Science.gov

Sample records for acid fa synthesis

  1. Design of an effective bifunctional catalyst organotriphosphonic acid-functionalized ferric alginate (ATMP-FA) and optimization by Box-Behnken model for biodiesel esterification synthesis of oleic acid over ATMP-FA.

    PubMed

    Liu, Wei; Yin, Ping; Liu, Xiguang; Qu, Rongjun

    2014-12-01

    Biodiesel production has become an intense research area because of rapidly depleting energy reserves and increasing petroleum prices together with environmental concerns. This paper focused on the optimization of the catalytic performance in the esterification reaction of oleic acid for biodiesel production over the bifunctional catalyst organotriphosphonic acid-functionalized ferric alginate ATMP-FA. The reaction parameters including catalyst amount, ethanol to oleic acid molar ratio and reaction temperature have been optimized by response surface methodology (RSM) using the Box-Behnken model. It was found that the reaction temperature was the most significant factor, and the best conversion ratio of oleic acid could reach 93.17% under the reaction conditions with 9.53% of catalyst amount and 8.62:1 of ethanol to oleic acid molar ratio at 91.0 °C. The research results show that two catalytic species could work cooperatively to promote the esterification reaction, and the bifunctional ATMP-FA is a potential catalyst for biodiesel production.

  2. Natural abundance stable carbon isotope evidence for the routing and de novo synthesis of bone FA and cholesterol.

    PubMed

    Jim, Susan; Ambrose, Stanley H; Evershed, Richard P

    2003-02-01

    This research reported in this paper investigated the relationship between diet and bone FA and cholesterol in rats raised on a variety of isotopically controlled diets comprising 20% C3 or C4 protein (casein) and C3 and/or C4 nonprotein or energy (sucrose, starch, and oil) macronutrients. Compound-specific stable carbon isotope analysis (delta13C) was performed on the FA (16:0, 18:0, 18:1, and 18:2) and cholesterol isolated from the diet (n = 4) and bone (n = 8) of these animals. The dietary signals reflected by the bone lipids were investigated using linear regression analysis. delta13C values of bone cholesterol and stearic (18:0) acid were shown to reflect whole-diet delta13C values, whereas the delta13C values of bone palmitic (16:0), oleic (18:1), and linoleic (18:2) acids reflected dietary FA delta13C values. Dietary signal differences are a result of the balance between direct incorporation (or routing) and de novo synthesis of each of these bone lipids. Estimates of the degree of routing of these bone lipids gleaned from correlations between delta13C(dlipid-wdiet) (= delta13C(diet lipid) - delta13C(whole diet)) spacings and delta13C(blipid-wdiet) (= delta13C(bone lipid) - delta13C(whole diet)) fractionations demonstrated that the extent of routing, where 18:2 > 16:0 > 18:1 > 18:0 > cholesterol, reflected the relative abundances of these lipids in the diet. These findings provide the basis for more accurate insights into diet when the delta13C analysis of bone fatty FA or cholesterol is employed.

  3. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  4. Poly(3-Hydroxybutyrate) Synthesis Genes in Azotobacter sp. Strain FA8

    PubMed Central

    Pettinari, M. Julia; Vázquez, Gustavo J.; Silberschmidt, Daniel; Rehm, Bernd; Steinbüchel, Alexander; Méndez, Beatriz S.

    2001-01-01

    Genes responsible for the synthesis of poly(3-hydroxybutyrate) (PHB) in Azotobacter sp. FA8 were cloned and analyzed. A PHB polymerase gene (phbC) was found downstream from genes coding for β-ketothiolase (phbA) and acetoacetyl-coenzyme A reductase (phbB). A PHB synthase mutant was obtained by gene inactivation and used for genetic studies. The phbC gene from this strain was introduced into Ralstonia eutropha PHB-4 (phbC-negative mutant), and the recombinant accumulated PHB when either glucose or octanoate was used as a source of carbon, indicating that this PHB synthase cannot incorporate medium-chain-length hydroxyalkanoates into PHB. PMID:11679365

  5. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.

    PubMed

    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc

    2015-09-01

    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica.

  6. An H-Infinity Approach to Control Synthesis with Load Minimization for the F/A-18 Active Aeroelastic Wing

    NASA Technical Reports Server (NTRS)

    Lind, Rick

    1999-01-01

    The F/A-18 Active Aeroelastic Wing research aircraft will demonstrate technologies related to aeroservoelastic effects such as wing twist and load minimization. This program presents several challenges for control design that are often not considered for traditional aircraft. This paper presents a control design based on H-infinity synthesis that simultaneously considers the multiple objectives associated with handling qualities, actuator limitations, and loads. A point design is presented to demonstrate a controller and the resulting closed-loop properties.

  7. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  8. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  9. Suppression of the ELO-2 FA elongation activity results in alterations of the fatty acid composition and multiple physiological defects, including abnormal ultradian rhythms, in Caenorhabditis elegans.

    PubMed Central

    Kniazeva, Marina; Sieber, Matt; McCauley, Scott; Zhang, Kang; Watts, Jennifer L; Han, Min

    2003-01-01

    While the general steps of fatty acid (FA) biosynthesis are well understood, the individual enzymes involved in the elongation of long chain saturated and polyunsaturated FA (PUFA) are largely unknown. Recent research indicates that these enzymes might be of considerable physiological importance for human health. We use Caenorhabditis elegans to study FA elongation activities and associated abnormal phenotypes. In this article we report that the predicted C. elegans F11E6.5/ELO-2 is a functional enzyme with the FA elongation activity. It is responsible for the elongation of palmitic acid and is involved in PUFA biosynthesis. RNAi-mediated suppression of ELO-2 causes an accumulation of palmitate and an associated decrease in the PUFA fraction in triacylglycerides and phospholipid classes. This imbalance in the FA composition results in multiple phenotypic defects such as slow growth, small body size, reproductive defects, and changes in rhythmic behavior. ELO-2 cooperates with the previously reported ELO-1 in 20-carbon PUFA production, and at least one of the enzymes must function to provide normal growth and development in C. elegans. The presented data indicate that suppression of a single enzyme of the FA elongation machinery is enough to affect various organs and systems in worms. This effect resembles syndromic disorders in humans. PMID:12586704

  10. Potent in vitro synergism of fusidic acid (FA) and berberine chloride (BBR) against clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA).

    PubMed

    Liang, Rong-mei; Yong, Xiao-lan; Duan, Yu-qin; Tan, Yong-hong; Zeng, Ping; Zhou, Zi-ying; Jiang, Yan; Wang, Shi-hua; Jiang, Yun-ping; Huang, Xiao-chun; Dong, Zhao-hui; Hu, Ting-ting; Shi, Hui-qing; Li, Nan

    2014-11-01

    It was found in the present study that combined use of fusidic acid (FA) and berberine chloride (BBR) offered an in vitro synergistic action against 7 of the 30 clinical methicillin-resistant Staphylococcus aureus (MRSA) strains, with a fractional inhibitory concentration (FIC) index ranging from 0.5 to 0.19. This synergistic effect was most pronounced on MRSA 4806, an FA-resistant isolate, with a minimum inhibitory concentration (MIC) value of 1,024 μg/ml. The time-kill curve experiment showed that FA plus BBR yielded a 4.2 log10 c.f.u./ml reduction in the number of MRSA 4806 bacteria after 24-h incubation as compared with BBR alone. Viable count analysis showed that FA plus BBR produced a 3.0 log10 c.f.u./ml decrease in biofilm formation and a 1.5 log10 c.f.u./ml decrease in mature biofilm in viable cell density as compared with BBR alone. In addition, phase contrast micrographs confirmed that biofilm formation was significantly inhibited and mature biofilm was obviously destructed when FA was used in combination with BBR. These results provide evidence that combined use of FA and BBR may prove to be a promising clinical therapeutic strategy against MRSA.

  11. The effect of gestational age on expression of genes involved in uptake, trafficking and synthesis of fatty acids in the rat placenta.

    PubMed

    Rodríguez-Cruz, Maricela; González, Raúl Sánchez; Maldonado, Jorge; López-Alarcón, Mardia; Bernabe-García, Mariela

    2016-10-15

    Gestation triggers a tight coordination among maternal tissues to provide fatty acids (FA) to the fetus through placental transport; however, there is insufficient evidence regarding regulation of proteins involved in placental transport of FA according to gestational age. The aim of this study was to determine the role of gestational age on the expression of genes involved in FA uptake, trafficking and synthesis in the rat placenta to support fetal demands. Gene expression of encoding proteins for placental transport and synthesis of FA was measured in placenta. Also, FA composition was measured in placenta, fetuses and newborns. mRNA expression of lipoprotein lipase (lpl) and fatp-1 (for uptake) was 4.4- and 1.43-fold higher, respectively, during late gestation than at P14, but expression of p-fabp-pm decreased 0.37-fold at late pregnancy in comparison with P14. Only mRNA fabp-4 member for trafficking of FA was 2.95-fold higher at late gestation than at P14. mRNA of fasn and elovl-6 participating in saturated FA and enzymes for the polyunsaturated FA synthesis were downregulated during late gestation and their regulator srebf-1c increased at P16. This study suggests that gestational age has an effect on expression of some genes involved in uptake, trafficking and synthesis of FA in the rat placenta; mRNA expression of lpl and, fatp-1 for uptake and fabp-4 implicated in trafficking was expressed at high levels at late gestation. In addition, placenta expresses the mRNAs involved in FA synthesis; these genes were expressed at low levels at late gestation. Additionally, mRNAs of Srebf-1c transcriptional regulator of desaturases and elongases was highly expressed during late gestation. Finally, these changes in the rat placenta allowed the placenta to partially supply saturated and monounsaturated FA to the fetus.

  12. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  13. Heterozygous FA2H mutations in autism spectrum disorders

    PubMed Central

    2013-01-01

    Background Widespread abnormalities in white matter development are frequently reported in cases of autism spectrum disorders (ASD) and could be involved in the disconnectivity suggested in these disorders. Homozygous mutations in the gene coding for fatty-acid 2-hydroxylase (FA2H), an enzyme involved in myelin synthesis, are associated with complex leukodystrophies, but little is known about the functional impact of heterozygous FA2H mutations. We hypothesized that rare deleterious heterozygous mutations of FA2H might constitute risk factors for ASD. Methods We searched deleterious mutations affecting FA2H, by genotyping 1256 independent patients with ASD genotyped using Genome Wide SNP arrays, and also by sequencing in independent set of 186 subjects with ASD and 353 controls. We then explored the impact of the identified mutations by measuring FA2H enzymatic activity and expression, in transfected COS7 cells. Results One heterozygous deletion within 16q22.3-q23.1 including FA2H was observed in two siblings who share symptoms of autism and severe cognitive impairment, axial T2-FLAIR weighted MRI posterior periventricular white matter lesions. Also, two rare non-synonymous mutations (R113W and R113Q) were reported. Although predictive models suggested that R113W should be a deleterious, we did not find that FA2H activity was affected by expression of the R113W mutation in cultured COS cells. Conclusions While our results do not support a major role for FA2H coding variants in ASD, a screening of other genes related to myelin synthesis would allow us to better understand the role of non-neuronal elements in ASD susceptibility. PMID:24299421

  14. Impact of high altitude on the hepatic fatty acid oxidation and synthesis in rats

    SciTech Connect

    Ni, Qian; Shao, Yuan; Wang, Ying Zhen; Jing, Yu Hong; Zhang, You Cheng

    2014-04-04

    Highlights: • Acute exposure to high altitude (HA) increased hepatic fatty acid (FA) β-oxidation. • Acute exposure of rats to HA increased hepatic FA synthesis. • PPARα and AMPK can regulate the FA metabolism. • FA may be a key energy fuel and a compensation for CHO during acute exposure to HA. • The acute changes of FA metabolism may be a mechanism of acclimatization. - Abstract: High altitude (HA) affects energy metabolism. The impact of acute and chronic HA acclimatization on the major metabolic pathways is still controversial. In this study, we aimed to unveil the impact of HA on the key enzymes involved in the fatty acid (FA) metabolism in liver. Rats were exposed to an altitude of 4300 m for 30 days and the expressions of two key proteins involved in FA β-oxidation (carnitine palmitoyl transferase I, CPT-I; and peroxisome proliferator-activated receptor alpha, PPARα), two proteins involved in FA synthesis (acetyl CoA carboxylase-1, ACC-1; and AMP-activated protein kinase, AMPK), as well as the total ketone body in the liver and the plasma FFAs were examined. Rats without HA exposure were used as controls. We observed that the acute exposure of rats to HA (3 days) led to a significant increase in the expressions of CPT-I and PPARα and in the total hepatic ketone body. Longer exposure (15 days) caused a marked decrease in the expression of CPT-I and PPARα. By 30 days after HA exposure, the expression levels of CPT-I and PPARα returned to the control level. The hepatic ACC-1 level showed a significant increase in rats exposed to HA for 1 and 3 days. In contrast, the hepatic level of AMPK showed a significant reduction throughout the experimental period. Plasma FFA concentrations did not show any significant changes following HA exposure. Thus, increased hepatic FA oxidation and synthesis in the early phase of HA exposure may be among the important mechanisms for the rats to respond to the hypoxic stress in order to acclimatize themselves to the

  15. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  16. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  17. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  18. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  19. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  20. Synthesis and Isolation of Chelidonic Acid

    ERIC Educational Resources Information Center

    Gagan, J. M. F.; Herbert, R. B.

    1976-01-01

    Described is an undergraduate laboratory experiment involving synthesis of chelidonic acid and its identification in plants. The experiment is offered as an ancillary topic for biology or chemistry classes. (SL)

  1. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  2. Trans fatty acids (tFA): sources and intake levels, biological effects and content in commercial Spanish food.

    PubMed

    Fernández-San Juan, P-M

    2009-01-01

    Recent studies of dietary habits in children and adolescents performed in Spain show that a high percentage of the daily energy intake corresponds to fat (42.0-43.0%). These findings show an excessive contribution of saturated fatty acids and also a considerable supply of trans fatty acids. These compounds are formed generally during partial hydrogenation of vegetable oils, a process that converts vegetable oils into semisolid fats. Also, in some cases naturally occurring trans fatty acids in smaller amounts in meat and dairy products from ruminants (cows, sheep), these trans fatty acids are produced by the action of bacteria in the ruminant stomach by reactions of biohydrogenation. On the other hand, metabolic studies have clearly shown that trans fatty acids increase LDL cholesterol and reduce HDL cholesterol. Our results show that major sources of trans fatty acids in commercial Spanish foods are fast-food (hamburger, French fries), snacks, bakery products (cakes, donuts, biscuits), margarines and dehydrated soups. PMID:19893860

  3. Trans fatty acids (tFA): sources and intake levels, biological effects and content in commercial Spanish food.

    PubMed

    Fernández-San Juan, P-M

    2009-01-01

    Recent studies of dietary habits in children and adolescents performed in Spain show that a high percentage of the daily energy intake corresponds to fat (42.0-43.0%). These findings show an excessive contribution of saturated fatty acids and also a considerable supply of trans fatty acids. These compounds are formed generally during partial hydrogenation of vegetable oils, a process that converts vegetable oils into semisolid fats. Also, in some cases naturally occurring trans fatty acids in smaller amounts in meat and dairy products from ruminants (cows, sheep), these trans fatty acids are produced by the action of bacteria in the ruminant stomach by reactions of biohydrogenation. On the other hand, metabolic studies have clearly shown that trans fatty acids increase LDL cholesterol and reduce HDL cholesterol. Our results show that major sources of trans fatty acids in commercial Spanish foods are fast-food (hamburger, French fries), snacks, bakery products (cakes, donuts, biscuits), margarines and dehydrated soups.

  4. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  5. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  6. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  7. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  8. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  9. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  10. Δ(9)-THC modulation of fatty acid 2-hydroxylase (FA2H) gene expression: possible involvement of induced levels of PPARα in MDA-MB-231 breast cancer cells.

    PubMed

    Takeda, Shuso; Ikeda, Eriko; Su, Shengzhong; Harada, Mari; Okazaki, Hiroyuki; Yoshioka, Yasushi; Nishimura, Hajime; Ishii, Hiroyuki; Kakizoe, Kazuhiro; Taniguchi, Aya; Tokuyasu, Miki; Himeno, Taichi; Watanabe, Kazuhito; Omiecinski, Curtis J; Aramaki, Hironori

    2014-12-01

    We recently reported that Δ(9)-tetrahydrocannabinol (Δ(9)-THC), a major cannabinoid component in Cannabis Sativa (marijuana), significantly stimulated the expression of fatty acid 2-hydroxylase (FA2H) in human breast cancer MDA-MB-231 cells. Peroxisome proliferator-activated receptor α (PPARα) was previously implicated in this induction. However, the mechanisms mediating this induction have not been elucidated in detail. We performed a DNA microarray analysis of Δ(9)-THC-treated samples and showed the selective up-regulation of the PPARα isoform coupled with the induction of FA2H over the other isoforms (β and γ). Δ(9)-THC itself had no binding/activation potential to/on PPARα, and palmitic acid (PA), a PPARα ligand, exhibited no stimulatory effects on FA2H in MDA-MB-231 cells; thus, we hypothesized that the levels of PPARα induced were involved in the Δ(9)-THC-mediated increase in FA2H. In support of this hypothesis, we herein demonstrated that; (i) Δ(9)-THC activated the basal transcriptional activity of PPARα in a concentration-dependent manner, (ii) the concomitant up-regulation of PPARα/FA2H was caused by Δ(9)-THC, (iii) PA could activate PPARα after the PPARα expression plasmid was introduced, and (iv) the Δ(9)-THC-induced up-regulation of FA2H was further stimulated by the co-treatment with L-663,536 (a known PPARα inducer). Taken together, these results support the concept that the induced levels of PPARα may be involved in the Δ(9)-THC up-regulation of FA2H in MDA-MB-231 cells.

  11. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  12. Poly(l-lysine)-graft-folic acid-coupled poly(2-methyl-2-oxazoline) (PLL-g-PMOXA-c-FA): a bioactive copolymer for specific targeting to folate receptor-positive cancer cells.

    PubMed

    Chen, Yin; Cao, Wenbin; Zhou, Junli; Pidhatika, Bidhari; Xiong, Bin; Huang, Lu; Tian, Qian; Shu, Yiwei; Wen, Weijia; Hsing, I-Ming; Wu, Hongkai

    2015-02-01

    In this study, we present the preparation, characterization and application of a novel bioactive copolymer poly(l-lysine)-graft-folic acid-coupled poly(2-methyl-2-oxazoline) (PLL-g-PMOXA-c-FA), which has a specific interaction with folate receptor (FR)-positive cancer cells. Glass surface immobilized with PLL-g-PMOXA-c-FA was demonstrated to be adhesive to FR-positive cancer cells (HeLa, JEG-3) while nonadhesive to FR-negative ones (MCF-7, HepG2) in 3 h. The specific interaction between conjugated FA on the substrate and FRs on the cells could hardly be inhibited unless a high concentration (5 mM) of free FA was used due to the multivalent nature of it. The FA functionality ratio of the copolymer on the substrate had a significant influence on the adhesion of HeLa cells, and our experiments revealed that the affinity of the substrate to the cells declined dramatically with the decrease of functionality ratio. This was believed to be caused by the polydispersity of PMOXA tethers, as supported by GPC and ToF-SIMS data. As a proof of concept in the application of our material, we demonstrated successful recovery of HeLa cells from mixture with MCF-7 (1:100) on the copolymer-coated glass, and our results showed that both high sensitivity (95.6 ± 13.3%) and specificity (24.3 ± 8.6%) were achieved.

  13. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  14. The role of FaBG3 in fruit ripening and B. cinerea fungal infection of strawberry.

    PubMed

    Li, Qian; Ji, Kai; Sun, Yufei; Luo, Hao; Wang, Hongqing; Leng, Ping

    2013-10-01

    In plants, β-glucosidases (BG) have been implicated in developmental and pathogen defense, and are thought to take part in abscisic acid (ABA) synthesis via hydrolysis of ABA glucose ester to release active ABA; however, there is no genetic evidence for the role of BG genes in ripening and biotic/abiotic stress in fruits. To clarify the role of BG genes in fruit, eight Fa/FvBG genes encoding β-glucosidase were isolated using information from the GenBank strawberry nucleotide database. Of the Fa/FvBG genes examined, expression of FaBG3 was the highest, showing peaks at the mature stage, coincident with the changes observed in ABA content. To verify the role of this gene, we suppressed the expression of FaBG3 via inoculation with Agrobacterium tumefaciens containing tobacco rattle virus carrying a FaBG3 fragment (RNAi). The expression of FaBG3 in FaBG3-RNAi-treated fruit was markedly reduced, and the ABA content was lower than that of the control. FaBG3-RNAi-treated fruit did not exhibit full ripening, and were firmer, had lower sugar content, and were pale compared with the control due to down-regulation of ripening-related genes. FaBG3-RNAi-treated fruit with reduced ABA levels were much more resistant to Botrytis cinerea fungus but were more sensitive to dehydration stress than control fruit. These results indicate that FaBG3 may play key roles in fruit ripening, dehydration stress and B. cinerea fungal infection in strawberries via modulation of ABA homeostasis and transcriptional regulation of ripening-related genes.

  15. One-pot synthesis of quantum dot-labeled hydrophilic molecularly imprinted polymer nanoparticles for direct optosensing of folic acid in real, undiluted biological samples.

    PubMed

    Yang, Yaqiong; Wang, Zhengzheng; Niu, Hui; Zhang, Huiqi

    2016-12-15

    A facile and efficient one-pot approach for the synthesis of quantum dot (QD)-labeled hydrophilic molecularly imprinted polymer (MIP) nanoparticles for direct optosensing of folic acid (FA) in the undiluted bovine and porcine serums is described. Hydrophilic macromolecular chain transfer agent-mediated reversible addition-fragmentation chain transfer (RAFT) precipitation polymerization was used to implement the molecular imprinting of FA in the presence of CdTe quantum dots (QDs). The resulting FA-imprinted polymer nanoparticles with surface-grafted hydrophilic poly(glyceryl monomethacrylate) brushes and QDs labeling not only showed outstanding specific molecular recognition toward FA in biological samples, but also exhibited good photostability, rapid binding kinetics, and obvious template binding-induced fluorescence quenching. These characteristics make them a useful fluorescent chemosensor for directly and selectively optosensing FA in the undiluted bovine and porcine serums, with its limit of detection being 0.025μM and average recoveries ranging from 98% to 102%, even in the presence of several interfering compounds. This advanced fluorescent MIP chemosensor is highly promising for rapid quantification of FA in such applications as clinical diagnostics and food analysis. PMID:27453986

  16. Synthesis and properties of synthetic fulvic acid derived from hematoxylin

    NASA Astrophysics Data System (ADS)

    Litvin, Valentina A.; Minaev, Boris F.; Baryshnikov, Gleb V.

    2015-04-01

    A model fulvic acid (FA) was synthesized from a natural dye, hematoxylin, in a slow oxidative polymerization/condensation reaction catalysed by OH- at pH ca. 12. The resulting dark-brown product, acidified to pH ca. 2, did not precipitate from the reaction solution. It was isolated and purified by cation-exchange resin. Its physicochemical and spectroscopic properties, as determined by means of elemental analysis, molecular weight analyses, Fourier transform infra red (FTIR) and ultraviolet-visible (UV-VIS) spectroscopy, X-ray diffraction and electron paramagnetic resonance (EPR) spectroscopy, showed a close resemblance to natural FA. The similarity and differences between synthetic fulvic acids derived from hematoxylin and the natural fulvic acids substances are discussed. Quantum-chemical calculations of the supposed primary oxidation products of hematoxylin are performed and compared with observations.

  17. Synthesis of Lipoteichoic Acids in Bacillus anthracis

    PubMed Central

    Garufi, Gabriella; Hendrickx, Antoni P.; Beeri, Karen; Kern, Justin W.; Sharma, Anshika; Richter, Stefan G.; Schneewind, Olaf

    2012-01-01

    Lipoteichoic acid (LTA), a glycerol phosphate polymer, is a component of the envelope of Gram-positive bacteria that has hitherto not been identified in Bacillus anthracis, the causative agent of anthrax. LTA synthesis in Staphylococcus aureus and other microbes is catalyzed by the product of the ltaS gene, a membrane protein that polymerizes polyglycerol phosphate from phosphatidyl glycerol. Here we identified four ltaS homologues, designated ltaS1 to -4, in the genome of Bacillus anthracis. Polyglycerol phosphate-specific monoclonal antibodies were used to detect LTA in the envelope of B. anthracis strain Sterne (pXO1+ pXO2−) vegetative forms. B. anthracis mutants lacking ltaS1, ltaS2, ltaS3, or ltaS4 did not display defects in growth or LTA synthesis. In contrast, B. anthracis strains lacking both ltaS1 and ltaS2 were unable to synthesize LTA and exhibited reduced viability, altered envelope morphology, aberrant separation of vegetative forms, and decreased sporulation efficiency. Expression of ltaS1 or ltaS2 alone in B. anthracis as well as in other microbes was sufficient for polyglycerol phosphate synthesis. Thus, similar to S. aureus, B. anthracis employs LtaS enzymes to synthesize LTA, an envelope component that promotes bacterial growth and cell division. PMID:22685279

  18. Opuntia ficus indica (nopal) attenuates hepatic steatosis and oxidative stress in obese Zucker (fa/fa) rats.

    PubMed

    Morán-Ramos, Sofía; Avila-Nava, Azalia; Tovar, Armando R; Pedraza-Chaverri, José; López-Romero, Patricia; Torres, Nimbe

    2012-11-01

    Nonalcoholic fatty liver disease (NAFLD) is associated with multiple factors such as obesity, insulin resistance, and oxidative stress. Nopal, a cactus plant widely consumed in the Mexican diet, is considered a functional food because of its antioxidant activity and ability to improve biomarkers of metabolic syndrome. The aim of this study was to assess the effect of nopal consumption on the development of hepatic steatosis and hepatic oxidative stress and on the regulation of genes involved in hepatic lipid metabolism. Obese Zucker (fa/fa) rats were fed a control diet or a diet containing 4% nopal for 7 wk. Rats fed the nopal-containing diet had ∼50% lower hepatic TG than the control group as well as a reduction in hepatomegaly and biomarkers of hepatocyte injury such as alanine and aspartate aminotransferases. Attenuation of hepatic steatosis by nopal consumption was accompanied by a higher serum concentration of adiponectin and a greater abundance of mRNA for genes involved in lipid oxidation and lipid export and production of carnitine palmitoyltransferase-1 and microsomal TG transfer proteins in liver. Hepatic reactive oxygen species and lipid peroxidation biomarkers were significantly lower in rats fed nopal compared with the control rats. Furthermore, rats fed the nopal diet had a lower postprandial serum insulin concentration and a greater liver phosphorylated protein kinase B (pAKT):AKT ratio in the postprandial state. This study suggests that nopal consumption attenuates hepatic steatosis by increasing fatty acid oxidation and VLDL synthesis, decreasing oxidative stress, and improving liver insulin signaling in obese Zucker (fa/fa) rats. PMID:23014486

  19. Opuntia ficus indica (nopal) attenuates hepatic steatosis and oxidative stress in obese Zucker (fa/fa) rats.

    PubMed

    Morán-Ramos, Sofía; Avila-Nava, Azalia; Tovar, Armando R; Pedraza-Chaverri, José; López-Romero, Patricia; Torres, Nimbe

    2012-11-01

    Nonalcoholic fatty liver disease (NAFLD) is associated with multiple factors such as obesity, insulin resistance, and oxidative stress. Nopal, a cactus plant widely consumed in the Mexican diet, is considered a functional food because of its antioxidant activity and ability to improve biomarkers of metabolic syndrome. The aim of this study was to assess the effect of nopal consumption on the development of hepatic steatosis and hepatic oxidative stress and on the regulation of genes involved in hepatic lipid metabolism. Obese Zucker (fa/fa) rats were fed a control diet or a diet containing 4% nopal for 7 wk. Rats fed the nopal-containing diet had ∼50% lower hepatic TG than the control group as well as a reduction in hepatomegaly and biomarkers of hepatocyte injury such as alanine and aspartate aminotransferases. Attenuation of hepatic steatosis by nopal consumption was accompanied by a higher serum concentration of adiponectin and a greater abundance of mRNA for genes involved in lipid oxidation and lipid export and production of carnitine palmitoyltransferase-1 and microsomal TG transfer proteins in liver. Hepatic reactive oxygen species and lipid peroxidation biomarkers were significantly lower in rats fed nopal compared with the control rats. Furthermore, rats fed the nopal diet had a lower postprandial serum insulin concentration and a greater liver phosphorylated protein kinase B (pAKT):AKT ratio in the postprandial state. This study suggests that nopal consumption attenuates hepatic steatosis by increasing fatty acid oxidation and VLDL synthesis, decreasing oxidative stress, and improving liver insulin signaling in obese Zucker (fa/fa) rats.

  20. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  1. Brain White Matter Development Is Associated with a Human-Specific Haplotype Increasing the Synthesis of Long Chain Fatty Acids

    PubMed Central

    Voineskos, Aristotle N.; Szeszko, Philip R.; Lett, Tristram A.; DeRosse, Pamela; Guha, Saurav; Karlsgodt, Katherine H.; Ikuta, Toshikazu; Felsky, Daniel; John, Majnu; Rotenberg, David J.; Kennedy, James L.; Lencz, Todd; Malhotra, Anil K.

    2014-01-01

    The genetic and molecular pathways driving human brain white matter (WM) development are only beginning to be discovered. Long chain polyunsaturated fatty acids (LC-PUFAs) have been implicated in myelination in animal models and humans. The biosynthesis of LC-PUFAs is regulated by the fatty acid desaturase (FADS) genes, of which a human-specific haplotype is strongly associated with ω-3 and ω-6 LC-PUFA concentrations in blood. To investigate the relationship between LC-PUFA synthesis and human brain WM development, we examined whether this FADS haplotype is associated with age-related WM differences across the life span in healthy individuals 9–86 years of age (n = 207). Diffusion tensor imaging was performed to measure fractional anisotropy (FA), a putative measure of myelination, of the cerebral WM tracts. FADS haplotype status was determined with a single nucleotide polymorphism (rs174583) that tags this haplotype. Overall, normal age-related WM differences were observed, including higher FA values in early adulthood compared with childhood, followed by lower FA values across older age ranges. However, individuals homozygous for the minor allele (associated with lower LC-PUFA concentrations) did not display these normal age-related WM differences (significant age × genotype interactions, pcorrected < 0.05). These findings suggest that LC-PUFAs are involved in human brain WM development from childhood into adulthood. This haplotype and LC-PUFAs may play a role in myelin-related disorders of neurodevelopmental origin. PMID:24790207

  2. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  3. Mass spectrometry of the lithium adducts of diacylglycerols containing hydroxy FA in castor oil and two normal FA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Castor oil can be used in industry. The molecular species of triacylglycerols containing hydroxy fatty acids (FA) in castor oil have been identified. We report here the identification of twelve diacylglycerols (DAG) containing hydroxy FA in castor oil using positive ion electrospray ionization mass ...

  4. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  5. Inhibition of plant fatty acid synthesis by nitroimidazoles.

    PubMed Central

    Jones, A V; Harwood, J L; Stratford, M R; Stumpf, P K

    1981-01-01

    1. The effect of the addition of a number of nitroimidazoles was tested on fatty acid synthesis by germinating pea seeds, isolated lettuce chloroplasts and a soluble fraction from pea seeds. 2. All the compounds tested had a marked inhibition on stearate desaturation by lettuce chloroplasts and on the synthesis of very-long-chain fatty acids by pea seeds. 3. In contrast, the effect of the drugs on total fatty acid synthesis from [14C]acetate in chloroplasts was related to the compound's electron reduction potentials. 4. Of the compounds used, only metronidazole had a marked inhibition on palmitate elongation in the systems tested. 5. The mechanism of inhibition of plant fatty acid synthesis by nitroimidazoles is discussed and the possible relevance of these findings to their neurotoxicity is suggested. PMID:7325993

  6. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  7. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  8. MAN or FA from n-butane

    SciTech Connect

    Di Cio, A.; Verde, L.

    1985-08-01

    Unsaturated polyester resins were first produced mostly from fumaric acid (FA) rather than from maleic anhydride (MAN). This is perfectly understandable if we consider that, using fumaric acid as raw material, polycondensates with a more homogeneous (less branched) structure are obtained, thus producing resins characterized by a more uniform and reproducible chemical and mechanical properties. Presently, for economical reasons, fumaric acid is used marginally as a MAN substitute in the production of polyester resins. These resins account for a major share (50%) of the overall MAN consumption in the U.S. and in Western Europe.

  9. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  10. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  11. Laccase-catalysed oxidation of ferulic acid and ethyl ferulate in aqueous medium: a green procedure for the synthesis of new compounds.

    PubMed

    Aljawish, Abdulhadi; Chevalot, Isabelle; Jasniewski, Jordane; Paris, Cédric; Scher, Joël; Muniglia, Lionel

    2014-02-15

    The enzymatic oxidation of ferulic acid (FA) and ethyl ferulate (EF) with Myceliophthora thermophila laccase, as biocatalyst, was performed in aqueous medium using an eco-friendly procedure to synthesize new active molecules. First, the commercial laccase was ultrafiltrated allowing for the elimination of phenolic contaminants and increasing the specific activity by a factor of 2. Then, kinetic parameters of this laccase were determined for both substrates (FA, EF), indicating a higher substrate affinity for ethyl ferulate. Additionally, enzymatic oxidation led to the synthesis of a FA-major product, exhibiting a molecular mass of 386 g/mol and a EF-major product with a molecular mass of 442 g/mol. Structural analyses by mass spectrometry allowed the identification of dimeric derivatives. The optical properties of the oxidation products showed the increase of red and yellow colours, with FA-products compared to EF-products. Additionally, enzymatic oxidation led to a decrease of antioxidant and cytotoxic activities compared to initial substrates. Consequently, this enzymatic procedure in aqueous medium could provide new compounds presenting optical, antioxidant and cytotoxic interest.

  12. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  13. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly.

    PubMed

    Bates, Philip D; Johnson, Sean R; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G; Ohlrogge, John B; Browse, John

    2014-01-21

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [(14)C]acetate and [(3)H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [(14)C]acetate and [(14)C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl-CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl-CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid.

  14. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  15. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  16. Kinetic investigation of erucamide synthesis using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Upadhayay, Santosh K; Singh, R P

    2008-01-01

    Fatty acid amides like erucamide are mainly used for lubrication and as slip agent to decrease friction in polymer and plastic industry. Erucamide is normally synthesized by ammonolysis of triglycerides or fatty acids at 200 degrees C and at high pressure (345-690 kPa.). However using urea in place of ammonia the economic synthesis of erucamide is possible at atmospheric pressure at approx 190 degrees C. In present investigation, the kinetics of synthesis of erucamide by ammonolysis of erucic acid has been investigated. The optimum conditions for the synthesis of erucamide have also been determined. 1:4 molar ratio of erucic acid to urea, 190 degrees C temperature and catalyst [P2O5 with (NH4)2H PO4, {(1:1) w/w }] concentration 3% (by wt. of erucic acid) were the optimum condition for synthesis of erucamide from erucic acid and can obtain a maximum yield of 92% of pure erucamide. Some other catalysts as titanium-iso -propoxide, phosphorus pent oxide were also tried but these catalysts were not economical. PMID:18685229

  17. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  18. Regulation of collagen synthesis by ascorbic acid.

    PubMed Central

    Murad, S; Grove, D; Lindberg, K A; Reynolds, G; Sivarajah, A; Pinnell, S R

    1981-01-01

    After prolonged exposure to ascorbate, collagen synthesis in cultured human skin fibroblasts increased approximately 8-fold with no significant change in synthesis of noncollagen protein. This effect of ascorbate appears to be unrelated to its cofactor function in collagen hydroxylation. The collagenous protein secreted in the absence of added ascorbate was normal in hydroxylysine but was mildly deficient in hydroxyproline. In parallel experiments, lysine hydroxylase (peptidyllysine, 2-oxoglutarate:oxygen 5-oxidoreductase, EC 1.14.11.4) activity increased 3-fold in response to ascorbate administration whereas proline hydroxylase (prolyl-glycyl-peptide, 2-oxoglutarate:oxygen oxidoreductase, EC 1.14.11.2) activity decreased considerably. These results suggest that collage polypeptide synthesis, posttranslational hydroxylations, and activities of the two hydroxylases are independently regulated by ascorbate. PMID:6265920

  19. Mechanisms of fatty acid synthesis in marine fungus-like protists.

    PubMed

    Xie, Yunxuan; Wang, Guangyi

    2015-10-01

    Thraustochytrids are unicellular fungus-like protists and are well known for their ability to produce interesting nutraceutical compounds. Significant efforts have been made to improve their efficient production of important fatty acids (FAs), mostly by optimizing fermentation conditions and selecting highly productive thraustochytrid strains. Furthermore, noticeable improvements have been made in understanding the mechanism of FA biosynthesis, allowing for a better understanding of how thraustochytrids assemble these unique metabolites and how their biosynthesis is coupled with other related pathways. This review summarizes recent achievements on two major FA biosynthesis pathways, the standard pathway and the polyketide synthase pathway, and detail features of individual enzymes involved in FA biosynthesis, biotechnological advances in pathway engineering and enzyme characterization, and the discovery of other pathways that affect the efficiency of FA accumulation. Perspectives of biotechnological potential application of thraustochytrids are also discussed.

  20. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  1. Regulation of synthesis and oxidation of fatty acids by adiponectin receptors (AdipoR1/R2) and insulin receptor substrate isoforms (IRS-1/-2) of the liver in a nonalcoholic steatohepatitis animal model.

    PubMed

    Matsunami, Tokio; Sato, Yukita; Ariga, Satomi; Sato, Takuya; Shimomura, Toshiko; Kashimura, Haruka; Hasegawa, Yuki; Yukawa, Masayoshi

    2011-06-01

    Nonalcoholic steatohepatitis (NASH) is one of the most frequent causes of abnormal liver dysfunction associated with synthesis and oxidation of fatty acids. Adiponectin receptors (AdipoR1/R2) and insulin receptor substrates (IRS-1/-2) are known as modulators of these fatty acid metabolisms in the liver; however, the regulatory roles of these receptors in the synthesis and oxidation of fatty acids are unclear in the liver of NASH. In this study, we examined the roles of hepatic AdipoR1/R2 and IRS-1/-2 in NASH using an animal model. After feeding a high-fat and high-cholesterol diet to obese fa/fa Zucker rats for 8 weeks, rats showed fatty liver spontaneously with inflammation and fibrosis that are characteristic of NASH. The expression levels of AdipoR1/R2 and IRS-2 were significantly decreased, whereas IRS-1 was significantly increased, in NASH. As a result of the decrease of AdipoR1/R2 expression, the messenger RNA expression levels of genes located downstream of AdipoR1/R2, adenosine monophosphate-activated protein kinase α1/α2, which inhibits fatty acid synthesis, and peroxisome proliferator-activated receptor α, which activates fatty acid oxidation, also decreased. Expression level of sterol regulatory element binding protein-1c was found to be elevated, suggesting the up-regulation of IRS-1, and resulted in increased fatty acid synthesis. Furthermore, increase of forkhead box protein A2 expression was observed, which might be associated with the down-regulation of IRS-2, facilitating fatty acid oxidation. Taken together, increased synthesis and oxidation of fatty acids by up- or down-regulation of AdipoR or IRS may contribute to the progression of NASH. Thus, AdipoR and IRS might be crucially important regulators for the synthesis and oxidation of fatty acids in the liver of NASH.

  2. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  3. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  4. Synthesis and antituberculosis activity of new fatty acid amides.

    PubMed

    D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

    2010-09-01

    This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains.

  5. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  6. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

  7. Synthesis of sulfonate analogs of bile acids.

    PubMed

    Kihira, K; Mikami, T; Ikawa, S; Okamoto, A; Yoshii, M; Miki, S; Mosbach, E H; Hoshita, T

    1992-04-01

    Sulfonate analogs of C23 and C24 bile acids were synthesized from norcholic, norchenodeoxycholic, norursodeoxycholic, nordeoxycholic, norhyodeoxycholic, cholic, deoxycholic, hyodeoxycholic, and lithocholic acids. The principal reactions used were (1) reduction of the bile acids with NaBH4 to the corresponding bile alcohols, (2) selective tosylation of the terminal hydroxyl group, (3) iodination of the tosyl esters with NaI, and (4) treatment of the iodides with Na2SO3 to form the sulfonate analogs of the bile acids. The sulfonate analogs showed polarity similar to that of taurine-conjugated bile acids on thin-layer chromatography. The carbon 13 nuclear magnetic resonance spectral data for the sulfonate analogs were tabulated.

  8. Does trans-10, cis-12 conjugated linoleic acid affect the intermediary glucose and energy expenditure of dairy cows due to repartitioning of milk component synthesis?

    PubMed

    Benninghoff, Jens; Metzger-Petersen, Katrin; Tröscher, Arnulf H A; Südekum, Karl-Heinz

    2015-11-01

    The overall goal of this study was to evaluate if intermediary energy metabolism of cows fed with trans-10, cis-12 conjugated linoleic acid (CLA) was modified such that milk-energy compounds were produced with less intermediary energy expenditure as compared to control cows. Published data on supplemented CLA were assembled. The extent was calculated to which the trans-10, cis-12 CLA isomer has an impact on glucose and energy conversion in the mammary gland by modifying glucose equivalent supply and energy required for fatty acid (FA) and fat synthesis, and if this will eventually lead to an improved glucose and energy status of CLA-supplemented high-yielding dairy cows. A possible relationship between CLA supplementation level and milk energy yield response was also studied. Calculations were conducted separately for orally and abomasally administered CLA and based on energy required for supply of glucose equivalents, i.e. lactose, glycerol and NADPH2. Further, modifications of milk FA profile due to CLA supplementation were considered when energy expenditures for FA and fat synthesis were quantified. Differences in yields between control and CLA groups were transformed into glucose energy equivalents. Only abomasal infusion (r(2) = 0.31) but not oral CLA administration (r(2) = 0.11) supplementation to dairy cow diets resulted in less glucose equivalent energy. Modifications of milk FA profiles also saved energy but the relationship with CLA supplementation was weaker for abomasal infusion (r(2) = 0.06) than oral administration (r(2) = 0.38). On average, 10 g/d of abomasally infused trans-10, cis-12 CLA saved 1.1 to 2.3 MJ net energy expressed as glucose equivalents, whereas both positive and negative values were observed when the trans-10, cis-12 CLA was fed to the cows. This study revealed a weak to moderate dose-dependent relationship between the amount of trans-10, cis-12 CLA administered and the amount of energy in glucose equivalents and energy for the

  9. Does trans-10, cis-12 conjugated linoleic acid affect the intermediary glucose and energy expenditure of dairy cows due to repartitioning of milk component synthesis?

