Science.gov

Sample records for acid fa synthesis

  1. Design of an effective bifunctional catalyst organotriphosphonic acid-functionalized ferric alginate (ATMP-FA) and optimization by Box-Behnken model for biodiesel esterification synthesis of oleic acid over ATMP-FA.

    PubMed

    Liu, Wei; Yin, Ping; Liu, Xiguang; Qu, Rongjun

    2014-12-01

    Biodiesel production has become an intense research area because of rapidly depleting energy reserves and increasing petroleum prices together with environmental concerns. This paper focused on the optimization of the catalytic performance in the esterification reaction of oleic acid for biodiesel production over the bifunctional catalyst organotriphosphonic acid-functionalized ferric alginate ATMP-FA. The reaction parameters including catalyst amount, ethanol to oleic acid molar ratio and reaction temperature have been optimized by response surface methodology (RSM) using the Box-Behnken model. It was found that the reaction temperature was the most significant factor, and the best conversion ratio of oleic acid could reach 93.17% under the reaction conditions with 9.53% of catalyst amount and 8.62:1 of ethanol to oleic acid molar ratio at 91.0 °C. The research results show that two catalytic species could work cooperatively to promote the esterification reaction, and the bifunctional ATMP-FA is a potential catalyst for biodiesel production. PMID:25310862

  2. A ferulic acid (FA)-eluting system for biodegradable magnesium stent: Cells response of HUVECs.

    PubMed

    Zhang, Erlin; Shen, Feng

    2015-08-01

    A new drug-eluting system was designed for biodegradable magnesium stents, in which ferulic acid (FA) was used as drug due to its promotion function to endothelial cells and PHBHHx as drug delivery due to its biodegradability and biocompatibility. A 5 and 10% FA were added in PHBHHx to prepare FA containing PHBHHX films. The cell adhesion, spreading and proliferation on these films was investigated in order to assess cell response of HUVECs. It was also found that FA enhanced the adhesion, spreading and proliferation of HUVECs in a dose-dependent manner. Cell viability after H2 O2 injury and NO production of HUVECs were also studied. The results indicated that FA effectively inhibited H2 O2 -induced injury and promotes NO production. It was also shown that alkali treatment improved the cell adhesion, spreading and proliferation while the treatment reduces the FA release and in turn reduces the inhibition on H2 O2 -induced injury and NO production. However, alkali treatment itself had no influence on the H2 O2 induced injure and NO production. The tensile shear strength between the FA containing coating and Mg substrate was also tested. All results demonstrated that FA containing PHBHHx films exhibited strong promotion to the endothelialization and could be a choice for surface modification of magnesium stent. PMID:25630748

  3. Modeling the binding of fulvic acid by goethite: the speciation of adsorbed FA molecules

    NASA Astrophysics Data System (ADS)

    Filius, Jeroen D.; Meeussen, Johannes C. L.; Lumsdon, David G.; Hiemstra, Tjisse; van Riemsdijk, Willem H.

    2003-04-01

    Under natural conditions, the adsorption of ions at the solid-water interface may be strongly influenced by the adsorption of organic matter. In this paper, we describe the adsorption of fulvic acid (FA) by metal(hydr)oxide surfaces with a heterogeneous surface complexation model, the ligand and charge distribution (LCD) model. The model is a self-consistent combination of the nonideal competitive adsorption (NICA) equation and the CD-MUSIC model. The LCD model can describe simultaneously the concentration, pH, and salt dependency of the adsorption with a minimum of only three adjustable parameters. Furthermore, the model predicts the coadsorption of protons accurately for an extended range of conditions. Surface speciation calculations show that almost all hydroxyl groups of the adsorbed FA molecules are involved in outer sphere complexation reactions. The carboxylic groups of the adsorbed FA molecule form inner and outer sphere complexes. Furthermore, part of the carboxylate groups remain noncoordinated and deprotonated.

  4. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  5. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.

    PubMed

    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc

    2015-09-01

    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica. PMID:25959598

  6. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  7. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  8. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei

    2009-01-01

    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  9. An H-Infinity Approach to Control Synthesis with Load Minimization for the F/A-18 Active Aeroelastic Wing

    NASA Technical Reports Server (NTRS)

    Lind, Rick

    1999-01-01

    The F/A-18 Active Aeroelastic Wing research aircraft will demonstrate technologies related to aeroservoelastic effects such as wing twist and load minimization. This program presents several challenges for control design that are often not considered for traditional aircraft. This paper presents a control design based on H-infinity synthesis that simultaneously considers the multiple objectives associated with handling qualities, actuator limitations, and loads. A point design is presented to demonstrate a controller and the resulting closed-loop properties.

  10. An H-infinity Approach to Control Synthesis with Load Minimization for the F/A-18 Active Aeroelastic Wing

    NASA Technical Reports Server (NTRS)

    Lind, Rick

    1999-01-01

    The F/A-18 Active Aeroelastic Wing research aircraft will demonstrate technologies related to aeroservoelastic effects such as wing twist and load minimization. This program presents several challenges for control design that are often not considered for traditional aircraft. This paper presents a control design based on H(sub infinity) synthesis that simultaneously considers the multiple objectives associated with handling qualities, actuator limitations, and loads. A point design is presented to demonstrate a controller and the resulting closed-loop properties.

  11. Synthesis and scavenging role of furan fatty acids

    PubMed Central

    Lemke, Rachelle A. S.; Peterson, Amelia C.; Ziegelhoffer, Eva C.; Westphall, Michael S.; Tjellström, Henrik; Coon, Joshua J.; Donohue, Timothy J.

    2014-01-01

    Fatty acids play important functional and protective roles in living systems. This paper reports on the synthesis of a previously unidentified 19 carbon furan-containing fatty acid, 10,13-epoxy-11-methyl-octadecadienoate (9-(3-methyl-5-pentylfuran-2-yl)nonanoic acid) (19Fu-FA), in phospholipids from Rhodobacter sphaeroides. We show that 19Fu-FA accumulation is increased in cells containing mutations that increase the transcriptional response of this bacterium to singlet oxygen (1O2), a reactive oxygen species generated by energy transfer from one or more light-excited donors to molecular oxygen. We identify a previously undescribed class of S-adenosylmethionine-dependent methylases that convert a phospholipid 18 carbon cis unsaturated fatty acyl chain to a 19 carbon methylated trans unsaturated fatty acyl chain (19M-UFA). We also identify genes required for the O2-dependent conversion of this 19M-UFA to 19Fu-FA. Finally, we show that the presence of 1O2 leads to turnover of 19Fu-Fa in vivo. We propose that furan-containing fatty acids like 19Fu-FA can act as a membrane-bound scavenger of 1O2, which is naturally produced by integral membrane enzymes of the R. sphaeroides photosynthetic apparatus. PMID:25092314

  12. Synthesis and in vitro and in vivo evaluation of SiFA-tagged bombesin and RGD peptides as tumor imaging probes for positron emission tomography.

    PubMed

    Lindner, Simon; Michler, Christina; Leidner, Stephanie; Rensch, Christian; Wängler, Carmen; Schirrmacher, Ralf; Bartenstein, Peter; Wängler, Björn

    2014-04-16

    Gastrin-releasing-peptide (GRP)-receptors and αvβ3-integrins are widely discussed as potential target structures for oncological imaging with positron emission tomography (PET). Favored by the overexpression of receptors on the surface of tumor cells good imaging characteristics can be achieved with highly specific radiolabeled receptor ligands. PEGylated bombesin (PESIN) derivatives as specific GRP receptor ligands and RGD (one-letter codes for arginine-glycine-aspartic acid) peptides as specific αvβ3 binders were synthesized and tagged with a silicon-fluorine-acceptor (SiFA) moiety. The SiFA synthon allows for a fast and highly efficient isotopic exchange reaction at room temperature giving the [(18)F]fluoride labeled peptides in up to 62% radiochemical yields (d.c.) and ≥99% radiochemical purity in a total synthesis time of less than 20 min. Using nanomolar quantities of precursor high specific activities of up to 60 GBq μmol(-1) were obtained. To compensate the high lipophilicity of the SiFA moiety various hydrophilic structure modifications were introduced leading to significantly reduced logD values. Competitive displacement experiments with the PESIN derivatives showed a 32 to 6 nM affinity to the GRP receptor on PC3 cells, and with the RGD peptides a 7 to 3 μM affinity to the αvβ3 integrins on U87MG cells. All derivatives proved to be stable in human plasma over at least 120 min. Small animal PET measurements and biodistribution studies revealed an enhanced and specific accumulation of the RGD peptide (18)F-SiFA-LysMe3-γ-carboxy-d-Glu-RGD (17) in the tumor tissue of U87MG tumor-bearing mice of 5.3% ID/g whereas the PESIN derivatives showed a high liver uptake and only a low accumulation in the tumor tissue of PC3 xenografts. Stability studies with compound 17 provided further information on its metabolism in vivo. These results altogether demonstrate that the reduction of the overall lipophilicity of SiFA tagged RGD peptides is a promising

  13. Inductions of the fatty acid 2-hydroxylase (FA2H) gene by Δ9-tetrahydrocannabinol in human breast cancer cells

    PubMed Central

    Takeda, Shuso; Harada, Mari; Su, Shengzhong; Okajima, Shunsuke; Miyoshi, Hiroko; Yoshida, Kazutaka; Nishimura, Hajime; Okamoto, Yoshiko; Amamoto, Toshiaki; Watanabe, Kazuhito; Omiecinski, Curtis J; Aramaki, Hironori

    2014-01-01

    To investigate gene(s) being regulated by Δ9-tetrahydrocannabinol (Δ9-THC), we performed DNA microarray analysis of human breast cancer MDA-MB-231 cells, which are poorly differentiated breast cancer cells, treated with Δ9-THC for 48 hr at an IC50 concentration of approximately 25 μM. Among the highly up-regulated genes (> 10-fold) observed, fatty acid 2-hydroxylase (FA2H) was significantly induced (17.8-fold). Although the physiological role of FA2H has not yet been fully understood, FA2H has been shown to modulate cell differentiation. The results of Oil Red O staining after Δ9-THC exposure showed the distribution of lipid droplets (a sign of the differentiated phenotype) in cells. Taken together, the results obtained here indicate that FA2H is a novel Δ9-THC-regulated gene, and that Δ9-THC induces differentiation signal(s) in poorly differentiated MDA-MB-231 cells. PMID:23535410

  14. Central nervous system dysfunction in a mouse model of FA2H deficiency.

    PubMed

    Potter, Kathleen A; Kern, Michael J; Fullbright, George; Bielawski, Jacek; Scherer, Steven S; Yum, Sabrina W; Li, Jian J; Cheng, Hua; Han, Xianlin; Venkata, Jagadish Kummetha; Khan, P Akbar Ali; Rohrer, Bärbel; Hama, Hiroko

    2011-07-01

    Fatty acid 2-hydroxylase (FA2H) is responsible for the synthesis of myelin galactolipids containing hydroxy fatty acid (hFA) as the N-acyl chain. Mutations in the FA2H gene cause leukodystrophy, spastic paraplegia, and neurodegeneration with brain iron accumulation. Using the Cre-lox system, we developed two types of mouse mutants, Fa2h(-/-) mice (Fa2h deleted in all cells by germline deletion) and Fa2h(flox/flox) Cnp1-Cre mice (Fa2h deleted only in oligodendrocytes and Schwann cells). We found significant demyelination, profound axonal loss, and abnormally enlarged axons in the CNS of Fa2h(-/-) mice at 12 months of age, while structure and function of peripheral nerves were largely unaffected. Fa2h(-/-) mice also exhibited histological and functional disruption in the cerebellum at 12 months of age. In a time course study, significant deterioration of cerebellar function was first detected at 7 months of age. Further behavioral assessments in water T-maze and Morris water maze tasks revealed significant deficits in spatial learning and memory at 4 months of age. These data suggest that various regions of the CNS are functionally compromised in young adult Fa2h(-/-) mice. The cerebellar deficits in 12-month-old Fa2h(flox/flox) Cnp1-Cre mice were indistinguishable from Fa2h(-/-) mice, indicating that these phenotypes likely stem from the lack of myelin hFA-galactolipids. In contrast, Fa2h(flox/flox) Cnp1-Cre mice did not show reduced performance in water maze tasks, indicating that oligodendrocytes are not involved in the learning and memory deficits found in Fa2h(-/-) mice. These findings provide the first evidence that FA2H has an important function outside of oligodendrocytes in the CNS. PMID:21491498

  15. Dissolution Profile of Mefenamic Acid Solid Dosage Forms in Two Compendial and Biorelevant (FaSSIF) Media.

    PubMed

    Nurhikmah, Wilda; Sumirtapura, Yeyet Cahyati; Pamudji, Jessie Sofia

    2016-01-01

    Mefenamic acid is a non-steroidal anti-inflammatory drug (NSAID) that is widely used for the treatment of mild-to-moderate pain. Mefenamic acid belongs to the Biopharmaceutical Classification System (BCS) class II drug which has lower water solubility but high permeability. There are two different compendial methods available for dissolution tests of mefenamic acid solid dosage forms, i.e. methods of United States Pharmacopeia 37 (USP) and Pharmacopoeia of the People's Republic of China 2010 (PPRC). Indonesian Pharmacopeia V ed. (FI) adopted the USP method. On the other hand, many researches focused on the use of a 'biorelevant' medium to develop the dissolution test method. The aim of this research was to study the dissolution profile of mefenamic acid from its solid dosage forms (caplet and capsule) available in the Indonesian market with three different dissolution medium: USP, PPRC, and biorelevant fasted simulated small intestinal fluid (FaSSIF) media. The tested products consisted of the innovator's product (available only in caplet dosage form, FN caplet) and generic products (available as caplet and capsule). The dissolution test of the drug products in all dissolution media was performed in 900 mL of medium using apparatus II (paddle) at a temperature of 37°C and rotation speed of 75 rpm, except for the capsule product and for USP medium, both of which tests were done using apparatus I (basket) with rotation speed of 100 rpm. The solubility test of mefenamic acid was carried out in all media at temperature of 37°C. The result obtained from the solubility test showed that the the highest solubility of mefenamic acid was obtained in USP medium (approximately 2 mg/mL), followed by PPRC medium (about 0.5 mg/mL), and FaSSIF medium (approximately 0.06 mg/ml). In the dissolution test, percentage of drug dissolved in in the USP and PPRC media after 45 min for all products reached more than 75%, except for the PN caplet in USP medium which reached only about 44

  16. Dissolution Profile of Mefenamic Acid Solid Dosage Forms in Two Compendial and Biorelevant (FaSSIF) Media

    PubMed Central

    Nurhikmah, Wilda; Sumirtapura, Yeyet Cahyati; Pamudji, Jessie Sofia

    2016-01-01

    Mefenamic acid is a non-steroidal anti-inflammatory drug (NSAID) that is widely used for the treatment of mild-to-moderate pain. Mefenamic acid belongs to the Biopharmaceutical Classification System (BCS) class II drug which has lower water solubility but high permeability. There are two different compendial methods available for dissolution tests of mefenamic acid solid dosage forms, i.e. methods of United States Pharmacopeia 37 (USP) and Pharmacopoeia of the People’s Republic of China 2010 (PPRC). Indonesian Pharmacopeia V ed. (FI) adopted the USP method. On the other hand, many researches focused on the use of a ‘biorelevant’ medium to develop the dissolution test method. The aim of this research was to study the dissolution profile of mefenamic acid from its solid dosage forms (caplet and capsule) available in the Indonesian market with three different dissolution medium: USP, PPRC, and biorelevant fasted simulated small intestinal fluid (FaSSIF) media. The tested products consisted of the innovator’s product (available only in caplet dosage form, FN caplet) and generic products (available as caplet and capsule). The dissolution test of the drug products in all dissolution media was performed in 900 mL of medium using apparatus II (paddle) at a temperature of 37°C and rotation speed of 75 rpm, except for the capsule product and for USP medium, both of which tests were done using apparatus I (basket) with rotation speed of 100 rpm. The solubility test of mefenamic acid was carried out in all media at temperature of 37°C. The result obtained from the solubility test showed that the the highest solubility of mefenamic acid was obtained in USP medium (approximately 2 mg/mL), followed by PPRC medium (about 0.5 mg/mL), and FaSSIF medium (approximately 0.06 mg/ml). In the dissolution test, percentage of drug dissolved in in the USP and PPRC media after 45 min for all products reached more than 75%, except for the PN caplet in USP medium which reached only

  17. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  18. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  19. The effect of gestational age on expression of genes involved in uptake, trafficking and synthesis of fatty acids in the rat placenta.

    PubMed

    Rodríguez-Cruz, Maricela; González, Raúl Sánchez; Maldonado, Jorge; López-Alarcón, Mardia; Bernabe-García, Mariela

    2016-10-15

    Gestation triggers a tight coordination among maternal tissues to provide fatty acids (FA) to the fetus through placental transport; however, there is insufficient evidence regarding regulation of proteins involved in placental transport of FA according to gestational age. The aim of this study was to determine the role of gestational age on the expression of genes involved in FA uptake, trafficking and synthesis in the rat placenta to support fetal demands. Gene expression of encoding proteins for placental transport and synthesis of FA was measured in placenta. Also, FA composition was measured in placenta, fetuses and newborns. mRNA expression of lipoprotein lipase (lpl) and fatp-1 (for uptake) was 4.4- and 1.43-fold higher, respectively, during late gestation than at P14, but expression of p-fabp-pm decreased 0.37-fold at late pregnancy in comparison with P14. Only mRNA fabp-4 member for trafficking of FA was 2.95-fold higher at late gestation than at P14. mRNA of fasn and elovl-6 participating in saturated FA and enzymes for the polyunsaturated FA synthesis were downregulated during late gestation and their regulator srebf-1c increased at P16. This study suggests that gestational age has an effect on expression of some genes involved in uptake, trafficking and synthesis of FA in the rat placenta; mRNA expression of lpl and, fatp-1 for uptake and fabp-4 implicated in trafficking was expressed at high levels at late gestation. In addition, placenta expresses the mRNAs involved in FA synthesis; these genes were expressed at low levels at late gestation. Additionally, mRNAs of Srebf-1c transcriptional regulator of desaturases and elongases was highly expressed during late gestation. Finally, these changes in the rat placenta allowed the placenta to partially supply saturated and monounsaturated FA to the fetus. PMID:27317891

  20. Reassessment of the Genetic Regulation of Fatty Acid Synthesis in Escherichia coli: Global Positive Control by the Dual Functional Regulator FadR

    PubMed Central

    My, L.; Ghandour Achkar, N.; Viala, J. P.

    2015-01-01

    ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator

  1. Impact of high altitude on the hepatic fatty acid oxidation and synthesis in rats

    SciTech Connect

    Ni, Qian; Shao, Yuan; Wang, Ying Zhen; Jing, Yu Hong; Zhang, You Cheng

    2014-04-04

    Highlights: • Acute exposure to high altitude (HA) increased hepatic fatty acid (FA) β-oxidation. • Acute exposure of rats to HA increased hepatic FA synthesis. • PPARα and AMPK can regulate the FA metabolism. • FA may be a key energy fuel and a compensation for CHO during acute exposure to HA. • The acute changes of FA metabolism may be a mechanism of acclimatization. - Abstract: High altitude (HA) affects energy metabolism. The impact of acute and chronic HA acclimatization on the major metabolic pathways is still controversial. In this study, we aimed to unveil the impact of HA on the key enzymes involved in the fatty acid (FA) metabolism in liver. Rats were exposed to an altitude of 4300 m for 30 days and the expressions of two key proteins involved in FA β-oxidation (carnitine palmitoyl transferase I, CPT-I; and peroxisome proliferator-activated receptor alpha, PPARα), two proteins involved in FA synthesis (acetyl CoA carboxylase-1, ACC-1; and AMP-activated protein kinase, AMPK), as well as the total ketone body in the liver and the plasma FFAs were examined. Rats without HA exposure were used as controls. We observed that the acute exposure of rats to HA (3 days) led to a significant increase in the expressions of CPT-I and PPARα and in the total hepatic ketone body. Longer exposure (15 days) caused a marked decrease in the expression of CPT-I and PPARα. By 30 days after HA exposure, the expression levels of CPT-I and PPARα returned to the control level. The hepatic ACC-1 level showed a significant increase in rats exposed to HA for 1 and 3 days. In contrast, the hepatic level of AMPK showed a significant reduction throughout the experimental period. Plasma FFA concentrations did not show any significant changes following HA exposure. Thus, increased hepatic FA oxidation and synthesis in the early phase of HA exposure may be among the important mechanisms for the rats to respond to the hypoxic stress in order to acclimatize themselves to the

  2. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  3. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  4. Hydroxamic acids in asymmetric synthesis.

    PubMed

    Li, Zhi; Yamamoto, Hisashi

    2013-02-19

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  5. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  6. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  7. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  8. Laccase mediated-synthesis of hydroxycinnamoyl-peptide from ferulic acid and carnosine.

    PubMed

    Aljawish, Abdulhadi; Chevalot, Isabelle; Madad, Nidal; Paris, Cédric; Muniglia, Lionel

    2016-06-10

    Carnosine (CAR) dipeptide was functionalized with ferulic acid (FA) as substrate using laccase from Myceliophtora thermophila as biocatalyst. The enzymatic reaction was performed in aqueous medium under mild conditions (pH 7.5, 30°C) as an eco-friendly procedure. Results showed that this enzymatic process led to the synthesis of two new derivatives (P1, P2), from the coupling between CAR and FA derived products. Conditions allowing a high production of P1, P2 derivatives were determined with an optimal ratio of (FA: CAR) of (1:1.6) at optimal time reaction of 8h. Under these optimal conditions, the coupling between CAR and FA-products was demonstrated, resulting in the decrease of -NH2 groups (almost 50%) as quantified via derivatization. Due to the presence of FA in the structure of these new derivatives, they exhibited higher hydrophobic property than carnosine. Structural analyses by mass spectrometry showed that P1 and P2 (FA-CAR) derivatives exhibited the same molecular mass (MM 770g/mol) containing one CAR-molecule and three FA-molecules but with different chemical structures. Furthermore, these derivatives presented improved antioxidant (almost 10 times) and anti-proliferative (almost 18 times) properties in comparison with CAR. Moreover, P1 derivative exhibited higher antioxidant and anti-proliferative activities than P2 derivative, which confirmed the different structures of P1 and P2. These results suggested that the oxidized phenols coupling with carnosine is a promising process to enhance the CAR-properties. PMID:27084055

  9. Synthesis of new polysialic acid derivatives.

    PubMed

    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke

    2010-09-01

    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  10. Total synthesis of (+)-zaragozic acid C.

    PubMed

    Armstrong, A; Barsanti, P A; Jones, L H; Ahmed, G

    2000-10-20

    A total synthesis of (+)-zaragozic acid C is described. Key features of the synthesis are the use of a double Sharpless asymmetric dihydroxylation reaction of diene 6 to control stereochemistry at four contiguous stereocenters from C3 to C6; the introduction of the C1-side chain by reaction between the anion derived from the dithiane monosulfoxide 27 and the core aldehyde 12; a high yielding, acid-mediated simultaneous acetonide deprotection-dithiane removal-ketalization procedure leading exclusively to the 2, 8-dioxabicyclo[3.2.1]octane core 34; and a novel triple oxidation procedure allowing installation of the tricarboxylic acid. PMID:11031024

  11. Folic acid conjugated cross-linked acrylic polymer (FA-CLAP) hydrogel for site specific delivery of hydrophobic drugs to cancer cells

    PubMed Central

    2014-01-01

    Background The hydrogel based system is found to be rarely reported for the delivery of hydrophobic drug due to the incompatibility of hydrophilicity of the polymer network and the hydrophobicity of drug. This problem can be solved by preparing semi-interpenetrating network of cross-linked polymer for tuning the hydrophilicity so as to entrap the hydrophobic drugs. The current study is to develop a folic acid conjugated cross-linked pH sensitive, biocompatible polymeric hydrogel to achieve a site specific drug delivery. For that, we have synthesized a folic acid conjugated PEG cross-linked acrylic polymer (FA-CLAP) hydrogel and investigated its loading and release of curcumin. The formed polymer hydrogel was then conjugated with folic acid for the site specific delivery of curcumin to cancer cells and then further characterized and conducted the cell uptake and cytotoxicity studies on human cervical cancer cell lines (HeLa). Results In this study, we synthesized folic acid conjugated cross-linked acrylic hydrogel for the delivery of hydrophobic drugs to the cancer site. Poly (ethyleneglycol) (PEG) diacrylate cross-linked acrylic polymer (PAA) was prepared via inverse emulsion polymerization technique and later conjugated it with folic acid (FA-CLAP). Hydrophobic drug curcumin is entrapped into it and investigated the entrapment efficiency. Characterization of synthesized hydogel was done by using Fourier Transform-Infrared spectroscopy (FT-IR), Transmission Electron Microscopy (TEM), Differential Scanning Calorimetry (DSC). Polymerization and folate conjugation was confirmed by FT-IR spectroscopy. The release kinetics of drug from the entrapped form was studied which showed initial burst release followed by sustained release due to swelling and increased cross-linking. In vitro cytotoxicity and cell uptake studies were conducted in human cervical cancer (HeLa) cell lines. Conclusions Results showed that curcumin entrapped folate conjugated cross-linked acrylic

  12. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  13. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  14. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  15. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  16. Enantioselective Total Synthesis of Secalonic Acid E.

    PubMed

    Ganapathy, Dhandapani; Reiner, Johannes R; Löffler, Lorenz E; Ma, Ling; Gnanaprakasam, Boopathy; Niepötter, Benedikt; Koehne, Ingo; Tietze, Lutz F

    2015-11-16

    The first enantioselective synthesis of a secalonic acid containing a dimeric tetrahydroxanthenone skeleton is described, using a Wacker-type cyclization of a methoxyphenolic compound to form a chiral chroman with a quaternary carbon stereogenic center with >99% ee. Further steps are a Sharpless dihydroxylation and a Dieckmann condensation to give a tetrahydroxanthenone. A late-stage one-pot palladium-catalyzed Suzuki-dimerization reaction leads to the 2,2'-biphenol linkage to complete the enantioselective total synthesis of secalonic acid E in 18 steps with 8% overall yield. PMID:26447631

  17. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  18. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  19. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  20. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  1. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  2. Synthesis of nucleic acid methylphosphonothioates.

    PubMed Central

    Roelen, H C; de Vroom, E; van der Marel, G A; van Boom, J H

    1988-01-01

    The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine. PMID:3412896

  3. t-Bu2SiF-derivatized D2-receptor ligands: the first SiFA-containing small molecule radiotracers for target-specific PET-imaging.

    PubMed

    Iovkova-Berends, Ljuba; Wängler, Carmen; Zöller, Thomas; Höfner, Georg; Wanner, Klaus Theodor; Rensch, Christian; Bartenstein, Peter; Kostikov, Alexey; Schirrmacher, Ralf; Jurkschat, Klaus; Wängler, Björn

    2011-01-01

    The synthesis, radiolabeling and in vitro evaluation of new silicon-fluoride acceptor (SiFA) derivatized D(2)-receptor ligands is reported. The SiFA-technology simplifies the introduction of fluorine-18 into target specific biomolecules for Positron-Emission-Tomography (PET). However, one of the remaining challenges, especially for small molecules such as receptor-ligands, is the bulkiness of the SiFA-moiety. We therefore synthesized four Fallypride SiFA-conjugates derivatized either directly at the benzoic acid ring system (SiFA-DMFP, SiFA-FP, SiFA-DDMFP) or at the butyl-side chain (SiFA-M-FP) and tested their receptor affinities. We found D(2)-receptor affinities for all compounds in the nanomolar range (K(i(SiFA-DMFP)) = 13.6 nM, K(i(SiFA-FP)) = 33.0 nM, K(i(SiFA-DDMFP)) = 62.7 nM and K(i(SiFA-M-FP)) = 4.21 nM). The radiofluorination showed highest yields when 10 nmol of the precursors were reacted with [(18)F]fluoride/TBAHCO(3) in acetonitrile. After a reversed phased cartridge purification the desired products could be isolated as an injectable solution after only 10 min synthesis time with radiochemical yields (RCY) of more than 40% in the case of SiFA-DMFP resulting in specific activities >41 GBq/µmol (>1,100 Ci/mmol). Furthermore, the radiolabeled products were shown to be stable in the injectable solutions, as well as in human plasma, for at least 90 min. PMID:21892125

  4. Inhibition of Peptidoglycan, Ribonucleic Acid, and Protein Synthesis in Tolerant Strains of Streptococcus mutans

    PubMed Central

    Mychajlonka, Myron; McDowell, Thomas D.; Shockman, Gerald D.

    1980-01-01

    Exposure of exponentially growing cultures of Streptococcus mutans strains FA-1 and GS-5 to various concentrations of benzylpenicillin (Pen G) resulted in inhibition of turbidity increases at low concentrations (0.02 to 0.04 μg/ml). However, in contrast to some other streptococcal species, growth inhibition was not accompanied by cellular lysis or by a rapid loss of viability. In both strains, synthesis of insoluble cell wall peptidoglycan was very sensitive to Pen G inhibition and responded in a dose-dependent manner to concentrations of about 0.2 and 0.5 μg/ml for strains GS-5 and FA-1, respectively. Higher Pen G concentrations failed to inhibit further either growth or insoluble peptidoglycan assembly. Somewhat surprisingly, Pen G also inhibited both ribonucleic acid (RNA) and protein syntheses, each in a dose-dependent manner. Compared with inhibition of peptidoglycan synthesis, inhibition of RNA and protein syntheses by Pen G was less rapid and less extensive. Maximum amounts of radiolabeled Pen G were specifically bound to intact cells upon exposure to about 0.2 and 0.5 μg/ml of Pen G for strains GS-5 and FA-1, respectively, concentrations consistent with those that resulted in maximum or near-maximum inhibitions of the synthesis of cellular peptidoglycan, RNA, and protein. Five polypeptide bands that had a very high affinity for [14C]Pen G were detected in a crude cell envelope preparation of strain FA-1. After exposure of cultures of strain FA-1 to the effects of saturating concentrations of the drug for up to 3 h, addition of penicillinase was followed by recovery of growth after a lag. The length of the lag before regrowth depended on both Pen G concentration and time of exposure. On the basis of these and other observations, it is proposed that the secondary inhibitions of cellular RNA or protein synthesis, or both, are involved in the tolerance of these organisms to lysis and killing by Pen G and other inhibitors of insoluble peptidoglycan assembly

  5. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  6. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  7. Δ(9)-THC modulation of fatty acid 2-hydroxylase (FA2H) gene expression: possible involvement of induced levels of PPARα in MDA-MB-231 breast cancer cells.

    PubMed

    Takeda, Shuso; Ikeda, Eriko; Su, Shengzhong; Harada, Mari; Okazaki, Hiroyuki; Yoshioka, Yasushi; Nishimura, Hajime; Ishii, Hiroyuki; Kakizoe, Kazuhiro; Taniguchi, Aya; Tokuyasu, Miki; Himeno, Taichi; Watanabe, Kazuhito; Omiecinski, Curtis J; Aramaki, Hironori

    2014-12-01

    We recently reported that Δ(9)-tetrahydrocannabinol (Δ(9)-THC), a major cannabinoid component in Cannabis Sativa (marijuana), significantly stimulated the expression of fatty acid 2-hydroxylase (FA2H) in human breast cancer MDA-MB-231 cells. Peroxisome proliferator-activated receptor α (PPARα) was previously implicated in this induction. However, the mechanisms mediating this induction have not been elucidated in detail. We performed a DNA microarray analysis of Δ(9)-THC-treated samples and showed the selective up-regulation of the PPARα isoform coupled with the induction of FA2H over the other isoforms (β and γ). Δ(9)-THC itself had no binding/activation potential to/on PPARα, and palmitic acid (PA), a PPARα ligand, exhibited no stimulatory effects on FA2H in MDA-MB-231 cells; thus, we hypothesized that the levels of PPARα induced were involved in the Δ(9)-THC-mediated increase in FA2H. In support of this hypothesis, we herein demonstrated that; (i) Δ(9)-THC activated the basal transcriptional activity of PPARα in a concentration-dependent manner, (ii) the concomitant up-regulation of PPARα/FA2H was caused by Δ(9)-THC, (iii) PA could activate PPARα after the PPARα expression plasmid was introduced, and (iv) the Δ(9)-THC-induced up-regulation of FA2H was further stimulated by the co-treatment with L-663,536 (a known PPARα inducer). Taken together, these results support the concept that the induced levels of PPARα may be involved in the Δ(9)-THC up-regulation of FA2H in MDA-MB-231 cells. PMID:25291031

  8. Δ9-THC modulation of fatty acid 2-hydroxylase (FA2H) gene expression: Possible involvement of induced levels of PPARα in MDA-MB-231 breast cancer cells

    PubMed Central

    Takeda, Shuso; Ikeda, Eriko; Su, Shengzhong; Harada, Mari; Okazaki, Hiroyuki; Yoshioka, Yasushi; Nishimura, Hajime; Ishii, Hiroyuki; Kakizoe, Kazuhiro; Taniguchi, Aya; Tokuyasu, Miki; Himeno, Taichi; Watanabe, Kazuhito; Omiecinski, Curtis J.; Aramaki, Hironori

    2014-01-01

    We recently reported that Δ9-tetrahydrocannabinol (Δ9-THC), a major cannabinoid component in Cannabis Sativa (marijuana), significantly stimulated the expression of fatty acid 2 hydroxylase (FA2H) in human breast cancer MDA-MB-231 cells. Peroxisome proliferator-activated receptor α (PPARα) was previously implicated in this induction. However, the mechanisms mediating this induction have not been elucidated in detail. We performed a DNA microarray analysis of Δ9-THC treated samples and showed the selective up-regulation of the PPARα isoform coupled with the induction of FA2H over the other isoforms (β and γ). Δ-THC itself had no binding/activation potential to/on PPARα, and palmitic acid (PA), a PPARα ligand, exhibited no stimulatory effects on FA2H in MDA MB 231 cells; thus, we hypothesized that the levels of PPARα induced were involved in the Δ9-THC mediated increase in FA2H. In support of this hypothesis, we herein demonstrated that; (i) Δ9 THC activated the basal transcriptional activity of PPARα in a concentration-dependent manner, (ii) the concomitant up-regulation of PPARα/FA2H was caused by Δ9-THC, (iii) PA could activate PPARα after the PPARα expression plasmid was introduced, and (iv) the Δ9-THC induced up regulation of FA2H was further stimulated by the co-treatment with L-663,536 (a known PPARα inducer). Taken together, these results support the concept that the induced levels of PPARα may be involved in the Δ9 THC up-regulation of FA2H in MDA-MB-231 cells. PMID:25291031

  9. Synthesis of carbon-13-labeled tetradecanoic acids.

    PubMed

    Sparrow, J T; Patel, K M; Morrisett, J D

    1983-07-01

    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  10. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  11. Synthesis and properties of synthetic fulvic acid derived from hematoxylin

    NASA Astrophysics Data System (ADS)

    Litvin, Valentina A.; Minaev, Boris F.; Baryshnikov, Gleb V.

    2015-04-01

    A model fulvic acid (FA) was synthesized from a natural dye, hematoxylin, in a slow oxidative polymerization/condensation reaction catalysed by OH- at pH ca. 12. The resulting dark-brown product, acidified to pH ca. 2, did not precipitate from the reaction solution. It was isolated and purified by cation-exchange resin. Its physicochemical and spectroscopic properties, as determined by means of elemental analysis, molecular weight analyses, Fourier transform infra red (FTIR) and ultraviolet-visible (UV-VIS) spectroscopy, X-ray diffraction and electron paramagnetic resonance (EPR) spectroscopy, showed a close resemblance to natural FA. The similarity and differences between synthetic fulvic acids derived from hematoxylin and the natural fulvic acids substances are discussed. Quantum-chemical calculations of the supposed primary oxidation products of hematoxylin are performed and compared with observations.

  12. Fatty Acids and Breast Cancer: Make Them on Site or Have Them Delivered.

    PubMed

    Kinlaw, William B; Baures, Paul W; Lupien, Leslie E; Davis, Wilson L; Kuemmerle, Nancy B

    2016-10-01

    Brisk fatty acid (FA) production by cancer cells is accommodated by the Warburg effect. Most breast and other cancer cell types are addicted to fatty acids (FA), which they require for membrane phospholipid synthesis, signaling purposes, and energy production. Expression of the enzymes required for FA synthesis is closely linked to each of the major classes of signaling molecules that stimulate BC cell proliferation. This review focuses on the regulation of FA synthesis in BC cells, and the impact of FA, or the lack thereof, on the tumor cell phenotype. Given growing awareness of the impact of dietary fat and obesity on BC biology, we will also examine the less-frequently considered notion that, in addition to de novo FA synthesis, the lipolytic uptake of preformed FA may also be an important mechanism of lipid acquisition. Indeed, it appears that cancer cells may exist at different points along a "lipogenic-lipolytic axis," and FA uptake could thwart attempts to exploit the strict requirement for FA focused solely on inhibition of de novo FA synthesis. Strategies for clinically targeting FA metabolism will be discussed, and the current status of the medicinal chemistry in this area will be assessed. J. Cell. Physiol. 231: 2128-2141, 2016. © 2016 Wiley Periodicals, Inc. PMID:26844415

  13. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  14. Hyaluronic acid lipoate: synthesis and physicochemical properties.

    PubMed

    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco

    2013-03-01

    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  15. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  16. Rapid synthesis of the 7-deoxy zaragozic acid core.

    PubMed

    Calter, Michael A; Zhu, Cheng; Lachicotte, Rene J

    2002-01-24

    [reaction: see text] We have developed an efficient synthesis of the 7-deoxy zaragozic acid core. The synthesis begins with a Feist-Bénary reaction that assembles all three carbons of the polycarboxylic acid portion of the core. This reaction is followed by highly diastereoselective aldol and dihydroxylation reactions that set the remaining stereocenters of the core. The synthesis finishes with lactol oxidation and lactone alcoholysis/ketal formation reactions to construct the bicyclic ring system of the core. PMID:11796052

  17. First total synthesis of prasinic acid and its anticancer activity.

    PubMed

    Chakor, Narayan; Patil, Ganesh; Writer, Diana; Periyasamy, Giridharan; Sharma, Rajiv; Roychowdhury, Abhijit; Mishra, Prabhu Dutt

    2012-11-01

    The first total synthesis of prasinic acid is being reported along with its biological evaluation. The ten step synthesis involved readily available and cheap starting materials and can easily be transposed to large scale manufacturing. The crucial steps of the synthesis included the formation of two different aromatic units (7 and 9) and their coupling reaction. The synthetic prasinic acid exhibited moderate antitumor activity (IC(50) 4.3-9.1 μM) in different lines of cancer cells. PMID:23031589

  18. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  19. Opuntia ficus indica (nopal) attenuates hepatic steatosis and oxidative stress in obese Zucker (fa/fa) rats.

    PubMed

    Morán-Ramos, Sofía; Avila-Nava, Azalia; Tovar, Armando R; Pedraza-Chaverri, José; López-Romero, Patricia; Torres, Nimbe

    2012-11-01

    Nonalcoholic fatty liver disease (NAFLD) is associated with multiple factors such as obesity, insulin resistance, and oxidative stress. Nopal, a cactus plant widely consumed in the Mexican diet, is considered a functional food because of its antioxidant activity and ability to improve biomarkers of metabolic syndrome. The aim of this study was to assess the effect of nopal consumption on the development of hepatic steatosis and hepatic oxidative stress and on the regulation of genes involved in hepatic lipid metabolism. Obese Zucker (fa/fa) rats were fed a control diet or a diet containing 4% nopal for 7 wk. Rats fed the nopal-containing diet had ∼50% lower hepatic TG than the control group as well as a reduction in hepatomegaly and biomarkers of hepatocyte injury such as alanine and aspartate aminotransferases. Attenuation of hepatic steatosis by nopal consumption was accompanied by a higher serum concentration of adiponectin and a greater abundance of mRNA for genes involved in lipid oxidation and lipid export and production of carnitine palmitoyltransferase-1 and microsomal TG transfer proteins in liver. Hepatic reactive oxygen species and lipid peroxidation biomarkers were significantly lower in rats fed nopal compared with the control rats. Furthermore, rats fed the nopal diet had a lower postprandial serum insulin concentration and a greater liver phosphorylated protein kinase B (pAKT):AKT ratio in the postprandial state. This study suggests that nopal consumption attenuates hepatic steatosis by increasing fatty acid oxidation and VLDL synthesis, decreasing oxidative stress, and improving liver insulin signaling in obese Zucker (fa/fa) rats. PMID:23014486

  20. Indoleamine 2,3-dioxygenase depletes tryptophan, activates general control non-derepressible 2 kinase and down-regulates key enzymes involved in fatty acid synthesis in primary human CD4+ T cells.

    PubMed

    Eleftheriadis, Theodoros; Pissas, Georgios; Antoniadi, Georgia; Liakopoulos, Vassilios; Stefanidis, Ioannis

    2015-10-01

    Indoleamine 2,3-dioxygenase (IDO) is expressed in antigen-presenting cells and exerts immunosuppressive effects on CD4(+) T cells. One mechanism is through the inhibition of aerobic glycolysis. Another prerequisite for T-cell proliferation and differentiation into effector cells is increased fatty acid (FA) synthesis. The effect of IDO on enzymes involved in FA synthesis was evaluated in primary human cells both in mixed lymphocyte reactions in the presence or not of the IDO inhibitor 1-dl-methyl-tryptophan, and in stimulated CD4(+) T cells in the presence or not of the general control non-derepressible 2 (GCN2) kinase activator tryptophanol (TRP). IDO or TRP inhibited cell proliferation. By assessing the level of GCN2 kinase or mammalian target of rapamycin complex 1 substrates along with a kynurenine free system we showed that IDO exerts its effect mainly through activation of GCN2 kinase. IDO or TRP down-regulated ATP-citrate lyase and acetyl coenzyme A carboxylase 1, key enzymes involved in FA synthesis. Also, IDO or TRP altered the expression of enzymes that control the availability of carbon atoms for FA synthesis, such as lactate dehydrogenase-A, pyruvate dehydrogenase, glutaminase 1 and glutaminase 2, in a way that inhibits FA synthesis. In conclusion, IDO through GCN2 kinase activation inhibits CD4(+) T-cell proliferation and down-regulates key enzymes that directly or indirectly promote FA synthesis, a prerequisite for CD4(+) T-cell proliferation and differentiation into effector cell lineages. PMID:26147366

  1. Brain white matter development is associated with a human-specific haplotype increasing the synthesis of long chain fatty acids.

