Science.gov

Sample records for acid fa synthesis

  1. Design of an effective bifunctional catalyst organotriphosphonic acid-functionalized ferric alginate (ATMP-FA) and optimization by Box-Behnken model for biodiesel esterification synthesis of oleic acid over ATMP-FA.

    PubMed

    Liu, Wei; Yin, Ping; Liu, Xiguang; Qu, Rongjun

    2014-12-01

    Biodiesel production has become an intense research area because of rapidly depleting energy reserves and increasing petroleum prices together with environmental concerns. This paper focused on the optimization of the catalytic performance in the esterification reaction of oleic acid for biodiesel production over the bifunctional catalyst organotriphosphonic acid-functionalized ferric alginate ATMP-FA. The reaction parameters including catalyst amount, ethanol to oleic acid molar ratio and reaction temperature have been optimized by response surface methodology (RSM) using the Box-Behnken model. It was found that the reaction temperature was the most significant factor, and the best conversion ratio of oleic acid could reach 93.17% under the reaction conditions with 9.53% of catalyst amount and 8.62:1 of ethanol to oleic acid molar ratio at 91.0 °C. The research results show that two catalytic species could work cooperatively to promote the esterification reaction, and the bifunctional ATMP-FA is a potential catalyst for biodiesel production.

  2. Blood compatibility of a ferulic acid (FA)-eluting PHBHHx system for biodegradable magnesium stent application.

    PubMed

    Zhang, Erlin; Shen, Feng

    2015-01-01

    Magnesium stent has shown potential application as a new biodegradable stent. However, the fast degradation of magnesium stent limited its clinic application. Recently, a biodegradable and drug-eluting coating system was designed to prevent magnesium from fast degradation by adding ferulic acid (FA) in poly (3-hydroxybutyrate-co-3-hydroxyhexanoate) (PHBHHx) by a physical method. In vitro study has demonstrated that the FA-eluting system exhibited strong promotion to the endothelialization, which might be a choice for the stent application. In this paper, the hemolysis rate, the plasma recalcification time (PRT), the plasma prothrombin time (PT) and the kinetic clotting time of the FA-eluting films were investigated and the platelet adhesion was observed in order to assess the blood compatibility of the FA-eluting PHBHHx films in comparison with PHBHHx film. The results have shown that the addition of FA had no influence on the hemolysis, but prolonged PRT, PT and the clotting time and reduced the platelet adhesion and activation, displaying that the FA-eluting PHBHHx exhibited better blood compatibility than PHBHHx. In addition, the effect of alkali treatment on the blood compatibility of FA-eluting PHBHHx was also studied. It was indicated that alkali treatment had no effect on the hemolysis and the coagulation time, but enhanced slightly the platelet adhesion. All these demonstrated that FA-eluting PHBHHx film had good blood compatibility and might be a candidate surface coating for the biodegradable magnesium stent.

  3. Poly(3-Hydroxybutyrate) Synthesis Genes in Azotobacter sp. Strain FA8

    PubMed Central

    Pettinari, M. Julia; Vázquez, Gustavo J.; Silberschmidt, Daniel; Rehm, Bernd; Steinbüchel, Alexander; Méndez, Beatriz S.

    2001-01-01

    Genes responsible for the synthesis of poly(3-hydroxybutyrate) (PHB) in Azotobacter sp. FA8 were cloned and analyzed. A PHB polymerase gene (phbC) was found downstream from genes coding for β-ketothiolase (phbA) and acetoacetyl-coenzyme A reductase (phbB). A PHB synthase mutant was obtained by gene inactivation and used for genetic studies. The phbC gene from this strain was introduced into Ralstonia eutropha PHB-4 (phbC-negative mutant), and the recombinant accumulated PHB when either glucose or octanoate was used as a source of carbon, indicating that this PHB synthase cannot incorporate medium-chain-length hydroxyalkanoates into PHB. PMID:11679365

  4. Analysis of ATP-citrate lyase and malic enzyme mutants of Yarrowia lipolytica points out the importance of mannitol metabolism in fatty acid synthesis.

    PubMed

    Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc

    2015-09-01

    The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica.

  5. Glucomannan- and glucomannan plus spirulina-enriched pork affect liver fatty acid profile, LDL receptor expression and antioxidant status in Zucker fa/fa rats fed atherogenic diets

    PubMed Central

    González-Torres, Laura; Matos, Cátia; Vázquez-Velasco, Miguel; Santos-López, Jorge A.; Sánchez-Martínez, Iria; García–Fernández, Camino; Bastida, Sara; Benedí, Juana; Sánchez-Muniz, Francisco J.

    2017-01-01

    ABSTRACT We evaluated the effects of glucomannan or glucomannan plus spirulina-restructured pork (RP) on liver fatty acid profile, desaturase/elongase enzyme activities and oxidative status of Zucker fa/fa rats for seven weeks. Control (C), glucomannan (G) and glucomannan/spirulina (GS)-RP; HC (cholesterol-enriched control), HG and HGS (cholesterol-enriched glucomannan and glucomannan/spirulina-RP) experimental diets were tested. Increased metabolic syndrome markers were found in C, G and GS rats. Cholesterol feeding increased liver size, fat, and cholesterol and reduced antioxidant enzyme levels and expressions. Cholesterolemia was lower in HG and HGS than in HC. GS vs. G showed higher stearic but lower oleic levels. SFA and PUFA decreased while MUFA increased by cholesterol feeding. The arachidonic/linoleic and docosahexaenoic/alpha-linolenic ratios were lower in HC, HG, and HGS vs. C, G, and GS, respectively, suggesting a delta-6-elongase-desaturase system inhibition. Moreover, cholesterol feeding, mainly in HGS, decreased low-density-lipoprotein receptor expression and the delta-5-desaturase activity and increased the delta-9-desaturase activity. In conclusion, the liver production of highly unsaturated fatty acids was limited to decrease their oxidation in presence of hypercholesterolaemia. Glucomannan or glucomannan/spirulina-RP has added new attributes to their functional properties in meat, partially arresting the negative effects induced by high-fat-high-cholesterol feeding on the liver fatty acid and antioxidant statuses. PMID:28325998

  6. An H-Infinity Approach to Control Synthesis with Load Minimization for the F/A-18 Active Aeroelastic Wing

    NASA Technical Reports Server (NTRS)

    Lind, Rick

    1999-01-01

    The F/A-18 Active Aeroelastic Wing research aircraft will demonstrate technologies related to aeroservoelastic effects such as wing twist and load minimization. This program presents several challenges for control design that are often not considered for traditional aircraft. This paper presents a control design based on H-infinity synthesis that simultaneously considers the multiple objectives associated with handling qualities, actuator limitations, and loads. A point design is presented to demonstrate a controller and the resulting closed-loop properties.

  7. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  8. Relationship of lipogenic enzyme activities to the rate of rat liver fatty acid synthesis

    SciTech Connect

    Nelson, G.; Kelley, D.; Schmidt, P.; Virk, S.; Serrato, C.

    1986-05-01

    The mechanism by which diet regulates liver lipogenesis is unclear. Here the authors report how dietary alterations effect the activities of key enzymes of fatty acid (FA) synthesis. Male Sprague-Dawley rats, 400-500 g, were fasted for 48h and then refed a fat-free, high carbohydrate (HC) diet (75% cal. from sucrose) for 0,3,9,24 and 48h, or refed a HC diet for 48h, then fed a high-fat (HF) diet (44% cal. from corn oil) for 3,9,24 and 48h. The FA synthesis rate and the activities of acetyl CoA carboxylase (AC), fatty acid synthase (FAS), ATP citrate lyase (CL), and glucose 6-phosphate dehydrogenase (G6PDH) were determined in the livers. FA synthesis was assayed with /sup 3/H/sub 2/O, enzyme activities were measured spectrophotometrically except for AC which was assayed with /sup 14/C-bicarbonate. There was no change in the activity of AC during fasting or on the HC diet. Fasting decreased the rate of FA synthesis by 25% and the activities of FAS and CL by 50%; refeeding the HC diet induced parallel changes in FA synthesis and the activities of FAS, CL, and G6PDH. After 9h on the HF diet, FA synthesis had decreased sharply, AC activity increased significantly while no changes were detected in the other activities. Subsequently FA synthesis did not change while the activities of the enzymes decreased slowly. These enzymes did not appear to regulate FA synthesis during inhibition of lipogenesis, but FAS, CL or G6PDH may be rate limiting in the induction phase. Other key factors may regulate FA synthesis during dietary alterations.

  9. Synergistic effect of chemo-photothermal for breast cancer therapy using folic acid (FA) modified zinc oxide nanosheet.

    PubMed

    Vimala, Karuppaiya; Shanthi, Krishnamurthy; Sundarraj, Shenbagamoorthy; Kannan, Soundarapandian

    2017-02-15

    Modern therapies for malignant breast cancer in clinics are not efficacious and often result in deprived patient compliance owing to squat therapeutic effectiveness and strong systemic side effects. In order to overcome this, we combined chemo-photothermal targeted therapy of breast cancer within one novel multifunctional drug delivery system. Folic Acid-functionalized polyethylene glycol coated Zinc Oxide nanosheet (FA-PEG-ZnO NS), was successfully synthesized, characterized and introduced to the drug delivery field for the first time. A doxorubicin (DOX)-loaded FA-PEG-ZnO NS based system (DOX-FA-PEG-ZnO NS) showed stimulative effect of heat, pH responsive and sustained drug release properties. Cytotoxicity experiments confirmed that combined therapy mediated the maximum rate of death in breast cancer cells compared to that of single chemotherapy or photothermal therapy. In vivo toxicity evaluation showed that the DOX-FA-PEG-ZnO NS contains minimum systemic toxicity in the mice model system. The findings of the present study provided an ideal drug delivery system for breast cancer therapy due to the advanced chemo-photothermal synergistic targeted therapy and good drug release properties of DOX-FA-PEG-ZnO NS, which could effectively avoid frequent and invasive dosing and improve patient compliance. Thus, functionalized-ZnO NS could be used as a novel nanomaterial for selective chemo-photothermal therapy.

  10. Induction of the fatty acid 2-hydroxylase (FA2H) gene by Δ(9)-tetrahydrocannabinol in human breast cancer cells.

    PubMed

    Takeda, Shuso; Harada, Mari; Su, Shengzhong; Okajima, Shunsuke; Miyoshi, Hiroko; Yoshida, Kazutaka; Nishimura, Hajime; Okamoto, Yoshiko; Amamoto, Toshiaki; Watanabe, Kazuhito; Omiecinski, Curtis J; Aramaki, Hironori

    2013-01-01

    To investigate gene(s) being regulated by ∆(9)-tetrahydrocannabinol (∆(9)-THC), we performed DNA microarray analysis of human breast cancer MDA-MB-231 cells, which are poorly differentiated breast cancer cells, treated with ∆(9)-THC for 48 hr at an IC50 concentration of approximately 25 µM. Among the highly up-regulated genes (> 10-fold) observed, fatty acid 2-hydroxylase (FA2H) was significantly induced (17.8-fold). Although the physiological role of FA2H has not yet been fully understood, FA2H has been shown to modulate cell differentiation. The results of Oil Red O staining after ∆(9)-THC exposure showed the distribution of lipid droplets (a sign of the differentiated phenotype) in cells. Taken together, the results obtained here indicate that FA2H is a novel ∆(9)-THC-regulated gene, and that ∆(9)-THC induces differentiation signal(s) in poorly differentiated MDA-MB-231 cells.

  11. Synthesis and characterization of covalent diphenylalanine nanotube-folic acid conjugates

    NASA Astrophysics Data System (ADS)

    Castillo, John J.; Rindzevicius, Tomas; Wu, Kaiyu; Schmidt, Michael S.; Janik, Katarzyna A.; Boisen, Anja; Svendsen, Winnie; Rozlosnik, Noemi; Castillo-León, Jaime

    2014-07-01

    Herein, we describe the synthesis and characterization of a covalent nanoscale assembly formed between diphenylalanine micro/nanotubes (PNT) and folic acid (FA). The conjugate was obtained via chemical functionalization through coupling of amine groups of PNTs and carboxylic groups of FA. The surface analysis of PNT-FA indicated the presence of FA aggregates on the surface of PNTs. The covalent interaction between FA and self-assembled PNTs was further investigated using fluorescence microscopy, Raman and surface-enhanced Raman scattering (SERS) spectroscopies. The SERS experiments were performed on a large area silver-capped (diameter of 62 nm) silicon nanopillars with an approximate height of 400 nm and a width of 200 nm. The results showed that the PNT-FA synthesis procedure preserves the molecular structure of FA. The PNT-FA conjugate presented in this study is a promising candidate for applications in the detection and diagnosis of cancer or tropical diseases such as leishmaniasis and as a carrier nanosystem delivering drugs to malignant tumors that overexpress folate receptors.

  12. [Enzymatic conversion of cephalosporin C to glutaryl-7-aminocephalosporanic acid using whole cells of the yeast Trigonopsis variabilis FA10].

    PubMed

    Chen, J; Zhu, T B; Zhang, Y F; Yang, Y L; Jiao, R S

    2001-03-01

    A process for the production of glutaryl-7-aminocephalosporanic acid (GL-7ACA) from cephalosporin C(CPC) using permeabilized cells of yeast Trigonopsis variabilis FA10 containing D-amino acid oxidase (DAO) is described. It was found that the bioconversion of CPC to GL-7ACA was interfered by the catalase activity presented in the cells that hydrolyzed the hydrogen peroxide and resulted in the accumulation of alpha-keto-adipyl-7-ACA (AKA-7ACA) and decrease of GL-7ACA yield. the methods to overcome this problem including the addition of extra H2O2 and use of catalase inhibitor, NaN3, were developed and the rate of GL-7ACA from CPC were 73% and 70.1%, respectively. Another alternative method was to incubate the permeabilized FA10 cells at pH10.5-11.0 for 30 minutes at 20 degrees C which served to selectively inactivate the catalase. In the bioconversion of CPC to GL-7ACA using pH10.5-treated cells without catalase activity, the high reaction yield of GL-7ACA(84%) was achieved.

  13. Borinic acid catalysed peptide synthesis.

    PubMed

    El Dine, Tharwat Mohy; Rouden, Jacques; Blanchet, Jérôme

    2015-11-18

    The catalytic synthesis of peptides is a major challenge in the modern organic chemistry hindered by the well-established use of stoichiometric coupling reagents. Herein, we describe for the first time that borinic acid is able to catalyse this reaction under mild conditions with an improved activity compared to our recently developed thiophene-based boronic acid. This catalyst is particularly efficient for peptide bond synthesis affording dipeptides in good yields without detectable racemization.