    PubMed

    Benninghoff, Jens; Metzger-Petersen, Katrin; Tröscher, Arnulf H A; Südekum, Karl-Heinz

    2015-11-01

    The overall goal of this study was to evaluate if intermediary energy metabolism of cows fed with trans-10, cis-12 conjugated linoleic acid (CLA) was modified such that milk-energy compounds were produced with less intermediary energy expenditure as compared to control cows. Published data on supplemented CLA were assembled. The extent was calculated to which the trans-10, cis-12 CLA isomer has an impact on glucose and energy conversion in the mammary gland by modifying glucose equivalent supply and energy required for fatty acid (FA) and fat synthesis, and if this will eventually lead to an improved glucose and energy status of CLA-supplemented high-yielding dairy cows. A possible relationship between CLA supplementation level and milk energy yield response was also studied. Calculations were conducted separately for orally and abomasally administered CLA and based on energy required for supply of glucose equivalents, i.e. lactose, glycerol and NADPH2. Further, modifications of milk FA profile due to CLA supplementation were considered when energy expenditures for FA and fat synthesis were quantified. Differences in yields between control and CLA groups were transformed into glucose energy equivalents. Only abomasal infusion (r(2) = 0.31) but not oral CLA administration (r(2) = 0.11) supplementation to dairy cow diets resulted in less glucose equivalent energy. Modifications of milk FA profiles also saved energy but the relationship with CLA supplementation was weaker for abomasal infusion (r(2) = 0.06) than oral administration (r(2) = 0.38). On average, 10 g/d of abomasally infused trans-10, cis-12 CLA saved 1.1 to 2.3 MJ net energy expressed as glucose equivalents, whereas both positive and negative values were observed when the trans-10, cis-12 CLA was fed to the cows. This study revealed a weak to moderate dose-dependent relationship between the amount of trans-10, cis-12 CLA administered and the amount of energy in glucose equivalents and energy for the

  10. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  11. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  12. Synthesis of nanomagnetic fluids and their UV spectrophotometric response with aliphatic organic acids and 1st tier dendrimers

    NASA Astrophysics Data System (ADS)

    Pandya, Shivani R.; Singh, Man

    2016-04-01

    Synthesis of Magnetic nanoparticles were made using coprecipitation method on mixing Fe+3 and Fe+2 in 2:1 ratio with aqueous 8M NaOH which on heating at 90°C for 2 h has yielded 85% magnetic (Fe3O4) nanoparticles (MNPs), characterized by XRD, VSM, SEM, and HR-TEM. The formic acid (FA), oxalic acid (OA) and citric acid (CA), the series of aliphatic organic acids along with Trimesoyl 1, 3, 5 tridimethyl malonate (TTDMM), trimesoyl 1, 3, 5 tridiethyl malonate (TTDEM), trimesoyl 1, 3, 5 tridipropyl malonate (TTDPM), trimesoyl 1, 3, 5 tridibutyl malonate (TTDBM) and trimesoyl 1, 3, 5 tridihexyl malonate (TTDHM) 1st tier dendrimers were used separately for preparing nanomagnetic fluid. From 25 to 150 µM MNPs at an interval of 25 µM were dispersed in 150 µM of acids and dendrimers separately with DMSO. UV-VIS spectrophotometry showed a maximum MNPs dispersion with TTDMM against others and found to be most stable nanomagnetic fluid on account of capping type mechanism of acids.

  13. FaPOD27 functions in the metabolism of polyphenols in strawberry fruit (Fragaria sp.).

    PubMed

    Yeh, Su-Ying; Huang, Fong-Chin; Hoffmann, Thomas; Mayershofer, Mechthild; Schwab, Wilfried

    2014-01-01

    The strawberry (Fragaria × ananassa) is one of the most preferred fresh fruit worldwide, accumulates numerous flavonoids but has limited shelf life due to excessive tissue softening caused by cell wall degradation. Since lignin is one of the polymers that strengthen plant cell walls and might contribute to some extent to fruit firmness monolignol biosynthesis was studied in strawberry fruit. Cinnamoyl-CoA reductase (CCR), cinnamyl alcohol dehydrogenase (CAD), and a peroxidase (POD27) gene were strongly expressed in red, ripe fruit whereas a second POD gene was primarily expressed in green, immature fruit. Moreover, FaPOD27 transcripts were strongly and constitutively induced in fruits exposed to Agrobacterium infection. Gene expression levels and enzymatic activities of FaCCR and FaCAD were efficiently suppressed through RNAi in FaCCR- and FaCAD-silenced strawberries. Besides, significantly elevated FaPOD transcript levels were detected after agroinfiltration of pBI-FaPOD constructs in fruits. At the same time, levels of G-monomers were considerably reduced in FaCCR-silenced fruits whereas the proportion of both G- and S-monomers decisively decreased in FaCAD-silenced and pBI-FaPOD fruits. Development, firmness, and lignin level of the treated fruits were similar to pBI-intron control fruits, presumably attributed to increased expression levels of FaPOD27 upon agroinfiltration. Additionally, enhanced firmness, accompanied with elevated lignin levels, was revealed in chalcone synthase-deficient fruits (CHS(-)), independent of down- or up-regulation of individual and combined FaCCR. FaCAD, and FaPOD genes by agroinfiltration, when compared to CHS(-)/pBI-intron control fruits. These approaches provide further insight into the genetic control of flavonoid and lignin synthesis in strawberries. The results suggest that FaPOD27 is a key gene for lignin biosynthesis in strawberry fruit and thus to improving the firmness of strawberries. PMID:25346738

  14. FaPOD27 functions in the metabolism of polyphenols in strawberry fruit (Fragaria sp.).

    PubMed

    Yeh, Su-Ying; Huang, Fong-Chin; Hoffmann, Thomas; Mayershofer, Mechthild; Schwab, Wilfried

    2014-01-01

    The strawberry (Fragaria × ananassa) is one of the most preferred fresh fruit worldwide, accumulates numerous flavonoids but has limited shelf life due to excessive tissue softening caused by cell wall degradation. Since lignin is one of the polymers that strengthen plant cell walls and might contribute to some extent to fruit firmness monolignol biosynthesis was studied in strawberry fruit. Cinnamoyl-CoA reductase (CCR), cinnamyl alcohol dehydrogenase (CAD), and a peroxidase (POD27) gene were strongly expressed in red, ripe fruit whereas a second POD gene was primarily expressed in green, immature fruit. Moreover, FaPOD27 transcripts were strongly and constitutively induced in fruits exposed to Agrobacterium infection. Gene expression levels and enzymatic activities of FaCCR and FaCAD were efficiently suppressed through RNAi in FaCCR- and FaCAD-silenced strawberries. Besides, significantly elevated FaPOD transcript levels were detected after agroinfiltration of pBI-FaPOD constructs in fruits. At the same time, levels of G-monomers were considerably reduced in FaCCR-silenced fruits whereas the proportion of both G- and S-monomers decisively decreased in FaCAD-silenced and pBI-FaPOD fruits. Development, firmness, and lignin level of the treated fruits were similar to pBI-intron control fruits, presumably attributed to increased expression levels of FaPOD27 upon agroinfiltration. Additionally, enhanced firmness, accompanied with elevated lignin levels, was revealed in chalcone synthase-deficient fruits (CHS(-)), independent of down- or up-regulation of individual and combined FaCCR. FaCAD, and FaPOD genes by agroinfiltration, when compared to CHS(-)/pBI-intron control fruits. These approaches provide further insight into the genetic control of flavonoid and lignin synthesis in strawberries. The results suggest that FaPOD27 is a key gene for lignin biosynthesis in strawberry fruit and thus to improving the firmness of strawberries.

  15. FaPOD27 functions in the metabolism of polyphenols in strawberry fruit (Fragaria sp.)

    PubMed Central

    Yeh, Su-Ying; Huang, Fong-Chin; Hoffmann, Thomas; Mayershofer, Mechthild; Schwab, Wilfried

    2014-01-01

    The strawberry (Fragaria × ananassa) is one of the most preferred fresh fruit worldwide, accumulates numerous flavonoids but has limited shelf life due to excessive tissue softening caused by cell wall degradation. Since lignin is one of the polymers that strengthen plant cell walls and might contribute to some extent to fruit firmness monolignol biosynthesis was studied in strawberry fruit. Cinnamoyl-CoA reductase (CCR), cinnamyl alcohol dehydrogenase (CAD), and a peroxidase (POD27) gene were strongly expressed in red, ripe fruit whereas a second POD gene was primarily expressed in green, immature fruit. Moreover, FaPOD27 transcripts were strongly and constitutively induced in fruits exposed to Agrobacterium infection. Gene expression levels and enzymatic activities of FaCCR and FaCAD were efficiently suppressed through RNAi in FaCCR- and FaCAD-silenced strawberries. Besides, significantly elevated FaPOD transcript levels were detected after agroinfiltration of pBI-FaPOD constructs in fruits. At the same time, levels of G-monomers were considerably reduced in FaCCR-silenced fruits whereas the proportion of both G- and S-monomers decisively decreased in FaCAD-silenced and pBI-FaPOD fruits. Development, firmness, and lignin level of the treated fruits were similar to pBI-intron control fruits, presumably attributed to increased expression levels of FaPOD27 upon agroinfiltration. Additionally, enhanced firmness, accompanied with elevated lignin levels, was revealed in chalcone synthase-deficient fruits (CHS−), independent of down- or up-regulation of individual and combined FaCCR. FaCAD, and FaPOD genes by agroinfiltration, when compared to CHS−/pBI-intron control fruits. These approaches provide further insight into the genetic control of flavonoid and lignin synthesis in strawberries. The results suggest that FaPOD27 is a key gene for lignin biosynthesis in strawberry fruit and thus to improving the firmness of strawberries. PMID:25346738

  16. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  17. Targeting cancer cells with folic acid-iminoboronate fluorescent conjugates.

    PubMed

    Cal, Pedro M S D; Frade, Raquel F M; Chudasama, Vijay; Cordeiro, Carlos; Caddick, Stephen; Gois, Pedro M P

    2014-05-25

    Herein we present the synthesis of fluorescent 2-acetylbenzeneboronic acids that undergo B-N promoted conjugation with lysozyme and N-(2-aminoethyl) folic acid (EDA-FA), generating conjugates that are selectively recognized and internalized by cancer cells that over-express folic acid receptors.

  18. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  19. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  20. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  1. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

  2. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  3. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  4. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  5. Sources of variability in fatty acid (FA) biomarkers in the application of compound-specific stable isotopes (CSSIs) to soil and sediment fingerprinting and tracing: A review.

    PubMed

    Reiffarth, D G; Petticrew, E L; Owens, P N; Lobb, D A

    2016-09-15

    Determining soil redistribution and sediment budgets in watersheds is often challenging. One of the methods for making such determinations employs soil and sediment fingerprinting techniques, using sediment properties such as geochemistry, fallout radionuclides, and mineral magnetism. These methods greatly improve the estimation of erosion and deposition within a watershed, but are limited when determining land use-based soil and sediment movement. Recently, compound-specific stable isotopes (CSSIs), which employ fatty acids naturally occurring in the vegetative cover of soils, offer the possibility of refining fingerprinting techniques based on land use, complementing other methods that are currently in use. The CSSI method has been met with some success; however, challenges still remain with respect to scale and resolution due to a potentially large degree of biological, environmental and analytical uncertainty. By better understanding the source of tracers used in CSSI work and the inherent biochemical variability in those tracers, improvement in sample design and tracer selection is possible. Furthermore, an understanding of environmental and analytical factors affecting the CSSI signal will lead to refinement of the approach and the ability to generate more robust data. This review focuses on sources of biological, environmental and analytical variability in applying CSSI to soil and sediment fingerprinting, and presents recommendations based on past work and current research in this area for improving the CSSI technique. A recommendation, based on current information available in the literature, is to use very-long chain saturated fatty acids and to avoid the use of the ubiquitous saturated fatty acids, C16 and C18. PMID:27155260

  6. Sources of variability in fatty acid (FA) biomarkers in the application of compound-specific stable isotopes (CSSIs) to soil and sediment fingerprinting and tracing: A review.

    PubMed

    Reiffarth, D G; Petticrew, E L; Owens, P N; Lobb, D A

    2016-09-15

    Determining soil redistribution and sediment budgets in watersheds is often challenging. One of the methods for making such determinations employs soil and sediment fingerprinting techniques, using sediment properties such as geochemistry, fallout radionuclides, and mineral magnetism. These methods greatly improve the estimation of erosion and deposition within a watershed, but are limited when determining land use-based soil and sediment movement. Recently, compound-specific stable isotopes (CSSIs), which employ fatty acids naturally occurring in the vegetative cover of soils, offer the possibility of refining fingerprinting techniques based on land use, complementing other methods that are currently in use. The CSSI method has been met with some success; however, challenges still remain with respect to scale and resolution due to a potentially large degree of biological, environmental and analytical uncertainty. By better understanding the source of tracers used in CSSI work and the inherent biochemical variability in those tracers, improvement in sample design and tracer selection is possible. Furthermore, an understanding of environmental and analytical factors affecting the CSSI signal will lead to refinement of the approach and the ability to generate more robust data. This review focuses on sources of biological, environmental and analytical variability in applying CSSI to soil and sediment fingerprinting, and presents recommendations based on past work and current research in this area for improving the CSSI technique. A recommendation, based on current information available in the literature, is to use very-long chain saturated fatty acids and to avoid the use of the ubiquitous saturated fatty acids, C16 and C18.

  7. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  8. A novel approach in cinnamic acid synthesis: direct synthesis of cinnamic acids from aromatic aldehydes and aliphatic carboxylic acids in the presence of boron tribromide.

    PubMed

    Chiriac, Constantin I; Tanasa, Fulga; Onciu, Marioara

    2005-02-28

    Cinnamic acids have been prepared in moderate to high yields by a new direct synthesis using aromatic aldehydes and aliphatic carboxylic acids, in the presence of boron tribromide as reagent, 4-dimethylaminopyridine (4-DMAP) and pyridine (Py) as bases and N-methyl-2-pyrolidinone (NMP) as solvent, at reflux (180-190 degrees C) for 8-12 hours.

  9. Effect of unsaturated fatty acids and triglycerides from soybeans on milk fat synthesis and biohydrogenation intermediates in dairy cattle.

    PubMed

    Boerman, J P; Lock, A L

    2014-11-01

    Increased rumen unsaturated fatty acid (FA) load is a risk factor for milk fat depression. This study evaluated if increasing the amount of unsaturated FA in the diet as triglycerides or free FA affected feed intake, yield of milk and milk components, and feed efficiency. Eighteen Holstein cows (132 ± 75 d in milk) were used in a replicated 3 × 3 Latin square design. Treatments were a control (CON) diet, or 1 of 2 unsaturated FA (UFA) treatments supplemented with either soybean oil (FA present as triglycerides; TAG treatment) or soybean FA distillate (FA present as free FA; FFA treatment). The soybean oil contained a higher concentration of cis-9 C18:1 (26.0 vs. 11.8 g/100g of FA) and lower concentrations of C16:0 (9.6 vs. 15.0 g/100g of FA) and cis-9,cis-12 C18:2 (50.5 vs. 59.1g/100g of FA) than the soybean FA distillate. The soybean oil and soybean FA distillate were included in the diet at 2% dry matter (DM) to replace soyhulls in the CON diet. Treatment periods were 21 d, with the final 4 d used for sample and data collection. The corn silage- and alfalfa silage-based diets contained 23% forage neutral detergent fiber and 17% crude protein. Total dietary FA were 2.6, 4.2, and 4.3% of diet DM for CON, FFA, and TAG treatments, respectively. Total FA intake was increased 57% for UFA treatments and was similar between FFA and TAG. The intakes of individual FA were similar, with the exception of a 24 g/d lower intake of C16:0 and a 64 g/d greater intake of cis-9 C18:1 for the TAG compared with the FFA treatment. Compared with CON, the UFA treatments decreased DM intake (1.0 kg/d) but increased milk yield (2.2 kg/d) and milk lactose concentration and yield. The UFA treatments reduced milk fat concentration, averaging 3.30, 3.18, and 3.11% for CON, FFA, and TAG treatments, respectively. Yield of milk fat, milk protein, and 3.5% fat-corrected milk remained unchanged when comparing CON with the UFA treatments. No differences existed in the yield of milk or milk

  10. Effect of unsaturated fatty acids and triglycerides from soybeans on milk fat synthesis and biohydrogenation intermediates in dairy cattle.

    PubMed

    Boerman, J P; Lock, A L

    2014-11-01

    Increased rumen unsaturated fatty acid (FA) load is a risk factor for milk fat depression. This study evaluated if increasing the amount of unsaturated FA in the diet as triglycerides or free FA affected feed intake, yield of milk and milk components, and feed efficiency. Eighteen Holstein cows (132 ± 75 d in milk) were used in a replicated 3 × 3 Latin square design. Treatments were a control (CON) diet, or 1 of 2 unsaturated FA (UFA) treatments supplemented with either soybean oil (FA present as triglycerides; TAG treatment) or soybean FA distillate (FA present as free FA; FFA treatment). The soybean oil contained a higher concentration of cis-9 C18:1 (26.0 vs. 11.8 g/100g of FA) and lower concentrations of C16:0 (9.6 vs. 15.0 g/100g of FA) and cis-9,cis-12 C18:2 (50.5 vs. 59.1g/100g of FA) than the soybean FA distillate. The soybean oil and soybean FA distillate were included in the diet at 2% dry matter (DM) to replace soyhulls in the CON diet. Treatment periods were 21 d, with the final 4 d used for sample and data collection. The corn silage- and alfalfa silage-based diets contained 23% forage neutral detergent fiber and 17% crude protein. Total dietary FA were 2.6, 4.2, and 4.3% of diet DM for CON, FFA, and TAG treatments, respectively. Total FA intake was increased 57% for UFA treatments and was similar between FFA and TAG. The intakes of individual FA were similar, with the exception of a 24 g/d lower intake of C16:0 and a 64 g/d greater intake of cis-9 C18:1 for the TAG compared with the FFA treatment. Compared with CON, the UFA treatments decreased DM intake (1.0 kg/d) but increased milk yield (2.2 kg/d) and milk lactose concentration and yield. The UFA treatments reduced milk fat concentration, averaging 3.30, 3.18, and 3.11% for CON, FFA, and TAG treatments, respectively. Yield of milk fat, milk protein, and 3.5% fat-corrected milk remained unchanged when comparing CON with the UFA treatments. No differences existed in the yield of milk or milk

  11. Is docosahexaenoic acid synthesis from α-linolenic acid sufficient to supply the adult brain?

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Bazinet, Richard P

    2015-07-01

    Docosahexaenoic acid (DHA) is important for brain function, and can be obtained directly from the diet or synthesized in the body from α-linolenic acid (ALA). Debate exists as to whether DHA synthesized from ALA can provide sufficient DHA for the adult brain, as measures of DHA synthesis from ingested ALA are typically <1% of the oral ALA dose. However, the primary fate of orally administered ALA is β-oxidation and long-term storage in adipose tissue, suggesting that DHA synthesis measures involving oral ALA tracer ingestion may underestimate total DHA synthesis. There is also evidence that DHA synthesized from ALA can meet brain DHA requirements, as animals fed ALA-only diets have brain DHA concentrations similar to DHA-fed animals, and the brain DHA requirement is estimated to be only 2.4-3.8 mg/day in humans. This review summarizes evidence that DHA synthesis from ALA can provide sufficient DHA for the adult brain by examining work in humans and animals involving estimates of DHA synthesis and brain DHA requirements. Also, an update on methods to measure DHA synthesis in humans is presented highlighting a novel approach involving steady-state infusion of stable isotope-labeled ALA that bypasses several limitations of oral tracer ingestion. It is shown that this method produces estimates of DHA synthesis that are at least 3-fold higher than brain uptake rates in rats.

  12. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  13. Novel synthesis of steryl esters from phytosterols and amino Acid.

    PubMed

    Pang, Min; Jiang, Shaotong; Cao, Lili; Pan, Lijun

    2011-10-12

    The feasibility of esterification of phytosterol with the amino acid l-glutamic acid was established. The influence of various organic solvents was investigated, and n-butanol was selected as an ideal solvent for phytosteryl esters synthesis with l-glutamic acid. The reaction conditions were further optimized by orthogonal experiments, and a 92.3% degree of esterification was obtained when optimum conditions were used. FT-IR spectral, GC-MS, and NMR analyses were adopted to determine the steryl esters of l-glutamic acid. The FT-IR spectrum indicated the presence of ester bonds in the phytosteryl esters with l-glutamic acid, and on the basis of the detailed mass spectrography analysis, GC-MS and NMR offered an efficient and reliable way to confirm the steryl esters. This novel synthesis approach of phytosteryl esters with amino acid supplied a promising alternative to the substrate on esterification of phytosterols and thus can be readily applied to further studies of functional food ingredients of phytosteryl esters.

  14. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  15. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions.

  16. The Significance of Different Diacylgycerol Synthesis Pathways on Plant Oil Composition and Bioengineering

    PubMed Central

    Bates, Philip D.; Browse, John

    2012-01-01

    The unique properties of vegetable oils from different plants utilized for food, industrial feedstocks, and fuel is dependent on the fatty acid (FA) composition of triacylglycerol (TAG). Plants can use two main pathways to produce diacylglycerol (DAG), the immediate precursor molecule to TAG synthesis: (1) De novo DAG synthesis, and (2) conversion of the membrane lipid phosphatidylcholine (PC) to DAG. The FA esterified to PC are also the substrate for FA modification (e.g., desaturation, hydroxylation, etc.), such that the FA composition of PC-derived DAG can be substantially different than that of de novo DAG. Since DAG provides two of the three FA in TAG, the relative flux of TAG synthesis from de novo DAG or PC-derived DAG can greatly affect the final oil FA composition. Here we review how the fluxes through these two alternate pathways of DAG/TAG synthesis are determined and present evidence that suggests which pathway is utilized in different plants. Additionally, we present examples of how the endogenous DAG synthesis pathway in a transgenic host plant can produce bottlenecks for engineering of plant oil FA composition, and discuss alternative strategies to overcome these bottlenecks to produce crop plants with designer vegetable oil compositions. PMID:22783267

  17. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  18. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  19. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  20. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  1. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  2. Is Acetylcarnitine a Substrate for Fatty Acid Synthesis in Plants?

    PubMed

    Roughan, G.; Post-Beittenmiller, D.; Ohlrogge, J.; Browse, J.

    1993-04-01

    Long-chain fatty acid synthesis from [1-14C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-14C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-14C]-Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-14C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-14C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-14C]acetylcarnitine and 47 to 57% of the [1-14C]acetate taken up was incorporated into lipids. Most (78-82%) of the [1-14C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants.

  3. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  4. Fatty acid synthesis: from CO2 to functional genomics.

    PubMed

    Ohlrogge, J; Pollard, M; Bao, X; Focke, M; Girke, T; Ruuska, S; Mekhedov, S; Benning, C

    2000-12-01

    For over 25 years there has been uncertainty over the pathway from CO(2) to acetyl-CoA in chloroplasts. On the one hand, free acetate is the most effective substrate for fatty acid synthesis by isolated chloroplasts, and free acetate concentrations reported in leaf tissue (0.1-1 mM) appear adequate to saturate fatty acid synthase. On the other hand, a clear mechanism to generate sufficient free acetate for fatty acid synthesis is not established and direct production of acetyl-CoA from pyruvate by a plastid pyruvate dehydrogenase seems a more simple and direct path. We have re-examined this question and attempted to distinguish between the alternatives. The kinetics of (13)CO(2) and (14)CO(2) movement into fatty acids and the absolute rate of fatty acid synthesis in leaves was determined in light and dark. Because administered (14)C appears in fatty acids within < 2-3 min our results are inconsistent with a large pool of free acetate as an intermediate in leaf fatty acid synthesis. In addition, these studies provide an estimate of the turnover rate of fatty acid in leaves. Studies similar to the above are more complex in seeds, and some questions about the regulation of plant lipid metabolism seem difficult to solve using conventional biochemical or molecular approaches. For example, we have little understanding of why or how some seeds produce >50% oil whereas other seeds store largely carbohydrate or protein. Major control over complex plant biochemical pathways may only become possible by understanding regulatory networks which provide 'global' control over these pathways. To begin to discover such networks and provide a broad analysis of gene expression in developing oilseeds, we have produced microarrays that display approx. 5000 seed-expressed Arabidopsis genes. Sensitivity of the arrays was 1-2 copies of mRNA/cell. The arrays have been hybridized with probes derived from seeds, leaves and roots, and analysis of expression ratios between the different tissues

  5. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  6. A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

    PubMed

    Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

    2015-04-01

    The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

  7. Synthesis of rosin acid starch catalyzed by lipase.

    PubMed

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2:1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch.

  8. Pterandric acid--its isolation, synthesis and stereochemistry.

    PubMed

    Haleem, Muhammad A; Capellari, Simone C; Sympson, Beryl B; Marsaioli, Anita J

    2015-01-01

    Some plant families have a specialized type of pollination system, with floral lipid rewards for pollinators, which is common. In neotropical Malpighiaceae species like Pterandra pyroidea, this specialized type of pollination system is apparently shifting from floral oils/lipids to pollen reward. Mass spectrometric analysis (GC/MS-EI) indicated that P. pyroidea floral oil has a unique chemical composition, i.e., few fatty acid constituents possessing acetoxy groups at positions 5 and 7, which is distinct from the other floral oils of sympatric Malpighiaceae species. The structure of the major floral oil constituent, a novel fatty acid, anti-5,7-diacetoxydocosanoic acid, was confirmed based on synthesis, mass fragmentation, and 1H and 13C NMR analyses; the compound is herein named pterandric acid.

  9. Very long chain fatty acid synthesis in sunflower kernels.

    PubMed

    Salas, Joaquín J; Martínez-Force, Enrique; Garcés, Rafael

    2005-04-01

    Most common seed oils contain small amounts of very long chain fatty acids (VLCFAs), the main components of oils from species such as Brassica napus or Lunnaria annua. These fatty acids are synthesized from acyl-CoA precursors in the endoplasmic reticulum through the activity of a dissociated enzyme complex known as fatty acid elongase. We studied the synthesis of the arachidic, behenic, and lignoceric VLCFAs in sunflower kernels, in which they account for 1-3% of the saturated fatty acids. These VLCFAs are synthesized from 18:0-CoA by membrane-bound fatty acid elongases, and their biosynthesis is mainly dependent on NADPH equivalents. Two condensing enzymes appear to be responsible for the synthesis of VLCFAs in sunflower kernels, beta-ketoacyl-CoA synthase-I (KCS-I) and beta-ketoacyl-CoA synthase-II (KCS-II). Both of these enzymes were resolved by ion exchange chromatography and display different substrate specificities. While KCS-I displays a preference for 20:0-CoA, 18:0-CoA was more efficiently elongated by KCS-II. Both enzymes have different sensitivities to pH and Triton X-100, and their kinetic properties indicate that both are strongly inhibited by the presence of their substrates. In light of these results, the VLCFA composition of sunflower oil is considered in relation to that in other commercially exploited oils.

  10. FaPYR1 is involved in strawberry fruit ripening.

    PubMed

    Chai, Ye-Mao; Jia, Hai-Feng; Li, Chun-Li; Dong, Qing-Hua; Shen, Yuan-Yue

    2011-10-01

    Although the plant hormone abscisic acid (ABA) has been suggested to play a role in the ripening of non-climatic fruit, direct genetic/molecular evidence is lacking. In the present study, a strawberry gene homologous to the Arabidopsis ABA receptor gene PYR1, named FaPYR1, was isolated and characterized. The 627 bp cDNA includes an intact open reading frame that encodes a deduced protein of 208 amino acids, in which putative conserved domains were detected by homology analysis. Using tobacco rattle virus-induced gene silencing (VIGS), the FaPYR1 gene was silenced in strawberry fruit. Down-regulation of the FaPYR1 gene not only significantly delayed fruit ripening, but also markedly altered ABA content, ABA sensitivity, and a set of ABA-responsive gene transcripts, including ABI1 and SnRK2. Furthermore, the loss of red colouring in FaPYR1 RNAi (RNA interference) fruits could not be rescued by exogenously applied ABA, which could promote the ripening of wild-type fruits. Collectively, these results demonstrate that the putative ABA receptor FaPYR1 acts as a positive regulator in strawberry fruit ripening. It was also revealed that the application of the VIGS technique in strawberry fruit could be used as a novel tool for studying strawberry fruit development.

  11. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  12. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  13. Invited review: palmitic and stearic acid metabolism in lactating dairy cows.

    PubMed

    Loften, J R; Linn, J G; Drackley, J K; Jenkins, T C; Soderholm, C G; Kertz, A F

    2014-01-01

    Energy is the most limiting nutritional component in diets for high-producing dairy cows. Palmitic (C16:0) and stearic (C18:0) acids have unique and specific functions in lactating dairy cows beyond a ubiquitous energy source. This review delineates their metabolism and usage in lactating dairy cows from diet to milk production. Palmitic acid is the fatty acid (FA) found in the greatest quantity in milk fat. Dietary sources of C16:0 generally increase milk fat yield and are used as an energy source for milk production and replenishing body weight loss during periods of negative energy balance. Stearic acid is the most abundant FA available to the dairy cow and is used to a greater extent for milk production and energy balance than C16:0. However, C18:0 is also intimately involved in milk fat production. Quantifying the transfer of each FA from diet into milk fat is complicated by de novo synthesis of C16:0 and desaturation of C18:0 to oleic acid in the mammary gland. In addition, incorporation of both FA into milk fat appears to be limited by the cow's requirement to maintain fluidity of milk, which requires a balance between saturated and unsaturated FA. Oleic acid is the second most abundant FA in milk fat and likely the main unsaturated FA involved in regulating fluidity of milk. Because the mammary gland can desaturate C18:0 to oleic acid, C18:0 appears to have a more prominent role in milk production than C16:0. To understand metabolism and utilization of these FA in lactating dairy cows, we reviewed production and milk fat synthesis studies. Additional and longer lactation studies on feeding both FA to lactating dairy cows are required to better delineate their roles in optimizing milk production and milk FA composition and yield.

  14. FaGAST2, a strawberry ripening-related gene, acts together with FaGAST1 to determine cell size of the fruit receptacle.

    PubMed

    Moyano-Cañete, Enriqueta; Bellido, María L; García-Caparrós, Nicolás; Medina-Puche, Laura; Amil-Ruiz, Francisco; González-Reyes, José A; Caballero, José L; Muñoz-Blanco, Juan; Blanco-Portales, Rosario

    2013-02-01

    Numerous GAST-like genes have been reported in higher plants, but only one GAST-like gene (FaGAST1) has been described in strawberry so far. Herein, we have identified a novel strawberry FaGAST gene (FaGAST2) whose expression showed an increase throughout fruit receptacle development and ripening, coinciding with those stages where a decrease in fruit expansion processes (G3-W and R-OR stages) occurs. FaGAST2 only shares 31% and 15.7% amino acid and nucleotide sequence homology, respectively, with the previously reported FaGAST1 gene, but both genes contain a signal peptide and a highly conserved GASA domain (cysteine-rich domain) in the C-terminal region. FaGAST2 expression is mainly confined to the fruit receptacle and is not regulated by auxins, GA(3) or ABA, but is regulated by ethephon, an intracellular generator of ethylene. In addition, the expression of the FaGAST2 gene also increased under oxidative stress conditions (H(2)O(2) or Colletotrichum acutatum infection), suggesting a direct role for FaGAST2 protein in reactive oxygen species scavenging during fruit growth and ripening and during fungal infection. On the other hand, the overexpression of the FaGAST2 gene in different transgenic lines analyzed caused a delay in the growth of strawberry plants and a reduction in the size of the transgenic fruits. The histological studies performed in these fruits showed that their parenchymal cells were smaller than those of the controls, supporting a relationship between FaGAST2 gene expression, strawberry fruit cell elongation and fruit size. However, transitory silencing of FaGAST2 gene expression through RNA interference approaches revealed an increase in FaGAST1 expression, but no changes in fruit cell size were observed. These results support the hypothesis that both genes must act synergistically to determine fruit cell size during fruit development and ripening.

  15. FaGAST2, a strawberry ripening-related gene, acts together with FaGAST1 to determine cell size of the fruit receptacle.

    PubMed

    Moyano-Cañete, Enriqueta; Bellido, María L; García-Caparrós, Nicolás; Medina-Puche, Laura; Amil-Ruiz, Francisco; González-Reyes, José A; Caballero, José L; Muñoz-Blanco, Juan; Blanco-Portales, Rosario

    2013-02-01

    Numerous GAST-like genes have been reported in higher plants, but only one GAST-like gene (FaGAST1) has been described in strawberry so far. Herein, we have identified a novel strawberry FaGAST gene (FaGAST2) whose expression showed an increase throughout fruit receptacle development and ripening, coinciding with those stages where a decrease in fruit expansion processes (G3-W and R-OR stages) occurs. FaGAST2 only shares 31% and 15.7% amino acid and nucleotide sequence homology, respectively, with the previously reported FaGAST1 gene, but both genes contain a signal peptide and a highly conserved GASA domain (cysteine-rich domain) in the C-terminal region. FaGAST2 expression is mainly confined to the fruit receptacle and is not regulated by auxins, GA(3) or ABA, but is regulated by ethephon, an intracellular generator of ethylene. In addition, the expression of the FaGAST2 gene also increased under oxidative stress conditions (H(2)O(2) or Colletotrichum acutatum infection), suggesting a direct role for FaGAST2 protein in reactive oxygen species scavenging during fruit growth and ripening and during fungal infection. On the other hand, the overexpression of the FaGAST2 gene in different transgenic lines analyzed caused a delay in the growth of strawberry plants and a reduction in the size of the transgenic fruits. The histological studies performed in these fruits showed that their parenchymal cells were smaller than those of the controls, supporting a relationship between FaGAST2 gene expression, strawberry fruit cell elongation and fruit size. However, transitory silencing of FaGAST2 gene expression through RNA interference approaches revealed an increase in FaGAST1 expression, but no changes in fruit cell size were observed. These results support the hypothesis that both genes must act synergistically to determine fruit cell size during fruit development and ripening. PMID:23231876

  16. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  17. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  18. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  19. Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

    PubMed

    Myrtle, J D; Beekman, A M; Barrow, R A

    2016-09-21

    A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1). PMID:27519121

  20. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described.

  1. Activation of PPARα by Fatty Acid Accumulation Enhances Fatty Acid Degradation and Sulfatide Synthesis.

    PubMed

    Yang, Yang; Feng, Yuyao; Zhang, Xiaowei; Nakajima, Takero; Tanaka, Naoki; Sugiyama, Eiko; Kamijo, Yuji; Aoyama, Toshifumi

    2016-01-01

    Very-long-chain acyl-CoA dehydrogenase (VLCAD) catalyzes the first reaction in the mitochondrial fatty acid β-oxidation pathway. VLCAD deficiency is associated with the accumulation of fat in multiple organs and tissues, which results in specific clinical features including cardiomyopathy, cardiomegaly, muscle weakness, and hepatic dysfunction in infants. We speculated that the abnormal fatty acid metabolism in VLCAD-deficient individuals might cause cell necrosis by fatty acid toxicity. The accumulation of fatty acids may activate peroxisome proliferator-activated receptor (PPAR), a master regulator of fatty acid metabolism and a potent nuclear receptor for free fatty acids. We examined six skin fibroblast lines, derived from VLCAD-deficient patients and identified fatty acid accumulation and PPARα activation in these cell lines. We then found that the expression levels of three enzymes involved in fatty acid degradation, including long-chain acyl-CoA synthetase (LACS), were increased in a PPARα-dependent manner. This increased expression of LACS might enhance the fatty acyl-CoA supply to fatty acid degradation and sulfatide synthesis pathways. In fact, the first and last reactions in the sulfatide synthesis pathway are regulated by PPARα. Therefore, we also measured the expression levels of enzymes involved in sulfatide metabolism and the regulation of cellular sulfatide content. The levels of these enzymes and cellular sulfatide content both increased in a PPARα-dependent manner. These results indicate that PPARα activation plays defensive and compensative roles by reducing cellular toxicity associated with fatty acids and sulfuric acid. PMID:27644403

  2. [Synthesis of new mandelic acid derivatives with preservative action. Synthesis and acute toxicity study].

    PubMed

    Stan, Cătălina; Năstase, V; Pavelescu, M; Vasile, Cornelia; Dumitrache, M; Gherase, Florenţa; Năstasă, Veronica

    2004-01-01

    Starting from the antiseptic action of DL mandelic acid, there were synthesized a series of esters of the mandelic acid, esters which could have preservative action. This study present the synthesis, structure validation and the acute toxicity study, for the new synthesized compounds. The esters were obtained by acylating 4-hydroxybenzoic acid propyl, ethyl, methyl esters and salicylic acid with the DL mandelic chloride (that was protected initially by the hydroxylic group). The structure of the synthesized compounds was confirmed by quantitative elemental analysis and RMN 1H spectral measurements. The acute toxicity was determined for two of the esters, who proved to had a preservative action (previously studied) and indicated that these esters have a small toxicity.

  3. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  4. Limiting amino acid for protein synthesis with mammary cells in tissue culture.

    PubMed

    Park, C S; Chandler, P T; Norman, A W

    1976-05-01

    To identify the limiting amino acid in the minimal essential medium as published by Eagle (Science 130:432, 1959) for milk protein synthesis in rat mammary cells in tissue culture, two different experimental approaches were used. The first study involved the reduction of amino acids singly from the total amino acid complement of the medium for milk protein synthesis. The second study was to investigate the effect on milk protein synthesis of single amino acid addition to the basic complement of amino acids. Order of limiting amino acids was lysine (first) and possible methionine, valine, or arginine (second).

  5. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  6. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  7. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  8. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  9. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  10. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  11. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  12. Fatty acid synthesis and oxidation in cumulus cells support oocyte maturation in bovine.

    PubMed

    Sanchez-Lazo, Laura; Brisard, Daphné; Elis, Sébastien; Maillard, Virginie; Uzbekov, Rustem; Labas, Valérie; Desmarchais, Alice; Papillier, Pascal; Monget, Philippe; Uzbekova, Svetlana

    2014-09-01

    Oocyte meiotic maturation requires energy from various substrates including glucose, amino acids, and lipids. Mitochondrial fatty acid (FA) β-oxidation (FAO) in the oocyte is required for meiotic maturation, which is accompanied by differential expression of numerous genes involved in FAs metabolism in surrounding cumulus cells (CCs) in vivo. The objective was to elucidate components involved in FAs metabolism in CCs during oocyte maturation. Twenty-seven genes related to lipogenesis, lipolysis, FA transport, and FAO were chosen from comparative transcriptome analysis of bovine CCs before and after maturation in vivo. Using real-time PCR, 22 were significantly upregulated at different times of in vitro maturation (IVM) in relation to oocyte meiosis progression from germinal vesicle breakdown to metaphase-II. Proteins FA synthase, acetyl-coenzyme-A carboxylase, carnitine palmitoyltransferase, perilipin 2, and FA binding protein 3 were detected by Western blot and immunolocalized to CCs and oocyte cytoplasm, with FA binding protein 3 concentrated around oocyte chromatin. By mass spectrometry, CCs lipid profiling was shown to be different before and after IVM. FAO inhibitors etomoxir and mildronate dose-dependently decreased the oocyte maturation rate in vitro. In terms of viability, cumulus enclosed oocytes were more sensitive to etomoxir than denuded oocytes. In CCs, etomoxir (150 μM) led to downregulation of lipogenesis genes and upregulated lipolysis and FAO genes. Moreover, the number of lipid droplets decreased, whereas several lipid species were more abundant compared with nontreated CCs after IVM. In conclusion, FAs metabolism in CCs is important to maintain metabolic homeostasis and may influence meiosis progression and survival of enclosed oocytes. PMID:25058602

  13. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  14. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  15. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc.

  16. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  17. Fumaric Acid Production in Saccharomyces cerevisiae by In Silico Aided Metabolic Engineering

    PubMed Central

    Xu, Guoqiang; Zou, Wei; Chen, Xiulai; Xu, Nan; Liu, Liming; Chen, Jian

    2012-01-01

    Fumaric acid (FA) is a promising biomass-derived building-block chemical. Bio-based FA production from renewable feedstock is a promising and sustainable alternative to petroleum-based chemical synthesis. Here we report on FA production by direct fermentation using metabolically engineered Saccharomyces cerevisiae with the aid of in silico analysis of a genome-scale metabolic model. First, FUM1 was selected as the target gene on the basis of extensive literature mining. Flux balance analysis (FBA) revealed that FUM1 deletion can lead to FA production and slightly lower growth of S. cerevisiae. The engineered S. cerevisiae strain obtained by deleting FUM1 can produce FA up to a concentration of 610±31 mg L–1 without any apparent change in growth in fed-batch culture. FT-IR and 1H and 13C NMR spectra confirmed that FA was synthesized by the engineered S. cerevisiae strain. FBA identified pyruvate carboxylase as one of the factors limiting higher FA production. When the RoPYC gene was introduced, S. cerevisiae produced 1134±48 mg L–1 FA. Furthermore, the final engineered S. cerevisiae strain was able to produce 1675±52 mg L–1 FA in batch culture when the SFC1 gene encoding a succinate–fumarate transporter was introduced. These results demonstrate that the model shows great predictive capability for metabolic engineering. Moreover, FA production in S. cerevisiae can be efficiently developed with the aid of in silico metabolic engineering. PMID:23300594

  18. Transcriptome analysis and identification of genes associated with omega-3 fatty acid biosynthesis in Perilla frutescens (L.) var. frutescens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Perilla (Perilla frutescens (L.) var frutescens) produces high levels of a-linolenic acid (ALA), an omega-3 fatty acid important to health and development. To uncover key genes involved in fatty acid (FA) and triacylglycerol (TAG) synthesis in perilla, we conducted deep sequencing of cD...

  19. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  20. Alternative kynurenic acid synthesis routes studied in the rat cerebellum.

    PubMed

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO(-)) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO(-) (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO(-) but not from D-KYN + ONOO(-). In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO(-) and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  1. On the Light Dependence of Fatty Acid Synthesis in Spinach Chloroplasts

    PubMed Central

    Sauer, Andreas; Heise, Klaus-Peter

    1983-01-01

    The capacity of intact chloroplasts to synthesize long chain fatty acids from acetate depends on the stroma pH in Spinacia oleracea, U. S. hybrid 424. The pH optimum is close to 8.5. Lowering of the stroma pH leads to a reduction of acetate incorporation but does not suffice to eliminate fatty acid synthesis completely. Chain elongation from palmitic to oleic acid shows the same pH dependence. Fatty acid synthesis is activated in the dark upon the simultaneous addition of dihydroxyacetone phosphate and orthophosphate supplying ATP and oxaloacetate for reoxidation of NADPH in the stroma. Under these conditions both dark fatty acid synthesis and synthesis of oleate from palmitate show the same pH dependence as in the light. Dark fatty acid synthesis is further stimulated by increasing the stromal Mg2+ concentration with the ionophore A 23187. In contrast to CO2 fixation, dark fatty acid synthesis is considerably reduced by dithiothreitol (DTT). This observation may be due to an acetyl-CoA deficiency, caused by a nonenzymic acylation of DTT, and a competition for ATP between DTT-activated CO2 fixation and fatty acid synthesis. Because d,l-glyceraldehyde as inhibitor of CO2 fixation compensates the DTT effect on dark fatty acid synthesis, reducing equivalents may be involved in the light dependence of acetate activation. PMID:16663156

  2. Cyclic diguanylic acid and cellulose synthesis in Agrobacterium tumefaciens

    SciTech Connect

    Amikam, D.; Benziman, M. )

    1989-12-01

    The occurrence of the novel regulatory nucleotide bis(3',5')-cyclic diguanylic acid (c-di-GMP) and its relation to cellulose biogenesis in the plant pathogen Agrobacterium tumefaciens was studied. c-di-GMP was detected in acid extracts of {sup 32}P-labeled cells grown in various media, and an enzyme responsible for its formation from GTP was found to be present in cell-free preparations. Cellulose synthesis in vivo was quantitatively assessed with ({sup 14}C)glucose as a tracer. The organism produced cellulose during growth in the absence of plant cells, and this capacity was retained in resting cells. Synthesis of a cellulosic product from UDP-glucose in vitro with membrane preparations was markedly stimulated by c-di-GMP and its precursor GTP and was further enhanced by Ca2+. The calcium effect was attributed to inhibition of a c-di-GMP-degrading enzyme shown to be present in the cellulose synthase-containing membranes.

  3. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  4. FaQR, required for the biosynthesis of the strawberry flavor compound 4-hydroxy-2,5-dimethyl-3(2H)-furanone, encodes an enone oxidoreductase.

    PubMed

    Raab, Thomas; López-Ráez, Juan Antonio; Klein, Dorothée; Caballero, Jose Luis; Moyano, Enriqueta; Schwab, Wilfried; Muñoz-Blanco, Juan

    2006-04-01

    The flavor of strawberry (Fragaria x ananassa) fruit is dominated by an uncommon group of aroma compounds with a 2,5-dimethyl-3(H)-furanone structure. We report the characterization of an enzyme involved in the biosynthesis of 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF; Furaneol), the key flavor compound in strawberries. Protein extracts were partially purified, and the observed distribution of enzymatic activity correlated with the presence of a single polypeptide of approximately 37 kD. Sequence analysis of two peptide fragments showed total identity with the protein sequence of a strongly ripening-induced, auxin-dependent putative quinone oxidoreductase, Fragaria x ananassa quinone oxidoreductase (FaQR). The open reading frame of the FaQR cDNA consists of 969 bp encoding a 322-amino acid protein with a calculated molecular mass of 34.3 kD. Laser capture microdissection followed by RNA extraction and amplification demonstrated the presence of FaQR mRNA in parenchyma tissue of the strawberry fruit. The FaQR protein was functionally expressed in Escherichia coli, and the monomer catalyzed the formation of HDMF. After chemical synthesis and liquid chromatography-tandem mass spectrometry analysis, 4-hydroxy-5-methyl-2-methylene-3(2H)-furanone was confirmed as a substrate of FaQR and the natural precursor of HDMF. This study demonstrates the function of the FaQR enzyme in the biosynthesis of HDMF as enone oxidoreductase and provides a foundation for the improvement of strawberry flavor and the biotechnological production of HDMF.