    PubMed

    Peters, Bart D; Voineskos, Aristotle N; Szeszko, Philip R; Lett, Tristram A; DeRosse, Pamela; Guha, Saurav; Karlsgodt, Katherine H; Ikuta, Toshikazu; Felsky, Daniel; John, Majnu; Rotenberg, David J; Kennedy, James L; Lencz, Todd; Malhotra, Anil K

    2014-04-30

    The genetic and molecular pathways driving human brain white matter (WM) development are only beginning to be discovered. Long chain polyunsaturated fatty acids (LC-PUFAs) have been implicated in myelination in animal models and humans. The biosynthesis of LC-PUFAs is regulated by the fatty acid desaturase (FADS) genes, of which a human-specific haplotype is strongly associated with ω-3 and ω-6 LC-PUFA concentrations in blood. To investigate the relationship between LC-PUFA synthesis and human brain WM development, we examined whether this FADS haplotype is associated with age-related WM differences across the life span in healthy individuals 9-86 years of age (n = 207). Diffusion tensor imaging was performed to measure fractional anisotropy (FA), a putative measure of myelination, of the cerebral WM tracts. FADS haplotype status was determined with a single nucleotide polymorphism (rs174583) that tags this haplotype. Overall, normal age-related WM differences were observed, including higher FA values in early adulthood compared with childhood, followed by lower FA values across older age ranges. However, individuals homozygous for the minor allele (associated with lower LC-PUFA concentrations) did not display these normal age-related WM differences (significant age × genotype interactions, p(corrected) < 0.05). These findings suggest that LC-PUFAs are involved in human brain WM development from childhood into adulthood. This haplotype and LC-PUFAs may play a role in myelin-related disorders of neurodevelopmental origin. PMID:24790207

  2. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  3. Stereospecificity of fatty acid 2-hydroxylase and differential functions of 2-hydroxy fatty acid enantiomers[S

    PubMed Central

    Guo, Lin; Zhang, Xu; Zhou, Dequan; Okunade, Adewole L.; Su, Xiong

    2012-01-01

    FA 2-hydroxylase (FA2H) is an NAD(P)H-dependent enzyme that initiates FA α oxidation and is also responsible for the biosynthesis of 2-hydroxy FA (2-OH FA)-containing sphingolipids in mammalian cells. The 2-OH FA is chiral due to the asymmetric carbon bearing the hydroxyl group. Our current study performed stereochemistry investigation and showed that FA2H is stereospecific for the production of (R)-enantiomers. FA2H knockdown in adipocytes increases diffusional mobility of raft-associated lipids, leading to reduced GLUT4 protein level, glucose uptake, and lipogenesis. The effects caused by FA2H knockdown were reversed by treatment with exogenous (R)-2-hydroxy palmitic acid, but not with the (S)-enantiomer. Further analysis of sphingolipids demonstrated that the (R)-enantiomer is enriched in hexosylceramide whereas the (S)-enantiomer is preferentially incorporated into ceramide, suggesting that the observed differential effects are in part due to synthesis of sphingolipids containing different 2-OH FA enantiomers. These results may help clarify the mechanisms underlying the recently identified diseases associated with FA2H mutations in humans and may lead to potential pharmaceutical and dietary treatments. This study also provides critical information to help study functions of 2-OH FA enantiomers in FA α oxidation and possibly other sphingolipid-independent pathways. PMID:22517924

  4. Total synthesis and complete stereostructure of gambieric acid A.

    PubMed

    Fuwa, Haruhiko; Ishigai, Kazuya; Hashizume, Keisuke; Sasaki, Makoto

    2012-07-25

    Total synthesis of gambieric acid A, a potent antifungal polycyclic ether metabolite, has been accomplished for the first time, which firmly established the complete stereostructure of this natural product. PMID:22779404

  5. Synthesis of fatty acids in the perused mouse liver.

    PubMed

    Salmon, D M; Bowen, N L; Hems, D A

    1974-09-01

    1. Fatty acid synthesis de novo was measured in the perfused liver of fed mice. 2. The total rate, measured by the incorporation into fatty acid of (3)H from (3)H(2)O (1-7mumol of fatty acid/h per g of fresh liver), resembled the rate found in the liver of intact mice. 3. Perfusions with l-[U-(14)C]lactic acid and [U-(14)C]glucose showed that circulating glucose at concentrations less than about 17mm was not a major carbon source for newly synthesized fatty acid, whereas lactate (10mm) markedly stimulated fatty acid synthesis, and contributed extensive carbon to lipogenesis. 4. The identification of 50% of the carbon converted into newly synthesized fatty acid lends further credibility to the use of (3)H(2)O to measure hepatic fatty acid synthesis. 5. The total rate of fatty acid synthesis, and the contribution of glucose carbon to lipogenesis, were directly proportional to the initial hepatic glycogen concentration. 6. The proportion of total newly synthesized lipid that was released into the perfusion medium was 12-16%. 7. The major products of lipogenesis were saturated fatty acids in triglyceride and phospholipid. 8. The rate of cholesterol synthesis, also measured with (3)H(2)O, expressed as acetyl residues consumed, was about one-fourth of the basal rate of fatty acid synthesis. 9. These results are discussed in terms of the carbon sources of hepatic newly synthesized fatty acids, and the effect of glucose, glycogen and lactate in stimulating lipogenesis, independently of their role as precursors. PMID:4464843

  6. Essential Fatty Acid Assimilation and Synthesis in Larvae of the Bivalve Crassostrea gigas.

    PubMed

    da Costa, Fiz; Robert, René; Quéré, Claudie; Wikfors, Gary H; Soudant, Philippe

    2015-05-01

    Essential fatty acids (EFA) are important for bivalve larval survival and growth. The purpose of this study was to quantitatively assess for the first time through a mass-balance approach dietary EFA incorporation and synthesis within Crassostrea gigas larvae. A first experiment was carried out using two microalgae, Tisochrysis lutea (T) and Chaetoceros neogracile (Cg), as mono- and bi-specific diets. A second experiment using a similar design was performed to confirm and extend the results obtained in the first. Flow-through larval rearing was used for accurate control of food supply and measurement of ingestion. Non-methylene-interrupted fatty acids were synthetized from precursors supplied in the diet: 16:1n-7 and 18:1n-9, mediated by Δ5 desaturase. Moreover, this Δ5 desaturase presumably allowed larvae to convert 20:3n-6 and 20:4n-3 to 20:4n-6 and 20:5n-3, respectively, when the product EFA were poorly or not supplied in the diet, as when larvae were fed T exclusively. Under our experimental conditions, none of the diets induced 22:6n-3 synthesis; however, 22:6n-3 incorporation into larval tissues occurred selectively under non-limiting dietary supply to maintain optimal levels in the larvae. This combination of flow-through larval rearing and biochemical analysis of FA levels could be applied to additional dietary experiments to precisely define optimal levels of EFA supply. PMID:25771891

  7. Lipids and FA analysis of canine prostate tissue.

    PubMed

    Attar-Bashi, Nadia M; Orzeszko, Karyn; Slocombe, Ronald F; Sinclair, Andrew J

    2003-06-01

    It is widely reported that an association exists between dietary fat intake and the incidence of prostate cancer in humans. To study this association, there is a need for an animal model where prostate carcinogenesis occurs spontaneously. The canine prostate is considered a suitable experimental model for prostate cancer in humans since it is morphologically similar to the human prostate and both humans and dogs have a predisposition to benign and malignant prostate disease. In this study, the FA and lipids profiles of the normal canine prostate tissue from nine dogs were examined. The total lipid content of the canine prostate tissue was 1.7 +/- 0.5% (wet weight). The lipid composition analysis using TLC-FID showed that the two major lipid classes were phospholipids and TAG. Total FA, phospholipid, and TAG FA analysis showed that the major FA were palmitic acid (16:0), stearic acid (18:0), oleic acid (18:1), linoleic acid (18:2n-6), and arachidonic acid (20:4n-6). The n-3 FA were present at <3% of total FA and included alpha-linolenic acid (18:3n-3) (in total and TAG tissue FA), EPA (20:5n-3) (not in TAG), and DHA (22:6n-3) (not in TAG). The n-3/n-6 ratio was 1:11, 1:13, and 1:8 in total, phospholipid, and TAG FA, respectively. This study shows the canine prostate has a low level of n-3 FA and a low n-3/n-6 ratio. This is perhaps due to low n-3 content of the diet of the dogs. FA analysis of dogfoods available in Australia showed that the n-3 content in both supermarket and premium brand dogfoods was <3% (wet weight), and the n-3/n-6 ratio was low. PMID:12934677

  8. A symmetry-based formal synthesis of zaragozic acid A.

    PubMed

    Freeman-Cook, K D; Halcomb, R L

    2000-09-22

    A symmetry-based strategy for the synthesis of the zaragozic acids is reported. Two enantioselective dihydroxylations were used to establish the absolute configuration of a C(2) symmetric intermediate. Noteworthy transformations include a group-selective lactonization, which accomplished an end-differentiation of a pseudo-C(2) symmetric intermediate. Late stage protecting group adjustments and oxidations accomplished a formal synthesis of zaragozic acid A. PMID:10987953

  9. Photoorganocatalytic One-Pot Synthesis of Hydroxamic Acids from Aldehydes.

    PubMed

    Papadopoulos, Giorgos N; Kokotos, Christoforos G

    2016-05-10

    An efficient one-pot synthesis of hydroxamic acids from aldehydes and hydroxylamine is described. A fast, visible-light-mediated metal-free hydroacylation of dialkyl azodicarboxylates was used to develop the subsequent addition of hydroxylamine hydrochloride. A range of aliphatic and aromatic aldehydes were employed in this reaction to give hydroxamic acids in high to excellent yields. Application of the current methodology was demonstrated in the synthesis of the anticancer medicine vorinostat. PMID:27038037

  10. Mass spectrometry of the lithium adducts of diacylglycerols containing hydroxy FA in castor oil and two normal FA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Castor oil can be used in industry. The molecular species of triacylglycerols containing hydroxy fatty acids (FA) in castor oil have been identified. We report here the identification of twelve diacylglycerols (DAG) containing hydroxy FA in castor oil using positive ion electrospray ionization mass ...

  11. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  12. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  13. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  14. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  15. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  16. Solid Phase Synthesis of C-Terminal Boronic Acid Peptides.

    PubMed

    Behnam, Mira A M; Sundermann, Tom R; Klein, Christian D

    2016-05-01

    Peptides and peptidomimetics with a C-terminal boronic acid group have prolific applications in numerous fields of research, but their synthetic accessibility remains problematic. A convenient, high yield synthesis of peptide-boronic acids on a solid support is described here, using commercially available 1-glycerol polystyrene resin. The method is compatible with Fmoc chemistry and offers a versatile approach to aryl and alkyl aminoboronic acids without additional purification steps. PMID:27104613

  17. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  18. MAN or FA from n-butane

    SciTech Connect

    Di Cio, A.; Verde, L.

    1985-08-01

    Unsaturated polyester resins were first produced mostly from fumaric acid (FA) rather than from maleic anhydride (MAN). This is perfectly understandable if we consider that, using fumaric acid as raw material, polycondensates with a more homogeneous (less branched) structure are obtained, thus producing resins characterized by a more uniform and reproducible chemical and mechanical properties. Presently, for economical reasons, fumaric acid is used marginally as a MAN substitute in the production of polyester resins. These resins account for a major share (50%) of the overall MAN consumption in the U.S. and in Western Europe.

  19. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  20. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  1. Total synthesis of legionaminic acid as basis for serological studies.

    PubMed

    Matthies, Stefan; Stallforth, Pierre; Seeberger, Peter H

    2015-03-01

    Legionaminic acid is a nine-carbon diamino monosaccharide that is found coating the surface of various bacterial human pathogens. Its unique structure makes it a valuable biological probe, but access via isolation is difficult and no practical synthesis has been reported. We describe a stereoselective synthesis that yields a legionaminic acid building block as well as linker-equipped conjugation-ready legionaminic acid starting from cheap d-threonine. To set the desired amino and hydroxyl group pattern of the target, we designed a concise sequence of stereoselective reactions. The key transformations rely on chelation-controlled organometallic additions and a Petasis multicomponent reaction. The legionaminic acid was synthesized in a form that enables attachment to surfaces. Glycan microarray containing legionaminic acid revealed that human antibodies bind the synthetic glycoside. The synthetic bacterial monosaccharide is a valuable probe to detect an immune response to bacterial pathogens such as Legionella pneumophila, the causative agent of Legionnaire's disease. PMID:25668389

  2. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton. PMID:26853637

  3. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  4. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  5. Mechanisms of fatty acid synthesis in marine fungus-like protists.

    PubMed

    Xie, Yunxuan; Wang, Guangyi

    2015-10-01

    Thraustochytrids are unicellular fungus-like protists and are well known for their ability to produce interesting nutraceutical compounds. Significant efforts have been made to improve their efficient production of important fatty acids (FAs), mostly by optimizing fermentation conditions and selecting highly productive thraustochytrid strains. Furthermore, noticeable improvements have been made in understanding the mechanism of FA biosynthesis, allowing for a better understanding of how thraustochytrids assemble these unique metabolites and how their biosynthesis is coupled with other related pathways. This review summarizes recent achievements on two major FA biosynthesis pathways, the standard pathway and the polyketide synthase pathway, and detail features of individual enzymes involved in FA biosynthesis, biotechnological advances in pathway engineering and enzyme characterization, and the discovery of other pathways that affect the efficiency of FA accumulation. Perspectives of biotechnological potential application of thraustochytrids are also discussed. PMID:26286514

  6. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    SciTech Connect

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.

    1982-05-01

    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

  7. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  8. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  9. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  10. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid. PMID:25715756

  11. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  12. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  13. Enantioselective synthesis of isotopically labeled homocitric acid lactone.

    PubMed

    Moore, Jared T; Hanhan, Nadine V; Mahoney, Maximillian E; Cramer, Stephen P; Shaw, Jared T

    2013-11-15

    A concise synthesis of homocitric acid lactone was developed to accommodate systematic placement of carbon isotopes (specifically (13)C) for detailed studies of this cofactor. This new route uses a chiral allylic alcohol, available in multigram quantities from enzymatic resolution, as a starting material, which transposes asymmetry through an Ireland-Claisen rearrangement. PMID:24180620

  14. Fatty acid composition in tissues of the farmed Siberian sturgeon (Acipenser baerii).

    PubMed

    Nieminen, Petteri; Westenius, Eini; Halonen, Toivo; Mustonen, Anne-Mari

    2014-09-15

    The fatty acid (FA) compositions of the diet and diverse tissues of the farmed Siberian sturgeon (Acipenser baerii) were analyzed in detail to assess their nutritional quality. Twelve male fish were sampled for muscle, fat, liver, brain, gill, kidney and gonad and the tissue FA measured by gas-liquid chromatography. The FA profile of the diet diverged from the FA signatures of the tissues, where the sturgeons accumulated particular highly-unsaturated FA (HUFA). They were probably derived from the diet but, as previous studies have shown that fish can also have desaturase enzymes, endogenous synthesis of these FA cannot be excluded. The sturgeon muscle tissue contained HUFA in proportions comparable to those of other fish species that are considered good sources of n-3 polyunsaturated FA. The indices of atherogenicity and thrombogenicity were also within the values considered to be health-promoting. PMID:24767029

  15. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  16. Synthesis of nanomagnetic fluids and their UV spectrophotometric response with aliphatic organic acids and 1st tier dendrimers

    NASA Astrophysics Data System (ADS)

    Pandya, Shivani R.; Singh, Man

    2016-04-01

    Synthesis of Magnetic nanoparticles were made using coprecipitation method on mixing Fe+3 and Fe+2 in 2:1 ratio with aqueous 8M NaOH which on heating at 90°C for 2 h has yielded 85% magnetic (Fe3O4) nanoparticles (MNPs), characterized by XRD, VSM, SEM, and HR-TEM. The formic acid (FA), oxalic acid (OA) and citric acid (CA), the series of aliphatic organic acids along with Trimesoyl 1, 3, 5 tridimethyl malonate (TTDMM), trimesoyl 1, 3, 5 tridiethyl malonate (TTDEM), trimesoyl 1, 3, 5 tridipropyl malonate (TTDPM), trimesoyl 1, 3, 5 tridibutyl malonate (TTDBM) and trimesoyl 1, 3, 5 tridihexyl malonate (TTDHM) 1st tier dendrimers were used separately for preparing nanomagnetic fluid. From 25 to 150 µM MNPs at an interval of 25 µM were dispersed in 150 µM of acids and dendrimers separately with DMSO. UV-VIS spectrophotometry showed a maximum MNPs dispersion with TTDMM against others and found to be most stable nanomagnetic fluid on account of capping type mechanism of acids.

  17. Amino acid synthesis in Europa's subsurface environment

    NASA Astrophysics Data System (ADS)

    Abbas, Sam H.; Schulze-Makuch, Dirk

    2008-10-01

    It has been suggested that Europa's subsurface environment may provide a haven for prebiotic evolution and the development of exotic biotic systems. The detection of hydrogen peroxide, sulfuric acid, water, hydrates and related species on the surface, coupled with observed mobility of icebergs, suggests the presence of a substantial subsurface liquid reservoir that actively exchanges materials with the surface environment. The atmospheric, surface and subsurface environments are described with their known chemistry. Three synthetic schemes using hydrogen peroxide, sulfuric acid and hydrocyanic acid leading to the production of larger biologically important molecules such as amino acids are described. Metabolic pathways based on properties of the subsurface ocean environment are detailed. Tidal heating, osmotic gradients, chemical cycling, as well as hydrothermal vents, provide energy and materials that may support a course of prebiotic evolution leading to the development or sustenance of simple biotic systems. Putative organisms may employ metabolic pathways based on chemical oxidation reduction cycles occurring in the putative subsurface ocean environment.

  18. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  19. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  20. Does trans-10, cis-12 conjugated linoleic acid affect the intermediary glucose and energy expenditure of dairy cows due to repartitioning of milk component synthesis?

    PubMed

    Benninghoff, Jens; Metzger-Petersen, Katrin; Tröscher, Arnulf H A; Südekum, Karl-Heinz

    2015-11-01

    The overall goal of this study was to evaluate if intermediary energy metabolism of cows fed with trans-10, cis-12 conjugated linoleic acid (CLA) was modified such that milk-energy compounds were produced with less intermediary energy expenditure as compared to control cows. Published data on supplemented CLA were assembled. The extent was calculated to which the trans-10, cis-12 CLA isomer has an impact on glucose and energy conversion in the mammary gland by modifying glucose equivalent supply and energy required for fatty acid (FA) and fat synthesis, and if this will eventually lead to an improved glucose and energy status of CLA-supplemented high-yielding dairy cows. A possible relationship between CLA supplementation level and milk energy yield response was also studied. Calculations were conducted separately for orally and abomasally administered CLA and based on energy required for supply of glucose equivalents, i.e. lactose, glycerol and NADPH2. Further, modifications of milk FA profile due to CLA supplementation were considered when energy expenditures for FA and fat synthesis were quantified. Differences in yields between control and CLA groups were transformed into glucose energy equivalents. Only abomasal infusion (r(2) = 0.31) but not oral CLA administration (r(2) = 0.11) supplementation to dairy cow diets resulted in less glucose equivalent energy. Modifications of milk FA profiles also saved energy but the relationship with CLA supplementation was weaker for abomasal infusion (r(2) = 0.06) than oral administration (r(2) = 0.38). On average, 10 g/d of abomasally infused trans-10, cis-12 CLA saved 1.1 to 2.3 MJ net energy expressed as glucose equivalents, whereas both positive and negative values were observed when the trans-10, cis-12 CLA was fed to the cows. This study revealed a weak to moderate dose-dependent relationship between the amount of trans-10, cis-12 CLA administered and the amount of energy in glucose equivalents and energy for the

  1. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. PMID:26572799

  2. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  3. Glucose and Insulin Induction of Bile Acid Synthesis

    PubMed Central

    Li, Tiangang; Francl, Jessica M.; Boehme, Shannon; Ochoa, Adrian; Zhang, Youcai; Klaassen, Curtis D.; Erickson, Sandra K.; Chiang, John Y. L.

    2012-01-01

    Bile acids facilitate postprandial absorption of nutrients. Bile acids also activate the farnesoid X receptor (FXR) and the G protein-coupled receptor TGR5 and play a major role in regulating lipid, glucose, and energy metabolism. Transgenic expression of cholesterol 7α-hydroxylase (CYP7A1) prevented high fat diet-induced diabetes and obesity in mice. In this study, we investigated the nutrient effects on bile acid synthesis. Refeeding of a chow diet to fasted mice increased CYP7A1 expression, bile acid pool size, and serum bile acids in wild type and humanized CYP7A1-transgenic mice. Chromatin immunoprecipitation assays showed that glucose increased histone acetylation and decreased histone methylation on the CYP7A1 gene promoter. Refeeding also induced CYP7A1 in fxr-deficient mice, indicating that FXR signaling did not play a role in postprandial regulation of bile acid synthesis. In streptozocin-induced type I diabetic mice and genetically obese type II diabetic ob/ob mice, hyperglycemia increased histone acetylation status on the CYP7A1 gene promoter, leading to elevated basal Cyp7a1 expression and an enlarged bile acid pool with altered bile acid composition. However, refeeding did not further increase CYP7A1 expression in diabetic mice. In summary, this study demonstrates that glucose and insulin are major postprandial factors that induce CYP7A1 gene expression and bile acid synthesis. Glucose induces CYP7A1 gene expression mainly by epigenetic mechanisms. In diabetic mice, CYP7A1 chromatin is hyperacetylated, and fasting to refeeding response is impaired and may exacerbate metabolic disorders in diabetes. PMID:22144677

  4. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  5. Amino Acid Synthesis in Photosynthesizing Spinach Cells 1

    PubMed Central

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.

    1981-01-01

    Isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis. PMID:16661904

  6. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  7. Synthesis of 3-chloro-6-((4-(di-tert-butyl[(18)F]fluorosilyl)-benzyl)oxy)-1,2,4,5-tetrazine ([(18)F]SiFA-OTz) for rapid tetrazine-based (18)F-radiolabeling.

    PubMed

    Zhu, Jun; Li, Stephen; Wängler, Carmen; Wängler, Björn; Lennox, R Bruce; Schirrmacher, Ralf

    2015-08-11

    An efficient method to prepare the (18)F-labeled tetrazine-derivative [(18)F]-SiFA-OTz for bioorthogonal radiochemistry was developed. [(18)F]-SiFA-OTz can be synthesized with a radiochemical yield of 78 ± 5% within 25 min and can quantitatively react with a model strained dienophile, trans-cyclooctenol. PMID:26145162

  8. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties. PMID:27071863

  9. Bile Acid Synthesis in the Isolated, Perfused Rabbit Liver

    PubMed Central

    Mosbach, E. H.; Rothschild, M. A.; Bekersky, I.; Oratz, M.; Mongelli, J.

    1971-01-01

    These experiments were carried out to demonstrate the usefulness of the perfused rabbit liver for studies of bile acid metabolism, and to determine the rate-limiting enzyme of bile acid synthesis. Rabbits were fed a semisynthetic diet, with or without the addition of 1% cholestyramine, under controlled conditions. At the end of 2-5 wk, the livers were removed and perfused for 2.5 hr employing various 14C-labeled precursors to measure de novo cholic acid synthesis. The livers were then analyzed for cholesterol, and the bile collected during the perfusion was analyzed for cholesterol and bile acids. Control bile contained, on the average, 0.34 mg of glycocholate, 7.4 mg of glycodeoxycholate, and 0.06 mg of cholesterol. After cholestyramine treatment of the donor rabbits, the bile contained 3.3 mg of glycocholate, 3.7 mg of glycodeoxycholate, and 0.05 mg of cholesterol. It was assumed that in cholestyramine-treated animals the enterohepatic circulation of the bile acids had been interrupted sufficiently to release the feedback inhibition of the rate-controlling enzyme of bile acid synthesis. Therefore, a given precursor should be incorporated into bile acids at a more rapid rate in livers of cholestyramine-treated animals, provided that the precursor was acted upon by the rate-controlling enzyme. It was found that the incorporation of acetate-14C, mevalonolactone-14C, and cholesterol-14C into cholate was 5-20 times greater in the livers of cholestyramine-treated animals than in the controls. In contrast, there was no difference in the incorporation of 7α-hydroxycholesterol-14C into cholate regardless of dietary pretreatment. It was concluded that given an adequate precursor pool, the 7α-hydroxylation of cholesterol is the rate-limiting step in bile acid formation. PMID:5097576

  10. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  11. Synthesis of Branched Methyl Hydroxy Stearates Including an Ester from Bio-Based Levulinic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the synthesis of 5 useful branched methyl alpha-hydroxy oleate esters from commercially available methyl oleate and common organic acids. Of special interest is the synthesis utilizing the natural byproduct, levulinic acid. The other common organic acids used herein were propionic acid, ...

  12. FaPOD27 functions in the metabolism of polyphenols in strawberry fruit (Fragaria sp.)

    PubMed Central

    Yeh, Su-Ying; Huang, Fong-Chin; Hoffmann, Thomas; Mayershofer, Mechthild; Schwab, Wilfried

    2014-01-01

    The strawberry (Fragaria × ananassa) is one of the most preferred fresh fruit worldwide, accumulates numerous flavonoids but has limited shelf life due to excessive tissue softening caused by cell wall degradation. Since lignin is one of the polymers that strengthen plant cell walls and might contribute to some extent to fruit firmness monolignol biosynthesis was studied in strawberry fruit. Cinnamoyl-CoA reductase (CCR), cinnamyl alcohol dehydrogenase (CAD), and a peroxidase (POD27) gene were strongly expressed in red, ripe fruit whereas a second POD gene was primarily expressed in green, immature fruit. Moreover, FaPOD27 transcripts were strongly and constitutively induced in fruits exposed to Agrobacterium infection. Gene expression levels and enzymatic activities of FaCCR and FaCAD were efficiently suppressed through RNAi in FaCCR- and FaCAD-silenced strawberries. Besides, significantly elevated FaPOD transcript levels were detected after agroinfiltration of pBI-FaPOD constructs in fruits. At the same time, levels of G-monomers were considerably reduced in FaCCR-silenced fruits whereas the proportion of both G- and S-monomers decisively decreased in FaCAD-silenced and pBI-FaPOD fruits. Development, firmness, and lignin level of the treated fruits were similar to pBI-intron control fruits, presumably attributed to increased expression levels of FaPOD27 upon agroinfiltration. Additionally, enhanced firmness, accompanied with elevated lignin levels, was revealed in chalcone synthase-deficient fruits (CHS−), independent of down- or up-regulation of individual and combined FaCCR. FaCAD, and FaPOD genes by agroinfiltration, when compared to CHS−/pBI-intron control fruits. These approaches provide further insight into the genetic control of flavonoid and lignin synthesis in strawberries. The results suggest that FaPOD27 is a key gene for lignin biosynthesis in strawberry fruit and thus to improving the firmness of strawberries. PMID:25346738

  13. Sources of variability in fatty acid (FA) biomarkers in the application of compound-specific stable isotopes (CSSIs) to soil and sediment fingerprinting and tracing: A review.

    PubMed

    Reiffarth, D G; Petticrew, E L; Owens, P N; Lobb, D A

    2016-09-15

    Determining soil redistribution and sediment budgets in watersheds is often challenging. One of the methods for making such determinations employs soil and sediment fingerprinting techniques, using sediment properties such as geochemistry, fallout radionuclides, and mineral magnetism. These methods greatly improve the estimation of erosion and deposition within a watershed, but are limited when determining land use-based soil and sediment movement. Recently, compound-specific stable isotopes (CSSIs), which employ fatty acids naturally occurring in the vegetative cover of soils, offer the possibility of refining fingerprinting techniques based on land use, complementing other methods that are currently in use. The CSSI method has been met with some success; however, challenges still remain with respect to scale and resolution due to a potentially large degree of biological, environmental and analytical uncertainty. By better understanding the source of tracers used in CSSI work and the inherent biochemical variability in those tracers, improvement in sample design and tracer selection is possible. Furthermore, an understanding of environmental and analytical factors affecting the CSSI signal will lead to refinement of the approach and the ability to generate more robust data. This review focuses on sources of biological, environmental and analytical variability in applying CSSI to soil and sediment fingerprinting, and presents recommendations based on past work and current research in this area for improving the CSSI technique. A recommendation, based on current information available in the literature, is to use very-long chain saturated fatty acids and to avoid the use of the ubiquitous saturated fatty acids, C16 and C18. PMID:27155260

  14. Effect of unsaturated fatty acids and triglycerides from soybeans on milk fat synthesis and biohydrogenation intermediates in dairy cattle.

    PubMed

    Boerman, J P; Lock, A L

    2014-11-01

    Increased rumen unsaturated fatty acid (FA) load is a risk factor for milk fat depression. This study evaluated if increasing the amount of unsaturated FA in the diet as triglycerides or free FA affected feed intake, yield of milk and milk components, and feed efficiency. Eighteen Holstein cows (132 ± 75 d in milk) were used in a replicated 3 × 3 Latin square design. Treatments were a control (CON) diet, or 1 of 2 unsaturated FA (UFA) treatments supplemented with either soybean oil (FA present as triglycerides; TAG treatment) or soybean FA distillate (FA present as free FA; FFA treatment). The soybean oil contained a higher concentration of cis-9 C18:1 (26.0 vs. 11.8 g/100g of FA) and lower concentrations of C16:0 (9.6 vs. 15.0 g/100g of FA) and cis-9,cis-12 C18:2 (50.5 vs. 59.1g/100g of FA) than the soybean FA distillate. The soybean oil and soybean FA distillate were included in the diet at 2% dry matter (DM) to replace soyhulls in the CON diet. Treatment periods were 21 d, with the final 4 d used for sample and data collection. The corn silage- and alfalfa silage-based diets contained 23% forage neutral detergent fiber and 17% crude protein. Total dietary FA were 2.6, 4.2, and 4.3% of diet DM for CON, FFA, and TAG treatments, respectively. Total FA intake was increased 57% for UFA treatments and was similar between FFA and TAG. The intakes of individual FA were similar, with the exception of a 24 g/d lower intake of C16:0 and a 64 g/d greater intake of cis-9 C18:1 for the TAG compared with the FFA treatment. Compared with CON, the UFA treatments decreased DM intake (1.0 kg/d) but increased milk yield (2.2 kg/d) and milk lactose concentration and yield. The UFA treatments reduced milk fat concentration, averaging 3.30, 3.18, and 3.11% for CON, FFA, and TAG treatments, respectively. Yield of milk fat, milk protein, and 3.5% fat-corrected milk remained unchanged when comparing CON with the UFA treatments. No differences existed in the yield of milk or milk

  15. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  16. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  17. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  18. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  19. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5 % based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications. PMID:26895244

  20. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.

    PubMed

    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei

    2010-06-01

    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC. PMID:20657439

  1. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  2. Strategies for the Total Synthesis of Clavicipitic Acid.

    PubMed

    Ito, Mamoru; Tahara, Yu-Ki; Shibata, Takanori

    2016-04-11

    Clavicipitic acid is an ergot alkaloid, which was isolated from Claviceps strain and Claviceps fusiformis. Its unique tricyclic azepinoindole skeleton has attracted synthetic chemists, and various strategies have been developed for its total synthesis. These strategies can be generally categorized into two types based on the synthetic intermediates, namely, 4-substituted gramine derivatives and 4-substituted tryptophan derivatives. This Minireview summarizes the reported total syntheses from the point of these two key intermediates. PMID:26822254

  3. Total Synthesis of (−)-Nodulisporic Acid D

    PubMed Central

    Zou, Yike; Melvin, Jason E.; Gonzales, Stephen S.; Spafford, Matthew J.; Smith, Amos B.

    2015-01-01

    A convergent total synthesis of the architecturally complex indole diterpenoid (−)-nodulisporic acid D has been achieved. Key synthetic transformations include vicinal difunctionalization of an advanced α,β-unsaturated aldehyde to form the E,F-transfused 5,6-ring system of the eastern hemisphere and a cascade cross-coupling/indolization protocol leading to the CDE multisubstituted indole core. PMID:26029849

  4. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  5. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  6. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  7. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans

    PubMed Central

    Watts, Jennifer L.; Browse, John

    2002-01-01

    Polyunsaturated fatty acids (PUFAs) are important membrane components and precursors of signaling molecules. To investigate the roles of these fatty acids in growth, development, and neurological function in an animal system, we isolated Caenorhabditis elegans mutants deficient in PUFA synthesis by direct analysis of fatty acid composition. C. elegans possesses all the desaturase and elongase activities to synthesize arachidonic acid and eicosapentaenoic acid from saturated fatty acid precursors. In our screen we identified mutants with defects in each fatty acid desaturation and elongation step of the PUFA biosynthetic pathway. The fatty acid compositions of the mutants reveal the substrate preferences of the desaturase and elongase enzymes and clearly demarcate the steps of this pathway. The mutants show that C. elegans does not require n3 or Δ5-unsaturated PUFAs for normal development under laboratory conditions. However, mutants with more severe PUFA deficiencies display growth and neurological defects. The mutants provide tools for investigating the roles of PUFAs in membrane biology and cell function in this animal model. PMID:11972048

  8. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  9. Influence of fatty acid on lipase-catalyzed synthesis of ascorbyl esters and their free radical scavenging capacity.

    PubMed

    Stojanović, Marija; Carević, Milica; Mihailović, Mladen; Veličković, Dušan; Dimitrijević, Aleksandra; Milosavić, Nenad; Bezbradica, Dejan

    2015-01-01

    Fatty acid (FA) ascorbyl esters are recently emerging food, cosmetic, and pharmaceutical additives, which can be prepared in an eco-friendly way by using lipases as catalysts. Because they are amphiphilic molecules, which possess high free radical scavenging capacity, they can be applied as liposoluble antioxidants as well as emulsifiers and biosurfactants. In this study, the influence of a wide range of acyl donors on ester yield in lipase-catalyzed synthesis and ester antioxidant activity was examined. Among saturated acyl donors, higher yields and antioxidant activities of esters were achieved when short-chain FAs were used. Oleic acid gave the highest yield overall and its ester exhibited a high antioxidant activity. Optimization of experimental factors showed that the highest conversion (60.5%) in acetone was achieved with 5 g L(-1) of lipase, 50 mM of vitamin C, 10-fold molar excess of oleic acid, and 0.7 mL L(-1) of initial water. Obtained results showed that even short- and medium-chain ascorbyl esters could be synthesized with high yields and retained (or even exceeded) free radical scavenging capacity of l-ascorbic acid, indicating prospects of broadening their application in emulsions and liposomes. PMID:25224149

  10. In Vitro Fatty Acid Synthesis and Complex Lipid Metabolism in the Cyanobacterium Anabaena variabilis: I. Some Characteristics of Fatty Acid Synthesis.

    PubMed

    Lem, N W; Stumpf, P K

    1984-01-01

    In vitro fatty acid synthesis was examined in crude cell extracts, soluble fractions, and 80% (NH(4))(2)SO(4) fractions from Anabaena variabilis M3. Fatty acid synthesis was absolutely dependent upon acyl carrier protein and required NADPH and NADH. Moreover, fatty acid synthesis and elongation occurred in the cytoplasm of the cell. The major fatty acid products were palmitic acid (16:0) and stearic acid (18:0). Of considerable interest, both stearoyl-acyl carrier protein and stearoyl-coenzyme A desaturases were not detected in any of the fractions from A. variabilis. The similarities and differences in fatty acid synthesis between A. variabilis and higher plant tissues are discussed with respect to the endosymbiotic theory of chloroplast evolution. PMID:16663367

  11. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2014-05-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  12. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2008-09-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  13. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  14. Ascorbic acid intake and oxalate synthesis.

    PubMed

    Knight, John; Madduma-Liyanage, Kumudu; Mobley, James A; Assimos, Dean G; Holmes, Ross P

    2016-08-01

    In humans, approximately 60 mg of ascorbic acid (AA) breaks down in the body each day and has to be replaced by a dietary intake of 70 mg in women and 90 mg in men to maintain optimal health and AA homeostasis. The breakdown of AA is non-enzymatic and results in oxalate formation. The exact amount of oxalate formed has been difficult to ascertain primarily due to the limited availability of healthy human tissue for such research and the difficulty in measuring AA and its breakdown products. The breakdown of 60 mg of AA to oxalate could potentially result in the formation of up to 30 mg oxalate per day. This exceeds our estimates of the endogenous production of 10-25 mg oxalate per day, indicating that degradative pathways that do not form oxalate exist. In this review, we examine what is known about the pathways of AA metabolism and how oxalate forms. We further identify how gaps in our knowledge may be filled to more precisely determine the contribution of AA breakdown to oxalate production in humans. The use of stable isotopes of AA to directly assess the conversion of vitamin to oxalate should help fill this void. PMID:27002809

  15. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives. PMID:26784936

  16. The Significance of Different Diacylgycerol Synthesis Pathways on Plant Oil Composition and Bioengineering

    PubMed Central

    Bates, Philip D.; Browse, John

    2012-01-01

    The unique properties of vegetable oils from different plants utilized for food, industrial feedstocks, and fuel is dependent on the fatty acid (FA) composition of triacylglycerol (TAG). Plants can use two main pathways to produce diacylglycerol (DAG), the immediate precursor molecule to TAG synthesis: (1) De novo DAG synthesis, and (2) conversion of the membrane lipid phosphatidylcholine (PC) to DAG. The FA esterified to PC are also the substrate for FA modification (e.g., desaturation, hydroxylation, etc.), such that the FA composition of PC-derived DAG can be substantially different than that of de novo DAG. Since DAG provides two of the three FA in TAG, the relative flux of TAG synthesis from de novo DAG or PC-derived DAG can greatly affect the final oil FA composition. Here we review how the fluxes through these two alternate pathways of DAG/TAG synthesis are determined and present evidence that suggests which pathway is utilized in different plants. Additionally, we present examples of how the endogenous DAG synthesis pathway in a transgenic host plant can produce bottlenecks for engineering of plant oil FA composition, and discuss alternative strategies to overcome these bottlenecks to produce crop plants with designer vegetable oil compositions. PMID:22783267

  17. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  18. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  19. Increased Bile Acid Synthesis and Deconjugation After Biliopancreatic Diversion.

    PubMed

    Ferrannini, Ele; Camastra, Stefania; Astiarraga, Brenno; Nannipieri, Monica; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Haeusler, Rebecca A

    2015-10-01

    Biliopancreatic diversion (BPD) improves insulin sensitivity and decreases serum cholesterol out of proportion with weight loss. Mechanisms of these effects are unknown. One set of proposed contributors to metabolic improvements after bariatric surgeries is bile acids (BAs). We investigated the early and late effects of BPD on plasma BA levels, composition, and markers of BA synthesis in 15 patients with type 2 diabetes (T2D). We compared these to the early and late effects of Roux-en-Y gastric bypass (RYGB) in 22 patients with T2D and 16 with normal glucose tolerance. Seven weeks after BPD, insulin sensitivity had doubled and serum cholesterol had halved. At this time, BA synthesis markers and total plasma BAs, particularly unconjugated BAs, had markedly risen; this effect could not be entirely explained by low FGF19. In contrast, after RYGB, insulin sensitivity improved gradually with weight loss and cholesterol levels declined marginally; BA synthesis markers were decreased at an early time point (2 weeks) after surgery and returned to the normal range 1 year later. These findings indicate that BA synthesis contributes to the decreased serum cholesterol after BPD. Moreover, they suggest a potential role for altered enterohepatic circulation of BAs in improving insulin sensitivity and cholesterol metabolism after BPD. PMID:26015549

  20. The acid tolerance response of Salmonella typhimurium involves transient synthesis of key acid shock proteins.

    PubMed Central

    Foster, J W

    1993-01-01

    Although Salmonella typhimurium prefers neutral-pH environments, it can adapt to survive conditions of severe low-pH stress (pH 3.3). The process, termed the acid tolerance response (ATR), includes two distinct stages. The first stage, called pre-acid shock, is induced at pH 5.8 and involves the production of an inducible pH homeostasis system functional at external pH values below 4.0. The second stage occurs following an acid shock shift to pH 4.5 or below and is called the post-acid shock stage. During this stage of the ATR, 43 acid shock proteins (ASPs) are synthesized. The present data reveal that several ASPs important for pH 3.3 acid tolerance are only transiently produced. Their disappearance after 30 to 40 min of pH 4.4 acid shock coincides with an inability to survive subsequent pH 3.3 acid challenge. Clearly, an essential feature of inducible acid tolerance is an ability to synthesize these key ASPs. The pre-acid shock stage, with its inducible pH homeostasis system, offers the cell an enhanced ability to synthesize ASPs following rapid shifts to conditions below pH 4.0, an external pH that normally prevents ASP synthesis. The data also address possible signals for ASP synthesis. The inducing signal for 22 ASPs appears to be internal acidification, while external pH serves to induce 13 others. Of the 14 transient ASPs, 10 are induced in response to changes in internal pH. Mutations in the fur (ferric uptake regulator) locus that produce an Atr- acid-sensitive phenotype also eliminate induction of six transiently induced ASPs. Images PMID:8458840

  1. Synthesis and characterization of a PAMAM-OH derivative containing an acid-labile β-thiopropionate bond for gene delivery.

    PubMed

    Chen, Kang; Chen, Qing; Wang, Kuanglei; Zhu, Jia; Li, Weinan; Li, Wenpan; Qiu, Lipeng; Guan, Guannan; Qiao, Mingxi; Zhao, Xiuli; Hu, Haiyang; Chen, Dawei

    2016-07-25

    The present report describes the synthesis of a hydroxyl terminal PAMAM dendrimer (PAMAM-OH) derivative (PAMSPF). The hydroxyls of PAMAM-OH were attached to S-Methyl-l-cysteine (SMLC) via an acid-labile ester bond, named as β-thiopropionate bond, followed by modification with folic acid (FA) through a polyethylene glycol (PEG) linker. The degrees of attachment of SMLC and FA to the PAMAM-OH backbone were 83.9% and 12.8%, respectively. PAMSPF could condense DNA to form spherical nanoparticles with particle sizes of ∼200nm and remain stable in the presence of heparin and nuclease. The β-thiopropionate bond in PAMSPF was hydrolyzed completely and the DNA release rate was 95.8±3.3% after incubation under mildly acidic conditions at 37°C for 3h. PAMSPF/DNA was less cytotoxic to KB and HepG2 cells and exhibited a higher gene transfection efficiency than native PAMAM/DNA. The uptake assays showed that PAMSPF/DNA entered KB cells within 0.5h through folate receptor-mediated endocytosis and escaped from endosomes within 2h. In addition, PAMSPF/DNA displayed long circulation time along with excellent targeting of tumor sites in vivo. These findings demonstrate that PAMSPF is an excellent carrier for safe and effective gene delivery. PMID:27260132

  2. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described. PMID:23465902

  3. Simian Virus 40 Deoxyribonucleic Acid Synthesis: Analysis by Gel Electrophoresis

    PubMed Central

    Tegtmeyer, Peter; Macasaet, Francisco

    1972-01-01

    An agarose-gel electrophoresis technique has been developed to study simian virus 40 deoxyribonucleic acid (DNA) synthesis. Superhelical DNA I, relaxed DNA II, and replicative intermediate (RI) molecules were clearly resolved from one another for analytical purposes. Moreover, the RI molecules could be identified as early or late forms on the basis of their electrophoretic migration in relation to that of DNA II. The technique has been utilized to study the kinetics of simian virus 40 DNA synthesis in pulse and in pulse-chase experiments. The average time required to complete the replication of prelabeled RI molecules and to convert them into DNA I was approximately 10 min under the experimental conditions employed. PMID:4343542

  4. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  5. Folic acid supplementation in pregnancy and implications in health and disease

    PubMed Central

    2014-01-01

    Maternal exposure to dietary factors during pregnancy can influence embryonic development and may modulate the phenotype of offspring through epigenetic programming. Folate is critical for nucleotide synthesis, and preconceptional intake of dietary folic acid (FA) is credited with reduced incidences of neural tube defects in infants. While fortification of grains with FA resulted in a positive public-health outcome, concern has been raised for the need for further investigation of unintended consequences and potential health hazards arising from excessive FA intakes, especially following reports that FA may exert epigenetic effects. The objective of this article is to discuss the role of FA in human health and to review the benefits, concerns and epigenetic effects of maternal FA on the basis of recent findings that are important to design future studies. PMID:25135350

  6. Synthesis and evaluation of colletoic acid core derivatives.

    PubMed

    Ling, Taotao; Gautam, Lekh Nath; Griffith, Elizabeth; Das, Sourav; Lang, Walter; Shadrick, William R; Shelat, Anang; Lee, Richard; Rivas, Fatima

    2016-03-01

    Cortisol homeostasis has been linked to the pathogenesis of metabolic syndrome (MetS), since it stimulates hepatic gluconeogenesis and adipogenesis. MetS is classified as a constellation of health conditions that increase the risk of type 2 diabetes and cardiovascular disease. Intracellular cortisol levels are regulated by 11β-hydroxysteroid dehydrogenase (type 1 and type 2) in a tissue dependent manner. The type 1 enzyme (11β-HSD1) is widely expressed in glucocorticoid targeted tissues and is responsible for the conversion of cortisone to the active cortisol. Local reduction of cortisol regeneration presents a potential strategy for MetS treatment. Recently we disclosed the total synthesis of (+)-colletoic acid as a potent 11β-HSD1 inhibitor. Herein, we describe our improved processing chemistry for the synthesis of the colletoic acid core to access a diverse number of derivatives for evaluation against 11β-HSD1. The Evan's chiral auxiliary was utilized to construct the acyclic precursor 12 to afford the acorane core 9 using a modified Heck reaction in excellent chemical yields. The colletoic acid core derivatives showed modest activity against 11β-HSD1 and will serve for further biological evaluation. PMID:26820555

  7. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  8. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.