  14. Bile acids: regulation of synthesis.

    PubMed

    Chiang, John Y L

    2009-10-01

    Bile acids are physiological detergents that generate bile flow and facilitate intestinal absorption and transport of lipids, nutrients, and vitamins. Bile acids also are signaling molecules and inflammatory agents that rapidly activate nuclear receptors and cell signaling pathways that regulate lipid, glucose, and energy metabolism. The enterohepatic circulation of bile acids exerts important physiological functions not only in feedback inhibition of bile acid synthesis but also in control of whole-body lipid homeostasis. In the liver, bile acids activate a nuclear receptor, farnesoid X receptor (FXR), that induces an atypical nuclear receptor small heterodimer partner, which subsequently inhibits nuclear receptors, liver-related homolog-1, and hepatocyte nuclear factor 4alpha and results in inhibiting transcription of the critical regulatory gene in bile acid synthesis, cholesterol 7alpha-hydroxylase (CYP7A1). In the intestine, FXR induces an intestinal hormone, fibroblast growth factor 15 (FGF15; or FGF19 in human), which activates hepatic FGF receptor 4 (FGFR4) signaling to inhibit bile acid synthesis. However, the mechanism by which FXR/FGF19/FGFR4 signaling inhibits CYP7A1 remains unknown. Bile acids are able to induce FGF19 in human hepatocytes, and the FGF19 autocrine pathway may exist in the human livers. Bile acids and bile acid receptors are therapeutic targets for development of drugs for treatment of cholestatic liver diseases, fatty liver diseases, diabetes, obesity, and metabolic syndrome.

  15. Dissolution Profile of Mefenamic Acid Solid Dosage Forms in Two Compendial and Biorelevant (FaSSIF) Media.

    PubMed

    Nurhikmah, Wilda; Sumirtapura, Yeyet Cahyati; Pamudji, Jessie Sofia

    2016-01-01

    Mefenamic acid is a non-steroidal anti-inflammatory drug (NSAID) that is widely used for the treatment of mild-to-moderate pain. Mefenamic acid belongs to the Biopharmaceutical Classification System (BCS) class II drug which has lower water solubility but high permeability. There are two different compendial methods available for dissolution tests of mefenamic acid solid dosage forms, i.e. methods of United States Pharmacopeia 37 (USP) and Pharmacopoeia of the People's Republic of China 2010 (PPRC). Indonesian Pharmacopeia V ed. (FI) adopted the USP method. On the other hand, many researches focused on the use of a 'biorelevant' medium to develop the dissolution test method. The aim of this research was to study the dissolution profile of mefenamic acid from its solid dosage forms (caplet and capsule) available in the Indonesian market with three different dissolution medium: USP, PPRC, and biorelevant fasted simulated small intestinal fluid (FaSSIF) media. The tested products consisted of the innovator's product (available only in caplet dosage form, FN caplet) and generic products (available as caplet and capsule). The dissolution test of the drug products in all dissolution media was performed in 900 mL of medium using apparatus II (paddle) at a temperature of 37°C and rotation speed of 75 rpm, except for the capsule product and for USP medium, both of which tests were done using apparatus I (basket) with rotation speed of 100 rpm. The solubility test of mefenamic acid was carried out in all media at temperature of 37°C. The result obtained from the solubility test showed that the the highest solubility of mefenamic acid was obtained in USP medium (approximately 2 mg/mL), followed by PPRC medium (about 0.5 mg/mL), and FaSSIF medium (approximately 0.06 mg/ml). In the dissolution test, percentage of drug dissolved in in the USP and PPRC media after 45 min for all products reached more than 75%, except for the PN caplet in USP medium which reached only about 44

  16. Potent in vitro synergism of fusidic acid (FA) and berberine chloride (BBR) against clinical isolates of methicillin-resistant Staphylococcus aureus (MRSA).

    PubMed

    Liang, Rong-mei; Yong, Xiao-lan; Duan, Yu-qin; Tan, Yong-hong; Zeng, Ping; Zhou, Zi-ying; Jiang, Yan; Wang, Shi-hua; Jiang, Yun-ping; Huang, Xiao-chun; Dong, Zhao-hui; Hu, Ting-ting; Shi, Hui-qing; Li, Nan

    2014-11-01

    It was found in the present study that combined use of fusidic acid (FA) and berberine chloride (BBR) offered an in vitro synergistic action against 7 of the 30 clinical methicillin-resistant Staphylococcus aureus (MRSA) strains, with a fractional inhibitory concentration (FIC) index ranging from 0.5 to 0.19. This synergistic effect was most pronounced on MRSA 4806, an FA-resistant isolate, with a minimum inhibitory concentration (MIC) value of 1,024 μg/ml. The time-kill curve experiment showed that FA plus BBR yielded a 4.2 log10 c.f.u./ml reduction in the number of MRSA 4806 bacteria after 24-h incubation as compared with BBR alone. Viable count analysis showed that FA plus BBR produced a 3.0 log10 c.f.u./ml decrease in biofilm formation and a 1.5 log10 c.f.u./ml decrease in mature biofilm in viable cell density as compared with BBR alone. In addition, phase contrast micrographs confirmed that biofilm formation was significantly inhibited and mature biofilm was obviously destructed when FA was used in combination with BBR. These results provide evidence that combined use of FA and BBR may prove to be a promising clinical therapeutic strategy against MRSA.

  17. Ferulic acid (FA) abrogates γ-radiation induced oxidative stress and DNA damage by up-regulating nuclear translocation of Nrf2 and activation of NHEJ pathway.

    PubMed

    Das, Ujjal; Manna, Krishnendu; Khan, Amitava; Sinha, Mahuya; Biswas, Sushobhan; Sengupta, Aaveri; Chakraborty, Anindita; Dey, Sanjit

    2017-01-01

    The present study was aimed to evaluate the radioprotective effect of ferulic acid (FA), a naturally occurring plant flavonoid in terms of DNA damage and damage related alterations of repair pathways by gamma radiation. FA was administered at a dose of 50 mg/kg body weight for five consecutive days prior to exposing the swiss albino mice to a single dose of 10 Gy gamma radiation. Ionising radiation induces oxidative damage manifested by decreased expression of Cu, Zn-SOD (SOD stands for super oxide dismutase), Mn-SOD and catalase. Gamma radiation promulgated reactive oxygen species (ROS) mediated DNA damage and modified repair pathways. ROS enhanced nuclear translocation of p53, activated ATM (ataxia telangiectasia-mutated protein), increased expression of GADD45a (growth arrest and DNA-damage-inducible protein) gene and inactivated Non homologous end joining (NHEJ) repair pathway. The comet formation in irradiated mice peripheral blood mononuclear cells (PBMC) reiterated the DNA damage in IR exposed groups. FA pretreatment significantly prevented the comet formation and regulated the nuclear translocation of p53, inhibited ATM activation and expression of GADD45a gene. FA promoted the nuclear translocation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and activated NHEJ repair pathway to overcome ROS mediated oxidative stress and DNA damage. Therefore, the current study stated that FA can challenge the oxidative stress by (i) inducing nuclear translocation of Nrf2, (ii) scavenging ROS, and (iii) activating NHEJ DNA repair process.

  18. Selective inhibition of leukotriene C/sub 4/ synthesis in human neutrophils by ethacrynic acid

    SciTech Connect

    Leung, K.H.

    1986-05-29

    Addition of glutathione S-transferase inhibitors, ethyacrynic acid (ET), caffeic acid (CA), and ferulic acid (FA) to human neutrophils led to inhibition of leukotriene C/sub 4/ (LTC/sub 4/) synthesis induced by calcium ionophore A23187. ET is the most specific of these inhibitors for it had little effect on LTB/sub 4/, PGE/sub 2/, and 5-HETE synthesis. The inhibition of LTC/sub 4/ was irreversible and time dependent. ET also had little effect on /sup 3/H-AA release from A23187-stimulated neutrophils.

  19. The effect of gestational age on expression of genes involved in uptake, trafficking and synthesis of fatty acids in the rat placenta.

    PubMed

    Rodríguez-Cruz, Maricela; González, Raúl Sánchez; Maldonado, Jorge; López-Alarcón, Mardia; Bernabe-García, Mariela

    2016-10-15

    Gestation triggers a tight coordination among maternal tissues to provide fatty acids (FA) to the fetus through placental transport; however, there is insufficient evidence regarding regulation of proteins involved in placental transport of FA according to gestational age. The aim of this study was to determine the role of gestational age on the expression of genes involved in FA uptake, trafficking and synthesis in the rat placenta to support fetal demands. Gene expression of encoding proteins for placental transport and synthesis of FA was measured in placenta. Also, FA composition was measured in placenta, fetuses and newborns. mRNA expression of lipoprotein lipase (lpl) and fatp-1 (for uptake) was 4.4- and 1.43-fold higher, respectively, during late gestation than at P14, but expression of p-fabp-pm decreased 0.37-fold at late pregnancy in comparison with P14. Only mRNA fabp-4 member for trafficking of FA was 2.95-fold higher at late gestation than at P14. mRNA of fasn and elovl-6 participating in saturated FA and enzymes for the polyunsaturated FA synthesis were downregulated during late gestation and their regulator srebf-1c increased at P16. This study suggests that gestational age has an effect on expression of some genes involved in uptake, trafficking and synthesis of FA in the rat placenta; mRNA expression of lpl and, fatp-1 for uptake and fabp-4 implicated in trafficking was expressed at high levels at late gestation. In addition, placenta expresses the mRNAs involved in FA synthesis; these genes were expressed at low levels at late gestation. Additionally, mRNAs of Srebf-1c transcriptional regulator of desaturases and elongases was highly expressed during late gestation. Finally, these changes in the rat placenta allowed the placenta to partially supply saturated and monounsaturated FA to the fetus.

  20. Reassessment of the Genetic Regulation of Fatty Acid Synthesis in Escherichia coli: Global Positive Control by the Dual Functional Regulator FadR

    PubMed Central

    My, L.; Ghandour Achkar, N.; Viala, J. P.

    2015-01-01

    ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator

  1. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  2. Impact of high altitude on the hepatic fatty acid oxidation and synthesis in rats

    SciTech Connect

    Ni, Qian; Shao, Yuan; Wang, Ying Zhen; Jing, Yu Hong; Zhang, You Cheng

    2014-04-04

    Highlights: • Acute exposure to high altitude (HA) increased hepatic fatty acid (FA) β-oxidation. • Acute exposure of rats to HA increased hepatic FA synthesis. • PPARα and AMPK can regulate the FA metabolism. • FA may be a key energy fuel and a compensation for CHO during acute exposure to HA. • The acute changes of FA metabolism may be a mechanism of acclimatization. - Abstract: High altitude (HA) affects energy metabolism. The impact of acute and chronic HA acclimatization on the major metabolic pathways is still controversial. In this study, we aimed to unveil the impact of HA on the key enzymes involved in the fatty acid (FA) metabolism in liver. Rats were exposed to an altitude of 4300 m for 30 days and the expressions of two key proteins involved in FA β-oxidation (carnitine palmitoyl transferase I, CPT-I; and peroxisome proliferator-activated receptor alpha, PPARα), two proteins involved in FA synthesis (acetyl CoA carboxylase-1, ACC-1; and AMP-activated protein kinase, AMPK), as well as the total ketone body in the liver and the plasma FFAs were examined. Rats without HA exposure were used as controls. We observed that the acute exposure of rats to HA (3 days) led to a significant increase in the expressions of CPT-I and PPARα and in the total hepatic ketone body. Longer exposure (15 days) caused a marked decrease in the expression of CPT-I and PPARα. By 30 days after HA exposure, the expression levels of CPT-I and PPARα returned to the control level. The hepatic ACC-1 level showed a significant increase in rats exposed to HA for 1 and 3 days. In contrast, the hepatic level of AMPK showed a significant reduction throughout the experimental period. Plasma FFA concentrations did not show any significant changes following HA exposure. Thus, increased hepatic FA oxidation and synthesis in the early phase of HA exposure may be among the important mechanisms for the rats to respond to the hypoxic stress in order to acclimatize themselves to the

  3. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  4. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  5. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  6. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  7. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  8. Enzymatic synthesis of cinnamic acid derivatives.

    PubMed

    Lee, Gia-Sheu; Widjaja, Arief; Ju, Yi-Hsu

    2006-04-01

    Using Novozym 435 as catalyst, the syntheses of ethyl ferulate (EF) from ferulic acid (4-hydroxy 3-methoxy cinnamic acid) and ethanol, and octyl methoxycinnamate (OMC) from p-methoxycinnamic acid and 2-ethyl hexanol were successfully carried out in this study. A conversion of 87% was obtained within 2 days at 75 degrees C for the synthesis of EF. For the synthesis of OMC at 80 degrees C, 90% conversion can be obtained within 1 day. The use of solvent and high reaction temperature resulted in better conversion for the synthesis of cinnamic acid derivatives. Some cinnamic acid esters could also be obtained with higher conversion and shorter reaction times in comparison to other methods reported in the literature. The enzyme can be reused several times before significant activity loss was observed.

  9. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

  10. Environmentally friendly, one-pot synthesis of folic acid-decorated graphene oxide-based drug delivery system

    NASA Astrophysics Data System (ADS)

    Lin, Quankui; Huang, Xiaojie; Tang, Junmei; Han, Yuemei; Chen, Hao

    2013-12-01

    A targeted drug delivery system based on graphene oxide (GO) was produced via one-pot synthesis method, taking advantages of the self-polymerization of the dopamine (DA). The polymerization of dopamine resulted in polydopamine capped GO nanocomposite. Meanwhile, the anti-tumor drug doxorubicin (DOX) can be loaded in the nanocomposite and the tumor cell targeting molecule folic acid (FA) can also been immobilized on the nanocomposite surface simultaneously. The size of the obtained FA-decorated GO-based drug delivery system (DA/GO(DOX)-FA) is about 600 nm. It renders a sustained drug release manner. The cell culture results reveal that the FA-decorated GO-based drug delivery system (DA/GO(DOX)-FA) via one-pot method shows property of targeted killing of cancer cells in vitro. This one-pot method just needs the pH adjusting to induce the self-polymerization of DA, but excludes the fussy chemical grafting process and the organic solvents, which make it an environmentally friendly method to synthesize FA-decorated GO-based drug delivery system.

  11. Evaluation of Carbohydrate-Derived Fulvic Acid (CHD-FA) as a Topical Broad-Spectrum Antimicrobial for Drug-Resistant Wound Infections

    DTIC Science & Technology

    2014-10-01

    molecular mechanisms during wound healing with CHD-FA. Figure 5. Wound images of rats infected with A. baumannii (ATCC BAA-747) and treated with CHD-FA...host gene expression profiling to better assess the cellular and molecular mechanisms during wound healing with CHD-FA. 13 Figure 6. Wound...expression profiling will be performed to better assess the cellular and molecular mechanisms during wound healing with CHD-FA. 20 Figure 5

  12. Trans fatty acids (tFA): sources and intake levels, biological effects and content in commercial Spanish food.

    PubMed

    Fernández-San Juan, P-M

    2009-01-01

    Recent studies of dietary habits in children and adolescents performed in Spain show that a high percentage of the daily energy intake corresponds to fat (42.0-43.0%). These findings show an excessive contribution of saturated fatty acids and also a considerable supply of trans fatty acids. These compounds are formed generally during partial hydrogenation of vegetable oils, a process that converts vegetable oils into semisolid fats. Also, in some cases naturally occurring trans fatty acids in smaller amounts in meat and dairy products from ruminants (cows, sheep), these trans fatty acids are produced by the action of bacteria in the ruminant stomach by reactions of biohydrogenation. On the other hand, metabolic studies have clearly shown that trans fatty acids increase LDL cholesterol and reduce HDL cholesterol. Our results show that major sources of trans fatty acids in commercial Spanish foods are fast-food (hamburger, French fries), snacks, bakery products (cakes, donuts, biscuits), margarines and dehydrated soups.