  5. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  6. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  7. Regulation of bile acid synthesis in rat hepatocyte monolayer cultures

    SciTech Connect

    Kubaska, W.M.

    1986-01-01

    Primary hepatocyte monolayer cultures (PHC) were prepared and incubated in serum free media. Cells from a cholestyramine fed rat converted exogenous (/sup 14/C)-cholesterol into (/sup 14/C)-bile acids at a 3-fold greater rate than rats fed a normal diet. PHC synthesize bile acids (BA) at a rate of approximately 0.06 ..mu..g/mg protein/h. The major bile acid composition, as determined by GLC, was ..beta..-muricholic acid (BMC) and cholic acid (CA) in a 3:1 ratio, respectively. PHC rapidly converted free BA and BA intermediates into taurine conjugated trihydroxy-BA up to 87h after plating. 3-Hydroxy-3-methylglutaryl-coenzyme A-reductase activity assayed in microsomes prepared from PHC, decreased during the initial 48h, then remained constant. Cholesterol 7..cap alpha..-hydroxylase activity decreased during the initial 48h, then increased during the next 48h. This occurred while whole cells produced BA at a linear rate. The effect of individual BA on bile acid synthesis (BAS) was also studied. Relative rates of BAS were measured as the conversion of (/sup 14/C)-cholesterol into (/sup 14/C)-BA. BA combinations were tested in order to simulate the composition of the enterohepatic circulation. The addition of TCA (525 ..mu..M) plus TCDCA (80..mu..M), in concentrations which greatly exceed the concentration of BA (60..mu..M) in rate portal blood, failed to inhibit BAS. BA plus phospholipid and/or cholesterol also did not inhibit BAS. Surprisingly, crude rat bile with a final concentration comparable to those in the synthetic mix inhibited (/sup 14/C)-cholesterol conversion into (/sup 14/C)-BA.

  8. Baker's Yeast Deficient in Storage Lipid Synthesis Uses cis-Vaccenic Acid to Reduce Unsaturated Fatty Acid Toxicity.

    PubMed

    Sec, Peter; Garaiova, Martina; Gajdos, Peter; Certik, Milan; Griac, Peter; Hapala, Ivan; Holic, Roman

    2015-07-01

    The role of cis-vaccenic acid (18:1n-7) in the reduction of unsaturated fatty acids toxicity was investigated in baker's yeast Saccharomyces cerevisiae. The quadruple mutant (QM, dga1Δ lro1Δ are1Δ are2Δ) deficient in enzymes responsible for triacylglycerol and steryl ester synthesis has been previously shown to be highly sensitive to exogenous unsaturated fatty acids. We have found that cis-vaccenic acid accumulated during cultivation in the QM cells but not in the corresponding wild type strain. This accumulation was accompanied by a reduction in palmitoleic acid (16:1n-7) content in the QM cells that is consistent with the proposed formation of cis-vaccenic acid by elongation of palmitoleic acid. Fatty acid analysis of individual lipid classes from the QM strain revealed that cis-vaccenic acid was highly enriched in the free fatty acid pool. Furthermore, production of cis-vaccenic acid was arrested if the mechanism of fatty acids release to the medium was activated. We also showed that exogenous cis-vaccenic acid did not affect viability of the QM strain at concentrations toxic for palmitoleic or oleic acids. Moreover, addition of cis-vaccenic acid to the growth medium provided partial protection against the lipotoxic effects of exogenous oleic acid. Transformation of palmitoleic acid to cis-vaccenic acid is thus a rescue mechanism enabling S. cerevisiae cells to survive in the absence of triacylglycerol synthesis as the major mechanism for unsaturated fatty acid detoxification.

  9. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life.

  10. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  11. Supplementation of essential fatty acids to Holstein calves during late uterine life and first month of life alters hepatic fatty acid profile and gene expression.

    PubMed

    Garcia, M; Greco, L F; Lock, A L; Block, E; Santos, J E P; Thatcher, W W; Staples, C R

    2016-09-01

    Linoleic acid is an essential dietary fatty acid (FA). However, how the supplementation of linoleic acid during uterine and early life may modify the FA profile and transcriptome regulation of the liver, and performance of preweaned dairy calves is unknown. Our objective was to evaluate the effect of supplementation of essential FA to Holstein calves during late uterine and early life on their hepatic FA profile and global gene expression at 30 d of age. During the last 8 wk of pregnancy, Holstein cattle (n=96) were fed either no fat supplement (control), a saturated FA supplement enriched with C18:0, or an unsaturated FA supplement enriched with linoleic acid. Male calves (n=40) born from these dams were fed a milk replacer (MR) with either low (LLA) or high linoleic acid (HLA) concentration as the sole feedstuff during the first 30 d. Liver biopsy was performed at 30 d of age, and microarray analysis was performed on 18 liver samples. Total concentration of FA in liver were greater in calves fed LLA compared with those fed HLA MR (8.2 vs. 7.1%), but plasma concentrations of total FA did not differ due to MR diets. The FA profiles of plasma and liver of calves were affected differently by the prepartum diets. Specifically, the FA profile in liver was affected moderately by the feeding of fat prepartum, but the profiles did not differ due to the type of FA fed prepartum. The type of MR fed during the first 30 d of life had major effects on both plasma and liver FA profiles, resembling the type of fat fed. Plasma and liver of calves fed LLA MR had greater percentage of medium-chain FA (C12:0 and C14:0), whereas plasma and liver from calves fed HLA MR had greater percentages of linoleic and α-linolenic acids. Dams fed fat or a specific type of FA modified the expression of some genes in liver of calves, particularly those genes involved in biological functions and pathways related to upregulation of lipid metabolism and downregulation of inflammatory responses

  12. Supplementation of essential fatty acids to Holstein calves during late uterine life and first month of life alters hepatic fatty acid profile and gene expression.

    PubMed

    Garcia, M; Greco, L F; Lock, A L; Block, E; Santos, J E P; Thatcher, W W; Staples, C R

    2016-09-01

    Linoleic acid is an essential dietary fatty acid (FA). However, how the supplementation of linoleic acid during uterine and early life may modify the FA profile and transcriptome regulation of the liver, and performance of preweaned dairy calves is unknown. Our objective was to evaluate the effect of supplementation of essential FA to Holstein calves during late uterine and early life on their hepatic FA profile and global gene expression at 30 d of age. During the last 8 wk of pregnancy, Holstein cattle (n=96) were fed either no fat supplement (control), a saturated FA supplement enriched with C18:0, or an unsaturated FA supplement enriched with linoleic acid. Male calves (n=40) born from these dams were fed a milk replacer (MR) with either low (LLA) or high linoleic acid (HLA) concentration as the sole feedstuff during the first 30 d. Liver biopsy was performed at 30 d of age, and microarray analysis was performed on 18 liver samples. Total concentration of FA in liver were greater in calves fed LLA compared with those fed HLA MR (8.2 vs. 7.1%), but plasma concentrations of total FA did not differ due to MR diets. The FA profiles of plasma and liver of calves were affected differently by the prepartum diets. Specifically, the FA profile in liver was affected moderately by the feeding of fat prepartum, but the profiles did not differ due to the type of FA fed prepartum. The type of MR fed during the first 30 d of life had major effects on both plasma and liver FA profiles, resembling the type of fat fed. Plasma and liver of calves fed LLA MR had greater percentage of medium-chain FA (C12:0 and C14:0), whereas plasma and liver from calves fed HLA MR had greater percentages of linoleic and α-linolenic acids. Dams fed fat or a specific type of FA modified the expression of some genes in liver of calves, particularly those genes involved in biological functions and pathways related to upregulation of lipid metabolism and downregulation of inflammatory responses

  13. Synthesis of ω-hydroxy dodecanoic acid based on an engineered CYP153A fusion construct

    PubMed Central

    Scheps, Daniel; Honda Malca, Sumire; Richter, Sven M; Marisch, Karoline; Nestl, Bettina M; Hauer, Bernhard

    2013-01-01

    A bacterial P450 monooxygenase-based whole cell biocatalyst using Escherichia coli has been applied in the production of ω-hydroxy dodecanoic acid from dodecanoic acid (C12-FA) or the corresponding methyl ester. We have constructed and purified a chimeric protein where the fusion of the monooxygenase CYP153A from Marinobacter aquaeloei to the reductase domain of P450 BM3 from Bacillus megaterium ensures optimal protein expression and efficient electron coupling. The chimera was demonstrated to be functional and three times more efficient than other sets of redox components evaluated. The established fusion protein (CYP153AM. aq.-CPR) was used for the hydroxylation of C12-FA in in vivo studies. These experiments yielded 1.2 g l–1 ω-hydroxy dodecanoic from 10 g l–1 C12-FA with high regioselectivity (> 95%) for the terminal position. As a second strategy, we utilized C12-FA methyl ester as substrate in a two-phase system (5:1 aqueous/organic phase) configuration to overcome low substrate solubility and product toxicity by continuous extraction. The biocatalytic system was further improved with the coexpression of an additional outer membrane transport system (AlkL) to increase the substrate transfer into the cell, resulting in the production of 4 g l–1 ω-hydroxy dodecanoic acid. We further summarized the most important aspects of the whole-cell process and thereupon discuss the limits of the applied oxygenation reactions referring to hydrogen peroxide, acetate and P450 concentrations that impact the efficiency of the production host negatively. PMID:23941649

  14. GPM Video of In-fa

    NASA Video Gallery

    On Nov. 19 GPM saw a few towering storms in In-fa's eye wall were reaching heights of up to 17.3 km (10.7 miles). The most intense precipitation was measured in In-fa's eye wall by DPR where it was...

  15. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  16. New stabilized FastPrep-CLEAs for sialic acid synthesis.

    PubMed

    García-García, María Inmaculada; Sola-Carvajal, Agustín; Sánchez-Carrón, Guiomar; García-Carmona, Francisco; Sánchez-Ferrer, Alvaro

    2011-05-01

    N-acetyl-D-neuraminic acid aldolase, a key enzyme in the biotechnological production of N-acetyl-D-neuraminic acid (sialic acid) from N-acetyl-D-mannosamine and pyruvate, was immobilized as cross-linked enzyme aggregates (CLEAs) by precipitation with 90% ammonium sulfate and crosslinking with 1% glutaraldehyde. Because dispersion in a reciprocating disruptor (FastPrep) was only able to recover 40% of the activity, improved CLEAs were then prepared by co-aggregation of the enzyme with 10mg/mL bovine serum albumin followed by a sodium borohydride treatment and final disruption by FastPrep (FastPrep-CLEAs). This produced a twofold increase in activity up to 86%, which is a 30% more than that reported for this aldolase in cross-linked inclusion bodies (CLIBs). In addition, these FastPrep-CLEAs presented remarkable biotechnological features for Neu5Ac synthesis, including, good activity and stability at alkaline pHs, a high K(M) for ManNAc (lower for pyruvate) and good operational stability. These results reinforce the practicability of using FastPrep-CLEAs in biocatalysis, thus reducing production costs and favoring reusability.

  17. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  18. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  19. Long-term ritonavir exposure increases fatty acid and glycerol recycling in 3T3-L1 adipocytes as compensatory mechanisms for increased triacylglycerol hydrolysis.

    PubMed

    Adler-Wailes, Diane C; Guiney, Evan L; Wolins, Nathan E; Yanovski, Jack A

    2010-05-01

    Lipodystrophy with high nonesterified fatty acid (FA) efflux is reported in humans receiving highly active antiretroviral therapy (HAART) to treat HIV infection. Ritonavir, a common component of HAART, alters adipocyte FA efflux, but the mechanism for this effect is not established. To investigate ritonavir-induced changes in FA flux and recycling through acylglycerols, we exposed differentiated murine 3T3-L1 adipocytes to ritonavir for 14 d. FA efflux, uptake, and incorporation into acylglycerols were measured. To identify a mediator of FA efflux, we measured adipocyte triacylglycerol lipase (ATGL) transcript and protein. To determine whether ritonavir-treated adipocytes increased glycerol backbone synthesis for FA reesterification, we measured labeled glycerol and pyruvate incorporation into triacylglycerol (TAG). Ritonavir-treated cells had increased FA efflux, uptake, and incorporation into TAG (all P < 0.01). Ritonavir increased FA efflux without consistently increasing glycerol release or changing TAG mass, suggesting increased partial TAG hydrolysis. Ritonavir-treated adipocytes expressed significantly more ATGL mRNA (P < 0.05) and protein (P < 0.05). Ritonavir increased glycerol (P < 0.01) but not pyruvate (P = 0.41), utilization for TAG backbone synthesis. Consistent with this substrate utilization, glycerol kinase transcript (required for glycerol incorporation into TAG backbone) was up-regulated (P < 0.01), whereas phosphoenolpyruvate carboxykinase transcript (required for pyruvate utilization) was down-regulated (P < 0.001). In 3T3-L1 adipocytes, long-term ritonavir exposure perturbs FA metabolism by increasing ATGL-mediated partial TAG hydrolysis, thus increasing FA efflux, and leads to compensatory increases in FA reesterification with glycerol and acylglycerols. These changes in FA metabolism may, in part, explain the increased FA efflux observed in ritonavir-associated lipodystrophy.

  20. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  1. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  2. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  3. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.

    1969-01-01

    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  4. Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

    PubMed

    Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

    2015-04-01

    D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

  5. Synthesis and application of acid labile anchor groups for the synthesis of peptide amides by Fmoc-solid-phase peptide synthesis.

    PubMed

    Breipohl, G; Knolle, J; Stüber, W

    1989-10-01

    The preparation and application of a new linker for the synthesis of peptide amides using a modified Fmoc-method is described. The new anchor group was developed based on our experience with 4,4'-dimethoxybenzhydryl (Mbh)-protecting group for amides. Lability towards acid treatment was increased dramatically and results in an easy cleavage procedure for the preparation of peptide amides. The synthesis of N-9-fluorenylmethoxycarbonyl- ([5-carboxylatoethyl-2.4-dimethoxyphenyl)- 4'-methoxyphenyl]-methylamin is reported in detail. This linker was coupled to a commercially available aminomethyl polystyrene resin. Peptide synthesis proceeded smoothly using HOOBt esters of Fmoc-amino acids. Release of the peptide amide and final cleavage of the side chain protecting groups was accomplished by treatment with trifluoroacetic acid-dichloromethane mixtures in the presence of scavengers. The synthesis of peptide amides such as LHRH and C-terminal hexapeptide of secretin are given as examples.

  6. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  7. Regulation of protein synthesis by amino acids in muscle of neonates.

    PubMed

    Suryawan, Agus; Davis, Teresa A

    2011-01-01

    The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed.

  8. Synthesis of L-ascorbic acid in the phloem

    PubMed Central

    Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto

    2003-01-01

    Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288

  9. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  10. Tailored fatty acid synthesis via dynamic control of fatty acid elongation.

    PubMed

    Torella, Joseph P; Ford, Tyler J; Kim, Scott N; Chen, Amanda M; Way, Jeffrey C; Silver, Pamela A

    2013-07-01

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even- and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired. PMID:23798438

  11. Ligand Binding to the FA3-FA4 Cleft Inhibits the Esterase-Like Activity of Human Serum Albumin

    PubMed Central

    Ascenzi, Paolo; Leboffe, Loris; di Masi, Alessandra; Trezza, Viviana; Fanali, Gabriella; Gioia, Magda; Coletta, Massimo; Fasano, Mauro

    2015-01-01

    The hydrolysis of 4-nitrophenyl esters of hexanoate (NphOHe) and decanoate (NphODe) by human serum albumin (HSA) at Tyr411, located at the FA3-FA4 site, has been investigated between pH 5.8 and 9.5, at 22.0°C. Values of Ks, k+2, and k+2/Ks obtained at [HSA] ≥ 5×[NphOXx] and [NphOXx] ≥ 5×[HSA] (Xx is NphOHe or NphODe) match very well each other; moreover, the deacylation step turns out to be the rate limiting step in catalysis (i.e., k+3 << k+2). The pH dependence of the kinetic parameters for the hydrolysis of NphOHe and NphODe can be described by the acidic pKa-shift of a single amino acid residue, which varies from 8.9 in the free HSA to 7.6 and 7.0 in the HSA:NphOHe and HSA:NphODe complex, respectively; the pK>a-shift appears to be correlated to the length of the fatty acid tail of the substrate. The inhibition of the HSA-Tyr411-catalyzed hydrolysis of NphOHe, NphODe, and 4-nitrophenyl myristate (NphOMy) by five inhibitors (i.e., diazepam, diflunisal, ibuprofen, 3-indoxyl-sulfate, and propofol) has been investigated at pH 7.5 and 22.0°C, resulting competitive. The affinity of diazepam, diflunisal, ibuprofen, 3-indoxyl-sulfate, and propofol for HSA reflects the selectivity of the FA3-FA4 cleft. Under conditions where Tyr411 is not acylated, the molar fraction of diazepam, diflunisal, ibuprofen, and 3-indoxyl-sulfate bound to HSA is higher than 0.9 whereas the molar fraction of propofol bound to HSA is ca. 0.5. PMID:25790235

  12. Ligand binding to the FA3-FA4 cleft inhibits the esterase-like activity of human serum albumin.

    PubMed

    Ascenzi, Paolo; Leboffe, Loris; di Masi, Alessandra; Trezza, Viviana; Fanali, Gabriella; Gioia, Magda; Coletta, Massimo; Fasano, Mauro

    2015-01-01

    The hydrolysis of 4-nitrophenyl esters of hexanoate (NphOHe) and decanoate (NphODe) by human serum albumin (HSA) at Tyr411, located at the FA3-FA4 site, has been investigated between pH 5.8 and 9.5, at 22.0°C. Values of Ks, k+2, and k+2/Ks obtained at [HSA] ≥ 5×[NphOXx] and [NphOXx] ≥ 5×[HSA] (Xx is NphOHe or NphODe) match very well each other; moreover, the deacylation step turns out to be the rate limiting step in catalysis (i.e., k+3 < k+2). The pH dependence of the kinetic parameters for the hydrolysis of NphOHe and NphODe can be described by the acidic pKa-shift of a single amino acid residue, which varies from 8.9 in the free HSA to 7.6 and 7.0 in the HSA:NphOHe and HSA:NphODe complex, respectively; the pK>a-shift appears to be correlated to the length of the fatty acid tail of the substrate. The inhibition of the HSA-Tyr411-catalyzed hydrolysis of NphOHe, NphODe, and 4-nitrophenyl myristate (NphOMy) by five inhibitors (i.e., diazepam, diflunisal, ibuprofen, 3-indoxyl-sulfate, and propofol) has been investigated at pH 7.5 and 22.0°C, resulting competitive. The affinity of diazepam, diflunisal, ibuprofen, 3-indoxyl-sulfate, and propofol for HSA reflects the selectivity of the FA3-FA4 cleft. Under conditions where Tyr411 is not acylated, the molar fraction of diazepam, diflunisal, ibuprofen, and 3-indoxyl-sulfate bound to HSA is higher than 0.9 whereas the molar fraction of propofol bound to HSA is ca. 0.5. PMID:25790235

  13. The cathepsin B inhibitor, z-FA-CMK is toxic and readily induced cell death in human T lymphocytes

    SciTech Connect

    Liow, K.Y.; Chow, S.C.

    2013-11-01

    The cathepsin B inhibitor, benzyloxycarbonyl-phenylalanine-alanine-chloromethylketone (z-FA-CMK) was found to be toxic and readily induced cell death in the human T cell line, Jurkat, whereas two other analogs benzyloxycarbonyl-phenylalanine-alanine-fluoromethylketone (z-FA-FMK) and benzyloxycarbonyl-phenylalanine-alanine-diazomethylketone (z-FA-DMK) were not toxic. The toxicity of z-FA-CMK requires not only the CMK group, but also the presence of alanine in the P1 position and the benzyloxycarbonyl group at the N-terminal. Dose–response studies showed that lower concentrations of z-FA-CMK induced apoptosis in Jurkat T cells whereas higher concentrations induced necrosis. In z-FA-CMK-induced apoptosis, both initiator caspases (-8 and -9) and effector caspases (-3, -6 and -7) were processed to their respective subunits in Jurkat T cells. However, only the pro-form of the initiator caspases were reduced in z-FA-CMK-induced necrosis and no respective subunits were apparent. The caspase inihibitor benzyloxycarbonyl-valine-alanine-aspartic acid-(O-methyl)-fluoromehylketone (z-VAD-FMK) inhibits apoptosis and caspase processing in Jurkat T cells treated with low concentration of z-FA-CMK but has no effect on z-FA-CMK-induced necrosis and the loss of initiator caspases. This suggests that the loss of initiator caspases in Jurkat T cells during z-FA-CMK-induced necrosis is not a caspase-dependent process. Taken together, we have demonstrated that z-FA-CMK is toxic to Jurkat T cells and induces apoptosis at low concentrations, while at higher concentrations the cells die of necrosis. - Highlights: • z-FA-CMK is toxic and induce cell death in the human T cells. • z-FA-CMK toxicity requires the CMK group, alanine and the benzyloxycarbonyl group. • z-FA-CMK induced apoptosis at low concentration and necrosis at high concentration.

  14. Purification and characterization of a proteinase from pineapple fruit, fruit bromelain FA2.

    PubMed

    Yamada, F; Takahashi, N; Murachi, T

    1976-06-01

    Fruit bromelain FA2, the main proteinase component of the juice of pineapple fruit, has been purified and characterized. 1. Efficient extraction of this enzyme from the crude material was possible using "Cellulosin AP," a microbial polysaccharidase preparation containing cellulase, hemicellulase, and pectinase. The enzyme was purified mainly by successive applications of anion-exchange chromatography, yielding an apparently homogeneous protein as judged by several physical, chemical, and immunochemical criteria. Properties of FA2 include: molecular weight, 31,000; isoelectric point, pH 4.6; absorbance at 280 nm of a 1% solution at pH 7.0 per cm, 19.2. 2. FA2 gave only alanine phenylthiohydantoin upon amino-terminal group analysis by the Edman procedure. Stepwise degradation yielded the amino-terminal sequence Ala-Val-Pro-Gln-Ser-Ile-Asp-Trp-Arg-Asp-Tyr-Gly-Ala. The amino acid composition of FA2 was not markedly different from that of stem bromelain, except for a much smaller lysine content and a smaller alanine content relative to glycine in FA2. FA2 contained neither amino sugars nor neutral carbohydrates as determined by several methods, so FA2 is not a glycoprotein. 3. By labeling the reactive cysteine residue (CYS) with [14C]iodoacetate, the following partial amino acid sequence has been determined. Asn-Glx-Asn-Pro-Cys-Gly-Ala-CYS.

  15. Thioacetic acid/NaSH-mediated synthesis of N-protected amino thioacids and their utility in peptide synthesis.

    PubMed

    Mali, Sachitanand M; Gopi, Hosahudya N

    2014-03-21

    Thioacids are recently gaining momentum due to their versatile reactivity. The reactivity of thioacids has been widely explored in the selective amide/peptide bond formation. Thioacids are generally synthesized from the reaction between activated carboxylic acids such as acid chlorides, active esters, etc., and Na2S, H2S, or NaSH. We sought to investigate whether the versatile reactivity of the thioacids can be tuned for the conversion of carboxylic acids into corresponding thioacids in the presence of NaSH. Herein, we report that thioacetic acid- and NaSH-mediated synthesis of N-protected amino thioacids from the corresponding N-protected amino acids, oxidative dimerization of thioacids, crystal conformations of thioacid oxidative dimers, and the utility of thioacids and oxidative dimers in peptide synthesis. Our results suggest that peptides can be synthesized without using standard coupling agents.

  16. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  17. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  18. Versatile Multicomponent Reaction Macrocycle Synthesis Using α-Isocyano-ω-carboxylic Acids.

    PubMed

    Liao, George P; Abdelraheem, Eman M M; Neochoritis, Constantinos G; Kurpiewska, Katarzyna; Kalinowska-Tłuścik, Justyna; McGowan, David C; Dömling, Alexander

    2015-10-16

    The direct macrocycle synthesis of α-isocyano-ω-carboxylic acids via an Ugi multicomponent reaction is introduced. This multicomponent reaction (MCR) protocol differs by being especially short, convergent, and versatile, giving access to 12-22 membered rings.

  19. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  20. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  1. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing.

    PubMed

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-21

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au(+) complexes, and then a class of ∼2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ∼1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au(+) complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe(3+) with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe(3+), and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs. PMID:26391420

  2. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  3. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  4. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement. PMID:21157681

  5. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed.

  6. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  7. Fluorine containing amino acids: synthesis and peptide coupling of amino acids containing the all-cis tetrafluorocyclohexyl motif.

    PubMed

    Ayoup, Mohammed Salah; Cordes, David B; Slawin, Alexandra M Z; O'Hagan, David

    2015-05-28

    A synthesis of two (S)-phenylalanine derivatives is described which have the all-cis, 2,3,5,6-tetrafluorocyclohexyl motif attached to the aromatic ring at the meta and para positions; the para substituted isomer is elaborated into illustrative dipeptides via the free amine and carboxylate respectively demonstrating its utility as a novel amino acid for peptide synthesis and offering a vehicle for incorporation of this unique and facially polarized ring system into bioactive compounds.

  8. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.

    PubMed

    Adhikari, Neil D; Bates, Philip D; Browse, John

    2016-05-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  9. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  10. Highly efficient procedure for the synthesis of fructone fragrance using a novel carbon based acid.

    PubMed

    Hu, Baowei; Li, Chunqing; Zhao, Sheng-Xian; Rong, Lin-Mei; Lv, Shao-Qin; Liang, Xuezheng; Qi, Chenze

    2010-08-01

    The novel carbon based acid has been synthesized via one-step hydrothermal carbonization of furaldehyde and hydroxyethylsulfonic acid. A highly efficient procedure for the synthesis of fructone has been developed using the novel carbon based acid. The results showed that the catalyst possessed high activity for the reaction, giving a yield of over 95%. The advantages of high activity, stability, reusability and low cost for a simple synthesis procedure and wide applicability to various diols and beta-keto esters make this novel carbon based acid one of the best choices for the reaction.

  11. The role of submarine hydrothermal systems in the synthesis of amino acids.

    PubMed

    Aubrey, A D; Cleaves, H J; Bada, Jeffrey L

    2009-04-01

    There is little consensus regarding the plausibility of organic synthesis in submarine hydrothermal systems (SHSs) and its possible relevance to the origin of life. The primary reason for the persistence of this debate is that most experimental high temperature and high-pressure organic synthesis studies have neglected important geochemical constraints with respect to source material composition. We report here the results of experiments exploring the potential for amino acid synthesis at high temperature from synthetic seawater solutions of varying composition. The synthesis of amino acids was examined as a function of temperature, heating time, starting material composition and concentration. Using very favorable reactant conditions (high concentrations of reactive, reduced species), small amounts of a limited set of amino acids are generated at moderate temperature conditions ( approximately 125-175 degrees C) over short heating times of a few days, but even these products are significantly decomposed after exposure times of approximately 1 week. The high concentration dependence observed for these synthetic reactions are demonstrated by the fact that a 10-fold drop in concentration results in orders of magnitude lower yields of amino acids. There may be other synthetic mechanisms not studied herein that merit investigation, but the results are likely to be similar. We conclude that although amino acids can be generated from simple likely environmentally available precursors under SHS conditions, the equilibrium at high temperatures characteristic of SHSs favors net amino acid degradation rather than synthesis, and that synthesis at lower temperatures may be more favorable. PMID:19034685

  12. Synthesis and characterization of Fatty acid/amino Acid self-assemblies.

    PubMed

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; Fray, Miroslawa El

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as "R" (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196-239 nm and critical micelle concentration (CMC) of 0.125-0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  13. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  14. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  15. Neutral lipid metabolism influences phospholipid synthesis and deacylation in Saccharomyces cerevisiae.

    PubMed

    Mora, Gabriel; Scharnewski, Michael; Fulda, Martin

    2012-01-01

    Establishment and maintenance of equilibrium in the fatty acid (FA) composition of phospholipids (PL) requires both regulation of the substrate available for PL synthesis (the acyl-CoA pool) and extensive PL turnover and acyl editing. In the present study, we utilize acyl-CoA synthetase (ACS) deficient cells, unable to recycle FA derived from lipid deacylation, to evaluate the role of several enzymatic activities in FA trafficking and PL homeostasis in Saccharomyces cerevisiae. The data presented show that phospholipases B are not contributing to constitutive PL deacylation and are therefore unlikely to be involved in PL remodeling. In contrast, the enzymes of neutral lipid (NL) synthesis and mobilization are central mediators of FA trafficking. The phospholipid:DAG acyltransferase (PDAT) Lro1p has a substantial effect on FA release and on PL equilibrium, emerging as an important mediator in PL remodeling. The acyl-CoA dependent biosynthetic activities of NL metabolism are also involved in PL homeostasis through active modulation of the substrate available for PL synthesis. In addition TAG mobilization makes an important contribution, especially in cells from stationary phase, to FA availability. Beyond its well-established role in the formation of a storage pool, NL metabolism could play a crucial role as a mechanism to uncouple the pools of PL and acyl-CoAs from each other and thereby to allow independent regulation of each one.

  16. Synthesis of amino-acid derivatives and dipeptides with an original peptidase enzyme.

    PubMed

    Auriol, D; Paul, F; Yoshpe, I; Gripon, J C; Monsan, P

    1991-01-01

    A peptidase from the non pathogenic Staphylococcus sp. strain BEC 299 was purified to a final specific activity of 84,400 U/mg protein. Its molecular weight is 450 kDa and optimum pH 10.0. This enzyme catalyzes the synthesis of dipeptides (aspartame) and alpha-amino acid derivatives (N-L-malyl-L-tyrosine ethyl ester). The influence of cosolvents and pH on dipeptides and alpha-amino acid derivative synthesis is described. Finally, we detail the use of the peptidase as a reagent in protease-catalyzed peptide synthesis.

  17. Both FA- and mPEG-conjugated chitosan nanoparticles for targeted cellular uptake and enhanced tumor tissue distribution

    NASA Astrophysics Data System (ADS)

    Hou, Zhenqing; Zhan, Chuanming; Jiang, Qiwei; Hu, Quan; Li, Le; Chang, Di; Yang, Xiangrui; Wang, Yixiao; Li, Yang; Ye, Shefang; Xie, Liya; Yi, Yunfeng; Zhang, Qiqing

    2011-10-01

    Both folic acid (FA)- and methoxypoly(ethylene glycol) (mPEG)-conjugated chitosan nanoparticles (NPs) had been designed for targeted and prolong anticancer drug delivery system. The chitosan NPs were prepared with combination of ionic gelation and chemical cross-linking method, followed by conjugation with both FA and mPEG, respectively. FA-mPEG-NPs were compared with either NPs or mPEG-/FA-NPs in terms of their size, targeting cellular efficiency and tumor tissue distribution. The specificity of the mPEG-FA-NPs targeting cancerous cells was demonstrated by comparative intracellular uptake of NPs and mPEG-/FA-NPs by human adenocarcinoma HeLa cells. Mitomycin C (MMC), as a model drug, was loaded to the mPEG-FA-NPs. Results show that the chitosan NPs presented a narrow-size distribution with an average diameter about 200 nm regardless of the type of functional group. In addition, MMC was easily loaded to the mPEG-FA-NPs with drug-loading content of 9.1%, and the drug releases were biphasic with an initial burst release, followed by a subsequent slower release. Laser confocal scanning imaging proved that both mPEG-FA-NPs and FA-NPs could greatly enhance uptake by HeLa cells. In vivo animal experiments, using a nude mice xenograft model, demonstrated that an increased amount of mPEG-FA-NPs or FA-NPs were accumulated in the tumor tissue relative to the mPEG-NPs or NPs alone. These results suggest that both FA- and mPEG-conjugated chitosan NPs are potentially prolonged drug delivery system for tumor cell-selective targeting treatments.

  18. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    NASA Astrophysics Data System (ADS)

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-01

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.

  19. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  20. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  1. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  2. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  3. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition.

  4. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  5. Size control in the synthesis of 1-6 nm gold nanoparticles using folic acid-chitosan conjugate as a stabilizer

    NASA Astrophysics Data System (ADS)

    Liu, Lili; Zhang, Xianwen; Chaudhuri, Jharna

    2014-09-01

    We report a simple and practical method for the preparation of folic acid (FA)-chitosan functionalized gold nanoparticles (AuNPs) with a very small size (1-6 nm). Sodium borohydride was used as a reducing agent. The size of the AuNPs was controlled by adjusting the mass fraction of FA-chitosan conjugate to Au. The AuNPs were characterized using UV-vis spectroscopy and transmission electron microscopy (TEM). The results indicated that the size distribution of AuNPs decreased ranging from 6 nm to 1 nm with increasing the fraction of FA-chitosan conjugate in the reaction systems.

  6. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  7. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  8. Synthesis of Long Chain Unsaturated-alpha,omega-Dicarboxylic Acids from Renewable Materials via Olefin Metathesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The self-metathesis reaction of soy, rapeseed, tall, and linseed oil fatty acids was investigated for the synthesis of symmetrical long-chain unsaturated-alpha,omega-dicarboxylic acids. The metathesis reactions were carried out in the presence of a Grubbs catalyst under solvent-free conditions at a...

  9. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.

    PubMed

    van Ameijde, Jeroen; Liskamp, Rob M J

    2003-08-01

    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  10. Synthesis and antibacterial evaluation of anziaic acid and analogues as topoisomerase I inhibitors

    PubMed Central

    Lin, Hao; Annamalai, Thirunavukkarasu; Bansod, Priyanka; Tse-Dinh, Yuk-Ching

    2013-01-01

    Naturally occurring anziaic acid was very recently reported as a topoisomerase I inhibitor with antibacterial activity. Herein total synthesis of anziaic acid and structural analogues is described and the preliminary structure-activity relationship (SAR) has been developed based on topoisomerase inhibition and whole cell antibacterial activity. PMID:24363888

  11. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  12. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective.

  13. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  14. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  15. Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

    PubMed

    Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

    2015-01-01

    We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

  16. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  17. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity. PMID:23230650

  18. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  19. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  20. GPM Video of In-fa

    NASA Video Gallery

    On Nov. 23, GPM saw In-fa dropping rain at an extreme rate of over 266 mm (10.5 inches) per hour in storms just to the northwest of the typhoon's eye where thunderstorms reached altitudes of over 1...

  1. De novo synthesis of amino acids by the ruminal anaerobic fungi, Piromyces communis and Neocallimastix frontalis.

    PubMed

    Atasoglu, Cengiz; Wallace, R John

    2002-07-01

    Anaerobic fungi are an important component of the cellulolytic ruminal microflora. Ammonia alone as N source supports growth, but amino acid mixtures are stimulatory. In order to evaluate the extent of de novo synthesis of individual amino acids in Piromyces communis and Neocallimastix frontalis, isotope enrichment in amino acids was determined during growth on (15)NH(4)Cl in different media. Most cell N (0.78 and 0.63 for P. communis and N. frontalis, respectively) and amino acid N (0.73 and 0.59) continued to be formed de novo from ammonia when 1 g l(-1) trypticase was added to the medium; this concentration approximates the peak concentration of peptides in the rumen after feeding. Higher peptide/amino acid concentrations decreased de novo synthesis. Lysine was exceptional, in that its synthesis decreased much more than other amino acids when Trypticase or amino acids were added to the medium, suggesting that lysine synthesis might limit fungal growth in the rumen.

  2. Synthesis and optical resolution of an allenoic acid by diastereomeric salt formation induced by chiral alkaloids.

    PubMed

    Nyhlén, Jonas; Eriksson, Lars; Bäckvall, Jan-E

    2008-01-01

    A synthetic procedure for the preparation of 4-cyclohexyl-2-methyl-buta-2,3-dienoic acid in the two optically active forms has been developed. Synthesis of the racemic allenoic acid was made by an efficient route with good overall yield. Resolution of the enantiomers was achieved by forming the cinchonidine and cinchonine diastereomeric salt, respectively, and the enantiomers were isolated in up to 95% enantiomeric excess. The absolute configuration of the allenoic acid was determined by X-ray crystallography.

  3. Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.

    PubMed

    Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra

    2016-09-01

    α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.

  4. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi

    2009-01-01

    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  5. Castor phospholipid:diacylglycerol acyltransferase facilitates efficient metabolism of hydroxy fatty acids in transgenic Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Producing unusual fatty acids (FAs) in crop plants has been a long-standing goal of green chemistry. However, expression of the enzymes that catalyze the primary synthesis of these unusual FAs in transgenic plants typically results in low levels of the desired FA. For example, seed-specific expressi...

  6. Direct microwave-assisted amino acid synthesis by reaction of succinic acid and ammonia in the presence of magnetite

    NASA Astrophysics Data System (ADS)

    Jiang, Nan; Liu, Dandan; Shi, Weiguang; Hua, Yingjie; Wang, Chongtai; Liu, Xiaoyang

    2013-10-01

    Since the discovery of submarine hot vents in the late 1970s, it has been postulated that submarine hydrothermal environments would be suitable for emergence of life on Earth. To simulate warm spring conditions, we designed a series of microwave-assisted amino acid synthesis involving direct reactions between succinic acid and ammonia in the presence of the magnetite catalyst. These reactions which generated aspartic acid and glycine were carried out under mild temperatures and pressures (90-180 °C, 4-19 bar). We studied this specific reaction inasmuch as succinic acid and ammonia were traditionally identified as prebiotic compounds in primitive deep-sea hydrothermal systems on Earth. The experimental results were discussed in both biochemical and geochemical context to offer a possible route for abiotic amino acid synthesis. With extremely diluted starting materials (0.002 M carboxylic acid and 0.002 M ammonia) and catalyst loading, an obvious temperature dependency was observed in both cases [neither product was detected at 90 °C in comparison with 21.08 μmol L-1 (aspartic acid) and 70.25 umol L-1 (glycine) in 180 °C]. However, an opposite trend presented for reaction time factor, namely a positive correlation for glycine, but a negative one for aspartic acid.

  7. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.

    2008-01-01

    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  8. Effect of omega-3 fatty acids on the modification of erythrocyte membrane fatty acid content including oleic acid in peritoneal dialysis patients.

    PubMed

    An, W S; Lee, S M; Son, Y K; Kim, S E; Kim, K H; Han, J Y; Bae, H R; Park, Y

    2012-01-01

    Erythrocyte membrane fatty acids (FA), such as oleic acid, are related to acute coronary syndrome. There is no report about the effect of omega-3 FA on oleic acid in peritoneal dialysis (PD) patients. We hypothesized that omega-3 FA can modify erythrocyte membrane FA, including oleic acid, in PD patients. In a double-blind, randomized, placebo-controlled study, 18 patients who were treated with PD for at least 6 months were randomized to treatment for 12 weeks with omega-3 FA or placebo. Erythrocyte membrane FA content was measured by gas chromatography at baseline and after 12 weeks. The erythrocyte membrane content of eicosapentaenoic acid and docosahexaenoic acid was significantly increased and saturated FA and oleic acid were significantly decreased in the omega-3 FA supplementation group after 12 weeks compared to baseline. In conclusion, erythrocyte membrane FA content, including oleic acid, was significantly modified by omega-3 FA supplementation for 12 weeks in PD patients.

  9. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-05-17

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids.

  10. Visible-light photoredox synthesis of unnatural chiral α-amino acids

    PubMed Central

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  11. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  12. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  13. Gene networks driving bovine milk fat synthesis during the lactation cycle

    PubMed Central

    Bionaz, Massimo; Loor, Juan J

    2008-01-01

    Background The molecular events associated with regulation of milk fat synthesis in the bovine mammary gland remain largely unknown. Our objective was to study mammary tissue mRNA expression via quantitative PCR of 45 genes associated with lipid synthesis (triacylglycerol and phospholipids) and secretion from the late pre-partum/non-lactating period through the end of subsequent lactation. mRNA expression was coupled with milk fatty acid (FA) composition and calculated indexes of FA desaturation and de novo synthesis by the mammary gland. Results Marked up-regulation and/or % relative mRNA abundance during lactation were observed for genes associated with mammary FA uptake from blood (LPL, CD36), intracellular FA trafficking (FABP3), long-chain (ACSL1) and short-chain (ACSS2) intracellular FA activation, de novo FA synthesis (ACACA, FASN), desaturation (SCD, FADS1), triacylglycerol synthesis (AGPAT6, GPAM, LPIN1), lipid droplet formation (BTN1A1, XDH), ketone body utilization (BDH1), and transcription regulation (INSIG1, PPARG, PPARGC1A). Change in SREBF1 mRNA expression during lactation, thought to be central for milk fat synthesis regulation, was ≤2-fold in magnitude, while expression of INSIG1, which negatively regulates SREBP activation, was >12-fold and had a parallel pattern of expression to PPARGC1A. Genes involved in phospholipid synthesis had moderate up-regulation in expression and % relative mRNA abundance. The mRNA abundance and up-regulation in expression of ABCG2 during lactation was markedly high, suggesting a biological role of this gene in milk synthesis/secretion. Weak correlations were observed between both milk FA composition and desaturase indexes (i.e., apparent SCD activity) with mRNA expression pattern of genes measured. Conclusion A network of genes participates in coordinating milk fat synthesis and secretion. Results challenge the proposal that SREBF1 is central for milk fat synthesis regulation and highlight a pivotal role for a

  14. Wavelength dependence of mycosporine-like amino acid synthesis in Gyrodinium dorsum.

    PubMed

    Klisch, M; Häder, D-P

    2002-02-01

    The synthesis or accumulation of mycosporine-like amino acids (MAAs) is an important UV tolerance mechanism in aquatic organisms. To investigate the wavelength dependence of MAA synthesis in the marine dinoflagellate Gyrodinium dorsum, the organism was exposed to polychromatic radiation (PAR and UV) from a solar simulator for up to 72 h. Different irradiance spectra were produced by inserting various cut-off filters between lamp and samples. A polychromatic action spectrum for the synthesis of MAA synthesis was constructed. PAR and long wavelength UV-A radiation showed almost no effect while the most effective wavelength range was around 310 nm. Shorter wavelengths where less effective in the induction of MAA synthesis. Wavelengths below 300 nm damaged the organisms severely as indicated by a decrease in chlorophyll a absorption.

  15. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  16. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    SciTech Connect

    Junker, L.H.; Davis, R.A. )

    1989-12-01

    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of (14C)cholesterol from (2-14C)acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of (14C)cholesterol from (2-14C)acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis.

  17. Approach to Merosesquiterpenes via Lewis Acid Catalyzed Nazarov-Type Cyclization: Total Synthesis of Akaol A.

    PubMed

    Kakde, Badrinath N; Kumar, Nivesh; Mondal, Pradip Kumar; Bisai, Alakesh

    2016-04-15

    A Lewis acid catalyzed Nazarov-type cyclization of arylvinylcarbinol has been developed for the asymmetric synthesis of carbotetracyclic core of merosesquiterpenes. The reaction works only in the presence of 2 mol % of Sn(OTf)2 and Bi(OTf)3 in dichloroethane under elevated temperature. The methodology offers the synthesis of a variety of enantioenriched arylvinylcarbinols from commercially available (3aR)-sclareolide 9 in six steps with an eventual concise total synthesis of marine sesquiterpene quinol, akaol A (1a). PMID:27028314

  18. Retinoic acid response element in the human alcohol dehydrogenase gene ADH3: implications for regulation of retinoic acid synthesis.