    PubMed

    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu

    2015-10-20

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  9. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  10. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids. PMID:25796392

  11. Design and synthesis of boronic acid inhibitors of endothelial lipase.

    PubMed

    O'Connell, Daniel P; LeBlanc, Daniel F; Cromley, Debra; Billheimer, Jeffrey; Rader, Daniel J; Bachovchin, William W

    2012-02-01

    Endothelial lipase (EL) and lipoprotein lipase (LPL) are homologous lipases that act on plasma lipoproteins. EL is predominantly a phospholipase and appears to be a key regulator of plasma HDL-C. LPL is mainly a triglyceride lipase regulating (V)LDL levels. The existing biological data indicate that inhibitors selective for EL over LPL should have anti-atherogenic activity, mainly through increasing plasma HDL-C levels. We report here the synthesis of alkyl, aryl, or acyl-substituted phenylboronic acids that inhibit EL. Many of the inhibitors evaluated proved to be nearly equally potent against both EL and LPL, but several exhibited moderate to good selectivity for EL. PMID:22225633

  12. Synthesis of Nanoporous Iminodiacetic Acid Sorbents for Binding Transition Metals

    PubMed Central

    Busche, Brad; Wiacek, Robert; Davidson, Joseph; Koonsiripaiboon, View; Yantasee, Wassana; Addleman, R. Shane; Fryxell, Glen E.

    2009-01-01

    Iminodiacetic acid (IDAA) forms strong complexes with a wide variety of metal ions. Using self-assembled monolayers in mesoporous supports (SAMMS) to present the IDAA ligand potentially allows for multiple metal-ligand interactions to enhance the metal binding affinity relative to that of randomly oriented polymer-based supports. This manuscript describes the synthesis of a novel nanostructured sorbent material built using self-assembly of a IDAA ligand inside a nanoporous silica, and demonstrates its use for capturing transition metal cations, and anionic metal complexes, such as PdCl4−2. PMID:22068901

  13. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth. PMID:26037611

  14. Synthesis of all nineteen appropriately protected chiral alpha-hydroxy acid equivalents of the alpha-amino acids for Boc solid-phase depsi-peptide synthesis.

    PubMed

    Deechongkit, Songpon; You, Shu-Li; Kelly, Jeffery W

    2004-02-19

    [reaction: see text] The preparation of depsi-peptides, amide-to-ester-substituted peptides used to probe the role of hydrogen bonding in protein folding energetics, is accomplished by replacing specific l-alpha-amino acid residues by their alpha-hydroxy acid counterparts in a solid-phase synthesis employing a t-Boc strategy. Herein we describe the efficient stereoselective synthesis of all 19 appropriately protected alpha-hydroxy acid equivalents of the l-alpha-amino acids, employing commercially available materials, expanding the number of available alpha-hydroxy acids from 9 to 19. PMID:14961607

  15. Synthesis and characterization of acidic mesoporous borosilicate thin films.

    PubMed

    Xiu, Tongping; Liu, Qian; Wang, Jiacheng

    2009-02-01

    Work on the synthesis and characterization of acidic wormhole-like ordered mesoporous borosilicate thin films (MBSTFs) on silicon wafers is described in this paper. The MBSTFs coated by the dip-coating method were prepared through an evaporation-induced self-assembly (EISA) process using nonionic block copolymers as structure-directing agents. Fourier transform infrared (FT-IR) spectroscopy confirmed the formation of borosiloxane bonds (Si-O-B). High-resolution transmission electron microscopy (HRTEM) and N2 sorption evidenced a wormhole-like mesoporous structure in the MBSTFs obtained. Scanning electron microscopy (SEM) images of the cross sections and surfaces of the samples showed that MBSTFs on silicon wafers were continuous, homogeneous and did not crack. The acidic properties of the MBSTFs were characterized by FT-IR spectra of chemisorbed pyridine. The MBSTFs thus prepared may find their future applications in many fields including chemical sensors, catalysis, optical coating, molecule separation, etc. PMID:19441565

  16. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants. PMID:27010742

  17. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  18. Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

    SciTech Connect

    Reich, I.L.; Reich, H.J.; Menahan, L.A.; Peterson, R.E.

    1987-01-01

    Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

  19. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  20. AMINO ACIDS AUGMENT MUSCLE PROTEIN SYNTHESIS IN NEONATAL PIGS DURING ENDOTOXEMIA BY MODULATING TRANSLATION INITIATION

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In adults, sepsis reduces protein synthesis in skeletal muscle by restraining translation. The effect of sepsis on amino acid-stimulated muscle protein synthesis has not been determined in neonates, a population who is highly anabolic and whose muscle protein synthesis rates are uniquely sensitive ...

  1. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  2. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  3. Transcriptome analysis and identification of genes associated with ¿-3 fatty acid biosynthesis in Perilla frutescens (L.) var. frutescens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Perilla (Perilla frutescens (L.) var frutescens) produces high levels of a-linolenic acid (ALA), a '-3 fatty acid important to health and development. To uncover key genes involved in fatty acid (FA) and triacylglycerol (TAG) synthesis in perilla, we conducted deep sequencing of cDNAs f...

  4. Total synthesis of the squalene synthase inhibitor zaragozic acid C.

    PubMed

    Nakamura, Seiichi

    2005-01-01

    Zaragozic acids and squalestatins were documented by Merck, Glaxo, and Tokyo Noko University/Mitsubishi Kasei Corporation as part of a program aimed at identifying novel inhibitors of squalene synthase, as well as farnesyl transferase. These natural products have attracted considerable attention from numerous synthetic chemists because of their therapeutic potential and novel architecture. This review highlights our total syntheses of zaragozic acid C by two convergent strategies. The key steps in our first-generation synthesis involve 1) simultaneous creation of the C4 and C5 quaternary stereocenters through the Sn(OTf)2-promoted aldol coupling reaction between the alpha-keto ester and silyl ketene thioacetal derived from L- and D-tartaric acids, respectively; and 2) construction of the bicyclic core structure via acid-catalyzed internal ketalization under kinetically controlled conditions. The second-generation strategy relies on a tandem carbonyl ylide formation/1,3-dipolar cycloaddition approach and features elongation of the C1 alkyl side chain through an olefin cross-metathesis as well as high convergency and flexibility. PMID:15635219

  5. The effect of linoleic acid on the whole body synthesis rates of polyunsaturated fatty acids from α-linolenic acid and linoleic acid in free-living rats.

    PubMed

    Domenichiello, Anthony F; Kitson, Alex P; Chen, Chuck T; Trépanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P

    2016-04-01

    Docosahexaenoic acid (DHA) is thought to be important for brain function. The main dietary source of DHA is fish, however, DHA can also be synthesized from precursor omega-3 polyunsaturated fatty acids (n-3 PUFA), the most abundantly consumed being α-linolenic acid (ALA). The enzymes required to synthesize DHA from ALA are also used to synthesize longer chain omega-6 (n-6) PUFA from linoleic acid (LNA). The large increase in LNA consumption that has occurred over the last century has led to concern that LNA and other n-6 PUFA outcompete n-3 PUFA for enzymes involved in DHA synthesis, and therefore, decrease overall DHA synthesis. To assess this, rats were fed diets containing LNA at 53 (high LNA diet), 11 (medium LNA diet) or 1.5% (low LNA diet) of the fatty acids with ALA being constant across all diets (approximately 4% of the fatty acids). Rats were maintained on these diets from weaning for 8 weeks, at which point they were subjected to a steady-state infusion of labeled ALA and LNA to measure DHA and arachidonic acid (ARA) synthesis rates. DHA and ARA synthesis rates were generally highest in rats fed the medium and high LNA diets, while the plasma half-life of DHA was longer in rats fed the low LNA diet. Therefore, increasing dietary LNA, in rats, did not impair DHA synthesis; however, low dietary LNA led to a decrease in DHA synthesis with tissue concentrations of DHA possibly being maintained by a longer DHA half-life. PMID:27012633

  6. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  7. Plasma fatty acid profile in multiple myeloma patients.

    PubMed

    Jurczyszyn, Artur; Czepiel, Jacek; Gdula-Argasińska, Joanna; Paśko, Paweł; Czapkiewicz, Anna; Librowski, Tadeusz; Perucki, William; Butrym, Aleksandra; Castillo, Jorge J; Skotnicki, Aleksander B

    2015-04-01

    New membrane formation in the proliferating tumor cells consequently results in hypermetabolism of fatty acids (FA), as seen in many cancer patients, including multiple myeloma (MM). The FA composition of plasma reflects both endogenous synthesis as well as the dietary supply of these compounds. Additionally, obesity is a risk factor for the development of MM. The aim of this study was to compare the FA composition of plasma in 60 MM patients and 60 healthy controls. We noted significant differences in the FA profile of plasma from patients with MM when compared to the control group. Increased levels of saturated and n-6 polyunsaturated fatty acids in MM patients suggest that there may be increased endogenous synthesis of these fatty acids, likely due to increased expression of desaturase and elongase. Furthermore, cluster analysis showed differences in the distribution of FA in plasma from MM patients compared to controls. Dietary fat and a deranged endogenous FA metabolism may contribute to cancer-associated inflammation through an abnormal arachidonic acid metabolism, caused by pro-inflammatory derivatives. Our study supports further research on the biochemistry of lipids in patients with MM. PMID:25666255

  8. Fumaric Acid Production in Saccharomyces cerevisiae by In Silico Aided Metabolic Engineering

    PubMed Central

    Xu, Guoqiang; Zou, Wei; Chen, Xiulai; Xu, Nan; Liu, Liming; Chen, Jian

    2012-01-01

    Fumaric acid (FA) is a promising biomass-derived building-block chemical. Bio-based FA production from renewable feedstock is a promising and sustainable alternative to petroleum-based chemical synthesis. Here we report on FA production by direct fermentation using metabolically engineered Saccharomyces cerevisiae with the aid of in silico analysis of a genome-scale metabolic model. First, FUM1 was selected as the target gene on the basis of extensive literature mining. Flux balance analysis (FBA) revealed that FUM1 deletion can lead to FA production and slightly lower growth of S. cerevisiae. The engineered S. cerevisiae strain obtained by deleting FUM1 can produce FA up to a concentration of 610±31 mg L–1 without any apparent change in growth in fed-batch culture. FT-IR and 1H and 13C NMR spectra confirmed that FA was synthesized by the engineered S. cerevisiae strain. FBA identified pyruvate carboxylase as one of the factors limiting higher FA production. When the RoPYC gene was introduced, S. cerevisiae produced 1134±48 mg L–1 FA. Furthermore, the final engineered S. cerevisiae strain was able to produce 1675±52 mg L–1 FA in batch culture when the SFC1 gene encoding a succinate–fumarate transporter was introduced. These results demonstrate that the model shows great predictive capability for metabolic engineering. Moreover, FA production in S. cerevisiae can be efficiently developed with the aid of in silico metabolic engineering. PMID:23300594

  9. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved. PMID:17511507

  10. Transport of fatty acids and monoacylglycerols in white and brown adipose tissues.

    PubMed

    Scow, R O; Blanchette-Mackie, E J

    1991-01-01

    Long chain fatty acids (FA) and 2-monoacylglycerols (MG) are produced by lipoprotein lipase (LPL) from plasma triacylglycerols (TG) in capillaries of adipose tissue and transported to adipocytes for TG synthesis. It is widely proposed FA may be transported in cells by FA-binding protein. Mode of transport of MG has received little attention. Our findings in tissues and model membranes indicate that FA (as 1:1 acid-soaps) and MG can be transported in vivo by lateral movement in an interfacial continuum (IFC) of the outer leaflets of plasma and intracellular membranes of capillary endothelium and adipocytes. We postulate that FA and MG enter the IFC in capillaries and flow in the IFC across endothelium and extracellular space to sites in adipocytes where MG are hydrolyzed by MG-lipase (MGL) to FA and glycerol, and FA are esterified in endoplasmic reticulum or transferred to inner mitochondrial membrane for oxidation. FA and MG produced by hormone-sensitive lipase also enter the IFC. These MG flow in the IFC to sites of MGL activity, and the FA flow in the IFC to capillaries for transport to other tissues by albumin, or to mitochondria for heat production. PMID:1959050

  11. Fructose utilization for nucleic acid synthesis in the fetal pig.

    PubMed

    White, C E; Piper, E L; Noland, P R; Daniels, L B

    1982-07-01

    Eight fetal pigs, in utero, were injected ip with 20 microCi/fetus [U14C]-fructose between d 55 and 65 pregnancy. The isotope was allowed to equilibrate between blood and tissues within injected fetuses for a period of 240 min. Fetal pigs were then sacrificed and nucleic acids were extracted from cold tissue homogenates of skeletal muscle and liver. Nuclide disintegrations per minute recovered in extracted DNA and RNA were used to calculate incorporation of labeled C from fructose. The recovery of labeled C per mmol of nucleic acids from skeletal muscle was greater (P less than .05) than that from liver. Relative incorporation of labeled C into skeletal muscle RNA (395.9 pmol/mmol) was greater (P less than .05) than for DNA (189.5 pmol/mmol). The same trend was observed for liver RNA (78.0 pmol/mmol) and DNA (55.6 pmol/mmol), but differences were nonsignificant. These data suggest that at least part of the high concentration of endogenous fructose measured in fetal pigs in utero is involved in synthesis of nucleic acids, thereby providing substrate for anabolic functions necessary for fetal growth and development. PMID:6181047

  12. FaQR, Required for the Biosynthesis of the Strawberry Flavor Compound 4-Hydroxy-2,5-Dimethyl-3(2H)-Furanone, Encodes an Enone Oxidoreductase

    PubMed Central

    Raab, Thomas; López-Ráez, Juan Antonio; Klein, Dorothée; Caballero, Jose Luis; Moyano, Enriqueta; Schwab, Wilfried; Muñoz-Blanco, Juan

    2006-01-01

    The flavor of strawberry (Fragaria × ananassa) fruit is dominated by an uncommon group of aroma compounds with a 2,5-dimethyl-3(H)-furanone structure. We report the characterization of an enzyme involved in the biosynthesis of 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF; Furaneol), the key flavor compound in strawberries. Protein extracts were partially purified, and the observed distribution of enzymatic activity correlated with the presence of a single polypeptide of ∼37 kD. Sequence analysis of two peptide fragments showed total identity with the protein sequence of a strongly ripening-induced, auxin-dependent putative quinone oxidoreductase, Fragaria × ananassa quinone oxidoreductase (FaQR). The open reading frame of the FaQR cDNA consists of 969 bp encoding a 322–amino acid protein with a calculated molecular mass of 34.3 kD. Laser capture microdissection followed by RNA extraction and amplification demonstrated the presence of FaQR mRNA in parenchyma tissue of the strawberry fruit. The FaQR protein was functionally expressed in Escherichia coli, and the monomer catalyzed the formation of HDMF. After chemical synthesis and liquid chromatography–tandem mass spectrometry analysis, 4-hydroxy-5-methyl-2-methylene-3(2H)-furanone was confirmed as a substrate of FaQR and the natural precursor of HDMF. This study demonstrates the function of the FaQR enzyme in the biosynthesis of HDMF as enone oxidoreductase and provides a foundation for the improvement of strawberry flavor and the biotechnological production of HDMF. PMID:16517758

  13. FaQR, required for the biosynthesis of the strawberry flavor compound 4-hydroxy-2,5-dimethyl-3(2H)-furanone, encodes an enone oxidoreductase.

    PubMed

    Raab, Thomas; López-Ráez, Juan Antonio; Klein, Dorothée; Caballero, Jose Luis; Moyano, Enriqueta; Schwab, Wilfried; Muñoz-Blanco, Juan

    2006-04-01

    The flavor of strawberry (Fragaria x ananassa) fruit is dominated by an uncommon group of aroma compounds with a 2,5-dimethyl-3(H)-furanone structure. We report the characterization of an enzyme involved in the biosynthesis of 4-hydroxy-2,5-dimethyl-3(2H)-furanone (HDMF; Furaneol), the key flavor compound in strawberries. Protein extracts were partially purified, and the observed distribution of enzymatic activity correlated with the presence of a single polypeptide of approximately 37 kD. Sequence analysis of two peptide fragments showed total identity with the protein sequence of a strongly ripening-induced, auxin-dependent putative quinone oxidoreductase, Fragaria x ananassa quinone oxidoreductase (FaQR). The open reading frame of the FaQR cDNA consists of 969 bp encoding a 322-amino acid protein with a calculated molecular mass of 34.3 kD. Laser capture microdissection followed by RNA extraction and amplification demonstrated the presence of FaQR mRNA in parenchyma tissue of the strawberry fruit. The FaQR protein was functionally expressed in Escherichia coli, and the monomer catalyzed the formation of HDMF. After chemical synthesis and liquid chromatography-tandem mass spectrometry analysis, 4-hydroxy-5-methyl-2-methylene-3(2H)-furanone was confirmed as a substrate of FaQR and the natural precursor of HDMF. This study demonstrates the function of the FaQR enzyme in the biosynthesis of HDMF as enone oxidoreductase and provides a foundation for the improvement of strawberry flavor and the biotechnological production of HDMF. PMID:16517758

  14. Synthesis of E. faecium wall teichoic acid fragments.

    PubMed

    van der Es, Daan; Groenia, Nadia A; Laverde, Diana; Overkleeft, Herman S; Huebner, Johannes; van der Marel, Gijsbert A; Codée, Jeroen D C

    2016-09-01

    The first synthesis of different Enterococcus faecium wall teichoic acid (WTA) fragments is presented. The structure of these major cell wall components was elucidated recently and it was shown that these glycerolphosphate (GroP) based polymers are built up from -6-(GalNAc-α(1-3)-GalNAc-β(1-2)-GroP)- repeating units. We assembled WTA fragments up to three repeating units in length, in two series that differ in the stereochemistry of the glycerolphosphate moiety. The key GalNAc-GalNAc-GroP synthons, required for the synthesis, were generated from galactosazide building blocks that were employed in highly stereoselective glycosylation reactions to furnish both the α- and β-configured linkages. By comparing the NMR spectra of the synthesized fragments with the isolated material it appears that the hereto undefined stereochemistry of the glycerol phosphate moiety is sn-glycerol-3-phosphate. The generated fragments will be valuable tools to study their immunological activity at the molecular level. PMID:26993744

  15. [Effect of gibberellic acid on RNA synthesis in dwarf peas].

    PubMed

    Kilev, S N; Kholodar', A V; Chekurov, V M; Mertvetsov, N P

    1982-04-01

    The effect of gibberellic acid (GA) on total RNA and polysomal poly-[A]+-RNA synthesis in epicotylia and embryos of dwarf pea of two varieties differing in their physiological sensitivity to GA was studied. It was found that incubation with GA increases the accumulation of total RNA in pea epicotylia, var. "Pioner" and "Polzunok". The maximal stimulation of RNA accumulation makes up to 40% for the low sensitivity variety "Polzunok" and 150% for the highly sensitive variety "Pioner". GA increases the synthesis of polysomal poly (A)+-mRNA in 5-year-old pea sprouts and that of newly synthesized poly (A)+-mRNA in epicotylian polysomes of both varieties 5, 24, 48 and 72 hrs after incubation with GA. GA at concentrations of 10(-6) and 10(-5) stimulates the incorporation of [3H]uridine into polysomal mRNA during the first 1--3 hours after treatment and enhances the accumulation of newly synthesized mRNA in pea embryonic polyribosomes. The stimulating effect is directly proportional to the dose of the hormone. The mechanisms of GA effect on the transcription and translation in pea plant cells are discussed. PMID:6177351

  16. Indoleacetic Acid and the Synthesis of Glucanases and Pectic Enzymes

    PubMed Central

    Datko, Anne Harmon; Maclachlan, G. A.

    1968-01-01

    Indoleacetic acid (IAA) and/or inhibitors of DNA, RNA or protein synthesis were added to the apex of decapitated seedlings of Pisum sativum L. var. Alaska. At various times up to 4 days, enzymic protein was extracted from a segment of epicotyl immediately below the apex and assayed for its ability to hydrolyse polysaccharides or their derivatives. With the exception of amylase, the total amounts per segment of all of the tested enzymes increased due to IAA treatment. The development of β-1,4-glucanase (cellulase) activity per unit of protein or fresh weight proceeded according to a typical sigmoid induction curve. Pectinase was formed for about 2 days in control segments and IAA treatment resulted in continued synthesis for at least another 2 days provided cell division took place. β-1,3-glucanase and pectinesterase activities were only enhanced by IAA to the extent that total protein levels increased. Reaction mechanisms for these effects and functions for the enzymes during growth are discussed. PMID:16656834

  17. Intermediates in the Synthesis of Type 2 Adenovirus Deoxyribonucleic Acid

    PubMed Central

    Horwitz, Marshall S.

    1971-01-01

    Intermediates in the synthesis of adenovirus type 2 deoxyribonucleic acid (DNA) were studied in HeLa cells. Pieces of DNA smaller than the viral genome were demonstrated after labeling with 3H-thymidine for 10 to 240 sec. Intermediates as small as the Okazaki fragments (8 to 10S) do not predominate at any of the above times. No detectable addition of nucleotides to parental genome could be shown, nor was there any breakdown of recently synthesized viral DNA. The DNA intermediates were of viral origin for they hybridized to viral DNA and were made at a stage of the cell cycle (G2) when host DNA is not synthesized. PMID:5132696

  18. Fanconi anemia (FA) and crosslinker sensitivity: Re-appraising the origins of FA definition.

    PubMed

    Pagano, Giovanni; d'Ischia, Marco; Pallardó, Federico V

    2015-07-01

    The commonly accepted definition of Fanconi anemia (FA) relying on DNA repair deficiency is submitted to a critical review starting from the early reports pointing to mitomycin C bioactivation and to the toxicity mechanisms of diepoxybutane and a group of nitrogen mustards causing DNA crosslinks in FA cells. A critical analysis of the literature prompts revisiting the FA phenotype and crosslinker sensitivity in terms of an oxidative stress (OS) background, redox-related anomalies of FA (FANC) proteins, and mitochondrial dysfunction. This re-appraisal of FA basic defect might lead to innovative approaches both in elucidating FA phenotypes and in clinical management. PMID:25732180

  19. Supplementation of essential fatty acids to Holstein calves during late uterine life and first month of life alters hepatic fatty acid profile and gene expression.

    PubMed

    Garcia, M; Greco, L F; Lock, A L; Block, E; Santos, J E P; Thatcher, W W; Staples, C R

    2016-09-01

    Linoleic acid is an essential dietary fatty acid (FA). However, how the supplementation of linoleic acid during uterine and early life may modify the FA profile and transcriptome regulation of the liver, and performance of preweaned dairy calves is unknown. Our objective was to evaluate the effect of supplementation of essential FA to Holstein calves during late uterine and early life on their hepatic FA profile and global gene expression at 30 d of age. During the last 8 wk of pregnancy, Holstein cattle (n=96) were fed either no fat supplement (control), a saturated FA supplement enriched with C18:0, or an unsaturated FA supplement enriched with linoleic acid. Male calves (n=40) born from these dams were fed a milk replacer (MR) with either low (LLA) or high linoleic acid (HLA) concentration as the sole feedstuff during the first 30 d. Liver biopsy was performed at 30 d of age, and microarray analysis was performed on 18 liver samples. Total concentration of FA in liver were greater in calves fed LLA compared with those fed HLA MR (8.2 vs. 7.1%), but plasma concentrations of total FA did not differ due to MR diets. The FA profiles of plasma and liver of calves were affected differently by the prepartum diets. Specifically, the FA profile in liver was affected moderately by the feeding of fat prepartum, but the profiles did not differ due to the type of FA fed prepartum. The type of MR fed during the first 30 d of life had major effects on both plasma and liver FA profiles, resembling the type of fat fed. Plasma and liver of calves fed LLA MR had greater percentage of medium-chain FA (C12:0 and C14:0), whereas plasma and liver from calves fed HLA MR had greater percentages of linoleic and α-linolenic acids. Dams fed fat or a specific type of FA modified the expression of some genes in liver of calves, particularly those genes involved in biological functions and pathways related to upregulation of lipid metabolism and downregulation of inflammatory responses

  20. Fulvic acid promotes extracellular anti-cancer mediators from RAW 264.7 cells, causing to cancer cell death in vitro.

    PubMed

    Jayasooriya, Rajapaksha Gedara Prasad Tharanga; Dilshara, Matharage Gayani; Kang, Chang-Hee; Lee, Seungheon; Choi, Yung Hyun; Jeong, Yong Kee; Kim, Gi-Young

    2016-07-01

    Fulvic acid (FA) is known to promote electrochemical balance as a donor or a receptor possessing many biomedical functions. Nevertheless, the effect of FA on the anti-cancer activity has not been elucidated. In the current study, we first isolated FA from humus and investigated whether FA regulates immune-stimulating functions, such as production of nitric oxide (NO), in RAW 264.7 cells. Our data showed that FA slightly enhances cell viability in a dose-dependent manner and secretion of NO from RAW 264.7 cells. It upregulated the protein and mRNA expression of inducible NO synthesis (iNOS). In addition, FA enhanced the DNA-binding activity of nuclear factor-κB (NF-κB) in RAW 264.7 cells; the NF-κB inhibitor, pyrrolidine dithiocarbamate (PDTC) effectively attenuated the expression of FA-stimulated iNOS, suggesting that FA stimulates NF-κB to promote iNOS and NO production. Finally, FA-stimulated culture media (FA-CM) from RAW 264.7 cells were collected and MCA-102 fibrosarcoma cells were cultured in this media. The FA-CM augmented MCA-102 fibrosarcoma cell apoptosis; however, an NO inhibitor N(G)-monomethyl-l-arginine (NMMA) slightly inhibited the FA-CM-mediated MCA-102 fibrosarcoma cell apoptosis, which was accompanied by low levels of NO. In the present study, we found that FA induces the generation of NO and iNOS in RAW 264.7 cells by inducing NF-κB activation; however, NO did not significantly stimulate MCA-102 fibrosarcoma cell apoptosis in the current study. In addition, FA-CM enhanced cell death in various human cancer cells such as Hep3B, LNCaP, and HL60. Taken together, FA most likely stimulates immune-modulating molecules such as NO and induces cancer cell apoptosis. PMID:27177083

  1. Xylonucleic acid: synthesis, structure, and orthogonal pairing properties

    PubMed Central

    Maiti, Mohitosh; Maiti, Munmun; Knies, Christine; Dumbre, Shrinivas; Lescrinier, Eveline; Rosemeyer, Helmut; Ceulemans, Arnout; Herdewijn, Piet

    2015-01-01

    There is a common interest for studying xeno-nucleic acid systems in the fields of synthetic biology and the origin of life, in particular, those with an engineered backbone and possessing novel properties. Along this line, we have investigated xylonucleic acid (XyloNA) containing a potentially prebiotic xylose sugar (a 3′-epimer of ribose) in its backbone. Herein, we report for the first time the synthesis of four XyloNA nucleotide building blocks and the assembly of XyloNA oligonucleotides containing all the natural nucleobases. A detailed investigation of pairing and structural properties of XyloNAs in comparison to DNA/RNA has been performed by thermal UV-melting, CD, and solution state NMR spectroscopic studies. XyloNA has been shown to be an orthogonal self-pairing system which adopts a slightly right-handed extended helical geometry. Our study on one hand, provides understanding for superior structure-function (-pairing) properties of DNA/RNA over XyloNA for selection as an informational polymer in the prebiotic context, while on the other hand, finds potential of XyloNA as an orthogonal genetic system for application in synthetic biology. PMID:26175047

  2. An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

    PubMed Central

    Carballeira, Néstor M.; Sanabria, David; Oyola, Delise

    2006-01-01

    An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

  3. Long-Term Ritonavir Exposure Increases Fatty Acid and Glycerol Recycling in 3T3-L1 Adipocytes as Compensatory Mechanisms for Increased Triacylglycerol Hydrolysis

    PubMed Central

    Adler-Wailes, Diane C.; Guiney, Evan L.; Wolins, Nathan E.; Yanovski, Jack A.

    2010-01-01

    Lipodystrophy with high nonesterified fatty acid (FA) efflux is reported in humans receiving highly active antiretroviral therapy (HAART) to treat HIV infection. Ritonavir, a common component of HAART, alters adipocyte FA efflux, but the mechanism for this effect is not established. To investigate ritonavir-induced changes in FA flux and recycling through acylglycerols, we exposed differentiated murine 3T3-L1 adipocytes to ritonavir for 14 d. FA efflux, uptake, and incorporation into acylglycerols were measured. To identify a mediator of FA efflux, we measured adipocyte triacylglycerol lipase (ATGL) transcript and protein. To determine whether ritonavir-treated adipocytes increased glycerol backbone synthesis for FA reesterification, we measured labeled glycerol and pyruvate incorporation into triacylglycerol (TAG). Ritonavir-treated cells had increased FA efflux, uptake, and incorporation into TAG (all P < 0.01). Ritonavir increased FA efflux without consistently increasing glycerol release or changing TAG mass, suggesting increased partial TAG hydrolysis. Ritonavir-treated adipocytes expressed significantly more ATGL mRNA (P < 0.05) and protein (P < 0.05). Ritonavir increased glycerol (P < 0.01) but not pyruvate (P = 0.41), utilization for TAG backbone synthesis. Consistent with this substrate utilization, glycerol kinase transcript (required for glycerol incorporation into TAG backbone) was up-regulated (P < 0.01), whereas phosphoenolpyruvate carboxykinase transcript (required for pyruvate utilization) was down-regulated (P < 0.001). In 3T3-L1 adipocytes, long-term ritonavir exposure perturbs FA metabolism by increasing ATGL-mediated partial TAG hydrolysis, thus increasing FA efflux, and leads to compensatory increases in FA reesterification with glycerol and acylglycerols. These changes in FA metabolism may, in part, explain the increased FA efflux observed in ritonavir-associated lipodystrophy. PMID:20228169

  4. Synthesis of novel acid electrolytes for phosphoric acid fuel cells. Final report, May 1985-October 1988

    SciTech Connect

    Adcock, J.L.

    1988-11-01

    Construction of a 40-millimole-per-hour-scale aerosol direct-fluorination reactor was completed June 26, 1986. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4-methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy-1-propene, 18 grams of F-3-(2-methoxy.ethoxy)-1-propene, and 37 grams of F-3,3-dimethyl-1-butene. Eighteen grams of F-2,2-dimethyl-1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy-1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy)-1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other GRI contractors for synthesis of perfluorinated sulfur(VI) and phosphorous(V) acids.

  5. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  6. GPM Video of In-fa

    NASA Video Gallery

    On Nov. 19 GPM saw a few towering storms in In-fa's eye wall were reaching heights of up to 17.3 km (10.7 miles). The most intense precipitation was measured in In-fa's eye wall by DPR where it was...

  7. Synthesis of hyaluronic acid oligosaccharides and exploration of a fluorous-assisted approach.

    PubMed

    Macchione, Giuseppe; de Paz, José L; Nieto, Pedro M

    2014-07-23

    The synthesis of hyaluronic acid oligomers (tri- and tetrasaccharide) is described. We have followed a pre-glycosylation oxidation strategy. Glucuronic acid units were directly employed in coupling reactions with suitably protected glucosamine derivatives. In order to simplify the purification of synthetic intermediates, a fluorous-assisted strategy has been also explored. Using this approach, a hyaluronic acid trisaccharide was prepared. PMID:24930061

  8. Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.

    PubMed

    Dacquin, J P; Lee, A F; Pirez, C; Wilson, K

    2012-01-01

    Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. PMID:22089025

  9. Selective synthesis of 3-hydroxy acids from Meldrum's acids using SmI2-H2O.

    PubMed

    Szostak, Michal; Spain, Malcolm; Procter, David J

    2012-05-01

    The single-step synthesis of 3-hydroxy carboxylic acids from readily available Meldrum's acids involves a selective monoreduction using a SmI(2)-H(2)O complex to give products in high crude purity, and it represents a considerable advancement over other methods for the synthesis of 3-hydroxy acids. The protocol includes a detailed guide to the preparation of a single electron-reducing SmI(2)-H(2)O complex and describes two representative examples of the methodology: monoreduction of a fully saturated Meldrum's acid (5-(4-bromobenzyl)-2,2-dimethyl-1,3-dioxane-4,6-dione) and tandem conjugate reduction-selective monoreduction of α,β-unsaturated Meldrum's acid (5-(4-methoxybenzylidene)-2,2-dimethyl-1,3-dioxane-4,6-dione). The protocol for selective monoreduction of Meldrum's acids takes ∼6 h to complete. PMID:22538848

  10. Dihydrolipoic acid activates oligomycin-sensitive thiol groups and increases ATP synthesis in mitochondria.

    PubMed

    Zimmer, G; Mainka, L; Krüger, E

    1991-08-01

    Investigations with dihydrolipoic acid in rat heart mitochondria and mitoplasts reveal an activation of ATP-synthase up to 45%, whereas ATPase activities decrease by 36%. In parallel with an increase in ATP synthesis oligomycin-sensitive mitochondrial -SH groups are activated at 2-4 nmol dihydrolipoic acid/mg protein. ATPase activation by the uncouplers carbonylcyanide-p-trifluoromethoxyphenylhydrazone and oleate is diminished by dihydrolipoic acid, and ATP synthesis depressed by oleate is partially restored. No such efficiency of dihydrolipoic acid is seen with palmitate-induced ATPase activation or decrease of ATP synthesis. This indicates different interference of oleate and palmitate with mitochondria. In addition to its known coenzymatic properties dihydrolipoic acid may act as a substitute for coenzyme A, thereby diminishing the uncoupling efficiency of oleate. Furthermore, dihydrolipoic acid is a very potent antioxidant, shifting the -SH-S-S- equilibrium in mitochondria to the reduced state and improving the energetic state of cells. PMID:1832845

  11. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  12. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  13. An Alkyne Diboration/6π-Electrocyclization Strategy for the Synthesis of Pyridine Boronic Acid Derivatives.

    PubMed

    Mora-Radó, Helena; Bialy, Laurent; Czechtizky, Werngard; Méndez, María; Harrity, Joseph P A

    2016-05-01

    A new and efficient synthesis of pyridine-based heteroaromatic boronic acid derivatives is reported through a novel diboration/6π-electrocyclization strategy. This method delivers a range of functionalized heterocycles from readily available starting materials. PMID:27059895

  14. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  15. Synthesis and self-assembly of poly(3-hexylthiophene)-block-poly(acrylic acid)

    SciTech Connect

    Li, Zicheng; Ono, Robert J.; Wu, Zong-Quan; Bielawski, Christopher W.

    2011-01-01

    A modular and convenient synthesis of ethynyl end functionalized poly(3-hexylthiophene) in high purity is reported; this material facilitated access to poly(3-hexylthiophene)-block-poly(acrylic acid) which self-assembled into hierarchical structures.

  16. Cellular Uptake and Antitumor Activity of DOX-hyd-PEG-FA Nanoparticles

    PubMed Central

    Na, Ren; Song, Yan-feng; Mei, Qi-bing; Zhao, Ming-gao; Zhou, Si-yuan

    2014-01-01

    A PEG-based, folate mediated, active tumor targeting drug delivery system using DOX-hyd-PEG-FA nanoparticles (NPs) were prepared. DOX-hyd-PEG-FA NPs showed a significantly faster DOX release in pH 5.0 medium than in pH 7.4 medium. Compared with DOX-hyd-PEG NPs, DOX-hyd-PEG-FA NPs increased the intracellular accumulation of DOX and showed a DOX translocation from lysosomes to nucleus. The cytotoxicity of DOX-hyd-PEG-FA NPs on KB cells was much higher than that of free DOX, DOX-ami-PEG-FA NPs and DOX-hyd-PEG NPs. The cytotoxicity of DOX-hyd-PEG-FA NPs on KB cells was attenuated in the presence of exogenous folic acid. The IC50 of DOX-hyd-PEG-FA NPs and DOX-hyd-PEG NPs on A549 cells showed no significant difference. After DOX-hyd-PEG-FA NPs were intravenously administered, the amount of DOX distributed in tumor tissue was significantly increased, while the amount of DOX distributed in heart was greatly decreased as compared with free DOX. Compared with free DOX, NPs yielded improved survival rate, prolonged life span, delayed tumor growth and reduced the cardiotoxicity in tumor bearing mice model. These results indicated that the acid sensitivity, passive and active tumor targeting abilities were likely to act synergistically to enhance the drug delivery efficiency of DOX-hyd-PEG-FA NPs. Therefore, DOX-hyd-PEG-FA NPs are a promising drug delivery system for targeted cancer therapy. PMID:24828815

  17. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  18. Cetalox and analogues: synthesis via acid-mediated polyene cyclizations.

    PubMed

    Snowden, Roger L

    2008-06-01

    Using a novel, acid-mediated cyclization methodology, a direct access to Cetalox ((+/-)-1; a commercially important ambergris-type odorant) and various structurally related didehydro (i.e., 19, 26, and 30) and tetradehydro (i.e., 28 and 37/38) analogues is described. Treatment of either (E,E)-14 or (E)-15 with an excess of FSO(3)H in 2-nitropropane at -90 degrees stereospecifically afforded (+/-)-1 in 40 and 42% yield, respectively. Under similar conditions, cyclization of (E)-18 or 20 furnished 19 in 60 and 64% yield, respectively. Analogously, using an excess of ClSO(3)H in CH(2)Cl(2) at -80 degrees, 26 is formed with high stereoselectivity by cyclization of either (E)-24 or (Z)-25 (52 and 31% yield, resp.); in the same manner, 28 was prepared from 27 (22% yield). The same principle was applied to the synthesis of racemic Superambrox (30), via cyclization of 35, but only with poor selectivity (22%) and low yield (7%). Another approach via cyclization of (E)-40 under solvolysis conditions (excess TFA in CH(2)Cl(2) at -10 degrees) gave a higher yield (15%) with improved selectivity (43%). Finally, cyclization of 34 (1:1 diastereoisomer mixture) afforded 37/38 (10:1) in 27% yield. The qualitative organoleptic properties of 19, 26, 28, 30, and 37/38 (10:1) are briefly discussed. PMID:18618391

  19. Synthesis of carboranyl amino acids, hydantoins, and barbiturates

    SciTech Connect

    Wyzlic, I.M.; Tjarks, W.; Soloway, A.H.

    1996-07-31

    The syntheses of three novel boronated hydantoins, 5-(o-carboran-1-ylmethyl)hydantoin, 14, the tetraphenylphosphonium salt of 7-(hydantoin-5-ylmethyl)dodecahydro-7,8-dicarba-nido-undecaborate, 15, 5-(o-carboran-1-ylmethyl)-2-thiohydantoin, 16, and two new barbiturates, 5,5-bis(but-2-ynyl)barbiturate, 18, and 5,5-bis[(2-methyl-0-carboran-1-yl)methyl]barbiturate, 20, are described. Hydantoins 14-16 were synthesized from o-carboranylalanine (Car, 13). The detailed synthesis of Car and two other carborane-containing amino acids, O-(o-carboran-1-ylmethyl)tyrosine (CBT, 5a) and p-(o-carboran-1-yl)phenylalanine (CBPA, 5b), presented earlier as a communication, {sup 16} are also described. Hydantoin 14 and barbiturates 18 and 20 were tested for their potential anticonvulsant activity. Initial qualitative screening showed moderate activities for hydantoin 14 and barbiturate 18. Barbiturate 20 had no activity. Compound 14 appeared to be nontoxic at doses of 300 mg/kg (mice, ip) and 50 mg/kg (rats, oral). However, 18 was very toxic under similar conditions.

  20. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  1. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds.

    PubMed

    Adhikari, Neil D; Bates, Philip D; Browse, John

    2016-05-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  2. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  3. Lactic acid as an invaluable green solvent for ultrasound-assisted scalable synthesis of pyrrole derivatives.

    PubMed

    Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang

    2015-09-01

    Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. PMID:25605585

  4. Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies

    PubMed Central

    Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa

    2014-01-01

    In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356

  5. Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids

    SciTech Connect

    Standaert, Robert F; Park, Dr Seung Bum

    2006-01-01

    Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A in the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.

  6. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  7. Comparative fatty acid selectivity of lipases in esterification reactions with glycerol and diol analogues in organic media.

    PubMed

    Lee, C H; Parkin, K L

    2000-01-01

    Reaction selectivity of Pseudomonas cepacia, Rhizomucor miehei, and Candida antarctica B lipases was assessed in multicompetitive esterification reaction mixtures containing an homologous series of n-chain even carbon number fatty acid (FA; C4-C18) substrates and a single alcohol cosubstrate (glycerol, 1,2-propanediol (1,2-PD), or 1, 3-propanediol (1,3-PD)) in tert-butyl methyl ether at water activity of 0.69 or 0.90 and a reaction temperature of 35 degrees C. For P. cepacia lipase, the ordinal patterns of FA selectivities observed were, with glycerol, C8 > C10, C6, C16 > other FA; with 1,2-PD and 1, 3-PD, C16 > C8 > C14 > other FA. For R. miehei lipase, the ordinal patterns of FA selectivities observed were, with glycerol, C8 > C12 > C10, C14 > other FA; with 1,2-PD and 1,3-PD, C8 > C12 > other FA. For C. antarctica B lipase, the ordinal patterns of FA selectivities observed were, with glycerol, C8 > C10, C6, C12 > other FA; with 1, 2-PD, C8 > C10, C6 > other FA; and with 1,3-PD, C8 > C10 > C6 > other FA. The differences in selectivity among FA ranged up to 16-fold, depending upon the lipase and alcohol cosubstrate used. These findings represent intrinsic and substrate-modulated features of FA selectivities that are of particular relevance to the use of lipases for acylglycerol synthesis reactions. PMID:10835238

  8. Respiratory CO(2) as Carbon Source for Nocturnal Acid Synthesis at High Temperatures in Three Species Exhibiting Crassulacean Acid Metabolism.

    PubMed

    Winter, K; Schröppel-Meier, G; Caldwell, M M

    1986-06-01

    TEMPERATURE EFFECTS ON NOCTURNAL CARBON GAIN AND NOCTURNAL ACID ACCUMULATION WERE STUDIED IN THREE SPECIES OF PLANTS EXHIBITING CRASSULACEAN ACID METABOLISM: Mamillaria woodsii, Opuntia vulgaris, and Kalanchoë daigremontiana. Under conditions of high soil moisture, nocturnal CO(2) gain and acid accumulation had temperature optima at 15 to 20 degrees C. Between 5 and 15 degrees C, uptake of atmospheric CO(2) largely accounted for acid accumulation. At higher tissue temperatures, acid accumulation exceeded net carbon gain indicating that acid synthesis was partly due to recycling of respiratory CO(2). When plants were kept in CO(2)-free air, acid accumulation based on respiratory CO(2) was highest at 25 to 35 degrees C. Net acid synthesis occurred up to 45 degrees C, although the nocturnal carbon balance became largely negative above 25 to 35 degrees C. Under conditions of water stress, net CO(2) exchange and nocturnal acid accumulation were reduced. Acid accumulation was proportionally more decreased at low than at high temperatures. Acid accumulation was either similar over the whole temperature range (5-45 degrees C) or showed an optimum at high temperatures, although net carbon balance became very negative with increasing tissue temperatures. Conservation of carbon by recycling respiratory CO(2) was temperature dependent. At 30 degrees C, about 80% of the dark respiratory CO(2) was conserved by dark CO(2) fixation, in both well irrigated and water stressed plants. PMID:16664827

  9. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  10. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis.