  13. Engineering fungal de novo fatty acid synthesis for short chain fatty acid production

    PubMed Central

    Gajewski, Jan; Pavlovic, Renata; Fischer, Manuel; Boles, Eckhard; Grininger, Martin

    2017-01-01

    Fatty acids (FAs) are considered strategically important platform compounds that can be accessed by sustainable microbial approaches. Here we report the reprogramming of chain-length control of Saccharomyces cerevisiae fatty acid synthase (FAS). Aiming for short-chain FAs (SCFAs) producing baker's yeast, we perform a highly rational and minimally invasive protein engineering approach that leaves the molecular mechanisms of FASs unchanged. Finally, we identify five mutations that can turn baker's yeast into a SCFA producing system. Without any further pathway engineering, we achieve yields in extracellular concentrations of SCFAs, mainly hexanoic acid (C6-FA) and octanoic acid (C8-FA), of 464 mg l−1 in total. Furthermore, we succeed in the specific production of C6- or C8-FA in extracellular concentrations of 72 and 245 mg l−1, respectively. The presented technology is applicable far beyond baker's yeast, and can be plugged into essentially all currently available FA overproducing microorganisms. PMID:28281527

  14. Synthesis of Pulcherriminic Acid by Bacillus subtilis

    PubMed Central

    Uffen, Robert L.; Canale-Parola, E.

    1972-01-01

    The pathway of pulcherriminic acid synthesis in Bacillus subtilis strains AM and AM-L11 (a leucine-requiring auxotroph) was investigated. Determinations of radioactivity in pulcherriminic acid synthesized by cells growing in media containing 14C-labeled amino acids indicated that B. subtilis produced pulcherriminic acid from l-leucine. The organism utilized the carbon skeletons of two l-leucine molecules to synthesize one molecule of pulcherriminic acid. Similar results were obtained with starved cell suspensions. Growing cells formed significant amounts of pulcherriminic acid only in media including a carbohydrate such as starch. However, carbohydrate carbon was not required for the synthesis of pulcherriminic acid molecules. Data obtained with cell suspensions supported the hypothesis that cyclo-l-leucyl-l-leucyl is an intermediate in pulcherriminic acid biosynthesis and indicated that molecular oxygen is required for the conversion of cyclo-l-leucyl-l-leucyl to pulcherriminic acid. A pathway for the synthesis of pulcherrimin from l-leucine in B. subtilis is proposed. PMID:4204912

  15. Nitrated fatty acids: synthesis and measurement.

    PubMed

    Woodcock, Steven R; Bonacci, Gustavo; Gelhaus, Stacy L; Schopfer, Francisco J

    2013-06-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia/reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis and sample extraction from complex biological matrices and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by liquid chromatography-mass spectrometry. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed.

  16. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  17. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  18. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  19. Synthesis of Hexagonal ZnO-PQ7 Nano Disks Conjugated with Folic Acid to Image MCF - 7 Cancer Cells.

    PubMed

    Sureshkumar, S; Jothimani, B; Sridhar, T M; Santhosh, Arul; Venkatachalapathy, B

    2017-01-01

    Surface modified ZnO nanomaterial is widely used in the field of bioimaging worldwide due to its optical properties, electronic characteristics and biocompatibility. Fluorescent enhanced, Polyquaternium-7(PQ7) capped, ZnO hexagonal nano disks (ZnO-PQ7) were synthesised by simple wet chemical method. The structural and optical properties of ZnO-PQ7 hexagonal nano disks were characterized using XRD, UV-Visible, Fluorescence, HRTEM, EDAX and FTIR studies. The size of synthesised ZnO-PQ7 were around 30-45 nm as confirmed by HRTEM studies. Fluorescence emission intensity increased with increase in PQ7 concentration. ZnO-PQ7 was further conjugated with folic acid (FA) to target human breast cancer cell line (MCF-7) via EDC/NHS coupling chemistry. Conjugation of folic acid with ZnO-PQ7 was confirmed by FTIR studies. The cell viability study using Methyl thiazolyltetrazolium(MTT) assay has demonstrated that the ZnO-PQ7 conjugated FA composites (ZnO-PQ7-FA) exhibit low toxicity towards MCF-7 up to a concentration of 125 μg/mL. Confocal laser scanning microscopic images confirmed the uptake of ZnO-PQ7-FA nanoparticles by MCF-7 cells. This study reveals ZnO-PQ7-FA nano disks as a potential imaging agent for detection of cancer cells. The synthesis route reported in this article is simple and easy to follow for the synthesis of ZnO-PQ7-FA in bulk quantities with high purity.

  20. [Total synthesis of nordihydroguaiaretic acid].

    PubMed

    Wu, A X; Zhao, Y R; Chen, N; Pan, X F

    1997-04-01

    beta-Keto ester(5) was obtained from vanilin through etherification, oxidation and condensation with acetoacetic ester, (5) on oxidative coupling reaction by NaOEt/I2 produced dimer (6) in high yield. Acid catalyzed cyclodehydration of (6) gave the furan derivative(7), and by a series of selective hydrogenation nordihydroguaiaretic acid, furoguaiacin dimethyl ether and dihydroguaiaretic acid dimethyl ether were synthesized.

  1. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  2. Δ(9)-THC modulation of fatty acid 2-hydroxylase (FA2H) gene expression: possible involvement of induced levels of PPARα in MDA-MB-231 breast cancer cells.

    PubMed

    Takeda, Shuso; Ikeda, Eriko; Su, Shengzhong; Harada, Mari; Okazaki, Hiroyuki; Yoshioka, Yasushi; Nishimura, Hajime; Ishii, Hiroyuki; Kakizoe, Kazuhiro; Taniguchi, Aya; Tokuyasu, Miki; Himeno, Taichi; Watanabe, Kazuhito; Omiecinski, Curtis J; Aramaki, Hironori

    2014-12-04

    We recently reported that Δ(9)-tetrahydrocannabinol (Δ(9)-THC), a major cannabinoid component in Cannabis Sativa (marijuana), significantly stimulated the expression of fatty acid 2-hydroxylase (FA2H) in human breast cancer MDA-MB-231 cells. Peroxisome proliferator-activated receptor α (PPARα) was previously implicated in this induction. However, the mechanisms mediating this induction have not been elucidated in detail. We performed a DNA microarray analysis of Δ(9)-THC-treated samples and showed the selective up-regulation of the PPARα isoform coupled with the induction of FA2H over the other isoforms (β and γ). Δ(9)-THC itself had no binding/activation potential to/on PPARα, and palmitic acid (PA), a PPARα ligand, exhibited no stimulatory effects on FA2H in MDA-MB-231 cells; thus, we hypothesized that the levels of PPARα induced were involved in the Δ(9)-THC-mediated increase in FA2H. In support of this hypothesis, we herein demonstrated that; (i) Δ(9)-THC activated the basal transcriptional activity of PPARα in a concentration-dependent manner, (ii) the concomitant up-regulation of PPARα/FA2H was caused by Δ(9)-THC, (iii) PA could activate PPARα after the PPARα expression plasmid was introduced, and (iv) the Δ(9)-THC-induced up-regulation of FA2H was further stimulated by the co-treatment with L-663,536 (a known PPARα inducer). Taken together, these results support the concept that the induced levels of PPARα may be involved in the Δ(9)-THC up-regulation of FA2H in MDA-MB-231 cells.

  3. A plausibly prebiotic synthesis of phosphonic acids.

    PubMed

    de Graaf, R M; Visscher, J; Schwartz, A W

    1995-11-30

    The insolubility of calcium phosphate in water is a significant stumbling block in the chemistry required for the origin of life. The discovery of alkyl phosphonic acids in the Murchison meteorite suggests the possibility of delivery of these water-soluble, phosphorus-containing molecules by meteorites or comets to the early Earth. This could have provided a supply of organic phosphorus for the earliest stages of chemical evolution; although probably not components of early genetic systems, phosphonic acids may have been precursors to the first nucleic acids. Here we report the synthesis of several phosphonic acids, including the most abundant found in the Murchison meteorite, by ultraviolet irradiation of orthophosphorous acid in the presence of formaldehyde, primary alcohols, or acetone. We argue that similar reactions might explain the presence of phosphonic acids in Murchison, and could also have occurred on the prebiotic Earth.

  4. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  5. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  6. Benzene-free synthesis of adipic acid.

    PubMed

    Niu, Wei; Draths, K M; Frost, J W

    2002-01-01

    Strains of Escherichia coli were constructed and evaluated that synthesized cis,cis-muconic acid from D-glucose under fed-batch fermentor conditions. Chemical hydrogenation of the cis,cis-muconic acid in the resulting fermentation broth has also been examined. Biocatalytic synthesis of adipic acid from glucose eliminates two environmental concerns characteristic of industrial adipic acid manufacture: use of carcinogenic benzene and benzene-derived chemicals as feedstocks and generation of nitrous oxide as a byproduct of a nitric acid catalyzed oxidation. While alternative catalytic syntheses that eliminate the use of nitric acid have been developed, most continue to rely on petroleum-derived benzene as the ultimate feedstock. In this study, E. coli WN1/pWN2.248 was developed that synthesized 36.8 g/L of cis,cis-muconic acid in 22% (mol/mol) yield from glucose after 48 h of culturing under fed-batch fermentor conditions. Optimization of microbial cis,cis-muconic acid synthesis required expression of three enzymes not typically found in E. coli. Two copies of the Klebsiella pneumoniae aroZ gene encoding DHS dehydratase were inserted into the E. coli chromosome, while the K. pneumoniae aroY gene encoding PCA decarboxylase and the Acinetobacter calcoaceticus catA gene encoding catechol 1,2-dioxygenase were expressed from an extrachromosomal plasmid. After fed-batch culturing of WN1/pWN2.248 was complete, the cells were removed from the broth, which was treated with activated charcoal and subsequently filtered to remove soluble protein. Hydrogenation of the resulting solution with 10% Pt on carbon (5% mol/mol) at 3400 kPa of H2 pressure for 2.5 h at ambient temperature afforded a 97% (mol/mol) conversion of cis,cis-muconic acid into adipic acid.

  7. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  8. One-pot synthesis of quantum dot-labeled hydrophilic molecularly imprinted polymer nanoparticles for direct optosensing of folic acid in real, undiluted biological samples.

    PubMed

    Yang, Yaqiong; Wang, Zhengzheng; Niu, Hui; Zhang, Huiqi

    2016-12-15

    A facile and efficient one-pot approach for the synthesis of quantum dot (QD)-labeled hydrophilic molecularly imprinted polymer (MIP) nanoparticles for direct optosensing of folic acid (FA) in the undiluted bovine and porcine serums is described. Hydrophilic macromolecular chain transfer agent-mediated reversible addition-fragmentation chain transfer (RAFT) precipitation polymerization was used to implement the molecular imprinting of FA in the presence of CdTe quantum dots (QDs). The resulting FA-imprinted polymer nanoparticles with surface-grafted hydrophilic poly(glyceryl monomethacrylate) brushes and QDs labeling not only showed outstanding specific molecular recognition toward FA in biological samples, but also exhibited good photostability, rapid binding kinetics, and obvious template binding-induced fluorescence quenching. These characteristics make them a useful fluorescent chemosensor for directly and selectively optosensing FA in the undiluted bovine and porcine serums, with its limit of detection being 0.025μM and average recoveries ranging from 98% to 102%, even in the presence of several interfering compounds. This advanced fluorescent MIP chemosensor is highly promising for rapid quantification of FA in such applications as clinical diagnostics and food analysis.

  9. A narrative synthesis of the applicability of the CaR-FA-X model in child and adolescent populations: a systematic review.

    PubMed

    Stewart, Tracy M; Hunter, Simon C; Rhodes, Sinéad M

    2017-03-13

    The CaR-FA-X model [Williams, J. M. G., Barnhofer, T., Crane, C., Hermans, D., Raes, F., Watkins, E., … Dalgleish, T. (2007). Autobiographical memory specificity and emotional disorder. Psychological Bulletin, 133(1), 122-148. doi: 10.1037/0033-2909.133.1.122 ] is the most prominent and comprehensive model of overgeneral autobiographical memory (OGM) and provides a framework for OGM. The model comprises of three mechanisms, capture and rumination, functional avoidance and impaired executive control. These can independently, or in interaction, account for OGM. This systematic review aims to evaluate the existing research on the CaR-FA-X model, and trauma exposure studies specific to child and adolescent populations. The following databases were searched: "PsychInfo", "PsychArticles", "PubMed", "Web of Science", "Medline", "SCOPUS" and "Embase" for English-language, peer-reviewed papers with samples FA-X model was found for child and adolescent populations. Recommendations, proposals for future research and plausible explanations for the mixed findings are discussed.

  10. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  11. Opuntia ficus indica (nopal) attenuates hepatic steatosis and oxidative stress in obese Zucker (fa/fa) rats.

    PubMed

    Morán-Ramos, Sofía; Avila-Nava, Azalia; Tovar, Armando R; Pedraza-Chaverri, José; López-Romero, Patricia; Torres, Nimbe

    2012-11-01

    Nonalcoholic fatty liver disease (NAFLD) is associated with multiple factors such as obesity, insulin resistance, and oxidative stress. Nopal, a cactus plant widely consumed in the Mexican diet, is considered a functional food because of its antioxidant activity and ability to improve biomarkers of metabolic syndrome. The aim of this study was to assess the effect of nopal consumption on the development of hepatic steatosis and hepatic oxidative stress and on the regulation of genes involved in hepatic lipid metabolism. Obese Zucker (fa/fa) rats were fed a control diet or a diet containing 4% nopal for 7 wk. Rats fed the nopal-containing diet had ∼50% lower hepatic TG than the control group as well as a reduction in hepatomegaly and biomarkers of hepatocyte injury such as alanine and aspartate aminotransferases. Attenuation of hepatic steatosis by nopal consumption was accompanied by a higher serum concentration of adiponectin and a greater abundance of mRNA for genes involved in lipid oxidation and lipid export and production of carnitine palmitoyltransferase-1 and microsomal TG transfer proteins in liver. Hepatic reactive oxygen species and lipid peroxidation biomarkers were significantly lower in rats fed nopal compared with the control rats. Furthermore, rats fed the nopal diet had a lower postprandial serum insulin concentration and a greater liver phosphorylated protein kinase B (pAKT):AKT ratio in the postprandial state. This study suggests that nopal consumption attenuates hepatic steatosis by increasing fatty acid oxidation and VLDL synthesis, decreasing oxidative stress, and improving liver insulin signaling in obese Zucker (fa/fa) rats.