    PubMed Central

    Duester, G; Shean, M L; McBride, M S; Stewart, M J

    1991-01-01

    Retinoic acid regulation of one member of the human class I alcohol dehydrogenase (ADH) gene family was demonstrated, suggesting that the retinol dehydrogenase function of ADH may play a regulatory role in the biosynthetic pathway for retinoic acid. Promoter activity of human ADH3, but not ADH1 or ADH2, was shown to be activated by retinoic acid in transient transfection assays of Hep3B human hepatoma cells. Deletion mapping experiments identified a region in the ADH3 promoter located between -328 and -272 bp which confers retinoic acid activation. This region was also demonstrated to confer retinoic acid responsiveness on the ADH1 and ADH2 genes in heterologous promoter fusions. Within a 34-bp stretch, the ADH3 retinoic acid response element (RARE) contains two TGACC motifs and one TGAAC motif, both of which exist in RAREs controlling other genes. A block mutation of the TGACC sequence located at -289 to -285 bp eliminated the retinoic acid response. As assayed by gel shift DNA binding studies, the RARE region (-328 to -272 bp) of ADH3 bound the human retinoic acid receptor beta (RAR beta) and was competed for by DNA containing a RARE present in the gene encoding RAR beta. Since ADH catalyzes the conversion of retinol to retinal, which can be further converted to retinoic acid by aldehyde dehydrogenase, these results suggest that retinoic acid activation of ADH3 constitutes a positive feedback loop regulating retinoic acid synthesis. Images PMID:1996113

  19. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  20. Solvent-free lipase-catalyzed synthesis of a novel hydroxyl-fatty acid derivative of kojic acid.

    PubMed

    El-Boulifi, Noureddin; Ashari, Siti Efliza; Serrano, Marta; Aracil, Jose; Martínez, Mercedes

    2014-02-01

    The aim of this work was the synthesis of a novel hydroxyl-fatty acid derivative of kojic acid rich in kojic acid monoricinoleate (KMR) which can be widely used in the cosmetic and food industry. The synthesis of KMR was carried out by lipase-catalysed esterification of ricinoleic and kojic acids in solvent-free system. Three immobilized lipases were tested and the best KMR yields were attained with Lipozyme TL IM and Novozym 435. Since Lipozyme TL IM is the cheapest, it was selected to optimize the reaction conditions. The optimal reaction conditions were 80 °C for the temperature, 1:1 for the alcohol/acid molar ratio, 600 rpm for stirring speed and 7.8% for the catalyst concentration. Under these conditions, the reaction was scaled up in a 5×10⁻³ m³ stirred tank reactor. ¹H-¹³C HMBC-NMR showed that the primary hydroxyl group of kojic acid was regioselectively esterified. The KMR has more lipophilicity than kojic acid and showed antioxidant activity that improves the oxidation stability of biodiesel.

  1. Cooperative Synthesis of Ultra Long-Chain Fatty Acid and Ceramide during Keratinocyte Differentiation

    PubMed Central

    Mizutani, Yukiko; Sun, Hui; Ohno, Yusuke; Sassa, Takayuki; Wakashima, Takeshi; Obara, Mari; Yuyama, Kohei; Kihara, Akio; Igarashi, Yasuyuki

    2013-01-01

    The lipid lamellae in the stratum corneum is important for the epidermal permeability barrier. The lipid lamellae component ceramide (CER), comprising an ultra long-chain (ULC) fatty acid (FA) of ≥26 carbons (ULC CER), plays an essential role in barrier formation. ULC acyl-CoAs, produced by the FA elongase ELOVL4, are converted to ULC CERs by the CER synthase CERS3. In the presented study, we observed that ELOVL4 and CERS3 mRNAs increased during keratinocyte differentiation in vivo and in vitro. We also determined that peroxisome proliferator-activated receptor β/δ is involved in the up-regulation of the mRNAs. Knockdown of CERS3 caused a reduction in the elongase activities toward ULC acyl-CoAs, suggesting that CERS3 positively regulates ULCFA. Thus, we reveal that the two key players in ULC CER production in epidermis, CERS3 and ELOVL4, are coordinately regulated at both the transcriptional and enzymatic levels. PMID:23826266

  2. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.

    PubMed

    Qi, Zisong; Wang, Mei; Li, Xingwei

    2014-09-01

    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  3. Synthesis of Hydroxymethylenebisphosphonic Acid Derivatives in Different Solvents.

    PubMed

    Nagy, Dávid Illés; Grün, Alajos; Garadnay, Sándor; Greiner, István; Keglevich, György

    2016-01-01

    The syntheses of hydroxymethylenebisphosphonic acid derivatives (dronic acid derivatives) starting from the corresponding substituted acetic acids and P-reagents, mainly phosphorus trichloride and phosphorous acid are surveyed according to the solvents applied. The nature of the solvent is a critical point due to the heterogeneity of the reaction mixtures. This review sheds light on the optimum choice and ratio of the P-reactants, and on the optimum conditions. PMID:27529200

  4. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  5. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  6. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  7. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  8. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  9. Selenium Catalyzed Oxidation of Aldehydes: Green Synthesis of Carboxylic Acids and Esters.

    PubMed

    Sancineto, Luca; Tidei, Caterina; Bagnoli, Luana; Marini, Francesca; Lenardão, Eder J; Santi, Claudio

    2015-01-01

    The stoichiometric use of hydrogen peroxide in the presence of a selenium-containing catalyst in water is here reported as a new ecofriendly protocol for the synthesis of variously functionalized carboxylic acids and esters. The method affords the desired products in good to excellent yields under very mild conditions starting directly from commercially available aldehydes. Using benzaldehyde as a prototype the gram scale synthesis of benzoic acid is described, in which the aqueous medium and the catalyst could be recycled at last five times while achieving an 87% overall yield.

  10. Communic acids: occurrence, properties and use as chirons for the synthesis of bioactive compounds.

    PubMed

    Barrero, Alejandro F; Herrador, M Mar; Arteaga, Pilar; Arteaga, Jesús F; Arteaga, Alejandro F

    2012-01-01

    Communic acids are diterpenes with labdane skeletons found in many plant species, mainly conifers, predominating in the genus Juniperus (fam. Cupresaceae). In this review we briefly describe their distribution and different biological activities (anti- bacterial, antitumoral, hypolipidemic, relaxing smooth muscle, etc.). This paper also includes a detailed explanation of their use as chiral building blocks for the synthesis of bioactive natural products. Among other uses, communic acids have proven useful as chirons for the synthesis of quassinoids (formal), abietane antioxidants, ambrox and other perfume fixatives, podolactone herbicides, etc., featuring shorter and more efficient processes.

  11. Measurement of Microbial Activity and Growth in the Ocean by Rates of Stable Ribonucleic Acid Synthesis

    PubMed Central

    Karl, David M.

    1979-01-01

    A relatively simple and extremely sensitive technique for measuring rates of stable ribonucleic acid (RNA) synthesis was devised and applied to bacterial cultures and seawater samples. The procedure is based upon the uptake and incorporation of exogenous radiolabeled adenine into cellular RNA. To calculate absolute rates of synthesis, measurements of the specific radioactivity of the intracellular adenosine 5′-triphosphate pools (precursor to RNA) and of the total amount of radioactivity incorporated into stable cellular RNA per unit time are required. Since the rate of RNA synthesis is positively correlated with growth rate, measurements of RNA synthesis should be extremely useful for estimating and comparing the productivities of microbial assemblages in nature. Adenosine 5′-triphosphate, adenylate energy charge, and rates of stable RNA synthesis have been measured at a station located in the Columbian Basin of the Caribbean Sea. A subsurface peak in RNA synthesis (and therefore growth) was located within the dissolved oxygen minimum zone (450 m), suggesting in situ microbiological utilization of dissolved molecular oxygen. Calculations of the specific rates of RNA synthesis (i.e., RNA synthesis per unit of biomass) revealed that the middepth maximum corresponded to the highest specific rate of growth (420 pmol of adenine incorporated into RNA·day−1) of all depths sampled, including the euphotic zone. The existence of an intermediate depth zone of active microbial growth may be an important site for nutrient regeneration and may serve as a source of reduced carbon for mesopelagic and deep sea environments. PMID:16345461

  12. Integrated acid mine drainage management using fly ash.

    PubMed

    Vadapalli, Viswanath R K; Gitari, Mugera W; Petrik, Leslie F; Etchebers, Olivier; Ellendt, Annabelle

    2012-01-01

    Fly Ash (FA) from a power station in South Africa was investigated to neutralise and remove contaminants from Acid Mine Drainage (AMD). After this primary treatment the insoluble FA residue namely solid residue (SR) was investigated as a suitable mine backfill material by means of strength testing. Moreover, SR was used to synthesise zeolite-P using a two-step synthesis procedure. Furthermore, the zeolite-P was investigated to polish process water from the primary FA-AMD reaction. The main objective of this series of investigations is to achieve zero waste and to propose an integrated AMD management using FA. Fly Ash was mixed with AMD at various predetermined FA-AMD ratios until the mixtures achieved circumneutral pH or higher. The supernatants were then analyzed using Inductively Coupled Plasma Mass Spectrometry (ICP-MS) and Ion Chromatography (IC) for cations and anions respectively. The physical strength testing of SR was carried out by mixing it with 3% Ordinary Portland Cement (OPC) and curing for 410 days. Synthesis of zeolite-P using SR was carried out by two step synthesis procedure: ageing for 24 hours followed by a mild hydrothermal synthesis at 100°C for 4 days. The polishing of process water from primary AMD treatment using FA was ascertained by mixing the process water with zeolite at a liquid to solid ratio of 100:1 for 1 hour. The results indicated that FA can be successfully used to ameliorate AMD. High removal of major AMD contaminants Fe, Al, Mg, Mn and sulphate was achieved with the ash treatment and trace elements such as Zn, Ni, Cu and Pb were also removed by the FA. Strength testing over 410 days indicated that the material gained strength over the testing period. The maximum unconfined compressive strength and elastic modulus was observed to be approximately 0.3 MPa and 150 Mpa respectively. The X-ray diffraction (XRD) analysis of the synthesized product indicated that SR was successfully converted into zeolite-P with some mullite phase

  13. Squaric acid ester-based total synthesis of echinochrome A.

    PubMed

    Peña-Cabrera, Eduardo; Liebeskind, Lanny S

    2002-03-01

    The total synthesis of echinochrome A is described. Both key intermediates 5 and 8 were efficiently prepared from diisopropyl squarate 7. Nucleophilic addition of aryllithium 8 to 5, followed by thermal ring-expansion/cyclization of the 1,2-adduct 4, furnished hydroquinone 3. Oxidation and full deprotection of 3 gave the title compound.

  14. MAFG is a transcriptional repressor of bile acid synthesis and metabolism.

    PubMed

    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Ahn, Hannah; Hagey, Lee R; Romanoski, Casey E; Lee, Richard G; Graham, Mark J; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A

    2015-02-01

    Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis, and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG(+/-) mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR.

  15. MAFG Is a Transcriptional Repressor of Bile Acid Synthesis and Metabolism

    PubMed Central

    de Aguiar Vallim, Thomas Q.; Tarling, Elizabeth J.; Ahn, Hannah; Hagey, Lee R.; Romanoski, Casey E.; Lee, Richard G.; Graham, Mark J.; Motohashi, Hozumi; Yamamoto, Masayuki; Edwards, Peter A.

    2015-01-01

    Summary Specific bile acids are potent signaling molecules that modulate metabolic pathways affecting lipid, glucose and bile acid homeostasis and the microbiota. Bile acids are synthesized from cholesterol in the liver, and the key enzymes involved in bile acid synthesis (Cyp7a1, Cyp8b1) are regulated transcriptionally by the nuclear receptor FXR. We have identified an FXR-regulated pathway upstream of a transcriptional repressor that controls multiple bile acid metabolism genes. We identify MafG as an FXR target gene and show that hepatic MAFG overexpression represses genes of the bile acid synthetic pathway, and modifies the biliary bile acid composition. In contrast, loss-of-function studies using MafG+/− mice causes de-repression of the same genes with concordant changes in biliary bile acid levels. Finally, we identify functional MafG response elements in bile acid metabolism genes using ChIP-Seq analysis. Our studies identify a molecular mechanism for the complex feedback regulation of bile acid synthesis controlled by FXR. PMID:25651182

  16. Racemic synthesis and solid phase peptide synthesis application of the chimeric valine/leucine derivative 2-amino-3,3,4-trimethyl-pentanoic acid.

    PubMed

    Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R

    2014-07-01

    The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.

  17. A Nitrogen-Assisted One-Pot Heteroaryl Ketone Synthesis from Carboxylic Acids and Heteroaryl Halides.

    PubMed

    Demkiw, Krystyna; Araki, Hirofumi; Elliott, Eric L; Franklin, Christopher L; Fukuzumi, Yoonjoo; Hicks, Frederick; Hosoi, Kazushi; Hukui, Tadashi; Ishimaru, Yoichiro; O'Brien, Erin; Omori, Yoshimasa; Mineno, Masahiro; Mizufune, Hideya; Sawada, Naotaka; Sawai, Yasuhiro; Zhu, Lei

    2016-04-15

    A practical and highly effective one-pot synthesis of versatile heteroaryl ketones directly from carboxylic acids and heteroaryl halides under mild conditions is reported. This method does not require derivatization of carboxylic acids (preparation of acid chlorides, Weinreb amides, etc.) or the use of any additives/catalysts. A wide substrate scope of carboxylic acids with high functional group tolerance has also been demonstrated. The results reveal that the presence of an α-nitrogen on the halide substrate greatly improves the desired ketone formation.

  18. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  19. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials. PMID:27482849

  20. Bacterial synthesis of polysialic acid lactosides in recombinant Escherichia coli K-12.

    PubMed

    Richard, Emeline; Buon, Laurine; Drouillard, Sophie; Fort, Sébastien; Priem, Bernard

    2016-07-01

    Bacterial polysialyltransferases (PSTs) are processive enzymes involved in the synthesis of polysialic capsular polysaccharides. They can also synthesize polysialic acid in vitro from disialylated and trisialylated lactoside acceptors, which are the carbohydrate moieties of GD3 and GT3 gangliosides, respectively. Here, we engineered a non-pathogenic Escherichia coli strain that overexpresses recombinant sialyltransferases and sialic acid synthesis genes and can convert an exogenous lactoside into polysialyl lactosides. Several PSTs were assayed for their ability to synthesize polysialyl lactosides in the recombinant strains. Fed-batch cultures produced α-2,8 polysialic acid or alternate α-2,8-2,9 polysialic acid in quantities reaching several grams per liter. Bacterial culture in the presence of propargyl-β-lactoside as the exogenous acceptor led to the production of conjugatable polysaccharides by means of copper-assisted click chemistry. PMID:26927318

  1. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials.

  2. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  3. Polymers from fatty acids: poly(ω-hydroxyl tetradecanoic acid) synthesis and physico-mechanical studies.

    PubMed

    Liu, Chen; Liu, Fei; Cai, Jiali; Xie, Wenchun; Long, Timothy E; Turner, S Richard; Lyons, Alan; Gross, Richard A

    2011-09-12

    This Article describes the synthesis and physicomechanical properties of bioplastics prepared from methyl ω-hydroxytetradecanoic acid (Me-ω-OHC14), a new monomer available by a fermentation process using an engineered Candida tropicalis strain. Melt-condensation experiments were conducted using titanium tetraisopropoxide (Ti[OiPr](4)) as a catalyst in a two-stage polymerization (2 h at 200 °C under N(2), 4 h at 220 °C under 0.1 mmHg). Poly(ω-hydroxytetradecanoate), P(ω-OHC14), M(w), determined by SEC-MALLS, increased from 53K to 110K as the Ti(OiPr)(4) concentration increased from 50 to 300 ppm. By varying the polymerization conditions (catalyst concentration, reaction time, second-stage reaction temperature) a series of P(ω-OHC14) samples were prepared with M(w) values from 53K to 140K. The synthesized polyesters with M(w) ranging from 53K to 140K were subjected to characterization by DSC, TGA, DMTA, and tensile testing. Influences of P(ω-OHC14) molecular weight, melting point, and enthalpies of melting/crystallization on material tensile properties were explored. Cold-drawing tensile tests at room temperature for P(ω-OHC14) with M(w) 53K-78K showed a brittle-to-ductile transition. In contrast, P(ω-OHC14) with M(w) 53K undergoes brittle fracture. Increasing P(ω-OHC14) M(w) above 78K resulted in a strain-hardening phenomena and tough properties with elongation at break ~700% and true tensile strength of ~50 MPa. Comparisons between high density polyethylene and P(ω-OHC14) mechanical and thermal properties as a function of their respective molecular weights are discussed. PMID:21793591

  4. [Synthesis, characterization and application of polyglycerols and polyglycerol fatty acid esters].

    PubMed

    Behrens, H; Mieth, G

    1984-01-01

    The current state of knowledge in the field of synthesis and properties of polyglycerols and polyglycerol fatty acid esters is presented. Alternatives for the analytical characterization of these families by means of physico-chemical methods, with special reference to chromatography and spectroscopy, are described. Furthermore, the use of polyglycerol fatty acid esters as food additives is considered from the view-points of the physiology of nutrition and of processing technology.

  5. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  6. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  7. Novel enzymatic synthesis of 4-O-cinnamoyl quinic and shikimic acid derivatives.

    PubMed

    Armesto, Nuria; Ferrero, Miguel; Fernández, Susana; Gotor, Vicente

    2003-07-11

    The first direct synthesis of 4-O-cinnamoyl derivatives of quinic and shikimic acids were accomplished by regioselective esterification with Candida antarctica lipase A. For hydrocinnamic esters, enzymatic transesterification with vinyl esters gave excellent yields. However, more reactive acylating agents such as anhydrides were used to synthesize cinnamic derivatives of both acids. An inhibitory effect was observed with this lipase for p-methoxy, p-hydroxy, and p-acetoxy vinyl ester and anhydride derivatives (coumarate and ferulate derivatives).

  8. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  9. Differential regulation of protein synthesis by amino acids and insulin in peripheral and visceral tissues of neonatal pigs.

    PubMed

    Suryawan, Agus; O'Connor, Pamela M J; Bush, Jill A; Nguyen, Hanh V; Davis, Teresa A

    2009-05-01

    The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose-amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8-12/group) with insulin at 0, 10, 22, and 110 ng kg(-0.66) min(-1) to achieve approximately 0, 2, 6 and 30 muU ml(-1) insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L: -[4-(3)H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids.

  10. Mutation affecting regulation of synthesis of acetohydroxy acid synthetase in Escherichia coli K-12.

    PubMed Central

    Jackson, J H; Henderson, E K

    1975-01-01

    Altered regulation of synthesis of acetohydroxy acid synthetase (AHAS) was previously reported in a mutant of Escherichia coli strain K-12. The mutant strain, growing in minimal medium, exhibits a partial growth limiatation and derepression of AHAS, owing to deficient synthesis of isoleucine. The genetic lesion (ilvE503) causing the isoleucine limitation was shown to cause derepression of a valine-sensitive AHAS activity. The derepression effect of the ilvE503 mutation upon synthesis of AHAS was conclusively demonstrated by introducing both the ilvE503 allele and an altered AHAS (ilv-521) into the same cell. Evidence is presented that suggests the presence of multiple genetic regions for synthesis and control of the valine-sensitive AHAS activity. PMID:1089632

  11. Asymmetric synthesis of aromatic β-amino acids using ω-transaminase: Optimizing the lipase concentration to obtain thermodynamically unstable β-keto acids.

    PubMed

    Mathew, Sam; Jeong, Seong-Su; Chung, Taeowan; Lee, Sang-Hyeup; Yun, Hyungdon

    2016-01-01

    Synthesized aromatic β-amino acids have recently attracted considerable attention for their application as precursors in many pharmacologically relevant compounds. Previous studies on asymmetric synthesis of aromatic β-amino acids using ω-transaminases could not be done efficiently due to the instability of β-keto acids. In this study, a strategy to circumvent the instability problem of β-keto acids was utilized to generate β-amino acids efficiently via asymmetric synthesis. In this work, thermodynamically stable β-ketoesters were initially converted to β-keto acids using lipase, and the β-keto acids were subsequently aminated using ω-transaminase. By optimizing the lipase concentration, we successfully overcame the instability problem of β-keto acids and enhanced the production of β-amino acids. This strategy can be used as a general approach to efficiently generate β-amino acids from β-ketoesters.

  12. Oxidative allylic rearrangement of cycloalkenols: Formal total synthesis of enantiomerically pure trisporic acid B

    PubMed Central

    Dubberke, Silke; Abbas, Muhammad

    2011-01-01

    Summary Enantiomerically highly enriched unsaturated β-ketoesters bearing a quaternary stereocenter can be utilized as building blocks for the synthesis of natural occurring terpenes, i. a., trisporic acid and its derivatives. An advanced building block has been synthesized in a short reaction sequence, which involves an oxidative allylic rearrangement initiated by pyridinium dichromate (PDC) as the key step. PMID:21512603

  13. An Overview of Stereoselective Synthesis of α-Aminophosphonic Acids and Derivatives

    PubMed Central

    Ordóñez, Mario; Rojas-Cabrera, Haydée; Cativiela, Carlos

    2009-01-01

    An overview of all methodologies published during the last few years focused to the stereoselective (diastereoselective or enantioselective) synthesis of α-aminophosphonic acids and derivatives is reported. The procedures have been classified according a retrosynthetic strategy and taking into account the formation of each one of the bonds connected to the chiral centre. PMID:20871799

  14. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  15. o-Iodoxybenzoic acid mediated oxidative desulfurization initiated domino reactions for synthesis of azoles.

    PubMed

    Chaudhari, Pramod S; Pathare, Sagar P; Akamanchi, Krishnacharaya G

    2012-04-20

    A systematic exploration of thiophilic ability of o-iodoxybenzoic acid (IBX) for oxidative desulfurization to trigger domino reactions leading to new methodologies for synthesis of different azoles is described. A variety of highly substituted oxadiazoles, thiadiazoles, triazoles, and tetrazoles have been successfully synthesized in good to excellent yields, starting from readily accessible thiosemicarbazides, bis-diarylthiourea, 1,3-disubtituted thiourea, and thioamides.

  16. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  17. Efficient Enantioselective Synthesis of Oxahelicenes Using Redox/Acid Cooperative Catalysts.

    PubMed

    Sako, Makoto; Takeuchi, Yoshiki; Tsujihara, Tetsuya; Kodera, Junpei; Kawano, Tomikazu; Takizawa, Shinobu; Sasai, Hiroaki

    2016-09-14

    An efficient and enantioselective synthesis of oxa[9]helicenes has been established via vanadium(V)-catalyzed oxidative coupling/intramolecular cyclization of polycyclic phenols. A newly developed vanadium complex cooperatively functions as both a redox and Lewis acid catalyst to promote the present sequential reaction and afford oxa[9]helicenes in good yields with up to 94% ee. PMID:27574874

  18. Insulin and amino acids stimulate whole body protein synthesis in neonates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Insulin and amino acids (AA) stimulate muscle protein synthesis in neonatal pigs. To determine the effects of insulin and AA on whole body protein turnover, hyperinsulinemic (0 and 100 ng/(kg[0.66]/min))-euglycemic-AA clamps were performed during euaminoacidemia or hyperaminoacidemia in fasted 7-d-...

  19. Veterinary Medicine and Omics (Veterinomics): Metabolic Transition of Milk Triacylglycerol Synthesis in Sows from Late Pregnancy to Lactation.

    PubMed

    Lv, Yantao; Guan, Wutai; Qiao, Hanzhen; Wang, Chaoxian; Chen, Fang; Zhang, Yinzhi; Liao, Zhichao

    2015-10-01

    Mammalian milk is a key source of lipids, providing not only important calories but also essential fatty acids. Veterinary medicine and omics systems sciences intersection, termed as "veterinomics" here, has received little attention to date but stands to offer much promise for building bridges between human and animal health. We determined the changes in porcine mammary genes and proteomics expression associated with milk triacylglycerol (TAG) synthesis and secretion from late pregnancy to lactation. TAG content and fatty acid (FA) composition were determined in porcine colostrum (the 1st day of lactation) and milk (the 17th day of lactation). The mammary transcriptome for 70 genes and 13 proteins involved in TAG synthesis and secretion from six sows, each at d -17(late pregnancy), d 1(early lactation), and d 17 (peak lactation) relative to parturition were analyzed using quantitative real-time PCR and Western blot analyses. The TAG content and the concentrations of de novo synthesized FAs, saturated FAs, and monounsaturated FAs were higher in milk than in colostrum (p<0.05). Robust upregulation with high relative mRNA abundance was evident during lactation for genes associated with FA uptake (VLDLR, LPL, CD36), FA activation (ACSS2, ACSL3), and intracellar transport (FABP3), de novo FA synthesis (ACACA, FASN), FA elongation (ELOVL1), FA desaturation (SCD, FADS1), TAG synthesis (GPAM, AGPAT1, LPIN1, DGAT1), lipid droplet formation (BTN2A1, XDH, PLIN2), and transcription factors and nuclear receptors (SREBP1, SCAP, INSIG1/2). In conclusion, a wide variety of lipogenic genes and proteins regulate the channeling of FAs towards milk TAG synthesis and secretion in porcine mammary gland tissue. These findings inform future omics strategies to increase milk fat production and lipid profile and attest to the rise of both veterinomics and lipidomics in postgenomics life sciences.

  20. Synthesis and transdermal properties of acetylsalicylic acid and selected esters.

    PubMed

    Gerber, Minja; Breytenbach, Jaco C; Hadgraft, Jonathan; du Plessis, Jeanetta

    2006-03-01

    The primary aim of this study was to determine the transdermal penetration of acetylsalicylic acid and some of its derivatives, to establish a correlation, if any, with selected physicochemical properties and to determine if transdermal application of acetylsalicylic acid and its derivatives will give therapeutic drug concentrations with respect to transdermal flux. Ten derivatives of acetylsalicylic acid were prepared by esterification of acetylsalicyloyl chloride with ten different alcohols. The experimental aqueous solubility, logD and transdermal flux values were determined for acetylsalicylic acid and its derivatives at pH 4.5. In vitro penetration was measured through excised female human abdominal skin in diffusion cells. The experimental aqueous solubility of acetylsalicylic acid (6.56 mg/ml) was higher than that of the synthesised acetylsalicylate derivatives (ranging from 1.76 x 10(-3) to 3.32 mg/ml), and the logD of acetylsalicylic acid (-0.85) was lower than that of its derivatives (ranging from -0.25 to 1.95). There was thus an inverse correlation between the aqueous solubility data and the logD values. The experimental transdermal flux of acetylsalicylic acid (263.83 nmol/cm(2)h) was much higher than that of its derivatives (ranging from 0.12 to 136.02 nmol/cm(2)h).

  1. [Asymmetric synthesis of aromatic L-amino acids catalyzed by transaminase].

    PubMed

    Xia, Wenna; Sun, Yu; Min, Cong; Han, Wei; Wu, Sheng

    2012-11-01

    Aromatic L-Amino acids are important chiral building blocks for the synthesis of many drugs, pesticides, fine chemicals and food additives. Due to the high activity and steroselectivity, enzymatic synthesis of chiral building blocks has become the main research direction in asymmetric synthesis field. Guided by the phylogenetic analysis of transaminases from different sources, two representative aromatic transaminases TyrB and Aro8 in type I subfamily, from the prokaryote Escherichia coli and eukaryote Saccharomyces cerevisia, respectively, were applied for the comparative study of asymmetric transamination reaction process and catalytic efficiency of reversely converting keto acids to the corresponding aromatic L-amino acid. Both TyrB and Aro8 could efficiently synthesize the natural aromatic amino acids phenylalanine and tyrosine as well as non-natural amino acid phenylglycine. The chiral HPLC analysis showed the produced amino acids were L-configuration and the e.e value was 100%. L-alanine was the optimal amino donor, and the transaminase TyrB and Aro8 could not use D-amino acids as amino donor. The optimal molar ratio of amino donor (L-alanine) and amino acceptor (aromatic alpha-keto acids) was 4:1. Both of the substituted group on the aromatic ring and the length of fatty acid carbon chain part in the molecular structure of aromatic substrate alpha-keto acid have the significant impact on the enzyme-catalyzed transamination efficiency. In the experiments of preparative-scale transamination synthesis of L-phenylglycine, L-phenylalanine and L-tyrosine, the specific production rate catalyzed by TryB were 0.28 g/(g x h), 0.31 g/(g x h) and 0.60 g/(g x h) and the specific production rate catalyzed by Aro8 were 0.61 g/(g x h), 0.48 g/(g x h) and 0.59 g/(g x h). The results obtained here were useful for applying the transaminases to asymmetric synthesis of L-amino acids by reversing the reaction balance in industry.

  2. The effect of nitrogen limitation on acetyl-CoA carboxylase expression and fatty acid content in Chromera velia and Isochrysis aff. galbana (TISO).

    PubMed

    Huerlimann, Roger; Steinig, Eike J; Loxton, Heather; Zenger, Kyall R; Jerry, Dean R; Heimann, Kirsten

    2014-06-15

    Lipids from microalgae have become a valuable product with applications ranging from biofuels to human nutrition. While changes in fatty acid (FA) content and composition under nitrogen limitation are well documented, the involved molecular mechanisms are poorly understood. Acetyl-CoA carboxylase (ACCase) is a key enzyme in the FA synthesis and elongation pathway. Plastidial and cytosolic ACCases provide malonyl-CoA for de novo FA synthesis in the plastid and FA elongation in the endoplasmic reticulum, respectively. The present study aimed at investigating the expression of plastidial and cytosolic ACCase in Chromera velia and Isochrysis aff. galbana (TISO) and their impact on FA content and elongation level when grown under nitrogen-deplete conditions. In C. velia, plastidial ACCase was significantly upregulated during nitrogen starvation and with culture age, strongly correlating with increased FA content. Conversely, plastidial ACCase of I. aff. galbana was not differentially expressed in nitrogen-deplete cultures, but upregulated during the logarithmic phase of nitrogen-replete cultures. In contrast to plastidial ACCase, the cytosolic ACCase of C. velia was downregulated with culture age and nitrogen-starvation, strongly correlating with an increase in medium-chain FAs. In conclusion, the expression of plastidial and cytosolic ACCase changed with growth phase and nutrient status in a species-specific manner and nitrogen limitation did not always result in FA accumulation.

  3. Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli

    PubMed Central

    Howard, Thomas P.; Middelhaufe, Sabine; Moore, Karen; Edner, Christoph; Kolak, Dagmara M.; Taylor, George N.; Parker, David A.; Lee, Rob; Smirnoff, Nicholas; Aves, Stephen J.; Love, John

    2013-01-01

    Biofuels are the most immediate, practical solution for mitigating dependence on fossil hydrocarbons, but current biofuels (alcohols and biodiesels) require significant downstream processing and are not fully compatible with modern, mass-market internal combustion engines. Rather, the ideal biofuels are structurally and chemically identical to the fossil fuels they seek to replace (i.e., aliphatic n- and iso-alkanes and -alkenes of various chain lengths). Here we report on production of such petroleum-replica hydrocarbons in Escherichia coli. The activity of the fatty acid (FA) reductase complex from Photorhabdus luminescens was coupled with aldehyde decarbonylase from Nostoc punctiforme to use free FAs as substrates for alkane biosynthesis. This combination of genes enabled rational alterations to hydrocarbon chain length (Cn) and the production of branched alkanes through upstream genetic and exogenous manipulations of the FA pool. Genetic components for targeted manipulation of the FA pool included expression of a thioesterase from Cinnamomum camphora (camphor) to alter alkane Cn and expression of the branched-chain α-keto acid dehydrogenase complex and β-keto acyl-acyl carrier protein synthase III from Bacillus subtilis to synthesize branched (iso-) alkanes. Rather than simply reconstituting existing metabolic routes to alkane production found in nature, these results demonstrate the ability to design and implement artificial molecular pathways for the production of renewable, industrially relevant fuel molecules. PMID:23610415

  4. Synthesis of multifunctional Ag@Au@phenol formaldehyde resin particles loaded with folic acids for photothermal therapy.

    PubMed

    Yang, Ping; Xu, Qi-Zhi; Jin, Sheng-Yu; Lu, Yang; Zhao, Yang; Yu, Shu-Hong

    2012-07-23

    Multifunctional Ag@Au@ phenol formaldehyde resin (PFR) particles loaded with folic acids (FA) have been designed for killing tumor cells through photothermy conversion under the irradiation of near-infrared (NIR) light. Possessing the virtue of good fluorescence, low toxicity, and good targeting, the nanocomposite consists of an Ag core, an Au layer, a PFR shell, and folic acids on the PFR shell. The Ag@PFR core-shell structure can be prepared with a simple hydrothermal method after preheating. We then filled the PFR shell with a layer of Au by heating and modified the shell with polyelectrolyte to change its surface charge state. To capture tumor cells actively, FA molecules were attached onto the surface of the Ag@Au@PFR particles in the presence of 1-ethyl-3-(3-dimethly aminopropyl) carbodiimide (EDAC) and N-hydroxysuccinimide (NHS). Owing to the excellent property of Au NPs and Ag NPs as photothermal conversion agents, the Ag@Au@ PFR@FA particles can be utilized to kill tumor cells when exposed to NIR light.

  5. Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli.

    PubMed

    Howard, Thomas P; Middelhaufe, Sabine; Moore, Karen; Edner, Christoph; Kolak, Dagmara M; Taylor, George N; Parker, David A; Lee, Rob; Smirnoff, Nicholas; Aves, Stephen J; Love, John

    2013-05-01

    Biofuels are the most immediate, practical solution for mitigating dependence on fossil hydrocarbons, but current biofuels (alcohols and biodiesels) require significant downstream processing and are not fully compatible with modern, mass-market internal combustion engines. Rather, the ideal biofuels are structurally and chemically identical to the fossil fuels they seek to replace (i.e., aliphatic n- and iso-alkanes and -alkenes of various chain lengths). Here we report on production of such petroleum-replica hydrocarbons in Escherichia coli. The activity of the fatty acid (FA) reductase complex from Photorhabdus luminescens was coupled with aldehyde decarbonylase from Nostoc punctiforme to use free FAs as substrates for alkane biosynthesis. This combination of genes enabled rational alterations to hydrocarbon chain length (Cn) and the production of branched alkanes through upstream genetic and exogenous manipulations of the FA pool. Genetic components for targeted manipulation of the FA pool included expression of a thioesterase from Cinnamomum camphora (camphor) to alter alkane Cn and expression of the branched-chain α-keto acid dehydrogenase complex and β-keto acyl-acyl carrier protein synthase III from Bacillus subtilis to synthesize branched (iso-) alkanes. Rather than simply reconstituting existing metabolic routes to alkane production found in nature, these results demonstrate the ability to design and implement artificial molecular pathways for the production of renewable, industrially relevant fuel molecules.

  6. Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli.

    PubMed

    Howard, Thomas P; Middelhaufe, Sabine; Moore, Karen; Edner, Christoph; Kolak, Dagmara M; Taylor, George N; Parker, David A; Lee, Rob; Smirnoff, Nicholas; Aves, Stephen J; Love, John

    2013-05-01

    Biofuels are the most immediate, practical solution for mitigating dependence on fossil hydrocarbons, but current biofuels (alcohols and biodiesels) require significant downstream processing and are not fully compatible with modern, mass-market internal combustion engines. Rather, the ideal biofuels are structurally and chemically identical to the fossil fuels they seek to replace (i.e., aliphatic n- and iso-alkanes and -alkenes of various chain lengths). Here we report on production of such petroleum-replica hydrocarbons in Escherichia coli. The activity of the fatty acid (FA) reductase complex from Photorhabdus luminescens was coupled with aldehyde decarbonylase from Nostoc punctiforme to use free FAs as substrates for alkane biosynthesis. This combination of genes enabled rational alterations to hydrocarbon chain length (Cn) and the production of branched alkanes through upstream genetic and exogenous manipulations of the FA pool. Genetic components for targeted manipulation of the FA pool included expression of a thioesterase from Cinnamomum camphora (camphor) to alter alkane Cn and expression of the branched-chain α-keto acid dehydrogenase complex and β-keto acyl-acyl carrier protein synthase III from Bacillus subtilis to synthesize branched (iso-) alkanes. Rather than simply reconstituting existing metabolic routes to alkane production found in nature, these results demonstrate the ability to design and implement artificial molecular pathways for the production of renewable, industrially relevant fuel molecules. PMID:23610415

  7. Acidosis Drives the Reprogramming of Fatty Acid Metabolism in Cancer Cells through Changes in Mitochondrial and Histone Acetylation.

    PubMed

    Corbet, Cyril; Pinto, Adán; Martherus, Ruben; Santiago de Jesus, João Pedro; Polet, Florence; Feron, Olivier

    2016-08-01

    Bioenergetic preferences of cancer cells foster tumor acidosis that in turn leads to dramatic reduction in glycolysis and glucose-derived acetyl-coenzyme A (acetyl-CoA). Here, we show that the main source of this critical two-carbon intermediate becomes fatty acid (FA) oxidation in acidic pH-adapted cancer cells. FA-derived acetyl-CoA not only fuels the tricarboxylic acid (TCA) cycle and supports tumor cell respiration under acidosis, but also contributes to non-enzymatic mitochondrial protein hyperacetylation, thereby restraining complex I activity and ROS production. Also, while oxidative metabolism of glutamine supports the canonical TCA cycle in acidic conditions, reductive carboxylation of glutamine-derived α-ketoglutarate sustains FA synthesis. Concomitance of FA oxidation and synthesis is enabled upon sirtuin-mediated histone deacetylation and consecutive downregulation of acetyl-CoA carboxylase ACC2 making mitochondrial fatty acyl-CoA degradation compatible with cytosolic lipogenesis. Perturbations of these regulatory processes lead to tumor growth inhibitory effects further identifying FA metabolism as a critical determinant of tumor cell proliferation under acidosis. PMID:27508876

  8. Microbiologically produced carboxylic acids used as building blocks in organic synthesis.

    PubMed

    Aurich, Andreas; Specht, Robert; Müller, Roland A; Stottmeister, Ulrich; Yovkova, Venelina; Otto, Christina; Holz, Martina; Barth, Gerold; Heretsch, Philipp; Thomas, Franziska A; Sicker, Dieter; Giannis, Athanassios

    2012-01-01

    Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building blocks. Thereby, our biotechnological goal was the development of process fundamentals regarding the variable use of renewable raw materials, the development of a multi purpose bioreactor and application of a pilot plant with standard equipment for organic acid production to minimize the technological effort. Furthermore the development of new product isolation procedures, with the aim of direct product recovery, capture of products or single step operation, was necessary. The application of robust and approved microorganisms, also genetically modified, capable of using a wide range of substrates as well as producing a large spectrum of products, was of special importance. Microbiologically produced acids, like 2-oxo-glutaric acid and 2-oxo-D-gluconic acid, are useful educts for the chemical synthesis of hydrophilic triazines, spiro-connected heterocycles, benzotriazines, and pyranoic amino acids. The chiral intermediate of the tricarboxylic acid cycle, (2R,3S)-isocitric acid, is another promising compound. For the first time our process provides large quantities of enantiopure trimethyl (2R,3S)-isocitrate which was used in subsequent chemical transformations to provide new chiral entities for further usage in total synthesis and pharmaceutical research.Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building

  9. Synthesis and biological evaluation of novel lipoamino acid derivatives.

    PubMed

    Kaki, Shiva Shanker; Arukali, Sammaiah; Korlipara, Padmaja V; Prasad, R B N; Yedla, Poornachandra; Ganesh Kumar, C

    2016-01-01

    Seven novel lipoamino acid conjugates were synthesized from methyl oleate and amino acids. Methyl oleate was grafted to different amino acids using thioglycolic acid as a spacer group. Seven derivatives (3a-g) were prepared and characterized by spectral data (NMR, IR and MS spectral studies). All the derivatives were studied for their antimicrobial, anti-biofilm and anticancer activities. Among all the derivatives, it was found that compound 3b was the most potent antibacterial compound which showed good activity against four Gram positive bacterial strains and also exhibited excellent antifungal activity against a fungal strain. In the anti-biofilm assay, compound 3b showed promising activity with IC50 value of 2.8μM against Bacillus subtilis MTCC 121. All the compounds showed anticancer activities with 3c showing promising anticancer activity (IC50=15.3-22.4μM) against the four cell lines tested. PMID:26586599

  10. New multifunctional phosphonic acid for metal phosphonate synthesis

    NASA Astrophysics Data System (ADS)

    Garczarek, Piotr; Janczak, Jan; Zoń, Jerzy

    2013-03-01

    A new heterotopic phosphonic acid, 3-amino-5-(dihydroxyphosphoryl)benzoic acid (1) has been synthesized and obtained in the crystalline form. Second multifunctional phosphonic acid - namely 3-(dihydroxyphosphoryl)-5-nitrobenzoic acid (2) has also been obtained, following a different synthetic route than previously reported. Compound 1 crystallizes in a centrosymmetric space group of the triclinic system as monohydrate, sbnd C6H3(NH2)(COOH)PO3H2·H2O -1a. The molecule in the crystal exists in a zwitterionic form, in which one of the proton of the phosphonic group is transferred to the amine group. The zwitterionic molecules interact to each other and with water molecules via Nsbnd H…O and Osbnd H…O hydrogen bonds forming a three-dimensional network.

  11. Synthesis and evaluation of dioleoyl glyceric acids showing antitrypsin activity.

    PubMed

    Habe, Hiroshi; Fukuoka, Tokuma; Sato, Shun; Kitamoto, Dai; Sakaki, Keiji

    2011-01-01

    Previously, Lešová et al. reported the isolation and identification of metabolite OR-1, showing antitrypsin activity, produced during fermentation by Penicillium funiculosum. The structure of OR-1 was a mixture of glyceric acid (GA), esterified with C(14)-C(18) fatty acids, and oleic acid (C18:1) as the most predominant fatty acid (Folia Microbiol. 46, 21-23, 2001). In this study, dioleoyl D-GA and dioleoyl L-GA were synthesized via diesterification with oleoyl chloride, and their antitrypsin activities were evaluated using both a disk diffusion method and spectral absorption measurements. The results show that both compounds and their equivalent mixtures possess antitrypsin activities; however, their IC(50) values (approximately 2 mM) are much higher than that of OR-1 (4.25 µM), suggesting that dioleoyl GA does not play a major role in the OR-1 antitrypsin activity. PMID:21606621

  12. Selection on synthesis cost affects interprotein amino acid usage in all three domains of life.

    PubMed

    Swire, Jonathan

    2007-05-01

    Most investigations of the forces shaping protein evolution have focused on protein function. However, cells are typically 50%-75% protein by dry weight, with protein expression levels distributed over five orders of magnitude. Cells may, therefore, be under considerable selection pressure to incorporate amino acids that are cheap to synthesize into proteins that are highly expressed. Such selection pressure has been demonstrated to alter amino acid usage in a few organisms, but whether "cost selection" is a general phenomenon remains unknown. One reason for this is that reliable protein expression level data is not available for most organisms. Accordingly, I have developed a new method for detecting cost selection. This method depends solely on interprotein gradients in amino acid usage. Applying it to an analysis of 43 whole genomes from all three domains of life, I show that selection on the synthesis cost of amino acids is a pervasive force in shaping the composition of proteins. Moreover, some amino acids have different price tags for different organisms--the cost of amino acids is changed for organisms living in hydrothermal vents compared with those living at the sea surface or for organisms that have difficulty acquiring elements such as nitrogen compared with those that do not--so I also investigated whether differences between organisms in amino acid usage might reflect differences in synthesis or acquisition costs. The results suggest that organisms evolve to alter amino acid usage in response to environmental conditions.

  13. Synthesis of an indole analog of folic acid

    SciTech Connect

    Shengeliya, M.S.; Avramenko, V.G.; Kuleshova, L.N.; Ershova, Yu.A.; Chernov, V.A.; Surorov, N.N.

    1987-06-01

    The authors study the replacement of the p-aminobenzoic acid (PABA) moiety. The authors synthesized an indole analog of folic acid, namely dimethyl N-(5-(2'-amino-4'-oxo-6'-pteridinyl)methylaminoindol-2-yl)glutamate. The physicochemical properties and the chemical shifts in the PMR spectra of the compounds obtained are shown. The examination of the compound for antitumor activity was carried out using rats and mice.

  14. Synthesis and antifungal activity of cinnamic acid esters.

    PubMed

    Tawata, S; Taira, S; Kobamoto, N; Zhu, J; Ishihara, M; Toyama, S

    1996-05-01

    Cinnamic, p-coumaric and ferulic acids were isolated from pineapple stems (Ananas comosus var. Cayenne). Twenty-four kinds of esters were prepared from these acids, alcohols and the components of Alpinia. Isopropyl 4-hydroxycinnamate (11) and butyl 4-hydroxycinnamate (12) were found to have almost the same effectiveness in antifungal activity against Pythium sp. at 10 ppm as that of the commercial fungicide iprobenfos (kitazin P).