    PubMed

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a "GRAS" (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  11. Ligand Binding to the FA3-FA4 Cleft Inhibits the Esterase-Like Activity of Human Serum Albumin

    PubMed Central

    Ascenzi, Paolo; Leboffe, Loris; di Masi, Alessandra; Trezza, Viviana; Fanali, Gabriella; Gioia, Magda; Coletta, Massimo; Fasano, Mauro

    2015-01-01

    The hydrolysis of 4-nitrophenyl esters of hexanoate (NphOHe) and decanoate (NphODe) by human serum albumin (HSA) at Tyr411, located at the FA3-FA4 site, has been investigated between pH 5.8 and 9.5, at 22.0°C. Values of Ks, k+2, and k+2/Ks obtained at [HSA] ≥ 5×[NphOXx] and [NphOXx] ≥ 5×[HSA] (Xx is NphOHe or NphODe) match very well each other; moreover, the deacylation step turns out to be the rate limiting step in catalysis (i.e., k+3 << k+2). The pH dependence of the kinetic parameters for the hydrolysis of NphOHe and NphODe can be described by the acidic pKa-shift of a single amino acid residue, which varies from 8.9 in the free HSA to 7.6 and 7.0 in the HSA:NphOHe and HSA:NphODe complex, respectively; the pK>a-shift appears to be correlated to the length of the fatty acid tail of the substrate. The inhibition of the HSA-Tyr411-catalyzed hydrolysis of NphOHe, NphODe, and 4-nitrophenyl myristate (NphOMy) by five inhibitors (i.e., diazepam, diflunisal, ibuprofen, 3-indoxyl-sulfate, and propofol) has been investigated at pH 7.5 and 22.0°C, resulting competitive. The affinity of diazepam, diflunisal, ibuprofen, 3-indoxyl-sulfate, and propofol for HSA reflects the selectivity of the FA3-FA4 cleft. Under conditions where Tyr411 is not acylated, the molar fraction of diazepam, diflunisal, ibuprofen, and 3-indoxyl-sulfate bound to HSA is higher than 0.9 whereas the molar fraction of propofol bound to HSA is ca. 0.5. PMID:25790235

  12. Ligand binding to the FA3-FA4 cleft inhibits the esterase-like activity of human serum albumin.

    PubMed

    Ascenzi, Paolo; Leboffe, Loris; di Masi, Alessandra; Trezza, Viviana; Fanali, Gabriella; Gioia, Magda; Coletta, Massimo; Fasano, Mauro

    2015-01-01

    The hydrolysis of 4-nitrophenyl esters of hexanoate (NphOHe) and decanoate (NphODe) by human serum albumin (HSA) at Tyr411, located at the FA3-FA4 site, has been investigated between pH 5.8 and 9.5, at 22.0°C. Values of Ks, k+2, and k+2/Ks obtained at [HSA] ≥ 5×[NphOXx] and [NphOXx] ≥ 5×[HSA] (Xx is NphOHe or NphODe) match very well each other; moreover, the deacylation step turns out to be the rate limiting step in catalysis (i.e., k+3 < k+2). The pH dependence of the kinetic parameters for the hydrolysis of NphOHe and NphODe can be described by the acidic pKa-shift of a single amino acid residue, which varies from 8.9 in the free HSA to 7.6 and 7.0 in the HSA:NphOHe and HSA:NphODe complex, respectively; the pK>a-shift appears to be correlated to the length of the fatty acid tail of the substrate. The inhibition of the HSA-Tyr411-catalyzed hydrolysis of NphOHe, NphODe, and 4-nitrophenyl myristate (NphOMy) by five inhibitors (i.e., diazepam, diflunisal, ibuprofen, 3-indoxyl-sulfate, and propofol) has been investigated at pH 7.5 and 22.0°C, resulting competitive. The affinity of diazepam, diflunisal, ibuprofen, 3-indoxyl-sulfate, and propofol for HSA reflects the selectivity of the FA3-FA4 cleft. Under conditions where Tyr411 is not acylated, the molar fraction of diazepam, diflunisal, ibuprofen, and 3-indoxyl-sulfate bound to HSA is higher than 0.9 whereas the molar fraction of propofol bound to HSA is ca. 0.5. PMID:25790235

  13. The cathepsin B inhibitor, z-FA-CMK is toxic and readily induced cell death in human T lymphocytes

    SciTech Connect

    Liow, K.Y.; Chow, S.C.

    2013-11-01

    The cathepsin B inhibitor, benzyloxycarbonyl-phenylalanine-alanine-chloromethylketone (z-FA-CMK) was found to be toxic and readily induced cell death in the human T cell line, Jurkat, whereas two other analogs benzyloxycarbonyl-phenylalanine-alanine-fluoromethylketone (z-FA-FMK) and benzyloxycarbonyl-phenylalanine-alanine-diazomethylketone (z-FA-DMK) were not toxic. The toxicity of z-FA-CMK requires not only the CMK group, but also the presence of alanine in the P1 position and the benzyloxycarbonyl group at the N-terminal. Dose–response studies showed that lower concentrations of z-FA-CMK induced apoptosis in Jurkat T cells whereas higher concentrations induced necrosis. In z-FA-CMK-induced apoptosis, both initiator caspases (-8 and -9) and effector caspases (-3, -6 and -7) were processed to their respective subunits in Jurkat T cells. However, only the pro-form of the initiator caspases were reduced in z-FA-CMK-induced necrosis and no respective subunits were apparent. The caspase inihibitor benzyloxycarbonyl-valine-alanine-aspartic acid-(O-methyl)-fluoromehylketone (z-VAD-FMK) inhibits apoptosis and caspase processing in Jurkat T cells treated with low concentration of z-FA-CMK but has no effect on z-FA-CMK-induced necrosis and the loss of initiator caspases. This suggests that the loss of initiator caspases in Jurkat T cells during z-FA-CMK-induced necrosis is not a caspase-dependent process. Taken together, we have demonstrated that z-FA-CMK is toxic to Jurkat T cells and induces apoptosis at low concentrations, while at higher concentrations the cells die of necrosis. - Highlights: • z-FA-CMK is toxic and induce cell death in the human T cells. • z-FA-CMK toxicity requires the CMK group, alanine and the benzyloxycarbonyl group. • z-FA-CMK induced apoptosis at low concentration and necrosis at high concentration.

  14. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  15. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  16. Inhibition of sterol but not fatty acid synthesis by valproate in developing rat brain in vivo.

    PubMed Central

    Bolaños, J P; Medina, J M; Williamson, D H

    1990-01-01

    The effect of administration of valproate on lipogenesis in the developing rat brain in vivo was studied. Valproate inhibited by 21-38% the rate of 3H2O incorporation into brain sterols, without significantly affecting fatty acid synthesis. Similarly, R-[2-14C]mevalonate incorporation into sterols was inhibited by 33-54%; the low rate of fatty acid synthesis under these conditions was not affected by valproate. Plasma ketone bodies decreased after treatment with valproate. Valproate inhibited (about 50%) both sterol and fatty acid synthesis in livers of weanling rats. It is concluded that valproate can specifically inhibit sterol synthesis in the brain during development, in part at a stage after mevalonate formation, and also by decreased exogenous precursor supply. PMID:2264830

  17. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  18. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  19. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  20. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  1. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-01

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. PMID:27258673

  2. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  3. Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

    SciTech Connect

    Chander, A.; Gullo, J.; Reicherter, J.; Fisher, A.

    1987-05-01

    Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased only by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.

  4. Synthesis of novel trivalent amino acid glycoconjugates based on the cyclotriveratrylene ('CTV') scaffold.

    PubMed

    van Ameijde, Jeroen; Liskamp, Rob M J

    2003-08-01

    The convenient synthesis of novel trivalent amino acid glycoconjugates based on cyclotriveratrylene ('CTV') is described. These constructs consist of the CTV scaffold, three oligoethylene glycol spacers of variable length connected to a glyco amino acid residue which can also be varied. The resulting library of trivalent glycoconjugates can be used for studying multivalent interactions. PMID:12948190

  5. Prolonged stimulation of muscle protein synthesis by leucine in neonates is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rise in amino acids and insulin after a meal independently stimulate protein synthesis in skeletal muscle of neonates by activating the intracellular signalling pathways that regulate mRNA translation. Leucine, in particular, is important in mediating the response to amino acids. Previously, w...

  6. Diesters from Oleic Acid: Synthesis, Low Temperature Properties, and Oxidation Stability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several diesters were prepared from commercially available oleic acid and common organic acids. The key step in the three step synthesis of oleochemical diesters entails a ring opening esterification of alkyl 9,10-epoxyoctadecanoates (alkyl: propyl, iso-propyl, octyl, 2-ethylhexyl) using propionic a...

  7. [The clinical evaluation of the hypocholesterolemic effects of an inhibitor of cholesterol synthesis: mevalonic acid].

    PubMed

    Del Nero, E; Aloe, N; Augeri, C; Avola, F; Carta, G; Cavagnaro, A; De Grandi, R; Gianfreda, M; Magro, G P; Mazzarello, G P

    1992-07-01

    Twenty eight patients with heterozygous familial hypercholesterolemia were treated with mevalonic acid (an inhibitor of cholesterol synthesis) for 45 days. Patients received a daily dose of 750 to 1500 mg mevalonic acid depending on plasma cholesterol levels. Results showed a significant reduction in cholesterol values whereas no significant difference was observed in HDL cholesterol and triglyceride levels. PMID:1505176

  8. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective. PMID:25055961

  9. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  10. Synthesis of zirconium carbide nanosized powders by pursed wire discharge in oleic acid

    NASA Astrophysics Data System (ADS)

    Sugashima, Kenta; Suzuki, Kazuma; Suzuki, Tsuneo; Nakayama, Tadachika; Suematsu, Hisayuki; Niihara, Koichi

    2016-01-01

    In this study, we propose novel PWD methods in inert gas mixed organic vapor and organic liquid which work as harmless carbon sources. Metal zirconium wire evaporation by PWD in organic vapor or liquid media was investigated. It was confirmed that in the PWD process using oleic acid liquid, single phase zirconium carbide nanopowders were synthesized by a reaction between Zr vapor and oleic acid. A new method for synthesis of carbide nanopowders was developed using the PWD in organic liquid. Therefore, the present result suggested that PWD method in oleic acid liquids is effective for the synthesis of carbide nanopowders.

  11. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives.

    PubMed

    Hayashi, N; Sugawara, T; Kato, S

    1991-01-01

    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4].Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  12. Computer-assisted automated synthesis. III. Synthesis of substituted N-(carboxyalkyl) amino-acid tert-butyl ester derivatives

    PubMed Central

    Hayashi, Nobuyoshi; Sugawara, Tohru; Kato, Shinji

    1991-01-01

    A versatile automated synthesis apparatus, equipped with a chemical artificial intelligence, was developed to prepare and isolate a wide variety of compounds. The apparatus was to the synthesis of substituted N-(carboxyalkyl)amino-acids. The apparatus [1,2] is composed of units for performing various tasks,for example reagent supply, reaction, purification and separation, each linked to a control system. All synthetic processes, including washing and drying of the apparatus after each synthetic run, were automatically performed from the mixing of the reactants to the isolation of the products as powders or crystals. The reaction of an amino-acid tertbutyl ester acetic acid salt with a 2-keto acid sodium salt produces an unstable intermediate, Schiff base, which is reduced with sodum cyanoborohydride to give a substituted N-(carboxyalkyl)aminoacid tert-butyl ester sodium salt. The equilibrium and the consecutive reactions were controlled by adding sodium cyanoborohydride using the artificial intelligence software, which contained novel kinetic equations [3] and substituent effects [4]. Substitued N-(carboxyalkyl)amino-acid tert-butyl esters, 90 derivatives, were automatically synthesized using the computerassisted automated synthesis apparatus. The syntheses were performed unattended 24 hours a day, except for supplying the raw materials, reagents and solvents. The apparatus is extremely valuable for synthesizing many derivatives of a particular compound. The configurations of the products were determined by circular dichroism measurements. PMID:18924904

  13. Neutral Lipid Metabolism Influences Phospholipid Synthesis and Deacylation in Saccharomyces cerevisiae

    PubMed Central

    Mora, Gabriel; Scharnewski, Michael; Fulda, Martin

    2012-01-01

    Establishment and maintenance of equilibrium in the fatty acid (FA) composition of phospholipids (PL) requires both regulation of the substrate available for PL synthesis (the acyl-CoA pool) and extensive PL turnover and acyl editing. In the present study, we utilize acyl-CoA synthetase (ACS) deficient cells, unable to recycle FA derived from lipid deacylation, to evaluate the role of several enzymatic activities in FA trafficking and PL homeostasis in Saccharomyces cerevisiae. The data presented show that phospholipases B are not contributing to constitutive PL deacylation and are therefore unlikely to be involved in PL remodeling. In contrast, the enzymes of neutral lipid (NL) synthesis and mobilization are central mediators of FA trafficking. The phospholipid:DAG acyltransferase (PDAT) Lro1p has a substantial effect on FA release and on PL equilibrium, emerging as an important mediator in PL remodeling. The acyl-CoA dependent biosynthetic activities of NL metabolism are also involved in PL homeostasis through active modulation of the substrate available for PL synthesis. In addition TAG mobilization makes an important contribution, especially in cells from stationary phase, to FA availability. Beyond its well-established role in the formation of a storage pool, NL metabolism could play a crucial role as a mechanism to uncouple the pools of PL and acyl-CoAs from each other and thereby to allow independent regulation of each one. PMID:23139841

  14. Long-chain fatty acid metabolism in dairy cows: a meta-analysis of milk fatty acid yield in relation to duodenal flows and de novo synthesis.

    PubMed

    Glasser, F; Ferlay, A; Doreau, M; Schmidely, P; Sauvant, D; Chilliard, Y

    2008-07-01

    This study is a meta-analysis of the response of milk long-chain fatty acid (FA) yield and composition to lipid supply, based on published experiments reporting duodenal FA flows or duodenal lipid infusions and milk FA composition (i.e., 39 experiments reporting 139 experimental treatments). Analysis of these data underlined the interdependence between milk yields of C18 and short- and medium-chain (C4 to C16) FA. Lipid supplementation (producing an increase in duodenal C18 flow) decreased linearly milk C4 to C16 yield (-0.26 g of C4 to C16 produced per gram of duodenal C18 flow increase) and increased quadratically milk C18 yield. When these 2 effects increased the percentage of C18 in milk FA up to a threshold value (around 52% of total FA), then milk C18 yield was limited by C4 to C16 yield, decreasing the C18 transfer efficiency from duodenum to milk with high-lipid diets. Moreover, for a given duodenal C18 flow, a decrease in milk C4 to C16 yield induced a decrease in milk C18 yield. Despite high variations in C18 transfer efficiency between duodenum and milk, for a given experimental condition, the percentages of C18 FA in milk total C18 could be predicted from their percentages in duodenal C18, and the percentages at the duodenum and in milk were very similar when mammary desaturation was taken into account (i.e., considering the sums of substrates and products of mammary desaturase). The estimated amounts of 18:0, trans-11-, and trans-13-18:1 desaturated by the mammary gland were a linear function of their mammary uptake, and mammary desaturation was responsible for 80, 95, and 81%, respectively, of the yield of their products (i.e., cis-9-18:1; cis-9, trans-11-, and cis-9, trans-13-18:2). Thus, mammary FA desaturation capacity did not seem to be a limiting factor in the experimental conditions published so far. PMID:18565935

  15. Role of Malic Enzyme during Fatty Acid Synthesis in the Oleaginous Fungus Mortierella alpina

    PubMed Central

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao

    2014-01-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi. PMID:24532075

  16. Chemical Synthesis of Uncommon Natural Bile Acids: The 9α-Hydroxy Derivatives of Chenodeoxycholic and Lithocholic Acids.

    PubMed

    Iida, Takashi; Namegawa, Kazunari; Nakane, Naoya; Iida, Kyoko; Hofmann, Alan Frederick; Omura, Kaoru

    2016-09-01

    The chemical synthesis of the 9α-hydroxy derivatives of chenodeoxycholic and lithocholic acids is reported. For initiating the synthesis of the 9α-hydroxy derivative of chenodeoxycholic acid, cholic acid was used; for the synthesis of the 9α-hydroxy derivative of lithocholic acid, deoxycholic acid was used. The principal reactions involved were (1) decarbonylation of conjugated 12-oxo-Δ(9(11))-derivatives using in situ generated monochloroalane (AlH2Cl) prepared from LiAlH4 and AlCl3, (2) epoxidation of the deoxygenated Δ(9(11))-enes using m-chloroperbenzoic acid catalyzed by 4,4'-thiobis-(6-tert-butyl-3-methylphenol), (3) subsequent Markovnikov 9α-hydroxylation of the Δ(9(11))-enes with AlH2Cl, and (4) selective oxidation of the primary hydroxyl group at C-24 in the resulting 3α,9α,24-triol and 3α,7α,9α,24-tetrol to the corresponding C-24 carboxylic acids using sodium chlorite (NaClO2) in the presence of a catalytic amount of 2,2,6,6-tetramethylpiperidine 1-oxyl free radical (TEMPO) and sodium hypochlorite (NaOCl). The (1)H- and (13)C-NMR spectra are reported. The 3α,7α,9α-trihydroxy-5β-cholan-24-oic acid has been reported to be present in the bile of the Asian bear, and its 7-deoxy derivative is likely to be a bacterial metabolite. These bile acids are now available as authentic reference standards, permitting their identification in vertebrate bile acids. PMID:27319285

  17. Latency, duration and dose response relationships of amino acid effects on human muscle protein synthesis.

    PubMed

    Rennie, Michael J; Bohé, Julien; Wolfe, Robert R

    2002-10-01

    The components of the stimulatory effect of food on net deposition of protein are beginning to be identified and separated. One of the most important of these appears to be the effect of amino acids per se in stimulating muscle anabolism. Amino acids appear to have a linear stimulatory effect within the range of normal diurnal plasma concentrations from postabsorptive to postprandial. Within this range, muscle protein synthesis (measured by incorporation of stable isotope tracers of amino acids into biopsied muscle protein) appears to be stimulated approximately twofold; however, little further increase occurs when very high concentrations of amino acids (>2.5 times the normal postabsorptive plasma concentration) are made available. Amino acids provided in surfeit of the ability of the system to synthesize protein are disposed of by oxidation, ureagenesis and gluconeogenesis. The stimulatory effect of amino acids appears to be time dependent; a square wave increase in the availability of amino acids causes muscle protein synthesis to be stimulated and to fall back to basal values, despite continued amino acid availability. The relationship between muscle protein synthesis and insulin availability suggests that most of the stimulatory effects occur at low insulin concentrations, with large increases having no effect. These findings may have implications for our understanding of the body's requirements for protein. The maximal capacity for storage of amino acids as muscle protein probably sets an upper value on the extent to which amino acids can be stored after a single meal. PMID:12368422

  18. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  19. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  20. Effect of Poliovirus on Deoxyribonucleic Acid Synthesis in HeLa Cells

    PubMed Central

    Ackermann, W. W.; Cox, D. C.; Kurtz, H.; Powers, C. D.; Davies, S. J.

    1966-01-01

    Ackermann, W. W. (University of Michigan, Ann Arbor), D. C. Cox, H. Kurtz, C. D. Powers, and S. J. Davies. Effect of poliovirus on deoxyribonucleic acid synthesis in HeLa cells. J. Bacteriol. 91:1943–1952. 1966.—Both poliovirus and arginine stimulated deoxyribonucleic acid (DNA) synthesis in cultures of HeLa cells which were preconditioned by incubation in a medium deficient in arginine. However, the number of cells producing DNA was unaffected. DNA synthesis in such preconditioned cells was 10 to 20% of the maximal value obtained with a full complement of amino acids. Inhibition of DNA synthesis was produced in these cultures either by increasing the multiplicity of exposure above 40 plaque-forming units of virus per cell or by increasing the concentration of the deficient amino acid at the time of virus addition. Inhibition of DNA synthesis resulted from a reduction in the fraction of cells producing DNA. The concentration of arginine required for viral inhibition of DNA synthesis is greater than that for viral multiplication. PMID:4287076

  1. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The reaction between epoxidized methyl oleate and the multifunctional carboxylic acid, levulinic acid, is shown to give two products of differing chemical reactivity. A branched alpha-hydroxy ester product which is acid stable, and a ketal product, which shows acid cleavability can be formed. The ...

  2. Parallel Chemoenzymatic Synthesis of Sialosides Containing a C5-Diversified Sialic Acid

    PubMed Central

    Cao, Hongzhi; Muthana, Saddam; Li, Yanhong; Cheng, Jiansong; Chen, Xi

    2009-01-01

    A convenient chemoenzymatic strategy for synthesizing sialosides containing a C5-diversified sialic acid was developed. The α2,3- and α2,6-linked sialosides containing a 5-azido neuraminic acid synthesized by a highly efficient one-pot three-enzyme approach were converted to C5″-amino sialosides, which were used as common intermediates for chemical parallel synthesis to quickly generate a series of sialosides containing various sialic acid forms. PMID:19740656

  3. Both FA- and mPEG-conjugated chitosan nanoparticles for targeted cellular uptake and enhanced tumor tissue distribution

    PubMed Central

    2011-01-01

    Both folic acid (FA)- and methoxypoly(ethylene glycol) (mPEG)-conjugated chitosan nanoparticles (NPs) had been designed for targeted and prolong anticancer drug delivery system. The chitosan NPs were prepared with combination of ionic gelation and chemical cross-linking method, followed by conjugation with both FA and mPEG, respectively. FA-mPEG-NPs were compared with either NPs or mPEG-/FA-NPs in terms of their size, targeting cellular efficiency and tumor tissue distribution. The specificity of the mPEG-FA-NPs targeting cancerous cells was demonstrated by comparative intracellular uptake of NPs and mPEG-/FA-NPs by human adenocarcinoma HeLa cells. Mitomycin C (MMC), as a model drug, was loaded to the mPEG-FA-NPs. Results show that the chitosan NPs presented a narrow-size distribution with an average diameter about 200 nm regardless of the type of functional group. In addition, MMC was easily loaded to the mPEG-FA-NPs with drug-loading content of 9.1%, and the drug releases were biphasic with an initial burst release, followed by a subsequent slower release. Laser confocal scanning imaging proved that both mPEG-FA-NPs and FA-NPs could greatly enhance uptake by HeLa cells. In vivo animal experiments, using a nude mice xenograft model, demonstrated that an increased amount of mPEG-FA-NPs or FA-NPs were accumulated in the tumor tissue relative to the mPEG-NPs or NPs alone. These results suggest that both FA- and mPEG-conjugated chitosan NPs are potentially prolonged drug delivery system for tumor cell-selective targeting treatments. PMID:22027239

  4. Visible-light photoredox synthesis of unnatural chiral α-amino acids.

    PubMed

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  5. Visible-light photoredox synthesis of unnatural chiral α-amino acids

    PubMed Central

    Jiang, Min; Jin, Yunhe; Yang, Haijun; Fu, Hua

    2016-01-01

    Unnatural chiral α-amino acids are widely used in fields of organic chemistry, biochemistry and medicinal chemistry, and their synthesis has attracted extensive attention. Although the asymmetric synthesis provides some efficient protocols, noble and elaborate catalysts, ligands and additives are usually required which leads to high cost. Distinctly, it is attractive to make unnatural chiral α-amino acids from readily available natural α-amino acids through keeping of the existing chiral α-carbon. However, it is a great challenge to construct them under mild conditions. In this paper, 83 unnatural chiral α-amino acids were prepared at room temperature under visible-light assistance. The protocol uses two readily available genetically coded proteinogenic amino acids, L-aspartic acid and glutamic acid derivatives as the chiral sources and radical precursors, olefins, alkynyl and alkenyl sulfones, and 2-isocyanobiphenyl as the radical acceptors, and various unnatural chiral α-amino acids were prepared in good to excellent yields. The simple protocol, mild conditions, fast reactions, and high efficiency make the method an important strategy for synthesis of diverse unnatural chiral α-amino acids. PMID:27185220

  6. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  7. Dietary Sugars Stimulate Fatty Acid Synthesis in Adults123

    PubMed Central

    Parks, Elizabeth J.; Skokan, Lauren E.; Timlin, Maureen T.; Dingfelder, Carlus S.

    2008-01-01

    The goal of this study was to determine the magnitude by which acute consumption of fructose in a morning bolus would stimulate lipogenesis (measured by infusion of 13C1-acetate and analysis by GC-MS) immediately and after a subsequent meal. Six healthy subjects [4 men and 2 women; aged (mean ± SD) 28 ± 8 y; BMI, 24.3 ± 2.8 kg/m2; and serum triacylglycerols (TG), 1.03 ± 0.32 mmol/L] consumed carbohydrate boluses of sugars (85 g each) in a random and blinded order, followed by a standardized lunch 4 h later. Subjects completed a control test of glucose (100:0) and a mixture of 50:50 glucose:fructose and one of 25:75 (wt:wt). Following the morning boluses, serum glucose and insulin after 100:0 were greater than both other treatments (P < 0.05) and this pattern occurred again after lunch. In the morning, fractional lipogenesis was stimulated when subjects ingested fructose and peaked at 15.9 ± 5.4% after the 50:50 treatment and at 16.9 ± 5.2% after the 25:75 treatment, values that were greater than after the 100:0 treatment (7.8 ± 5.7%; P < 0.02). When fructose was consumed, absolute lipogenesis was 2-fold greater than when it was absent (100:0). Postlunch, serum TG were 11–29% greater than 100:0 and TG-rich lipoprotein-TG concentrations were 76–200% greater after 50:50 and 25:75 were consumed (P < 0.05). The data demonstrate that an early stimulation of lipogenesis after fructose, consumed in a mixture of sugars, augments subsequent postprandial lipemia. The postlunch blood TG elevation was only partially due to carry-over from the morning. Acute intake of fructose stimulates lipogenesis and may create a metabolic milieu that enhances subsequent esterification of fatty acids flowing to the liver to elevate TG synthesis postprandially. PMID:18492831

  8. Cell Division During Inhibition of Deoxyribonucleic Acid Synthesis in Escherichia coli

    PubMed Central

    Helmstetter, Charles E.; Pierucci, Olga

    1968-01-01

    When cultures of Escherichia coli B/r growing at various rates were exposed to ultraviolet light, mitomycin C, or nalidixic acid, deoxyribonucleic acid (DNA) synthesis stopped but cell division continued for at least 20 min. The chromosome configurations in the cells which divided were estimated by determining the rate of DNA synthesis during the division cycle. The cultures were pulse-labeled with 14C-thymidine, and the amount of label incorporated into cells of different ages was found by measuring the radioactivity in cells born subsequent to the labeling period. The cells which divided in the absence of DNA synthesis were those which had completed a round of chromosome replication prior to the treatments. It was concluded that completion of a round of replication is a necessary and sufficient condition of DNA synthesis for cell division. PMID:4870278

  9. Castor phospholipid:diacylglycerol acyltransferase facilitates efficient metabolism of hydroxy fatty acids in transgenic Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Producing unusual fatty acids (FAs) in crop plants has been a long-standing goal of green chemistry. However, expression of the enzymes that catalyze the primary synthesis of these unusual FAs in transgenic plants typically results in low levels of the desired FA. For example, seed-specific expressi...

  10. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  11. Synthesis and proteinase inhibitory properties of diphenyl phosphonate analogues of aspartic and glutamic acids.

    PubMed

    Hamilton, R; Walker, B; Walker, B J

    1998-07-01

    The synthesis of diphenyl phosphonate analogues of aspartic and glutamic acid, and their inhibitory activity against S. aureus V8 protease and granzyme B, is described. The study has revealed difficulties with protecting group compatibility in the synthesis of these analogues. Two analogues, Acetyl. AspP (OPh)2 and Acetyl.GluP (OPh)2 were found to function as irreversible inactivators of V8 proteinase, yet exhibit no activity against granzyme B. PMID:9873408

  12. Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

    PubMed Central

    Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

    2009-01-01

    In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

  13. Wavelength dependence of mycosporine-like amino acid synthesis in Gyrodinium dorsum.

    PubMed

    Klisch, M; Häder, D-P

    2002-02-01

    The synthesis or accumulation of mycosporine-like amino acids (MAAs) is an important UV tolerance mechanism in aquatic organisms. To investigate the wavelength dependence of MAA synthesis in the marine dinoflagellate Gyrodinium dorsum, the organism was exposed to polychromatic radiation (PAR and UV) from a solar simulator for up to 72 h. Different irradiance spectra were produced by inserting various cut-off filters between lamp and samples. A polychromatic action spectrum for the synthesis of MAA synthesis was constructed. PAR and long wavelength UV-A radiation showed almost no effect while the most effective wavelength range was around 310 nm. Shorter wavelengths where less effective in the induction of MAA synthesis. Wavelengths below 300 nm damaged the organisms severely as indicated by a decrease in chlorophyll a absorption. PMID:11849984

  14. Mechanism of Shope Fibroma Virus-Induced Suppression of Host Deoxyribonucleic Acid Synthesis

    PubMed Central

    Chan, James C.; Hodes, M. E.

    1973-01-01

    The effects of treatment with live or inactivated Shope fibroma virus on host cell deoxyribonucleic acid (DNA) synthesis were determined. The incorporation of 3H-thymidine into nuclear DNA was suppressed by both active and inactivated virus, although live virus was more effective. During the early phase of infection, stimulation of host nuclear DNA synthesis of up to 240% of control value was observed in cells infected with active virus. Inhibition of DNA synthesis began at about the 8th h and was maximal by 12 h postinfection. Virus inactivated by ultraviolet-irradiation or heat treatment did not induce viral DNA synthesis but was, nevertheless, able to suppress host DNA synthesis. PMID:4202660

  15. Receptor-mediated uptake of low density lipoprotein stimulates bile acid synthesis by cultured rat hepatocytes

    SciTech Connect

    Junker, L.H.; Davis, R.A. )

    1989-12-01

    The cellular mechanisms responsible for the lipoprotein-mediated stimulation of bile acid synthesis in cultured rat hepatocytes were investigated. Adding 280 micrograms/ml of cholesterol in the form of human or rat low density lipoprotein (LDL) to the culture medium increased bile acid synthesis by 1.8- and 1.6-fold, respectively. As a result of the uptake of LDL, the synthesis of (14C)cholesterol from (2-14C)acetate was decreased and cellular cholesteryl ester mass was increased. Further studies demonstrated that rat apoE-free LDL and apoE-rich high density lipoprotein (HDL) both stimulated bile acid synthesis 1.5-fold, as well as inhibited the formation of (14C)cholesterol from (2-14C)acetate. Reductive methylation of LDL blocked the inhibition of cholesterol synthesis, as well as the stimulation of bile acid synthesis, suggesting that these processes require receptor-mediated uptake. To identify the receptors responsible, competitive binding studies using 125I-labeled apoE-free LDL and 125I-labeled apoE-rich HDL were performed. Both apoE-free LDL and apoE-rich HDL displayed an equal ability to compete for binding of the other, suggesting that a receptor or a group of receptors that recognizes both apolipoproteins is involved. Additional studies show that hepatocytes from cholestyramine-treated rats displayed 2.2- and 3.4-fold increases in the binding of apoE-free LDL and apoE-rich HDL, respectively. These data show for the first time that receptor-mediated uptake of LDL by the liver is intimately linked to processes activating bile acid synthesis.

  16. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  17. Synthesis of Hydroxymethylenebisphosphonic Acid Derivatives in Different Solvents.

    PubMed

    Nagy, Dávid Illés; Grün, Alajos; Garadnay, Sándor; Greiner, István; Keglevich, György

    2016-01-01

    The syntheses of hydroxymethylenebisphosphonic acid derivatives (dronic acid derivatives) starting from the corresponding substituted acetic acids and P-reagents, mainly phosphorus trichloride and phosphorous acid are surveyed according to the solvents applied. The nature of the solvent is a critical point due to the heterogeneity of the reaction mixtures. This review sheds light on the optimum choice and ratio of the P-reactants, and on the optimum conditions. PMID:27529200

  18. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  19. Molecular Characterization of a Strawberry FaASR Gene in Relation to Fruit Ripening

    PubMed Central

    Jiang, Yue-ming; Zhao, Ming-lei; Shan, Wei; Kuang, Jian-fei; Lu, Wang-jin

    2011-01-01

    Background ABA-, stress- and ripening-induced (ASR) proteins have been reported to act as a downstream component involved in ABA signal transduction. Although much attention has been paid to the roles of ASR in plant development and stress responses, the mechanisms by which ABA regulate fruit ripening at the molecular level are not fully understood. In the present work, a strawberry ASR gene was isolated and characterized (FaASR), and a polyclonal antibody against FaASR protein was prepared. Furthermore, the effects of ABA, applied to two different developmental stages of strawberry, on fruit ripening and the expression of FaASR at transcriptional and translational levels were investigated. Methodology/Principal Findings FaASR, localized in the cytoplasm and nucleus, contained 193 amino acids and shared common features with other plant ASRs. It also functioned as a transcriptional activator in yeast with trans-activation activity in the N-terminus. During strawberry fruit development, endogenous ABA content, levels of FaASR mRNA and protein increased significantly at the initiation of ripening at a white (W) fruit developmental stage. More importantly, application of exogenous ABA to large green (LG) fruit and W fruit markedly increased endogenous ABA content, accelerated fruit ripening, and greatly enhanced the expression of FaASR transcripts and the accumulation of FaASR protein simultaneously. Conclusions These results indicate that FaASR may be involved in strawberry fruit ripening. The observed increase in endogenous ABA content, and enhanced FaASR expression at transcriptional and translational levels in response to ABA treatment might partially contribute to the acceleration of strawberry fruit ripening. PMID:21915355

  20. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  1. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  2. Protein labeling with the labeling precursor [(18)F]SiFA-SH for positron emission tomography.

    PubMed

    Wängler, Björn; Kostikov, Alexey P; Niedermoser, Sabrina; Chin, Joshua; Orchowski, Katy; Schirrmacher, Esther; Iovkova-Berends, Liuba; Jurkschat, Klaus; Wängler, Carmen; Schirrmacher, Ralf

    2012-11-01

    Proteins previously derivatized with the cross-coupling reagent sulfo-SMCC (4-(N-maleimidomethyl)cyclohexane-1-carboxylic acid 3-sulfo-N-hydroxy-succinimide ester sodium salt) can be easily labeled in high radiochemical yields with the silicon-fluoride acceptor (SiFA) reagent [(18)F]SiFA-SH, obtained via isotopic exchange, by thiol-maleimide coupling chemistry (n = 10). The specific activity of SiFA-SH obtained in a one-step labeling reaction was > 18.5 GBq μmol(-1) (> 500 Ci mmol(-1)). The number of SiFA building blocks per protein molecule is defined by the previously introduced number of maleimide groups, which can be determined by a simple and convenient Ellman's assay. Not more than two maleimide groups are introduced using sulfo-SMCC, thereby keeping the modification of the protein low and preserving its biological activity. PMID:23037311

  3. Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...

  4. The prebiotic synthesis of amino acids - interstellar vs. atmospheric mechanisms

    NASA Astrophysics Data System (ADS)

    Meierhenrich, U. J.; Muñoz Caro, G. M.; Schutte, W. A.; Barbier, B.; Arcones Segovia, A.; Rosenbauer, H.; Thiemann, W. H.-P.; Brack, A.

    2002-11-01

    Until very recently, prebiotic amino acids were believed to have been generated in the atmosphere of the early Earth, as successfully simulated by the Urey-Miller experiments. Two independent studies now identified ice photochemistry in the interstellar medium as a possible source of prebiotic amino acids. Ultraviolet irradiation of ice mixtures containing identified interstellar molecules (such as H2O, CO2, CO, CH3OH, and NH3) in the conditions of vacuum and low temperature found in the interstellar medium generated amino acid structures including glycine, alanine, serine, valine, proline, and aspartic acid. After warmup, hydrolysis and derivatization, our team was able to identify 16 amino acids as well as furans and pyrroles. Enantioselective analyses of the amino acids showed racemic mixtures. A prebiotic interstellar origin of amino acid structures is now discussed to be a plausible alternative to the Urey-Miller mechanism.

  5. Synthesis of new optically active propargylic fluorides and application to the enantioselective synthesis of monofluorinated analogues of fatty acid metabolites.

    PubMed

    Prakesch, M; Grée, D; Grée, R

    2001-05-01

    A new approach to obtain optically active unsaturated or polyunsaturated systems with a single fluorine atom in an allylic or propargylic position is reported. Central to this strategy is the high regio- and stereocontrol observed during the fluorination of propargylic alcohols allowing a short and efficient synthesis of 1. Further, simple functional group transformations gave the enals 2 and 3. These three key intermediates were used for the preparation of optically active monofluorinated analogues of fatty acid metabolites. PMID:11325281

  6. Effect of the “Ribonucleic Acid Control” Locus in Escherichia coli on T4 Bacteriophage-Specific Ribonucleic Acid Synthesis

    PubMed Central

    Sköld, Ola

    1970-01-01

    Amino acid control of ribonucleic acid (RNA) synthesis in bacteria is known to be governed genetically by the rel locus. We investigated whether the rel gene of the host would also exert its effect on the regulation of phage-specific RNA synthesis in T4 phage-infected Escherichia coli cells. Since T-even phage infection completely shuts off host macromolecular synthesis, phage RNA synthesis could be followed specifically by the cumulative incorporation of radioactivity from labeled precursors into RNA of infected cells. Labeled uracil was shown to accumulate in phage-specific RNA for 30 to 35 min after infection, a phenomenon which probably reflects an expansion of the labile phage-RNA pool. Amino acid starvation was effected by the use of auxotrophic bacterial strains or thienylalanine. The latter substance is an amino acid analogue which induces a chemical auxotrophy by inhibiting the biosynthesis of phenylalanine, tyrosine, and tryptophan. Phage RNA synthesis was strictly dependent on the presence of amino acids, whereas phage deoxyribonucleic acid synthesis was not. By the use of several pairs of bacterial strains which were isogenic except for the rel gene, it was demonstrated that amino acid dependence was related to the allelic state of this gene. If the rel gene was mutated, amino acid starvation did not restrict phage RNA synthesis. PMID:4914097

  7. Synthesis and antimycobacterial evaluation of new trans-cinnamic acid hydrazide derivatives.

    PubMed

    Carvalho, Samir A; da Silva, Edson F; de Souza, Marcus V N; Lourenço, Maria C S; Vicente, Felipe R

    2008-01-15

    In this work, we report the synthesis and the antimycobacterial evaluation of new trans-cinnamic acid derivatives of isonicotinic acid series (5) and benzoic acid series (6), designed by exploring the molecular hybridization approach between isoniazid (1) and trans-cinnamic acid derivative (3). The minimum inhibitory concentration (MIC) of the compounds 5a-d and 6c exhibited activity between 3.12 and 12.5 microg/mL and could be a good start point to find new lead compounds against multi-drug resistant tuberculosis. PMID:18068364

  8. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  9. Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

  10. Stimulation of muscle protein synthesis by prolonged parenteral infusion of leucine is dependent on amino acid availability in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....

  11. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  12. GPM Video of In-fa

    NASA Video Gallery

    On Nov. 23, GPM saw In-fa dropping rain at an extreme rate of over 266 mm (10.5 inches) per hour in storms just to the northwest of the typhoon's eye where thunderstorms reached altitudes of over 1...

  13. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  14. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials. PMID:27482849

  15. Selectivity of Candida antarctica B lipase toward fatty acid and (Iso)propanol substrates in esterification reactions in organic media.

    PubMed

    Arsan, J; Parkin, K L

    2000-08-01

    Fatty acid (FA) selectivity of immobilized Candida antarctica B lipase was assessed as influenced by various cosubstrate systems for ester synthesis. Reaction mixtures contained a homologous series of even-chain n-acyl donor (C(4)(-)(16)) substrates (FA or their methyl esters, FAME) and a single alcohol cosubstrate (propanol, 2-propanol, or their acetate derivatives) in hexane. Multiple FA optima were often observed, with preferences for C(6) (or C(4)) followed by C(14) and sometimes C(10). The degree of selectivity among acyl donors was modest (up to 1.28-2.60, based on ratios of selectivity constants) and was dependent on the choice of cosubstrate system. Acyl group selectivity ranged up to 1.31-1.36 for [FA + alcohol], 1. 48-2.60 for [FAME + alcohol], 1.30-1.72 for [FA + alcohol acetate], and 1.28-1.88 [FAME + alcohol acetate] reaction systems. General shifts in selectivity were observed between short-chain (C(4)(-)(8)) and long-chain (C(10)(-)(16)) FA as groups with propanol cosubstrate, whereas shifts in reaction selectivity were observed toward specific FA(s) for 2-propanol cosubstrate. Selectivity among a series of alcohol cosubstrates ranged up to 13-fold in esterification reactions with C(6) FA. PMID:10956180

  16. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  17. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  18. EFFECTS OF ETHYLENE CHLOROHYDRIN ON FATTY ACID SYNTHESIS

    EPA Science Inventory

    Male chicks weighing 700 to 900 g. received an acute or eight doses IG of 60 or 40 mg/kg ethylene chlorohydrin (ECH) respectively and were sacrificed eighteen hours after the last dose. Mitochondrial elongation of fatty acids was decreased significantly while fatty acid synthetas...

  19. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  20. EFFECT OF LEAD ON GAMMA AMINO BUTYRIC ACID SYNTHESIS

    EPA Science Inventory

    The project studies the inhibitory effect of lead on the enzymatic activity of brain glutamic amino acid decarboxylase (GADC). The enzyme is responsible for the catalytic formation of gamma amino butyric acid (GABA) inhibitory neurons which is believed to be involved with the tra...

  1. Synthesis and characterization of hydrogen-bond acidic functionalized graphene

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Han, Qiang; Pan, Yong; Cao, Shuya; Ding, Mingyu

    2014-05-01

    Hexafluoroisopropanol phenyl group functionalized materials have great potential in the application of gas-sensitive materials for nerve agent detection, due to the formation of strong hydrogen-bonding interactions between the group and the analytes. In this paper, take full advantage of ultra-large specific surface area and plenty of carbon-carbon double bonds and hexafluoroisopropanol phenyl functionalized graphene was synthesized through in situ diazonium reaction between -C=C- and p-hexafluoroisopropanol aniline. The identity of the as-synthesis material was confirmed by transmission electron microscopy, Raman spectroscopy, ultraviolet visible spectroscopy, X-ray photoelectron spectroscopy and thermo gravimetric analysis. The synthesis method is simply which retained the excellent physical properties of original graphene. In addition, the novel material can be assigned as an potential candidate for gas sensitive materials towards organophosphorus nerve agent detection.

  2. Stimulation of muscle protein synthesis by leucine is dependent on plasma amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that a physiological increase in plasma leucine increased translation initiation factor activity during 60- and 120-min leucine infusion. Muscle protein synthesis was stimulated at 60 min but not at 120 min, perhaps due to the decrease (-50%) in plasma essential amino acids (AA). ...

  3. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  4. Tandem Ru-alkylidene-catalysed cross metathesis/hydrogenation: synthesis of lipophilic amino acids.

    PubMed

    Wang, Zhen J; Spiccia, Nicolas D; Jackson, W Roy; Robinson, Andrea J

    2013-08-01

    Highly efficient synthesis of lipidic amino acids can be achieved via Ru-alkylidene-catalysed cross metathesis of long chain alkenes with commercially available allylglycine. The resultant unsaturated analogues can be then optionally hydrogenated under mild reaction conditions by using the spent metathesis catalyst. PMID:23733491

  5. One-Pot Synthesis of Arylketones from Aromatic Acids via Palladium-Catalyzed Suzuki Coupling.

    PubMed

    Wu, Hongxiang; Xu, Baiping; Li, Yue; Hong, Fengying; Zhu, Dezhao; Jian, Junsheng; Pu, Xiaoer; Zeng, Zhuo

    2016-04-01

    A palladium-catalyzed one-pot procedure for the synthesis of aryl ketones has been developed. Triazine esters when coupled with aryl boronic acids provided aryl ketones in moderate to excellent yields (up to 95%) in the presence of 1 mol % Pd(PPh3)2Cl2 for 30 min. PMID:26949103

  6. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  7. Synthesis and bioactivity of novel caffeic acid esters from Zuccagnia punctata.