  12. Chemoenzymatic synthesis of surfactants from carbohydrates, amino acids, and fatty acids.

    PubMed

    Bellahouel, S; Rolland, V; Roumestant, M L; Viallefont, P; Martinez, J

    2001-02-01

    The chemoenzymatic synthesis of new surfactants is reported; they were prepared from unprotected carbohydrates, amino acids, and fatty acids. This study pointed out the factors that govern the possibility to enzymatically bind the carbohydrate to the amino acid.

  13. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  14. Escherichia coli Unsaturated Fatty Acid Synthesis

    PubMed Central

    Feng, Youjun; Cronan, John E.

    2009-01-01

    Although the unsaturated fatty acid (UFA) synthetic pathway of Escherichia coli is the prototype of such pathways, several unresolved issues have accumulated over the years. The key players are the fabA and fabB genes. Earlier studies of fabA transcription showed that the gene was transcribed from two promoters, with one being positively regulated by the FadR protein. The other weaker promoter (which could not be mapped with the technology then available) was considered constitutive because its function was independent of FadR. However, the FabR negative regulator was recently shown to represses fabA transcription. We report that the weak promoter overlaps the FadR-dependent promoter and is regulated by FabR. This promoter is strictly conserved in all E. coli and Salmonella enterica genomes sequenced to date and is thought to provide insurance against inappropriate regulation of fabA transcription by exogenous saturated fatty acids. Also, the fabAup promoter, a mutant promoter previously isolated by selection for increased FabA activity, was shown to be a promoter created de novo by a four-base deletion within the gene located immediately upstream of fabA. Demonstration of the key UFA synthetic reaction catalyzed by FabB has been elusive, although it was known to catalyze an elongation reaction. Strains lacking FabB are UFA auxotrophs indicating that the enzyme catalyzes an essential step in UFA synthesis. Using thioesterases specific for hydrolysis of short chain acyl-ACPs, the intermediates of the UFA synthetic pathway have been followed in vivo for the first time. These experiments showed that a fabB mutant strain accumulated less cis-5-dodecenoic acid than the parental wild-type strain. These data indicate that the key reaction in UFA synthesis catalyzed by FabB is elongation of the cis-3-decenoyl-ACP produced by FabA. PMID:19679654

  15. Synthesis of new kojic acid based unnatural α-amino acid derivatives.

    PubMed

    Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Devi, P Uma; Behera, Manoranjan

    2015-11-01

    An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond.

  16. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  17. Brain white matter development is associated with a human-specific haplotype increasing the synthesis of long chain fatty acids.

    PubMed

    Peters, Bart D; Voineskos, Aristotle N; Szeszko, Philip R; Lett, Tristram A; DeRosse, Pamela; Guha, Saurav; Karlsgodt, Katherine H; Ikuta, Toshikazu; Felsky, Daniel; John, Majnu; Rotenberg, David J; Kennedy, James L; Lencz, Todd; Malhotra, Anil K

    2014-04-30

    The genetic and molecular pathways driving human brain white matter (WM) development are only beginning to be discovered. Long chain polyunsaturated fatty acids (LC-PUFAs) have been implicated in myelination in animal models and humans. The biosynthesis of LC-PUFAs is regulated by the fatty acid desaturase (FADS) genes, of which a human-specific haplotype is strongly associated with ω-3 and ω-6 LC-PUFA concentrations in blood. To investigate the relationship between LC-PUFA synthesis and human brain WM development, we examined whether this FADS haplotype is associated with age-related WM differences across the life span in healthy individuals 9-86 years of age (n = 207). Diffusion tensor imaging was performed to measure fractional anisotropy (FA), a putative measure of myelination, of the cerebral WM tracts. FADS haplotype status was determined with a single nucleotide polymorphism (rs174583) that tags this haplotype. Overall, normal age-related WM differences were observed, including higher FA values in early adulthood compared with childhood, followed by lower FA values across older age ranges. However, individuals homozygous for the minor allele (associated with lower LC-PUFA concentrations) did not display these normal age-related WM differences (significant age × genotype interactions, p(corrected) < 0.05). These findings suggest that LC-PUFAs are involved in human brain WM development from childhood into adulthood. This haplotype and LC-PUFAs may play a role in myelin-related disorders of neurodevelopmental origin.

  18. Juvenile Hormone Synthesis: “esterify then epoxidize” or “epoxidize then esterify”? Insights from the Structural Characterization of Juvenile Hormone Acid Methyltransferase

    PubMed Central

    Defelipe, L.A; Dolghih, E.; Roitberg, A.E.; Nouzova, M.; Mayoral, J.G; Noriega, F.G.; Turjanski, A.G.

    2011-01-01

    Juvenile hormones (JHs) play key roles in regulating metamorphosis and reproduction in insects. The last two steps of JH synthesis diverge depending on the insect order. In Lepidoptera, epoxidation by a P450 monooxygenase precedes esterification by a juvenile hormone acid methyltransferase (JHAMT). In Orthoptera, Dictyoptera, Coleoptera and Diptera epoxidation follows methylation. The aim of our study was to gain insight into the structural basis of JHAMT’s substrate recognition as a means to understand the divergence of these pathways. Homology modeling was used to build the structure of Aedes aegypti JHAMT. The substrate binding site was identified, as well as the residues that interact with the methyl donor (S-adenosylmethionine) and the carboxylic acid of the substrate methyl acceptors, farnesoic acid (FA) and juvenile hormone acid (JHA). To gain further insight we generated the structures of Anopheles gambiae, Bombyx mori, Drosophila melanogaster and Tribolium castaneum JHAMTs. The modeling results were compared with previous experimental studies using recombinant proteins, whole insects, corpora allata or tissue extracts. The computational study helps explain the selectivity towards the (10R)-JHA isomer and the reduced activity for palmitic and lauric acids. The analysis of our results supports the hypothesis that all insect JHAMTs are able to recognize both FA and JHA as substrates. Therefore, the order of the methylation/epoxidation reactions may be primarily imposed by the epoxidase’s substrate specificity. In Lepidoptera, epoxidase might have higher affinity than JHAMT for FA, so epoxidation precedes methylation, while in most other insects there is no epoxidation of FA, but esterification of FA to form MF, followed by epoxidation to JH III. PMID:21195763

  19. Mass spectrometry of the lithium adducts of diacylglycerols containing hydroxy FA in castor oil and two normal FA

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Castor oil can be used in industry. The molecular species of triacylglycerols containing hydroxy fatty acids (FA) in castor oil have been identified. We report here the identification of twelve diacylglycerols (DAG) containing hydroxy FA in castor oil using positive ion electrospray ionization mass ...

  20. Motualevic Acids and Analogs: Synthesis and Antimicrobial Structure Activity Relationships

    PubMed Central

    Cheruku, Pradeep; Keffer, Jessica L.; Dogo-Isonagie, Cajetan; Bewley, Carole A.

    2010-01-01

    Synthesis of the marine natural products motualevic acids A, E, and analogs in which modifications have been made to the ω-brominated lipid (E)-14,14-dibromotetra-deca-2,13-dienoic acid or amino acid unit are reported, together with antimicrobial activities against Staphylococcus aureus, methicillin-resistant S. aureus, Enterococcus faecium, and vancomycin-resistant Enterococcus. PMID:20538459

  1. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  2. Derivatives of diphosphonic acids: synthesis and biological activity

    NASA Astrophysics Data System (ADS)

    Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

    1993-07-01

    The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

  3. Transaminases for the synthesis of enantiopure beta-amino acids

    PubMed Central

    2012-01-01

    Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

  4. SYNTHESIS OF RIBONUCLEIC ACID BY X-IRRADIATED BACTERIA1

    PubMed Central

    Frampton, E. W.

    1964-01-01

    Frampton, E. W. (The University of Texas M. D. Anderson Hospital and Tumor Institute, Houston). Synthesis of ribonucleic acid by X-irradiated bacteria. J. Bacteriol. 87:1369–1376. 1964.—Postirradiation synthesis of total ribonucleic acid (RNA) and of RNA components was measured after exposure of Escherichia coli B/r to X rays. Net synthesis of RNA measured by the orcinol reaction and by the incorporation of uridine-2-C14 was depressed in irradiated cells, but paralleled the period of postirradiation growth (30 to 40 min). Incorporation of uridine-2-C14, added after net synthesis of RNA had ceased, detected an apparent turnover in a portion of the RNA. Irradiated cells retained their ability to adjust RNA synthesis to growth rate. After a shift-down in growth rate, irradiated cells incorporated radioactive uridine, while the net synthesis of RNA ceased—presumptive evidence for a continued synthesis of messenger RNA. Chloramphenicol addition (100 μg/ml) did not influence the total amount of RNA synthesized. Synthesis of ribosomes and transfer RNA preceded by 0, 5, 10, and 15 min of postirradiation incubation was observed by the resolution of cell-free extracts on sucrose density gradients. Little immediate influence of irradiation could be detected on the synthesis of 50S and 30S ribosomes. A decline was observed in the synthesis of 50S ribosomes with continued postirradiation incubation; 30S ribosomes, ribosomal precursors, and 4S RNA continued to be synthesized. PMID:14188715

  5. Direct Catalytic Asymmetric Synthesis of β-Hydroxy Acids from Malonic Acid.

    PubMed

    Gao, Hang; Luo, Zhenli; Ge, Pingjin; He, Junqian; Zhou, Feng; Zheng, Peipei; Jiang, Jun

    2015-12-18

    A nickel(II) catalyzed asymmetric synthesis of β-hydroxy acids from malonic acid and ketones was developed, revealing for the first time the synthetic utility of malonic acid in the construction of chiral carboxyl acids; importantly, the synthetic potential of this strategy was further demonstrated by the rapid construction of cephalanthrin A, phaitanthrin B, cruciferane, and rice metabolites.

  6. Inadequacy of prebiotic synthesis as origin of proteinous amino acids.

    PubMed

    Wong, J T; Bronskill, P M

    1979-07-18

    The production of some nonproteinous, and lack of production of other proteinous, amino acids in model prebiotic synthesis, along with the instability of glutamine and asparagine, suggest that not all of the 20 present day proteinous amino acids gained entry into proteins directly from the primordial soup. Instead, a process of active co-evolution of the genetic code and its constituent amino acids would have to precede the final selection of these proteinous amono acids.

  7. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  8. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  9. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  10. The enxymatic synthesis and characterization of disolketal iminodiacetic acid (DSIDA)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Esterifications between iminodiacetic acid and its methyl and ethyl derivatives with glycerol or solketal have been studied. The synthesis of IDA with solketal was unsuccessful under experimental conditions of 70 degrees C and 200 torr for 24h. However, using dimethyl iminodiacetic acid with solke...

  11. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  12. Phosphoric Acid-Mediated Synthesis of Vinyl Sulfones through Decarboxylative Coupling Reactions of Sodium Sulfinates with Phenylpropiolic Acids.

    PubMed

    Rong, Guangwei; Mao, Jincheng; Yan, Hong; Zheng, Yang; Zhang, Guoqi

    2015-08-07

    A novel phosphoric acid -mediated synthesis of vinyl sulfones through decarboxylative coupling reactions of sodium sulfinates with phenylpropiolic acids is described. This transformation is efficient and environmentally friendly.

  13. Laccase-catalysed oxidation of ferulic acid and ethyl ferulate in aqueous medium: a green procedure for the synthesis of new compounds.

    PubMed

    Aljawish, Abdulhadi; Chevalot, Isabelle; Jasniewski, Jordane; Paris, Cédric; Scher, Joël; Muniglia, Lionel

    2014-02-15

    The enzymatic oxidation of ferulic acid (FA) and ethyl ferulate (EF) with Myceliophthora thermophila laccase, as biocatalyst, was performed in aqueous medium using an eco-friendly procedure to synthesize new active molecules. First, the commercial laccase was ultrafiltrated allowing for the elimination of phenolic contaminants and increasing the specific activity by a factor of 2. Then, kinetic parameters of this laccase were determined for both substrates (FA, EF), indicating a higher substrate affinity for ethyl ferulate. Additionally, enzymatic oxidation led to the synthesis of a FA-major product, exhibiting a molecular mass of 386 g/mol and a EF-major product with a molecular mass of 442 g/mol. Structural analyses by mass spectrometry allowed the identification of dimeric derivatives. The optical properties of the oxidation products showed the increase of red and yellow colours, with FA-products compared to EF-products. Additionally, enzymatic oxidation led to a decrease of antioxidant and cytotoxic activities compared to initial substrates. Consequently, this enzymatic procedure in aqueous medium could provide new compounds presenting optical, antioxidant and cytotoxic interest.

  14. Regulation of lipid synthesis genes and milk fat production in human mammary epithelial cells during secretory activation.

    PubMed

    Mohammad, Mahmoud A; Haymond, Morey W

    2013-09-15

    Expression of genes for lipid biosynthetic enzymes during initiation of lactation in humans is unknown. Our goal was to study mRNA expression of lipid metabolic enzymes in human mammary epithelial cell (MEC) in conjunction with the measurement of milk fatty acid (FA) composition during secretory activation. Gene expression from mRNA isolated from milk fat globule (MFG) and milk FA composition were measured from 6 h to 42 days postpartum in seven normal women. Over the first 96 h postpartum, daily milk fat output increased severalfold and mirrored expression of genes for all aspects of lipid metabolism and milk FA production, including lipolysis at the MEC membrane, FA uptake from blood, intracellular FA transport, de novo FA synthesis, FA and glycerol activation, FA elongation, FA desaturation, triglyceride synthesis, cholesterol synthesis, and lipid droplet formation. Expression of the gene for a key lipid synthesis regulator, sterol regulatory element-binding transcription factor 1 (SREBF1), increased 2.0-fold by 36 h and remained elevated over the study duration. Expression of genes for estrogen receptor 1, thyroid hormone-responsive protein, and insulin-induced 2 increased progressively to plateau by 96 h. In contrast, mRNA of peroxisome proliferator-activated receptor-γ decreased severalfold. With onset of lactation, increased de novo synthesis of FA was the most prominent change in milk FA composition and mirrored the expression of FA synthesis genes. In conclusion, milk lipid synthesis and secretion in humans is a complex process requiring the orchestration of a wide variety of pathways of which SREBF1 may play a primary role.

  15. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  16. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  17. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  18. Total Synthesis of (±)- and (−)-Actinophyllic Acid

    PubMed Central

    Martin, Connor L.; Overman, Larry E.; Rohde, Jason M.