  15. Induction of cellular deoxyribonucleic acid synthesis in butyrate-treated cells by simian virus 40 deoxyribonucleic acid

    SciTech Connect

    Kawasaki, S.; Diamond, L.; Baserga, R.

    1981-11-01

    Sodium butyrate (3mM) inhibited the entry into the S phase of quiescent 3T3 cells stimulated by serum, but had no effect on the accumulation of cellular ribonucleic acid. Simian virus 40 infection or manual microinjection of cloned fragments from the simian virus 40 A gene caused quiescent 3T3 cells to enter the S phase even in the presence of butyrate. NGI cells, a line of 3T3 cells transformed by simian virus 40, grew vigorously in 3 mM butyrate. Homokaryons were formed between G/sub 1/ and S-phase 3T3 cells. Butyrate inhibited the induction of deoxyribonucleic acid synthesis that usually occurs in G/sub 1/ nuclei when G/sub 1/ cells are fused with S-phase cells. However, when G/sub 1/ 3T3 cells were fused with exponentially growing NGI cells, the 3T3 nuclei were induced to enter deoxyribonucleic acid synthesis. In tsAF8 cells, a ribonucleic acid polymerase II mutant that stops in the G/sub 1/ phase of the cell cycle, no temporal sequence was demonstrated between the butyrate block and the temperature-sensitive block. These results confirm previous reports that certain virally coded proteins can induce cell deoxyribonucleic acid synthesis in the absence of cellular functions that are required by serum-stimulated cells. The author's interpretation of these data is that butyrate inhibited cell growth by inhibiting the expression of genes required for the G/sub o/ ..-->.. G/sub 1/ ..-->.. S transition and that the product of the simian virus 40 A gene overrode this inhibition by providing all of the necessary functions for the entry into the S phase.

  16. Mitochondrial acyl carrier protein is involved in lipoic acid synthesis in Saccharomyces cerevisiae.

    PubMed

    Brody, S; Oh, C; Hoja, U; Schweizer, E

    1997-05-19

    The yeast gene, ACP1, encoding the mitochondrial acyl carrier protein, was deleted by gene replacement. The resulting acp1-deficient mutants had only 5-10% of the wild-type lipoic acid content remaining, and exhibited a respiratory-deficient phenotype. Upon meiosis, the lipoate deficiency co-segregated with the acp1 deletion. The role of ACP1 in long-chain fatty acid synthesis was studied in fast and fas2 null mutants completely lacking cytoplasmic fatty acid synthase. When grown on odd-chain (13:0 and 15:0) fatty acids, these cells showed less than 1% of C-16 and C-18 acids in their total lipids. Mitochondrial ACP is therefore suggested to be involved with the biosynthesis of octanoate, a precursor to lipoic acid. PMID:9187370

  17. Synthesis of locked cyclohexene and cyclohexane nucleic acids (LCeNA and LCNA) with modified adenosine units.

    PubMed

    Šála, Michal; Dejmek, Milan; Procházková, Eliška; Hřebabecký, Hubert; Rybáček, Jiří; Dračínský, Martin; Novák, Pavel; Rosenbergová, Šárka; Fukal, Jiří; Sychrovský, Vladimír; Rosenberg, Ivan; Nencka, Radim

    2015-03-01

    We describe here the preparation of conformationally locked cyclohexane nucleic acids designed as hybrids between locked nucleic acids (LNAs) and cyclohexene nucleic acids (CeNAs), both of which excel in hybridization with complementary RNAs. We have accomplished the synthesis of these adenine derivatives starting from a simple ketoester and installed all four chiral centres by means of total synthesis. The acquired monomers were incorporated into nonamer oligonucleotides.

  18. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  19. Excessive Food Intake, Obesity and Inflammation Process in Zucker fa/fa Rat Pancreatic Islets

    PubMed Central

    Chentouf, Myriam; Dubois, Gregor; Jahannaut, Céline; Castex, Françoise; Lajoix, Anne Dominique; Gross, René; Peraldi-Roux, Sylvie

    2011-01-01

    Inappropriate food intake-related obesity and more importantly, visceral adiposity, are major risk factors for the onset of type 2 diabetes. Evidence is emerging that nutriment-induced β-cell dysfunction could be related to indirect induction of a state of low grade inflammation. Our aim was to study whether hyperphagia associated obesity could promote an inflammatory response in pancreatic islets leading to ß-cell dysfunction. In the hyperphagic obese insulin resistant male Zucker rat, we measured the level of circulating pro-inflammatory cytokines and estimated their production as well as the expression of their receptors in pancreatic tissue and β-cells. Our main findings concern intra-islet pro-inflammatory cytokines from fa/fa rats: IL-1β, IL-6 and TNFα expressions were increased; IL-1R1 was also over-expressed with a cellular redistribution also observed for IL-6R. To get insight into the mechanisms involved in phenotypic alterations, abArrays were used to determine the expression profile of proteins implicated in different membrane receptors signaling, apoptosis and cell cycle pathways. Despite JNK overexpression, cell viability was unaffected probably because of decreases in cleaved caspase3 as well as in SMAC/DIABLO and APP, involved in the induction and amplification of apoptosis. Concerning β-cell proliferation, decreases in important cell cycle regulators (Cyclin D1, p35) and increased expression of SMAD4 probably contribute to counteract and restrain hyperplasia in fa/fa rat islets. Finally and probably as a result of IL-1β and IL-1R1 increased expressions with sub-cellular redistribution of the receptor, islets from fa/fa rats were found more sensitive to both stimulating and inhibitory concentrations of the cytokine; this confers some physiopathological relevance to a possible autocrine regulation of β-cell function by IL-1β. These results support the hypothesis that pancreatic islets from prediabetic fa/fa rats undergo an inflammatory

  20. In vitro synthesis of arachidonoyl amino acids by cytochrome c.

    PubMed

    McCue, Jeffrey M; Driscoll, William J; Mueller, Gregory P

    2009-11-01

    Arachidonoyl amino acids are a class of endogenous lipid messengers that are expressed in the mammalian central nervous system and peripherally. While several of their prominent pharmacologic effects have been documented, the mechanism by which arachidonoyl amino acids are biosynthesized has not been defined. We have previously observed that the mitochondrial protein, cytochrome c, is capable of catalyzing the formation of the prototypic arachidonoyl amino acid, arachidonoyl glycine, utilizing arachidonoyl CoA and glycine as substrates, in the presence of hydrogen peroxide. Here we report that cytochrome c is similarly able to catalyze the formation of N-arachidonoyl serine, N-arachidonoyl alanine, and N-arachidonoyl gamma aminobutyric acid from arachidonoyl CoA and the respective amino acids. The identities of the arachidonoyl amino acid products were verified by mass spectral fragmentation pattern analysis. The synthetic reactions exhibited Michaelis-Menten kinetics and continued favorably at physiologic temperature and pH. Spectral data indicate that both cytochrome c protein structure and a +3 heme iron oxidation state are required for the reaction mechanism to proceed optimally. Reactions designed to catalyze the formation of N-arachidonoyl dopamine were not efficient due to the rapid oxidation of dopamine substrate by hydrogen peroxide, consuming both reactants. Finally, under standard assay conditions, arachidonoyl CoA and ethanolamine were found to react spontaneously to form anandamide, independent of cytochrome c and hydrogen peroxide. Accordingly, it was not possible to demonstrate a potential role for cytochrome c in the biosynthetic mechanism for either arachidonoyl dopamine or anandamide. However, the ability of cytochrome c to effectively catalyze the formation of N-arachidonoyl serine, N-arachidonoyl alanine, and N-arachidonoyl gamma aminobutyric acid in vitro highlights its potential role for the generation of these lipid messengers in vivo.

  1. Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.

    PubMed

    Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko

    2016-09-01

    Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. PMID:27630308

  2. Nature's Starships: Amino Acid Synthesis, Frequency, and Delivery to Earth via Meteorites

    NASA Astrophysics Data System (ADS)

    Cobb, Alyssa; Pudritz, Ralph

    2013-07-01

    Understanding the origin of organic molecules on Earth is vital to our understanding of the origins of life. One proposed mechanism for the introduction of organic material to our planet is via meteorite impacts. Meteoritic parent bodies contain organic material and water ice, which, given radionuclide decay in their interiors, cause the ice to melt and the parent bodies to undergo a process called aqueous alteration. An example of this internal chemistry is Strecker synthesis, a process resulting in the production of various amino acids. Our work summarizes recent discoveries regarding amino acid synthesis and concentration data. We present the amino acid concentrations collated from a variety of meteorites (~20) covering a range of meteorite classes. We can use the dependence of amino acid frequency on variables such as temperature and pressure to model Strecker synthesis inside a theoretical parent body. Our modeling software takes a set of chemical species and outputs their relative frequencies based on a minimization of their Gibbs free energies. The goal of this work is to predict and quantify the presence of amino acids on a foreign landscape using thermodynamic principles.

  3. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids.

    PubMed

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D V S; Sharma, Rohit K

    2014-10-31

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  4. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  5. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  6. Fatty acid composition of muscle fat and enzymes of storage lipid synthesis in whole muscle from beef cattle.

    PubMed

    Kazala, E Chris; Lozeman, Fred J; Mir, Priya S; Aalhus, Jennifer L; Schmutz, Sheila M; Weselake, Randall J

    2006-11-01

    Enhanced intramuscular fat content (i.e., marbling) in beef is a desirable trait, which can result in increased product value. This study was undertaken with the aim of revealing biochemical factors associated with the marbling trait in beef cattle. Samples of longissimus lumborum (LL) and pars costalis diaphragmatis (PCD) were taken from a group of intact crossbred males and females at slaughter, lipids extracted, and the resulting FAME examined for relationships with marbling fat deposition. For LL, significant associations were found between degree of marbling and myristic (14:0, r = 0.55, P < 0.01), palmitic (16:0, r = 0.80, P < 0.001), stearic (18:0, r = -0.58, P < 0.01), and oleic (18:1c-9, r = 0.79, P < 0.001) acids. For PCD, significant relationships were found between marbling and palmitic (r = 0.71, P < 0.001) and oleic (r = 0.74, P < 0.001) acids. Microsomal fractions prepared from PCD muscle were assayed for diacylglycerol acyltransferase (DGAT), lysophosphatidic acid acyltransferase (LPAAT), and phosphatidic acid phosphatase-1 (PAP-1) activity, and the results examined for relationships with degree of intramuscular fat deposition. None of the enzyme activities from PCD displayed an association with marbling fat content, but DGAT specific activity showed significant positive associations with LPAAT (r = 0.54, P < 0.01), total PAP (r = 0.66, P < 0.001), and PAP-1 (r = 0.63, P < 0.01) specific activities. The results on FA compositions of whole muscle tissues provide insight into possible enzyme action associated with the production of specific FA. The increased proportion of oleic acid associated with enhanced lipid content of whole muscle is noteworthy given the known health benefits of this FA. PMID:17263304

  7. Fatty acid composition of muscle fat and enzymes of storage lipid synthesis in whole muscle from beef cattle.

    PubMed

    Kazala, E Chris; Lozeman, Fred J; Mir, Priya S; Aalhus, Jennifer L; Schmutz, Sheila M; Weselake, Randall J

    2006-11-01

    Enhanced intramuscular fat content (i.e., marbling) in beef is a desirable trait, which can result in increased product value. This study was undertaken with the aim of revealing biochemical factors associated with the marbling trait in beef cattle. Samples of longissimus lumborum (LL) and pars costalis diaphragmatis (PCD) were taken from a group of intact crossbred males and females at slaughter, lipids extracted, and the resulting FAME examined for relationships with marbling fat deposition. For LL, significant associations were found between degree of marbling and myristic (14:0, r = 0.55, P < 0.01), palmitic (16:0, r = 0.80, P < 0.001), stearic (18:0, r = -0.58, P < 0.01), and oleic (18:1c-9, r = 0.79, P < 0.001) acids. For PCD, significant relationships were found between marbling and palmitic (r = 0.71, P < 0.001) and oleic (r = 0.74, P < 0.001) acids. Microsomal fractions prepared from PCD muscle were assayed for diacylglycerol acyltransferase (DGAT), lysophosphatidic acid acyltransferase (LPAAT), and phosphatidic acid phosphatase-1 (PAP-1) activity, and the results examined for relationships with degree of intramuscular fat deposition. None of the enzyme activities from PCD displayed an association with marbling fat content, but DGAT specific activity showed significant positive associations with LPAAT (r = 0.54, P < 0.01), total PAP (r = 0.66, P < 0.001), and PAP-1 (r = 0.63, P < 0.01) specific activities. The results on FA compositions of whole muscle tissues provide insight into possible enzyme action associated with the production of specific FA. The increased proportion of oleic acid associated with enhanced lipid content of whole muscle is noteworthy given the known health benefits of this FA.

  8. QUANTITATIVE CONTRIBUTIONS OF DIET AND LIVER SYNTHESIS TO DOCOSAHEXAENOIC ACID HOMEOSTASIS

    PubMed Central

    Rapoport, Stanley I.; Igarashi, Miki; Gao, Fei

    2010-01-01

    Dietary requirements for maintaining brain and heart docosahexaenoic acid (DHA, 22:6n-3) homeostasis are not agreed on, in part because rates of liver DHA synthesis from circulating α-linolenic acid (α-LNA, 18:2n-3) have not been quantified. These rates can be estimated in vivo using intravenous radiotracer- or heavy isotope-labeled α-LNA infusion. In adult unanesthetized male rats, such infusion shows that liver synthesis-secretion rates of DHA from α-LNA markedly exceed brain and heart DHA synthesis rates and brain DHA consumption rate, and that liver but not heart or brain synthesis is upregulated as dietary n-3 PUFA content is reduced. These differences in rate reflect much higher expression of DHA-synthesizing enzymes in liver, and upregulation of liver but not heart or brain enzyme expression by reduced dietary n-3 PUFA content. A noninvasive intravenous [U-13C]α-LNA infusion method that produces steady-state liver tracer metabolism gives exact liver DHA synthesis-secretion rates and could be extended for human studies. PMID:20226642

  9. Synthesis of l-(+)-Tartaric Acid from l-Ascorbic Acid via 5-Keto-d-Gluconic Acid in Grapes

    PubMed Central

    Saito, Kazumi; Kasai, Zenzaburo

    1984-01-01

    5-Keto-l-idionic acid (≡5-keto-d-gluconic acid, d-xylo-5-hexulosonic acid) was found as a metabolic product of l-ascorbic acid in slices of immature grapes, Vitis labrusca L. cv `Delaware'. Specifically labeled compounds, recognized as metabolic products of l-ascorbic acid in grapes, were fed to young grape tissues to investigate the metabolic pathway from l-ascorbic acid to l-(+)-tartaric acid. Label from dehydro-l-[1-14C]ascorbic acid, 2-keto-l-[1-14C]idonic acid (l-xylo-2-hexulosonic acid), l-[1-14C]idonic acid, or 5-keto-l-[1-14C] idonic acid was incorporated into l-(+)-tartaric acid in high yields as it was in the l-[1-14C]ascorbic acid experiment. In a double label experiment involving a mixture of l-[1-14C]idonic acid and l-[2-3H]idonic acid, the 3H/14C ratios of 5-keto-l-idonic acid and l-(+)-tartaric acid synthesized in young grape leaves were almost the same as the value of the l-idonic acid fed. Label from 5-keto-l-[6-14C]idonic acid was incorporated into sugars and insoluble residue in the same way as l-[6-14C]ascorbic acid was metabolized in grapes. These results provide strong evidence that in grapes l-(+)-tartaric acid is synthesized from the C4 fragment that corresponds to the C1 to C4 group of the 5-keto-l-idonic acid derived from l-ascorbic acid via 2-keto-l-idonic acid and l-idonic acid. PMID:16663792

  10. Effect of low temperature on chlorophyll biosynthesis in albinism line of wheat (Triticum aestivum) FA85.

    PubMed

    Liu, Xiao-Gang; Xu, Hong; Zhang, Jing-Ya; Liang, Guang-Wang; Liu, Ying-Tuan; Guo, Ai-Guang

    2012-07-01

    The 'stage albinism line of winter wheat' FA85 exhibits a severe block in chlorophyll (Chl) biosynthesis with prolonged low-temperature treatment. The correlations between leaf color and low temperature provide more comprehensive understanding of low temperature as an environmental signal that regulate the metabolic changes in the entire Chl-synthesizing pathway. In this study, we investigated differences in Chl biosynthesis between leaves of Aibian1 and FA85 by measuring their Chl precursors and heme content, transcripts for key genes of Chl biosynthesis and key enzyme activities. With prolonged low-temperature treatment, the Chl content gradually decreased, but Chl precursors, including protoporphyrin IX, Mg-protoporphyrin IX and protochlorophyllide (Pchlide), simultaneously accumulated. Parallel to the decline in Chl content, the protoporphyrin IX distribution toward Chl synthesis was less than that in heme synthesis in the leaves of FA85. Corresponding to the change of protoporphyrin IX distribution, the relative changes in magnesium chelatase (EC 6.6.1.1) and ferrochelatase (EC 4.99.1.1) activities in the leaves of FA85 also indirectly reflected channeling of the metabolic flow into heme rather than Chl. A drastic loss in the transcripts for Pchlide oxidoreductase (EC 1.3.1.33) and Chl synthase (EC 2.5.1.62) accounted for a decrease in the metabolic flux and the re-direction of metabolites. The high-level accumulations of Chl precursors and traces of Chl in the leaves of FA85 suggest that a severe block between the steps from Pchlide to Chl formation during Chl biosynthesis is partially derived from the transcriptional downregulation of Pchlide oxidoreductase and Chl synthase.

  11. Folic acid bio-inspired route for facile synthesis of AuPt nanodendrites as enhanced electrocatalysts for methanol and ethanol oxidation reactions

    NASA Astrophysics Data System (ADS)

    Wang, Ai-Jun; Ju, Ke-Jian; Zhang, Qian-Li; Song, Pei; Wei, Jie; Feng, Jiu-Ju

    2016-09-01

    Folic acid (FA), as an important biomolecule in cell division and growth, is firstly employed as the structure director and stabilizing agent for controlled synthesis of uniform Au65Pt35 nanodendrites (NDs) by a one-pot wet-chemical bio-inspired route at room temperature. No pre-seed, template, organic solvent, polymer, surfactant or complex instrument is involved. The products are mainly characterized by transmission electron microscopy (TEM), high angle annular dark-field scanning transmission electron microscopy (HAADF-STEM), X-ray diffraction (XRD), and X-Ray photoelectron spectroscopy (XPS). The architectures have enlarged electrochemically active surface area (60.6 m2 gPt-1), enhanced catalytic activity and durability for methanol and ethanol oxidation in contrast with commercial Pt black and the other AuPt alloys by tuning the molar ratios of Au to Pt (e.g., Au31Pt69 and Au82Pt18 nanoparticles). This strategy would be applied to fabricate other bimetallic nanocatalysts in fuel cells.

  12. A Novel Process for the Synthesis of Highly Pure n-3 Polyunsaturated Fatty Acid (PUFA)-Enriched Triglycerides by Combined Transesterification and Ethanolysis.

    PubMed

    Li, Daoming; Wang, Weifei; Qin, Xiaoli; Li, Xingxing; Yang, Bo; Wang, Yonghua

    2016-08-31

    In this study, a novel two-step enzymatic reaction was developed for the synthesis of highly pure triacylglycerols (TAGs) with a high content of n-3 polyunsaturated fatty acids (PUFAs). Glyceride mixtures were primarily synthesized by Novozym 435-catalyzed transesterification of glycerol and DHA/EPA-rich ethyl esters (EEs), followed by removal of partial glycerides, for the first time, by immobilized mono- and diacylglycerol lipase SMG1-F278N-catalyzed ethanolysis. TAG yield as high as 98.66% was achieved under the optimized conditions, and highly pure (98.75%) n-3 PUFA-enriched TAGs with 88.44% of n-3 PUFA was obtained after molecular distillation at lower temperature (140 °C). In addition, the EEs produced during ethanolysis had a FA composition similar to that of the original EEs, making them feasible for cyclic utilization. This was the first study reporting removal of partial glycerides by ethanolysis. Through ethanolysis, a higher purity product could be easily obtained at a relatively low temperature compared with the conventional high-temperature molecular distillation. PMID:27540752

  13. Studies on chemical modification and biology of a natural product, gambogic acid (II): Synthesis and bioevaluation of gambogellic acid and its derivatives from gambogic acid as antitumor agents.

    PubMed

    Wang, Jinxin; Ma, Junhai; You, Qidong; Zhao, Li; Wang, Fan; Li, Chong; Guo, Qinglong

    2010-09-01

    Gambogic acid (GA) has been reported to be a potent apoptosis inducer. The fact that it is amenable to chemical modification makes GA an attractive molecule for the development of anticancer agents. We firstly reported the synthesis of gambogellic acid, which was generated under acid catalysis from readily available GA by a base-catalyzed diene intramolecular annelation. Sequentially, thirteen new compounds were synthesized and their inhibitory activity on HT-29, Bel-7402, BGC-823, and A549 cell lines were evaluated in vitro by MTT assay, and (38, 40)-epoxy-33-chlorogambogellic acid (4) was identified as a BGC-823 cell apoptosis inducer through MTT cell assay, observations of morphological changes, and Annexin-V/PI double-staining assay. Compound 4 showed significant effects in inducing apoptosis and might serve as a potential lead compound for discovery of new anticancer drugs. Further structure-activity relationships (SARs) of gambogic acid derivatives were discussed.

  14. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  15. Amino acids in a Fischer Tropsch type synthesis

    NASA Technical Reports Server (NTRS)

    Brown, D. L.; Lawless, J. G.

    1974-01-01

    One postulation is described for the presence of organic compounds in meteorites which states that they were formed during the condensation of the solar nebula. A viable laboratory simulation of these conditions can be modeled after the industrial Fischer Tropsch reaction, which is known to produce organic compounds called hydrocarbons. In this simulation, a mixture of carbon monoxide, hydrogen and ammonia is heated in the presence of iron meteorite. The reaction products for amino acids, a class of organic compounds important to life, were examined. A large number of these compounds is found in meteorites and other chemical evolution experiments, but only small quantities of a few amino acids were found in the present simulation work. These results are at odds with the existing literature in which many amino acids were reported.

  16. [Effect of citric acid on synthesis of surfactants in Rhodococcus erythropolis IMV Ac-5017].

    PubMed

    Pyroh, T P; Shevchuk, T A; Shuliakova, M O; Tarasenko, D O

    2011-01-01

    Expediency of sodium citrate (regulator of lipids synthesis) substitution is shown in the medium of cultivation of Rhodococcus erythropolis IMV Ac-5017 with ethanol (or hexadecane) and fumarate (gluconeogenesis precursor) by citric acid for pH maintenance at the level optimal for synthesis of surfactants. It has been established the maximum synthesis of surfactants of R. erythropolis IMV Ac-5017 was observed at pH 8.0. Introduction of 0.2% sodium fumarate at the end of experimental growth phase of the strain IMV Ac-5017 in the medium with 2% of ethanol with further periodic acidification of culture liquid by citric acid up to pH 8.0 was accompanied by the increase of conditional concentration of surfactants by 30, 40 and 95% as compared with an analogous process without pH regulation, by the use of sodium citrate as the regulator of lipids synthesis on the medium with ethanol as well as without organic acids, respectively.

  17. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  18. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  19. Synthesis, structure, and biological applications of α-fluorinated β-amino acids and derivatives.

    PubMed

    March, Taryn L; Johnston, Martin R; Duggan, Peter J; Gardiner, James

    2012-11-01

    This review gives a broad overview of the state of play with respect to the synthesis, conformational properties, and biological activity of α-fluorinated β-amino acids and derivatives. General methods are described for the preparation of monosubstituted α-fluoro-β-amino acids (Scheme 1). Nucleophilic methods for the introduction of fluorine predominantly involve the reaction of DAST with alcohols derived from α-amino acids, whereas electrophilic sources of fluorine such as NFSI have been used in conjunction with Arndt-Eistert homologation, conjugate addition or organocatalyzed Mannich reactions. α,α-Difluoro-β-amino acids have also been prepared using DAST; however, this area of synthesis is largely dominated by the use of difluorinated Reformatsky reagents to introduce the difluoro ester functionality (Scheme 9). α-Fluoro-β-amino acids and derivatives analyzed by X-ray crystal and NMR solution techniques are found to adopt preferred conformations which are thought to result from stereoelectronic effects associated with F located close to amines, amides, and esters (Figs. 2-6). α-Fluoro amide and β-fluoro ethylamide/amine effects can influence the secondary structure of α-fluoro-β-amino acid-containing derivatives including peptides and peptidomimetics (Figs. 7-9). α-Fluoro-β-amino acids are also components of a diverse range of bioactive anticancer (e.g., 5-fluorouracil), antifungal, and antiinsomnia agents as well as protease inhibitors where such fluorinated analogs have shown increased potency and spectrum of activity.

  20. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  1. Enhanced synthesis of alkyl amino acids in Miller's 1958 H2S experiment.

    PubMed

    Parker, Eric T; Cleaves, H James; Callahan, Michael P; Dworkin, Jason P; Glavin, Daniel P; Lazcano, Antonio; Bada, Jeffrey L

    2011-12-01

    Stanley Miller's 1958 H(2)S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH(4)), ammonia (NH(3)), carbon dioxide (CO(2)), and hydrogen sulfide (H(2)S) produced several alkyl amino acids, including the α-, β-, and γ-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H(2)S, aspartic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H(2)S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H(2)S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth. PMID:22139514

  2. Synthesis, antimicrobial evaluation and QSAR studies of stearic acid derivatives.

    PubMed

    Tahlan, S; Kumar, P; Narasimhan, B

    2014-02-01

    A series of Schiff bases (1-17) and esters (18-28) of stearic acid was synthesized and characterized by physicochemical as well as spectral means. The synthesized compounds were evaluated in vitro for their antimicrobial activity by tube dilution method. The antimicrobial screening results indicated that the compounds having electron releasing groups on benzylidene nucleus were found to be more active against bacterial strains and compounds having electron withdrawing groups on benzylidene nucleus were found to be more active against fungal strains. QSAR studies demonstrated that electronic parameters dipole moment (µ) and total energy (Te) were the most important descriptors in describing the antimicrobial activity of synthesized stearic acid derivatives.

  3. Okadaic acid disrupts Golgi structure and impairs enzyme synthesis and secretion in the rat pancreas.

    PubMed

    Waschulewski, I H; Kruse, M L; Agricola, B; Kern, H F; Schmidt, W E

    1996-06-01

    Okadaic acid, a serine/threonine phosphatase inhibitor, has been shown to inhibit rat pancreatic enzyme secretion by interference with late processes in stimulus-secretion coupling. To further characterize its action, we studied the effect of okadaic acid on secretion of newly synthesized proteins, protein synthesis, and cellular ultrastructure in pancreatic lobules derived from rats stimulated in vivo by feeding the synthetic proteinase inhibitor FOY-305. Okadaic acid completely blocked protein secretion at concentrations that inhibit the Ca2+/calmodulin-dependent protein phosphatase 2b, calcineurin. Protein synthesis was abolished at 10(-6) mol/l and reduced by 60% at 5 x 10(-7) mol/l okadaic acid. Pancreatic lobules exposed to 5 x 10(-7) mol/l okadaic acid for 20 min fully restored their secretory capacity on removal of the drug; whereas, after a preincubation with okadaic acid for > 40 min, protein secretion remained impaired during the recovery period. Electron microscopic examination of pancreatic acinar cells treated with 5 x 10(-7) mol/l okadaic acid revealed a dilated Golgi complex after 15 and 30 min and a subsequent fragmentation of Golgi cisternae into clouds of small uniform vesicles after 60 min. Reassembly of Golgi stacks occurred after a 60-min recovery without okadaic acid. These data indicate that serine/threonine phosphatases play an important role not only in the regulation of pancreatic enzyme synthesis and exocytosis but also are crucial for the maintenance of normal Golgi architecture and function in the exocrine rat pancreas. These effects are probably not exclusively mediated via type 2b calcineurin-like protein phosphatases.

  4. Effect of nerve growth factor on the synthesis of amino acids in PC12 cells

    SciTech Connect

    Zielke, H.R.; Tildon, J.T.; Kauffman, F.C.; Baab, P.J. )

    1989-04-01

    Radioactive short-chain fatty acids preferentially label glutamine relative to glutamate in brain due to compartmentation of glutamine and glutamate. To determine whether this phenomenon occurs in a single cell culture model, we examined the effect of fatty acid chain length on the synthesis as well as pool size of selected amino acids in rat pheochromocytoma PC12 cells, a cell culture model of the large glutamate compartment in neurons. Intracellular 14C-amino acids were quantitated by HPLC, and the incorporation of (U-14C)-glucose, (1-14C)-butyrate, (1-14C)-octanoate, and (1-14C)-palmitate into five amino acids was measured in native and NGF-treated PC12 cells. NGF pretreatment decreased the intracellular concentration of amino acids as did addition of fatty acids but these effects were not additive. Specific activities of amino acids in native cells labelled by 14C-octanoate were 1,300 DPM/nmol, 490 DPM/nmol, 200 DPM/nmol, and 110 DPM/nmol for glutamate, aspartate, glutamine, and serine, respectively. No radioactivity was detected in alanine. Similar specific activities were noted when 14C-butyrate was the precursor; however, there was at least 5-fold less if 14C-palmitate was the precursor. Pretreatment of cells with NGF decreased the specific activity of amino acids by 25-65%. Specific activities of amino acids synthesized from 14C-glucose decreased in the following order: glutamate, 1,640 DPM/nmol; aspartate, 1,210 DPM/nmol; alanine, 580 DPM/nmol; glutamine, 275 DPM/nmol; and serine, 80 DPM/nmol for native cells. NGF pretreatment decreased the specific activities of glutamate and glutamine, but not of the other 3 amino acids. The preferred precursor for glutamate synthesis in native PC12 cells was glucose followed by octanoate, butyrate and palmitate (16:6:3:1).

  5. Synthesis and phosphorylation of the glial fibrillary acidic protein during brain development: A tissue slice study

    SciTech Connect

    Noetzel, M.J. )

    1990-01-01

    Brain slices were incubated with either (3H) amino acids or (32P) orthophosphate in order to characterize the synthesis and phosphorylation of the glial fibrillary acidic protein (GFAP) in the rat nervous system. The incorporation of (3H) amino acids into GFAP was found to increase significantly during early postnatal development, reaching a peak of activity on day 5 of life and then declining over the next 2 weeks. Concomitant with this peak of synthetic activity the content of GFAP in rat brain was also observed to increase dramatically. GFAP continued to accumulate in brain through postnatal day 30 despite a decrease in the synthesis of the protein. These results indicate that the increase in GFAP during the first month of life cannot be ascribed solely to the rate of GFAP synthesis. The findings are consistent with the hypothesis that during later stages of astrocytic development the accumulation of GFAP may be primarily dependent upon a low rate of protein degradation. The pattern of GFAP phosphorylation in the developing rat brain differed from that observed for the incorporation of (3H) amino acids. The peak incorporation of 32P into GFAP occurred on postnatal day 10 at a time when synthesis of the protein had declined by 43%. These findings suggest that during development phosphorylation of GFAP is mediated by factors different from those directing its synthesis. In addition, phosphorylation of GFAP did not alter its solubility in cytoskeletal preparations indicating that GFAP phosphorylation is probably not a major regulatory mechanism in disassembly of the astroglial filaments.

  6. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  7. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes.

    PubMed

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-08-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  8. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  9. Synthesis and characterization of ultraviolet light-emitting organic acids.

    PubMed

    An, Chun-Ai; Guo, Yanchao; Si, Zhenjun; Duan, Qian

    2014-05-01

    Three ultraviolet light-emitting organic acids of 3,3'-(4-phenyl-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-1), 4,4',4″-(4H-1,2,4-triazole-3,4,5-triyl)tribenzoic acid (Tz-2), and 4,4'-(4-(4'-carboxy-[1,1'-biphenyl]-4-yl)-4H-1,2,4-triazole-3,5-diyl)dibenzoic acid (Tz-3) were successfully synthesized and fully characterized by the (1)H NMR, the IR absorption spectra, and the X-ray single crystal diffraction. It was found that Tz-1, Tz-2, and Tz-3 could give out the ultraviolet photoluminescent spectra centered at 369 nm, 365 nm and 350 nm, respectively. The luminescence quantum yields of Tz-1 and Tz-2 were measured to be 0.20 and 0.14, respectively. Additionally, the density functional theory (DFT) and the time-dependent DFT calculations were also carried out for Tz-1, Tz-2, and Tz-3.

  10. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  11. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    PubMed

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  12. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  13. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  14. An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

    PubMed

    Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

    2014-05-20

    Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies.

  15. Synthesis and characterization of a pH responsive folic acid functionalized polymeric drug delivery system.

    PubMed

    Li, Xia; McTaggart, Matt; Malardier-Jugroot, Cecile

    2016-01-01

    We report the computational analysis, synthesis and characterization of folate functionalized poly(styrene-alt-maleic anhydride), PSMA for drug delivery purpose. The selection of the proper linker between the polymer and the folic acid group was performed before conducting the synthesis using Density Functional Theory (DFT). The computational results showed the bio-degradable linker 2, 4-diaminobutyric acid, DABA as a good candidate allowing flexibility of the folic acid group while maintaining the pH sensitivity of PSMA, used as a trigger for drug release. The synthesis was subsequently carried out in multi-step experimental procedures. The functionalized polymer was characterized using InfraRed spectroscopy, Nuclear Magnetic Resonance and Dynamic Light Scattering confirming both the chemical structure and the pH responsiveness of PSMA-DABA-Folate polymers. This study provides an excellent example of how computational chemistry can be used in selection process for the functional materials and product characterization. The pH sensitive polymers are expected to be used in delivering anti-cancer drugs to solid tumors with overly expressed folic acid receptors. PMID:27183249

  16. A branched chain amino acid metabolite drives vascular transport of fat and causes insulin resistance

    PubMed Central

    Jang, Cholsoon; Oh, Sungwhan F; Wada, Shogo; Rowe, Glenn C; Liu, Laura; Chan, Mun Chun; Rhee, James; Hoshino, Atsushi; Kim, Boa; Ibrahim, Ayon; Baca, Luisa G; Kim, Esl; Ghosh, Chandra C; Parikh, Samir M; Jiang, Aihua; Chu, Qingwei; Forman, Daniel E.; Lecker, Stewart H.; Krishnaiah, Saikumari; Rabinowitz, Joshua D; Weljie, Aalim M; Baur, Joseph A; Kasper, Dennis L; Arany, Zoltan

    2016-01-01

    Epidemiological and experimental data implicate branched chain amino acids (BCAAs) in the development of insulin resistance, but the mechanisms underlying this link remain unclear.1–3 Insulin resistance in skeletal muscle stems from excess accumulation of lipid species4, a process that requires blood-borne lipids to first traverse the blood vessel wall. Little is known, however, of how this trans-endothelial transport occurs or is regulated. Here, we leverage PGC-1α, a transcriptional coactivator that regulates broad programs of FA consumption, to identify 3-hydroxy-isobutyrate (3-HIB), a catabolic intermediate of the BCAA valine, as a novel paracrine regulator of trans-endothelial fatty acids (FA) transport. 3-HIB is secreted from muscle cells, activates endothelial FA transport, stimulates muscle FA uptake in vivo, and promotes muscle lipid accumulation and insulin resistance in animals. Conversely, inhibiting the synthesis of 3-HIB in muscle cells blocks the promotion of endothelial FA uptake. 3-HIB levels are elevated in muscle from db/db mice and from subjects with diabetes. These data thus unveil a novel mechanism that regulates trans-endothelial flux of FAs, revealing 3-HIB as a new bioactive signaling metabolite that links the regulation of FA flux to BCAA catabolism and provides a mechanistic explanation for how increased BCAA catabolic flux can cause diabetes. PMID:26950361

  17. LC/MS/MS identification of some folic acid degradation products after E-beam irradiation

    NASA Astrophysics Data System (ADS)

    Araújo, M. M.; Marchioni, E.; Zhao, M.; Kuntz, F.; Di Pascoli, T.; Villavicencio, A. L. C. H.; Bergaentzle, M.

    2012-08-01

    Folates belong to the B vitamin group based on the parental compound folic acid (FA). They are involved in important biochemical processes like DNA synthesis and repair. FA is composed of a pteridine ring, p-aminobenzoic acid and glutamate moieties. The human metabolism is not able to synthesize folates and therefore obtain them from diet. FA, a synthetic vitamin, is used as a food fortificant because of its low price, relative stability and increased bioavailability compared to natural folate forms. FA is known to be a sensitive compound easily degradable in aqueous solution by ultraviolet and visible light towards various by-products. Irradiation is a process for preservation of foods that uses accelerated electrons, gamma rays or X-rays. Irradiation is proposed for the treatment of various food products, eliminating or reducing pathogens and insects, increasing the storage time and replacing chemical fumigants. This study concerns the identification of degradation products of FA after E-beam irradiation. FA aqueous solutions were irradiated with a Van de Graaff electrons beam accelerator (2 MeV, 100 μA current, 20 cm scan width, dose rate about 2 kGy/s). Applied doses were between 0 (control) and 10.0 kGy. Absorbed doses were monitored with FWT 60.00 radiochromic dosimeters.

  18. [New biological active derivatives of indomethacin and acetylsalicylic acid. Synthesis, physico-chemical characterisation and structure validation].

    PubMed

    Stan, Catalina; Stefanache, Alina; Dumitrache, M

    2006-01-01

    It is well known that niflumic acid glycinamide has a good antiinflammatory action useful in gum inflammatory diseases. The objective of this study was to obtain new glycinamides of acetylsalicylic acid and indomethacin, which could have a better antiinflammatory action than niflumic acid glycinamide. The study presents the synthesis, physico-chemical characterisation and structure validation of these glycinamides.

  19. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi

    2015-02-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  20. Dihydroasparagusic acid: antioxidant and tyrosinase inhibitory activities and improved synthesis.

    PubMed

    Venditti, Alessandro; Mandrone, Manuela; Serrilli, Anna Maria; Bianco, Armandodoriano; Iannello, Carmelina; Poli, Ferruccio; Antognoni, Fabiana

    2013-07-17

    Dihydroasparagusic acid (DHAA) is the reduced form of asparagusic acid, a sulfur-containing flavor component produced by Asparagus plants. In this work, DHAA was synthetically produced by modifying some published protocols, and the synthesized molecule was tested in several in vitro assays (DPPH, ABTS, FRAP-ferrozine, BCB, deoxyribose assays) to evaluate its radical scavenging activity. Results show that DHAA is endowed with a significant in vitro antioxidant activity, comparable to that of Trolox. DHAA was also evaluated for its inhibitory activity toward tyrosinase, an enzyme involved, among others, in melanogenesis and in browning processes of plant-derived foods. DHAA was shown to exert an inhibitory effect on tyrosinase activity, and the inhibitor kinetics, analyzed by a Lineweaver-Burk plot, exhibited a competitive mechanism. Taken together, these results suggest that DHAA may be considered as a potentially active molecule for use in various fields of application, such as pharmaceutical, cosmetics, agronomic and food. PMID:23790134

  1. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  2. Synthesis and antifungal activity of bile acid-derived oxazoles.

    PubMed

    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela

    2016-04-01

    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives. PMID:26827629

  3. First synthesis of thia steroids from cholic acid.

    PubMed

    Ibrahim-Ouali, Malika; Rocheblave, Luc

    2010-10-01

    Heterosteroids remain interesting due to their potential biological activities. This prompted us to synthesize novel thia steroids possessing the heteroatom in the A-ring. We set out to describe a new and versatile method for preparing 3-thia steroids from cholic acid via a selective oxidation of one hydroxyl group, a Baeyer-Villiger oxidation and a photolysis as the key steps. The characteristic (1)H and (13)C NMR spectroscopic features of the synthesized compounds are reported.

  4. Lipid characterization of seed oils from high-palmitic, low-palmitoleic, and very high-stearic acid sunflower lines.

    PubMed

    Serrano-Vega, María J; Martínez-Force, Enrique; Garcés, Rafael

    2005-04-01

    Information obtained in recent years regarding the enzymes involved in FA synthesis can now be applied to develop novel sunflower lines by incorporating enzymes with specific characteristics into lines with a defined background. We have generated three highly saturated mutant lines in this way and characterized their FA content. The new high-palmitic, low-palmitoleic lines CAS-18 and CAS-25, the latter on a high-oleic background, have been selected from the high-stearic mutant CAS-3 by introducing a deficient stearic acid desaturase in a high-palmitic background from the previously developed mutant lines CAS-5 and CAS-12, respectively. As such, the desaturation of palmitic acid and the synthesis of palmitoleic acid and its derivatives (asclepic and palmitolinoleic acids) were reduced in these high-palmitic lines, increasing the stearic acid content. Likewise, introducing a FA thioesterase from a high-palmitic line (e.g., CAS-5) into the high-stearic CAS-3 increased the stearic acid content from 27 to 32% in the new high-stearic line CAS-31. As previously described in high-palmitic lines, high growth temperatures did not reduce the linoleic acid content of the oil. Furthermore, the FA composition of TAG, DAG, and phospholipids was modified in these lines. Besides a high degree of saturation, the TAG from these new vegetable oils have a low content of saturated FA in the sn-2 position. The alpha asymmetric coefficient obtained also indicates that the saturated FA are asymmetrically distributed within the TAG molecules. Indeed, the disaturated TAG content rose from 31.8 to 48.2%. These values of disaturated TAG are the highest to date in a temperate oilseed.

  5. Synthesis and properties of N-hexadecyl ethylenediamine triacetic acid.

    PubMed

    Wang, Xixin; Zhao, Jianling; Yao, Xingzhi; Chen, Wentao

    2004-11-15

    A new kind of surfactant named N-hexadecyl ethylenediamine triacetic acid (HED3A) was synthesized from anhydrous ethylenediamine, 1-bromohexadecane, and chloroacetic acid. Testing showed stability of HED3A in hard water, wetting power, dispersing power, and surface tension increased along with pH value. Stability in hard water of trisodium N-hexadecyl ethylenediamine triacetate (3NaHED3A) was at level 4, which was better than that of sodium dodecylsulfate (SDS) and sodium dodecylbenzene sulfonate (LAS). Other properties of 3NaHED3A including wetting power, dispersing power, emulsifying power, and surface tension had intermediate value between SDS, LAS, AES, peregal-O, and cetyltrimethylammonium chloride (CTAC). The ethylenediamine triacetic acid (ED3A) group in 3NaHED3A can chelate many kinds of metal ions, which indicates a promising application prospect in many fields including metal anticorrosion, corrosion control agent, additives in electroplating solution, and ore selection and solid surface treatment.

  6. Synthesis and bioactivity of 2',3'-benzoabscisic acid analogs.

    PubMed

    Han, Xiaoqiang; Wan, Chuan; Li, Xiuyun; Li, Hong; Yang, Dongyan; Du, Shijie; Xiao, Yumei; Qin, Zhaohai

    2015-06-01

    2',3'-Benzoabscisic acid 4a is significantly more active than (±)-ABA and can be potentially used as a plant growth regulator for agriculture. In this study, six 4a analogs were designed and synthesized. Bioassay showed that 4a displayed greater activity than (±)-ABA and the six analogs produced less inhibition than 4a itself. Specially, some analogs displayed markedly different activities to different physiological and biochemical process, which were largely different from ABA and 4a. Compared to (±)-ABA, 4b and 4c were more effective germination inhibitors for lettuce, but less effective inhibitors for rice elongation. Five-membered analog 5 was higher or slightly weaker in inhibiting Arabidopsis seed germination and rice elongation, respectively, but at least 10 times less effective than (±)-ABA in lettuce seed germination. Dual acid 6 and alkyne acid 20 nearly produced no inhibitory activity for Arabidopsis seed germination, but displayed excellent activity in inhibiting rice seedling growth. The preference of the analogs to different physiology process indicated that they might provide a strategy to develop novel ABA agonists or antagonist and be used as probe to investigate the function of different ABA receptors. PMID:25913114

  7. Fatty Acid Phytyl Ester Synthesis in Chloroplasts of Arabidopsis[W

    PubMed Central

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-01-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence. PMID:22623494

  8. Role of ferrocyanides in the prebiotic synthesis of α-amino acids.

    PubMed

    Ruiz-Bermejo, Marta; Osuna-Esteban, Susana; Zorzano, María-Paz

    2013-06-01

    We investigated the synthesis of α-amino acids under possible prebiotic terrestrial conditions in the presence of dissolved iron (II) in a simulated prebiotic ocean. An aerosol-liquid cycle with a prebiotic atmosphere is shown to produce amino acids via Strecker synthesis with relatively high yields. However, in the presence of iron, the HCN was captured in the form of a ferrocyanide, partially inhibiting the formation of amino acids. We showed how HCN captured as Prussian Blue (or another complex compound) may, in turn, have served as the HCN source when exposed to UV radiation, allowing for the sustained production of amino acids in conjunction with the production of oxyhydroxides that precipitate as by-products. We conclude that ferrocyanides and related compounds may have played a significant role as intermediate products in the prebiotic formation of amino acids and oxyhydroxides, such as those that are found in iron-containing soils and that the aerosol cycle of the primitive ocean may have enhanced the yield of the amino acid production.