    PubMed

    Ramachandra, M S; Subbaraju, G V

    2006-12-01

    Synthesis of novel caffeic acid esters (1 and 2) was accomplished starting from appropriately substituted benzaldehydes (3 and 9). While compound 2 exhibited potent anti-oxidative activity in both the nitroblue tetrazolium and 1,1-diphenyl-2-picrylhydrazyl radical-scavenging models, compound 1 showed moderate 5-lipoxygenase inhibitory activity. PMID:17145655

  8. Templated synthesis of nylon nucleic acids and characterization by nuclease digestion

    PubMed Central

    Liu, Yu; Wang, Risheng; Ding, Liang; Sha, Roujie

    2012-01-01

    Nylon nucleic acids containing oligouridine nucleotides with pendent polyamide linkers and flanked by unmodified heteronucleotide sequences were prepared by DNA templated synthesis. Templation was more efficient than the single-stranded synthesis: Coupling step yields were as high as 99.2%, with up to 7 amide linkages formed in the synthesis of a molecule containing 8 modified nucleotides. Controlled digestion by calf spleen phosphodiesterase enabled the mapping of modified nucleotides in the sequences. A combination of complete degradation of nylon nucleic acids by snake venom phosphodiesterase and dephosphorylation of the resulting nucleotide fragments by bacterial alkaline phosphatase, followed by LCMS analysis, clarified the linear structure of the oligo-amide linkages. The templated synthesis strategy afforded nylon nucleic acids in the target structure and was compatible with the presence heteronucleotides. The complete digestion procedure produced a new species of DNA analogues, nylon ribonucleosides, which display nucleosides attached via a 2′-alkylthio linkage to each diamine and dicarboxylate repeat unit of the original nylon nucleic acids. The binding affinity of a nylon ribonucleoside octamer to the complementary DNA was evaluated by thermal denaturing experiments. The octamer was found to form stable duplexes with an inverse dependence on salt concentration, in contrast to the salt-dependent DNA control. PMID:23125913

  9. Insulin and amino acids stimulate whole body protein synthesis in neonates

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Insulin and amino acids (AA) stimulate muscle protein synthesis in neonatal pigs. To determine the effects of insulin and AA on whole body protein turnover, hyperinsulinemic (0 and 100 ng/(kg[0.66]/min))-euglycemic-AA clamps were performed during euaminoacidemia or hyperaminoacidemia in fasted 7-d-...

  10. Synthesis of selenium-containing amino acid analogues and their biological study.

    PubMed

    Abdel-Hafez, S H; Saad, H A; Aly, M R E

    2011-01-01

    Synthesis of selenium-containing amino acid analogues is described. These compounds were prepared in a concise and short synthetic route in good yields by nucleophilic substitution reaction of pyridineselenol and quinolineselenol derivatives with N-phthaloylglycyl chloride followed by hydrazinolysis. The newly synthesized compounds were screened against different strains of bacteria and fungi. PMID:21899043

  11. Hydroxy fatty acid synthesis and lipid gene expression during seed development in Lesquerella fendleri (L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella fendleri is a developing oilseed crop in U.S. Its seed oil is rich in hydroxy fatty acid (HFA), lesquerolate (C20:1OH), suitable as a raw material for many industrial applications. To understand regulatory mechanism underlying synthesis and accumulation of the lesquerolate, we have inves...

  12. De novo fatty acid synthesis at the mitotic exit is required to complete cellular division

    PubMed Central

    Scaglia, Natalia; Tyekucheva, Svitlana; Zadra, Giorgia; Photopoulos, Cornelia; Loda, Massimo

    2014-01-01

    Although the regulation of the cell cycle has been extensively studied, much less is known about its coordination with the cellular metabolism. Using mass spectrometry we found that lysophospholipid levels decreased drastically from G2/M to G1 phase, while de novo phosphatidylcholine synthesis, the main phospholipid in mammalian cells, increased, suggesting that enhanced membrane production was concomitant to a decrease in its turnover. In addition, fatty acid synthesis and incorporation into membranes was increased upon cell division. The rate-limiting reaction for de novo fatty acid synthesis is catalyzed by acetyl-CoA carboxylase. As expected, its inhibiting phosphorylation decreased prior to cytokinesis initiation. Importantly, the inhibition of fatty acid synthesis arrested the cells at G2/M despite the presence of abundant fatty acids in the media. Our results suggest that de novo lipogenesis is essential for cell cycle completion. This “lipogenic checkpoint” at G2/M may be therapeutically exploited for hyperproliferative diseases such as cancer. PMID:24418822

  13. Synthesis of polyacrylic-acid-based thermochromic polymers

    NASA Astrophysics Data System (ADS)

    Srivastava, Jyoti; Alam, Sarfaraz; Mathur, G. N.

    2003-10-01

    Smart materials respond to environmental stimuli with particular changes in some variables (for example temperature, pressure and electric field etc), for that reason they are often called responsive materials. In the present work, we have synthesized thermochromic polymer based on poly acrylic acid cobalt chloride (CoCl2) and phosphoric acid (H3PO4) that visually and reversibly changes color in the temperature range (70 - 130°C). These thermochromic materials can be used as visual sensors of temperature. Thermochromic polymers are based on polyacrylic acid and CoCl2 complex.

  14. Induction of cellular deoxyribonucleic acid synthesis in butyrate-treated cells by simian virus 40 deoxyribonucleic acid

    SciTech Connect

    Kawasaki, S.; Diamond, L.; Baserga, R.

    1981-11-01

    Sodium butyrate (3mM) inhibited the entry into the S phase of quiescent 3T3 cells stimulated by serum, but had no effect on the accumulation of cellular ribonucleic acid. Simian virus 40 infection or manual microinjection of cloned fragments from the simian virus 40 A gene caused quiescent 3T3 cells to enter the S phase even in the presence of butyrate. NGI cells, a line of 3T3 cells transformed by simian virus 40, grew vigorously in 3 mM butyrate. Homokaryons were formed between G/sub 1/ and S-phase 3T3 cells. Butyrate inhibited the induction of deoxyribonucleic acid synthesis that usually occurs in G/sub 1/ nuclei when G/sub 1/ cells are fused with S-phase cells. However, when G/sub 1/ 3T3 cells were fused with exponentially growing NGI cells, the 3T3 nuclei were induced to enter deoxyribonucleic acid synthesis. In tsAF8 cells, a ribonucleic acid polymerase II mutant that stops in the G/sub 1/ phase of the cell cycle, no temporal sequence was demonstrated between the butyrate block and the temperature-sensitive block. These results confirm previous reports that certain virally coded proteins can induce cell deoxyribonucleic acid synthesis in the absence of cellular functions that are required by serum-stimulated cells. The author's interpretation of these data is that butyrate inhibited cell growth by inhibiting the expression of genes required for the G/sub o/ ..-->.. G/sub 1/ ..-->.. S transition and that the product of the simian virus 40 A gene overrode this inhibition by providing all of the necessary functions for the entry into the S phase.

  15. Synthesis and biological evaluation of novel lipoamino acid derivatives.

    PubMed

    Kaki, Shiva Shanker; Arukali, Sammaiah; Korlipara, Padmaja V; Prasad, R B N; Yedla, Poornachandra; Ganesh Kumar, C

    2016-01-01

    Seven novel lipoamino acid conjugates were synthesized from methyl oleate and amino acids. Methyl oleate was grafted to different amino acids using thioglycolic acid as a spacer group. Seven derivatives (3a-g) were prepared and characterized by spectral data (NMR, IR and MS spectral studies). All the derivatives were studied for their antimicrobial, anti-biofilm and anticancer activities. Among all the derivatives, it was found that compound 3b was the most potent antibacterial compound which showed good activity against four Gram positive bacterial strains and also exhibited excellent antifungal activity against a fungal strain. In the anti-biofilm assay, compound 3b showed promising activity with IC50 value of 2.8μM against Bacillus subtilis MTCC 121. All the compounds showed anticancer activities with 3c showing promising anticancer activity (IC50=15.3-22.4μM) against the four cell lines tested. PMID:26586599

  16. Synthesis and Functionalization of Cyclic Sulfonimidamides: A Novel Chiral Heterocyclic Carboxylic Acid Bioisostere

    PubMed Central

    2012-01-01

    An efficient synthesis of aryl substituted cyclic sulfonimidamides designed as chiral nonplanar heterocyclic carboxylic acid bioisosteres is described. The cyclic sulfonimidamide ring system could be prepared in two steps from a trifluoroacetyl protected sulfinamide and methyl ester protected amino acids. By varying the amino acid, a range of different C-3 substituted sulfonimidamides could be prepared. The compounds could be further derivatized in the aryl ring using standard cross-coupling reactions to yield highly substituted cyclic sulfonimidamides in excellent yields. The physicochemical properties of the final compounds were examined and compared to those of the corresponding carboxylic acid and tetrazole derivatives. The unique nonplanar shape in combination with the relatively strong acidity (pKa 5–6) and the ease of modifying the chemical structure to fine-tune the physicochemical properties suggest that this heterocycle can be a valuable addition to the range of available carboxylic acid isosteres. PMID:24900513

  17. Synthesis of a bicyclic delta-amino acid as a constrained Gly-Asn dipeptide isostere.

    PubMed

    Trabocchi, A; Menchi, G; Danieli, E; Guarna, A

    2008-06-01

    Delta-amino acids are very attractive in drug discovery, especially in the peptidomimetic area, because of their capability to act as dipeptide isosteres and reverse turn mimetics. Herein we report the synthesis of a rigid delta-amino acid constrained by a 3-aza-6,8-dioxabicyclo[3.2.1]octane-based scaffold, which can be considered as a Gly-Asn dipeptide mimetic. Key steps are the condensation of glycidol and tartaric acid derivatives, and the intramolecular trans-acetalization of the oxidized adduct to give the bicyclic delta-amino acid. Starting from L-tartaric acid derivative, it was achieved the corresponding Gly-D-Asn isostere, whereas from the enantiomeric D-tartaric acid derivative the corresponding Gly-L-Asn isostere could be obtained, thus giving access to both enantiomeric dipeptide sequences. PMID:18235990

  18. Synthesis and properties of coumaric acid derivative homo-polymers.

    PubMed

    Thi, Tran Hang; Matsusaki, Michiya; Shi, Dongjian; Kaneko, Tatsuo; Akashi, Mitsuru

    2008-01-01

    Poly(4-hydroxycinnamic acid) (P4HCA), poly(3-hydroxycinnamic acid) (P3HCA), poly(3-methoxy-4-hydroxycinnamic acid) (PMHCA) and poly(3,4-dihydroxycinnamic acid) (PDHCA) were synthesized by the thermal poly-condensation of the corresponding monomers, which are lignin precursors, coumaric acid derivatives consisting of cinnamoyl groups and different position and number of OH groups. The solubility of the homo-polymers in organic solvents decreased in the order of P3HCA > PDHCA > P4HCA > PMHCA. The wide angle X-ray diffraction (WAXD) results indicated that P4HCA or PMHCA with p-OH group had higher crystallinity, in contrast to P3HCA or PDHCA with m-OH group which had lower crystallinity. Crossed-polarizing microscopy suggested that P4HCA had the nematic liquid crystal properties at 220 degrees C and PDHCA showed birefringence properties at 200 degrees C. In cell-adhesion tests, PDHCA showed the highest cell adhesion (ca. 70%), whereas P3HCA, P4HCA and PMHCA had 50, 18 and 10% cell adhesion, respectively. The coumaric acid derivative homo-polymers can be useful as cell adhesion controllable thermotropic polymers for biomedical and environmental fields. PMID:18177555

  19. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  20. Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli.

    PubMed

    Howard, Thomas P; Middelhaufe, Sabine; Moore, Karen; Edner, Christoph; Kolak, Dagmara M; Taylor, George N; Parker, David A; Lee, Rob; Smirnoff, Nicholas; Aves, Stephen J; Love, John

    2013-05-01

    Biofuels are the most immediate, practical solution for mitigating dependence on fossil hydrocarbons, but current biofuels (alcohols and biodiesels) require significant downstream processing and are not fully compatible with modern, mass-market internal combustion engines. Rather, the ideal biofuels are structurally and chemically identical to the fossil fuels they seek to replace (i.e., aliphatic n- and iso-alkanes and -alkenes of various chain lengths). Here we report on production of such petroleum-replica hydrocarbons in Escherichia coli. The activity of the fatty acid (FA) reductase complex from Photorhabdus luminescens was coupled with aldehyde decarbonylase from Nostoc punctiforme to use free FAs as substrates for alkane biosynthesis. This combination of genes enabled rational alterations to hydrocarbon chain length (Cn) and the production of branched alkanes through upstream genetic and exogenous manipulations of the FA pool. Genetic components for targeted manipulation of the FA pool included expression of a thioesterase from Cinnamomum camphora (camphor) to alter alkane Cn and expression of the branched-chain α-keto acid dehydrogenase complex and β-keto acyl-acyl carrier protein synthase III from Bacillus subtilis to synthesize branched (iso-) alkanes. Rather than simply reconstituting existing metabolic routes to alkane production found in nature, these results demonstrate the ability to design and implement artificial molecular pathways for the production of renewable, industrially relevant fuel molecules. PMID:23610415

  1. Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli

    PubMed Central

    Howard, Thomas P.; Middelhaufe, Sabine; Moore, Karen; Edner, Christoph; Kolak, Dagmara M.; Taylor, George N.; Parker, David A.; Lee, Rob; Smirnoff, Nicholas; Aves, Stephen J.; Love, John

    2013-01-01

    Biofuels are the most immediate, practical solution for mitigating dependence on fossil hydrocarbons, but current biofuels (alcohols and biodiesels) require significant downstream processing and are not fully compatible with modern, mass-market internal combustion engines. Rather, the ideal biofuels are structurally and chemically identical to the fossil fuels they seek to replace (i.e., aliphatic n- and iso-alkanes and -alkenes of various chain lengths). Here we report on production of such petroleum-replica hydrocarbons in Escherichia coli. The activity of the fatty acid (FA) reductase complex from Photorhabdus luminescens was coupled with aldehyde decarbonylase from Nostoc punctiforme to use free FAs as substrates for alkane biosynthesis. This combination of genes enabled rational alterations to hydrocarbon chain length (Cn) and the production of branched alkanes through upstream genetic and exogenous manipulations of the FA pool. Genetic components for targeted manipulation of the FA pool included expression of a thioesterase from Cinnamomum camphora (camphor) to alter alkane Cn and expression of the branched-chain α-keto acid dehydrogenase complex and β-keto acyl-acyl carrier protein synthase III from Bacillus subtilis to synthesize branched (iso-) alkanes. Rather than simply reconstituting existing metabolic routes to alkane production found in nature, these results demonstrate the ability to design and implement artificial molecular pathways for the production of renewable, industrially relevant fuel molecules. PMID:23610415

  2. Synthesis of novel conjugates of a saccharide, amino acids, nucleobase and the evaluation of their cell compatibility.

    PubMed

    Yuan, Dan; Du, Xuewen; Shi, Junfeng; Zhou, Ning; Baoum, Abdulgader Ahmed; Xu, Bing

    2014-01-01

    This article reports the synthesis of a novel type of conjugate of three fundamental biological build blocks (i.e., saccharide, amino acids, and nucleobase) and their cell compatibility. The facile synthesis starts with the synthesis of nucleobase and saccharide derivatives, then uses solid-phase peptide synthesis (SPPS) to build the peptide segment (Phe-Arg-Gly-Asp or naphthAla-Phe-Arg-Gly-Asp with fully protected groups), and later, an amidation reaction in liquid phase connects these three parts together. The overall yield of these multiple step synthesis is about 34%. Besides exhibiting excellent solubility, these conjugates of saccharide-amino acids-nucleobase (SAN), like the previously reported conjugates of nucleobase-amino acids-saccharide (NAS) and nucleobase-saccharide-amino acids (NSA), are mammalian cell compatible. PMID:25383110

  3. Synthesis of phosphoramidites of isoGNA, an isomer of glycerol nucleic acid

    PubMed Central

    Kim, Keunsoo; Punna, Venkateshwarlu; Karri, Phaneendrasai

    2014-01-01

    Summary IsoGNA, an isomer of glycerol nucleic acid GNA, is a flexible (acyclic) nucleic acid with bases directly attached to its linear backbone. IsoGNA exhibits (limited) base-pairing properties which are unique compared to other known flexible nucleic acids. Herein, we report on the details of the preparation of isoGNA phosphoramidites and an alternative route for the synthesis of the adenine derivative. The synthetic improvements described here enable an easy access to isoGNA and allows for the further exploration of this structural unit in oligonucleotide chemistry thereby spurring investigations of its usefulness and applicability. PMID:25246971

  4. Tunable and Diastereoselective Brønsted Acid Catalyzed Synthesis of β-Enaminones.

    PubMed

    Kang, Ye-Won; Cho, Yu Jin; Han, Seung Jin; Jang, Hye-Young

    2016-01-15

    The Brønsted acid catalyzed Meyer-Schuster reaction of hemiaminals was studied for the stereoselective synthesis of β-enaminones. Hemiaminals were formed from propargyl aldehydes (or the oxidation of propargyl alcohols) and amines in the presence of Brønsted acids. A critical step to control the stereochemistry of the products is the protonation of the corresponding allenol intermediate, which is dictated by the Brønsted acid used, the steric effect of the amine, and the electronic effect of the propargyl aldehyde. PMID:26741050

  5. Chemoenzymatic synthesis of CMP-N-acetyl-7-fluoro-7-deoxy-neuraminic acid.

    PubMed

    Hartlieb, Sina; Günzel, Almut; Gerardy-Schahn, Rita; Münster-Kühnel, Anja K; Kirschning, Andreas; Dräger, Gerald

    2008-08-11

    7-Fluoro sialic acid was prepared and activated as cytidine monophosphate (CMP) ester. The synthesis started with d-glucose, which was efficiently converted into N-acetyl-4-fluoro-4-deoxy-d-mannosamine. Aldolase catalyzed transformation yielded the corresponding fluorinated sialic acid which was activated as CMP ester using three different synthetases in the presence as well as in the absence of pyrophosphatase which possesses inhibitory properties. Finally, conditions were optimized to perform a one-pot reaction starting from fluorinated mannosamine, which yielded the 7-fluoro-7-deoxy-CMP-sialic acid by incubation with three enzymes. PMID:18353292

  6. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  7. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases. PMID:25282359

  8. Nature's Starships: Amino Acid Synthesis, Frequency, and Delivery to Earth via Meteorites

    NASA Astrophysics Data System (ADS)

    Cobb, Alyssa; Pudritz, Ralph

    2013-07-01

    Understanding the origin of organic molecules on Earth is vital to our understanding of the origins of life. One proposed mechanism for the introduction of organic material to our planet is via meteorite impacts. Meteoritic parent bodies contain organic material and water ice, which, given radionuclide decay in their interiors, cause the ice to melt and the parent bodies to undergo a process called aqueous alteration. An example of this internal chemistry is Strecker synthesis, a process resulting in the production of various amino acids. Our work summarizes recent discoveries regarding amino acid synthesis and concentration data. We present the amino acid concentrations collated from a variety of meteorites (~20) covering a range of meteorite classes. We can use the dependence of amino acid frequency on variables such as temperature and pressure to model Strecker synthesis inside a theoretical parent body. Our modeling software takes a set of chemical species and outputs their relative frequencies based on a minimization of their Gibbs free energies. The goal of this work is to predict and quantify the presence of amino acids on a foreign landscape using thermodynamic principles.

  9. Templated synthesis of peptide nucleic acids via sequence-selective base-filling reactions.

    PubMed

    Heemstra, Jennifer M; Liu, David R

    2009-08-19

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  10. Templated Synthesis of Peptide Nucleic Acids via Sequence-Selective Base-Filling Reactions

    PubMed Central

    2009-01-01

    The templated synthesis of nucleic acids has previously been achieved through the backbone ligation of preformed nucleotide monomers or oligomers. In contrast, here we demonstrate templated nucleic acid synthesis using a base-filling approach in which individual bases are added to abasic sites of a peptide nucleic acid (PNA). Because nucleobase substrates in this approach are not self-reactive, a base-filling approach may reduce the formation of nontemplated reaction products. Using either reductive amination or amine acylation chemistries, we observed efficient and selective addition of each of the four nucleobases to an abasic site in the middle of the PNA strand. We also describe the addition of single nucleobases to the end of a PNA strand through base filling, as well as the tandem addition of two bases to the middle of the PNA strand. These findings represent an experimental foundation for nonenzymatic information transfer through base filling. PMID:19722647

  11. Acidosis Drives the Reprogramming of Fatty Acid Metabolism in Cancer Cells through Changes in Mitochondrial and Histone Acetylation.

    PubMed

    Corbet, Cyril; Pinto, Adán; Martherus, Ruben; Santiago de Jesus, João Pedro; Polet, Florence; Feron, Olivier

    2016-08-01

    Bioenergetic preferences of cancer cells foster tumor acidosis that in turn leads to dramatic reduction in glycolysis and glucose-derived acetyl-coenzyme A (acetyl-CoA). Here, we show that the main source of this critical two-carbon intermediate becomes fatty acid (FA) oxidation in acidic pH-adapted cancer cells. FA-derived acetyl-CoA not only fuels the tricarboxylic acid (TCA) cycle and supports tumor cell respiration under acidosis, but also contributes to non-enzymatic mitochondrial protein hyperacetylation, thereby restraining complex I activity and ROS production. Also, while oxidative metabolism of glutamine supports the canonical TCA cycle in acidic conditions, reductive carboxylation of glutamine-derived α-ketoglutarate sustains FA synthesis. Concomitance of FA oxidation and synthesis is enabled upon sirtuin-mediated histone deacetylation and consecutive downregulation of acetyl-CoA carboxylase ACC2 making mitochondrial fatty acyl-CoA degradation compatible with cytosolic lipogenesis. Perturbations of these regulatory processes lead to tumor growth inhibitory effects further identifying FA metabolism as a critical determinant of tumor cell proliferation under acidosis. PMID:27508876

  12. Multiple inputs control sulfur-containing amino acid synthesis in Saccharomyces cerevisiae

    PubMed Central

    Sadhu, Meru J.; Moresco, James J.; Zimmer, Anjali D.; Yates, John R.; Rine, Jasper

    2014-01-01

    In Saccharomyces cerevisiae, transcription of the MET regulon, which encodes the proteins involved in the synthesis of the sulfur-containing amino acids methionine and cysteine, is repressed by the presence of either methionine or cysteine in the environment. This repression is accomplished by ubiquitination of the transcription factor Met4, which is carried out by the SCF(Met30) E3 ubiquitin ligase. Mutants defective in MET regulon repression reveal that loss of Cho2, which is required for the methylation of phosphatidylethanolamine to produce phosphatidylcholine, leads to induction of the MET regulon. This induction is due to reduced cysteine synthesis caused by the Cho2 defects, uncovering an important link between phospholipid synthesis and cysteine synthesis. Antimorphic mutants in S-adenosyl-methionine (SAM) synthetase genes also induce the MET regulon. This effect is due, at least in part, to SAM deficiency controlling the MET regulon independently of SAM's contribution to cysteine synthesis. Finally, the Met30 protein is found in two distinct forms whose relative abundance is controlled by the availability of sulfur-containing amino acids. This modification could be involved in the nutritional control of SCF(Met30) activity toward Met4. PMID:24648496

  13. Contributions of de novo synthesis of fatty acids to total VLDL-triglyceride secretion during prolonged hyperglycemia/hyperinsulinemia in normal man.

    PubMed Central

    Aarsland, A; Chinkes, D; Wolfe, R R

    1996-01-01

    Triglycerides (TG) are synthesized in the liver principally from two sources of fatty acids (FA): FA synthesized de novo in the liver and preformed FA. We have measured the rate of secretion of de novo synthesized FA and total secretion of FA bound to VLDL-TG in healthy men (n = 5) in the basal state, and after 1 (day 1) and 4 d (day 4) of a hypercaloric carbohydrate diet (approximately 2.5 times energy expenditure) that generated a moderate endogenous hyperinsulinemia (plasma insulin approximately 60 microU/ml). Prolonged carbohydrate hyperalimentation/hyperinsulinemia increased plasma VLDL-TG approximately 10-fold in part due to a 3.4-fold increase in total VLDL-TG secretion rate (basal state = 72+/-23, day 4 = 242+/-78 micromol TG/kg/d). Although the secretion of de novo synthesized FA increased throughout the study (basal state = 1.1+/-0.4, day 1 = 15.9+/-7.9, day 4 = 50.0+/-18.8 micromol TG/ kg/d), the 2.7-fold increase in secretion rate of preformed FA (basal state = 70+/-23, day 4 = 191+/-57 micromol TG/kg/d) quantitatively contributed the most to total VLDL-TG secretion rate. Decreased catabolism of VLDL-TG also contributed to the hypertriglyceridemia as reflected by an approximately fourfold decrease in both fractional turnover rate (basal state = 9.2+/-3.8, day 1 = 2.1+/-0.2, day 4 = 2.1+/-0.3 pools/d) and rate of clearance (basal state = 0.35+/-0.08, day 1 = 0.11+/-0.01, day 4 = 0.09+/-0.01 liter/kg/d) of VLDL-TG. Thus, the primary difference between 1 and 4 d of hyperinsulinemia in conjunction with carbohydrate hyperalimentation is the increase in hepatic secretion of preformed FA into VLDL-TG. PMID:8903319

  14. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  15. Amino acids in a Fischer Tropsch type synthesis

    NASA Technical Reports Server (NTRS)

    Brown, D. L.; Lawless, J. G.

    1974-01-01

    One postulation is described for the presence of organic compounds in meteorites which states that they were formed during the condensation of the solar nebula. A viable laboratory simulation of these conditions can be modeled after the industrial Fischer Tropsch reaction, which is known to produce organic compounds called hydrocarbons. In this simulation, a mixture of carbon monoxide, hydrogen and ammonia is heated in the presence of iron meteorite. The reaction products for amino acids, a class of organic compounds important to life, were examined. A large number of these compounds is found in meteorites and other chemical evolution experiments, but only small quantities of a few amino acids were found in the present simulation work. These results are at odds with the existing literature in which many amino acids were reported.

  16. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  17. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  18. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  19. Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S

    PubMed Central

    Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats

    2014-01-01

    Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631

  20. Urinary excretion of mevalonic acid as an indicator of cholesterol synthesis.

    PubMed

    Lindenthal, B; Simatupang, A; Dotti, M T; Federico, A; Lütjohann, D; von Bergmann, K

    1996-10-01

    Urinary excretion of mevalonic acid was investigated as an indicator of cholesterol synthesis. In normolipemic volunteers, excretion of mevalonic acid averaged 3.51 +/- 0.59 (SD) micrograms/kg x day1; (n = 24) and was not different from patients with hypercholesterolemia (3.30 +/- 0.92 micrograms/kg x day1; n = 24). In patients with cerebrotendineous xanthomatosis, the excretion was significantly higher (8.55 +/- 1.92 micrograms/kg x day1; n = 6, P < 0.001) but comparable to volunteers treated with cholestyramine (6.69 +/- 2.6 micrograms/kg x day1; n = 5). A significant correlation was found between 24-h excretion of mevalonic acid and cholesterol synthesis (r = 0.835; n = 35; P < 0.001). The coefficient of variation of excretion of mevalonic acid during 3 consecutive days was small (9.8%; n = 7). However, urinary output of mevalonic acid was significantly higher during the night (164 +/- 14 micrograms/12-h) than during the day (129 +/- 9 micrograms/12-h; n = 11; P < 0.05). In patients treated with simvastatin (40 mg/day) for 6 weeks, the ratio of mevalonic acid to creatinine in a morning urine sample decreased significantly compared to pretreatment values (110 +/- 25 micrograms/g vs. 66 +/- 25 micrograms/g; P < 0.001). Furthermore, the ratio of mevalonic acid to creatinine in a morning urine sample correlated with the ratio from the 24-h collection period (r = 0.714; n = 34; P < 0.001). The results indicate that the analysis of urinary mevalonic acid, either in 24-h collection or in a single morning sample, is an attractive method for evaluation of long and very short term changes of the rates of cholesterol synthesis. PMID:8906596

  1. Fatty acid composition of muscle fat and enzymes of storage lipid synthesis in whole muscle from beef cattle.

    PubMed

    Kazala, E Chris; Lozeman, Fred J; Mir, Priya S; Aalhus, Jennifer L; Schmutz, Sheila M; Weselake, Randall J

    2006-11-01

    Enhanced intramuscular fat content (i.e., marbling) in beef is a desirable trait, which can result in increased product value. This study was undertaken with the aim of revealing biochemical factors associated with the marbling trait in beef cattle. Samples of longissimus lumborum (LL) and pars costalis diaphragmatis (PCD) were taken from a group of intact crossbred males and females at slaughter, lipids extracted, and the resulting FAME examined for relationships with marbling fat deposition. For LL, significant associations were found between degree of marbling and myristic (14:0, r = 0.55, P < 0.01), palmitic (16:0, r = 0.80, P < 0.001), stearic (18:0, r = -0.58, P < 0.01), and oleic (18:1c-9, r = 0.79, P < 0.001) acids. For PCD, significant relationships were found between marbling and palmitic (r = 0.71, P < 0.001) and oleic (r = 0.74, P < 0.001) acids. Microsomal fractions prepared from PCD muscle were assayed for diacylglycerol acyltransferase (DGAT), lysophosphatidic acid acyltransferase (LPAAT), and phosphatidic acid phosphatase-1 (PAP-1) activity, and the results examined for relationships with degree of intramuscular fat deposition. None of the enzyme activities from PCD displayed an association with marbling fat content, but DGAT specific activity showed significant positive associations with LPAAT (r = 0.54, P < 0.01), total PAP (r = 0.66, P < 0.001), and PAP-1 (r = 0.63, P < 0.01) specific activities. The results on FA compositions of whole muscle tissues provide insight into possible enzyme action associated with the production of specific FA. The increased proportion of oleic acid associated with enhanced lipid content of whole muscle is noteworthy given the known health benefits of this FA. PMID:17263304

  2. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone

    PubMed Central

    Feagin, Trevor A.; Shah, Nirmal I.; Heemstra, Jennifer M.

    2012-01-01

    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  3. Convenient and scalable synthesis of fmoc-protected Peptide nucleic Acid backbone.

    PubMed

    Feagin, Trevor A; Shah, Nirmal I; Heemstra, Jennifer M

    2012-01-01

    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  4. Synthesis and phosphorylation of the glial fibrillary acidic protein during brain development: A tissue slice study

    SciTech Connect

    Noetzel, M.J. )

    1990-01-01

    Brain slices were incubated with either (3H) amino acids or (32P) orthophosphate in order to characterize the synthesis and phosphorylation of the glial fibrillary acidic protein (GFAP) in the rat nervous system. The incorporation of (3H) amino acids into GFAP was found to increase significantly during early postnatal development, reaching a peak of activity on day 5 of life and then declining over the next 2 weeks. Concomitant with this peak of synthetic activity the content of GFAP in rat brain was also observed to increase dramatically. GFAP continued to accumulate in brain through postnatal day 30 despite a decrease in the synthesis of the protein. These results indicate that the increase in GFAP during the first month of life cannot be ascribed solely to the rate of GFAP synthesis. The findings are consistent with the hypothesis that during later stages of astrocytic development the accumulation of GFAP may be primarily dependent upon a low rate of protein degradation. The pattern of GFAP phosphorylation in the developing rat brain differed from that observed for the incorporation of (3H) amino acids. The peak incorporation of 32P into GFAP occurred on postnatal day 10 at a time when synthesis of the protein had declined by 43%. These findings suggest that during development phosphorylation of GFAP is mediated by factors different from those directing its synthesis. In addition, phosphorylation of GFAP did not alter its solubility in cytoskeletal preparations indicating that GFAP phosphorylation is probably not a major regulatory mechanism in disassembly of the astroglial filaments.

  5. Synthesis and antihyperlipidemic activity of piperic acid derivatives.

    PubMed

    A, Rong; Bao, Narisu; Sun, Zhaorigetu; Borjihan, Gereltu; Qiao, Yanjiang; Jin, Zhuang

    2015-02-01

    A series of piperic acid derivatives were designed and synthesized from piperine/piperlonguminine, and their antihyperlipidemic activities evaluated in diet-induced hyperlipidemic rats with respect to simvastatin. Two promising analogues 3 and 10 were discovered and their antihyperlipidemic activities were comparable to or better than those of simvastatin. PMID:25920263

  6. Design, synthesis and biological evaluation of novel betulinic acid derivatives

    PubMed Central

    2012-01-01

    Background Tumor, is one of the major reason for human death, due to its widespread occurrence. Betulinic acid derivatives have attracted considerable attention as cancer chemopreventive agents and also as cancer therapeutics. Many of its derivatives inhibit the growth of human cancer cell lines by triggering apoptosis. With this background, we planned to synthesize a series of betulinic acid derivatives to assess their antiproliferation efficacy on human cancer cell lines. Results A series of novel betulinic acid derivatives were designed and synthesized as highlighted by the preliminary antitumor evaluation against MGC-803, PC3, A375, Bcap-37 and A431 human cancer cell lines in vitro. The pharmacological results showed that some of the compounds displayed moderate to high levels of antitumor activities with most of new exhibiting higher inhibitory activities compared to BA. The IC50 values of compound 3c on the five cancer cell lines were 2.3, 4.6, 3.3, 3.6, and 4.3 μM, respectively. Subsequent fluorescence staining and flow cytometry analysis (FCM) indicated that compound 3c could induce apoptosis in MGC-803 and PC3 cell lines, and the apoptosis ratios reached the peak (37.38% and 33.74%) after 36 h of treatment at 10 μM. Conclusions This study suggests that most of betulinic acid derivatives could inhibit the growth of human cancer cell lines. Furthermore, compound 3c could induce apoptosis of cancer cells. PMID:23174002

  7. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes.

    PubMed

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-08-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  8. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  9. A Novel Process for the Synthesis of Highly Pure n-3 Polyunsaturated Fatty Acid (PUFA)-Enriched Triglycerides by Combined Transesterification and Ethanolysis.

    PubMed

    Li, Daoming; Wang, Weifei; Qin, Xiaoli; Li, Xingxing; Yang, Bo; Wang, Yonghua

    2016-08-31

    In this study, a novel two-step enzymatic reaction was developed for the synthesis of highly pure triacylglycerols (TAGs) with a high content of n-3 polyunsaturated fatty acids (PUFAs). Glyceride mixtures were primarily synthesized by Novozym 435-catalyzed transesterification of glycerol and DHA/EPA-rich ethyl esters (EEs), followed by removal of partial glycerides, for the first time, by immobilized mono- and diacylglycerol lipase SMG1-F278N-catalyzed ethanolysis. TAG yield as high as 98.66% was achieved under the optimized conditions, and highly pure (98.75%) n-3 PUFA-enriched TAGs with 88.44% of n-3 PUFA was obtained after molecular distillation at lower temperature (140 °C). In addition, the EEs produced during ethanolysis had a FA composition similar to that of the original EEs, making them feasible for cyclic utilization. This was the first study reporting removal of partial glycerides by ethanolysis. Through ethanolysis, a higher purity product could be easily obtained at a relatively low temperature compared with the conventional high-temperature molecular distillation. PMID:27540752

  10. Folic acid bio-inspired route for facile synthesis of AuPt nanodendrites as enhanced electrocatalysts for methanol and ethanol oxidation reactions

    NASA Astrophysics Data System (ADS)

    Wang, Ai-Jun; Ju, Ke-Jian; Zhang, Qian-Li; Song, Pei; Wei, Jie; Feng, Jiu-Ju

    2016-09-01

    Folic acid (FA), as an important biomolecule in cell division and growth, is firstly employed as the structure director and stabilizing agent for controlled synthesis of uniform Au65Pt35 nanodendrites (NDs) by a one-pot wet-chemical bio-inspired route at room temperature. No pre-seed, template, organic solvent, polymer, surfactant or complex instrument is involved. The products are mainly characterized by transmission electron microscopy (TEM), high angle annular dark-field scanning transmission electron microscopy (HAADF-STEM), X-ray diffraction (XRD), and X-Ray photoelectron spectroscopy (XPS). The architectures have enlarged electrochemically active surface area (60.6 m2 gPt-1), enhanced catalytic activity and durability for methanol and ethanol oxidation in contrast with commercial Pt black and the other AuPt alloys by tuning the molar ratios of Au to Pt (e.g., Au31Pt69 and Au82Pt18 nanoparticles). This strategy would be applied to fabricate other bimetallic nanocatalysts in fuel cells.

  11. Influence of light on the free amino acid content and γ-aminobutyric acid synthesis in Brassica juncea seedlings.

    PubMed

    Li, Xiaohua; Kim, Yeon Bok; Uddin, Md Romij; Lee, Sanghyun; Kim, Sun-Ju; Park, Sang Un

    2013-09-11

    Glutamate decarboxylase (GAD; EC 4.1.1.15) is an important enzyme in γ-aminobutyric acid (GABA) biosynthesis. Here we report the influence of light on amino acid accumulation and investigate the molecular mechanism by which light influences GABA biosynthesis at the seedling stage of two mustard (Brassica juncea) cultivars (green-leaf and purple-leaf). Gene expression profiles of four GAD-encoding genes (GAD1, GAD2, GAD4a, and GAD4b) and their impact on GABA biosynthesis were analyzed. Light exerted an obvious influence on amino acid accumulation in mustard seedlings. GAD gene expression was also significantly regulated by light/dark or dark treatment, which differentially regulated GABA biosynthesis in B. juncea seedlings. High-performance liquid chromatography (HPLC) revealed that the seeds of purple cultivars contain a higher amount of free amino acids and GABA than do the seeds of green cultivars. After seed germination, however, the accumulation of free amino acids peaked in dark-treated seedlings on day 9 in both cultivars, whereas GABA synthesis peaked at 9 days under light conditions. This study may provide a foundation for understanding the effect of light on amino acids, particularly GABA biosynthesis in Brassica plants. PMID:23909820

  12. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  13. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2.

    PubMed

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru-Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  14. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  15. 2 CFR 200.414 - Indirect (F&A) costs.

    Code of Federal Regulations, 2014 CFR

    2014-01-01

    ... indirect costs. If an extension is granted the non-Federal entity may not request a rate review until the... REQUIREMENTS FOR FEDERAL AWARDS Cost Principles Direct and Indirect (f&a) Costs § 200.414 Indirect (F&A) costs... the types of cost which may be classified as indirect (F&A) cost in all situations....

  16. The effects of retinoic acid on immunoglobulin synthesis by human cord blood mononuclear cells.

    PubMed

    Israel, H; Odziemiec, C; Ballow, M

    1991-06-01

    Derivatives of vitamin A have attracted considerable attention as agents which have immune potentiating properties and possibly tumor-suppressive effects. Recent investigations have shown that retinoic acid (RA) can augment immunoglobulin production of B-cell hybridomas from patients with immune deficiency. In this study we examined the ability of RA to modify the mitogen-induced polyclonal immunoglobulin synthesis of cord blood mononuclear cells (CBMC). RA in concentrations ranging from 10(-5) to 10(-7) M augmented IgM synthesis of CBMC in response to formalinized Cowans I strain Staphylococcus aureus (SAC) up to 45.6-fold which was greater at suboptimal responses to SAC. There were no changes in IgG or IgA synthesis and minimal effects on SAC-induced proliferative responses. RA did not produce similar changes in IgM synthesis of SAC-stimulated adult peripheral blood mononuclear cells (PBMC), and RA had no effect on the immunoglobulin synthesis of Epstein-Barr virus (EBV)-stimulated CBMC or adult PBMC. Time course studies showed that peak enhancement occurred when RA was added between 4 and 24 hr after culture initiation and required prior activation by SAC for augmentation of IgM synthesis. Cell separation experiments showed that prior incubation (18 hr) of an enriched T-cell fraction with RA enhanced the IgM synthesis of a T-cell-depleted B-cell fraction. These experiments and the findings that RA-induced augmentation of IgM production in response to SAC, but not to EBV suggest that the immunoregulatory effects of RA may be mediated by either T cells or T-cell products. Further studies will be necessary to understand the mechanism by which RA augments IgM synthesis of CBMC. PMID:2029794

  17. Direct Synthesis of 5-Aryl Barbituric Acids by Rhodium(II)-Catalyzed Reactions of Arenes with Diazo Compounds**

    PubMed Central

    Best, Daniel; Burns, David J; Lam, Hon Wai

    2015-01-01

    A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N—H groups are tolerated on the barbituric acid, with no complications arising from N—H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. PMID:25959544

  18. Complestatin exerts antibacterial activity by the inhibition of fatty acid synthesis.

    PubMed

    Kwon, Yun-Ju; Kim, Hyun-Ju; Kim, Won-Gon

    2015-01-01

    Bacterial enoyl-acyl carrier protein (ACP) reductase has been confirmed as a novel target for antibacterial drug development. In the screening of inhibitors of Staphylococcus aureus enoyl-ACP reductase (FabI), complestatin was isolated as a potent inhibitor of S. aureus FabI together with neuroprotectin A and chloropeptin I from Streptomyces chartreusis AN1542. Complestatin and related compounds inhibited S. aureus FabI with IC₅₀ of 0.3-0.6 µM. They also prevented the growth of S. aureus as well as methicillin-resistance S. aureus (MRSA) and quinolone-resistant S. aureus (QRSA), with minimum inhibitory concentrations (MICs) of 2-4 µg/mL. Consistent with its FabI-inhibition, complestatin selectively inhibited the intracellular fatty acid synthesis in S. aureus, whereas it did not affect the macromolecular biosynthesis of other cellular components, such as DNA, RNA, proteins, and the cell wall. Additionally, supplementation with exogenous fatty acids reversed the antibacterial effect of complestatin, demonstrating that it targets fatty acid synthesis. In this study, we reported that complestatin and related compounds showed potent antibacterial activity via inhibiting fatty acid synthesis. PMID:25947917

  19. Synthesis and characterization of a pH responsive folic acid functionalized polymeric drug delivery system.

    PubMed

    Li, Xia; McTaggart, Matt; Malardier-Jugroot, Cecile

    2016-01-01

    We report the computational analysis, synthesis and characterization of folate functionalized poly(styrene-alt-maleic anhydride), PSMA for drug delivery purpose. The selection of the proper linker between the polymer and the folic acid group was performed before conducting the synthesis using Density Functional Theory (DFT). The computational results showed the bio-degradable linker 2, 4-diaminobutyric acid, DABA as a good candidate allowing flexibility of the folic acid group while maintaining the pH sensitivity of PSMA, used as a trigger for drug release. The synthesis was subsequently carried out in multi-step experimental procedures. The functionalized polymer was characterized using InfraRed spectroscopy, Nuclear Magnetic Resonance and Dynamic Light Scattering confirming both the chemical structure and the pH responsiveness of PSMA-DABA-Folate polymers. This study provides an excellent example of how computational chemistry can be used in selection process for the functional materials and product characterization. The pH sensitive polymers are expected to be used in delivering anti-cancer drugs to solid tumors with overly expressed folic acid receptors. PMID:27183249

  20. Role of amidation in bile acid effect on DNA synthesis by regenerating mouse liver.

    PubMed

    Barbero, E R; Herrera, M C; Monte, M J; Serrano, M A; Marin, J J

    1995-06-01

    Effect of bile acids on DNA synthesis by the regenerating liver was investigated in mice in vivo after partial hepatectomy (PH). Radioactivity incorporation into DNA after [14C]thymidine intraperitoneal administration peaked at 48 h after PH. At this time a significant taurocholate-induced dose-dependent reduction in DNA synthesis without changes in total liver radioactivity content was found (half-maximal effect at approximately 0.1 mumol/g body wt). Effect of taurocholate (0.5 mumol/g body wt) was mimicked by chocolate, ursodeoxycholate, deoxycholate, dehydrocholate, tauroursodeoxycholate, taurochenodeoxycholate, and taurodeoxycholate. In contrast, chenodeoxycholate, glycocholate, glycochenodeoxycholate, glycoursodeoxycholate, glycodeoxycholate, 5 beta-cholestane, bromosulfophthalein, and free taurine lacked this effect. No relationship between hydrophobic-hydrophilic balance and inhibitory effect was observed. Analysis by high-performance liquid chromatography indicated that inhibition of thymidine incorporation into DNA was not accompanied by an accumulation of phosphorylated DNA precursors in the liver but rather by a parallel increase in nucleotide catabolism. Bile acid-induced modifications in DNA synthesis were observed in vivo even in the absence of changes in toxicity tests, which suggests that the inhibitory effect shared by most unconjugated and tauroconjugated bile acids but not by glycoconjugated bile acids should be accounted for by mechanisms other than nonselective liver cell injury. PMID:7611405

  1. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  2. Synthesis and biological activity of tetralone abscisic acid analogues.