    2010-01-01

    Development of efficient sequences for the total syntheses of (±)-actinophyllic acid (rac-1) and (−)-actinophyllic acid (1) are described. The central step in these syntheses is the aza-Cope/Mannich reaction, which constructs the previously unknown hexacyclic ring system of actinophyllic acid in one step from much simpler tetracyclic precursors. The tetracyclic hexahydro-1,5-methano-1H-azocino[4,3-b]indole ketone rac-37 is assembled from o-nitrophenylacetic acid in four steps, with oxidative cyclization of a dienolate derivative of tricyclic precursor rac-35 being the central step. In the first-generation synthesis, this intermediate is transformed in two steps to homoallyl amine rac-43, whose formaldiminium derivative undergoes efficient aza-Cope/Mannich reaction to give pentacyclic ketone rac-44. In four additional steps, this intermediate is advanced to (±)-actinophyllic acid. The synthesis is streamlined by elaborating ketone rac-37 to β-hydroxyester intermediate rac-53, which is directly transformed to (±)-actinophyllic acid upon exposure to HCl and paraformaldehyde. This concise second-generation total synthesis of (±)-actinophyllic acid is realized in 22% overall yield from commercially available di-tert-butylmalonate and o-nitrophenylacetic acid by a sequence that proceeds by way of only six isolated intermediates. The first enantioselective total synthesis of (−)-actinophyllic acid (1) is accomplished by this direct sequence from tricyclic keto malonate (S)-35. Catalytic enantioselective reduction of α,β-unsaturated ketone 66 is the key step in the preparation of intermediate (S)-35 from the commercially available Boc-amino acid 65. Discussed also is the possibility that the aza-Cope/Mannich reaction might be involved in the biosynthesis of (−)-actinophyllic acid. PMID:20218696

  19. Induction of collagen synthesis by ascorbic acid. A possible mechanism.

    PubMed

    Pinnel, S R; Murad, S; Darr, D

    1987-12-01

    L-Ascorbic acid stimulates procollagen synthesis in cultured human skin fibroblasts without appreciably altering noncollagen protein synthesis. The effect is unrelated to intracellular degradation of newly synthesized procollagen. Levels of mRNA for pro alpha 1(I), pro alpha 2(I), and pro alpha 1(III), measured by hybridization with the corresponding cDNA probes, are elevated in the presence of ascorbic acid, whereas the level of mRNA for fibronectin is unchanged. Levels of functional mRNA for procollagen, measured in a cell-free translation assay, are specifically increased in the presence of ascorbic acid. Thus, ascorbic acid appears to control the expression of three different procollagen genes, each of which is located on a separate chromosome. It is proposed that intracellularly accumulated procollagen in ascorbate deficiency may lead to a translational repression of procollagen synthesis. Ascorbic acid may relieve this block by promoting hydroxyproline formation and, consequently, secretion of procollagen from the cell. The increased level of procollagen mRNA under the influence of ascorbic acid may be secondary to increased synthesis of procollagen polypeptides; the control point may be gene transcription or mRNA degradation.

  20. Pyrophosphate-condensing activity linked to nucleic acid synthesis.

    PubMed Central

    Volloch, V Z; Rits, S; Tumerman, L

    1979-01-01

    In some preparations of DNA dependent RNA polymerase a new enzymatic activity has been found which catalyzes the condensation of two pyrophosphate molecules, liberated in the process of RNA synthesis, to one molecule of orthophosphate and one molecule of Mg (or Mn) - chelate complex with trimetaphosphate. This activity can also cooperate with DNA-polymerase, on condition that both enzymes originate from the same cells. These results point to two general conclusions. First, energy is conserved in the overall process of nucleic acid synthesis and turnover, so that the process does not require an energy influx from the cell's general resources. Second, the synthesis of nucleic acids is catalyzed by a complex enzyme system which contains at least two separate enzymes, one responsible for nucleic acid polymerization and the other for energy conservation via pyrophosphate condensation. Images PMID:88040

  1. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton.

  2. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

  3. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  4. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway.

  5. Effects of pyrazinamide on fatty acid synthesis by whole mycobacterial cells and purified fatty acid synthase I.

    PubMed

    Boshoff, Helena I; Mizrahi, Valerie; Barry, Clifton E

    2002-04-01

    The effects of low extracellular pH and intracellular accumulation of weak organic acids were compared with respect to fatty acid synthesis by whole cells of Mycobacterium tuberculosis and Mycobacterium smegmatis. The profile of fatty acids synthesized during exposure to benzoic, nicotinic, or pyrazinoic acids, as well as that observed during intracellular hydrolysis of the corresponding amides, was not a direct consequence of modulation of fatty acid synthesis by these compounds but reflected the response to inorganic acid stress. Analysis of fatty acid synthesis in crude mycobacterial cell extracts demonstrated that pyrazinoic acid failed to directly modulate the fatty acid synthase activity catalyzed by fatty acid synthase I (FAS-I). However, fatty acid synthesis was irreversibly inhibited by 5-chloro-pyrazinamide in a time-dependent fashion. Moreover, we demonstrate that pyrazinoic acid does not inhibit purified mycobacterial FAS-I, suggesting that this enzyme is not the immediate target of pyrazinamide.

  6. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  7. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  8. Does trans-10, cis-12 conjugated linoleic acid affect the intermediary glucose and energy expenditure of dairy cows due to repartitioning of milk component synthesis?

    PubMed

    Benninghoff, Jens; Metzger-Petersen, Katrin; Tröscher, Arnulf H A; Südekum, Karl-Heinz

    2015-11-01

    The overall goal of this study was to evaluate if intermediary energy metabolism of cows fed with trans-10, cis-12 conjugated linoleic acid (CLA) was modified such that milk-energy compounds were produced with less intermediary energy expenditure as compared to control cows. Published data on supplemented CLA were assembled. The extent was calculated to which the trans-10, cis-12 CLA isomer has an impact on glucose and energy conversion in the mammary gland by modifying glucose equivalent supply and energy required for fatty acid (FA) and fat synthesis, and if this will eventually lead to an improved glucose and energy status of CLA-supplemented high-yielding dairy cows. A possible relationship between CLA supplementation level and milk energy yield response was also studied. Calculations were conducted separately for orally and abomasally administered CLA and based on energy required for supply of glucose equivalents, i.e. lactose, glycerol and NADPH2. Further, modifications of milk FA profile due to CLA supplementation were considered when energy expenditures for FA and fat synthesis were quantified. Differences in yields between control and CLA groups were transformed into glucose energy equivalents. Only abomasal infusion (r(2) = 0.31) but not oral CLA administration (r(2) = 0.11) supplementation to dairy cow diets resulted in less glucose equivalent energy. Modifications of milk FA profiles also saved energy but the relationship with CLA supplementation was weaker for abomasal infusion (r(2) = 0.06) than oral administration (r(2) = 0.38). On average, 10 g/d of abomasally infused trans-10, cis-12 CLA saved 1.1 to 2.3 MJ net energy expressed as glucose equivalents, whereas both positive and negative values were observed when the trans-10, cis-12 CLA was fed to the cows. This study revealed a weak to moderate dose-dependent relationship between the amount of trans-10, cis-12 CLA administered and the amount of energy in glucose equivalents and energy for the

  9. Synthesis of nanomagnetic fluids and their UV spectrophotometric response with aliphatic organic acids and 1st tier dendrimers

    NASA Astrophysics Data System (ADS)

    Pandya, Shivani R.; Singh, Man

    2016-04-01

    Synthesis of Magnetic nanoparticles were made using coprecipitation method on mixing Fe+3 and Fe+2 in 2:1 ratio with aqueous 8M NaOH which on heating at 90°C for 2 h has yielded 85% magnetic (Fe3O4) nanoparticles (MNPs), characterized by XRD, VSM, SEM, and HR-TEM. The formic acid (FA), oxalic acid (OA) and citric acid (CA), the series of aliphatic organic acids along with Trimesoyl 1, 3, 5 tridimethyl malonate (TTDMM), trimesoyl 1, 3, 5 tridiethyl malonate (TTDEM), trimesoyl 1, 3, 5 tridipropyl malonate (TTDPM), trimesoyl 1, 3, 5 tridibutyl malonate (TTDBM) and trimesoyl 1, 3, 5 tridihexyl malonate (TTDHM) 1st tier dendrimers were used separately for preparing nanomagnetic fluid. From 25 to 150 µM MNPs at an interval of 25 µM were dispersed in 150 µM of acids and dendrimers separately with DMSO. UV-VIS spectrophotometry showed a maximum MNPs dispersion with TTDMM against others and found to be most stable nanomagnetic fluid on account of capping type mechanism of acids.

  10. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  11. FaPOD27 functions in the metabolism of polyphenols in strawberry fruit (Fragaria sp.)

    PubMed Central

    Yeh, Su-Ying; Huang, Fong-Chin; Hoffmann, Thomas; Mayershofer, Mechthild; Schwab, Wilfried

    2014-01-01

    The strawberry (Fragaria × ananassa) is one of the most preferred fresh fruit worldwide, accumulates numerous flavonoids but has limited shelf life due to excessive tissue softening caused by cell wall degradation. Since lignin is one of the polymers that strengthen plant cell walls and might contribute to some extent to fruit firmness monolignol biosynthesis was studied in strawberry fruit. Cinnamoyl-CoA reductase (CCR), cinnamyl alcohol dehydrogenase (CAD), and a peroxidase (POD27) gene were strongly expressed in red, ripe fruit whereas a second POD gene was primarily expressed in green, immature fruit. Moreover, FaPOD27 transcripts were strongly and constitutively induced in fruits exposed to Agrobacterium infection. Gene expression levels and enzymatic activities of FaCCR and FaCAD were efficiently suppressed through RNAi in FaCCR- and FaCAD-silenced strawberries. Besides, significantly elevated FaPOD transcript levels were detected after agroinfiltration of pBI-FaPOD constructs in fruits. At the same time, levels of G-monomers were considerably reduced in FaCCR-silenced fruits whereas the proportion of both G- and S-monomers decisively decreased in FaCAD-silenced and pBI-FaPOD fruits. Development, firmness, and lignin level of the treated fruits were similar to pBI-intron control fruits, presumably attributed to increased expression levels of FaPOD27 upon agroinfiltration. Additionally, enhanced firmness, accompanied with elevated lignin levels, was revealed in chalcone synthase-deficient fruits (CHS−), independent of down- or up-regulation of individual and combined FaCCR. FaCAD, and FaPOD genes by agroinfiltration, when compared to CHS−/pBI-intron control fruits. These approaches provide further insight into the genetic control of flavonoid and lignin synthesis in strawberries. The results suggest that FaPOD27 is a key gene for lignin biosynthesis in strawberry fruit and thus to improving the firmness of strawberries. PMID:25346738

  12. Orthogonal Synthesis of Xeno Nucleic Acids.

    PubMed

    Fiers, Guillaume; Chouikhi, Dalila; Oswald, Laurence; Al Ouahabi, Abdelaziz; Chan-Seng, Delphine; Charles, Laurence; Lutz, Jean-François

    2016-12-12

    Sequence-defined peptide triazole nucleic acids (PTzNA) were synthesized by means of a solid-phase orthogonal "AB+CD" iterative strategy. In this approach, AB and CD building blocks containing carboxylic acid (A), azide (B), alkyne (C), and primary amine (D) functions are assembled together by successive copper-catalyzed azide-alkyne cycloaddition (CuAAC) and acid-amine coupling steps. Different PTzNA genetic sequences were prepared using a library of eight building blocks (i.e., four AB and four CD building blocks).

  13. Amino acid synthesis in a supercritical carbon dioxide - water system.

    PubMed

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-06-15

    Mars is a CO(2)-abundant planet, whereas early Earth is thought to be also CO(2)-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO(2)/liquid H(2)O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life's origin.

  14. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  15. [Possible route for thiamine participation in fatty acid synthesis].

    PubMed

    Buko, V U; Larin, F S

    1976-01-01

    The possibility of thiamine partaking in the synthesis of fatty acids through the functions unrelated to the catalytic properties of thiamine-diphosphate was studied. Rats kept on a fat-free ration devoid of thiamine were given thiamine of thiochrome with no vitaminic properties. The total fatty acids content in different tissues and incorporation therein of tagged acetate and pyruvate was determined, while the fatty acids composition of the liver was investigated by using gas chromatography. Thiamine and thiochrome produced a similar effect on a number of the study factors, i.e. they forced down the total acids level in the spleen, intensified incorporation of tagged acetate and pyruvate in fatty acids of the heart and uniformly changed the fatty acids composition in the liver. It is suggested that the unindirectional effects of thiamine and thiochrome is due to the oxidative transformation of thiamine into thiochrome.

  16. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  17. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  18. Targeting cancer cells with folic acid-iminoboronate fluorescent conjugates.

    PubMed

    Cal, Pedro M S D; Frade, Raquel F M; Chudasama, Vijay; Cordeiro, Carlos; Caddick, Stephen; Gois, Pedro M P

    2014-05-25

    Herein we present the synthesis of fluorescent 2-acetylbenzeneboronic acids that undergo B-N promoted conjugation with lysozyme and N-(2-aminoethyl) folic acid (EDA-FA), generating conjugates that are selectively recognized and internalized by cancer cells that over-express folic acid receptors.

  19. Sources of variability in fatty acid (FA) biomarkers in the application of compound-specific stable isotopes (CSSIs) to soil and sediment fingerprinting and tracing: A review.

    PubMed

    Reiffarth, D G; Petticrew, E L; Owens, P N; Lobb, D A

    2016-09-15

    Determining soil redistribution and sediment budgets in watersheds is often challenging. One of the methods for making such determinations employs soil and sediment fingerprinting techniques, using sediment properties such as geochemistry, fallout radionuclides, and mineral magnetism. These methods greatly improve the estimation of erosion and deposition within a watershed, but are limited when determining land use-based soil and sediment movement. Recently, compound-specific stable isotopes (CSSIs), which employ fatty acids naturally occurring in the vegetative cover of soils, offer the possibility of refining fingerprinting techniques based on land use, complementing other methods that are currently in use. The CSSI method has been met with some success; however, challenges still remain with respect to scale and resolution due to a potentially large degree of biological, environmental and analytical uncertainty. By better understanding the source of tracers used in CSSI work and the inherent biochemical variability in those tracers, improvement in sample design and tracer selection is possible. Furthermore, an understanding of environmental and analytical factors affecting the CSSI signal will lead to refinement of the approach and the ability to generate more robust data. This review focuses on sources of biological, environmental and analytical variability in applying CSSI to soil and sediment fingerprinting, and presents recommendations based on past work and current research in this area for improving the CSSI technique. A recommendation, based on current information available in the literature, is to use very-long chain saturated fatty acids and to avoid the use of the ubiquitous saturated fatty acids, C16 and C18.

  20. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  1. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues.

  2. Conjugated linoleic acid-induced milk fat depression in lactating ewes is accompanied by reduced expression of mammary genes involved in lipid synthesis.