  9. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-01-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  10. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  11. Regulation of L-ascorbic acid content in strawberry fruits

    PubMed Central

    Cruz-Rus, Eduardo; Amaya, Iraida; Sánchez-Sevilla, José F.; Botella, Miguel A.; Valpuesta, Victoriano

    2011-01-01

    Plants have several L-ascorbic acid (AsA) biosynthetic pathways, but the contribution of each one to the synthesis of AsA varyies between different species, organs, and developmental stages. Strawberry (Fragaria×ananassa) fruits are rich in AsA. The pathway that uses D-galacturonate as the initial substrate is functional in ripe fruits, but the contribution of other pathways to AsA biosynthesis has not been studied. The transcription of genes encoding biosynthetic enzymes such as D-galacturonate reductase (FaGalUR) and myo-inositol oxygenase (FaMIOX), and the AsA recycling enzyme monodehydroascorbate reductase (FaMDHAR) were positively correlated with the increase in AsA during fruit ripening. Fruit storage for 72 h in a cold room reduced the AsA content by 30%. Under an ozone atmosphere, this reduction was 15%. Ozone treatment increased the expression of the FaGalUR, FaMIOX, and L-galactose-1-phosphate phosphatase (FaGIPP) genes, and transcription of the L-galactono-1,4-lactone dehydrogenase (FaGLDH) and FAMDHAR genes was higher in the ozone-stored than in the air-stored fruits. Analysis of AsA content in a segregating population from two strawberry cultivars showed high variability, which did not correlate with the transcription of any of the genes studied. Study of GalUR protein in diverse cultivars of strawberry and different Fragaria species showed that a correlation between GalUR and AsA content was apparent in most cases, but it was not general. Three alleles were identified in strawberry, but any sequence effect on the AsA variability was eliminated by analysis of the allele-specific expression. Taken together, these results indicate that FaGalUR shares the control of AsA levels with other enzymes and regulatory elements in strawberry fruit. PMID:21561953

  12. Eutectic Phases in Ice Facilitate Nonenzymatic Nucleic Acid Synthesis

    NASA Astrophysics Data System (ADS)

    Kanavarioti, Anastassia; Monnard, Pierre-Alain; Deamer, David W.

    2001-09-01

    Polymeric compounds similar to oligonucleotides are relevant to the origin of life and particularly to the concept of an RNA world. Although short oligomers of RNA can be synthesized nonenzymatically under laboratory conditions by second-order reactions in concentrated solutions, there is no consensus on how these polymers could have been synthesized de novo on the early Earth from dilute solutions of monomers. To address this question in the context of an RNA world, we have explored ice eutectic phases as a reaction medium. When an aqueous solution freezes, the solutes become concentrated in the spaces between the ice crystals. The increased concentration offsets the effect of the lower temperature and accelerates the reaction. Here we show that in the presence of metal ions in dilute solutions, frozen samples of phosphoimidazolide-activated uridine react within days at -18°C to form oligouridylates up to 11 bases long. Product yields typically exceed 90%, and ~30% of the oligomers include one or more 3‧-5‧ linkages. These conditions facilitate not only the notoriously difficult oligouridylate synthesis, but also the oligomerization of activated cytidylate, adenylate, and guanylate. To our knowledge, this represents the first report to indicate that ice matrices on the early Earth may have accelerated certain prebiotic polymerization reactions.

  13. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

  14. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed. PMID:27677557

  15. Fatty acid metabolism in the regulation of T cell function.

    PubMed

    Lochner, Matthias; Berod, Luciana; Sparwasser, Tim

    2015-02-01

    The specific regulation of cellular metabolic processes is of major importance for directing immune cell differentiation and function. We review recent evidence indicating that changes in basic cellular lipid metabolism have critical effects on T cell proliferation and cell fate decisions. While induction of de novo fatty acid (FA) synthesis is essential for activation-induced proliferation and differentiation of effector T cells, FA catabolism via β-oxidation is important for the development of CD8(+) T cell memory as well as for the differentiation of CD4(+) regulatory T cells. We consider the influence of lipid metabolism and metabolic intermediates on the regulation of signaling and transcriptional pathways via post-translational modifications, and discuss how an improved understanding of FA metabolism may reveal strategies for manipulating immune responses towards therapeutic outcomes. PMID:25592731

  16. Development of electrochemical folic acid sensor based on hydroxyapatite nanoparticles

    NASA Astrophysics Data System (ADS)

    Kanchana, P.; Sekar, C.

    2015-02-01

    We report the synthesis of hydroxyapatite (HA) nanoparticles (NPs) by a simple microwave irradiation method and its application as sensing element for the precise determination of folic acid (FA) by electrochemical method. The structure and composition of the HA NPs characterized using XRD, FTIR, Raman and XPS. SEM and EDX studies confirmed the formation of elongated spherical shaped HA NPs with an average particle size of about 34 nm. The HA NPs thin film on glassy carbon electrode (GCE) were deposited by drop casting method. Electrocatalytic behavior of FA in the physiological pH 7.0 was investigated by cyclic voltammetry (CV), linear sweep voltammetry (LSV) and chronoamperometry. The fabricated HA/GCE exhibited a linear calibration plot over a wide FA concentration ranging from 1.0 × 10-7 to 3.5 × 10-4 M with the detection limit of 75 nM. In addition, the HA NPs modified GCE showed good selectivity toward the determination of FA even in the presence of a 100-fold excess of ascorbic acid (AA) and 1000-fold excess of other common interferents. The fabricated biosensor exhibits good sensitivity and stability, and was successfully applied for the determination of FA in pharmaceutical samples.

  17. Acid gradient across plasma membrane can drive phosphate bond synthesis in cancer cells: acidic tumor milieu as a potential energy source.

    PubMed

    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

    2015-01-01

    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target.

  18. Benign synthesis of 2-ethylhexanoic acid by cytochrome P450cam: enzymatic, crystallographic, and theoretical studies.

    PubMed

    French, K J; Strickler, M D; Rock, D A; Rock, D A; Bennett, G A; Wahlstrom, J L; Goldstein, B M; Jones, J P

    2001-08-14

    This study examines the ability of P450cam to catalyze the formation of 2-ethylhexanoic acid from 2-ethylhexanol relative to its activity on the natural substrate camphor. As is the case for camphor, the P450cam exhibits stereoselectivity for binding (R)- and (S)-2-ethylhexanol. Kinetic studies indicate (R)-2-ethylhexanoic acid is produced 3.5 times as fast as the (S)-enantiomer. In a racemic mixture of 2-ethylhexanol, P450cam produces 50% more (R)-2-ethylhexanoic acid than (S)-2-ethylhexanoic acid. The reason for stereoselective 2-ethylhexanoic acid production is seen in regioselectivity assays, where (R)-2-ethylhexanoic acid comprises 50% of total products while (S)-2-ethylhexanoic acid comprises only 13%. (R)- and (S)-2-ethylhexanol exhibit similar characteristics with respect to the amount of oxygen and reducing equivalents consumed, however, with (S)-2-ethylhexanol turnover producing more water than the (R)-enantiomer. Crystallographic studies of P450cam with (R)- or (S)-2-ethylhexanoic acid suggest that the (R)-enantiomer binds in a more ordered state. These results indicate that wild-type P450cam displays stereoselectivity toward 2-ethylhexanoic acid synthesis, providing a platform for rational active site design. PMID:11583152

  19. Study on Synthesis, Characterization and Antiproliferative Activity of Novel Diisopropylphenyl Esters of Selected Fatty Acids.

    PubMed

    Reddy, Yasa Sathyam; Kaki, Shiva Shanker; Rao, Bala Bhaskara; Jain, Nishant; Vijayalakshmi, Penumarthy

    2016-01-01

    The present study describes the synthesis, characterization and evaluation of antiproliferative activity of novel diisopropylphenyl esters of alpha-linolenic acid (ALA), valproic acid (VA), butyric acid (BA) and 2-ethylhexanoic acid (2-EHA). These esters were chemically synthesized by the esterification of fatty acids with 2,6-diisopropylphenol and 2,4-diisopropylphenol (propofol). The structure of new conjugates viz. propofol-(alpha-linolenic acid) (2,6P-ALA and 2,4P-ALA), propofol-valproic acid (2,6P-VA and 2,4P-VA), propofol-butyric acid (2,6P-BA and 2,4P-BA) and propofol-(2-ethylhexanoic acid) (2,6P2-EHA and 2,4P-2-EHA) were characterized by FT-IR, NMR ((1)H, (13)C) and mass spectral data. The synthesized conjugates having more lipophilic character were tested for antiproliferative in vitro studies on A549, MDA-MB-231, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. All the conjugates showed specific growth inhibition on studied cancer cell lines. Among the synthesized esters, the conjugates synthesized from BA, VA and 2-EHA exhibited prominent growth inhibition against A549, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. The preliminary results suggest that the entire novel conjugates possess antiproliferative properties that reduce the proliferation of cancer cells in vitro.

  20. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail. PMID:27452282

  1. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail.

  2. Stimulation of phosphatidic acid of calcium influx and cyclic GMP synthesis in neuroblastoma cells.

    PubMed

    Ohsako, S; Deguchi, T

    1981-11-10

    Phosphatidic acid added to the medium markedly elevated intracellular cyclic GMP content in cultured neuroblastoma N1E 115 cells. There was a significant elevation of cyclic GMP with 1 micrograms/ml and a maximum (70-fold) elevation with 100 micrograms/ml of phosphatidic acid. Other natural phospholipids did not increase, or increased only slightly, the cyclic GMP content in the cells. The elevation of cyclic GMP content by phosphatidic acid was absolutely dependent on extracellular calcium. Phosphatidic acid stimulated the influx of calcium into neuroblastoma cells 2- to 5-fold. The pattern of the calcium influx induced by phosphatidic acid was comparable to that of cyclic GMP elevation. The stimulation of calcium influx by phosphatidic acid was also observed in cultured heart cells, indicating that phosphatidic acid acts as a calcium ionophore or opens a specific calcium-gate in a variety of cell membranes. Treatment of neuroblastoma cells with phospholipase C increased 32Pi labeling of phosphatidic acid, stimulated the influx of calcium, and elevated the cyclic GMP content in the cells. Thus exogenous as well as endogenous phosphatidic acid stimulates the translocation of calcium across cell membranes and, as a consequence, induces the synthesis of cyclic GMP in the neuroblastoma cells.

  3. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  4. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  5. Synthesis and Evaluation of Aryl Boronic Acids as Fluorescent Artificial Receptors for Biological Carbohydrates

    PubMed Central

    Craig, Sandra

    2011-01-01

    Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855

  6. Synthesis of Aminoboronic Acid Derivatives from Amines and Amphoteric Boryl Carbonyl Compounds.

    PubMed

    Diaz, Diego B; Scully, Conor C G; Liew, Sean K; Adachi, Shinya; Trinchera, Piera; St Denis, Jeffrey D; Yudin, Andrei K

    2016-10-01

    Herein, we demonstrate the use of α-boryl aldehydes and acyl boronates in the synthesis of aminoboronic acid derivatives. This work highlights the untapped potential of boron-substituted iminium ions and offers insights into the behavior of N-methyliminodiacetyl (MIDA) boronates during condensation and tautomerization processes. The preparative value of this contribution lies in the demonstration that various amines, including linear and cyclic peptides, can be readily conjugated with boron-containing fragments. A mild deprotection of amino MIDA-boronates enables access to α- and β-aminoboronic acids in high chemical yields. This simple process should be applicable to the synthesis of a wide range of bioactive molecules as well as precursors for cross-coupling reactions. PMID:27584917

  7. Synthesis and in vitro Evaluation of Polymeric Prodrug of Ibuprofen with Amino Acid Spacer.

    PubMed

    Redasani, Vivekkumar K; Bari, Sanjay B

    2015-01-01

    The present work is an agreement with simple and efficient method of improving the therapeutic efficacy of ibuprofen by masking its acidic moiety. It aims to reduce gastrointestinal side effects by controlling the rate, duration and site of release. This is achieved by synthesis and evaluation of polymeric prodrug of ibuprofen with natural polymer sodium alginate. The synthesis was supported by N-protected serine as spacer due to chemical incompatibility of drug and polymer. Synthesized prodrug was characterized for confirmation of said structures. The in-vitro dissolution profile of ibuprofen-alginate prodrug showed that the release of the drug is significantly higher in case of pH 7.2 buffer as compared to ibuprofen, which might be due to ester group adjacent to drug get hydrolyzed. The hydrolysis was found to be with faster rate in alkaline media than that of in acidic media.

  8. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.

    1980-01-01

    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  9. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

    PubMed

    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

    2016-01-01

    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed. PMID:27589703

  10. REGULATION OF CARDIAC AND SKELETAL MUSCLE PROTEIN SYNTHESIS BY INDIVIDUAL BRANCHED-CHAIN AMINO ACIDS IN NEONATAL PIGS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Skeletal muscle grows at a very rapid rate in the neonatal pig, due in part to an enhanced sensitivity of protein synthesis to the postprandial rise in amino acids. An increase in leucine alone stimulates protein synthesis in skeletal muscle of the neonatal pig; however, the effect of isoleucine and...

  11. Highly diastereoselective synthesis of quaternary α-trifluoromethyl α-amino acids from chiral imines of trifluoropyruvate.

    PubMed

    Min, Qiao-Qiao; He, Chun-Yang; Zhou, Haibing; Zhang, Xingang

    2010-11-14

    An efficient method for highly diastereoselective synthesis of quaternary α-trifluoromethyl α-amino acids was developed via indium mediated allylation of (R)-phenylglycinol methyl ether based imines of trifluoropyruvate in good yields with high diastereoselectivities at room temperature; to illustrate the application of this method in organic synthesis, 2-allyl-2-(trifluoromethyl) aziridine was prepared in an efficient manner.

  12. Synthesis, biological activity, and bioavailability of moschamine, a safflomide-type phenylpropenoic acid amide found in Centaurea cyanus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...

  13. A practical synthesis of 3,4-diethoxybenzthioamide based on Friedel-Crafts reaction with potassium thiocyanate in methanesulfonic acid.

    PubMed

    Aki, Shinji; Fujioka, Takafumi; Ishigami, Masashi; Minamikawa, Jun-ichi

    2002-09-01

    The synthesis of 3,4-diethoxybenzthioamide, the key intermediate for OPC-6535, is achieved by employing Friedel-Crafts reaction of 1,2-diethoxybenzene with potassium thiocyanate in methanesulfonic acid at ambient temperature.

  14. Synthesis of Fused Polycyclic Indoles by Brønsted Acid-Catalyzed Intramolecular Alkylation of Indoles with Alcohols.

    PubMed

    Suárez, Anisley; Gohain, Mukut; Fernández-Rodríguez, Manuel A; Sanz, Roberto

    2015-10-16

    An efficient methodology for the synthesis of a series of new fused polyclyclic indoles has been developed by Brønsted acid-catalyzed intramolecular Friedel-Crafts reactions of properly designed indolyl alcohols. PMID:26418556

  15. Green Chemistry in the Organic Teaching Laboratory: An Environmentally Benign Synthesis of Adipic Acid

    NASA Astrophysics Data System (ADS)

    Reed, Scott M.; Hutchison, James E.

    2000-12-01

    Environmentally benign ("green") chemical techniques are growing in importance in academic and industrial research laboratories. Such chemistry has been slow to appear in teaching laboratories, owing in part to a lack of published material on this subject. Recent developments in green synthesis provide opportunities to introduce this material in teaching laboratories. We present a synthesis of adipic acid that utilizes green reagents (hydrogen peroxide as the oxidant), solvents (water), and methods (phase-transfer catalysis, catalyst recycling). The synthesis works well and provides an excellent forum for emphasizing green chemical concepts while teaching laboratory skills. It demonstrates reuse of a product, synthesis using a nonhazardous solvent, elimination of deleterious by-products, and use of a recyclable catalyst. It can be carried out on either the macroscale or microscale and generates little waste if the catalyst solution is recycled. This experiment fits well in a sophomore organic sequence; it covers the topics of oxidation, phase-transfer catalysis, and the technique of recrystallization, reinforces lecture topics such as alkene synthesis and reactivity, and provides an opportunity to introduce polymer chemistry.

  16. Studies on independent synthesis of cytoplasmic ribonucleic acids in Acetabularia mediterranea.

    PubMed

    NAORA, H; BRACHET, J

    1960-07-01

    1. The RNA content of anucleate and nucleate fragments of Acetabularia has been measured. It was found that there is a net synthesis of RNA in nucleate fragments. On the other hand, the RNA content of anucleate fragments did not change significantly after enucleation. 2. Anucleate fragments, however, can readily incorporate (14)C-labeled adenine, orotic acid, and carbon dioxide into their cytoplasmic RNA. 3. The results of experiments on (14)CO(2) incorporation into the RNA of anucleate and nucleate fragments suggest that there is a mechanism for de novo synthesis of RNA in anucleate cytoplasm. 4. In Acetabularia, 81 per cent of the cytoplasmic RNA is bound to a large granule fraction, consisting mainly of chloroplasts. Even after removal of the nucleus, RNA is synthesized in this "chloroplast" fraction. The chloroplasts are thus a major site of RNA synthesis in the cytoplasm of these algae. Synthesis of "chloroplastic" RNA, in anucleate fragments, possibly occurs at the expense of the RNA present in other fractions (microsomes and supernatant). 5. 8-Azaguanine stimulates regeneration and cap formation in anucleate fragments and does not inhibit RNA synthesis in these fragments.

  17. Oleic acid coated magnetic nano-particles: Synthesis and characterizations

    SciTech Connect

    Panda, Biswajit Goyal, P. S.

    2015-06-24

    Magnetic nano particles of Fe{sub 3}O{sub 4} coated with oleic acid were synthesized using wet chemical route, which involved co-precipitation of Fe{sup 2+} and Fe{sup 3+} ions. The nano particles were characterized using XRD, TEM, FTIR, TGA and VSM. X-ray diffraction studies showed that nano particles consist of single phase Fe{sub 3}O{sub 4} having inverse spinel structure. The particle size obtained from width of Bragg peak is about 12.6 nm. TEM analysis showed that sizes of nano particles are in range of 6 to 17 nm with a dominant population at 12 - 14 nm. FTIR and TGA analysis showed that -COOH group of oleic acid is bound to the surface of Fe{sub 3}O{sub 4} particles and one has to heat the sample to 278° C to remove the attached molecule from the surface. Further it was seen that Fe{sub 3}O{sub 4} particles exhibit super paramagnetism with a magnetization of about 53 emu/ gm.

  18. Enzymatic synthesis of enantiopure alpha- and beta-amino acids by phenylalanine aminomutase-catalysed amination of cinnamic acid derivatives.

    PubMed

    Wu, Bian; Szymanski, Wiktor; Wietzes, Piet; de Wildeman, Stefaan; Poelarends, Gerrit J; Feringa, Ben L; Janssen, Dick B

    2009-01-26

    The phenylalanine aminomutase (PAM) from Taxus chinensis catalyses the conversion of alpha-phenylalanine to beta-phenylalanine, an important step in the biosynthesis of the N-benzoyl phenylisoserinoyl side-chain of the anticancer drug taxol. Mechanistic studies on PAM have suggested that (E)-cinnamic acid is an intermediate in the mutase reaction and that it can be released from the enzyme's active site. Here we describe a novel synthetic strategy that is based on the finding that ring-substituted (E)-cinnamic acids can serve as a substrate in PAM-catalysed ammonia addition reactions for the biocatalytic production of several important beta-amino acids. The enzyme has a broad substrate range and a high enantioselectivity with cinnamic acid derivatives; this allows the synthesis of several non-natural aromatic alpha- and beta-amino acids in excellent enantiomeric excess (ee >99 %). The internal 5-methylene-3,5-dihydroimidazol-4-one (MIO) cofactor is essential for the PAM-catalysed amination reactions. The regioselectivity of amination reactions was influenced by the nature of the ring substituent.

  19. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  20. Synthesis of milk specific fatty acids and proteins by dispersed goat mammary-gland epithelial cells.

    PubMed Central

    Hansen, H O; Tornehave, D; Knudsen, J

    1986-01-01

    The method now described for preparation of dispersed lactating goat mammary-gland cells gives a high yield of morphologically and functionally normal mammary cells. The cells synthesize specific goat milk fatty acids in the right proportions, and they respond to hormones by increased protein synthesis. The cells can be frozen and thawed without losing the above properties, which makes them an excellent tool for metabolic and hormonal studies. Images Fig. 1. Fig. 2. PMID:3800930

  1. o-Iodoxybenzoic acid mediated oxidative desulfurization initiated domino reactions for synthesis of azoles.

    PubMed

    Chaudhari, Pramod S; Pathare, Sagar P; Akamanchi, Krishnacharaya G

    2012-04-20

    A systematic exploration of thiophilic ability of o-iodoxybenzoic acid (IBX) for oxidative desulfurization to trigger domino reactions leading to new methodologies for synthesis of different azoles is described. A variety of highly substituted oxadiazoles, thiadiazoles, triazoles, and tetrazoles have been successfully synthesized in good to excellent yields, starting from readily accessible thiosemicarbazides, bis-diarylthiourea, 1,3-disubtituted thiourea, and thioamides. PMID:22423599

  2. Synthesis and activity of 2-oxoamides containing long chain beta-amino acids.

    PubMed

    Constantinou-Kokotou, Violetta; Peristeraki, Anna; Kokotos, Christoforos G; Six, David A; Dennis, Edward A

    2005-07-01

    2-Oxoamides based on long chain beta-amino acids were synthesized. 1-Benzyl substituted long chain amines, needed for such synthesis, were synthesized starting from Boc-phenylalaninol. The oxidative conversion of a phenyl group to a carboxyl group was used as the key transformation synthetic step. The compounds synthesized were studied for their activity against GIVA PLA(2), and were proven to be weak inhibitors. PMID:15635664

  3. What is the relationship between gestational age and docosahexaenoic acid (DHA) and arachidonic acid (ARA) levels?

    PubMed

    Baack, Michelle L; Puumala, Susan E; Messier, Stephen E; Pritchett, Deborah K; Harris, William S

    2015-09-01

    Long chain polyunsaturated fatty acids (LCPUFA) including docosahexaenoic acid (DHA) and arachidonic acid (ARA) are increasingly transferred from mother to fetus late in pregnancy. Infants born before this transfer is complete are at risk for deficiency. This study determines the relationship between gestational age (GA) and circulating LCPUFA levels to better understand the unique needs of premature infants born at various GAs. Whole blood was collected within the first 7 days of life from 60 preterm (≤34 weeks GA) and 30 term infants (≥38 weeks GA) and FA levels were analyzed. Since concurrent intravenous lipid emulsion can skew composition data, blood LCPUFA concentrations were also measured. Levels were compared among groups, and linear regression models were used to examine the association between FA composition and GA. Preterm infants had significantly lower DHA and ARA levels than term peers, and whether assessed as concentrations or compositions, both directly correlated with GA (p<0.0001). Moreover, FA comparisons suggest that premature infants have impaired synthesis of LCPUFAs from precursors and may require preformed DHA and ARA. This study confirms that essential FA status is strongly related to GA, and that those babies born the earliest are at the greatest risk of LCPUFA deficiency.

  4. What is the Relationship between Gestational Age and Docosahexaenoic Acid (DHA) and Arachidonic Acid (ARA) Levels?

    PubMed Central

    Baack, Michelle L; Puumala, Susan E; Messier, Stephen E; Pritchett, Deborah K; Harris, William S

    2015-01-01

    Long chain polyunsaturated fatty acids (LCPUFA) including docosahexaenoic acid (DHA) and arachidonic acid (ARA) are increasingly transferred from mother to fetus late in pregnancy. Infants born before this transfer is complete are at risk for deficiency. This study determines the relationship between gestational age (GA) and circulating LCPUFA levels to better understand the unique needs of premature infants born at various GAs. Whole blood was collected within the first 7 days of life from 60 preterm (≤34 weeks GA) and 30 term infants (≥38 weeks GA) and FA levels were analyzed. Since concurrent intravenous lipid emulsion can skew composition data, blood LCPUFA concentrations were also measured. Levels were compared among groups, and linear regression models were used to examine the association between FA composition and GA. Preterm infants had significantly lower DHA and ARA levels than term peers, and whether assessed as concentrations or compositions, both directly correlated with GA (p<0.0001). Moreover, FA comparisons suggest that premature infants have impaired synthesis of LCPUFAs from precursors and may require preformed DHA and ARA. This study confirms that essential FA status is strongly related to GA, and that those babies born the earliest are at the greatest risk of LCPUFA deficiency. PMID:26205427

  5. Omega-6 and omega-3 fatty acids metabolism pathways in the body of pigs fed diets with different sources of fatty acids.

    PubMed

    Skiba, Grzegorz; Poławska, Ewa; Sobol, Monika; Raj, Stanisława; Weremko, Dagmara

    2015-01-01

    This study was carried out on 24 gilts (♀ Polish Large White × ♂ Danish Landrace) grown with body weight (BW) of 60 to 105 kg. The pigs were fed diets designed on the basis of a standard diet (appropriate for age and BW of pigs) where a part of the energy content was replaced by different fat supplements: linseed oil in Diet L, rapeseed oil in Diet R and fish oil in Diet F (6 gilts per dietary treatment). The fat supplements were sources of specific fatty acids (FA): in Diet L α-linolenic acid (C18:3 n-3, ALA); in Diet R linoleic acid (C18:2 n-6, LA) and in Diet F eicosapentaenoic acid (C20:5 n-3, EPA), docosapentaenoic acid (C22:5 n-3, DPA) and docosahexaenoic acid (C22:6 n-3, DHA). The protein, fat and total FA contents in the body did not differ among groups of pigs. The enhanced total intake of LA and ALA by pigs caused an increased deposition of these FA in the body (p < 0.01) and an increased potential body pool of these acids for further metabolism/conversions. The conversion efficiency of LA and ALA from the feed to the pig's body differed among groups (p < 0.01) and ranged from 64.4% to 67.2% and from 69.4% to 81.7%, respectively. In Groups L and R, the level of de novo synthesis of long-chain polyunsaturated FA was higher than in Group F. From the results, it can be concluded that the efficiency of deposition is greater for omega-3 FA than for omega-6 FA and depends on their dietary amount. The level of LA and ALA intake influences not only their deposition in the body but also the end products of the omega-3 and omega-6 pathways.

  6. Synthesis of kojic acid derivatives as secondary binding site probes of D-amino acid oxidase

    PubMed Central

    Raje, Mithun; Hin, Niyada; Duvall, Bridget; Ferraris, Dana V.; Berry, James F.; Thomas, Ajit G.; Alt, Jesse; Rojas, Camilo; Slusher, Barbara S.; Tsukamoto, Takashi

    2013-01-01

    A series of kojic acid (5-hydroxy-2-hydroxymethyl-4H-pyran-4-one) derivatives were synthesized and tested for their ability to inhibit D-amino acid oxidase (DAAO). Various substituents were incorporated into kojic acid at its 2-hydroxymethyl group. These analogs serve as useful molecular probes to explore the secondary binding site, which can be exploited in designing more potent DAAO inhibitors. PMID:23683589

  7. New Insight on the Synthesis of Neurotoxins Domoic Acid and Kainic Acid.

    PubMed

    Mollica, Adriano; Costante, Roberto; Stefanucci, Azzurra; Novellino, Ettore

    2015-01-01

    Mono or di-substituted prolines, namely proline chimeras of natural or synthetic origin, carry the side chain of other specific amino acids on the pyrrolidine ring. Thus, proline chimeras are useful tools for a wide range of chemical and biological applications as chiral synthons or building blocks for peptidomimetic design. We focused our attention on domoic acid and kainic acid and we report here a concise and up to date review on their stereoselective and asymmetric syntheses.

  8. Integrated process of distillation with side reactors for synthesis of organic acid esters

    SciTech Connect

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T

    2015-11-04

    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  9. Enantioselective Synthesis of Dialkylated α-Hydroxy Carboxylic Acids through Asymmetric Phase-Transfer Catalysis.

    PubMed

    Duan, Shaobo; Li, Sanliang; Ye, Xinyi; Du, Nuan-Nuan; Tan, Choon-Hong; Jiang, Zhiyong

    2015-08-01

    In the presence of an L-tert-leucine-derived urea-ammonium salt as phase-transfer catalyst, a highly enantioselective alkylation of 5H-oxazol-4-ones with various benzyl bromides and allylic bromides has been developed to furnish catalytic asymmetric synthesis of biologically important dialkylated α-hydroxy carboxylic acids with a broad scope. This is the first example of an L-amino acid-derived urea-ammonium salt being used as a phase-transfer catalyst with excellent catalytic efficiency.

  10. Synthesis and sintering of nanocrystalline hydroxyapatite powders by citric acid sol-gel combustion method

    SciTech Connect

    Han Yingchao; Li Shipu; Wang Xinyu; Chen Xiaoming

    2004-01-03

    The citric acid sol-gel combustion method has been used for the synthesis of nanocrystalline hydroxyapatite (HAP) powder from calcium nitrate, diammonium hydrogen phosphate and citric acid. The phase composition of HAP powder was characterized by X-ray powder diffraction analysis (XRD). The morphology of HAP powder was observed by transmission electron microscope (TEM). The HAP powder has been sintered into microporous ceramic in air at 1200 deg. C with 3 h soaking time. The microstructure and phase composition of the resulting HAP ceramic were characterized by scanning electron microscope (SEM) and XRD, respectively. The physical characterization of open porosity and flexural strength have also been carried out.

  11. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity.

    PubMed

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna; Dallavalle, Sabrina

    2016-01-01

    The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  12. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity

    PubMed Central

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna

    2016-01-01

    Summary The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  13. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone

    2014-01-01

    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  14. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketene–alkene [2+2] cycloadditions and late-stage C—H oxidation

    SciTech Connect

    Rasik, Christopher M.; Brown, M. Kevin

    2014-12-22

    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketene–alkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp³)—H oxidation. The synthesis requires only eight steps from norbornadiene.

  15. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively). PMID:27017352

  16. A novel and highly regioselective synthesis of new carbamoylcarboxylic acids from dianhydrides.

    PubMed

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N'-disubstituted 4,4'-carbonylbis(carbamoylbenzoic) acids and N,N'-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3',4,4'-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS.

  17. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    PubMed Central

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  18. Ionic liquids as novel solvents for the synthesis of sugar fatty acid ester.

    PubMed

    Mai, Ngoc Lan; Ahn, Kihun; Bae, Sang Woo; Shin, Dong Woo; Morya, Vivek Kumar; Koo, Yoon-Mo

    2014-12-01

    Sugar fatty acid esters are bio-surfactants known for their non-toxic, non-ionic, and high biodegradability . With great emulsifying and conditioning effects, sugar fatty acids are widely used in the food, pharmaceutical, and cosmetic industries. Biosynthesis of sugar fatty acid esters has attracted growing attention in recent decades. In this study, the enzymatic synthesis of sugar fatty acid esters in ionic liquids was developed, optimized, and scaled up. Reaction parameters affecting the conversion yield of lipase-catalyzed synthesis of glucose laurate from glucose and vinyl laurate (i.e. temperature, vinyl laurate/glucose molar ratio, and enzyme loads) were optimized by response surface methodology (RSM). In addition, production was scaled up to 2.5 L, and recycling of enzyme and ionic liquids was investigated. The results showed that under optimal reaction conditions (66.86 °C, vinyl laurate/glucose molar ratio of 7.63, enzyme load of 73.33 g/L), an experimental conversion yield of 96.4% was obtained which is close to the optimal value predicted by RSM (97.16%). A similar conversion yield was maintained when the reaction was carried out at 2.5 L. Moreover, the enzymes and ionic liquids could be recycled and reused effectively for up to 10 cycles. The results indicate the feasibility of ionic liquids as novel solvents for the biosynthesis of sugar fatty acid esters.

  19. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    NASA Astrophysics Data System (ADS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M. S. A.

    2016-02-01

    Non-aggregated magnetite nanorods with average diameters of 20-30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications.

  20. Metabolic switch during adipogenesis: From branched chain amino acid catabolism to lipid synthesis.

    PubMed

    Halama, Anna; Horsch, Marion; Kastenmüller, Gabriele; Möller, Gabriele; Kumar, Pankaj; Prehn, Cornelia; Laumen, Helmut; Hauner, Hans; Hrabĕ de Angelis, Martin; Beckers, Johannes; Suhre, Karsten; Adamski, Jerzy

    2016-01-01

    Fat cell metabolism has an impact on body homeostasis and its proper function. Nevertheless, the knowledge about simultaneous metabolic processes, which occur during adipogenesis and in mature adipocytes, is limited. Identification of key metabolic events associated with fat cell metabolism could be beneficial in the field of novel drug development, drug repurposing, as well as for the discovery of patterns predicting obesity risk. The main objective of our work was to provide comprehensive characterization of metabolic processes occurring during adipogenesis and in mature adipocytes. In order to globally determine crucial metabolic pathways involved in fat cell metabolism, metabolomics and transcriptomics approaches were applied. We observed significantly regulated metabolites correlating with significantly regulated genes at different stages of adipogenesis. We identified the synthesis of phosphatidylcholines, the metabolism of even and odd chain fatty acids, as well as the catabolism of branched chain amino acids (BCAA; leucine, isoleucine and valine) as key regulated pathways. Our further analysis led to identification of an enzymatic switch comprising the enzymes Hmgcs2 (3-hydroxy-3-methylglutaryl-CoA synthase) and Auh (AU RNA binding protein/enoyl-CoA hydratase) which connects leucine degradation with cholesterol synthesis. In addition, propionyl-CoA, a product of isoleucine degradation, was identified as a putative substrate for odd chain fatty acid synthesis. The uncovered crosstalks between BCAA and lipid metabolism during adipogenesis might contribute to the understanding of molecular mechanisms of obesity and have potential implications in obesity prediction. PMID:26408941

  1. Abolished synthesis of cholic acid reduces atherosclerotic development in apolipoprotein E knockout mice.

    PubMed

    Slätis, Katharina; Gåfvels, Mats; Kannisto, Kristina; Ovchinnikova, Olga; Paulsson-Berne, Gabrielle; Parini, Paolo; Jiang, Zhao-Yan; Eggertsen, Gösta

    2010-11-01

    To investigate the effects of abolished cholic acid (CA) synthesis in the ApoE knockout model [apolipoprotein E (apoE) KO],a double-knockout (DKO) mouse model was created by crossbreeding Cyp8b1 knockout mice (Cyp8b1 KO), unable to synthesize the primary bile acid CA, with apoE KO mice. After 5 months of cholesterol feeding, the development of atherosclerotic plaques in the proximal aorta was 50% less in the DKO mice compared with the apoE KO mice. This effect was associated with reduced intestinal cholesterol absorption, decreased levels of apoB-containing lipoproteins in the plasma, enhanced bile acid synthesis, reduced hepatic cholesteryl esters, and decreased hepatic activity of ACAT2. The upregulation of Cyp7a1 in DKO mice seemed primarily caused by reduced expression of the intestinal peptide FGF15. Treatment of DKO mice with the farnesoid X receptor (FXR) agonist GW4064 did not alter the intestinal cholesterol absorption, suggesting that the action of CA in this process is confined mainly to formation of intraluminal micelles and less to its ability to activate the nuclear receptor FXR. Inhibition of CA synthesis may offer a therapeutic strategy for the treatment of hyperlipidemic conditions that lead to atherosclerosis.

  2. Acid synthesis of luminescent amine-functionalized or erbium-doped silica spheres for biological applications.

    PubMed

    Enrichi, Francesco; Trave, Enrico; Bersani, Marco

    2008-03-01

    In this work we discuss and investigate the morphological and optical properties of luminescent silica spheres which can have interesting applications in bioimaging and biosensing. The spheres are synthesized following an acid route by the hydrolysis and condensation of tetraethylortosilicate (TEOS) and can be functionalized by incorporation of aminopropyl-triethoxysilane (APTES) during the synthesis, inducing a significant luminescence that can be attributed to a recombination mechanism from localized organic defects related to -NH(2) groups. It is shown that the acid synthesis route produces very regular spherical particles, but their diameter vary in the range of 200-4,000 nm. The luminescence properties have been investigated and optimized by variation of the annealing temperature for the functionalized spheres, obtaining the most efficient PL emission after a thermal treatment of 1 h at 600 degrees C in air. Moreover, the possibility to introduce rare earths like erbium in the spheres was also studied and the corresponding Er(3) luminescence emission at 1.53 microm is reported in terms of intensity and lifetime, pointing out that erbium can be easily and efficiently incorporated during the acid synthesis giving high PL intensity with a good lifetime of 3.9 ms.

  3. Synthesis and characterization of agricultural controllable humic acid superabsorbent.

    PubMed

    Gao, Lijuan; Wang, Shiqiang; Zhao, Xuefei

    2013-12-01

    Humic acid superabsorbent polymer (P(AA/AM-HA)) and superabsorbent polymer (P(AA/AM)) were synthesized by aqueous solution polymerization method using acrylic acid (AA), acrylamide (AM) and humic acid (HA) as raw material. The effects of N,N'-methylenebisacrylamide (MBA) crosslinking agent, potassium peroxydisulfate (KPS) initiator, reaction temperature, HA content, ratio of AA to AM, concentration of monomer and neutralization of AA on water absorption were investigated. Absorption and desorption ratios of nitrogen fertilizer and phosphate fertilizer were also investigated by determination of absorption and desorption ratio of NH4(+), PO4(3-) on P(AA/AM-HA) and P(AA/AM). The P(AA/AM-HA) and P(AA/AM) were characterized by Fourier translation infrared spectroscopy, biological photomicroscope and scanning electron microscopy (SEM). The optimal conditions obtained were as follows: the weight ratio of MBA to AA and AM was 0.003; the weight ratio of KPS to AA and AM was 0.008; the weight ratio of HA to AA was 0.1; the mole ratio of AM to AA is 0.1; the mole ratio of NaOH to AA is 0.9; the reaction temperature was 60°C. P(AA/AM-HA) synthesized under optimal conditions, has a good saline tolerance, its water absorbency in distilled water and 0.9 wt.% saline solution is 1180 g/g and 110 g/g, respectively. P(AA/AM-HA) achieves half saturation in 6.5 min. P(AA/AM-HA) is superior to P(AA/AM) on absorption of NH4(+), PO4(3-). The SEM micrograph of P(AA/AM-HA) shows a fine alveolate structure. The biological optical microscope micrograph of P(AA/AM-HA) shows a network structure. Graft polymerization between P(AA/AM) and HA was demonstrated by infrared spectrum. The P(AA/AM-HA) superabsorbent has better absorbing ability of water and fertilizer, electrolytic tolerance and fewer cost than P(AA/AM) superabsorbent. PMID:25078843

  4. Radiation synthesis of nanosilver nanohydrogels of poly(methacrylic acid)

    NASA Astrophysics Data System (ADS)

    Gupta, Bhuvanesh; Gautam, Deepti; Anjum, Sadiya; Saxena, Shalini; Kapil, Arti

    2013-11-01

    Nanosilver nanohydrogels (nSnH) of poly(methacrylic acid) were synthesized and stabilized using gamma irradiation. The main objective of this study was to develop silver nanoparticles and to evaluate the antimicrobial activity. Radiation helps in the polymerization, crosslinking and reduction of silver nitrate as well. Highly stable and uniformly distributed silver nanoparticles have been obtained within hydrogel network by water in oil nanoemulsion polymerization and were evaluated by dynamic light scattering (DLS) and transmission electron microscopy (TEM) respectively. TEM showed almost spherical and uniform distribution of silver nanoparticles through the hydrogel network. The mean size of silver nanoparticles ranging is 10-50 nm. The nanohydrogels showed good swelling in water. Antibacterial studies of nSnH suggest that it can be a good candidate as coating material in biomedical applications.

  5. Proton donor acidity controls selectivity in nonaromatic nitrogen heterocycle synthesis.

    PubMed

    Duttwyler, Simon; Chen, Shuming; Takase, Michael K; Wiberg, Kenneth B; Bergman, Robert G; Ellman, Jonathan A

    2013-02-01

    Piperidines are prevalent in natural products and pharmaceutical agents and are important synthetic targets for drug discovery and development. We report on a methodology that provides highly substituted piperidine derivatives with regiochemistry selectively tunable by varying the strength of acid used in the reaction. Readily available starting materials are first converted to dihydropyridines via a cascade reaction initiated by rhodium-catalyzed carbon-hydrogen bond activation. Subsequent divergent regio- and diastereoselective protonation of the dihydropyridines under either kinetic or thermodynamic control provides two distinct iminium ion intermediates that then undergo highly diastereoselective nucleophilic additions. X-ray structural characterization of both the kinetically and thermodynamically favored iminium ions along with density functional theory calculations provide a theoretical underpinning for the high selectivities achieved for the reaction sequences.

  6. Synthesis and antiproliferative activity of glutamic acid-based dipeptides.

    PubMed

    Silveira-Dorta, Gastón; Martín, Víctor S; Padrón, José M

    2015-08-01

    A small and focused library of 22 dipeptides derived from N,N-dibenzylglutamic acid α- and γ-benzyl esters was prepared in a straightforward manner. The evaluation of the antiproliferative activity in the human solid tumor cell lines HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast), and WiDr (colon) provided γ-glutamyl methionine (GI50 = 6.0-41 μM) and α-glutamyl proline (GI50 = 7.5-18 μM) as lead compounds. In particular, glutamyl serine and glutamyl proline dipeptides were more active in the resistant cancer cell line WiDr than the conventional anticancer drugs cisplatin and etoposide. Glutamyl tryptophan dipeptides did not affect cell growth of HBL-100, while in T-47D cells, proliferation was inhibited. This result might be attributed to the inhibition of the ATB(0,+) transporter.