    PubMed

    Nyangulu, James M; Nelson, Ken M; Rose, Patricia A; Gai, Yuanzhu; Loewen, Mary; Lougheed, Brenda; Quail, J Wilson; Cutler, Adrian J; Abrams, Suzanne R

    2006-04-01

    Bicyclic analogues of the plant hormone abscisic acid (ABA) were designed to incorporate the structural elements and functional groups of the parent molecule that are required for biological activity. The resulting tetralone analogues were predicted to have enhanced biological activity in plants, in part because oxidized products would not cyclize to forms corresponding to the inactive catabolite phaseic acid. The tetralone analogues were synthesized in seven steps from 1-tetralone and a range of analogues were accessible through a second route starting with 2-methyl-1-naphthol. Tetralone ABA 8 was found to have greater activity than ABA in two bioassays. The absolute configuration of (+)-8 was established by X-ray crystallography of a RAMP hydrazone derivative. The hydroxymethyl compounds 10 and 11, analogues for studying the roles of 8- and 9-hydroxy ABA 3 and 6, were also synthesized and found to be active. PMID:16557330

  3. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi

    2015-02-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  4. Synthesis and verification of biobased terephthalic acid from furfural.

    PubMed

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  5. Synthesis and antifungal activity of bile acid-derived oxazoles.

    PubMed

    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela

    2016-04-01

    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives. PMID:26827629

  6. Mitochondrial fatty acid synthesis is required for normal mitochondrial morphology and function in Trypanosoma brucei

    PubMed Central

    Guler, Jennifer L.; Kriegova, Eva; Smith, Terry K.; Lukeš, Julius; Englund, Paul T.

    2013-01-01

    Summary Trypanosoma brucei use microsomal elongases for de novo synthesis of most of its fatty acids. In addition, this parasite utilizes an essential mitochondrial type II synthase for production of octanoate (a lipoic acid precursor) as well as longer fatty acids such as palmitate. Evidence from other organisms suggests that mitochondrially synthesized fatty acids are required for efficient respiration but the exact relationship remains unclear. In procyclic form trypanosomes, we also found that RNAi depletion of the mitochondrial acyl carrier protein, an important component of the fatty acid synthesis machinery, significantly reduces cytochrome-mediated respiration. This reduction was explained by RNAi-mediated inhibition of respiratory complexes II, III and IV, but not complex I. Other effects of RNAi, such as changes in mitochondrial morphology and alterations in membrane potential, raised the possibility of a change in mitochondrial membrane composition. Using mass spectrometry, we observed a decrease in total and mitochondrial phosphatidylinositol and mitochondrial phosphatidylethanolamine. Thus, we conclude that the mitochondrial synthase produces fatty acids needed for maintaining local phospholipid levels that are required for activity of respiratory complexes and preservation of mitochondrial morphology and function. PMID:18221265

  7. Synthesis of 4-substituted nipecotic acid derivatives and their evaluation as potential GABA uptake inhibitors.

    PubMed

    Hellenbrand, Tim; Höfner, Georg; Wein, Thomas; Wanner, Klaus T

    2016-05-01

    In this study, we disclose the design and synthesis of novel 4-susbtituted nipecotic acid derivatives as inhibitors of the GABA transporter mGAT1. Based on molecular modeling studies the compounds are assumed to adopt a binding pose similar to that of the potent mGAT1 inhibitor nipecotic acid. As substitution in 4-position should not cause an energetically unfavorable orientation of nipecotic acid as it is the case for N-substituted derivatives this is expected to lead to highly potent binders. For the synthesis of novel 4-substituted nipecotic acid derivatives a linear synthetic strategy was employed. As a key step, palladium catalyzed cross coupling reactions were used to attach the required biaryl moieties to the ω-position of the alkenyl- or alkynyl spacers of varying length in the 4-position of the nipecotic acid scaffold. The resulting amino acids were characterized with respect to their binding affinities and inhibitory potencies at mGAT1. Though the biological activities found were generally insignificant to poor, two compounds, one of which possesses a reasonable binding affinity for mGAT1, rac-57, the other a notable inhibitory potency at mGAT4, rac-84, both displaying a slight subtype selectivity for the individual transporters, could be identified. PMID:27039250

  8. Synthesis of glycoaminooxy acid and N-oxyamide-linked glycolipids.

    PubMed

    Chen, N; Xie, J

    2016-01-21

    Aminooxyl sugar derivatives are versatile building blocks for the generation of various glycoconjugates with interesting bioactivities. We report herein a synthetic method for the preparation of orthogonally protected glycoaminooxy acid from methyl α-d-glycopyranoside in 7 steps. The key steps involve the selective protection, O-alkylation and Mitsunobu reaction. Fully deprotected N-oxyamide-linked novel glycolipids can be easily generated from the glycoaminooxy ester or from the 2-hydroxy free sugar in 5 or 6 steps. PMID:26646087

  9. Synthesis and properties of N-hexadecyl ethylenediamine triacetic acid.

    PubMed

    Wang, Xixin; Zhao, Jianling; Yao, Xingzhi; Chen, Wentao

    2004-11-15

    A new kind of surfactant named N-hexadecyl ethylenediamine triacetic acid (HED3A) was synthesized from anhydrous ethylenediamine, 1-bromohexadecane, and chloroacetic acid. Testing showed stability of HED3A in hard water, wetting power, dispersing power, and surface tension increased along with pH value. Stability in hard water of trisodium N-hexadecyl ethylenediamine triacetate (3NaHED3A) was at level 4, which was better than that of sodium dodecylsulfate (SDS) and sodium dodecylbenzene sulfonate (LAS). Other properties of 3NaHED3A including wetting power, dispersing power, emulsifying power, and surface tension had intermediate value between SDS, LAS, AES, peregal-O, and cetyltrimethylammonium chloride (CTAC). The ethylenediamine triacetic acid (ED3A) group in 3NaHED3A can chelate many kinds of metal ions, which indicates a promising application prospect in many fields including metal anticorrosion, corrosion control agent, additives in electroplating solution, and ore selection and solid surface treatment. PMID:15464823

  10. Synthesis and bioactivity of 2',3'-benzoabscisic acid analogs.

    PubMed

    Han, Xiaoqiang; Wan, Chuan; Li, Xiuyun; Li, Hong; Yang, Dongyan; Du, Shijie; Xiao, Yumei; Qin, Zhaohai

    2015-06-01

    2',3'-Benzoabscisic acid 4a is significantly more active than (±)-ABA and can be potentially used as a plant growth regulator for agriculture. In this study, six 4a analogs were designed and synthesized. Bioassay showed that 4a displayed greater activity than (±)-ABA and the six analogs produced less inhibition than 4a itself. Specially, some analogs displayed markedly different activities to different physiological and biochemical process, which were largely different from ABA and 4a. Compared to (±)-ABA, 4b and 4c were more effective germination inhibitors for lettuce, but less effective inhibitors for rice elongation. Five-membered analog 5 was higher or slightly weaker in inhibiting Arabidopsis seed germination and rice elongation, respectively, but at least 10 times less effective than (±)-ABA in lettuce seed germination. Dual acid 6 and alkyne acid 20 nearly produced no inhibitory activity for Arabidopsis seed germination, but displayed excellent activity in inhibiting rice seedling growth. The preference of the analogs to different physiology process indicated that they might provide a strategy to develop novel ABA agonists or antagonist and be used as probe to investigate the function of different ABA receptors. PMID:25913114

  11. Akt phosphorylation and regulation of transketolase is a nodal point for amino acid control of purine synthesis.

    PubMed

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T; Phan, Tony; Pilz, Renate B; Boss, Gerry R

    2014-07-17

    The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mammalian target of rapamycin 2 and IκB kinase regulate Akt activity and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the nonoxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the nonoxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for 2 days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  12. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-01-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  13. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  14. Acid gradient across plasma membrane can drive phosphate bond synthesis in cancer cells: acidic tumor milieu as a potential energy source.

    PubMed

    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

    2015-01-01

    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623

  15. Synthesis of alanyl nucleobase amino acids and their incorporation into proteins.

    PubMed

    Talukder, Poulami; Dedkova, Larisa M; Ellington, Andrew D; Yakovchuk, Petro; Lim, Jaebum; Anslyn, Eric V; Hecht, Sidney M

    2016-09-15

    Proteins which bind to nucleic acids and regulate their structure and functions are numerous and exceptionally important. Such proteins employ a variety of strategies for recognition of the relevant structural elements in their nucleic acid substrates, some of which have been shown to involve rather subtle interactions which might have been difficult to design from first principles. In the present study, we have explored the preparation of proteins containing unnatural amino acids having nucleobase side chains. In principle, the introduction of multiple nucleobase amino acids into the nucleic acid binding domain of a protein should enable these modified proteins to interact with their nucleic acid substrates using Watson-Crick and other base pairing interactions. We describe the synthesis of five alanyl nucleobase amino acids protected in a fashion which enabled their attachment to a suppressor tRNA, and their incorporation into each of two proteins with acceptable efficiencies. The nucleobases studied included cytosine, uracil, thymine, adenine and guanine, i.e. the major nucleobase constituents of DNA and RNA. Dihydrofolate reductase was chosen as one model protein to enable direct comparison of the facility of incorporation of the nucleobase amino acids with numerous other unnatural amino acids studied previously. The Klenow fragment of DNA polymerase I was chosen as a representative DNA binding protein whose mode of action has been studied in detail. PMID:27452282

  16. Study on Synthesis, Characterization and Antiproliferative Activity of Novel Diisopropylphenyl Esters of Selected Fatty Acids.

    PubMed

    Reddy, Yasa Sathyam; Kaki, Shiva Shanker; Rao, Bala Bhaskara; Jain, Nishant; Vijayalakshmi, Penumarthy

    2016-01-01

    The present study describes the synthesis, characterization and evaluation of antiproliferative activity of novel diisopropylphenyl esters of alpha-linolenic acid (ALA), valproic acid (VA), butyric acid (BA) and 2-ethylhexanoic acid (2-EHA). These esters were chemically synthesized by the esterification of fatty acids with 2,6-diisopropylphenol and 2,4-diisopropylphenol (propofol). The structure of new conjugates viz. propofol-(alpha-linolenic acid) (2,6P-ALA and 2,4P-ALA), propofol-valproic acid (2,6P-VA and 2,4P-VA), propofol-butyric acid (2,6P-BA and 2,4P-BA) and propofol-(2-ethylhexanoic acid) (2,6P2-EHA and 2,4P-2-EHA) were characterized by FT-IR, NMR ((1)H, (13)C) and mass spectral data. The synthesized conjugates having more lipophilic character were tested for antiproliferative in vitro studies on A549, MDA-MB-231, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. All the conjugates showed specific growth inhibition on studied cancer cell lines. Among the synthesized esters, the conjugates synthesized from BA, VA and 2-EHA exhibited prominent growth inhibition against A549, HeLa, Mia-Pa-Ca and HePG2 cancer cell lines. The preliminary results suggest that the entire novel conjugates possess antiproliferative properties that reduce the proliferation of cancer cells in vitro. PMID:26666272

  17. Overexpression of malate dehydrogenase in transgenic alfalfa enhances organic acid synthesis and confers tolerance to aluminum.

    PubMed

    Tesfaye, M; Temple, S J; Allan, D L; Vance, C P; Samac, D A

    2001-12-01

    Al toxicity is a severe impediment to production of many crops in acid soil. Toxicity can be reduced through lime application to raise soil pH, however this amendment does not remedy subsoil acidity, and liming may not always be practical or cost-effective. Addition of organic acids to plant nutrient solutions alleviates phytotoxic Al effects, presumably by chelating Al and rendering it less toxic. In an effort to increase organic acid secretion and thereby enhance Al tolerance in alfalfa (Medicago sativa), we produced transgenic plants using nodule-enhanced forms of malate dehydrogenase and phosphoenolpyruvate carboxylase cDNAs under the control of the constitutive cauliflower mosaic virus 35S promoter. We report that a 1.6-fold increase in malate dehydrogenase enzyme specific activity in root tips of selected transgenic alfalfa led to a 4.2-fold increase in root concentration as well as a 7.1-fold increase in root exudation of citrate, oxalate, malate, succinate, and acetate compared with untransformed control alfalfa plants. Overexpression of phosphoenolpyruvate carboxylase enzyme specific activity in transgenic alfalfa did not result in increased root exudation of organic acids. The degree of Al tolerance by transformed plants in hydroponic solutions and in naturally acid soil corresponded with their patterns of organic acid exudation and supports the concept that enhancing organic acid synthesis in plants may be an effective strategy to cope with soil acidity and Al toxicity. PMID:11743127

  18. Effects of Long Chain Fatty Acid Synthesis and Associated Gene Expression in Microalga Tetraselmis sp

    PubMed Central

    Adarme-Vega, T. Catalina; Thomas-Hall, Skye R.; Lim, David K. Y.; Schenk, Peer M.

    2014-01-01

    With the depletion of global fish stocks, caused by high demand and effective fishing techniques, alternative sources for long chain omega-3 fatty acids are required for human nutrition and aquaculture feeds. Recent research has focused on land-based cultivation of microalgae, the primary producers of omega-3 fatty acids in the marine food web. The effect of salinity on fatty acids and related gene expression was studied in the model marine microalga, Tetraselmis sp. M8. Correlations were found for specific fatty acid biosynthesis and gene expression according to salinity and the growth phase. Low salinity was found to increase the conversion of C18:4 stearidonic acid (SDA) to C20:4 eicosatetraenoic acid (ETA), correlating with increased transcript abundance of the Δ-6-elongase-encoding gene in salinities of 5 and 10 ppt compared to higher salinity levels. The expression of the gene encoding β-ketoacyl-coenzyme was also found to increase at lower salinities during the nutrient deprivation phase (Day 4), but decreased with further nutrient stress. Nutrient deprivation also triggered fatty acids synthesis at all salinities, and C20:5 eicosapentaenoic acid (EPA) increased relative to total fatty acids, with nutrient starvation achieving a maximum of 7% EPA at Day 6 at a salinity of 40 ppt. PMID:24901700

  19. In vitro effects of fat, FA, and cholesterol on sphingomyelin hydrolysis induced by rat intestinal alkaline sphingomyelinase.

    PubMed

    Liu, Jian-Jun; Nilsson, Ake; Duan, Rui-Dong

    2002-05-01

    Dietary sphingomyelin (SM) may have regulatory effects on cell proliferation and tumorigenesis in the colon. Alkaline sphingomyelinase (SMase) is the major enzyme responsible for hydrolysis of SM in the gut. Previously we purified the enzyme and showed that the presence of glycerophospholipids inhibited SM hydrolysis induced by alkaline SMase in vitro. In the present work, we studied the effects of TG, DG, FA, ceramide, and cholesterol on SM hydrolysis catalyzed by purified alkaline SMase. The results showed that both TG (triolein and tristearin) and DG (1,2-dioleoyl-sn-glycerol and 1,2-distearoyl-rac-glycerol) inhibited the activity of alkaline SMase. 1-Monooleoyl-rac-glycerol, 1-monostearoyl-rac-glycerol, stearic acid, oleic acid, linoleic acid, linolenic acid, and arachidonic acid stimulated the activity of alkaline SMase at 0.4-0.8 mM concentrations but inhibited the enzyme at higher concentrations. There was no difference between the effects induced by saturated and unsaturated FA. A short-chain FA such as lauric acid had a stronger stimulatory effect at low concentrations and weaker inhibitory effect at high concentrations than long-chain FA. Choosing linoleic acid as an example, we found that FA had similar effects on both alkaline SMase and neutral SMase. Cholesterol and ceramide when mixed with FA to increase its solubility in bile salt micelles inhibited SMase activity. In conclusion, glycerides, FA, ceramide, and cholesterol influence SM hydrolysis catalyzed by intestinal alkaline SMase. The presence of lipids in the diet may thus influence the course of SM digestion in the gut and thereby the exposure of colon to SM metabolites. PMID:12056588

  20. Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis.

    PubMed

    Kerr, Thomas A; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W; Schwarz, Margrit

    2002-06-01

    The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  1. Electrodialysis synthesis of concentrated solutions of perrhenic acid

    NASA Astrophysics Data System (ADS)

    Palant, A. A.; Bryukvin, V. A.; Levin, A. M.; Reshetova, O. V.

    2011-03-01

    The presented results demonstrate the possibility of electrodialysis production of concentrated solutions of perrhenic acid (HReO4 concentration >400 g/l). KReO4 is used as a precursor. The investigations are performed in a three-chamber electrodialysis cell in a continuous mode. The optimal processing parameters are as follows: the current is 3-5 A, the voltage is 30-40 V, and the anode chamber temperature is 20-25°C. Grade AR-0 ammonium perrhenate is precipitated from the obtained HReO4 solution.

  2. Synthesis, preliminary bioevaluation and computational analysis of caffeic acid analogues.

    PubMed

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  3. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  4. Concise synthesis of ether analogues of lysobisphosphatidic acid.

    PubMed

    Jiang, Guowei; Xu, Yong; Falguières, Thomas; Gruenberg, Jean; Prestwich, Glenn D

    2005-09-01

    We describe a versatile, efficient method for the preparation of ether analogues of (S,S)-lysobisphosphatidic acid (LBPA) and its enantiomer from (S)-solketal. Phosphorylation of a protected sn-2-O-octadecenyl glyceryl ether with 2-cyanoethyl bis-N,N-diisopropylamino phosphine and subsequent deprotection generated the bisether LBPA analogues. By simply changing the sequence of deprotection steps, we obtained the (R,R)- and (S,S)-enantiomers of 2,2'-bisether LBPA. An ELISA assay with anti-LBPA monoclonal antibodies showed that the bisether LBPAs were recognized with the same affinity as the natural 2,2'-bisoleolyl LBPA. [reaction: see text] PMID:16119911

  5. Continuous-flow reactor-based synthesis of carbohydrate and dihydrolipoic acid-capped quantum dots.

    PubMed

    Laurino, Paola; Kikkeri, Raghavendra; Seeberger, Peter H

    2011-08-01

    A detailed protocol for the large-scale synthesis of carbohydrate and dihydrolipoic acid (DHLA)-coated CdSe/ZnS and CdTe/ZnS nanoparticles using continuous flow reactors is described here. Three continuous flow microreaction systems, operating at three different temperatures, are used for the synthesis of mannose-, galactose- or DHLA-functionalized quantum dots (QDs). In the first step of synthesis, the CdSe and CdTe nanoparticles are prepared. The size and spectral properties of the CdSe core of the nanoparticles are controlled by adjustment of the residence time and the temperature. As a second step, the zinc sulfide capping under homogenous conditions is carried out at a substantially lower temperature than is required for nanoparticle growth in batch processes. Finally, the trioctylphosphine/oleic acid ligand is effectively replaced with either carbohydrate PEG-thiol moieties or DHLA at 60 °C. This new protocol allows the synthesis of biologically active fluorescent QDs in 4 d. PMID:21799489

  6. Synthesis and Evaluation of Aryl Boronic Acids as Fluorescent Artificial Receptors for Biological Carbohydrates

    PubMed Central

    Craig, Sandra

    2011-01-01

    Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855

  7. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.

    1980-01-01

    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  8. Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

    PubMed

    Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

    2016-01-01

    α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed. PMID:27589703

  9. The Effects of Borate Minerals on the Synthesis of Nucleic Acid Bases, Amino Acids and Biogenic Carboxylic Acids from Formamide

    NASA Astrophysics Data System (ADS)

    Saladino, Raffaele; Barontini, Maurizio; Cossetti, Cristina; di Mauro, Ernesto; Crestini, Claudia

    2011-08-01

    The thermal condensation of formamide in the presence of mineral borates is reported. The products afforded are precursors of nucleic acids, amino acids derivatives and carboxylic acids. The efficiency and the selectivity of the reaction was studied in relation to the elemental composition of the 18 minerals analyzed. The possibility of synthesizing at the same time building blocks of both genetic and metabolic apparatuses, along with the production of amino acids, highlights the interest of the formamide/borate system in prebiotic chemistry.

  10. Stimulation of skeletal muscle protein synthesis in neonatal pigs by long-term infusion of leucine is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 hr increases skeletal muscle protein synthesis in neonatal pigs, but this is not sustained for 2 h unless the leucine-induced fall in amino acids is prevented. We aimed to determine whether continuous leucine infusion can stimulate protein synthesis for a prolonged period whe...

  11. Acetyl xylan esterase of Aspergillus ficcum catalyzed the synthesis of peracetic acid from ethyl acetate and hydrogen peroxide.

    PubMed

    Park, Seung-Moon

    2011-11-01

    Recombinant acetyl xylan esterase (rAXE) of Aspergillus ficcum catalyzed the synthesis of peracetic acid (PAA) from ethyl acetate and hydrogen peroxide. Ten micrograms of rAXE catalyzed the synthesis of 1.34 mM of PAA, which can be used for the pretreatment of cellulosic biomass in situ. PMID:21824816

  12. Differential regulation of protein synthesis by amino acids and insulin in peripheral and visceral tissues of neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and ...

  13. Efficient Synthesis of 3,3'-Mixed Bisindoles via Lewis Acid Catalyzed Reaction of Spiro-epoxyoxindoles and Indoles.

    PubMed

    Hajra, Saumen; Maity, Subrata; Maity, Ramkrishna

    2015-07-17

    An efficient strategy for the synthesis of 3-(3-indolyl)-oxindole-3-methanol has been developed to achieve a Lewis acid catalyzed, highly regioselective ring opening of spiro-epoxyoxindoles with indoles. The method is used for the gram-scale formal total synthesis of (±)-gliocladin C. PMID:26158390

  14. REGULATION OF CARDIAC AND SKELETAL MUSCLE PROTEIN SYNTHESIS BY INDIVIDUAL BRANCHED-CHAIN AMINO ACIDS IN NEONATAL PIGS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Skeletal muscle grows at a very rapid rate in the neonatal pig, due in part to an enhanced sensitivity of protein synthesis to the postprandial rise in amino acids. An increase in leucine alone stimulates protein synthesis in skeletal muscle of the neonatal pig; however, the effect of isoleucine and...

  15. LC/MS/MS identification of some folic acid degradation products after E-beam irradiation

    NASA Astrophysics Data System (ADS)

    Araújo, M. M.; Marchioni, E.; Zhao, M.; Kuntz, F.; Di Pascoli, T.; Villavicencio, A. L. C. H.; Bergaentzle, M.

    2012-08-01

    Folates belong to the B vitamin group based on the parental compound folic acid (FA). They are involved in important biochemical processes like DNA synthesis and repair. FA is composed of a pteridine ring, p-aminobenzoic acid and glutamate moieties. The human metabolism is not able to synthesize folates and therefore obtain them from diet. FA, a synthetic vitamin, is used as a food fortificant because of its low price, relative stability and increased bioavailability compared to natural folate forms. FA is known to be a sensitive compound easily degradable in aqueous solution by ultraviolet and visible light towards various by-products. Irradiation is a process for preservation of foods that uses accelerated electrons, gamma rays or X-rays. Irradiation is proposed for the treatment of various food products, eliminating or reducing pathogens and insects, increasing the storage time and replacing chemical fumigants. This study concerns the identification of degradation products of FA after E-beam irradiation. FA aqueous solutions were irradiated with a Van de Graaff electrons beam accelerator (2 MeV, 100 μA current, 20 cm scan width, dose rate about 2 kGy/s). Applied doses were between 0 (control) and 10.0 kGy. Absorbed doses were monitored with FWT 60.00 radiochromic dosimeters.

  16. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease.

    PubMed

    Lake, April D; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D; Lu, Zhenqiang; Lehman-McKeeman, Lois D; Cherrington, Nathan J

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the 'classical' (neutral) and 'alternative' (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. PMID:23391614

  17. Synthesis, biological activity, and bioavailability of moschamine, a safflomide-type phenylpropenoic acid amide found in Centaurea cyanus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...

  18. Oleic acid coated magnetic nano-particles: Synthesis and characterizations

    SciTech Connect

    Panda, Biswajit Goyal, P. S.

    2015-06-24

    Magnetic nano particles of Fe{sub 3}O{sub 4} coated with oleic acid were synthesized using wet chemical route, which involved co-precipitation of Fe{sup 2+} and Fe{sup 3+} ions. The nano particles were characterized using XRD, TEM, FTIR, TGA and VSM. X-ray diffraction studies showed that nano particles consist of single phase Fe{sub 3}O{sub 4} having inverse spinel structure. The particle size obtained from width of Bragg peak is about 12.6 nm. TEM analysis showed that sizes of nano particles are in range of 6 to 17 nm with a dominant population at 12 - 14 nm. FTIR and TGA analysis showed that -COOH group of oleic acid is bound to the surface of Fe{sub 3}O{sub 4} particles and one has to heat the sample to 278° C to remove the attached molecule from the surface. Further it was seen that Fe{sub 3}O{sub 4} particles exhibit super paramagnetism with a magnetization of about 53 emu/ gm.

  19. CML10, a variant of calmodulin, modulates ascorbic acid synthesis.

    PubMed

    Cho, Kwang-Moon; Nguyen, Ha Thi Kim; Kim, Soo Youn; Shin, Jin Seok; Cho, Dong Hwa; Hong, Seung Beom; Shin, Jeong Sheop; Ok, Sung Han

    2016-01-01

    Calmodulins (CaMs) regulate numerous Ca(2+) -mediated cellular processes in plants by interacting with their respective downstream effectors. Due to the limited number of CaMs, other calcium sensors modulate the regulation of Ca(2+) -mediated cellular processes that are not managed by CaMs. Of 50 CaM-like (CML) proteins identified in Arabidopsis thaliana, we characterized the function of CML10. Yeast two-hybrid screening revealed phosphomannomutase (PMM) as a putative interaction partner of CML10. In vitro and in vivo interaction assays were performed to analyze the interaction mechanisms of CML10 and PMM. PMM activity and the phenotypes of cml10 knock-down mutants were studied to elucidate the role(s) of the CML10-PMM interaction. PMM interacted specifically with CML10 in the presence of Ca(2+) through its multiple interaction motifs. This interaction promoted the activity of PMM. The phenotypes of cml10 knock-down mutants were more sensitive to stress conditions than wild-type plants, corresponding with the fact that PMM is an enzyme which modulates the biosynthesis of ascorbic acid, an antioxidant. The results of this research demonstrate that a calcium sensor, CML10, which is an evolutionary variant of CaM, modulates the stress responses in Arabidopsis by regulating ascorbic acid production. PMID:26315131

  20. [Synthesis and properties of nuclear hydroxylated derivatives of flufenamic acid and etofenamate (author's transl)].

    PubMed

    Boltze, K H; Bäcker, U; Kreisfeld, H

    1982-01-01

    Synthesis of six nuclear hydroxylated derivatives of flufenamic acid and etofenamate (5-OH-, 4'-OH and 5,4'-(OH2) on a preparative scale is described. All compounds show low toxicity, but only weak anti-inflammatory activity in the rat paw kaolin edema test as compared to 2-(2-hydroxyethoxy)ethyl-N-(a,a,a-trifluoro-m-tolyl)-anthranilate (etofenamate, active substance of Rheumon Gel). PMID:7200776

  1. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  2. Synthesis of milk specific fatty acids and proteins by dispersed goat mammary-gland epithelial cells.

    PubMed Central

    Hansen, H O; Tornehave, D; Knudsen, J

    1986-01-01

    The method now described for preparation of dispersed lactating goat mammary-gland cells gives a high yield of morphologically and functionally normal mammary cells. The cells synthesize specific goat milk fatty acids in the right proportions, and they respond to hormones by increased protein synthesis. The cells can be frozen and thawed without losing the above properties, which makes them an excellent tool for metabolic and hormonal studies. Images Fig. 1. Fig. 2. PMID:3800930

  3. Synthesis of 15-(p-iodophenyl)-6-tellurapentadecanoic acid: a new myocardial imaging agent

    SciTech Connect

    Goodman, M.M.; Knapp, F.F. Jr.

    1982-07-16

    1-Cl-9-(p-iodophenyl)nonane was coupled with sodium (methylvaleryl) telluride to produce methyl-15-(p-iodophenyl)-6-tellurapentadecanoate in 90% yield. Hydrolysis produced the title compound. /sup 1/HNMR and chromatographic analysis substantiated the structure. This method can be used in the synthesis of other fatty acid analogues. The compound has been prepared with iodine 125 and 131 labels. These agents showed prolonged myocardial retention in rats with little in vivo deiodination.

  4. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  5. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity.

    PubMed

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna; Dallavalle, Sabrina

    2016-01-01

    The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  6. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone

    2014-01-01

    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  7. Total synthesis of leopolic acid A, a natural 2,3-pyrrolidinedione with antimicrobial activity

    PubMed Central

    Dhavan, Atul A; Kaduskar, Rahul D; Musso, Loana; Scaglioni, Leonardo; Martino, Piera Anna

    2016-01-01

    Summary The first total synthesis of leopolic acid A, a fungal metabolite with a rare 2,3-pyrrolidinedione nucleus linked to an ureido dipeptide, was designed and carried out. Crucial steps for the strategy include a Dieckmann cyclization to obtain the 2,3-pyrrolidinedione ring and a Wittig olefination to install the polymethylene chain. An oxazolidinone-containing leopolic acid A analogue was also synthesized. The antibacterial activity showed by both compounds suggests that they could be considered as promising candidates for future developments. PMID:27559415

  8. Synthesis and sintering of nanocrystalline hydroxyapatite powders by citric acid sol-gel combustion method

    SciTech Connect

    Han Yingchao; Li Shipu; Wang Xinyu; Chen Xiaoming

    2004-01-03

    The citric acid sol-gel combustion method has been used for the synthesis of nanocrystalline hydroxyapatite (HAP) powder from calcium nitrate, diammonium hydrogen phosphate and citric acid. The phase composition of HAP powder was characterized by X-ray powder diffraction analysis (XRD). The morphology of HAP powder was observed by transmission electron microscope (TEM). The HAP powder has been sintered into microporous ceramic in air at 1200 deg. C with 3 h soaking time. The microstructure and phase composition of the resulting HAP ceramic were characterized by scanning electron microscope (SEM) and XRD, respectively. The physical characterization of open porosity and flexural strength have also been carried out.

  9. Increased fatty acid synthesis inhibits nitrogen starvation-induced autophagy in lipid droplet-deficient yeast.

    PubMed

    Régnacq, Matthieu; Voisin, Pierre; Sere, Yves Y; Wan, Bin; Soeroso, Venty M S; Bernard, Marianne; Camougrand, Nadine; Bernard, François-Xavier; Barrault, Christine; Bergès, Thierry

    2016-08-12

    Macroautophagy is a degradative pathway whereby cells encapsulate and degrade cytoplasmic material within endogenously-built membranes. Previous studies have suggested that autophagosome membranes originate from lipid droplets. However, it was recently shown that rapamycin could induce autophagy in cells lacking these organelles. Here we show that lipid droplet-deprived cells are unable to perform autophagy in response to nitrogen-starvation because of an accelerated lipid synthesis that is not observed with rapamycin. Using cerulenin, a potent inhibitor of fatty acid synthase, and exogenous addition of palmitic acid we could restore nitrogen-starvation induced autophagy in the absence of lipid droplets. PMID:27270031

  10. Synthesis, characterization, and crystal structure of 2-iodo-3,4,5-trimethoxybenzoic acid

    NASA Astrophysics Data System (ADS)

    Kolev, Iliyan N.; Petrova, Svetlana P.; Nikolova, Rositsa P.; Dimowa, Louiza T.; Shivachev, Boris L.

    2013-02-01

    This work describes the synthesis of 2-iodo-3,4,5-trimethoxybenzoic acid. The combination of iodine and silver trifluoroacetate (AgTFA) reagents was used successfully for the iodination of 3,4,5-trimetoxybenzoic acid. To improve the efficiency of the synthetic process a significant modification on the experimental design was also performed. The main structural features of the obtained aryl iodide were investigated by a single crystal X-ray diffraction analysis, FTIR, 1H and 13C NMR spectroscopy.

  11. Integrated process of distillation with side reactors for synthesis of organic acid esters

    SciTech Connect

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T

    2015-11-04

    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  12. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    PubMed Central

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  13. Synthesis and use of deuterated palmitic acids to decipher the cryptoregiochemistry of a Delta13 desaturation.

    PubMed

    Abad, José-Luis; Serra, Montserrat; Camps, Francisco; Fabriàs, Gemma

    2007-02-01

    The synthesis of two hexadeuterated palmitic acids differing in the position of the diagnostic labels, and their use to decipher the cryptoregiochemistry of a Delta13 desaturation are described. A dithiane and a triple bond functionalities were used to introduce the diagnostic (C13 or C14) and tagging (C8 and C9) labels, respectively, in the palmitic acid skeleton. Using these probes, the cryptoregiochemistry of the Delta13 desaturation involved in the biosynthesis of Thaumetopoea pityocampa sex pheromone was studied by means of kinetic isotope effect determinations. Transformation of both (Z)-11-hexadecenoic and 11-hexadecynoic acids into (Z, Z)-11,13-hexadecadienoic and (Z)-13-hexadecen-11-ynoic acids, respectively, is initiated by abstraction of the hydrogen atom at the C13 position, followed by the fast elimination of the C14 hydrogen to give the double bond. PMID:17253792

  14. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively). PMID:27017352

  15. Insulin-independent regulation of hepatic triglyceride synthesis by fatty acids

    PubMed Central

    Vatner, Daniel F.; Majumdar, Sachin K.; Kumashiro, Naoki; Petersen, Max C.; Rahimi, Yasmeen; Gattu, Arijeet K.; Bears, Mitchell; Camporez, João-Paulo G.; Cline, Gary W.; Jurczak, Michael J.; Samuel, Varman T.; Shulman, Gerald I.

    2015-01-01

    A central paradox in type 2 diabetes is the apparent selective nature of hepatic insulin resistance—wherein insulin fails to suppress hepatic glucose production yet continues to stimulate lipogenesis, resulting in hyperglycemia, hyperlipidemia, and hepatic steatosis. Although efforts to explain this have focused on finding a branch point in insulin signaling where hepatic glucose and lipid metabolism diverge, we hypothesized that hepatic triglyceride synthesis could be driven by substrate, independent of changes in hepatic insulin signaling. We tested this hypothesis in rats by infusing [U-13C] palmitate to measure rates of fatty acid esterification into hepatic triglyceride while varying plasma fatty acid and insulin concentrations independently. These experiments were performed in normal rats, high fat-fed insulin-resistant rats, and insulin receptor 2′-O-methoxyethyl chimeric antisense oligonucleotide-treated rats. Rates of fatty acid esterification into hepatic triglyceride were found to be dependent on plasma fatty acid infusion rates, independent of changes in plasma insulin concentrations and independent of hepatocellular insulin signaling. Taken together, these results obviate a paradox of selective insulin resistance, because the major source of hepatic lipid synthesis, esterification of preformed fatty acids, is primarily dependent on substrate delivery and largely independent of hepatic insulin action. PMID:25564660

  16. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    NASA Astrophysics Data System (ADS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M. S. A.

    2016-02-01

    Non-aggregated magnetite nanorods with average diameters of 20-30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications.

  17. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketene–alkene [2+2] cycloadditions and late-stage C—H oxidation

    SciTech Connect

    Rasik, Christopher M.; Brown, M. Kevin

    2014-12-22

    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketene–alkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp³)—H oxidation. The synthesis requires only eight steps from norbornadiene.

  18. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, L.

    1999-05-25

    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  19. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  20. FA-loaded lipid drug delivery systems: preparation, characterization and biological studies.

    PubMed

    Carbone, Claudia; Campisi, Agata; Musumeci, Teresa; Raciti, Giuseppina; Bonfanti, Roberta; Puglisi, Giovanni

    2014-02-14

    The main purpose of this research was to prepare and to characterize ferulic acid-loaded nanostructured lipid carrier (FA-NLC) to evaluate the cytotoxic effect on human glioblastoma cancer U87MG cells. First of all, the influence of different materials on mean size and homogeneity of NLC prepared by a low energy organic solvent-free method was investigated. Technological characterization (encapsulation efficiency, mean particle size, homogeneity and in vitro release profile) was performed on the selected NLC in comparison to others lipid carriers, nanoemulsion and SLN. Furthermore, the thermal behavior of NLC and SLN was investigated using Differential Scanning Calorimetry (DSC) in order to evaluate their structure. Biological studies (MTT bioassay and caspase-3 cleavage) on the selected NLC showed no cytotoxic effects of the unloaded tested NLC. Besides, the effectiveness of FA-loaded NLC was higher compared to the free drug. Cells treated with FA or FA-loaded NLC showed a greater effect compared to idebenone (IDE) or IDE-loaded NLC, respectively. These results strongly support that FA-loaded NLC could be potentially used for the treatment of glioblastoma. PMID:24514450

  1. The effect of pantothenic acid deficiency on keratinocyte proliferation and the synthesis of keratinocyte growth factor and collagen in fibroblasts.

    PubMed

    Kobayashi, Daisaku; Kusama, Miho; Onda, Masaaki; Nakahata, Norimichi

    2011-01-01

    It has been reported that pantothenic acid (vitamin B5) and panthenol, an alcohol derivative of pantothenic acid, have beneficial moisturizing effects on the skin. However, few studies have investigated the mechanism of action of pantothenic acid on skin tissues. We tried to clarify the role of pantothenic acid on skin function by using keratinocytes and fibroblasts. The depletion of pantothenic acid from the culture medium suppressed keratinocyte proliferation and promoted differentiation. Moreover, pantothenic acid depletion decreased the synthesis of keratinocyte growth factor and procollagen 4a2 in fibroblasts. These results suggest that pantothenic acid is essential for maintaining keratinocyte proliferation and differentiation. PMID:21258175

  2. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. PMID:26197418

  3. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    SciTech Connect

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

    2010-10-29

    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  4. The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis

    2004-01-01

    The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

  5. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin

    2011-06-15

    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  6. Development of electrochemical folic acid sensor based on hydroxyapatite nanoparticles

    NASA Astrophysics Data System (ADS)

    Kanchana, P.; Sekar, C.

    2015-02-01

    We report the synthesis of hydroxyapatite (HA) nanoparticles (NPs) by a simple microwave irradiation method and its application as sensing element for the precise determination of folic acid (FA) by electrochemical method. The structure and composition of the HA NPs characterized using XRD, FTIR, Raman and XPS. SEM and EDX studies confirmed the formation of elongated spherical shaped HA NPs with an average particle size of about 34 nm. The HA NPs thin film on glassy carbon electrode (GCE) were deposited by drop casting method. Electrocatalytic behavior of FA in the physiological pH 7.0 was investigated by cyclic voltammetry (CV), linear sweep voltammetry (LSV) and chronoamperometry. The fabricated HA/GCE exhibited a linear calibration plot over a wide FA concentration ranging from 1.0 × 10-7 to 3.5 × 10-4 M with the detection limit of 75 nM. In addition, the HA NPs modified GCE showed good selectivity toward the determination of FA even in the presence of a 100-fold excess of ascorbic acid (AA) and 1000-fold excess of other common interferents. The fabricated biosensor exhibits good sensitivity and stability, and was successfully applied for the determination of FA in pharmaceutical samples.

  7. Fatty acid metabolism in the regulation of T cell function.

    PubMed

    Lochner, Matthias; Berod, Luciana; Sparwasser, Tim

    2015-02-01

    The specific regulation of cellular metabolic processes is of major importance for directing immune cell differentiation and function. We review recent evidence indicating that changes in basic cellular lipid metabolism have critical effects on T cell proliferation and cell fate decisions. While induction of de novo fatty acid (FA) synthesis is essential for activation-induced proliferation and differentiation of effector T cells, FA catabolism via β-oxidation is important for the development of CD8(+) T cell memory as well as for the differentiation of CD4(+) regulatory T cells. We consider the influence of lipid metabolism and metabolic intermediates on the regulation of signaling and transcriptional pathways via post-translational modifications, and discuss how an improved understanding of FA metabolism may reveal strategies for manipulating immune responses towards therapeutic outcomes. PMID:25592731

  8. Radiation synthesis of nanosilver nanohydrogels of poly(methacrylic acid)

    NASA Astrophysics Data System (ADS)

    Gupta, Bhuvanesh; Gautam, Deepti; Anjum, Sadiya; Saxena, Shalini; Kapil, Arti

    2013-11-01

    Nanosilver nanohydrogels (nSnH) of poly(methacrylic acid) were synthesized and stabilized using gamma irradiation. The main objective of this study was to develop silver nanoparticles and to evaluate the antimicrobial activity. Radiation helps in the polymerization, crosslinking and reduction of silver nitrate as well. Highly stable and uniformly distributed silver nanoparticles have been obtained within hydrogel network by water in oil nanoemulsion polymerization and were evaluated by dynamic light scattering (DLS) and transmission electron microscopy (TEM) respectively. TEM showed almost spherical and uniform distribution of silver nanoparticles through the hydrogel network. The mean size of silver nanoparticles ranging is 10-50 nm. The nanohydrogels showed good swelling in water. Antibacterial studies of nSnH suggest that it can be a good candidate as coating material in biomedical applications.