    PubMed

    Hussein, M; Harvatine, K H; Weerasinghe, W M P B; Sinclair, L A; Bauman, D E

    2013-06-01

    Conjugated linoleic acids (CLA) are produced during rumen biohydrogenation and exert a range of biological effects. The trans-10,cis-12 CLA isomer is a potent inhibitor of milk fat synthesis in lactating dairy cows and some aspects of the mechanism have been established. Conjugated linoleic acid-induced milk fat depression has also been observed in small ruminants and our objective was to examine the molecular mechanism in lactating ewes. Multiparous lactating ewes were fed a basal ration (0.55:0.45 concentrate-to-forage ratio; dry matter basis) and randomly allocated to 2 dietary CLA levels (n=8 ewes/treatment). Treatments were zero CLA (control) or 15 g/d of lipid-encapsulated CLA supplement containing cis-9,trans-11 and trans-10,cis-12 CLA isomers in equal proportions. Treatments were fed for 10 wk and the CLA supplement provided 1.5 g of trans-10,cis-12/d. No treatment effects were observed on milk yield or milk composition for protein or lactose at wk 10 of the study. In contrast, CLA treatment significantly decreased both milk fat percentage and milk fat yield (g/d) by about 23%. The de novo synthesized fatty acids (FA; FA (>C16) was increased (10%) for the CLA treatment. In agreement with the reduced de novo FA synthesis, mRNA abundance of acetyl-coenzyme A carboxylase α, FA synthase, stearoyl-CoA desaturase 1, and glycerol-3-phosphate acyltransferase 6 decreased by 25 to 40% in the CLA-treated group. Conjugated linoleic acid treatment did not significantly reduce the mRNA abundance of enzymes involved in NADPH production, but the mRNA abundance for sterol regulatory element-binding factor 1 and insulin-induced gene 1, genes involved in regulation of transcription of lipogenic enzymes, was decreased by almost 30 and 55%, respectively, with CLA treatment. Furthermore, mRNA abundance of lipoprotein lipase decreased by almost 40% due to CLA treatment

  3. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties.

  4. Fatty acid phytyl ester synthesis in chloroplasts of Arabidopsis.

    PubMed

    Lippold, Felix; vom Dorp, Katharina; Abraham, Marion; Hölzl, Georg; Wewer, Vera; Yilmaz, Jenny Lindberg; Lager, Ida; Montandon, Cyrille; Besagni, Céline; Kessler, Felix; Stymne, Sten; Dörmann, Peter

    2012-05-01

    During stress or senescence, thylakoid membranes in chloroplasts are disintegrated, and chlorophyll and galactolipid are broken down, resulting in the accumulation of toxic intermediates, i.e., tetrapyrroles, free phytol, and free fatty acids. Chlorophyll degradation has been studied in detail, but the catabolic pathways for phytol and fatty acids remain unclear. A large proportion of phytol and fatty acids is converted into fatty acid phytyl esters and triacylglycerol during stress or senescence in chloroplasts. We isolated two genes (PHYTYL ESTER SYNTHASE1 [PES1] and PES2) of the esterase/lipase/thioesterase family of acyltransferases from Arabidopsis thaliana that are involved in fatty acid phytyl ester synthesis in chloroplasts. The two proteins are highly expressed during senescence and nitrogen deprivation. Heterologous expression in yeast revealed that PES1 and PES2 have phytyl ester synthesis and diacylglycerol acyltransferase activities. The enzymes show broad substrate specificities and can employ acyl-CoAs, acyl carrier proteins, and galactolipids as acyl donors. Double mutant plants (pes1 pes2) grow normally but show reduced phytyl ester and triacylglycerol accumulation. These results demonstrate that PES1 and PES2 are involved in the deposition of free phytol and free fatty acids in the form of phytyl esters in chloroplasts, a process involved in maintaining the integrity of the photosynthetic membrane during abiotic stress and senescence.

  5. Effect of unsaturated fatty acids and triglycerides from soybeans on milk fat synthesis and biohydrogenation intermediates in dairy cattle.

    PubMed

    Boerman, J P; Lock, A L

    2014-11-01

    Increased rumen unsaturated fatty acid (FA) load is a risk factor for milk fat depression. This study evaluated if increasing the amount of unsaturated FA in the diet as triglycerides or free FA affected feed intake, yield of milk and milk components, and feed efficiency. Eighteen Holstein cows (132 ± 75 d in milk) were used in a replicated 3 × 3 Latin square design. Treatments were a control (CON) diet, or 1 of 2 unsaturated FA (UFA) treatments supplemented with either soybean oil (FA present as triglycerides; TAG treatment) or soybean FA distillate (FA present as free FA; FFA treatment). The soybean oil contained a higher concentration of cis-9 C18:1 (26.0 vs. 11.8 g/100g of FA) and lower concentrations of C16:0 (9.6 vs. 15.0 g/100g of FA) and cis-9,cis-12 C18:2 (50.5 vs. 59.1g/100g of FA) than the soybean FA distillate. The soybean oil and soybean FA distillate were included in the diet at 2% dry matter (DM) to replace soyhulls in the CON diet. Treatment periods were 21 d, with the final 4 d used for sample and data collection. The corn silage- and alfalfa silage-based diets contained 23% forage neutral detergent fiber and 17% crude protein. Total dietary FA were 2.6, 4.2, and 4.3% of diet DM for CON, FFA, and TAG treatments, respectively. Total FA intake was increased 57% for UFA treatments and was similar between FFA and TAG. The intakes of individual FA were similar, with the exception of a 24 g/d lower intake of C16:0 and a 64 g/d greater intake of cis-9 C18:1 for the TAG compared with the FFA treatment. Compared with CON, the UFA treatments decreased DM intake (1.0 kg/d) but increased milk yield (2.2 kg/d) and milk lactose concentration and yield. The UFA treatments reduced milk fat concentration, averaging 3.30, 3.18, and 3.11% for CON, FFA, and TAG treatments, respectively. Yield of milk fat, milk protein, and 3.5% fat-corrected milk remained unchanged when comparing CON with the UFA treatments. No differences existed in the yield of milk or milk

  6. Fatty acid effects on fibroblast cholesterol synthesis

    SciTech Connect

    Shireman, R.B.; Muth, J.; Lopez, C.

    1987-05-01

    Two cell lines of normal (CRL 1475, GM5565) and of familial hypercholesterolemia (FH) (CM 486,488) fibroblasts were preincubated with medium containing the growth factor ITS, 2.5 mg/ml fatty acid-free BSA, or 35.2 ..mu..mol/ml of these fatty acids complexed with 2.5 mg BSA/ml: stearic (18:0), caprylic (8:0), oleic (18:1;9), linoleic (18:2;9,12), linolenic (18:3;9,12,15), docosahexaenoic (22:6;4,7,10,13,16,19)(DHA) or eicosapentaenoic (20:5;5,8,11,14,17)(EPA). After 20 h, cells were incubated for 2 h with 0.2 ..mu..Ci (/sup 14/C)acetate/ml. Cells were hydrolyzed; an aliquot was quantitated for radioactivity and protein. After saponification and extraction with hexane, radioactivity in the aqueous and organic phases was determined. The FH cells always incorporated 30-90% more acetate/mg protein than normal cells but the pattern of the fatty acid effects was similar in both types. When the values were normalized to 1 for the BSA-only group, cells with ITS had the greatest (/sup 14/C)acetate incorporation (1.45) followed by the caprylic group (1.14). Cells incubated with 18:3, 20:6 or 22:6 incorporated about the same amount as BSA-only. Those preincubated with 18:2, 18:1, 18:0 showed the least acetate incorporation (0.87, 0.59 and 0.52, respectively). The percentage of total /sup 14/C counts which extracted into hexane was much greater in FH cells; however, these values varied with the fatty acid, e.g., 1.31(18:0) and 0.84(8:0) relative to 1(BSA).

  7. Fatty Acid Biosynthesis Inhibition Increases Reduction Potential in Neuronal Cells under Hypoxia

    PubMed Central

    Brose, Stephen A.; Golovko, Svetlana A.; Golovko, Mikhail Y.

    2016-01-01

    Recently, we have reported a novel neuronal specific pathway for adaptation to hypoxia through increased fatty acid (FA) biosynthesis followed by esterification into lipids. However, the biological role of this pathway under hypoxia remains to be elucidated. In the presented study, we have tested our hypothesis that activation of FA synthesis maintains reduction potential and reduces lactoacidosis in neuronal cells under hypoxia. To address this hypothesis, we measured the effect of FA synthesis inhibition on NADH2+/NAD+ and NADPH2+/NADP+ ratios, and lactic acid levels in neuronal SH-SY5Y cells exposed to normoxic and hypoxic conditions. FA synthesis inhibitors, TOFA (inhibits Acetyl-CoA carboxylase) and cerulenin (inhibits FA synthase), increased NADH2+/NAD+ and NADPH2+/NADP+ ratios under hypoxia. Further, FA synthesis inhibition increased lactic acid under both normoxic and hypoxic conditions, and caused cytotoxicity under hypoxia but not normoxia. These results indicate that FA may serve as hydrogen acceptors under hypoxia, thus supporting oxidation reactions including anaerobic glycolysis. These findings may help to identify a radically different approach to attenuate hypoxia related pathophysiology in the nervous system including stroke. PMID:27965531

  8. A Concise Synthesis of Berkelic Acid Inspired by Combining the Natural Products Spicifernin and Pulvilloric Acid

    PubMed Central

    Bender, Christopher F.; Yoshimoto, Francis K.; Paradise, Christopher L.; De Brabander, Jef K.

    2009-01-01

    We describe a concise synthesis of the structurally novel fungal extremophile metabolite berkelic acid – an effort leading to an unambiguous assignment of C22 stereochemistry. Our synthetic approach was inspired by the recognition that berkelic acid displays structural characteristics reminiscent of two other fungal metabolites, spicifernin and pulvilloric acid. Based on this notion, we executed a synthesis that features a Ag-catalyzed cascade dearomatization-cycloisomerization-cycloaddition sequence to couple two natural product inspired fragments. Notably, a spicifernin-like synthon was prepared with defined C22 stereochemistry in seven steps and three purifications (24–28% overall yield). A potentially useful anti-selective conjugate propargylation reaction was developed to introduce the vicinal stereodiad. An enantioconvergent synthesis of the other coupling partner, the aromatic precursor to pulvilloric acid methyl ester, was achieved in eight steps and 48% overall yield. The total synthesis of berkelic acid and its C22 epimer was thus completed in 10 steps longest linear sequence and 11–27% overall yield. PMID:19722648

  9. Stimulation of protein synthesis by phosphatidic acid in rat cardiomyocytes.

    PubMed

    Xu, Y J; Yau, L; Yu, L P; Elimban, V; Zahradka, P; Dhalla, N S

    1996-12-13

    Phosphatidic acid (PA) was observed to stimulate protein synthesis in adult cardiomyocytes in a time- and concentration-dependent manner. The maximal stimulation in protein synthesis (142 +/- 12% vs 100% as the control) was achieved at 10 microM PA within 60 min and was inhibited by actinomycin D (107 +/- 4% of the control) or cycloheximide (105 +/- 6% of the control). The increase in protein synthesis due to PA was attenuated or abolished by preincubation of cardiomyocytes with a tyrosine kinase inhibitor, genistein (94 +/- 9% of the control), phospholipase C inhibitors 2-nitro-4-carboxyphenyl N,N-diphenyl carbamate or carbon-odithioic acid O-(octahydro-4,7-methanol-1H-inden-5-yl (101 +/- 6 and 95 +/- 5% of the control, respectively), protein kinase C inhibitors staurosporine or polymyxin B (109 +/- 3 and 93 +/- 3% of the control), and chelators of extracellular and intracellular free Ca2+ EGTA or BAPTA/AM (103 +/- 6 and 95 +/- 6% of the control, respectively). PA at different concentrations (0.1 to 100 microM) also caused phosphorylation of a cell surface protein of approximately 24 kDa. In addition, mitogen-activated protein kinase was stimulated by PA in a concentration-dependent manner; maximal stimulation (217 +/- 6% of the control) was seen at 10 microM PA. These data suggest that PA increases protein synthesis in adult rat cardiomyocytes and thus may play an important role in the development of cardiac hypertrophy.

  10. Inhibition of in vitro cholesterol synthesis by fatty acids.

    PubMed

    Kuroda, M; Endo, A

    1976-01-18

    Inhibitory effect of 44 species of fatty acids on cholesterol synthesis has been examined with a rat liver enzyme system. In the case of saturated fatty acids, the inhibitory activity increased with chain length to a maximum at 11 to 14 carbons, after which activity decreased rapidly. The inhibition increased with the degree of unsaturation of fatty acids. Introduction of a hydroxy group at the alpha-position of fatty acids abolished the inhibition, while the inhibition was enhanced by the presence of a hydroxy group located in an intermediate position of the chain. Branched chain fatty acids having a methyl group at the terminal showed much higher activity than the corresponding saturated straight chain fatty acids with the same number of carbons. With respect to the mechanism for inhibition, tridecanoate was found to inhibit acetoacetyl-CoA thiolase specifically without affecting the other reaction steps in the cholesterol synthetic pathway. The highly unsaturated fatty acids, arachidonate and linoleate, were specific inhibitors of 3-hydroxy-3-methyl-glutaryl-CoA synthase. On the other hand, ricinoleate (hydroxy acid) and phytanate (branched-chain acid) diminished the conversion of mevalonate to sterols by inhibiting a step or steps between squalene and lanosterol.

  11. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  12. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-02

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

  13. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  14. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

  15. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  16. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  17. A new regulatory mechanism for bacterial lipoic acid synthesis.

    PubMed

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-22

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis.