  7. Synthesis and antiproliferative activity of glutamic acid-based dipeptides.

    PubMed

    Silveira-Dorta, Gastón; Martín, Víctor S; Padrón, José M

    2015-08-01

    A small and focused library of 22 dipeptides derived from N,N-dibenzylglutamic acid α- and γ-benzyl esters was prepared in a straightforward manner. The evaluation of the antiproliferative activity in the human solid tumor cell lines HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast), and WiDr (colon) provided γ-glutamyl methionine (GI50 = 6.0-41 μM) and α-glutamyl proline (GI50 = 7.5-18 μM) as lead compounds. In particular, glutamyl serine and glutamyl proline dipeptides were more active in the resistant cancer cell line WiDr than the conventional anticancer drugs cisplatin and etoposide. Glutamyl tryptophan dipeptides did not affect cell growth of HBL-100, while in T-47D cells, proliferation was inhibited. This result might be attributed to the inhibition of the ATB(0,+) transporter. PMID:25900811

  8. Synthesis and degradation test of hyaluronic acid hydrogels.

    PubMed

    Hahn, Sei Kwang; Park, Jung Kyu; Tomimatsu, Takashi; Shimoboji, Tsuyoshi

    2007-03-10

    Hyaluronic acid (HA) hydrogels prepared with three different crosslinking reagents were assessed by in vitro and in vivo degradation tests for various tissue engineering applications. Adipic acid dihydrazide grafted HA (HA-ADH) was synthesized and used for the preparation of methacrylated HA (HA-MA) with methacrylic anhydride and thiolated HA (HA-SH) with Traut's reagent (imminothiolane). (1)H NMR analysis showed that the degrees of HA-ADH, HA-MA, and HA-SH modification were 69, 29, and 56 mol%, respectively. HA-ADH hydrogel was prepared by the crosslinking with bis(sulfosuccinimidyl) suberate (BS(3)), HA-MA hydrogel with dithiothreitol (DTT) by Michael addition, and HA-SH hydrogel with sodium tetrathionate by disulfide bond formation. According to in vitro degradation tests, HA-SH hydrogel was degraded very fast, compared to HA-ADH and HA-MA hydrogels. HA-ADH hydrogel was degraded slightly faster than HA-MA hydrogel. Based on these results, HA-MA hydrogels and HA-SH hydrogels were implanted in the back of SD rats and their degradation was assessed according to the pre-determined time schedule. As expected from the in vitro degradation test results, HA-SH hydrogel was in vivo degraded completely only in 2 weeks, whereas HA-MA hydrogels were degraded only partially even in 29 days. The degradation rate of HA hydrogels were thought to be controlled by changing the crosslinking reagents and the functional group of HA derivatives. In addition, the state of HA hydrogel was another factor in controlling the degradation rate. Dried HA hydrogel at 37 degrees C for a day resulted in relatively slow degradation compared to the bulk HA hydrogel. There was no adverse effect during the in vivo tests. PMID:17101173

  9. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin

    2011-06-15

    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  10. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  11. The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis

    2004-01-01

    The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

  12. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki

    2016-04-01

    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  13. Synthesis and Anti-microbial Activity of Novel Phosphatidylethanolamine-N-amino Acid Derivatives.

    PubMed

    Vijeetha, Tadla; Balakrishna, Marrapu; Karuna, Mallampalli Sri Lakshmi; Surya Koppeswara Rao, Bhamidipati Venkata; Prasad, Rachapudi Badari Narayana; Kumar, Koochana Pranay; Surya Narayana Murthy, Upadyaula

    2015-01-01

    The study involved synthesis of five novel amino acid derivatives of phosphatidylethanolamine isolated from egg yolk lecithin employing a three step procedure i) N-protection of L-amino acids with BOC anhydride in alkaline medium ii) condensation of - CO2H group of N-protected amino acid with free -NH2 of PE by a peptide linkage and iii) deprotection of N-protected group of amino acids to obtain phosphatidylethanolamine-N-amino acid derivatives in 60-75% yield. The five L-amino acids used were L glycine, L-valine, L-leucine, L-isoleucine and L-phenylalanine. The amino acid derivatives were screened for anti-baterial activity against B. subtilis, S. aureus, P. aeroginosa and E. coli taking Streptomycin as reference compound and anti-fungal activity against C. albicans, S. cervisiae, A. niger taking AmphotericinB as reference compound. All the amino acid derivatives exhibited extraordinary anti-bacterial activities about 3 folds or comparable to Streptomycin and moderate or no anti-fungal activity against Amphotericin-B.

  14. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    SciTech Connect

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

    2010-10-29

    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  15. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  16. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, L.

    1999-05-25

    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  17. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  18. Chemical synthesis and enzymatic, stereoselective hydrolysis of a functionalized dihydropyrimidine for the synthesis of β-amino acids.

    PubMed

    Slomka, Christin; Zhong, Sabilla; Fellinger, Anna; Engel, Ulrike; Syldatk, Christoph; Bräse, Stefan; Rudat, Jens

    2015-12-01

    A novel substrate, 6-(4-nitrophenyl)dihydropyrimidine-2,4(1H,3H)-dione (pNO2PheDU), was chemically synthesized and analytically verified for the potential biocatalytic synthesis of enantiopure β-amino acids. The hydantoinase (EC 3.5.2.2) from Arthrobacter crystallopoietes DSM20117 was chosen to prove the enzymatic hydrolysis of this substrate, since previous investigations showed activities of this enzyme toward 6-monosubstituted dihydrouracils. Whole cell biotransformations with recombinant Escherichia coli expressing the hydantoinase showed degradation of pNO2PheDU. Additionally, the corresponding N-carbamoyl-β-amino acid (NCarbpNO2 βPhe) was chemically synthesized, an HPLC-method with chiral stationary phases for detection of this product was established and thus (S)-enantioselectivity toward pNO2PheDU has been shown. Consequently this novel substrate is a potential precursor for the enantiopure β-amino acid para-nitro-β-phenylalanine (pNO2 βPhe). PMID:26705241

  19. Template-directed synthesis of oligoguanylic acids - Metal ion catalysis

    NASA Technical Reports Server (NTRS)

    Bridson, P. K.; Fakhrai, H.; Lohrmann, R.; Orgel, L. E.; Van Roode, M.

    1981-01-01

    The effects of Zn(2+), Pb(2+) and other metal ions on the efficiency and stereo-selectivity of the template-directed oligomerization of guanosine 5'-phosphorimidazolide are investigated. Reactions were run in the presence of a polyC template in a 2,6-lutidine buffer, and products analyzed by high-performance liquid chromatography on an RPC-5 column. The presence of the Pb(2+) ion is found to lead to the formation of 2'-5' linked oligomers up to the 40-mer, while Zn(2+) favors the formation of predominantly 3'-5' linked oligomers up to the 35-mer. When amounts of uracil, cytidine or adenosine 5'-phosphorimidazole equal to those of the guanosine derivative are included in the reaction mixture, the incorrect base is incorporated into the oligomer about 10% of the time with a Pb(2+) catalyst, but less than 0.5% of the time with Zn(2+). The Sn(2+), Sb(3+) and Bi(3+) ions are also found to promote the formation of 2'-5' oligomers, although not as effectively as Pb(2+), while no metal ions other than Zn(2+) promote the formation of the 3'-5' oligomers. The results may be important for the understanding of the evolution of nucleic acid replication in the absence of enzymes.

  20. Synthesis and characterization of hybrid hyaluronic acid-gelatin hydrogels.

    PubMed

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-04-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g., cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three-dimensional culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications.

  1. Synthesis and Characterization of Hybrid Hyaluronic Acid-Gelatin Hydrogels

    PubMed Central

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-01-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g. cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three dimensional (2D and 3D) culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  2. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.

  3. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties. PMID:26159785

  4. Enantiopure synthesis of dihydrobenzo[1,4]-oxazine-3-carboxylic acids and a route to benzoxazinyl oxazolidinones.

    PubMed

    Malhotra, Rajesh; Dey, Tushar K; Basu, Sourav; Hajra, Saumen

    2015-03-21

    A two step protocol is developed for the efficient synthesis of enantiopure N-Boc-dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 from serine derived cyclic sulfamidate via intramolecular arylamination. The RuPhos Palladacycle along with additional RuPhos ligand is found to be an efficient catalyst for the arylamination of β-(2-bromoaryloxy)amino acids 3 to provide easy and direct access to a variety of dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 with complete retention of enantiopurity in moderate to high yields. Dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids are not only important unnatural amino acids, but are key precursors for the synthesis of important compounds such as benzoxazinyl oxazolidinones. A general approach for the synthesis of benzoxazinyl oxazolidinone is presented.

  5. Physiologic hyperinsulinemia stimulates protein synthesis and enhances transport of selected amino acids in human skeletal muscle.

    PubMed Central

    Biolo, G; Declan Fleming, R Y; Wolfe, R R

    1995-01-01

    We have investigated the mechanisms of the anabolic effect of insulin on muscle protein metabolism in healthy volunteers, using stable isotopic tracers of amino acids. Calculations of muscle protein synthesis, breakdown, and amino acid transport were based on data obtained with the leg arteriovenous catheterization and muscle biopsy. Insulin was infused (0.15 mU/min per 100 ml leg) into the femoral artery to increase femoral venous insulin concentration (from 10 +/- 2 to 77 +/- 9 microU/ml) with minimal systemic perturbations. Tissue concentrations of free essential amino acids decreased (P < 0.05) after insulin. The fractional synthesis rate of muscle protein (precursor-product approach) increased (P < 0.01) after insulin from 0.0401 +/- 0.0072 to 0.0677 +/- 0.0101%/h. Consistent with this observation, rates of utilization for protein synthesis of intracellular phenylalanine and lysine (arteriovenous balance approach) also increased from 40 +/- 8 to 59 +/- 8 (P < 0.05) and from 219 +/- 21 to 298 +/- 37 (P < 0.08) nmol/min per 100 ml leg, respectively. Release from protein breakdown of phenylalanine, leucine, and lysine was not significantly modified by insulin. Local hyperinsulinemia increased (P < 0.05) the rates of inward transport of leucine, lysine, and alanine, from 164 +/- 22 to 200 +/- 25, from 126 +/- 11 to 221 +/- 30, and from 403 +/- 64 to 595 +/- 106 nmol/min per 100 ml leg, respectively. Transport of phenylalanine did not change significantly. We conclude that insulin promoted muscle anabolism, primarily by stimulating protein synthesis independently of any effect on transmembrane transport. Images PMID:7860765

  6. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.

    2015-01-01

    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  7. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward

    2015-01-01

    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  8. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media

    PubMed Central

    Moret, Séverine; Dyson, Paul J.; Laurenczy, Gábor

    2014-01-01

    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M formic acid. In both solvents the catalysts can be reused multiple times without a decrease in activity. Worldwide demand for formic acid continues to grow, especially in the context of a renewable energy hydrogen carrier, and its production from CO2 without base, via the direct catalytic carbon dioxide hydrogenation, is considerably more sustainable than the existing routes. PMID:24886955

  9. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)

    1991-01-01

    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  10. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  11. Downregulation of de Novo Fatty Acid Synthesis in Subcutaneous Adipose Tissue of Moderately Obese Women

    PubMed Central

    Guiu-Jurado, Esther; Auguet, Teresa; Berlanga, Alba; Aragonès, Gemma; Aguilar, Carmen; Sabench, Fàtima; Armengol, Sandra; Porras, José Antonio; Martí, Andreu; Jorba, Rosa; Hernández, Mercè; del Castillo, Daniel; Richart, Cristóbal

    2015-01-01

    The purpose of this work was to evaluate the expression of fatty acid metabolism-related genes in human adipose tissue from moderately obese women. We used qRT-PCR and Western Blot to analyze visceral (VAT) and subcutaneous (SAT) adipose tissue mRNA expression involved in de novo fatty acid synthesis (ACC1, FAS), fatty acid oxidation (PPARα, PPARδ) and inflammation (IL6, TNFα), in normal weight control women (BMI < 25 kg/m2, n = 35) and moderately obese women (BMI 30–38 kg/m2, n = 55). In SAT, ACC1, FAS and PPARα mRNA expression were significantly decreased in moderately obese women compared to controls. The downregulation reported in SAT was more pronounced when BMI increased. In VAT, lipogenic-related genes and PPARα were similar in both groups. Only PPARδ gene expression was significantly increased in moderately obese women. As far as inflammation is concerned, TNFα and IL6 were significantly increased in moderate obesity in both tissues. Our results indicate that there is a progressive downregulation in lipogenesis in SAT as BMI increases, which suggests that SAT decreases the synthesis of fatty acid de novo during the development of obesity, whereas in VAT lipogenesis remains active regardless of the degree of obesity. PMID:26694359

  12. Effect of Nitric Acid Concentrations on Synthesis and Stability of Maghemite Nanoparticles Suspension

    PubMed Central

    Yaacob, Iskandar Idris

    2014-01-01

    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension. PMID:24963510

  13. Functional characterization of FaNIP1;1 gene, a ripening-related and receptacle-specific aquaporin in strawberry fruit.

    PubMed

    Molina-Hidalgo, Francisco J; Medina-Puche, Laura; Gelis, Samuel; Ramos, José; Sabir, Farzana; Soveral, Graça; Prista, Catarina; Iglesias-Fernández, Raquel; Caballero, José L; Muñoz-Blanco, Juan; Blanco-Portales, Rosario

    2015-09-01

    Strawberry fruit (Fragaria × ananassa) is a soft fruit with high water content at ripe stage (more than 90% of its fresh weight). Aquaporins play an important role in plant water homeostasis, through the facilitation of water transport and solutes. We report the role played by FaNIP1;1 in the receptacle ripening process. The analysis by qRT-PCR of FaNIP1;1 showed that this gene is mainly expressed in fruit receptacle and has a ripening-related expression pattern that was accompanied by an increase in both the abscisic acid and water content of the receptacle throughout fruit ripening. Moreover, FaNIP1;1 was induced in situations of water deficit. Additionally, we show that FaNIP1;1 expression was positively regulated by abscisic acid and negatively regulated by auxins. The water transport capacity of FaNIP1;1 was determined by a stopped-flow spectroscopy in yeast over-expressing FaNIP1;1. Glycerol, H2O2 and boron transport were also demonstrated in yeast. On the other hand, GFP-FaNIP1;1 fusion protein was located in plasma membrane. In conclusion, FaNIP1;1 seems to play an important role increasing the plasma membrane permeability, that allows the water accumulation in the strawberry fruit receptacle throughout the ripening process. PMID:26259188

  14. Functional characterization of FaNIP1;1 gene, a ripening-related and receptacle-specific aquaporin in strawberry fruit.

    PubMed

    Molina-Hidalgo, Francisco J; Medina-Puche, Laura; Gelis, Samuel; Ramos, José; Sabir, Farzana; Soveral, Graça; Prista, Catarina; Iglesias-Fernández, Raquel; Caballero, José L; Muñoz-Blanco, Juan; Blanco-Portales, Rosario

    2015-09-01

    Strawberry fruit (Fragaria × ananassa) is a soft fruit with high water content at ripe stage (more than 90% of its fresh weight). Aquaporins play an important role in plant water homeostasis, through the facilitation of water transport and solutes. We report the role played by FaNIP1;1 in the receptacle ripening process. The analysis by qRT-PCR of FaNIP1;1 showed that this gene is mainly expressed in fruit receptacle and has a ripening-related expression pattern that was accompanied by an increase in both the abscisic acid and water content of the receptacle throughout fruit ripening. Moreover, FaNIP1;1 was induced in situations of water deficit. Additionally, we show that FaNIP1;1 expression was positively regulated by abscisic acid and negatively regulated by auxins. The water transport capacity of FaNIP1;1 was determined by a stopped-flow spectroscopy in yeast over-expressing FaNIP1;1. Glycerol, H2O2 and boron transport were also demonstrated in yeast. On the other hand, GFP-FaNIP1;1 fusion protein was located in plasma membrane. In conclusion, FaNIP1;1 seems to play an important role increasing the plasma membrane permeability, that allows the water accumulation in the strawberry fruit receptacle throughout the ripening process.

  15. Synthesis and structural characterisation of amides from picolinic acid and pyridine-2,6-dicarboxylic acid

    PubMed Central

    Devi, Prarthana; Barry, Sarah M.; Houlihan, Kate M.; Murphy, Michael J.; Turner, Peter; Jensen, Paul; Rutledge, Peter J.

    2015-01-01

    Coupling picolinic acid (pyridine-2-carboxylic acid) and pyridine-2,6-dicarboxylic acid with N-alkylanilines affords a range of mono- and bis-amides in good to moderate yields. These amides are of interest for potential applications in catalysis, coordination chemistry and molecular devices. The reaction of picolinic acid with thionyl chloride to generate the acid chloride in situ leads not only to the N-alkyl-N-phenylpicolinamides as expected but also the corresponding 4-chloro-N-alkyl-N-phenylpicolinamides in the one pot. The two products are readily separated by column chromatography. Chlorinated products are not observed from the corresponding reactions of pyridine-2,6-dicarboxylic acid. X-Ray crystal structures for six of these compounds are described. These structures reveal a general preference for cis amide geometry in which the aromatic groups (N-phenyl and pyridyl) are cis to each other and the pyridine nitrogen anti to the carbonyl oxygen. Variable temperature 1H NMR experiments provide a window on amide bond isomerisation in solution. PMID:25954918

  16. Erythrocyte membrane fatty acids in multiple myeloma patients.

    PubMed

    Jurczyszyn, Artur; Czepiel, Jacek; Gdula-Argasińska, Joanna; Czapkiewicz, Anna; Biesiada, Grażyna; Dróżdż, Mirosław; Perucki, William; Castillo, Jorge J

    2014-10-01

    Mounting data show that fatty acids (FA) and fatty acid synthase (FAS) function could be potential targets for multiple myeloma (MM) therapy. Our study aimed at comparing the FA composition of erythrocyte membranes of MM patients and healthy controls. MM patients had higher saturated FA and n-6 polyunsaturated FA (PUFA) and lower monounsaturated, n-3 PUFA and trans-FA indices than controls. The n-3/n-6 PUFA ratio was lower in MM patients and there was distinct clustering of variants of individual FA in MM patients. The FA content of erythrocyte membrane could serve as a diagnostic and/or predictive biomarker in MM.

  17. Induction of human choriogonadotropin in HeLa-cell cultures by aliphatic monocarboxylates and inhibitors of deoxyribonucleic acid synthesis

    PubMed Central

    Ghosh, Nimai K.; Rukenstein, Adriana; Cox, Rody P.

    1977-01-01

    The ectopic production of the glycopeptide hormone human placental choriogonadotropin by HeLa65 cells was measured by radioimmunoassay with antiserum against the β-subunit of choriogonadotropin and with the 125I-labelled β-subunit as a tracer antigen. Choriogonadotropin synthesis was markedly (500-fold) stimulated by sodium butyrate. Kinetic studies and the use of an inhibitor of protein synthesis, cycloheximide, indicated that protein synthesis was required for this induction. Investigation of the efficiency of 22 aliphatic short-chain fatty acids and derivatives in causing increased choriogonadotropin synthesis by HeLa cells showed stringent structural requirements. Induction of choriogonadotropin synthesis in HeLa cells was not restricted to butyrate. Other aliphatic acids (propionate, isobutyrate, valerate and hexanoate) were also capable of inducing choriogonadotropin synthesis at 10–50% of the efficiency of butyrate. Hydroxy derivatives of monocarboxylate inducers, related mono- and di-carboxylic acids, alcohols, amines, ketones, esters and sulphoxide were ineffective in increasing choriogonadotropin production by HeLa cells. A saturated C4 straight-chain acid without substituent hydroxyl groups but with a methyl group at one end and a carboxyl moiety at the other appeared to be most efficient in activating choriogonadotropin production. A second clonal line of HeLa cells, HeLa71, showed a higher constitutive synthesis of choriogonadotropin than HeLa65 cells, which was also markedly increased by butyrate. Butyrate and other aliphatic monocarboxylate inducers of choriogonadotropin synthesis inhibited HeLa-cell growth and DNA synthesis. This inhibition of DNA replication may be related to the mechanism of choriogonadotropin synthesis, since two well-characterized anti-neoplastic inhibitors of DNA synthesis, hydroxyurea and 1-β-d-arabinofuranosylcytosine, also stimulated a 300-fold increase in choriogonadotropin synthesis in HeLa cells and were synergistic

  18. Cell proliferation and progesterone synthesis depend on lipid metabolism in bovine granulosa cells.

    PubMed

    Elis, Sebastien; Desmarchais, Alice; Maillard, Virginie; Uzbekova, Svetlana; Monget, Philippe; Dupont, Joëlle

    2015-03-15

    In dairy cows, lipids are essential to support energy supplies for all biological functions, especially during early lactation. Lipid metabolism is crucial for sustaining proper reproductive function. Alteration of lipid metabolism impacts follicular development and affects oocyte developmental competence. Indeed, nonesterified fatty acids are able to decrease granulosa cell (GC) proliferation and affect estradiol synthesis, thus potentially affecting follicular growth and viability. The objective of this study was to assess the impact of lipid metabolism on bovine GCs, through the use of the lipid metabolism inhibitors etomoxir, an inhibitor of fatty acid (FA) oxidation through inhibition of carnitine palmitoyl transferase 1 (CPT1), and C75, an inhibitor of FA synthesis through inhibition of fatty acid synthase. We showed that etomoxir and C75 significantly inhibited DNA synthesis in vitro; C75 also significantly decreased progesterone synthesis. Both inhibitors significantly reduced AMPK (5' adenosine monophosphate-activated protein kinase) and acetyl-CoA carboxylase phosphorylation. Etomoxir also affected the AKT (protein kinase B) signaling pathway. Combined, these data suggest that both FA oxidation and synthesis are important for the bovine GCs to express a proliferative and steroidogenic phenotype and, thus, for sustaining follicular growth. Despite these findings, it is important to note that the changes caused by the inhibitors of FA metabolism on GCs in vitro are globally mild, suggesting that lipid metabolism is not as critical in GCs as was observed in the oocyte-cumulus complex. Further studies are needed to investigate the detailed mechanisms by which lipid metabolism interacts with GC functions.

  19. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    PubMed

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress. PMID:25113613

  20. Taurine homeostasis requires de novo synthesis via cysteine sulfinic acid decarboxylase during zebrafish early embryogenesis.

    PubMed

    Chang, Yen-Chia; Ding, Shih-Torng; Lee, Yen-Hua; Wang, Ya-Ching; Huang, Ming-Feng; Liu, I-Hsuan

    2013-02-01

    Cysteine sulfinic acid decarboxylase (Csad) is the rate-limiting enzyme in the de novo biosynthesis of taurine. There are a number of physiological roles of taurine, such as bile salt synthesis, osmoregulation, lipid metabolism, and oxidative stress inhibition. To investigate the role of de novo synthesis of taurine during embryonic development, zebrafish csad was cloned and functionally analyzed. Semi-quantitative RT-PCR showed that csad transcripts are maternally deposited, while whole-mount in situ hybridization demonstrated that csad is expressed in yolk syncytial layer and various embryonic tissues such as notochord, brain, retina, pronephric duct, liver, and pancreas. Knockdown of csad significantly reduced the embryonic taurine level, and the affected embryos had increased early mortality and cardiac anomalies. mRNA coinjection and taurine supplementation rescued the cardiac phenotypes suggesting that taurine originating from the de novo synthesis pathway plays a role in cardiac development. Our findings indicated that the de novo synthesis pathway via Csad plays a critical role in taurine homeostasis and cardiac development in zebrafish early embryos. PMID:22907836

  1. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    PubMed

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress.

  2. Alginic acid synthesis in Pseudomonas aeruginosa mutants defective in carbohydrate metabolism.

    PubMed Central

    Banerjee, P C; Vanags, R I; Chakrabarty, A M; Maitra, P K

    1983-01-01

    Mutant cells of mucoid Pseudomonas aeruginosa isolated from cystic fibrosis patients were examined for their ability to synthesize alginic acid in resting cell suspensions. Unlike the wild-type strain which synthesizes alginic acid from glycerol, fructose, mannitol, glucose, gluconate, glutamate, or succinate, mutants lacking specific enzymes of carbohydrate metabolism are uniquely impaired. A phosphoglucose isomerase mutant did not synthesize the polysaccharide from mannitol, nor did a glucose 6-phosphate dehydrogenase mutant synthesize the polysaccharide from mannitol or glucose. Mutants lacking the Entner-Doudoroff pathway dehydrase or aldolase failed to produce alginate from mannitol, glucose, or gluconate, as a 3-phosphoglycerate kinase or glyceraldehyde 3-phosphate dehydrogenase mutant failed to produce from glutamate or succinate. These results demonstrate the primary role of the Entner-Doudoroff pathway enzymes in the synthesis of alginate from glucose, mannitol, or gluconate and the role of glyceraldehyde 3-phosphate dehydrogenase reaction for the synthesis from gluconeogenic precursors such as glutamate. The virtual absence of any activity of phosphomannose isomerase in cell extracts of several independent mucoid bacteria and the impairment of alginate synthesis from mannitol in mutants lacking phosphoglucose isomerase or glucose 6-phosphate dehydrogenase rule out free mannose 6-phosphate as an intermediate in alginate biosynthesis. PMID:6408061

  3. Total Synthesis of the Aristolochic Acids, Their Major Metabolites, and Related Compounds

    PubMed Central

    2015-01-01

    Plants from the Aristolochia genus have been recommended for the treatment of a variety of human ailments since the time of Hippocrates. However, many species produce the highly toxic aristolochic acids (AAs), which are both nephrotoxic and carcinogenic. For the purposes of extensive biological studies, a versatile approach to the synthesis of the AAs and their major metabolites was devised based primarily on a Suzuki–Miyaura coupling reaction. The key to success lies in the preparation of a common ring-A precursor, namely, the tetrahydropyranyl ether of 2-nitromethyl-3-iodo-4,5-methylendioxybenzyl alcohol (27), which was generated in excellent yield by oxidation of the aldoxime precursor 26. Suzuki–Miyaura coupling of 27 with a variety of benzaldehyde 2-boronates was accompanied by an aldol condensation/elimination reaction to give the desired phenanthrene intermediate directly. Deprotection of the benzyl alcohol followed by two sequential oxidation steps gave the desired phenanthrene nitrocarboxylic acids. This approach was used to synthesize AAs I–IV and several other related compounds, including AA I and AA II bearing an aminopropyloxy group at position-6, which were required for further conversion to fluorescent biological probes. Further successful application of the Suzuki–Miyaura coupling reaction to the synthesis of the N-hydroxyaristolactams of AA I and AA II then allowed the synthesis of the putative, but until now elusive, N-acetoxy- and N-sulfonyloxy-aristolactam metabolites. PMID:24877584

  4. Total synthesis of the aristolochic acids, their major metabolites, and related compounds.

    PubMed

    Attaluri, Sivaprasad; Iden, Charles R; Bonala, Radha R; Johnson, Francis

    2014-07-21

    Plants from the Aristolochia genus have been recommended for the treatment of a variety of human ailments since the time of Hippocrates. However, many species produce the highly toxic aristolochic acids (AAs), which are both nephrotoxic and carcinogenic. For the purposes of extensive biological studies, a versatile approach to the synthesis of the AAs and their major metabolites was devised based primarily on a Suzuki-Miyaura coupling reaction. The key to success lies in the preparation of a common ring-A precursor, namely, the tetrahydropyranyl ether of 2-nitromethyl-3-iodo-4,5-methylendioxybenzyl alcohol (27), which was generated in excellent yield by oxidation of the aldoxime precursor 26. Suzuki-Miyaura coupling of 27 with a variety of benzaldehyde 2-boronates was accompanied by an aldol condensation/elimination reaction to give the desired phenanthrene intermediate directly. Deprotection of the benzyl alcohol followed by two sequential oxidation steps gave the desired phenanthrene nitrocarboxylic acids. This approach was used to synthesize AAs I-IV and several other related compounds, including AA I and AA II bearing an aminopropyloxy group at position-6, which were required for further conversion to fluorescent biological probes. Further successful application of the Suzuki-Miyaura coupling reaction to the synthesis of the N-hydroxyaristolactams of AA I and AA II then allowed the synthesis of the putative, but until now elusive, N-acetoxy- and N-sulfonyloxy-aristolactam metabolites. PMID:24877584

  5. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.

    1986-01-01

    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  6. Synthesis of goethite in solutions of artificial seawater and amino acids: a prebiotic chemistry study

    NASA Astrophysics Data System (ADS)

    Carneiro, Cristine E. A.; Ivashita, Flávio F.; de Souza, Ivan Granemann; de Souza, Cláudio M. D.; Paesano, Andrea; da Costa, Antonio C. S.; di Mauro, Eduardo; de Santana, Henrique; Zaia, Cássia T. B. V.; Zaia, Dimas A. M.

    2013-04-01

    This study investigated the synthesis of goethite under conditions resembling those of the prebiotic Earth. The artificial seawater used contains all the major elements as well as amino acids (α-Ala, β-Ala, Gly, Cys, AIB) that could be found on the prebiotic Earth. The spectroscopic methods (FT-IR, EPR, Raman), scanning electron microscopy (SEM) and X-ray diffraction showed that in any condition Gly and Cys favoured the formation of goethite, artificial seawater plus β-Ala and distilled water plus AIB favoured the formation of hematite and for the other synthesis a mixture of goethite and hematite were obtained. Thus in general no protein amino acids (β-Ala, AIB) favoured the formation of hematite. As shown by surface enhanced Raman spectroscopy (SERS) spectra the interaction between Cys and Fe3+ of goethite is very complex, involving decomposition of Cys producing sulphur, as well as interaction of carboxylic group with Fe3+. SERS spectra also showed that amino/CN and C-CH3 groups of α-Ala are interacting with Fe3+ of goethite. For the other samples the shifting of several bands was observed. However, it was not possible to say which amino acid groups are interacting with Fe3+. The pH at point of zero charge of goethites increased with artificial seawater and decreased with amino acids. SEM images showed when only goethite was synthesized the images of the samples were acicular and when only hematite was synthesized the images of the samples were spherical. SEM images for the synthesis of goethite with Cys were spherical crystal aggregates with radiating acicular crystals. The highest resonance line intensities were obtained for the samples where only hematite was obtained. Electron paramagnetic resonance (EPR) and Mössbauer spectra showed for the synthesis of goethite with artificial seawater an isomorphic substitution of iron by seawater cations. Mössbauer spectra also showed that for the synthesis goethite in distilled water plus Gly only goethite was

  7. Differential effects of insulin and dietary amino acids on muscle protein synthesis in adult and old rats

    PubMed Central

    Prod'homme, Magali; Balage, Michèle; Debras, Elisabeth; Farges, Marie-Chantal; Kimball, Scott; Jefferson, Leonard; Grizard, Jean

    2005-01-01

    The potential roles of insulin and dietary amino acids in the regulation of skeletal muscle protein synthesis were examined in adult and old rats. Animals were fed over 1 h with either a 25% or a 0% amino acid/protein meal. In each nutritional condition, postprandial insulin secretion was either maintained or blocked with diazoxide injections. Protein synthesis in gastrocnemius and soleus muscles was assessed in vivo using the flooding dose method. Insulin suppression decreased protein synthesis in both muscles irrespective of the nutritional condition and age of the rats. Moreover, reduced insulinaemia was associated with 4E-BP1 dephosphorylation, enhanced assembly of the 4E-BP1−eIF4E inactive complex and hypophosphorylation of eIF4E, p70S6k and protein kinase B, key intermediates in the regulation of translation initiation and protein synthesis. Old rats did not differ from adult rats. The lack of amino acids in the meal of insulin-suppressed rats did not result in any additional decrease in protein synthesis. In the presence of insulin secretion, dietary amino acid suppression significantly decreased gastrocnemius protein synthesis in adult but not in old rats. Amino acid suppression was associated with reduced phosphorylation of 4E-BP1 and p70S6k in adults. Along with protein synthesis, only the inhibition of p70S6k phosphorylation was abolished in old rats. We concluded that insulin is required for the regulation of muscle protein synthesis irrespective of age and that the effect of dietary amino acids is blunted in old rats. PMID:15513948

  8. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress.

    PubMed

    Simón, María Victoria; Agnolazza, Daniela L; German, Olga Lorena; Garelli, Andrés; Politi, Luis E; Agbaga, Martin-Paul; Anderson, Robert E; Rotstein, Nora P

    2016-03-01

    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here, we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat and hydrogen peroxide (H2 O2 ). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in retina photoreceptors, and its precursor, eicosapentaenoic acid (EPA) have multiple beneficial effects. Here, we show that retina neurons in vitro express the desaturase FADS2 and can synthesize DHA from EPA. Moreover, addition of EPA to these cultures protects photoreceptors from oxidative stress and promotes their differentiation through its metabolization to DHA. PMID:26662863

  9. Synthesis and anticoagulant activity of bioisosteric sulfonic-Acid analogues of the antithrombin-binding pentasaccharide domain of heparin.

    PubMed

    Herczeg, Mihály; Lázár, László; Bereczky, Zsuzsanna; Kövér, Katalin E; Timári, István; Kappelmayer, János; Lipták, András; Antus, Sándor; Borbás, Anikó

    2012-08-20

    Two pentasaccharide sulfonic acids that were related to the antithrombin-binding domain of heparin were prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic-acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic-acid esters were found to be excellent donors and acceptors in the glycosylation reactions. Throughout the synthesis, the hydroxy groups to be methylated were masked in the form of acetates and the hydroxy groups to be sulfated were masked with benzyl groups. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of these new sulfonic-acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic-acid moiety resulted in a notable decrease in the anti-Xa activity. The difference in the biological activity of the disulfonic- and trisulfonic-acid counterparts could be explained by the different conformation of their L-iduronic-acid residues.

  10. Hybrid Compounds Strategy in the Synthesis of Oleanolic Acid Skeleton-NSAID Derivatives.

    PubMed

    Pawełczyk, Anna; Olender, Dorota; Sowa-Kasprzak, Katarzyna; Zaprutko, Lucjusz

    2016-04-12

    The current study focuses on the synthesis of several hybrid individuals combining a natural oleanolic acid skeleton and synthetic nonsteroidal anti-inflammatory drug moieties (NSAIDs). It studied structural modifications of the oleanolic acid structure by use of the direct reactivity of hydroxyl or hydroxyimino groups at position C-3 of the triterpenoid skeleton with the carboxylic function of anti-inflammatory drugs leading to new perspective compounds with high potential pharmacological activities. Novel ester- and iminoester-type derivatives of oleanolic unit with the different NSAIDs, such as ibuprofen, aspirin, naproxen, and ketoprofen, were obtained and characterized. Moreover, preliminary research of compounds obtaining structure stability under acidic conditions was examined and the PASS method of prediction of activity spectra for substances was used to estimate the potential biological activity of these compounds.

  11. Facile synthesis of PtAu alloy nanoparticles with high activity for formic acid oxidation

    SciTech Connect

    Zhang, Sheng; Shao, Yuyan; Yin, Geping; Lin, Yuehe

    2010-02-15

    We report the facile synthesis of carbon supported PtAu alloy nanoparticles with high electrocatalytic activity as the anode catalyst for direct formic acid fuel cells (DFAFCs). PtAu alloy nanopaticles are synthesized by co-reducing HAuCl4 and H2PtCl6 with NaBH4 in the presence of sodium citrate and then the nanoparticles are deposited on Vulcan XC-72R carbon support (PtAu/C). The obtained catalysts are characterized with X-ray diffraction (XRD) and transmission electron microscope (TEM), which reveal PtAu alloy formation with an average diameter of 4.6 nm. PtAu/C exhibits 8 times higher catalytic activity toward formic acid oxidation than Pt/C. The enhanced activity of PtAu/C catalyst is attributed to noncontinuous Pt sites formed in the presence of the neighbored Au sites, which promotes direct oxidation of formic acid by avoiding poison CO.

  12. A plausible simultaneous synthesis of amino acids and simple peptides on the primordial Earth.

    PubMed

    Parker, Eric T; Zhou, Manshui; Burton, Aaron S; Glavin, Daniel P; Dworkin, Jason P; Krishnamurthy, Ramanarayanan; Fernández, Facundo M; Bada, Jeffrey L

    2014-07-28

    Following his seminal work in 1953, Stanley Miller conducted an experiment in 1958 to study the polymerization of amino acids under simulated early Earth conditions. In the experiment, Miller sparked a gas mixture of CH4, NH3, and H2O, while intermittently adding the plausible prebiotic condensing reagent cyanamide. For unknown reasons, an analysis of the samples was not reported. We analyzed the archived samples for amino acids, dipeptides, and diketopiperazines by liquid chromatography, ion mobility spectrometry, and mass spectrometry. A dozen amino acids, 10 glycine-containing dipeptides, and 3 glycine-containing diketopiperazines were detected. Miller's experiment was repeated and similar polymerization products were observed. Aqueous heating experiments indicate that Strecker synthesis intermediates play a key role in facilitating polymerization. These results highlight the potential importance of condensing reagents in generating diversity within the prebiotic chemical inventory.

  13. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.

    PubMed

    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J

    2014-04-25

    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism.

  14. Synthesis, characterization and biological activity of hydroxyl-bisphosphonic analogs of bile acids.

    PubMed

    Bortolini, Olga; Fantin, Giancarlo; Fogagnolo, Marco; Rossetti, Stefano; Maiuolo, Loredana; Di Pompo, Gemma; Avnet, Sofia; Granchi, Donatella

    2012-06-01

    Bisphosphonates (BPs) are now the most widely used drugs for diseases associated with increased bone resorption, such as osteoporosis, and tumor bone diseases. A significant drawback of the BPs is their poor oral absorption that is enhanced by the presence of bile acid substituents in the bisphosphonate framework, with no toxic effects. A straightforward synthesis of bile acid-containing hydroxy-bisphosphonates and a full characterization of these pharmaceutically important molecules, including an evaluation of affinity and the mechanism of binding to hydroxyapatite, is presented. The biological activity of bile acid-containing bisphosphonate salts was determined using the neutral-red assay on the L929 cell line and primary cultures of osteoclasts. The bioactivity of the new compounds was found superior than bisphosphonates of established activity. PMID:22483634

  15. Formation of Amino Acid Thioesters for Prebiotic Peptide Synthesis: Catalysis By Amino Acid Products

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.; DeVincenzi, Donald L. (Technical Monitor)

    1999-01-01

    The origin of life can be described as a series of events in which a prebiotic chemical process came increasingly under the control of its catalytic products. In our search for this prebiotic process that yielded catalytic takeover products (such as polypeptides), we have been investigating a reaction system that generates peptide-forming amino acid thioesters from formaldehyde, glycolaldehyde, and ammonia in the presence of thiols. As shown below, this model process begins by aldol condensation of formaldehyde and glycolaldehyde to give trioses and releases. These sugars then undergo beta-dehydration yielding their respective alpha-ketoaldehydes. Addition of ammonia to the alpha-ketoaldehydes yields imines which can either: (a) rearrange in the presence of thesis to give amino acid thioesters or (be react with another molecule of aldehyde to give imidazoles. This 'one-pot' reaction system operates under mild aqueous conditions, and like modem amino acid biosynthesis, uses sugar intermediates which are converted to products by energy-yielding redox reactions. Recently, we discovered that amino acids, such as the alanine reaction product, catalyze the first and second steps of the process. In the presence of ammonia the process also generates other synthetically useful products, like the important biochemical -- pyruvic acid.

  16. The role of alpha-methylacyl-CoA racemase in bile acid synthesis.

    PubMed

    Cuebas, Dean A; Phillips, Christopher; Schmitz, Werner; Conzelmann, Ernst; Novikov, Dmitry K

    2002-05-01

    According to current views, the second peroxisomal beta-oxidation pathway is responsible for the degradation of the side chain of bile acid intermediates. Peroxisomal multifunctional enzyme type 2 [peroxisomal multifunctional 2-enoyl-CoA hydratase/(R)-3-hydroxyacyl-CoA dehydrogenase; MFE-2] catalyses the second (hydration) and third (dehydrogenation) reactions of the pathway. Deficiency of MFE-2 leads to accumulation of very-long-chain fatty acids, 2-methyl-branched fatty acids and C(27) bile acid intermediates in plasma, but bile acid synthesis is not blocked completely. In this study we describe an alternative pathway, which allows MFE-2 deficiency to be overcome. The alternative pathway consists of alpha-methylacyl-CoA racemase and peroxisomal multifunctional enzyme type 1 [peroxisomal multifunctional 2-enoyl-CoA hydratase/(S)-3-hydroxyacyl-CoA dehydrogenase; MFE-1]. (24E)-3alpha,7alpha,12alpha-Trihydroxy-5beta-cholest-24-enoyl-CoA, the presumed physiological isomer, is hydrated by MFE-1 with the formation of (24S,25S)-3alpha,7alpha,12alpha,24-tetrahydroxy-5beta-cholestanoyl-CoA [(24S,25S)-24-OH-THCA-CoA], which after conversion by a alpha-methylacyl-CoA racemase into the (24S,25R) isomer can again be dehydrogenated by MFE-1 to 24-keto-3alpha,7alpha,12alpha-trihydroxycholestanoyl-CoA, a physiological intermediate in cholic acid synthesis. The discovery of the alternative pathway of cholesterol side-chain oxidation will improve diagnosis of peroxisomal deficiencies by identification of serum 24-OH-THCA-CoA diastereomer profiles.

  17. Leucine and alpha-Ketoisocaproic acid, but not norleucine, stimulate skeletal muscle protein synthesis in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The branched-chain amino acid, leucine, acts as a nutrient signal to stimulate protein synthesis in skeletal muscle of young pigs. However, the chemical structure responsible for this effect has not been identified. We have shown that the other branched-chain amino acids, isoleucine and valine, are ...

  18. Asymmetric synthesis of allylic sulfonic acids: enantio- and regioselective iridium-catalyzed allylations of Na2SO3.

    PubMed

    Liu, Wei; Zhao, Xiao-ming; Zhang, Hong-bo; Zhang, Liang; Zhao, Ming-zhu

    2014-12-15

    An enantioselective allylation reaction of allylic carbonates with sodium sulfite (Na2 SO3 ) catalyzed by Ir complex was accomplished, providing allylic sulfonic acids in good to excellent yields with a high level of enantio- and regioselectivities. (R)-2-Phenyl-2-sulfoacetic acid, a key intermediate for the synthesis of Cefsulodin and Sulbenicillin, was synthesized as well.

  19. Indium metal-organic frameworks as high-performance heterogeneous catalysts for the synthesis of amino acid derivatives.

    PubMed

    Xia, Jing; Xu, Jianing; Fan, Yong; Song, Tianyou; Wang, Li; Zheng, Jifu

    2014-10-01

    Indium metal-organic frameworks (MOFs) were first used as recyclable heterogeneous Lewis acid catalysts for the synthesis of amino acid derivatives with excellent conversion yields. Moreover, exposed ether groups (Lewis basic sites) on the pore walls of In-MOF 2 could activate trimethylsilyl cyanide, forming hypervalent silicate intermediates, as proven by (29)Si NMR.

  20. Asymmetric synthesis of allylic sulfonic acids: enantio- and regioselective iridium-catalyzed allylations of Na2SO3.

    PubMed

    Liu, Wei; Zhao, Xiao-ming; Zhang, Hong-bo; Zhang, Liang; Zhao, Ming-zhu

    2014-12-15

    An enantioselective allylation reaction of allylic carbonates with sodium sulfite (Na2 SO3 ) catalyzed by Ir complex was accomplished, providing allylic sulfonic acids in good to excellent yields with a high level of enantio- and regioselectivities. (R)-2-Phenyl-2-sulfoacetic acid, a key intermediate for the synthesis of Cefsulodin and Sulbenicillin, was synthesized as well. PMID:25367779

  1. The Synthesis of a Dipeptide from its Component Amino Acids: Protecting Groups in the Elementary Organic Laboratory.

    ERIC Educational Resources Information Center

    Young, Paul E.; Campbell, Andrew

    1982-01-01

    A simple, three-step procedure for synthesizing a dipeptide from its component amino acids is described. The dipeptide synthesized uses inexpensive amino acids having hydrocarbon side-chains and can be observed in E/Z forms by nuclear magnetic resonance spectroscopy. Each step in the synthesis produces white crystalline products using standard…

  2. Glycerine and levulinic acid: renewable co-substrates for the fermentative synthesis of short-chain poly(hydroxyalkanoate) biopolymers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Glycerine and levulinic acid were used alone and in combination for the fermentative synthesis of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHB/V) biopolymers. Shake-flask cultures of Pseudomonas oleovorans NRRL B-14682 containing different glycerine:levulinic acid ratios (1%, w/v total carbon ...