  9. Corrole and Porphyrin Amino Acid Conjugates: Synthesis and Physicochemical Properties.

    PubMed

    Karikis, Kostas; Georgilis, Evangelos; Charalambidis, Georgios; Petrou, Athanasia; Vakuliuk, Olena; Chatziioannou, Theodore; Raptaki, Iliana; Tsovola, Sofia; Papakyriacou, Ioanna; Mitraki, Anna; Gryko, Daniel T; Coutsolelos, Athanassios G

    2016-08-01

    A series of conjugates of amino acids with porphyrins and corroles was synthesized. Their self-assembling ability under defined conditions was investigated by scanning electron microscopy. The morphology and photophysical properties of these molecules were studied by absorption and fluorescence spectroscopy in solid, liquid, and self-assembled forms. We observed that both corrole and porphyrin conjugated with the l-phenylalanine-l-phenylalanine peptide to form spherical nanostructures with bathochromic shifts in the emission spectra, indicating the formation of aggregates. These aggregates are characterized by the impressive absorption of light over nearly the whole visible range. The broadening of all bands was particularly strong in the case of corroles. The fluorescence lifetimes of self-assembled species were longer as compared to the solid-state form. PMID:27356185

  10. Synthesis and antiproliferative activity of glutamic acid-based dipeptides.

    PubMed

    Silveira-Dorta, Gastón; Martín, Víctor S; Padrón, José M

    2015-08-01

    A small and focused library of 22 dipeptides derived from N,N-dibenzylglutamic acid α- and γ-benzyl esters was prepared in a straightforward manner. The evaluation of the antiproliferative activity in the human solid tumor cell lines HBL-100 (breast), HeLa (cervix), SW1573 (non-small cell lung), T-47D (breast), and WiDr (colon) provided γ-glutamyl methionine (GI50 = 6.0-41 μM) and α-glutamyl proline (GI50 = 7.5-18 μM) as lead compounds. In particular, glutamyl serine and glutamyl proline dipeptides were more active in the resistant cancer cell line WiDr than the conventional anticancer drugs cisplatin and etoposide. Glutamyl tryptophan dipeptides did not affect cell growth of HBL-100, while in T-47D cells, proliferation was inhibited. This result might be attributed to the inhibition of the ATB(0,+) transporter. PMID:25900811

  11. Synthesis and degradation test of hyaluronic acid hydrogels.

    PubMed

    Hahn, Sei Kwang; Park, Jung Kyu; Tomimatsu, Takashi; Shimoboji, Tsuyoshi

    2007-03-10

    Hyaluronic acid (HA) hydrogels prepared with three different crosslinking reagents were assessed by in vitro and in vivo degradation tests for various tissue engineering applications. Adipic acid dihydrazide grafted HA (HA-ADH) was synthesized and used for the preparation of methacrylated HA (HA-MA) with methacrylic anhydride and thiolated HA (HA-SH) with Traut's reagent (imminothiolane). (1)H NMR analysis showed that the degrees of HA-ADH, HA-MA, and HA-SH modification were 69, 29, and 56 mol%, respectively. HA-ADH hydrogel was prepared by the crosslinking with bis(sulfosuccinimidyl) suberate (BS(3)), HA-MA hydrogel with dithiothreitol (DTT) by Michael addition, and HA-SH hydrogel with sodium tetrathionate by disulfide bond formation. According to in vitro degradation tests, HA-SH hydrogel was degraded very fast, compared to HA-ADH and HA-MA hydrogels. HA-ADH hydrogel was degraded slightly faster than HA-MA hydrogel. Based on these results, HA-MA hydrogels and HA-SH hydrogels were implanted in the back of SD rats and their degradation was assessed according to the pre-determined time schedule. As expected from the in vitro degradation test results, HA-SH hydrogel was in vivo degraded completely only in 2 weeks, whereas HA-MA hydrogels were degraded only partially even in 29 days. The degradation rate of HA hydrogels were thought to be controlled by changing the crosslinking reagents and the functional group of HA derivatives. In addition, the state of HA hydrogel was another factor in controlling the degradation rate. Dried HA hydrogel at 37 degrees C for a day resulted in relatively slow degradation compared to the bulk HA hydrogel. There was no adverse effect during the in vivo tests. PMID:17101173

  12. d-Amino Acids Indirectly Inhibit Biofilm Formation in Bacillus subtilis by Interfering with Protein Synthesis

    PubMed Central

    Leiman, Sara A.; May, Janine M.; Lebar, Matthew D.; Kahne, Daniel; Kolter, Roberto

    2013-01-01

    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of d-leucine, d-methionine, d-tryptophan, and d-tyrosine and was reported to inhibit biofilm formation via the incorporation of these d-amino acids into the cell wall. Here, we show that l-amino acids were able to specifically reverse the inhibitory effects of their cognate d-amino acids. We also show that d-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding d-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of d-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of d-amino acids without losing the ability to incorporate at least one noncanonical d-amino acid, d-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of d-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  13. D-amino acids indirectly inhibit biofilm formation in Bacillus subtilis by interfering with protein synthesis.

    PubMed

    Leiman, Sara A; May, Janine M; Lebar, Matthew D; Kahne, Daniel; Kolter, Roberto; Losick, Richard

    2013-12-01

    The soil bacterium Bacillus subtilis forms biofilms on surfaces and at air-liquid interfaces. It was previously reported that these biofilms disassemble late in their life cycle and that conditioned medium from late-stage biofilms inhibits biofilm formation. Such medium contained a mixture of D-leucine, D-methionine, D-tryptophan, and D-tyrosine and was reported to inhibit biofilm formation via the incorporation of these D-amino acids into the cell wall. Here, we show that L-amino acids were able to specifically reverse the inhibitory effects of their cognate D-amino acids. We also show that D-amino acids inhibited growth and the expression of biofilm matrix genes at concentrations that inhibit biofilm formation. Finally, we report that the strain routinely used to study biofilm formation has a mutation in the gene (dtd) encoding D-tyrosyl-tRNA deacylase, an enzyme that prevents the misincorporation of D-amino acids into protein in B. subtilis. When we repaired the dtd gene, B. subtilis became resistant to the biofilm-inhibitory effects of D-amino acids without losing the ability to incorporate at least one noncanonical D-amino acid, D-tryptophan, into the peptidoglycan peptide side chain. We conclude that the susceptibility of B. subtilis to the biofilm-inhibitory effects of D-amino acids is largely, if not entirely, due to their toxic effects on protein synthesis. PMID:24097941

  14. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes.

    PubMed

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki

    2016-04-01

    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids. PMID:27001726

  15. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki

    2016-04-01

    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  16. What is the relationship between gestational age and docosahexaenoic acid (DHA) and arachidonic acid (ARA) levels?

    PubMed

    Baack, Michelle L; Puumala, Susan E; Messier, Stephen E; Pritchett, Deborah K; Harris, William S

    2015-09-01

    Long chain polyunsaturated fatty acids (LCPUFA) including docosahexaenoic acid (DHA) and arachidonic acid (ARA) are increasingly transferred from mother to fetus late in pregnancy. Infants born before this transfer is complete are at risk for deficiency. This study determines the relationship between gestational age (GA) and circulating LCPUFA levels to better understand the unique needs of premature infants born at various GAs. Whole blood was collected within the first 7 days of life from 60 preterm (≤34 weeks GA) and 30 term infants (≥38 weeks GA) and FA levels were analyzed. Since concurrent intravenous lipid emulsion can skew composition data, blood LCPUFA concentrations were also measured. Levels were compared among groups, and linear regression models were used to examine the association between FA composition and GA. Preterm infants had significantly lower DHA and ARA levels than term peers, and whether assessed as concentrations or compositions, both directly correlated with GA (p<0.0001). Moreover, FA comparisons suggest that premature infants have impaired synthesis of LCPUFAs from precursors and may require preformed DHA and ARA. This study confirms that essential FA status is strongly related to GA, and that those babies born the earliest are at the greatest risk of LCPUFA deficiency. PMID:26205427

  17. Omega-6 and omega-3 fatty acids metabolism pathways in the body of pigs fed diets with different sources of fatty acids.

    PubMed

    Skiba, Grzegorz; Poławska, Ewa; Sobol, Monika; Raj, Stanisława; Weremko, Dagmara

    2015-01-01

    This study was carried out on 24 gilts (♀ Polish Large White × ♂ Danish Landrace) grown with body weight (BW) of 60 to 105 kg. The pigs were fed diets designed on the basis of a standard diet (appropriate for age and BW of pigs) where a part of the energy content was replaced by different fat supplements: linseed oil in Diet L, rapeseed oil in Diet R and fish oil in Diet F (6 gilts per dietary treatment). The fat supplements were sources of specific fatty acids (FA): in Diet L α-linolenic acid (C18:3 n-3, ALA); in Diet R linoleic acid (C18:2 n-6, LA) and in Diet F eicosapentaenoic acid (C20:5 n-3, EPA), docosapentaenoic acid (C22:5 n-3, DPA) and docosahexaenoic acid (C22:6 n-3, DHA). The protein, fat and total FA contents in the body did not differ among groups of pigs. The enhanced total intake of LA and ALA by pigs caused an increased deposition of these FA in the body (p < 0.01) and an increased potential body pool of these acids for further metabolism/conversions. The conversion efficiency of LA and ALA from the feed to the pig's body differed among groups (p < 0.01) and ranged from 64.4% to 67.2% and from 69.4% to 81.7%, respectively. In Groups L and R, the level of de novo synthesis of long-chain polyunsaturated FA was higher than in Group F. From the results, it can be concluded that the efficiency of deposition is greater for omega-3 FA than for omega-6 FA and depends on their dietary amount. The level of LA and ALA intake influences not only their deposition in the body but also the end products of the omega-3 and omega-6 pathways. PMID:25530317

  18. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties. PMID:26159785

  19. Design, Synthesis, and Antimycobacterial Activity of Novel Theophylline-7-Acetic Acid Derivatives With Amino Acid Moieties.

    PubMed

    Stavrakov, Georgi; Valcheva, Violeta; Voynikov, Yulian; Philipova, Irena; Atanasova, Mariyana; Konstantinov, Spiro; Peikov, Plamen; Doytchinova, Irini

    2016-03-01

    The theophylline-7-acetic acid (7-TAA) scaffold is a promising novel lead compound for antimycobacterial activity. Here, we derive a model for antitubercular activity prediction based on 14 7-TAA derivatives with amino acid moieties and their methyl esters. The model is applied to a combinatorial library, consisting of 40 amino acid and methyl ester derivatives of 7-TAA. The best three predicted compounds are synthesized and tested against Mycobacterium tuberculosis H37Rv. All of them are stable, non-toxic against human cells and show antimycobacterial activity in the nanomolar range being 60 times more active than ethambutol. PMID:26502828

  20. Ethanol-Induced Alterations in Fatty Acid-Related Lipids in Serum and Tissues in Mice

    PubMed Central

    Zhao, Zhenwen; Yu, Menggang; Crabb, David; Xu, Yan; Liangpunsakul, Suthat

    2010-01-01

    Background Chronic alcohol consumption is a major factor for several human diseases and alcoholism is associated with a host of societal problems. One of the major alcohol- induced metabolic changes is the increased NADH levels, which reduces glucose synthesis and increases fatty acid (FA) synthesis. Probably more important is the induction of FA synthesizing enzymes under the control of sterol regulatory element binding proteins (SREBP), plus increased malonyl-CoA which blocks FA entry to the mitochondria for oxidation. The changes in FA-related lipids, particularly lysophospholipids (LPLs) and ceramides (Cers), in different tissues in ethanol-fed have not been reported. Methods We systematically determined the levels of FA-related lipids, including FAs, phosphatidylcholines (PCs), phosphatidylethanolamines (PEs), lysophosphatidic acid (LPA), lysophosphatidylcholine (LPC), lysophosphatidylethanolamine (LPE), lysophosphatidylinositol (LPI), sphingomyelins (SMs), and ceramides (Cers) in the serum and different tissues by high-performance-liquid-chromatography electrospray ionization tandem mass spectrometry (HPLC-ESI-MS/MS). The study was performed in C57BL/6J mice fed with Lieber DeCarli diet; in which ethanol was added to account for 27.5% of total calories. The serum and tissues were collected at the time of sacrifice in these mice and the results were compared to pair-fed controls. Results The important observation was that ethanol induced tissue-specific changes, which were related to different FA chains. Several 22:6 FA, 18:0 FA, 18:0 to 18:3 FA-containing lipids were significantly increased in the serum, liver, and skeletal muscle, respectively. In the kidney, all 22:6 FA-containing lipids detected were increased. In addition, alterations of other lipids in tissues, except adipose tissue, were also observed. Conclusions We found tissue-specific alterations in the levels of FA-related lipids after ethanol administration. The implications of these findings

  1. Whole-body DHA synthesis-secretion kinetics from plasma eicosapentaenoic acid and alpha-linolenic acid in the free-living rat.

    PubMed

    Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P

    2016-09-01

    Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. PMID:27263420

  2. Synthesis and Characterization of Hybrid Hyaluronic Acid-Gelatin Hydrogels

    PubMed Central

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-01-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g. cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three dimensional (2D and 3D) culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  3. Synthesis and characterization of hybrid hyaluronic acid-gelatin hydrogels.

    PubMed

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-04-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g., cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three-dimensional culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  4. Synthesis and characterization of europium- trimesic acid luminescent complex nanorods

    NASA Astrophysics Data System (ADS)

    Ren, Huijuan; Liu, Guixia; Song, Xinyuan; Hong, Guangyan; Cui, Zhenfeng

    2006-01-01

    Eu(III)-trimesic acid (TMA) luminescent complex Nanorods were synthesized in the polyvinylpyrrolidone matrix. The obtained sample was characterized by elemental analysis, Inductively Coupled Plasma-atomic emission spectroscopy(ICP-AES), X-ray diffraction(XRD), Fourier-transform Infrared spectroscopy(FT-IR), transmission electron microscopy(TEM) and photoluminescence spectra (PL). The results demonstrated that its chemical constitution is PVP/Eu(MTA) • 2H IIO. The XRD patterns show that the complex was a new kind of crystal whose structure is totally different with the ligand. TEM image indicated that the complex is nanocrystal with rod shape in one dimension, the size of rod diameter is about 50~100 nm, and the length ranges from hundred nanometer to a few micrometers, in addition, the dispersity is better. Photoluminescence analysis indicated that the complex emits Eu 3+ characteristic luminescence under ultraviolet excitation. TG-DTA curves indicated that the complex is heat stable under the temperature of 454°C. Therefore an thermal decomposition mechanism is: Eu(MTA) • 2H IIO->Eu(MTA)-> Eu IIO 3.

  5. Template-directed synthesis of oligoguanylic acids - Metal ion catalysis

    NASA Technical Reports Server (NTRS)

    Bridson, P. K.; Fakhrai, H.; Lohrmann, R.; Orgel, L. E.; Van Roode, M.

    1981-01-01

    The effects of Zn(2+), Pb(2+) and other metal ions on the efficiency and stereo-selectivity of the template-directed oligomerization of guanosine 5'-phosphorimidazolide are investigated. Reactions were run in the presence of a polyC template in a 2,6-lutidine buffer, and products analyzed by high-performance liquid chromatography on an RPC-5 column. The presence of the Pb(2+) ion is found to lead to the formation of 2'-5' linked oligomers up to the 40-mer, while Zn(2+) favors the formation of predominantly 3'-5' linked oligomers up to the 35-mer. When amounts of uracil, cytidine or adenosine 5'-phosphorimidazole equal to those of the guanosine derivative are included in the reaction mixture, the incorrect base is incorporated into the oligomer about 10% of the time with a Pb(2+) catalyst, but less than 0.5% of the time with Zn(2+). The Sn(2+), Sb(3+) and Bi(3+) ions are also found to promote the formation of 2'-5' oligomers, although not as effectively as Pb(2+), while no metal ions other than Zn(2+) promote the formation of the 3'-5' oligomers. The results may be important for the understanding of the evolution of nucleic acid replication in the absence of enzymes.

  6. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media

    PubMed Central

    Moret, Séverine; Dyson, Paul J.; Laurenczy, Gábor

    2014-01-01

    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M formic acid. In both solvents the catalysts can be reused multiple times without a decrease in activity. Worldwide demand for formic acid continues to grow, especially in the context of a renewable energy hydrogen carrier, and its production from CO2 without base, via the direct catalytic carbon dioxide hydrogenation, is considerably more sustainable than the existing routes. PMID:24886955

  7. Chemical synthesis and enzymatic, stereoselective hydrolysis of a functionalized dihydropyrimidine for the synthesis of β-amino acids.

    PubMed

    Slomka, Christin; Zhong, Sabilla; Fellinger, Anna; Engel, Ulrike; Syldatk, Christoph; Bräse, Stefan; Rudat, Jens

    2015-12-01

    A novel substrate, 6-(4-nitrophenyl)dihydropyrimidine-2,4(1H,3H)-dione (pNO2PheDU), was chemically synthesized and analytically verified for the potential biocatalytic synthesis of enantiopure β-amino acids. The hydantoinase (EC 3.5.2.2) from Arthrobacter crystallopoietes DSM20117 was chosen to prove the enzymatic hydrolysis of this substrate, since previous investigations showed activities of this enzyme toward 6-monosubstituted dihydrouracils. Whole cell biotransformations with recombinant Escherichia coli expressing the hydantoinase showed degradation of pNO2PheDU. Additionally, the corresponding N-carbamoyl-β-amino acid (NCarbpNO2 βPhe) was chemically synthesized, an HPLC-method with chiral stationary phases for detection of this product was established and thus (S)-enantioselectivity toward pNO2PheDU has been shown. Consequently this novel substrate is a potential precursor for the enantiopure β-amino acid para-nitro-β-phenylalanine (pNO2 βPhe). PMID:26705241

  8. Palladium-catalyzed synthesis of aromatic carboxylic acids with silacarboxylic acids.

    PubMed

    Friis, Stig D; Andersen, Thomas L; Skrydstrup, Troels

    2013-03-15

    Aryl iodides and bromides were easily converted to their corresponding aromatic carboxylic acids via a Pd-catalyzed carbonylation reaction using silacarboxylic acids as an in situ source of carbon monoxide. The reaction conditions were compatible with a wide range of functional groups, and with the aryl iodides, the carbonylation was complete within minutes. The method was adapted to the double and selective isotope labeling of tamibarotene. PMID:23441830

  9. Physiologic hyperinsulinemia stimulates protein synthesis and enhances transport of selected amino acids in human skeletal muscle.

    PubMed Central

    Biolo, G; Declan Fleming, R Y; Wolfe, R R

    1995-01-01

    We have investigated the mechanisms of the anabolic effect of insulin on muscle protein metabolism in healthy volunteers, using stable isotopic tracers of amino acids. Calculations of muscle protein synthesis, breakdown, and amino acid transport were based on data obtained with the leg arteriovenous catheterization and muscle biopsy. Insulin was infused (0.15 mU/min per 100 ml leg) into the femoral artery to increase femoral venous insulin concentration (from 10 +/- 2 to 77 +/- 9 microU/ml) with minimal systemic perturbations. Tissue concentrations of free essential amino acids decreased (P < 0.05) after insulin. The fractional synthesis rate of muscle protein (precursor-product approach) increased (P < 0.01) after insulin from 0.0401 +/- 0.0072 to 0.0677 +/- 0.0101%/h. Consistent with this observation, rates of utilization for protein synthesis of intracellular phenylalanine and lysine (arteriovenous balance approach) also increased from 40 +/- 8 to 59 +/- 8 (P < 0.05) and from 219 +/- 21 to 298 +/- 37 (P < 0.08) nmol/min per 100 ml leg, respectively. Release from protein breakdown of phenylalanine, leucine, and lysine was not significantly modified by insulin. Local hyperinsulinemia increased (P < 0.05) the rates of inward transport of leucine, lysine, and alanine, from 164 +/- 22 to 200 +/- 25, from 126 +/- 11 to 221 +/- 30, and from 403 +/- 64 to 595 +/- 106 nmol/min per 100 ml leg, respectively. Transport of phenylalanine did not change significantly. We conclude that insulin promoted muscle anabolism, primarily by stimulating protein synthesis independently of any effect on transmembrane transport. Images PMID:7860765

  10. Synthesis and structural characterisation of amides from picolinic acid and pyridine-2,6-dicarboxylic acid

    PubMed Central

    Devi, Prarthana; Barry, Sarah M.; Houlihan, Kate M.; Murphy, Michael J.; Turner, Peter; Jensen, Paul; Rutledge, Peter J.

    2015-01-01

    Coupling picolinic acid (pyridine-2-carboxylic acid) and pyridine-2,6-dicarboxylic acid with N-alkylanilines affords a range of mono- and bis-amides in good to moderate yields. These amides are of interest for potential applications in catalysis, coordination chemistry and molecular devices. The reaction of picolinic acid with thionyl chloride to generate the acid chloride in situ leads not only to the N-alkyl-N-phenylpicolinamides as expected but also the corresponding 4-chloro-N-alkyl-N-phenylpicolinamides in the one pot. The two products are readily separated by column chromatography. Chlorinated products are not observed from the corresponding reactions of pyridine-2,6-dicarboxylic acid. X-Ray crystal structures for six of these compounds are described. These structures reveal a general preference for cis amide geometry in which the aromatic groups (N-phenyl and pyridyl) are cis to each other and the pyridine nitrogen anti to the carbonyl oxygen. Variable temperature 1H NMR experiments provide a window on amide bond isomerisation in solution. PMID:25954918

  11. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.

    2015-01-01

    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  12. Synthesis and anticancer activity of novel fluorinated asiatic acid derivatives.

    PubMed

    Gonçalves, Bruno M F; Salvador, Jorge A R; Marín, Silvia; Cascante, Marta

    2016-05-23

    A series of novel fluorinated Asiatic Acid (AA) derivatives were successfully synthesized, tested for their antiproliferative activity against HeLa and HT-29 cell lines, and their structure activity relationships were evaluated. The great majority of fluorinated derivatives showed stronger antiproliferative activity than AA in a concentration dependent manner. The most active compounds have a pentameric A-ring containing an α,β-unsaturated carbonyl group. The compounds with better cytotoxic activity were then evaluated against MCF-7, Jurkat, PC-3, A375, MIA PaCa-2 and BJ cell lines. Derivative 14 proved to be the most active compound among all tested derivatives and its mechanism of action was further investigated in HeLa cell line. The results showed that compound 14 induced cell cycle arrest in G0/G1 stage as a consequence of up-regulation of p21(cip1/waf1) and p27(kip1) and down-regulation of cyclin D3 and Cyclin E. Furthermore, compound 14 was found to induce caspase driven-apoptosis with activation of caspases-8 and caspase-3 and the cleavage of PARP. The cleavage of Bid into t-Bid, the up-regulation of Bax and the down-regulation of Bcl-2 were also observed after treatment of HeLa cells with compound 14. Taken together, these mechanistic studies revealed the involvement of extrinsic and intrinsic pathways in the apoptotic process induced by compound 14. Importantly, the antiproliferative activity of this compound on the non-tumor BJ human fibroblast cell line is weaker than in the tested cancer cell lines. The enhanced potency (between 45 and 90-fold more active than AA in a panel of cancer cell lines) and selectivity of this new AA derivative warrant further preclinical evaluation. PMID:26974379

  13. Effect of nitric acid concentrations on synthesis and stability of maghemite nanoparticles suspension.

    PubMed

    Nurdin, Irwan; Johan, Mohd Rafie; Yaacob, Iskandar Idris; Ang, Bee Chin

    2014-01-01

    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension. PMID:24963510

  14. Effect of Nitric Acid Concentrations on Synthesis and Stability of Maghemite Nanoparticles Suspension

    PubMed Central

    Yaacob, Iskandar Idris

    2014-01-01

    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension. PMID:24963510

  15. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper.

    PubMed

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  16. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  17. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)

    1991-01-01

    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  18. The effects of retinoic acid on immunoglobulin synthesis: Role of interleukin 6

    SciTech Connect

    Ballow, M.; Xiang, Shunan; Wang, Weiping; Brodsky, L. |

    1996-05-01

    Retinoic acid (RA) and its parent compound, retinol (ROH, vitamin A), have been recognized as important immunopotentiating agents. Previous studies from our laboratory have demonstrated that PA can augment formalin-treated Staphylococcus aureus (SAC) stimulated immunoglobulin (Ig) synthesis of cord blood mononuclear cells (CBMC). To determine the mechanism(s) by which RA modulates Ig synthesis, we studied the effects of RA on B cells and cytokine production. The addition of RA (10{sup -5} to 10{sup -10} M) to Epstein-Barr virus (EBV)-transformed B-cell clones derived from either adult or cord blood B cells augmented Ig secretion twofold. In contrast, cell proliferation was inhibited as measured by {sup 3}H-thymidine incorporation. We evaluated two cytokines known to be constitutively produced by EBV cell lines, IL-1 and IL-6. While RA had no effect on IL-1 production, IL-6 synthesis was greatly enhanced (20- to 45-fold), which was also reflected by an increase in steady-state mRNA levels for IL-6 but not TNF-{alpha} or TGF-{beta} on Northern blot analysis. Polyclonal rabbit anti-IL-6 antibodies were used to block the augmenting effects of RA on Ig synthesis of adenoidal B cells. RA-induced augmentation in IgG and IgA synthesis was blocked 58 and 29%, respectively, by anti-IL-6 antibodies. These studies suggest that the enhancing effects of RA on Ig synthesis are mediated, at least in part, by the autocrine or paracrine effects of IL-6 on B-cell differentiation. 37 refs., 5 figs.

  19. TORC1 inhibits GSK3-mediated Elo2 phosphorylation to regulate very long chain fatty acid synthesis and autophagy.

    PubMed

    Zimmermann, Christine; Santos, Aline; Gable, Kenneth; Epstein, Sharon; Gururaj, Charulatha; Chymkowitch, Pierre; Pultz, Dennis; Rødkær, Steven V; Clay, Lorena; Bjørås, Magnar; Barral, Yves; Chang, Amy; Færgeman, Nils J; Dunn, Teresa M; Riezman, Howard; Enserink, Jorrit M

    2013-11-27

    Very long chain fatty acids (VLCFAs) are essential fatty acids with multiple functions, including ceramide synthesis. Although the components of the VLCFA biosynthetic machinery have been elucidated, how their activity is regulated to meet the cell's metabolic demand remains unknown. The goal of this study was to identify mechanisms that regulate the rate of VLCFA synthesis, and we discovered that the fatty acid elongase Elo2 is regulated by phosphorylation. Elo2 phosphorylation is induced upon inhibition of TORC1 and requires GSK3. Expression of nonphosphorylatable Elo2 profoundly alters the ceramide spectrum, reflecting aberrant VLCFA synthesis. Furthermore, VLCFA depletion results in constitutive activation of autophagy, which requires sphingoid base phosphorylation. This constitutive activation of autophagy diminishes cell survival, indicating that VLCFAs serve to dampen the amplitude of autophagy. Together, our data reveal a function for TORC1 and GSK3 in the regulation of VLCFA synthesis that has important implications for autophagy and cell homeostasis. PMID:24239358

  20. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress.

    PubMed

    Simón, María Victoria; Agnolazza, Daniela L; German, Olga Lorena; Garelli, Andrés; Politi, Luis E; Agbaga, Martin-Paul; Anderson, Robert E; Rotstein, Nora P

    2016-03-01

    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here, we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat and hydrogen peroxide (H2 O2 ). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in retina photoreceptors, and its precursor, eicosapentaenoic acid (EPA) have multiple beneficial effects. Here, we show that retina neurons in vitro express the desaturase FADS2 and can synthesize DHA from EPA. Moreover, addition of EPA to these cultures protects photoreceptors from oxidative stress and promotes their differentiation through its metabolization to DHA. PMID:26662863

  1. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward

    2015-01-01

    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  2. Formation of Amino Acid Thioesters for Prebiotic Peptide Synthesis: Catalysis By Amino Acid Products

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.; DeVincenzi, Donald L. (Technical Monitor)

    1999-01-01

    The origin of life can be described as a series of events in which a prebiotic chemical process came increasingly under the control of its catalytic products. In our search for this prebiotic process that yielded catalytic takeover products (such as polypeptides), we have been investigating a reaction system that generates peptide-forming amino acid thioesters from formaldehyde, glycolaldehyde, and ammonia in the presence of thiols. As shown below, this model process begins by aldol condensation of formaldehyde and glycolaldehyde to give trioses and releases. These sugars then undergo beta-dehydration yielding their respective alpha-ketoaldehydes. Addition of ammonia to the alpha-ketoaldehydes yields imines which can either: (a) rearrange in the presence of thesis to give amino acid thioesters or (be react with another molecule of aldehyde to give imidazoles. This 'one-pot' reaction system operates under mild aqueous conditions, and like modem amino acid biosynthesis, uses sugar intermediates which are converted to products by energy-yielding redox reactions. Recently, we discovered that amino acids, such as the alanine reaction product, catalyze the first and second steps of the process. In the presence of ammonia the process also generates other synthetically useful products, like the important biochemical -- pyruvic acid.

  3. The Synthesis of α,α-Disubstituted α-Amino Acids via Ichikawa Rearrangement.

    PubMed

    Szcześniak, Piotr; Pieczykolan, Michał; Stecko, Sebastian

    2016-02-01

    An approach to α,α-disubstituted α-amino acids is reported. The key step is allyl cyanate-to-isocyanate rearrangement. As demonstrated, the resultant allyl isocyanates can be directly trapped with various nucleophiles, for instance, alcohols, amines, and organometallic reagents, to provide a broad range of N-functionalized allylamines. The developed method has been successfully applied in the synthesis of two bioactive peptides: 2-aminoadamantane-2-carboxylic acid derived P2X7-evoked glutamate release inhibitor and 4-amino-tetrahydropyranyl-4-carboxylic acid derived dipeptide GSK-2793660, which is currently in clinical trials as cathepsin C inhibitor for the treatment of cystic fibrosis, noncystic fibrosis bronchiectasis, ANCA-associated vasculitis and bronchiectasis. PMID:26726732

  4. Hybrid Compounds Strategy in the Synthesis of Oleanolic Acid Skeleton-NSAID Derivatives.

    PubMed

    Pawełczyk, Anna; Olender, Dorota; Sowa-Kasprzak, Katarzyna; Zaprutko, Lucjusz

    2016-01-01

    The current study focuses on the synthesis of several hybrid individuals combining a natural oleanolic acid skeleton and synthetic nonsteroidal anti-inflammatory drug moieties (NSAIDs). It studied structural modifications of the oleanolic acid structure by use of the direct reactivity of hydroxyl or hydroxyimino groups at position C-3 of the triterpenoid skeleton with the carboxylic function of anti-inflammatory drugs leading to new perspective compounds with high potential pharmacological activities. Novel ester- and iminoester-type derivatives of oleanolic unit with the different NSAIDs, such as ibuprofen, aspirin, naproxen, and ketoprofen, were obtained and characterized. Moreover, preliminary research of compounds obtaining structure stability under acidic conditions was examined and the PASS method of prediction of activity spectra for substances was used to estimate the potential biological activity of these compounds. PMID:27077841

  5. Facile synthesis of PtAu alloy nanoparticles with high activity for formic acid oxidation

    SciTech Connect

    Zhang, Sheng; Shao, Yuyan; Yin, Geping; Lin, Yuehe

    2010-02-15

    We report the facile synthesis of carbon supported PtAu alloy nanoparticles with high electrocatalytic activity as the anode catalyst for direct formic acid fuel cells (DFAFCs). PtAu alloy nanopaticles are synthesized by co-reducing HAuCl4 and H2PtCl6 with NaBH4 in the presence of sodium citrate and then the nanoparticles are deposited on Vulcan XC-72R carbon support (PtAu/C). The obtained catalysts are characterized with X-ray diffraction (XRD) and transmission electron microscope (TEM), which reveal PtAu alloy formation with an average diameter of 4.6 nm. PtAu/C exhibits 8 times higher catalytic activity toward formic acid oxidation than Pt/C. The enhanced activity of PtAu/C catalyst is attributed to noncontinuous Pt sites formed in the presence of the neighbored Au sites, which promotes direct oxidation of formic acid by avoiding poison CO.

  6. Synthesis, characterization and biological activity of hydroxyl-bisphosphonic analogs of bile acids.

    PubMed

    Bortolini, Olga; Fantin, Giancarlo; Fogagnolo, Marco; Rossetti, Stefano; Maiuolo, Loredana; Di Pompo, Gemma; Avnet, Sofia; Granchi, Donatella

    2012-06-01

    Bisphosphonates (BPs) are now the most widely used drugs for diseases associated with increased bone resorption, such as osteoporosis, and tumor bone diseases. A significant drawback of the BPs is their poor oral absorption that is enhanced by the presence of bile acid substituents in the bisphosphonate framework, with no toxic effects. A straightforward synthesis of bile acid-containing hydroxy-bisphosphonates and a full characterization of these pharmaceutically important molecules, including an evaluation of affinity and the mechanism of binding to hydroxyapatite, is presented. The biological activity of bile acid-containing bisphosphonate salts was determined using the neutral-red assay on the L929 cell line and primary cultures of osteoclasts. The bioactivity of the new compounds was found superior than bisphosphonates of established activity. PMID:22483634

  7. Synthesis of goethite in solutions of artificial seawater and amino acids: a prebiotic chemistry study

    NASA Astrophysics Data System (ADS)

    Carneiro, Cristine E. A.; Ivashita, Flávio F.; de Souza, Ivan Granemann; de Souza, Cláudio M. D.; Paesano, Andrea; da Costa, Antonio C. S.; di Mauro, Eduardo; de Santana, Henrique; Zaia, Cássia T. B. V.; Zaia, Dimas A. M.

    2013-04-01

    This study investigated the synthesis of goethite under conditions resembling those of the prebiotic Earth. The artificial seawater used contains all the major elements as well as amino acids (α-Ala, β-Ala, Gly, Cys, AIB) that could be found on the prebiotic Earth. The spectroscopic methods (FT-IR, EPR, Raman), scanning electron microscopy (SEM) and X-ray diffraction showed that in any condition Gly and Cys favoured the formation of goethite, artificial seawater plus β-Ala and distilled water plus AIB favoured the formation of hematite and for the other synthesis a mixture of goethite and hematite were obtained. Thus in general no protein amino acids (β-Ala, AIB) favoured the formation of hematite. As shown by surface enhanced Raman spectroscopy (SERS) spectra the interaction between Cys and Fe3+ of goethite is very complex, involving decomposition of Cys producing sulphur, as well as interaction of carboxylic group with Fe3+. SERS spectra also showed that amino/CN and C-CH3 groups of α-Ala are interacting with Fe3+ of goethite. For the other samples the shifting of several bands was observed. However, it was not possible to say which amino acid groups are interacting with Fe3+. The pH at point of zero charge of goethites increased with artificial seawater and decreased with amino acids. SEM images showed when only goethite was synthesized the images of the samples were acicular and when only hematite was synthesized the images of the samples were spherical. SEM images for the synthesis of goethite with Cys were spherical crystal aggregates with radiating acicular crystals. The highest resonance line intensities were obtained for the samples where only hematite was obtained. Electron paramagnetic resonance (EPR) and Mössbauer spectra showed for the synthesis of goethite with artificial seawater an isomorphic substitution of iron by seawater cations. Mössbauer spectra also showed that for the synthesis goethite in distilled water plus Gly only goethite was

  8. Synthesis of homo and hetero metal-phosphonate frameworks from bi-functional aminomethylphosphonic acid

    SciTech Connect

    Samanamu, Christian R.; Zamora, Elena Nicole; Montchamp, Jean-Luc; Richards, Anne F.

    2008-06-15

    The reaction between aminomethylphosphonic acid (ampa) and the metal salts of Zn, Cd, Hg, Pb, Ag, and Cu afforded seven metal-phosphonate polymers with unique structural features and includes the synthesis of a bimetallic metal-organic framework (Cu/Ag). The characterization of these metal phosphonates is reported by means of infrared spectroscopy, {sup 1}H-NMR, {sup 31}P-NMR, X-ray crystallography, energy dispersive X-ray (EDX), and thermogravimetric analysis (TGA). Individual structural features are compared based on the preferred coordination mode of ampa and the geometrical requirements for each metallic center that manipulates the structural motif. - Graphical abstract: The synthesis and characterization of polymeric metal phosphonates featuring zinc, cadmium, mercury, lead, and silver phosphonate are described from the reactions of the bi-funtional aminomethylphosphonic acid with the metal precursor in aqueous conditions. These previously undescribed polymers display unusual structural features and include the synthesis of a bimetallic metal-organic framework (Cu/Ag)

  9. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.

    1986-01-01

    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  10. Total Synthesis of the Aristolochic Acids, Their Major Metabolites, and Related Compounds

    PubMed Central

    2015-01-01

    Plants from the Aristolochia genus have been recommended for the treatment of a variety of human ailments since the time of Hippocrates. However, many species produce the highly toxic aristolochic acids (AAs), which are both nephrotoxic and carcinogenic. For the purposes of extensive biological studies, a versatile approach to the synthesis of the AAs and their major metabolites was devised based primarily on a Suzuki–Miyaura coupling reaction. The key to success lies in the preparation of a common ring-A precursor, namely, the tetrahydropyranyl ether of 2-nitromethyl-3-iodo-4,5-methylendioxybenzyl alcohol (27), which was generated in excellent yield by oxidation of the aldoxime precursor 26. Suzuki–Miyaura coupling of 27 with a variety of benzaldehyde 2-boronates was accompanied by an aldol condensation/elimination reaction to give the desired phenanthrene intermediate directly. Deprotection of the benzyl alcohol followed by two sequential oxidation steps gave the desired phenanthrene nitrocarboxylic acids. This approach was used to synthesize AAs I–IV and several other related compounds, including AA I and AA II bearing an aminopropyloxy group at position-6, which were required for further conversion to fluorescent biological probes. Further successful application of the Suzuki–Miyaura coupling reaction to the synthesis of the N-hydroxyaristolactams of AA I and AA II then allowed the synthesis of the putative, but until now elusive, N-acetoxy- and N-sulfonyloxy-aristolactam metabolites. PMID:24877584

  11. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    PubMed

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress. PMID:25113613

  12. α-Azido Acids in Solid-Phase Peptide Synthesis: Compatibility with Fmoc Chemistry and an Alternative Approach to the Solid Phase Synthesis of Daptomycin Analogs.

    PubMed

    Lohani, Chuda Raj; Rasera, Benjamin; Scott, Bradley; Palmer, Michael; Taylor, Scott D

    2016-03-18

    α-Azido acids have been used in solid phase peptide synthesis (SPPS) for almost 20 years. Here we report that peptides bearing an N-terminal α-azidoaspartate residue undergo elimination of an azide ion when treated with reagents that are commonly used for removing the Fmoc group during SPPS. We also report an alternative solid-phase route to the synthesis of an analog of daptomycin that uses a reduced number of α-azido amino acids and without elimination of an azide ion. PMID:26938305

  13. Identification and characterization of FaSOC1, a homolog of SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 from strawberry.

    PubMed

    Lei, Heng-Jiu; Yuan, Hua-Zhao; Liu, Yun; Guo, Xin-Wei; Liao, Xiong; Liu, Lin-Lin; Wang, Qi; Li, Tian-Hong

    2013-12-01

    A MADS-box gene SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 (SOC1) integrates multiple flowering signals to regulate floral transition in Arabidopsis. Strawberry (Fragaria spp.) is an economically important fruit crop, but its molecular control of flowering is largely unknown. In this study, a SOC1-like gene, FaSOC1, was isolated and characterized from strawberry. The open reading frame of FaSOC1 was 648bp, encoding a protein of 215 amino acids. Sequence alignment and phylogenetic analysis showed that the FaSOC1 protein contained a highly conserved MADS domain and a SOC1 motif, and that it was a member of the SOC1-like genes of dicots. The FaSOC1 protein mainly localized in the cytoplasm of onion epidermal cells and Arabidopsis protoplasts, and showed no transcriptional activation activity in yeast cells. Under the floral induction conditions, the expression of FaSOC1 increased during the first 2weeks of short-day treatment, but declined dramatically during three to 4weeks. FaSOC1 was highly expressed in reproductive organs, including shoot apices, floral buds, flowers, stamens and sepals. Overexpression of FaSOC1 in wild-type Arabidopsis caused early flowering and upregulated the expression of flowering time genes LFY and AP1. In addition, the yeast two-hybrid and BiFC assays confirmed that FaSOC1 could interact with AGL24. In conclusion, these results suggest that FaSOC1 is a flowering promoter in strawberry. PMID:24055423

  14. Synthesis and biological evaluation of phenoxyacetic acid derivatives as novel free fatty acid receptor 1 agonists.

    PubMed

    Wang, Xuekun; Zhao, Tianxiao; Yang, Baowei; Li, Zheng; Cui, Jian; Dai, Yuxuan; Qiu, Qianqian; Qiang, Hao; Huang, Wenlong; Qian, Hai

    2015-01-01

    Free fatty acid receptor 1 (FFA1) is a new potential drug target for the treatment of type 2 diabetes because of its role in amplifying glucose-stimulated insulin secretion in pancreatic β-cell. In the present studies, we identified phenoxyacetic acid derivative (18b) as a potent FFA1 agonist (EC50=62.3 nM) based on the structure of phenylpropanoic acid derivative 4p. Moreover, compound 18b could significantly improve oral glucose tolerance in ICR mice and dose-dependently reduced glucose levels in type 2 diabetic C57BL/6 mice without observation of hypoglycemic side effect. Additionally, compound 18b exhibited acceptable PK profiles. In summary, compound 18b with ideal PK profiles exhibited good activity in vitro and in vivo, and might be a promising drug candidate for the treatment of diabetes mellitus. PMID:25481394

  15. First chemoenzymatic synthesis of (+)-2-carboxypyrrolidine-3-acetic acid, the nucleus of kainoid amino acids.

    PubMed

    Felluga, Fulvia; Forzato, Cristina; Nitti, Patrizia; Pitacco, Giuliana; Ghelfi, Franco; Valentin, Ennio

    2012-02-01

    The distinctive nucleus of kainoid amino acids, (2S,3R)-(+)-2-carboxypyrrolidine-3-acetic acid 6, was synthesized by a chemoenzymatic process, exploiting the diastereomeric cis/trans methyl pyroglutamate derivatives 10a-c/11a-c as key intermediates. These mixtures, when subjected to a kinetic resolution mediated by α-chymotrypsin, reacted diastereo-, regio-, and enantioselectively to give the trans derivatives (+)-10a-c possessing the correct (2S,3R) configuration. Subsequently, the desired product (2S,3R)-(+)-6 could be obtained after well-established transformations. PMID:22180179

  16. Glycerine and levulinic acid: renewable co-substrates for the fermentative synthesis of short-chain poly(hydroxyalkanoate) biopolymers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Glycerine and levulinic acid were used alone and in combination for the fermentative synthesis of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHB/V) biopolymers. Shake-flask cultures of Pseudomonas oleovorans NRRL B-14682 containing different glycerine:levulinic acid ratios (1%, w/v total carbon ...

  17. The Synthesis of a Dipeptide from its Component Amino Acids: Protecting Groups in the Elementary Organic Laboratory.

    ERIC Educational Resources Information Center

    Young, Paul E.; Campbell, Andrew

    1982-01-01

    A simple, three-step procedure for synthesizing a dipeptide from its component amino acids is described. The dipeptide synthesized uses inexpensive amino acids having hydrocarbon side-chains and can be observed in E/Z forms by nuclear magnetic resonance spectroscopy. Each step in the synthesis produces white crystalline products using standard…

  18. SYNTHESIS AND CHARACTERIZATION OF A NOVEL SOLID ACID CATALYST FOR IMPROVED USE OF WASTE OIL FEEDSTOCK FOR BIODIESEL PRODUCTION

    EPA Science Inventory

    Carbon Catalyst Synthesis - Sucrose was treated directly with excess sulfuric acid sulfuric acid (9:1 mol/mol, 25°C). A carbon foam (nearly 20 fold increase in bulk volume) was immediately formed. The foam was then washed until no sulfate was dete...

  19. Leucine and alpha-Ketoisocaproic acid, but not norleucine, stimulate skeletal muscle protein synthesis in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The branched-chain amino acid, leucine, acts as a nutrient signal to stimulate protein synthesis in skeletal muscle of young pigs. However, the chemical structure responsible for this effect has not been identified. We have shown that the other branched-chain amino acids, isoleucine and valine, are ...

  20. Shock synthesis of amino acids from impacting cometary and icy planet surface analogues

    NASA Astrophysics Data System (ADS)

    Martins, Zita; Price, Mark C.; Goldman, Nir; Sephton, Mark A.; Burchell, Mark J.

    2013-12-01

    Comets are known to harbour simple ices and the organic precursors of the building blocks of proteins--amino acids--that are essential to life. Indeed, glycine, the simplest amino acid, was recently confirmed to be present on comet 81P/Wild-2 from samples returned by NASA's Stardust spacecraft. Impacts of icy bodies (such as comets) onto rocky surfaces, and, equally, impacts of rocky bodies onto icy surfaces (such as the jovian and saturnian satellites), could have been responsible for the manufacture of these complex organic molecules through a process of shock synthesis. Here we present laboratory experiments in which we shocked ice mixtures analogous to those found in a comet with a steel projectile fired at high velocities in a light gas gun to test whether amino acids could be produced. We found that the hypervelocity impact shock of a typical comet ice mixture produced several amino acids after hydrolysis. These include equal amounts of D- and L-alanine, and the non-protein amino acids α-aminoisobutyric acid and isovaline as well as their precursors. Our findings suggest a pathway for the synthetic production of the components of proteins within our Solar System, and thus a potential pathway towards life through icy impacts.

  1. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  2. Regulation of Bile Acid Synthesis by Fat-soluble Vitamins A and D*

    PubMed Central

    Schmidt, Daniel R.; Holmstrom, Sam R.; Fon Tacer, Klementina; Bookout, Angie L.; Kliewer, Steven A.; Mangelsdorf, David J.