  18. The Significance of Different Diacylgycerol Synthesis Pathways on Plant Oil Composition and Bioengineering

    PubMed Central

    Bates, Philip D.; Browse, John

    2012-01-01

    The unique properties of vegetable oils from different plants utilized for food, industrial feedstocks, and fuel is dependent on the fatty acid (FA) composition of triacylglycerol (TAG). Plants can use two main pathways to produce diacylglycerol (DAG), the immediate precursor molecule to TAG synthesis: (1) De novo DAG synthesis, and (2) conversion of the membrane lipid phosphatidylcholine (PC) to DAG. The FA esterified to PC are also the substrate for FA modification (e.g., desaturation, hydroxylation, etc.), such that the FA composition of PC-derived DAG can be substantially different than that of de novo DAG. Since DAG provides two of the three FA in TAG, the relative flux of TAG synthesis from de novo DAG or PC-derived DAG can greatly affect the final oil FA composition. Here we review how the fluxes through these two alternate pathways of DAG/TAG synthesis are determined and present evidence that suggests which pathway is utilized in different plants. Additionally, we present examples of how the endogenous DAG synthesis pathway in a transgenic host plant can produce bottlenecks for engineering of plant oil FA composition, and discuss alternative strategies to overcome these bottlenecks to produce crop plants with designer vegetable oil compositions. PMID:22783267

  19. Influence of fatty acid on lipase-catalyzed synthesis of ascorbyl esters and their free radical scavenging capacity.

    PubMed

    Stojanović, Marija; Carević, Milica; Mihailović, Mladen; Veličković, Dušan; Dimitrijević, Aleksandra; Milosavić, Nenad; Bezbradica, Dejan

    2015-01-01

    Fatty acid (FA) ascorbyl esters are recently emerging food, cosmetic, and pharmaceutical additives, which can be prepared in an eco-friendly way by using lipases as catalysts. Because they are amphiphilic molecules, which possess high free radical scavenging capacity, they can be applied as liposoluble antioxidants as well as emulsifiers and biosurfactants. In this study, the influence of a wide range of acyl donors on ester yield in lipase-catalyzed synthesis and ester antioxidant activity was examined. Among saturated acyl donors, higher yields and antioxidant activities of esters were achieved when short-chain FAs were used. Oleic acid gave the highest yield overall and its ester exhibited a high antioxidant activity. Optimization of experimental factors showed that the highest conversion (60.5%) in acetone was achieved with 5 g L(-1) of lipase, 50 mM of vitamin C, 10-fold molar excess of oleic acid, and 0.7 mL L(-1) of initial water. Obtained results showed that even short- and medium-chain ascorbyl esters could be synthesized with high yields and retained (or even exceeded) free radical scavenging capacity of l-ascorbic acid, indicating prospects of broadening their application in emulsions and liposomes.

  20. Interactions among triphenyltin degradation, phospholipid synthesis and membrane characteristics of Bacillus thuringiensis in the presence of d-malic acid.

    PubMed

    Wang, Linlin; Yi, Wenying; Ye, Jinshao; Qin, Huaming; Long, Yan; Yang, Meng; Li, Qusheng

    2017-02-01

    Degradation pathway and surface biosorption of triphenyltin (TPT) by effective microbes have been investigated in the past. However, unclear interactions among membrane components and TPT binding and transport are still obstacles to understanding TPT biotransformation. To reveal the mechanism involved, the phospholipid expression, membrane potential, cellular mechanism and molecular dynamics between TPT and fatty acids (FAs) during the TPT degradation process in the presence of d-malic acid (DMA) were studied. The results show that the degradation efficiency of 1 mg L(-1) TPT by Bacillus thuringiensis (1 g L(-1)) with 0.5 or 1 mg L(-1) DMA reached values up to approximately 90% due to the promotion of element metabolism and cellular activity, and the depression of FA synthesis induced by DMA. The addition of DMA caused conversion of more linoleic acid into 10-oxo-12(Z)-octadecenoic acid, increased the membrane permeability, and alleviated the decrease in membrane potential, resulting in TPT transport and degradation. Fluorescence analysis reveals that the endospore of B. thuringiensis could act as an indicator for membrane potential and cellular activities. The current findings are advantageous for acceleration of biosorption, transport and removal of pollutants from natural environments.

  1. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  2. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  3. Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

    PubMed

    Matsuno, Koya; Fujimura, Tatsuhito

    2014-03-01

    A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis.

  4. Invited review: palmitic and stearic acid metabolism in lactating dairy cows.

    PubMed

    Loften, J R; Linn, J G; Drackley, J K; Jenkins, T C; Soderholm, C G; Kertz, A F

    2014-01-01

    Energy is the most limiting nutritional component in diets for high-producing dairy cows. Palmitic (C16:0) and stearic (C18:0) acids have unique and specific functions in lactating dairy cows beyond a ubiquitous energy source. This review delineates their metabolism and usage in lactating dairy cows from diet to milk production. Palmitic acid is the fatty acid (FA) found in the greatest quantity in milk fat. Dietary sources of C16:0 generally increase milk fat yield and are used as an energy source for milk production and replenishing body weight loss during periods of negative energy balance. Stearic acid is the most abundant FA available to the dairy cow and is used to a greater extent for milk production and energy balance than C16:0. However, C18:0 is also intimately involved in milk fat production. Quantifying the transfer of each FA from diet into milk fat is complicated by de novo synthesis of C16:0 and desaturation of C18:0 to oleic acid in the mammary gland. In addition, incorporation of both FA into milk fat appears to be limited by the cow's requirement to maintain fluidity of milk, which requires a balance between saturated and unsaturated FA. Oleic acid is the second most abundant FA in milk fat and likely the main unsaturated FA involved in regulating fluidity of milk. Because the mammary gland can desaturate C18:0 to oleic acid, C18:0 appears to have a more prominent role in milk production than C16:0. To understand metabolism and utilization of these FA in lactating dairy cows, we reviewed production and milk fat synthesis studies. Additional and longer lactation studies on feeding both FA to lactating dairy cows are required to better delineate their roles in optimizing milk production and milk FA composition and yield.

  5. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives.

  6. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  7. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  8. Marine lipid-based liposomes increase in vivo FA bioavailability.

    PubMed

    Cansell, Maud; Nacka, Fabienne; Combe, Nicole

    2003-05-01

    Liposomes made from an extract of natural marine lipids and containing a high n-3 PUFA lipid ratio were envisaged as oral route vectors for FA supplements in order to increase PUFA bioavailability. The absorption of FA in thoracic lymph duct-cannulated rats, after intragastric feeding of dietary fats in the form of liposomes or fish oil, was compared. Lipid and FA analyses were also performed on feces. Five mole percent alpha-tocopherol was added to fish oil and incorporated into the liposome membrane. The influence of alpha-tocopherol on FA lymph recovery was also investigated. In vivo, FA absorption in rats was favored by liposomes (98 +/- 1%) compared to fish oil (73 +/- 6%). In the same way, the DHA proportion in lymph was higher after liposome ingestion (78%) than after fish oil ingestion (47%). However, phospholipid (PL) concentration in lymph was not affected by the kind of dietary fat ingested, suggesting a PL regulation due to de novo TAG synthesis. The influence of the intramolecular distribution of n-3 PUFA in dietary lipids (TAG and PL) on the intramolecular FA distribution in TAG of chylomicrons was also investigated. The results obtained showed that the distribution of n-3 PUFA esterified on the sn-2 position of chylomicron TAG depended on the lipid source administered. All these results correlated, at least partly, with in vitro liposome behavior under conditions that mimic those of the gastrointestinal tract. As a whole, this study pointed out that marine PL may constitute an attractive material for the development of liposomes as oral PUFA supplements.

  9. Fusidic acid targets elongation factor G in several stages of translocation on the bacterial ribosome.

    PubMed

    Borg, Anneli; Holm, Mikael; Shiroyama, Ikue; Hauryliuk, Vasili; Pavlov, Michael; Sanyal, Suparna; Ehrenberg, Måns

    2015-02-06

    The antibiotic fusidic acid (FA) targets elongation factor G (EF-G) and inhibits ribosomal peptide elongation and ribosome recycling, but deeper mechanistic aspects of FA action have remained unknown. Using quench flow and stopped flow experiments in a biochemical system for protein synthesis and taking advantage of separate time scales for inhibited (10 s) and uninhibited (100 ms) elongation cycles, a detailed kinetic model of FA action was obtained. FA targets EF-G at an early stage in the translocation process (I), which proceeds unhindered by the presence of the drug to a later stage (II), where the ribosome stalls. Stalling may also occur at a third stage of translocation (III), just before release of EF-G from the post-translocation ribosome. We show that FA is a strong elongation inhibitor (K50% ≈ 1 μm), discuss the identity of the FA targeted states, and place existing cryo-EM and crystal structures in their functional context.

  10. Folic acid supplementation in pregnancy and implications in health and disease

    PubMed Central

    2014-01-01

    Maternal exposure to dietary factors during pregnancy can influence embryonic development and may modulate the phenotype of offspring through epigenetic programming. Folate is critical for nucleotide synthesis, and preconceptional intake of dietary folic acid (FA) is credited with reduced incidences of neural tube defects in infants. While fortification of grains with FA resulted in a positive public-health outcome, concern has been raised for the need for further investigation of unintended consequences and potential health hazards arising from excessive FA intakes, especially following reports that FA may exert epigenetic effects. The objective of this article is to discuss the role of FA in human health and to review the benefits, concerns and epigenetic effects of maternal FA on the basis of recent findings that are important to design future studies. PMID:25135350

  11. The Effect of TRANSPARENT TESTA2 on Seed Fatty Acid Biosynthesis and Tolerance to Environmental Stresses during Young Seedling Establishment in Arabidopsis1[W][OA

    PubMed Central

    Chen, Mingxun; Wang, Zhong; Zhu, Yana; Li, Zhilan; Hussain, Nazim; Xuan, Lijie; Guo, Wanli; Zhang, Guoping; Jiang, Lixi

    2012-01-01

    In plants, fatty acids (FAs) and FA-derived complex lipids are major carbon and energy reserves in seeds. They are essential components of cellular membranes and cellular signal or hormone molecules. Although TRANSPARENT TESTA2 (TT2) is well studied for its function in regulating proanthocyanidin biosynthesis in the seed coat, little attention has been given to its role in affecting seed FA accumulation and tolerance to environmental stresses. We demonstrate that the tt2 mutation remarkably increased the seed FA content, decreased seed weight, and altered the FA composition. The increase in FA content in the tt2 seeds was due to the relative decrease of seed coat proportion as well as the more efficient FA synthesis in the tt2 embryo. Microarray analysis revealed that tt2 mutation up-regulated a group of genes critical to FA biosynthesis and embryonic development. The mutation also altered the gene expressions that respond to stress. The microarray analysis discovered that the increase in FA accumulation of the tt2 seeds were accompanied by the significant up-regulation of FUSCA3, a transcriptional factor for embryonic development and FATTY ACID ELONGASE1, which catalyzes the elongation of FA chains. Moreover, lower seed protein accumulation during seed maturation also contributed to the increased seed FA accumulation in tt2 mutants. This study advances the understanding of the TT2 gene in seed FA accumulation and abiotic stresses during seed germination and seedling establishment. PMID:22879396

  12. Synthesis of benzyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Chen, Na; Zhi, Gao-Ying

    2015-12-01

    In this study, lipase catalysis was successfully applied in synthesis of benzyl cinnamate through esterification of cinnamic acid with benzyl alcohol. Lipozyme TLIM was found to be more efficient for catalyzing this reaction than Novozym 435. In order to increase the yield of benzyl cinnamate, several media, including acetone, trichloromethane, methylbenzene, and isooctane, were used in this reaction. The reaction showed a high yield using isooctane as medium. Furthermore, the effects of several parameters such as water activity, reaction temperature, etc, on this reaction were analyzed. It was pointed out that too much benzyl alcohol would inhibit lipase activity. Under the optimum conditions, lipase-catalyzed synthesis of benzyl cinnamate gave a maximum yield of 97.3%. Besides, reusable experiment of enzyme demonstrated that Lipozyme TLIM retained 63% of its initial activity after three cycles. These results were of general interest for developing industrial processes for the preparation of benzyl cinnamate.

  13. Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

    DTIC Science & Technology

    2000-08-01

    Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer PRINCIPAL INVESTIGATOR: Francis P. Kuhajda, M.D. CONTRACTING ORGANIZATION...SUBTITLE 5. FUNDING NUMBERS Xenograft Studies of Fatty Acid Synthesis DAMD17-96-1-6235 Inhibition as Novel Therapy for Breast Cancer 6. AUTHOR(S...5012. 13. ABSTRACT (Maximum 200 Words) This grant proposed to study the effect of fatty acid synthesis inhibition in human breast cancer xenografts

  14. Synthesis of amino Derivatives of Dithio Acids as Potential Radiation Protective Agents

    DTIC Science & Technology

    1984-08-01

    ation Management S SI ____ K> AD Synthesis of Amino Derivatives of Dithio Acids as Potential Radiation Protective Agents * 0 Annual Report "TIi: o DTIC...Sftcuntiy Clatuftcatio") Synthesis of Amino Derivatives of Dithio Acids as PotentitI- Radiation Protective Agents 12l PERISONAL. Ak.TI4OR(S) * William...methyl- picoline derivatives was accomplished. Use of N-mthyl-2,6-dimethylpyridine also allowed the synthesis of a bis(dithioacetic acid) function not

  15. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  16. Synthesis and characterization of copolyanhydrides of carbohydrate-based galactaric acid and adipic acid.

    PubMed

    Mehtiö, Tuomas; Nurmi, Leena; Rämö, Virpi; Mikkonen, Hannu; Harlin, Ali

    2015-01-30

    A series of copolyanhydrides, consisting of 2,3,4,5-tetra-O-acetylgalactaric acid (AGA) and adipic acid (AA) as monomer units, was polymerized. Synthesis of AGA monomer consisted of two steps. First, O-acetylation of galactaric acid secondary hydroxyl groups was performed using acetic anhydride as a reagent. Acetic anhydride was then further used as a reagent in the synthesis of diacetyl mixed anhydride of AGA. Polymerizations were conducted as bulk condensation polymerization at 150 °C. Thermal properties of the copolymers varied depending on monomer composition. Increase in the AGA content had a clear increasing effect on the Tg. A similar increasing effect was observed in Tm. The degree of crystallinity decreased as AGA content increased. There was a slightly lowering tendency in the molecular weights of the obtained polymers when the AGA content in the polymerization mixtures increased. The described synthesis route shows that bio-based aldaric acid monomers are potential candidates for the adjustment of thermal properties of polyanhydrides.

  17. Synthesis and biological activity of novel deoxycholic acid derivatives.

    PubMed

    Popadyuk, Irina I; Markov, Andrey V; Salomatina, Oksana V; Logashenko, Evgeniya B; Shernyukov, Andrey V; Zenkova, Marina A; Salakhutdinov, Nariman F

    2015-08-01

    We report the synthesis and biological activity of new semi-synthetic derivatives of naturally occurring deoxycholic acid (DCA) bearing 2-cyano-3-oxo-1-ene, 3-oxo-1(2)-ene or 3-oxo-4(5)-ene moieties in ring A and 12-oxo or 12-oxo-9(11)-ene moieties in ring C. Bioassays using murine macrophage-like cells and tumour cells show that the presence of the 9(11)-double bond associated with the increased polarity of ring A or with isoxazole ring joined to ring A, improves the ability of the compounds to inhibit cancer cell growth.

  18. Antimicrobial polyurethane thermosets based on undecylenic acid: synthesis and evaluation.

    PubMed

    Lluch, Cristina; Esteve-Zarzoso, Braulio; Bordons, Albert; Lligadas, Gerard; Ronda, Juan C; Galià, Marina; Cádiz, Virginia

    2014-08-01

    In the present study, plant oil-derived surface-modifiable polyurethane thermosets are presented. Polyol synthesis is carried out taking advantage of thiol-yne photopolymerization of undecylenic acid derivatives containing methyl ester or hydroxyl moieties. The prepared methyl ester-containing polyurethanes allow surface modification treatment to enhance their hydrophilicity and impart antimicrobial activity through the following two steps: i) grafting poly(propylene glycol) monoamine (Jeffamine M-600) via aminolysis and ii) Jeffamine M-600 layer complexation with iodine. The antimicrobial activity of the iodine-containing polyurethanes is demonstrated by its capacity to inhibit the growth of Staphylococcus aureus, and Candida albicans in agar media.