  3. Central role of FaGAMYB in the transition of the strawberry receptacle from development to ripening.

    PubMed

    Vallarino, José G; Osorio, Sonia; Bombarely, Aureliano; Casañal, Ana; Cruz-Rus, Eduardo; Sánchez-Sevilla, José F; Amaya, Iraida; Giavalisco, Patrick; Fernie, Alisdair R; Botella, Miguel A; Valpuesta, Victoriano

    2015-10-01

    The receptacle of the strawberry (Fragaria × ananassa) fruit accounts for the main properties of the ripe fruit for human consumption. As it ripens, it undergoes changes similar to other fruits in sugar : acid ratio, volatile production and cell wall softening. However, the main regulators of this process have not yet been reported. The white stage marks the initiation of the ripening process, and we had previously reported a peak of expression for a FaGAMYB gene. Transient silencing of FaGAMYB using RNAi and further determination of changes in global gene expression by RNAseq, and composition of primary and secondary metabolites have been used to investigate the role played by this gene during the development of the receptacle. Down-regulation of FaGAMYB caused an arrest in the ripening of the receptacle and inhibited colour formation. Consistent with this, several transcription factors associated with the regulation of flavonoid biosynthetic pathway showed altered expression. FaGAMYB silencing also caused a reduction of ABA biosynthesis and sucrose content. Interestingly, exogenous ABA application to the RNAI-transformed receptacle reversed most defects caused by FaGAMYB down-regulation. The study assigns a key regulatory role to FaGAMYB in the initiation of strawberry receptacle ripening and acting upstream of the known regulator ABA. PMID:26010039

  4. Central role of FaGAMYB in the transition of the strawberry receptacle from development to ripening.

    PubMed

    Vallarino, José G; Osorio, Sonia; Bombarely, Aureliano; Casañal, Ana; Cruz-Rus, Eduardo; Sánchez-Sevilla, José F; Amaya, Iraida; Giavalisco, Patrick; Fernie, Alisdair R; Botella, Miguel A; Valpuesta, Victoriano

    2015-10-01

    The receptacle of the strawberry (Fragaria × ananassa) fruit accounts for the main properties of the ripe fruit for human consumption. As it ripens, it undergoes changes similar to other fruits in sugar : acid ratio, volatile production and cell wall softening. However, the main regulators of this process have not yet been reported. The white stage marks the initiation of the ripening process, and we had previously reported a peak of expression for a FaGAMYB gene. Transient silencing of FaGAMYB using RNAi and further determination of changes in global gene expression by RNAseq, and composition of primary and secondary metabolites have been used to investigate the role played by this gene during the development of the receptacle. Down-regulation of FaGAMYB caused an arrest in the ripening of the receptacle and inhibited colour formation. Consistent with this, several transcription factors associated with the regulation of flavonoid biosynthetic pathway showed altered expression. FaGAMYB silencing also caused a reduction of ABA biosynthesis and sucrose content. Interestingly, exogenous ABA application to the RNAI-transformed receptacle reversed most defects caused by FaGAMYB down-regulation. The study assigns a key regulatory role to FaGAMYB in the initiation of strawberry receptacle ripening and acting upstream of the known regulator ABA.

  5. Amino acids, precursors for cationic and anionic intercalation synthesis and characterization of amino acid pillared materials

    NASA Astrophysics Data System (ADS)

    Fudala, Á.; Pálinkó, I.; Kiricsi, I.

    1999-05-01

    The preparation and characterization of amino acid pillared materials are reported in this contribution. Host substances were Na-montmorillonite for cationic and hydrotalcite for anionic pillaring. Guest molecules were L-phenylalanine and L-tyrosine. The pillared materials were characterized by powder X-ray diffraction, BET measurements and FT-IR spectroscopy. Pillaring was successful: the layers propped open and the basal distances increased significantly. For hydrotalcite this increase was always significantly larger than for montmorillonite. This fact indicated that the spatial arrangement of the amino acid moieties is widely different. A model for this arrangement is given.

  6. Selective use of palmitic acid over stearic acid for synthesis of phosphatidylcholine and phosphatidylglycerol in lung

    SciTech Connect

    Tsao, F.H.

    1986-11-01

    The incorporation of (/sup 3/H)palmitic acid and (/sup 14/C)stearic acid into phospholipids in rabbit lung tissue was studied. Under equal molar concentrations of palmitate and stearate, palmitate was incorporated to the 1- and 2-positions of phosphatidylcholine (PC) and phosphatidylglycerol (PG) 2-3 times more than stearate. By contrast, palmitate was 30% less than stearate in phosphatidylethanolamine, phosphatidylinositol and phosphatidylserine. These results suggest that preferential utilization of palmitate over stearate, rather than substrate availability, determines the high content of palmitoyl at the 1- and 2-positions of PC and PG in lung.

  7. High-yield synthesis of bioactive ethyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Zhang, Jiang-Yan; Chen, Na; Zhi, Gao-Ying

    2016-01-01

    In this paper, Lipozyme TLIM-catalyzed synthesis of ethyl cinnamate through esterification of cinnamic acid with ethanol was studied. In order to increase the yield of ethyl cinnamate, several media, including acetone, isooctane, DMSO and solvent-free medium, were investigated in this reaction. The reaction showed a high yield by using isooctane as reaction medium, which was found to be much higher than the yields reported previously. Furthermore, several parameters such as shaking rate, water activity, reaction temperature, substrate molar ratio and enzyme loading had important influences on this reaction. For instance, when temperature increased from 10 to 50 °C, the initial reaction rate increased by 18 times and the yield of ethyl cinnamate increased by 6.2 times. Under the optimum conditions, lipase-catalyzed synthesis of ethyl cinnamate gave a maximum yield of 99%, which was of general interest for developing industrial processes for the preparation of ethyl cinnamate.

  8. Synthesis of nucleic acid probes on membrane supports: a procedure for the removal of unincorporated precursors.

    PubMed

    Bhat, S P

    1990-01-01

    We have used DNA bound to small pieces of nylon membrane for the synthesis of radioactive probes. The DNA to be used for generating the probe(s) is first bound to nylon membranes and then introduced into the reaction mix. The labeling reaction takes place on the membrane and therefore allows easy removal of unincorporated precursors by simple washing for 1-2 min. The clean labeled probe is eluted from the membrane in formamide or in water and is ready for use. This DNA-membrane can be stored for reuse. Synthesis of probes on a solid support such as nylon membrane thus circumvents problems associated with chromatographic manipulations needed for the separation of labeled DNA from unicorporated precursors. Probes synthesized in this manner are as efficient in detecting nucleic acid sequences as those synthesized in solution. PMID:2321760

  9. Effect of Ethylene on Cell Division and Deoxyribonucleic Acid Synthesis in Pisum sativum1

    PubMed Central

    Apelbaum, Akiva; Burg, Stanley P.

    1972-01-01

    Ethylene and supraoptimal levels of 2,4-dichlorophenoxyacetic acid inhibit the growth of the apical hook region of etiolated Pisum sativum (var. Alaska) seedlings by stopping almost all cell divisions. Cells are prevented from entering prophase. The hormones also retard cell division in intact root tips and completely stop the process in lateral buds. The latter inhibition is reversed partially by benzyl adenine. In root tips and the stem plumular and subhook regions, ethylene inhibits DNA synthesis. The magnitude of this inhibition is correlated with the degree of repression of cell division in meristematic tissue, suggesting that the effect on cell division results from a lack of DNA synthesis. Ethylene inhibits cell division within a few hours with a dose-response curve similar to that for most other actions of the gas. Experiments with seedlings grown under hypobaric conditions suggest that the gas naturally controls plumular expansion and cell division in the apical region. Images PMID:16658105

  10. Synthesis of ettringite: a way to deal with the acid wastewaters of aluminium anodising industry.

    PubMed

    Alvarez-Ayuso, E; Nugteren, H W

    2005-01-01

    Synthesis of ettringite from acid wastewaters of the aluminium anodising industry has been studied as a possible route of reducing the emissions to the environment, recovering at the same time resource materials as a useful marketable mineral. Wastewaters of different concentrations have been subjected to the process of synthesis suspending calcium oxide and calcium aluminate powders at different time and pH conditions. High caustic alkalinity (pH approximately 12) and low sulphate concentrations (<0.1 M) are the most suitable conditions to synthesise ettringite. The mineral characterisation has been performed using X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TGA) and differential thermal analysis (DTA), proving the high purity of the pursued solid product when hydrated in the appropriate sodium hydroxide concentrations. In such conditions, around 90% of the aluminium initially present in the wastewater solutions is recovered in the form of ettringite. PMID:15607165

  11. Synthesis of ettringite: a way to deal with the acid wastewaters of aluminium anodising industry.

    PubMed

    Alvarez-Ayuso, E; Nugteren, H W

    2005-01-01

    Synthesis of ettringite from acid wastewaters of the aluminium anodising industry has been studied as a possible route of reducing the emissions to the environment, recovering at the same time resource materials as a useful marketable mineral. Wastewaters of different concentrations have been subjected to the process of synthesis suspending calcium oxide and calcium aluminate powders at different time and pH conditions. High caustic alkalinity (pH approximately 12) and low sulphate concentrations (<0.1 M) are the most suitable conditions to synthesise ettringite. The mineral characterisation has been performed using X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TGA) and differential thermal analysis (DTA), proving the high purity of the pursued solid product when hydrated in the appropriate sodium hydroxide concentrations. In such conditions, around 90% of the aluminium initially present in the wastewater solutions is recovered in the form of ettringite.

  12. SYNTHESIS AND CHARACTERIZATION OF SUBSTITUTED POLY(STYRENE)-b-POLY(ACRYLIC ACID) BLOCK COPOLYMER MICELLES

    SciTech Connect

    Pickel, Deanna L; Pickel, Joseph M; Devenyi, Jozsef; Britt, Phillip F

    2009-01-01

    Block copolymer micelle synthesis and characterization has been extensively studied. In particular, most studies have focused on the properties of the hydrophilic corona due to the micelle corona structure s impact on the biodistribution and biocompatibility. Unfortunately, less attention has been given to the effect of the core block on the micelle stability, morphology, and the rate of diffusion of small molecules from the core. This investigation is focused on the synthesis of block copolymers composed of meta-substituted styrenes and acrylic acid by Atom Transfer Radical Polymerization. Micelles with cores composed of substituted styrenes having Tgs ranging from -30 to 100 oC have been prepared and the size and shape of these micelles were characterized by Static and Dynamic Light Scattering and TEM. In addition, the critical micelle concentration and rate of diffusion of small molecules from the core were determined by fluorimetry using pyrene as the probe.

  13. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  14. Shock synthesis of amino acids from impacting cometary and icy planet surface analogues

    NASA Astrophysics Data System (ADS)

    Martins, Zita; Price, Mark C.; Goldman, Nir; Sephton, Mark A.; Burchell, Mark J.

    2013-12-01

    Comets are known to harbour simple ices and the organic precursors of the building blocks of proteins--amino acids--that are essential to life. Indeed, glycine, the simplest amino acid, was recently confirmed to be present on comet 81P/Wild-2 from samples returned by NASA's Stardust spacecraft. Impacts of icy bodies (such as comets) onto rocky surfaces, and, equally, impacts of rocky bodies onto icy surfaces (such as the jovian and saturnian satellites), could have been responsible for the manufacture of these complex organic molecules through a process of shock synthesis. Here we present laboratory experiments in which we shocked ice mixtures analogous to those found in a comet with a steel projectile fired at high velocities in a light gas gun to test whether amino acids could be produced. We found that the hypervelocity impact shock of a typical comet ice mixture produced several amino acids after hydrolysis. These include equal amounts of D- and L-alanine, and the non-protein amino acids α-aminoisobutyric acid and isovaline as well as their precursors. Our findings suggest a pathway for the synthetic production of the components of proteins within our Solar System, and thus a potential pathway towards life through icy impacts.

  15. Effect of penicillin on fatty acid synthesis and excretion in Streptococcus mutans BHT

    SciTech Connect

    Brissette, J.L.; Pieringer, R.A.

    1985-03-01

    Treatment of exponentially growing cultures of Streptococcus mutans BHT with growth-inhibitory concentrations (0.2 microgram/ml) of benzylpenicillin stimulates the incorporation of (2-/sup 14/C) acetate into lipids excreted by the cells by as much as 69-fold, but does not change the amount of /sup 14/C incorporated into intracellular lipids. At this concentration of penicillin cellular lysis does not occur. The radioactive label is incorporated exclusively into the fatty acid moieties of the glycerolipids. During a 4-hr incubation in the presence of penicillin, the extracellular fatty acid ester concentration increases 1.5 fold, even though there is no growth or cellular lysis. An indication of the relative rate of fatty acid synthesis was most readily obtained by placing S. mutans BHT in a buffer containing /sup 14/C-acetate. Under these nongrowing conditions free fatty acids are the only lipids labeled, a factor which simplifies the assay. The addition of glycerol to the buffer causes all of the nonesterified fatty acids to be incorporated into glycerolipid. The cells excrete much of the lipid whether glycerol is present or not. Addition of penicillin to the nongrowth supporting buffer system does not stimulate the incorporation of (/sup 14/C)-acetate into fatty acids.

  16. Time to Detection with BacT/Alert FA Plus Compared to BacT/Alert FA Blood Culture Media.

    PubMed

    Nutman, A; Fisher Even-Tsur, S; Shapiro, G; Braun, T; Schwartz, D; Carmeli, Y

    2016-09-01

    Rapid identification of the causative pathogen in patients with bacteremia allows adjustment of antibiotic therapy and improves patient outcomes. We compared in vitro and real-life time to detection (TTD) of two blood culture media, BacT/Alert FA (FA) and BacT/Alert FA Plus (FA Plus), for the nine most common species of bacterial pathogens recovered from blood samples. Experimental data from simulated cultures was compared with microbiology records of TTD for both culture media with growth of the species of interest in clinical blood cultures. In the experimental conditions, median TTD was 3.8 hours (23.9 %) shorter using FA Plus media. The magnitude of reduction differed between species. Similarly, in real life data, FA Plus had shorter TTD than FA media; however, the difference between culture media was smaller, and median TTD was only 1 hour (8.5 %) less. We found shorter TTD with BacT/Alert FA Plus culture media, both experimentally and in real-life conditions and unrelated to antibiotic neutralization, highlighting the importance of appropriate blood culture media selection. PMID:27272123

  17. Vitamin B-6 restriction impairs fatty acid synthesis in cultured human hepatoma (HepG2) cells.

    PubMed

    Zhao, Mei; Ralat, Maria A; da Silva, Vanessa; Garrett, Timothy J; Melnyk, Stephan; James, S Jill; Gregory, Jesse F

    2013-02-15

    Vitamin B-6 deficiency has been reported to alter n-6 and n-3 fatty acid profiles in plasma and tissue lipids; however, the mechanisms underlying such metabolic changes remain unclear. The objective of this study was to determine the effects of vitamin B-6 restriction on fatty acid profiles and fatty acid synthesis in HepG2 cells. Cells were cultured for 6 wk in media with four different vitamin B-6 concentrations (10, 20, 50, and 2,000 nM added pyridoxal, representing deficient, marginal, adequate, and supraphysiological conditions) that induced a range of steady-state cellular concentrations of pyridoxal phosphate. Total cellular lipid content was greatest in the deficient (10 nM pyridoxal) medium. The percentage of arachidonic acid and the ratio of arachidonic acid to linoleic acid in the total lipid fraction were ~15% lower in vitamin B-6-restricted cells, which suggests that vitamin B-6 restriction affects n-6 fatty acid interconversions. Metabolic flux studies indicated significantly lower fractional synthesis rate of oleic acid and arachidonic acid at 10, 20, and 50 nM pyridoxal, whereas that of eicosapentaenoic acid was lower in the cells cultured in 10 nM pyridoxal. Additionally, relative mRNA expressions of Δ5 and Δ6 desaturases were 40-50% lower in vitamin B-6-restricted cells. Overall, these findings suggest that vitamin B-6 restriction alters unsaturated fatty acid synthesis, particularly n-6 and n-3 polyunsaturated fatty acid synthesis. These results and observations of changes in human plasma fatty acid profiles caused by vitamin B-6 restriction suggest a mechanism by which vitamin B-6 inadequacy influences the cardiovascular risk.

  18. Quorum sensing in Vibrio fischeri: evidence that S-adenosylmethionine is the amino acid substrate for autoinducer synthesis.

    PubMed

    Hanzelka, B L; Greenberg, E P

    1996-09-01

    Synthesis of the autoinducer signal involved in the cell density-dependent activation of Vibrio fischeri luminescence is directed by luxI. The autoinducer is N-(3-oxohexanoyl)homoserine lactone, and little is known about its synthesis. We have measured autoinducer synthesis by amino acid auxotrophs of Escherichia coli that contained luxI on a high-copy-number plasmid. Experiments with cell suspensions starved for methionine or homoserine show that either methionine or S-adenosylmethionine but not homoserine or homoserine lactone is required for autoinducer synthesis. The S-adenosylmethionine synthesis inhibitor cycloleucine blocks methionine-dependent autoinducer synthesis. Thus, it appears that S-adenosylmethionine rather than methionine is the molecule required for autoinducer synthesis. The amount of 15N-labeled methionine incorporated into the autoinducer by growing cultures of a homoserine and a methionine auxotroph was measured by mass spectrometry. The labeling studies show that even in the presence of homoserine, almost all of the autoinducer produced contains the 15N label from methionine. Thus, it appears that S-adenosylmethionine serves as the amino acid substrate in the luxI-dependent synthesis of the V. fischeri autoinducer.

  19. Implementing bacterial acid resistance into cell-free protein synthesis for buffer-free expression and screening of enzymes.

    PubMed

    Kim, Ho-Cheol; Kim, Kwang-Soo; Kang, Taek-Jin; Choi, Jong Hyun; Song, Jae Jun; Choi, Yun Hee; Kim, Byung-Gee; Kim, Dong-Myung

    2015-12-01

    Cell-free protein synthesis utilizes translational machinery isolated from the cells for in vitro expression of template genes. Because it produces proteins without gene cloning and cell cultivation steps, cell-free protein synthesis can be used as a versatile platform for high-throughput expression of enzyme libraries. Furthermore, the open nature of cell-free protein synthesis allows direct integration of enzyme synthesis with subsequent screening steps. However, the presence of high concentration of chemical buffers in the conventional reaction mixture makes it difficult to streamline cell-free protein synthesis with pH-based assay of the synthesized enzymes. In this study, we have implemented an enzyme-assisted bacterial acid resistance mechanism into an Escherichia coli (E.coli) extract-based cell-free protein synthesis system in place of chemical buffers. When deployed in the reaction mixture for cell-free synthesis of enzymes, through proton-consuming conversion of glutamate into γ-aminobutyric acid (GABA), an engineered glutamate decarboxylase (GADβ) was able to maintain the pH of reaction mixture during enzyme synthesis. Because the reaction mixture becomes free of buffering capacity upon the depletion of glutamate, synthesized enzyme could be directly assayed without purification steps. The designed method was successfully applied to the screening of mutant library of sialyltransferase genes to identify mutants with improved enzymatic activity.

  20. Synthesis, aggregation behavior and cholesterol solubilization studies of 16-epi-pythocholic acid (3 alpha,12 alpha,16 beta-trihydroxy-5 beta-cholan-24-oic acid).

    PubMed

    Nonappa; Maitra, Uday

    2010-07-01

    Synthesis, aggregation behavior and in vitro cholesterol solubilization studies of 16-epi-pythocholic acid (3 alpha,12 alpha,16 beta-trihydroxy-5 beta-cholan-24-oic acid, EPCA) are reported. The synthesis of this unnatural epimer of pythocholic acid (3 alpha,12 alpha,16 alpha-trihydroxy-5 beta-cholan-24-oic acid, PCA) involves a series of simple and selective chemical transformations with an overall yield of 21% starting from readily available cholic acid (CA). The critical micellar concentration (CMC) of 16-epi-pythocholate in aqueous media was determined using pyrene as a fluorescent probe. In vitro cholesterol solubilization ability was evaluated using anhydrous cholesterol and results were compared with those of other natural di- and trihydroxy bile acids. These studies showed that 16-epi-pythocholic acid (16 beta-hydroxy-deoxycholic acid) behaves similar to cholic acid (CA) and avicholic acid (3 alpha,7 alpha,16 alpha-trihydroxy-5 beta-cholan-24-oic acid, ACA) in its aggregation behavior and cholesterol dissolution properties.

  1. Regulation of Lipid Synthesis in Soybeans by Two Benzoic Acid Herbicides 1

    PubMed Central

    Muslih, Raad K.; Linscott, Dean L.

    1977-01-01

    The effects of 3-nitro-2,5-dichlorobenzoic acid (dinoben) and 3-amino-2,4-dichlorobenzoic acid (chloramben) on lipid formation and on the incorporation of various substrates into lipids by intact seeds and subcellular fractions of germinating soybean (Glycine max [L.] Merr. `Amsoy') were studied. Dinoben (20 μg/ml) inhibited synthesis of total lipids 67%, neutral lipids 73%, glycolipids 51%, and phospholipids 39% in germinating seeds. When polar lipids were analyzed further, inhibition of individual lipid classes was also observed. Chloramben (20 μg/ml) stimulated total lipid synthesis 25%. With the exception of the mitochondrial fraction where malonate thiokinase was absent, dinoben inhibited up to 99% the incorporation of acetate and malonate into lipids, but did not inhibit acetyl-CoA and malonyl-CoA incorporation. Chloramben stimulated the incorporation of all substrates tested into lipids by all fractions except the mitochondrial fraction when malonate was the substrate. When dinoben and chloramben were used in combinations, chloramben did not reverse the inhibitory effect of dinoben. It is concluded that the dinoben inhibitory effect is specific and is associated with the acetate and malonate thiokinase systems. The chloramben effect is stimulatory to either acetyl-CoA carboxylase or fatty acid synthetase or both. PMID:16660173

  2. Sugar amino acid based scaffolds--novel peptidomimetics and their potential in combinatorial synthesis.

    PubMed

    Chakraborty, Tushar K; Jayaprakash, Sarva; Ghosh, Subhash

    2002-08-01

    To meet the growing demands for the development of new molecular entities for discovering new drugs and materials, organic chemists have started looking for new concepts to supplement traditional approaches. In one such approach, the expertise gained over the years in the area of organic synthesis and the rational drug-design concepts are combined together to create "nature-like" and yet unnatural organic molecules that are expected to provide leads in discovering new molecules. Emulating the basic principles followed by nature to build its vast repertoire of biomolecules, organic chemists are developing many novel multifunctional building blocks. Sugar amino acids constitute an important class of such polyfunctional scaffolds where the carboxyl, amino and hydroxyl groups provide an excellent opportunity for organic chemists to create structural diversities akin to nature's molecular arsenal. Recent advances in the area of combinatorial chemistry give unprecedented technological support for rapid compilations of sugar amino acid-based libraries exploiting the diversities of carbohydrate molecules and well-developed solid-phase peptide synthesis methods. This review chronicles the development of sugar amino acids as a novel class of peptidomimetic building blocks and their applications in generating desired secondary structures in peptides as well as in creating mimics of natural biopolymers. PMID:12180903

  3. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    PubMed Central

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  4. Stereocontrolled synthesis of syn-β-Hydroxy-α-amino acids by direct aldolization of pseudoephenamine glycinamide.

    PubMed

    Seiple, Ian B; Mercer, Jaron A M; Sussman, Robin J; Zhang, Ziyang; Myers, Andrew G

    2014-04-25

    β-Hydroxy-α-amino acids figure prominently as chiral building blocks in chemical synthesis and serve as precursors to numerous important medicines. Reported herein is a method for the synthesis of β-hydroxy-α-amino acid derivatives by aldolization of pseudoephenamine glycinamide, which can be prepared from pseudoephenamine in a one-flask protocol. Enolization of (R,R)- or (S,S)-pseudoephenamine glycinamide with lithium hexamethyldisilazide in the presence of LiCl followed by addition of an aldehyde or ketone substrate affords aldol addition products that are stereochemically homologous with L- or D-threonine, respectively. These products, which are typically solids, can be obtained in stereoisomerically pure form in yields of 55-98 %, and are readily transformed into β-hydroxy-α-amino acids by mild hydrolysis or into 2-amino-1,3-diols by reduction with sodium borohydride. This new chemistry greatly facilitates the construction of novel antibiotics of several different classes. PMID:24692320

  5. Synthesis of cellulose by Acetobacter xylinum. VI. Growth on citric acid-cycle intermediates.

    PubMed

    GROMET-ELHANAN, Z; HESTRIN, S

    1963-02-01

    Gromet-Elhanan, Zippora (The Hebrew University, Jerusalem, Israel) and Shlomo Hestrin. Synthesis of cellulose by Acetobacter xylinum. VI. Growth on citric acid-cycle intermediates. J. Bacteriol. 85:284-292. 1963.-Acetobacter xylinum could be made to grow on ethanol, acetate, succinate, or l-malate. The growth was accompanied by formation of opaque leathery pellicles on the surface of the growth medium. These pellicles were identified as cellulose on the basis of their chemical properties, solubility behavior, and infrared absorption spectra. Washed-cell suspensions prepared from cultures grown on ethanol or the organic acids, in contrast to washed sugar-grown cells, were able to transform citric-cycle intermediates into cellulose. The variations in the substrate spectrum of cellulose synthesis between sugar-grown cells and organic acids-grown cells were found to be correlated with differences in the oxidative capacity of the cells. The significance of the findings that A. xylinum could be made to grow on ethanol on complex as well as synthetic media is discussed from the viewpoint of the whole pattern of Acetobacter classification.

  6. West Nile virus replication requires fatty acid synthesis but is independent on phosphatidylinositol-4-phosphate lipids.

    PubMed

    Martín-Acebes, Miguel A; Blázquez, Ana-Belén; Jiménez de Oya, Nereida; Escribano-Romero, Estela; Saiz, Juan-Carlos

    2011-01-01

    West Nile virus (WNV) is a neurovirulent mosquito-borne flavivirus, which main natural hosts are birds but it also infects equines and humans, among other mammals. As in the case of other plus-stranded RNA viruses, WNV replication is associated to intracellular membrane rearrangements. Based on results obtained with a variety of viruses, different cellular processes have been shown to play important roles on these membrane rearrangements for efficient viral replication. As these processes are related to lipid metabolism, fatty acid synthesis, as well as generation of a specific lipid microenvironment enriched in phosphatidylinositol-4-phosphate (PI4P), has been associated to it in other viral models. In this study, intracellular membrane rearrangements following infection with a highly neurovirulent strain of WNV were addressed by means of electron and confocal microscopy. Infection of WNV, and specifically viral RNA replication, were dependent on fatty acid synthesis, as revealed by the inhibitory effect of cerulenin and C75, two pharmacological inhibitors of fatty acid synthase, a key enzyme of this process. However, WNV infection did not induce redistribution of PI4P lipids, and PI4P did not localize at viral replication complex. Even more, WNV multiplication was not inhibited by the use of the phosphatidylinositol-4-kinase inhibitor PIK93, while infection by the enterovirus Coxsackievirus B5 was reduced. Similar features were found when infection by other flavivirus, the Usutu virus (USUV), was analyzed. These features of WNV replication could help to design specific antiviral approaches against WNV and other related flaviviruses.

  7. Stereocontrolled Synthesis of Syn-β-Hydroxy-α-Amino Acids by Direct Aldolization of Pseudoephenamine Glycinamide

    PubMed Central

    Seiple, Ian B.; Mercer, Jaron A. M.; Sussman, Robin J.; Zhang, Ziyang

    2014-01-01

    β-Hydroxy-α-amino acids figure prominently as chiral building blocks in chemical synthesis, serving as precursors to numerous important medicines. We have developed and here report a method for the synthesis of β-hydroxy-α-amino acid derivatives by aldolization of pseudoephenamine glycinamide, which can be prepared from pseudoephenamine in a one-flask protocol. Enolization of (R,R)- or (S,S)-pseudoephenamine glycinamide with lithium hexamethyldisilazide in the presence of lithium chloride followed by addition of an aldehyde or ketone substrate affords aldol addition products that are stereochemically homologous with L- or D-threonine, respectively. These products, which are typically solids, can be obtained in stereoisomerically pure form in yields of 55–98%, and are readily transformed into β-hydroxy-α-amino acids by mild hydrolysis or into 2-amino-1,3-diols by reduction with sodium borohydride. This new chemistry greatly facilitates the construction of novel antibiotics of several different classes. PMID:24692320

  8. Facile synthesis of graphene from graphite using ascorbic acid as reducing agent

    NASA Astrophysics Data System (ADS)

    Andrijanto, Eko; Shoelarta, Shoerya; Subiyanto, Gatot; Rifki, Sadur

    2016-04-01

    Graphene has attracted a tremendous attention in recent years due to its unique properties such as mechanical, thermal, optical and electrical properties. However, a large scale production of this material is still an issue and subjected to intense research efforts. Here, we show a simple and green approach of the graphene synthesis from graphene oxide using ascorbic acid as reduction agent. A facile synthesis of graphene (rGO) through chemical oxidation of graphite into graphene oxide (GO) was described using modified Hummers method (Improved Tour Method/ITM). The ITM method does not produce toxic gas and the temperature of the oxidation is easily controlled using ice bath. The synthesized of graphene oxide was highly soluble and stable in water. The reduction of graphene oxide into graphene was performed using ascorbic acid (AA) in mild condition. The combined ITM method and green reduction using ascorbic acid open the avenue of replacing hydrazine in the reduction of graphite oxide into graphene and may be very important step for bulk production of graphene.

  9. Aliphatic amidase of Rhodococcus rhodochrous PA-34: Purification, characterization and application in synthesis of acrylic acid.

    PubMed

    Thakur, Neerja; Kumar, Vijay; Sharma, Nirmal Kant; Thakur, Shikha; Bhalla, Tek Chand

    2016-01-01

    An intracellular aliphatic amide degrading inducible amidase produced by Rhodococcus rhodochrous PA-34 was characterized and acrylic acid synthesis from acrylamide was carried out using whole cell amidase. A bioprocess was developed at 50 ml fed batch reaction using 400 mM acrylamide feeding at an interval of 30 min resulted in the production of 4 g acrylic acid with volumetric and catalytic productivity of 80 g/l and 19 g/g/h respectively. The amidase of this organism had molecular weight of 40 kDa and was purified to 8.5 fold with 8% yield. This enzyme was active within the temperature range of 30 to 60 °C, with optimum temperature 45 °C and pH 7.5. The Vmax, Km, and kcat of purified amidase were calculated as 250 U/mg protein, 4.5 mM, and 166 sec-1 for acrylamide. The enzyme showed tolerance to metal chelating agent (EDTA) and was strongly inhibited by heavy metal ions Hg2+, Ag2+, Cu2+ and Co2+. R. rhodochrous PA-34 amidase preferentially hydrolyzed small aliphatic toxic amide such as acrylamide. Thus, the amidase of R. rhodochrous PA-34 is promising biocatalyst for the synthesis of industrially important acids and biodegradation of toxic amides. PMID:26667322

  10. Role of fatty acids in Bacillus environmental adaptation

    PubMed Central

    Diomandé, Sara E.; Nguyen-The, Christophe; Guinebretière, Marie-Hélène; Broussolle, Véronique; Brillard, Julien

    2015-01-01

    The large bacterial genus Bacillus is widely distributed in the environment and is able to colonize highly diverse niches. Some Bacillus species harbor pathogenic characteristics. The fatty acid (FA) composition is among the essential criteria used to define Bacillus species. Some elements of the FA pattern composition are common to Bacillus species, whereas others are specific and can be categorized in relation to the ecological niches of the species. Bacillus species are able to modify their FA patterns to adapt to a wide range of environmental changes, including changes in the growth medium, temperature, food processing conditions, and pH. Like many other Gram-positive bacteria, Bacillus strains display a well-defined FA synthesis II system that is equilibrated with a FA degradation pathway and regulated to efficiently respond to the needs of the cell. Like endogenous FAs, exogenous FAs may positively or negatively affect the survival of Bacillus vegetative cells and the spore germination ability in a given environment. Some of these exogenous FAs may provide a powerful strategy for preserving food against contamination by the Bacillus pathogenic strains responsible for foodborne illness. PMID:26300876

  11. Synthesis and antimicrobial activities of new higher amino acid Schiff base derivatives of 6-aminopenicillanic acid and 7-aminocephalosporanic acid

    NASA Astrophysics Data System (ADS)

    Özdemir (nee Güngör), Özlem; Gürkan, Perihan; Özçelik, Berrin; Oyardı, Özlem

    2016-02-01

    Novel β-lactam derivatives (1c-3c) (1d-3d) were produced by using 6-aminopenicillanic acid (6-APA), 7-aminocephalosporanic acid (7-ACA) and the higher amino acid Schiff bases. The synthesized compounds were characterized by elemental analysis, IR, 1H/13C NMR and UV-vis spectra. Antibacterial activities of all the higher amino acid Schiff bases (1a-3a) (1b-3b) and β-lactam derivatives were screened against three gram negative bacteria (Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, Acinetobacter baumannii RSKK 02026), three gram positive bacteria (Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 07005, Bacillus subtilis ATCC 6633) and their drug-resistant isolates by using broth microdilution method. Two fungi (Candida albicans and Candida krusei) were used for antifungal activity.

  12. Lipase-catalyzed hydrolysis of TG containing acetylenic FA.

    PubMed

    Jie, Marcel S F Lie Ken; Fua, Xun; Lau, Maureen M L; Chye, M L

    2002-10-01

    Hydrolysis of symmetrical acetylenic TG of type AAA [viz., glycerol tri-(4-decynoate), glycerol tri-(6-octadecynoate), glycerol tri-(9-octadecynoate), glycerol tri-(10-undecynoate), and glycerol tri-(13-docosynoate)] in the presence of eight microbial lipases was studied. Novozyme 435 (Candida antarctica), an efficient enzyme for esterification, showed a significant resistance in the hydrolysis of glycerol tri-(9-octadecynoate) and glycerol tri-(13-docosynoate). Hydrolysis of acetylenic TG with Lipolase 100T (Humicola lanuginosa) was rapidly accomplished. Lipase PS-D (Pseudomonas cepacia) showed a fair resistance toward the hydrolysis of glycerol tri-(6-octadecynoate) only, which reflected its ability to recognize the delta6 positional isomer of 18:1. Lipase CCL (Candida cylindracea, syn. C. rugosa) and AY-30 (C. rugosa) were able to catalyze the release of 10-undecynoic acid and 9-octadecynoic acid from the corresponding TG, but less readily the 13-docosynoic acid in the case of glycerol tri-(13-docosynoate). The two lipases CCL and AY-30 were able to distinguish the small difference in structure of fatty acyl moieties in the TG substrate. To confirm this trend, three regioisomers of mixed acetylenic TG of type ABC (containing one each of delta6, delta9, and delta13 acetylenic FA in various positions) were prepared and hydrolyzed with CCL and AY-40. The results reconfirmed the observation that AY-30 and CCL were able to distinguish the slight differences in the molecular structure (position of the acetylenic bond and chain length) of the acyl groups in the TG during the hydrolysis of such TG substrates.

  13. Microbial synthesis of polyhydroxyalkanoate using seaweed-derived crude levulinic acid as co-nutrient.

    PubMed

    Bera, Anupam; Dubey, Sonam; Bhayani, Khushbu; Mondal, Dibyendu; Mishra, Sandhya; Ghosh, Pushpito K

    2015-01-01

    Production of polyhydroxyalkanoates (PHAs) from Jatropha biodiesel residues, namely crude glycerol and oil cake hydrolysate, has been reported previously. Halomonas hydrothermalis (MTCC accession no. 5445; NCBI Genbank accession no. GU938192), a wild marine strain, was used in the bio-synthesis. The present study was initiated to vary the properties of the polymer. Seaweed-derived crude levulinic acid (SDCLA), containing formic acid, residual sugars and dissolved minerals additionally, was proposed as co-feed along with the biodiesel residues. Experiments were conducted at 100mL scale in batch process. Whereas the PHA yield was only 0.40 ± 0.01 g when only biodiesel residues were employed, it rose to 1.07 ± 0.02 g in presence of 0.35% (w/v) of SDCLA. The corresponding carbon utilisation efficiencies were 29.3% and 57.5%, respectively. 3-Hydroxy valerate incorporation in the PHA was pronounced in presence of SDCLA, with associated changes in polymer properties. The microbial synthesis fared poorly when SDCLA was substituted with pure levulinic acid. Thus, Halomonas hydrothermalis had a poor response to levulinic acid, as such, and other constituents present in SDCLA appear to have played a vital role in bacterial cell division and accumulation of PHA. Biodegradability tests in moist soil were also conducted as part of the study. Marine microalgal cultivation for biodiesel and seaweed cultivation for fuels may help generate biodiesel residues and crude levulinic acid in proximity, which would open up the possibility of large scale PHA manufacture in efficient and practical manner in the future through the methodology of the present study.

  14. Regulation of glycolysis and fatty acid synthesis from glucose in sheep adipose tissue

    PubMed Central

    Robertson, James P.; Faulkner, Anne; Vernon, Richard G.

    1982-01-01

    1. The following were measured in adipose-tissue pieces, obtained from 7–9 month-old sheep, before or after the tissue pieces had been maintained in tissue culture for 24 h: the rates of synthesis from glucose of fatty acids, acylglycerol glycerol, pyruvate and lactate; the rate of glucose oxidation to CO2; the rate of glucose oxidation via the pentose phosphate pathway; the activities of hexokinase, glucose 6-phosphate dehydrogenase, phosphofructokinase, pyruvate kinase, pyruvate dehydrogenase and ATP citrate lyase; the intra- and extra-cellular water content; the concentration of various metabolites and ATP, ADP and AMP. 2. The proportion of glucose carbon converted into the various products in sheep adipose tissue differs markedly from that observed in rat adipose tissue. 3. There was a general increase in the rate of glucose utilization by the adipose-tissue pieces after maintenance in tissue culture; largest changes were seen in the rates of glycolysis and fatty acid synthesis from glucose. These increases are paralleled by an increase in pyruvate kinase activity. There was no change in the activities of the other enzymes as measured, although the net flux through all the enzymes increased. 4. Incubation of fresh adipose-tissue pieces for 2–6h led to an increase in the affinity of pyruvate kinase for phosphoenolpyruvate. 5. The rate of pyruvate production by glycolysis was greater than the activity of pyruvate dehydrogenase of the tissue. 6. The results suggest that both pyruvate kinase and pyruvate dehydrogenase have important roles in restricting the utilization of glucose carbon for fatty acid synthesis in sheep adipose tissue. PMID:7150263

  15. Synthesis of boron suboxide from boron and boric acid under mild pressure and temperature conditions

    SciTech Connect

    Jiao, Xiaopeng; Jin, Hua; Ding, Zhanhui; Yang, Bin; Lu, Fengguo; Zhao, Xudong; Liu, Xiaoyang; Peng, Liping

    2011-05-15

    Graphical abstract: Well-crystallized and icosahedral B{sub 6}O crystals were prepared by reacting boron and boric acid at milder reaction conditions (1 GPa and 1300 {sup o}C for 2 h) as compared to previous work.. Research highlights: {yields} Well-crystallized icosahedral B{sub 6}O was synthesized by reacting boric acid and boron. {yields} The synthesis conditions (1 GPa and 1300 {sup o}C for 2 h) are milder in comparison with previous work. {yields} The more practical synthesis method may make B{sub 6}O as a potential substitute for diamond in industry. -- Abstract: Boron suboxide (B{sub 6}O) was synthesized by reacting boron and boric acid (H{sub 3}BO{sub 3}) at pressures between 1 and 10 GPa, and at temperatures between 1300 and 1400 {sup o}C. The B{sub 6}O samples prepared were icosahedral with diameters ranging from 20 to 300 nm. Well-crystallized and icosahedral crystals with an average size of {approx}100 nm can be obtained at milder reaction conditions (1 GPa and 1300 {sup o}C for 2 h) as compared to previous work. The bulk B{sub 6}O sample was stable in air at 600 {sup o}C and then slowly oxidized up to 1000 {sup o}C. The relatively mild synthetic conditions developed in this study provide a more practical synthesis of B{sub 6}O, which may potentially be used as a substitute for diamond in industry as a new superhard material.

  16. Lyso(bis)phosphatidic acid: a preferred donor of arachidonic acid for macrophage-synthesis of eicosanoids

    SciTech Connect

    Cochran, F.; Roddick, V.; Connor, J.; Waite, M.

    1986-05-01

    In order to dissect mechanisms of arachidonic acid (20:4) metabolism, two cell populations were investigated, resident (AM) and Bacillus Calmette-Guerin-activated (BCG-AM) rabbit alveolar macrophages. After purified AM were labeled overnight with (/sup 3/H)20:4, radioactivity was localized primarily within lyso(bis)phosphatidic acid (L(bis)PA) (13.1%), phosphatidylethanolamine (PE) (22.8%) and phosphatidylcholine (PC) (26.7%), with lesser amounts recovered in phosphatidyl-serine (PS) plus phosphatidylinositol (PI) (9.2%). By contrast, analysis of the phospholipid classes from prelabeled BCG-AM revealed that the mass of L(bis)PA as well as its (/sup 3/H)20:4 content was profoundly decreased while other BCG-AM phospholipids remained unchanged. When (/sup 3/H)20:4-labeled AM were stimulated with 1 ..mu..M 12-0-tetradecanoyl-phorbol-13-acetate (TPA), a loss of (/sup 3/H)20:4 was observed from L(bis)PA, PE, PC, and PS/PI with a corresponding increase in eicosanoid synthesis. BCG-AM exposed to either TPA or 3.8 ..mu..M Ca/sup +2/ ionophore A23187 liberated (/sup 3/H)20:4 solely from Pe and PC. BCG-AM, which exhibited depressed eicosanoid formation, consistently failed to deacylate (/sup 3/H)20:4 from L(bis)PA or PI. Their evidence suggests that the diminution of eicosanoid synthesis by BCG-AM may be due to the reduction of 20:4 contained within specific phospholipid pools, namely L(bis)PA.

  17. Merging Photoredox and Nickel Catalysis: The Direct Synthesis of Ketones by the Decarboxylative Arylation of α-Oxo Acids.

    PubMed

    Chu, Lingling; Lipshultz, Jeffrey M; MacMillan, David W C

    2015-06-26

    The direct decarboxylative arylation of α-oxo acids has been achieved by synergistic visible-light-mediated photoredox and nickel catalysis. This method offers rapid entry to aryl and alkyl ketone architectures from simple α-oxo acid precursors via an acyl radical intermediate. Significant substrate scope is observed with respect to both the oxo acid and arene coupling partners. This mild decarboxylative arylation can also be utilized to efficiently access medicinal agents, as demonstrated by the rapid synthesis of fenofibrate.

  18. Age and Haplotype Variations within FADS1 Interact and Associate with Alterations in Fatty Acid Composition in Human Male Cortical Brain Tissue

    PubMed Central

    Freemantle, Erika; Lalovic, Aleksandra; Mechawar, Naguib; Turecki, Gustavo

    2012-01-01

    Fatty acids (FA) play an integral role in brain function and alterations have been implicated in a variety of complex neurological disorders. Several recent genomic studies have highlighted genetic variability in the fatty acid desaturase (FADS1/2/3) gene cluster as an important contributor to FA alterations in serum lipids as well as measures of FA desaturase index estimated by ratios of relevant FAs. The contribution to alterations of FAs within the brain by local synthesis is still a matter of debate. Thus, the impact of genetic variants in FADS genes on gene expression and brain FA levels is an important avenue to investigate. Methods Analyses were performed on brain tissue from prefrontal cortex Brodmann area 47 (BA47) of 61 male subjects of French Canadian ancestry ranging in age from young adulthood to middle age (18–58 years old), with the exception of one teenager (15 years old). Haplotype tagging SNPs were selected using the publicly available HapMap genotyping dataset in conjunction with Haploview. DNA sequencing was performed by the Sanger method and gene expression was measured by quantitative real-time PCR. FAs in brain tissue were analysed by gas chromatography. Variants in the FADS1 gene region were sequenced and analyzed for their influence on both FADS gene expression and FAs in brain tissue. Results Our results suggest an association of the minor haplotype with alteration in estimated fatty acid desaturase activity. Analysis of the impact of DNA variants on expression and alternative transcripts of FADS1 and FADS2, however, showed no differences. Furthermore, there was a significant interaction between haplotype and age on certain brain FA levels. Discussion This study suggests that genetic variability in the FADS genes cluster, previously shown to be implicated in alterations in peripheral FA levels, may also affect FA composition in brain tissue, but not likely by local synthesis. PMID:22900039

  19. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9.

  20. Microwave-assisted polyol synthesis of carbon nitride dots from folic acid for cell imaging.

    PubMed

    Guan, Weiwei; Gu, Wei; Ye, Ling; Guo, Chenyang; Su, Su; Xu, Pinxiang; Xue, Ming

    2014-01-01

    A green, one-step microwave-assisted polyol synthesis was employed to prepare blue luminescent carbon nitride dots (CNDs) using folic acid molecules as both carbon and nitrogen sources. The as-prepared CNDs had an average size of around 4.51 nm and could be well dispersed in water. Under excitation at 360 nm, the CNDs exhibited a strong blue luminescence and the quantum yield was estimated to be 18.9%, which is greater than that of other reported CNDs. Moreover, the CNDs showed low cytotoxicity and could efficiently label C6 glioma cells, demonstrating their potential in cell imaging. PMID:25382977