    2010-01-01

    Bile acids are required for proper absorption of dietary lipids, including fat-soluble vitamins. Here, we show that the dietary vitamins A and D inhibit bile acid synthesis by repressing hepatic expression of the rate-limiting enzyme CYP7A1. Receptors for vitamin A and D induced expression of Fgf15, an intestine-derived hormone that acts on liver to inhibit Cyp7a1. These effects were mediated through distinct cis-acting response elements in the promoter and intron of Fgf15. Interestingly, transactivation of both response elements appears to be required to maintain basal Fgf15 expression levels in vivo. Furthermore, whereas induction of Fgf15 by vitamin D is mediated through its receptor, the induction of Fgf15 by vitamin A is mediated through the retinoid X receptor/farnesoid X receptor heterodimer and is independent of bile acids, suggesting that this heterodimer functions as a distinct dietary vitamin A sensor. Notably, vitamin A treatment reversed the effects of the bile acid sequestrant cholestyramine on Fgf15, Shp, and Cyp7a1 expression, suggesting a potential therapeutic benefit of vitamin A under conditions of bile acid malabsorption. These results reveal an unexpected link between the intake of fat-soluble vitamins A and D and bile acid metabolism, which may have evolved as a means for these dietary vitamins to regulate their own absorption. PMID:20233723

  3. Effects of acetylsalicylic acid and paracetamol alone and in combination on prostanoid synthesis in man.

    PubMed Central

    Bippi, H; Frölich, J C

    1990-01-01

    1. The present study was designed to investigate the effects of acetylsalicylic acid and paracetamol given separately and in combination on total body and renal PGE2 synthesis in healthy volunteers. 2. In a randomized four-way cross-over study eleven female volunteers received for two consecutive days 3 g day-1 acetylsalicylic acid or 3 g day-1 paracetamol or a combination of 1.5 g day-1 acetylsalicylic acid and 1.5 g day-1 paracetamol, or 1.5 g day-1 acetylsalicylic acid separated by washout phases of at least 5 days. Urinary excretion of the major urinary metabolite of PGE2 (PGE-MUM), PGE2 and creatinine clearance were measured before and on day 2 of each treatment period. Compliance was tested by measuring metabolites of the two drugs in urine. 3. Paracetamol did not reduce urinary excretion of PGE2 whereas both dosages of acetylsalicylic acid caused a significant reduction. 4. The combination of both drugs did not reduce PGE2 excretion more than acetylsalicylic acid alone. 5. All four drug schedules reduced urinary excretion of PGE-MUM significantly. PMID:2310655

  4. Effect of penicillin on fatty acid synthesis and excretion in Streptococcus mutans BHT

    SciTech Connect

    Brissette, J.L.; Pieringer, R.A.

    1985-03-01

    Treatment of exponentially growing cultures of Streptococcus mutans BHT with growth-inhibitory concentrations (0.2 microgram/ml) of benzylpenicillin stimulates the incorporation of (2-/sup 14/C) acetate into lipids excreted by the cells by as much as 69-fold, but does not change the amount of /sup 14/C incorporated into intracellular lipids. At this concentration of penicillin cellular lysis does not occur. The radioactive label is incorporated exclusively into the fatty acid moieties of the glycerolipids. During a 4-hr incubation in the presence of penicillin, the extracellular fatty acid ester concentration increases 1.5 fold, even though there is no growth or cellular lysis. An indication of the relative rate of fatty acid synthesis was most readily obtained by placing S. mutans BHT in a buffer containing /sup 14/C-acetate. Under these nongrowing conditions free fatty acids are the only lipids labeled, a factor which simplifies the assay. The addition of glycerol to the buffer causes all of the nonesterified fatty acids to be incorporated into glycerolipid. The cells excrete much of the lipid whether glycerol is present or not. Addition of penicillin to the nongrowth supporting buffer system does not stimulate the incorporation of (/sup 14/C)-acetate into fatty acids.

  5. Facile one-pot synthesis of gold nanoparticles using tannic acid and its application in catalysis

    NASA Astrophysics Data System (ADS)

    Aswathy Aromal, S.; Philip, Daizy

    2012-04-01

    The paper reports a simple and efficient method for the synthesis of stable, nearly spherical gold nanoparticles using tannic acid as both the reducing and stabilizing agent. The nanoparticles are characterized by UV-visible spectroscopy, transmission electron microscopy (TEM), EDX and X-ray diffraction (XRD) analysis. The influence of tannic acid on the control of size and shape of gold nanoparticles is reported. Upon an increase in the concentration of tannic acid, there is a shift in the shape of nanoparticles as evidenced by the change in bandwidth and peak position of the surface plasmon resonance (SPR) band. Also, it is found that tannic acid ceases to act as a reducing agent beyond the limit of 10 mL (6×10-3 M) for 30 mL of HAuCl4 (1.3×10-3 M). On increasing the quantity of tannic acid, nucleation is favored in the initial stages and thereafter growth supersedes nucleation. The stable colloids obtained by this method are found to consist of nanoparticles with average size 8 and 12 nm. The crystallinity of the sample with fcc phase is observed from TEM, SAED and XRD pattern. Involvement of carboxylic acid group in capping of gold nanoparticles is evident from the FTIR spectrum. The application of the synthesized nanoparticles as catalyst in the reduction of 4-Nitrophenol to 4-Aminophenol is also reported.

  6. Synthesis and antimicrobial activities of new higher amino acid Schiff base derivatives of 6-aminopenicillanic acid and 7-aminocephalosporanic acid

    NASA Astrophysics Data System (ADS)

    Özdemir (nee Güngör), Özlem; Gürkan, Perihan; Özçelik, Berrin; Oyardı, Özlem

    2016-02-01

    Novel β-lactam derivatives (1c-3c) (1d-3d) were produced by using 6-aminopenicillanic acid (6-APA), 7-aminocephalosporanic acid (7-ACA) and the higher amino acid Schiff bases. The synthesized compounds were characterized by elemental analysis, IR, 1H/13C NMR and UV-vis spectra. Antibacterial activities of all the higher amino acid Schiff bases (1a-3a) (1b-3b) and β-lactam derivatives were screened against three gram negative bacteria (Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, Acinetobacter baumannii RSKK 02026), three gram positive bacteria (Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 07005, Bacillus subtilis ATCC 6633) and their drug-resistant isolates by using broth microdilution method. Two fungi (Candida albicans and Candida krusei) were used for antifungal activity.

  7. Novel approach to the zaragozic acids. Enantioselective total synthesis of 6,7-dideoxysqualestatin H5.

    PubMed

    Naito, Satoru; Escobar, Maya; Kym, Philip R; Liras, Spiros; Martin, Stephen F

    2002-06-14

    The total synthesis of 6,7-dideoxysqualestatin H5 (3) has been completed by a concise approach that features the stereoselective intramolecular vinylogous aldol reaction of the furoic ester 25a to give 30 or its trimethylsilyl ether derivative 34, which possess the requisite absolute stereochemistry at C(3)-C(5) of 3. Compound 34 was reduced to the saturated bislactone 39, and the C(1) side chain subunit 47 was introduced leading to a mixture of the hemiacetals 48 and the corresponding ketone 49. When this mixture was stirred with methanolic acid, transketalization occurred to give a mixture of 50 and the spirocyclic methyl acetals 51a,b. Oxidation of the primary alcohol group in 50 followed by saponification of the two remaining ester groups gave 3. The longest linear sequence in the synthesis commences with commercially available erythronolactone (26) and requires 17 chemical steps with only 10 isolated intermediates. PMID:12054955

  8. SYNTHESIS AND CHARACTERIZATION OF SUBSTITUTED POLY(STYRENE)-b-POLY(ACRYLIC ACID) BLOCK COPOLYMER MICELLES

    SciTech Connect

    Pickel, Deanna L; Pickel, Joseph M; Devenyi, Jozsef; Britt, Phillip F

    2009-01-01

    Block copolymer micelle synthesis and characterization has been extensively studied. In particular, most studies have focused on the properties of the hydrophilic corona due to the micelle corona structure s impact on the biodistribution and biocompatibility. Unfortunately, less attention has been given to the effect of the core block on the micelle stability, morphology, and the rate of diffusion of small molecules from the core. This investigation is focused on the synthesis of block copolymers composed of meta-substituted styrenes and acrylic acid by Atom Transfer Radical Polymerization. Micelles with cores composed of substituted styrenes having Tgs ranging from -30 to 100 oC have been prepared and the size and shape of these micelles were characterized by Static and Dynamic Light Scattering and TEM. In addition, the critical micelle concentration and rate of diffusion of small molecules from the core were determined by fluorimetry using pyrene as the probe.

  9. Synthesis of nucleic acid probes on membrane supports: A procedure for the removal of unincorporated precursors

    SciTech Connect

    Bhat, S.P. )

    1990-01-01

    We have used DNA bound to small pieces of nylon membrane for the synthesis of radioactive probes. The DNA to be used for generating the probe(s) is first bound to nylon membranes and then introduced into the reaction mix. The labeling reaction takes place on the membrane and therefore allows easy removal of unincorporated precursors by simple washing for 1-2 min. The clean labeled probe is eluted from the membrane in formamide or in water and is ready for use. This DNA-membrane can be stored for reuse. Synthesis of probes on a solid support such as nylon membrane thus circumvents problems associated with chromatographic manipulations needed for the separation of labeled DNA from unicorporated precursors. Probes synthesized in this manner are as efficient in detecting nucleic acid sequences as those synthesized in solution.

  10. High-yield synthesis of bioactive ethyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Zhang, Jiang-Yan; Chen, Na; Zhi, Gao-Ying

    2016-01-01

    In this paper, Lipozyme TLIM-catalyzed synthesis of ethyl cinnamate through esterification of cinnamic acid with ethanol was studied. In order to increase the yield of ethyl cinnamate, several media, including acetone, isooctane, DMSO and solvent-free medium, were investigated in this reaction. The reaction showed a high yield by using isooctane as reaction medium, which was found to be much higher than the yields reported previously. Furthermore, several parameters such as shaking rate, water activity, reaction temperature, substrate molar ratio and enzyme loading had important influences on this reaction. For instance, when temperature increased from 10 to 50 °C, the initial reaction rate increased by 18 times and the yield of ethyl cinnamate increased by 6.2 times. Under the optimum conditions, lipase-catalyzed synthesis of ethyl cinnamate gave a maximum yield of 99%, which was of general interest for developing industrial processes for the preparation of ethyl cinnamate. PMID:26213020

  11. Challenges in the Synthesis of a Unique Mono-Carboxylic Acid Antibiotic (+)-Zincophorin

    PubMed Central

    Song, Zhenlei; Lohse, Andrew G.; Hsung, Richard P.

    2009-01-01

    (+)-Zincophorin, also referred to as M144255 or griseochellin, is a polyoxygenated ionophoric antibiotic that was isolated from Streptomyces griseus in 1984. It possesses strong in vivo activity against Gram-positive bacteria and Clostridium coelchii. Its methyl ester was reported in a patent as having strong inhibitory properties against influenza WSN/virus with reduced toxicity for the host cell. Its ability to strongly bind with Zn2+, which is also present in its X-ray structure, is the basis for its name. Over the last two decades, (+)-zincophorin h as attracted an impressive array of synthetic efforts including Danishefsky's first total synthesis along with two recent elegant total syntheses reported by Cossy and Miyashita as well as our own formal total synthesis. This Account provides a comparison of the different synthetic efforts on this novel mono-carboxylic acid antibiotic and documents its interesting isolation, structure determination, and biological activities. PMID:19642422

  12. Synthesis of ettringite: a way to deal with the acid wastewaters of aluminium anodising industry.

    PubMed

    Alvarez-Ayuso, E; Nugteren, H W

    2005-01-01

    Synthesis of ettringite from acid wastewaters of the aluminium anodising industry has been studied as a possible route of reducing the emissions to the environment, recovering at the same time resource materials as a useful marketable mineral. Wastewaters of different concentrations have been subjected to the process of synthesis suspending calcium oxide and calcium aluminate powders at different time and pH conditions. High caustic alkalinity (pH approximately 12) and low sulphate concentrations (<0.1 M) are the most suitable conditions to synthesise ettringite. The mineral characterisation has been performed using X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TGA) and differential thermal analysis (DTA), proving the high purity of the pursued solid product when hydrated in the appropriate sodium hydroxide concentrations. In such conditions, around 90% of the aluminium initially present in the wastewater solutions is recovered in the form of ettringite. PMID:15607165

  13. Synthesis of nucleic acid probes on membrane supports: a procedure for the removal of unincorporated precursors.

    PubMed

    Bhat, S P

    1990-01-01

    We have used DNA bound to small pieces of nylon membrane for the synthesis of radioactive probes. The DNA to be used for generating the probe(s) is first bound to nylon membranes and then introduced into the reaction mix. The labeling reaction takes place on the membrane and therefore allows easy removal of unincorporated precursors by simple washing for 1-2 min. The clean labeled probe is eluted from the membrane in formamide or in water and is ready for use. This DNA-membrane can be stored for reuse. Synthesis of probes on a solid support such as nylon membrane thus circumvents problems associated with chromatographic manipulations needed for the separation of labeled DNA from unicorporated precursors. Probes synthesized in this manner are as efficient in detecting nucleic acid sequences as those synthesized in solution. PMID:2321760

  14. Total synthesis and biological evaluation of (+)-gambieric acid A and its analogues.

    PubMed

    Ishigai, Kazuya; Fuwa, Haruhiko; Hashizume, Keisuke; Fukazawa, Ryo; Cho, Yuko; Yotsu-Yamashita, Mari; Sasaki, Makoto

    2013-04-22

    In this study, we report the first total synthesis and complete stereostructure of gambieric acid A, a potent antifungal polycyclic ether metabolite, in detail. The A/B-ring exocyclic enol ether 32 was prepared through a Suzuki-Miyaura coupling of the B-ring vinyl iodide 18 and the alkylborate 33 and subsequent closure of the A-ring by using diastereoselective bromoetherification as the key transformation. Suzuki-Miyaura coupling of 32 with acetate-derived enol phosphate 49, followed by ring-closing metathesis of the derived diene, produced the D-ring. Subsequent closure of the C-ring through a mixed thioacetalization completed the synthesis of the A/BCD-ring fragment 8. The A/BCD- and F'GHIJ-ring fragments (i.e., 8 and 9) were assembled through Suzuki-Miyaura coupling. The C25 stereogenic center was elaborated by exploiting the intrinsic conformational property of the seven-membered F'-ring. After the oxidative cleavage of the F'-ring, the E-ring was formed as a cyclic mixed thioacetal (i.e., 70) and then stereoselectively allylated by using glycosylation chemistry. Ring-closing metathesis of the diene 3 thus obtained closed the F-ring and completed the polycyclic ether skeleton. Finally, the J-ring side chain was introduced by using a Julia-Kocienski olefination in the presence of CeCl3 to complete the total synthesis of gambieric acid A (1), thereby unambiguously establishing its complete stereostructure. The present total synthesis enabled us to evaluate the antifungal and antiproliferative activities of 1 and several synthetic analogues. PMID:23554126

  15. Facile synthesis of graphene from graphite using ascorbic acid as reducing agent

    NASA Astrophysics Data System (ADS)

    Andrijanto, Eko; Shoelarta, Shoerya; Subiyanto, Gatot; Rifki, Sadur

    2016-04-01

    Graphene has attracted a tremendous attention in recent years due to its unique properties such as mechanical, thermal, optical and electrical properties. However, a large scale production of this material is still an issue and subjected to intense research efforts. Here, we show a simple and green approach of the graphene synthesis from graphene oxide using ascorbic acid as reduction agent. A facile synthesis of graphene (rGO) through chemical oxidation of graphite into graphene oxide (GO) was described using modified Hummers method (Improved Tour Method/ITM). The ITM method does not produce toxic gas and the temperature of the oxidation is easily controlled using ice bath. The synthesized of graphene oxide was highly soluble and stable in water. The reduction of graphene oxide into graphene was performed using ascorbic acid (AA) in mild condition. The combined ITM method and green reduction using ascorbic acid open the avenue of replacing hydrazine in the reduction of graphite oxide into graphene and may be very important step for bulk production of graphene.

  16. Regulation of Lipid Synthesis in Soybeans by Two Benzoic Acid Herbicides 1

    PubMed Central

    Muslih, Raad K.; Linscott, Dean L.

    1977-01-01

    The effects of 3-nitro-2,5-dichlorobenzoic acid (dinoben) and 3-amino-2,4-dichlorobenzoic acid (chloramben) on lipid formation and on the incorporation of various substrates into lipids by intact seeds and subcellular fractions of germinating soybean (Glycine max [L.] Merr. `Amsoy') were studied. Dinoben (20 μg/ml) inhibited synthesis of total lipids 67%, neutral lipids 73%, glycolipids 51%, and phospholipids 39% in germinating seeds. When polar lipids were analyzed further, inhibition of individual lipid classes was also observed. Chloramben (20 μg/ml) stimulated total lipid synthesis 25%. With the exception of the mitochondrial fraction where malonate thiokinase was absent, dinoben inhibited up to 99% the incorporation of acetate and malonate into lipids, but did not inhibit acetyl-CoA and malonyl-CoA incorporation. Chloramben stimulated the incorporation of all substrates tested into lipids by all fractions except the mitochondrial fraction when malonate was the substrate. When dinoben and chloramben were used in combinations, chloramben did not reverse the inhibitory effect of dinoben. It is concluded that the dinoben inhibitory effect is specific and is associated with the acetate and malonate thiokinase systems. The chloramben effect is stimulatory to either acetyl-CoA carboxylase or fatty acid synthetase or both. PMID:16660173

  17. Sugar amino acid based scaffolds--novel peptidomimetics and their potential in combinatorial synthesis.

    PubMed

    Chakraborty, Tushar K; Jayaprakash, Sarva; Ghosh, Subhash

    2002-08-01

    To meet the growing demands for the development of new molecular entities for discovering new drugs and materials, organic chemists have started looking for new concepts to supplement traditional approaches. In one such approach, the expertise gained over the years in the area of organic synthesis and the rational drug-design concepts are combined together to create "nature-like" and yet unnatural organic molecules that are expected to provide leads in discovering new molecules. Emulating the basic principles followed by nature to build its vast repertoire of biomolecules, organic chemists are developing many novel multifunctional building blocks. Sugar amino acids constitute an important class of such polyfunctional scaffolds where the carboxyl, amino and hydroxyl groups provide an excellent opportunity for organic chemists to create structural diversities akin to nature's molecular arsenal. Recent advances in the area of combinatorial chemistry give unprecedented technological support for rapid compilations of sugar amino acid-based libraries exploiting the diversities of carbohydrate molecules and well-developed solid-phase peptide synthesis methods. This review chronicles the development of sugar amino acids as a novel class of peptidomimetic building blocks and their applications in generating desired secondary structures in peptides as well as in creating mimics of natural biopolymers. PMID:12180903

  18. Deoxycholate Bile Acid Directed Synthesis of Branched Au Nanostructures for Near Infrared Photothermal Ablation

    PubMed Central

    Kim, Dong-Hyun; Larson, Andrew C.

    2015-01-01

    We report an approach for simple, reproducible and high-yield synthesis of branched GNPs directed by deoxycholate bile acid supramolecular aggregates in Au solution. A growth process involving stepwise trapping of the GNP seeds and Au ions in the deoxycholate bile acid solution yields multiple-branched GNPs. Upon NIR laser irradiation strong NIR absorption for branched GNPs induced photothermal-heating to destroy tumor cells. Subsequently, these branched GNPs were bio-functionalized with cRGD cell penetrating-targeting peptides for photothermal cancer treatment applications. Branched GNPs conjugated with cRGD peptides enhanced internalization of the branched GNPs in BxPC3 human pancreatic adenocarcinoma cells and effectively ablated BxPC3 cells when irradiated with a NIR laser (808 nm). Their potential use as photothermal transducing agents was demonstrated in in vivo settings using a pancreatic cancer xenograft model. The tumors were effectively ablated with cRGD-branched GNPs injection and laser exposure without any observation of tumor recurrence. This firstly reported method for deoxycholate bile acid directed synthesis of branched GNPs opens new possibilities for the production of strong NIR absorbing nanostructures for selective nanophotothermolisys of cancer cells and the further design of novel materials with customized spectral and structural properties for broader applications. PMID:25934288

  19. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9. PMID:24184513

  20. Cell proliferation and progesterone synthesis depend on lipid metabolism in bovine granulosa cells.

    PubMed

    Elis, Sebastien; Desmarchais, Alice; Maillard, Virginie; Uzbekova, Svetlana; Monget, Philippe; Dupont, Joëlle

    2015-03-15

    In dairy cows, lipids are essential to support energy supplies for all biological functions, especially during early lactation. Lipid metabolism is crucial for sustaining proper reproductive function. Alteration of lipid metabolism impacts follicular development and affects oocyte developmental competence. Indeed, nonesterified fatty acids are able to decrease granulosa cell (GC) proliferation and affect estradiol synthesis, thus potentially affecting follicular growth and viability. The objective of this study was to assess the impact of lipid metabolism on bovine GCs, through the use of the lipid metabolism inhibitors etomoxir, an inhibitor of fatty acid (FA) oxidation through inhibition of carnitine palmitoyl transferase 1 (CPT1), and C75, an inhibitor of FA synthesis through inhibition of fatty acid synthase. We showed that etomoxir and C75 significantly inhibited DNA synthesis in vitro; C75 also significantly decreased progesterone synthesis. Both inhibitors significantly reduced AMPK (5' adenosine monophosphate-activated protein kinase) and acetyl-CoA carboxylase phosphorylation. Etomoxir also affected the AKT (protein kinase B) signaling pathway. Combined, these data suggest that both FA oxidation and synthesis are important for the bovine GCs to express a proliferative and steroidogenic phenotype and, thus, for sustaining follicular growth. Despite these findings, it is important to note that the changes caused by the inhibitors of FA metabolism on GCs in vitro are globally mild, suggesting that lipid metabolism is not as critical in GCs as was observed in the oocyte-cumulus complex. Further studies are needed to investigate the detailed mechanisms by which lipid metabolism interacts with GC functions. PMID:25583222

  1. Microbial synthesis of polyhydroxyalkanoate using seaweed-derived crude levulinic acid as co-nutrient.

    PubMed

    Bera, Anupam; Dubey, Sonam; Bhayani, Khushbu; Mondal, Dibyendu; Mishra, Sandhya; Ghosh, Pushpito K

    2015-01-01

    Production of polyhydroxyalkanoates (PHAs) from Jatropha biodiesel residues, namely crude glycerol and oil cake hydrolysate, has been reported previously. Halomonas hydrothermalis (MTCC accession no. 5445; NCBI Genbank accession no. GU938192), a wild marine strain, was used in the bio-synthesis. The present study was initiated to vary the properties of the polymer. Seaweed-derived crude levulinic acid (SDCLA), containing formic acid, residual sugars and dissolved minerals additionally, was proposed as co-feed along with the biodiesel residues. Experiments were conducted at 100mL scale in batch process. Whereas the PHA yield was only 0.40 ± 0.01 g when only biodiesel residues were employed, it rose to 1.07 ± 0.02 g in presence of 0.35% (w/v) of SDCLA. The corresponding carbon utilisation efficiencies were 29.3% and 57.5%, respectively. 3-Hydroxy valerate incorporation in the PHA was pronounced in presence of SDCLA, with associated changes in polymer properties. The microbial synthesis fared poorly when SDCLA was substituted with pure levulinic acid. Thus, Halomonas hydrothermalis had a poor response to levulinic acid, as such, and other constituents present in SDCLA appear to have played a vital role in bacterial cell division and accumulation of PHA. Biodegradability tests in moist soil were also conducted as part of the study. Marine microalgal cultivation for biodiesel and seaweed cultivation for fuels may help generate biodiesel residues and crude levulinic acid in proximity, which would open up the possibility of large scale PHA manufacture in efficient and practical manner in the future through the methodology of the present study. PMID:25193103

  2. The regulation of triglyceride synthesis and fatty acid synthesis in rat epididymal adipose tissue. Effects of altered dietary and hormonal conditions

    PubMed Central

    Saggerson, E. D.; Greenbaum, A. L.

    1970-01-01

    1. Epididymal adipose tissues obtained from rats that had been previously starved, starved and refed a high fat diet for 72h, starved and refed bread for 144h or fed a normal diet were incubated in the presence of insulin+glucose or insulin+glucose+acetate. 2. Measurements were made of the whole-tissue concentrations of hexose phosphates, triose phosphates, glycerol 1-phosphate, 3-phosphoglycerate, 6-phosphogluconate, adenine nucleotides, acid-soluble CoA, long-chain fatty acyl-CoA, malate and citrate after 1h of incubation. The release of lactate, pyruvate and glycerol into the incubation medium during this period was also determined. 3. The rates of metabolism of glucose in the hexose monophosphate pathway, the glycolytic pathway, the citric acid cycle and into glyceride glycerol, fatty acids and lactate+pyruvate were also determined over a 2h period in similarly treated tissues. The metabolism of acetate to CO2 and fatty acids in the presence of glucose was also measured. 4. The activities of acetyl-CoA carboxylase, fatty acid synthetase and isocitrate dehydrogenase were determined in adipose tissues from starved, starved and fat-refed, and alloxan-diabetic animals and also in tissues from animals that had been starved and refed bread for up to 96h. Changes in these activities were compared with the ability of similar tissues to incorporate [14C]glucose into fatty acids in vitro. 5. The activities of acetyl-CoA carboxylase and fatty acid synthetase roughly paralleled the ability of tissues to incorporate glucose into fatty acids. 6. Rates of triglyceride synthesis and fatty acid synthesis could not be correlated with tissue concentrations of long-chain fatty acyl-CoA, citrate or glycerol 1-phosphate. In some cases changes in phosphofructokinase flux rates could be correlated with changes in citrate concentration. 7. The main lesion in fatty acid synthesis in tissues from starved, starved and fat-refed, and alloxan-diabetic rats appeared to reside at the level of

  3. Synthesis of boron suboxide from boron and boric acid under mild pressure and temperature conditions

    SciTech Connect

    Jiao, Xiaopeng; Jin, Hua; Ding, Zhanhui; Yang, Bin; Lu, Fengguo; Zhao, Xudong; Liu, Xiaoyang; Peng, Liping

    2011-05-15

    Graphical abstract: Well-crystallized and icosahedral B{sub 6}O crystals were prepared by reacting boron and boric acid at milder reaction conditions (1 GPa and 1300 {sup o}C for 2 h) as compared to previous work.. Research highlights: {yields} Well-crystallized icosahedral B{sub 6}O was synthesized by reacting boric acid and boron. {yields} The synthesis conditions (1 GPa and 1300 {sup o}C for 2 h) are milder in comparison with previous work. {yields} The more practical synthesis method may make B{sub 6}O as a potential substitute for diamond in industry. -- Abstract: Boron suboxide (B{sub 6}O) was synthesized by reacting boron and boric acid (H{sub 3}BO{sub 3}) at pressures between 1 and 10 GPa, and at temperatures between 1300 and 1400 {sup o}C. The B{sub 6}O samples prepared were icosahedral with diameters ranging from 20 to 300 nm. Well-crystallized and icosahedral crystals with an average size of {approx}100 nm can be obtained at milder reaction conditions (1 GPa and 1300 {sup o}C for 2 h) as compared to previous work. The bulk B{sub 6}O sample was stable in air at 600 {sup o}C and then slowly oxidized up to 1000 {sup o}C. The relatively mild synthetic conditions developed in this study provide a more practical synthesis of B{sub 6}O, which may potentially be used as a substitute for diamond in industry as a new superhard material.

  4. Nature’s Starships. II. Simulating the Synthesis of Amino Acids in Meteorite Parent Bodies

    NASA Astrophysics Data System (ADS)

    Cobb, Alyssa K.; Pudritz, Ralph E.; Pearce, Ben K. D.

    2015-08-01

    Carbonaceous chondrite meteorites are known for having high water and organic material contents, including amino acids. Here we address the origin of amino acids in the warm interiors of their parent bodies (planetesimals) within a few million years of their formation, and we connect this with the astrochemistry of their natal protostellar disks. We compute both the total amino acid abundance pattern and the relative frequencies of amino acids within the CM2 (e.g., Murchison) and CR2 chondrite subclasses based on Strecker reactions within these bodies. We match the relative frequencies to well within an order of magnitude among both CM2 and CR2 meteorites for parent body temperatures <200°C. These temperatures agree with 3D models of young planetesimal interiors. We find theoretical abundances of approximately 7 × 105 parts per billion, which is in agreement with the average observed abundance in CR2 meteorites of (4 ± 7) × 105, but an order of magnitude higher than the average observed abundance in CM2 meteorites of (2 ± 2) × 104. We find that the production of hydroxy acids could be favored over the production of amino acids within certain meteorite parent bodies (e.g., CI1, CM2) but not others (e.g., CR2). This could be due to the relatively lower NH3 abundances within CI1 and CM2 meteorite parent bodies, which leads to less amino acid synthesis. We also find that the water content in planetesimals is likely to be the main cause of variance between carbonaceous chondrites of the same subclass. We propose that amino acid abundances are primarily dependent on the ammonia and water content of planetesimals that are formed in chemically distinct regions within their natal protostellar disks.

  5. Iron-Catalyzed Diastereoselective Synthesis of Unnatural Chiral Amino Acid Derivatives.

    PubMed

    Zhang, Hao; Li, Haifang; Yang, Haijun; Fu, Hua

    2016-07-15

    An iron-catalyzed diastereoselective synthesis of unnatural chiral (S)-α-amino acids with γ-quaternary carbon centers has been developed. The protocol uses inexpensive iron salt as the catalyst, readily available 2-phthaloyl acrylamide and alkenes as the starting materials, and phenylsilane as the reductant, and the reactions were performed well in mixed solvent of 1,2-dichloroethane and ethylene glycol at room temperature. The method shows some advantages including simple and wide substrates, mild conditions, high diastereoselectivity, and easy workup procedures. PMID:27367820

  6. Synthesis of carboxymethylcellulose/acrylic acid hydrogels with superabsorbent properties by radiation-initiated crosslinking

    NASA Astrophysics Data System (ADS)

    Fekete, Tamás; Borsa, Judit; Takács, Erzsébet; Wojnárovits, László

    2016-07-01

    Superabsorbent hydrogels were prepared by gamma irradiation from aqueous solutions of carboxymethylcellulose (CMC) and acrylic acid (AAc) with varying CMC:AAc ratio. By partially replacing the CMC with AAc the gelation increased and led to a higher gel fraction and lower water uptake. Moreover, the gelation required significantly milder synthesis conditions. Decreasing both the dose and the solute concentration in the presence of AAc led to gels with higher gel fraction and higher degree of swelling compared to pure CMC gels. Increasing the AAc content up to 10% proved to be very effective, while very high AAc content (over 50%) hindered the gelation process.

  7. Novel synthesis of 2-[18F]-fluoroisonicotinic acid hydrazide and initial biological evaluation.

    PubMed

    Amartey, J K; Al-Jammaz, I; Al-Otaibi, B; Esguerra, C

    2002-11-01

    2-[18F]-Fluoroisonicotinic acid hydrazide was synthesized by nucleophilic displacement reaction on ethyl-2- (trimethylammonium)-isonicotinate precursor in acetonitrile. Kryptofix 222 was used as the phase transfer catalyst. The intermediate fluorinated ethyl ester reacted with hydrazine hydrate to produce the hydrazide in excellent radiochemical yield. The overall radiochemical yield was greater than 70% with total synthesis time of approximately 60 minutes. Biological evaluation was performed in bacterial cells and biodistribution in normal CBA/J mice. It was found that the S. pneumoniae cells retained the radiotracer in an in vitro assay. PMID:12453591

  8. Physiology and molecular genetics of poly(beta-hydroxy-alkanoic acid) synthesis in Alcaligenes eutrophus.

    PubMed

    Steinbüchel, A; Schlegel, H G

    1991-03-01

    The Alcaligenes eutrophus genes for beta-ketothiolase, NADPH-dependent acetoacetyl-CoA reductase and poly(beta-hydroxybutyric acid) synthase (PHB synthase) which comprise the three-step PHB-biosynthetic pathway, were cloned. Molecular studies revealed that these genes are organized in a single operon. The A. eutrophus PHB-biosynthetic genes are readily expressed in other bacteria, and DNA fragments harbouring the operon can be used as a cartridge to confer to other bacteria the ability to synthesize PHB from acetyl-CoA. The biochemical and physiological capabilities of A. eutrophus for the synthesis of a wide variety of polyhydroxyalkanoates are discussed. PMID:2046547

  9. Microwave-assisted polyol synthesis of carbon nitride dots from folic acid for cell imaging

    PubMed Central

    Guan, Weiwei; Gu, Wei; Ye, Ling; Guo, Chenyang; Su, Su; Xu, Pinxiang; Xue, Ming

    2014-01-01

    A green, one-step microwave-assisted polyol synthesis was employed to prepare blue luminescent carbon nitride dots (CNDs) using folic acid molecules as both carbon and nitrogen sources. The as-prepared CNDs had an average size of around 4.51 nm and could be well dispersed in water. Under excitation at 360 nm, the CNDs exhibited a strong blue luminescence and the quantum yield was estimated to be 18.9%, which is greater than that of other reported CNDs. Moreover, the CNDs showed low cytotoxicity and could efficiently label C6 glioma cells, demonstrating their potential in cell imaging. PMID:25382977

  10. Microwave-assisted polyol synthesis of carbon nitride dots from folic acid for cell imaging.

    PubMed

    Guan, Weiwei; Gu, Wei; Ye, Ling; Guo, Chenyang; Su, Su; Xu, Pinxiang; Xue, Ming

    2014-01-01

    A green, one-step microwave-assisted polyol synthesis was employed to prepare blue luminescent carbon nitride dots (CNDs) using folic acid molecules as both carbon and nitrogen sources. The as-prepared CNDs had an average size of around 4.51 nm and could be well dispersed in water. Under excitation at 360 nm, the CNDs exhibited a strong blue luminescence and the quantum yield was estimated to be 18.9%, which is greater than that of other reported CNDs. Moreover, the CNDs showed low cytotoxicity and could efficiently label C6 glioma cells, demonstrating their potential in cell imaging. PMID:25382977

  11. Synergistic Acid-Catalyzed Synthesis of N-Aryl-Substituted Azacycles from Anilines and Cyclic Ethers.

    PubMed

    Zhang, Zhenbei; Miao, Chengxia; Xia, Chungu; Sun, Wei

    2016-04-01

    A metal-free and efficient approach to N-aryl-substituted azacycles from arylamines and cyclic ethers is described. In this synthesis, the synergistic effect between Lewis and Brønsted acids is crucial to the ring-opening of cyclic ethers and the subsequent cyclization. The use of B(C6F5)3 enabled the formation of frustrated Lewis pairs (FLPs) from the reactants, and the resulting FLPs allowed ready access to the N-arylazacycles in moderate to good yields via further cyclization. Water is the sole waste resulting from the reaction, thereby making it an environmentally benign process. PMID:26962879

  12. Heteroatom-directed reverse Wacker oxidations. Synthesis of the reported structure of (-)-herbaric acid.

    PubMed

    Choi, Peter J; Sperry, Jonathan; Brimble, Margaret A

    2010-11-01

    A microwave-assisted chemoenzymatic resolution has been used to install the C3 stereocenter of the reported structure of the fungal metabolite herbaric acid in high enantiomeric excess. The synthesis and stereochemical assignment was accomplished using a completely regioselective anti-Markovnikov addition of water to vinylphthalide 3, achieved using a heteroatom-directed Wacker oxidation that proceeds with retention of stereochemistry. These results establish that so-called "reverse" Wacker oxidations are a viable alternative to hydroboration/oxidation procedures. PMID:20873747

  13. Synthesis of phytuberin. 4-endo-tet acid-catalyzed cyclization of alpha-hydroxy epoxides.

    PubMed

    Prangé, Thierry; Rodríguez, María S; Suárez, Ernesto

    2003-05-30

    The total synthesis of phytuberin, a phytoalexin of the Solanum genus, from (-)-alpha-santonin is reported. The key steps include (a) reductive cleavage of the C-O bond of the gamma-lactone with concomitant protection of the C1 double bond, (b) Sharpless stereocontrolled hydroxy-assisted epoxidation of allylic alcohol 6 and simultaneous deprotection of the C1 double bond, (c) a rare 4-endo-tet acid-catalyzed cyclization of an alpha-hydroxy epoxide, and (d) an unprecedented 4-exo selenocyclization of a homoallylic alcohol. PMID:12762747

  14. Synthesis and Proton NMR Spectroscopy of Intra-Vesicular Gamma-Aminobutyric Acid (GABA)*

    PubMed Central

    Wang, Luke Y.-J.; Tong, Rong; Kohane, Daniel S.

    2014-01-01

    We report the synthesis of vesicles containing gamma-aminobutyric acid (GABA), and their proton nuclear magnetic resonance (1H NMR) spectra. These vesicles were constructed to more closely mimic the intracellular environment wherein GABA exists. For this study, these GABA-containing vesicles were examined under 1H NMR as a potential platform for future studies on the differences between aqueous phantoms, ex vivo brain extracts, and in vivo magnetic resonance spectroscopy results. We found that intra-vesicular GABA faithfully yielded the chemical shifts and J-coupling constants of free aqueous GABA, alongside the chemical shift signals of the vesicle wall. PMID:24109882

  15. Structural organization of films based on polyaniline/polysulfonic acid complexes depending on the synthesis method

    SciTech Connect

    Simagina, L. V. Gaynutdinov, R. V.; Stepina, N. D.; Sorokina, K. L.; Morozova, O. V.; Shumakovich, G. P.; Yaropolov, A. I.; Tolstikhina, A. L.

    2010-07-15

    The optical properties and morphology of complexes based on polyaniline (PANI) and poly(2-acrylamido-2-methyl-1-propanesulfonic acid) (PAMPS), depending on their synthesis conditions, have been characterized by UV-visible spectroscopy and atomic force microscopy. The dependence of the electron absorption spectra of PANI/PAMPS complexes and the surface topography of their films on the initiation way of PANI formation (chemical and enzymatic) and the use of promoters of aniline polymerization has been investigated. The aniline polymerization kinetics with and without polymerization promoters has been studied. All PANI/PAMPS complexes are found to have a nanocomposite time-stable structure.

  16. Functional characterization of FaNIP1;1 gene, a ripening-related and receptacle-specific aquaporin in strawberry fruit.

    PubMed

    Molina-Hidalgo, Francisco J; Medina-Puche, Laura; Gelis, Samuel; Ramos, José; Sabir, Farzana; Soveral, Graça; Prista, Catarina; Iglesias-Fernández, Raquel; Caballero, José L; Muñoz-Blanco, Juan; Blanco-Portales, Rosario

    2015-09-01

    Strawberry fruit (Fragaria × ananassa) is a soft fruit with high water content at ripe stage (more than 90% of its fresh weight). Aquaporins play an important role in plant water homeostasis, through the facilitation of water transport and solutes. We report the role played by FaNIP1;1 in the receptacle ripening process. The analysis by qRT-PCR of FaNIP1;1 showed that this gene is mainly expressed in fruit receptacle and has a ripening-related expression pattern that was accompanied by an increase in both the abscisic acid and water content of the receptacle throughout fruit ripening. Moreover, FaNIP1;1 was induced in situations of water deficit. Additionally, we show that FaNIP1;1 expression was positively regulated by abscisic acid and negatively regulated by auxins. The water transport capacity of FaNIP1;1 was determined by a stopped-flow spectroscopy in yeast over-expressing FaNIP1;1. Glycerol, H2O2 and boron transport were also demonstrated in yeast. On the other hand, GFP-FaNIP1;1 fusion protein was located in plasma membrane. In conclusion, FaNIP1;1 seems to play an important role increasing the plasma membrane permeability, that allows the water accumulation in the strawberry fruit receptacle throughout the ripening process. PMID:26259188

  17. Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

    PubMed

    Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

    2014-04-01

    Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. PMID:24571086

  18. Amino acids fail to prevent halothane depression of albumin synthesis: studies in the isolated perfused rat liver.

    PubMed

    Kruskal, J B; Franks, J J; Kirsch, R E

    1991-01-01

    Halothane (1.3 MAC) and ethanol (0.4%) depress albumin synthesis in isolated perfused rat livers (IPRLs). Addition of amino acids prevents depression by ethanol. We have examined the effects of amino acids on albumin synthesis by IPRLs exposed to halothane. Seventeen livers were perfused with a mixture of rat erythrocytes and rabbit plasma. Five were exposed to oxygen/carbon dioxide alone and 12 to oxygen/carbon dioxide with 1.5% halothane. A mixture of 10 essential amino acids was added to the perfusate of six of the halothane-exposed livers to a concentration approximately 10 times the normal rat plasma level. Perfusate concentrations of newly synthesized albumin were measured by radial immunodiffusion, and the rate of synthesis for the 4.25-h study period was calculated. The mean +/- SEM albumin synthetic rate (mg/h per 300-g rat) in the control group (12.13 +/- 1.36) was significantly greater than in the group receiving halothane alone (6.98 +/- 0.92). Amino acid treatment failed to prevent halothane depression of albumin synthesis (8.68 +/- 0.84). Thus, although amino acids block ethanol depression of albumin synthesis, we could show no such effect in rat livers exposed to halothane. PMID:1984365

  19. The DNA gyrase inhibitors, nalidixic acid and oxolinic acid, prevent iron-mediated repression of catechol siderophore synthesis in Azotobacter vinelandii.

    PubMed

    Page, W J; Patrick, J

    1988-01-01

    Low concentrations of nalidixic acid and oxolinic acid that were just inhibitory to Azotobacter vinelandii growth promoted the production of the catechol siderophores azotochelin and aminochelin, in the presence of normally repressive concentrations of Fe3+. There was a limited effect on the pyoverdin siderophore, azotobactin, where low concentrations of Fe3+ were rendered less repressive, but the repression by higher concentrations of Fe3+ was normal. These drugs did not induce high-molecular-mass iron-repressible outer-membrane proteins and similar effects on the regulation of catechol siderophore synthesis were not produced by novobiocin, coumermycin, or ethidium bromide. The timing of nalidixic acid and Fe3+ addition to iron-limited cells was critical. Nalidixic acid had to be added before iron-repression of catechol siderophore synthesis and before the onset of iron-sufficient growth. Continued production of the catechol siderophores, however, was not due to interference with normal iron uptake. These data indicated that nalidixic acid prevented normal iron-repression of catechol siderophore synthesis but could not reverse iron repression once it had occurred. The possible roles of DNA gyrase activity in the regulation of catechol siderophore synthesis is discussed. PMID:2856355

  20. Poly-lactic acid synthesis for application in biomedical devices - a review.

    PubMed

    Lasprilla, Astrid J R; Martinez, Guillermo A R; Lunelli, Betânia H; Jardini, André L; Filho, Rubens Maciel

    2012-01-01

    Bioabsorbable polymers are considered a suitable alternative to the improvement and development of numerous applications in medicine. Poly-lactic acid (PLA,) is one of the most promising biopolymers due to the fact that the monomers may produced from non toxic renewable feedstock as well as is naturally occurring organic acid. Lactic acid can be made by fermentation of sugars obtained from renewable resources as such sugarcane. Therefore, PLA is an eco-friendly product with better features for use in the human body (nontoxicity). Lactic acid polymers can be synthesized by different processes so as to obtain products with an ample variety of chemical and mechanical properties. Due to their excellent biocompatibility and mechanical properties, PLA and their copolymers are becoming widely used in tissue engineering for function restoration of impaired tissues. In order to maximize the benefits of its use, it is necessary to understand the relationship between PLA material properties, the manufacturing process and the final product with desired characteristics. In this paper, the lactic acid production by fermentation and the polymer synthesis such biomaterial are reviewed. The paper intends to contribute to the critical knowledge and development of suitable use of PLA for biomedical applications. PMID:21756992