  19. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.

    PubMed

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  20. Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments

    NASA Astrophysics Data System (ADS)

    Kitadai, Norio

    2015-12-01

    Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.

  1. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  2. Effect of mitochondrial ascorbic acid synthesis on photosynthesis.

    PubMed

    Senn, M E; Gergoff Grozeff, G E; Alegre, M L; Barrile, F; De Tullio, M C; Bartoli, C G

    2016-07-01

    Ascorbic acid (AA) is synthesized in plant mitochondria through the oxidation of l-galactono-1,4-lactone (l-GalL) and then distributed to different cell compartments. AA-deficient Arabidopsis thaliana mutants (vtc2) and exogenous applications of l-GalL were used to generate plants with different AA content in their leaves. This experimental approach allows determining specific AA-dependent effects on carbon metabolism. No differences in O2 uptake, malic and citric acid and NADH content suggest that AA synthesis or accumulation did not affect mitochondrial activity; however, l-GalL treatment increased CO2 assimilation and photosynthetic electron transport rate in vtc2 (but not wt) leaves demonstrating a stimulation of photosynthesis after l-GalL treatment. Increased CO2 assimilation correlated with increased leaf stomatal conductance observed in l-GalL-treated vtc2 plants.

  3. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  4. Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

    PubMed

    Hansen, Alexandar L; Behrman, Edward J

    2016-08-05

    We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid.

  5. Synthesis and characterization of acetic acid and ethanoic acid (based)-maleimide

    NASA Astrophysics Data System (ADS)

    Poad, Siti Nashwa Mohd; Hassan, Nurul Izzaty; Hassan, Nur Hasyareeda

    2016-11-01

    A new route to the synthesis of maleimide is described. 2-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)acetic acid maleimide (1) and 2-(4-(2,5-Dioxo-2,5-dihydro- 1H-pyrrol-1-yl)phenyl)ethanoic acid maleimide (2) have been synthesized by the reaction of maleic anhydride with glycine and 4-aminophenyl acetic aicd. Maleimide (1) was synthesized by conventional technique while maleimide (2) was synthesized by microwave method. The compounds were characterized using FT-Infrared (FT-IR), 1H and 13C Nuclear Magnetic Resonance (NMR) spectroscopies and Mass Spectrometry.

  6. Transcriptome analysis and identification of genes associated with omega-3 fatty acid biosynthesis in Perilla frutescens (L.) var. frutescens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Perilla (Perilla frutescens (L.) var frutescens) produces high levels of a-linolenic acid (ALA), an omega-3 fatty acid important to health and development. To uncover key genes involved in fatty acid (FA) and triacylglycerol (TAG) synthesis in perilla, we conducted deep sequencing of cD...

  7. Alternative kynurenic acid synthesis routes studied in the rat cerebellum

    PubMed Central

    Blanco Ayala, Tonali; Lugo Huitrón, Rafael; Carmona Aparicio, Liliana; Ramírez Ortega, Daniela; González Esquivel, Dinora; Pedraza Chaverrí, José; Pérez de la Cruz, Gonzalo; Ríos, Camilo; Schwarcz, Robert; Pérez de la Cruz, Verónica

    2015-01-01

    Kynurenic acid (KYNA), an astrocyte-derived, endogenous antagonist of α7 nicotinic acetylcholine and excitatory amino acid receptors, regulates glutamatergic, GABAergic, cholinergic and dopaminergic neurotransmission in several regions of the rodent brain. Synthesis of KYNA in the brain and elsewhere is generally attributed to the enzymatic conversion of L-kynurenine (L-KYN) by kynurenine aminotransferases (KATs). However, alternative routes, including KYNA formation from D-kynurenine (D-KYN) by D-amino acid oxidase (DAAO) and the direct transformation of kynurenine to KYNA by reactive oxygen species (ROS), have been demonstrated in the rat brain. Using the rat cerebellum, a region of low KAT activity and high DAAO activity, the present experiments were designed to examine KYNA production from L-KYN or D-KYN by KAT and DAAO, respectively, and to investigate the effect of ROS on KYNA synthesis. In chemical combinatorial systems, both L-KYN and D-KYN interacted directly with peroxynitrite (ONOO−) and hydroxyl radicals (OH•), resulting in the formation of KYNA. In tissue homogenates, the non-specific KAT inhibitor aminooxyacetic acid (AOAA; 1 mM) reduced KYNA production from L-KYN and D-KYN by 85.1 ± 1.7% and 27.1 ± 4.5%, respectively. Addition of DAAO inhibitors (benzoic acid, kojic acid or 3-methylpyrazole-5-carboxylic acid; 5 μM each) attenuated KYNA formation from L-KYN and D-KYN by ~35% and ~66%, respectively. ONOO− (25 μM) potentiated KYNA production from both L-KYN and D-KYN, and these effects were reduced by DAAO inhibition. AOAA attenuated KYNA production from L-KYN + ONOO− but not from D-KYN + ONOO−. In vivo, extracellular KYNA levels increased rapidly after perfusion of ONOO− and, more prominently, after subsequent perfusion with L-KYN or D-KYN (100 μM). Taken together, these results suggest that different mechanisms are involved in KYNA production in the rat cerebellum, and that, specifically, DAAO and ROS can function as alternative

  8. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  9. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  10. Induction of fatty acid synthesis by pravastatin sodium in rat liver and primary hepatocytes.

    PubMed

    Fujioka, T; Tsujita, Y; Shimotsu, H

    1997-06-11

    We examined the effect of pravastatin sodium (pravastatin), a 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor, on fatty acid synthesis in rat liver. The repeated administration of pravastatin to rats at 250 mg/kg for 7 days led to a 2.8-fold increase in fatty acid synthesis in the liver. The diurnal change of fatty acid synthesis was not affected by the treatment. Hepatic fatty acid synthase activity was increased 3.2-fold, while acetyl-CoA carboxylase activity was not changed by the repeated administration of pravastatin. In rat hepatocytes, the incubation with 2 microg/ml pravastatin for 24 h increased fatty acid synthase activity 1.5-fold, as well as HMG-CoA reductase activity 2.8-fold. These results suggest that HMG-CoA reductase inhibitors might increase fatty acid synthesis in vivo through the induction of hepatic fatty acid synthase.

  11. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  12. Indole diterpene synthetic studies. Total synthesis of (+)-nodulisporic acid F and construction of the heptacyclic cores of (+)-nodulisporic acids A and B and (-)-nodulisporic acid D.

    PubMed

    Smith, Amos B; Davulcu, Akin H; Cho, Young Shin; Ohmoto, Kazuyuki; Kürti, László; Ishiyama, Haruaki

    2007-06-22

    A first-generation strategy for construction of (+)-nodulisporic acids A (1) and B (2) is described. The strategy entails union of the eastern and western hemisphere subtargets via the indole synthesis protocol developed in our laboratory. Subsequent elaboration of rings E and F, however, revealed the considerable acid instability of the C(24) hydroxyl, thereby preventing further advancement. Nonetheless, preparation of the heptacyclic core of (+)-nodulisporic acids A and B, the total synthesis of (+)-nodulisporic acid F, the simplest member of the nodulisporic acid family, and elaboration of the heptacyclic core of (-)-nodulisporic acid D were achieved.

  13. Iodide-catalyzed reductions: development of a synthesis of phenylacetic acids.

    PubMed

    Milne, Jacqueline E; Storz, Thomas; Colyer, John T; Thiel, Oliver R; Dilmeghani Seran, Mina; Larsen, Robert D; Murry, Jerry A

    2011-11-18

    A new convenient and scalable synthesis of phenylacetic acids has been developed via the iodide catalyzed reduction of mandelic acids. The procedure relies on in situ generation of hydroiodic acid from catalytic sodium iodide, employing phosphorus acid as the stoichiometric reductant.

  14. GPM Video of In-fa

    NASA Video Gallery

    On Nov. 19 GPM saw a few towering storms in In-fa's eye wall were reaching heights of up to 17.3 km (10.7 miles). The most intense precipitation was measured in In-fa's eye wall by DPR where it was...

  15. Hypoglycemic effects of a phenolic acid fraction of rice bran and ferulic acid in C57BL/KsJ-db/db mice.

    PubMed

    Jung, Eun Hee; Kim, Sung Ran; Hwang, In Kyeong; Ha, Tae Youl

    2007-11-28

    Rice bran contains many phenolic acids, the most abundant of which is the antioxidant, ferulic acid (FA). We evaluated the hypoglycemic effects of a phenolic acid fraction (the ethyl acetate fraction, EAE) of rice bran and of FA in C57BL/KsJ db/db mice. Type 2 diabetic mice were allocated to a control group, an EAE group, or an FA group. Animals were fed a modified AIN-76 diet, and EAE or FA was administered orally for 17 days. There was no significant difference in body weight gain between groups. Administration of EAE and FA significantly decreased blood glucose levels and increased plasma insulin levels. EAE or FA groups had significantly elevated hepatic glycogen synthesis and glucokinase activity compared with the control group. Plasma total cholesterol and low density lipoprotein (LDL) cholesterol concentrations were significantly decreased by EAE and FA administration. These findings suggest that EAE and FA may be beneficial for treatment of type 2 diabetes because they regulate blood glucose levels by elevating glucokinase activity and production of glycogen in the liver.

  16. Synthesis of ω-hydroxy dodecanoic acid based on an engineered CYP153A fusion construct

    PubMed Central

    Scheps, Daniel; Honda Malca, Sumire; Richter, Sven M; Marisch, Karoline; Nestl, Bettina M; Hauer, Bernhard

    2013-01-01

    A bacterial P450 monooxygenase-based whole cell biocatalyst using Escherichia coli has been applied in the production of ω-hydroxy dodecanoic acid from dodecanoic acid (C12-FA) or the corresponding methyl ester. We have constructed and purified a chimeric protein where the fusion of the monooxygenase CYP153A from Marinobacter aquaeloei to the reductase domain of P450 BM3 from Bacillus megaterium ensures optimal protein expression and efficient electron coupling. The chimera was demonstrated to be functional and three times more efficient than other sets of redox components evaluated. The established fusion protein (CYP153AM. aq.-CPR) was used for the hydroxylation of C12-FA in in vivo studies. These experiments yielded 1.2 g l–1 ω-hydroxy dodecanoic from 10 g l–1 C12-FA with high regioselectivity (> 95%) for the terminal position. As a second strategy, we utilized C12-FA methyl ester as substrate in a two-phase system (5:1 aqueous/organic phase) configuration to overcome low substrate solubility and product toxicity by continuous extraction. The biocatalytic system was further improved with the coexpression of an additional outer membrane transport system (AlkL) to increase the substrate transfer into the cell, resulting in the production of 4 g l–1 ω-hydroxy dodecanoic acid. We further summarized the most important aspects of the whole-cell process and thereupon discuss the limits of the applied oxygenation reactions referring to hydrogen peroxide, acetate and P450 concentrations that impact the efficiency of the production host negatively. PMID:23941649

  17. Effects of different model diets on milk composition and expression of genes related to fatty acid synthesis in the mammary gland of lactating dairy goats.

    PubMed

    Zhang, H; Ao, C J; Khas-Erdene; Song, L W; Zhang, X F

    2015-07-01

    This study examined the effects of different roughage diets on milk composition and the expression of key genes associated with fatty acid (FA) synthesis in the mammary gland of lactating dairy goats. Eight multiparous lactating goats (body weight=43.6±2.5kg, 90±12 d in milk) fitted with external pudic artery and subcutaneous abdominal vein catheters were assigned to 2 treatments in a crossover design. The goats were fed different roughage diets with a similar concentrate-to-roughage ratio. The diets were (1) a high-quality roughage treatment (HQR) containing 28.5% Chinese wildrye hay, 19% corn silage, 9.5% alfalfa, and 43% concentrate or (2) a low-quality roughage treatment (LQR) containing 28% Chinese wildrye hay, 28% corn stover, and 44% concentrate, on a dry matter basis. Each feeding period lasted 21 d. The first 18 d served as an adaptation period, and the last 3 d served as a sample collection period. Dry matter intake, milk yield, and milk composition were measured. Milk and blood samples were collected for FA analysis. Mammary gland biopsies were performed after milking on the last day of each period and the tissues were analyzed for the mRNA expression of acetyl-coenzyme A carboxylase-α (ACACA), FA synthase (FASN), stearoyl CoA desaturase (SCD), and lipoprotein lipase (LPL). Dry matter intake and milk yield were not affected by the treatments. Milk fat (3.16 vs. 2.96%) and protein (2.99 vs. 2.89%) contents were higher in HQR goats than in LQR goats, and milk fat yield tended to be higher in HQR goats (16.7 vs. 15.1g/d). Milk FA composition was not different between treatments, except for C18:3n-3 (0.27 vs. 0.15g/100g). Compared with LQR goats, HQR goats had a higher vein concentration of total FA (0.62 vs. 0.44mg/mL). In HQR goats, the mammary balance of total FA increased (9.17 vs. 5.51g/d), whereas the clearance rate of total FA decreased (103.03 vs. 138.25 L/d). No differences were found in mammary blood flow, artery concentration, and mammary

  18. Supplementation of essential fatty acids to Holstein calves during late uterine life and first month of life alters hepatic fatty acid profile and gene expression.

    PubMed

    Garcia, M; Greco, L F; Lock, A L; Block, E; Santos, J E P; Thatcher, W W; Staples, C R

    2016-09-01

    Linoleic acid is an essential dietary fatty acid (FA). However, how the supplementation of linoleic acid during uterine and early life may modify the FA profile and transcriptome regulation of the liver, and performance of preweaned dairy calves is unknown. Our objective was to evaluate the effect of supplementation of essential FA to Holstein calves during late uterine and early life on their hepatic FA profile and global gene expression at 30 d of age. During the last 8 wk of pregnancy, Holstein cattle (n=96) were fed either no fat supplement (control), a saturated FA supplement enriched with C18:0, or an unsaturated FA supplement enriched with linoleic acid. Male calves (n=40) born from these dams were fed a milk replacer (MR) with either low (LLA) or high linoleic acid (HLA) concentration as the sole feedstuff during the first 30 d. Liver biopsy was performed at 30 d of age, and microarray analysis was performed on 18 liver samples. Total concentration of FA in liver were greater in calves fed LLA compared with those fed HLA MR (8.2 vs. 7.1%), but plasma concentrations of total FA did not differ due to MR diets. The FA profiles of plasma and liver of calves were affected differently by the prepartum diets. Specifically, the FA profile in liver was affected moderately by the feeding of fat prepartum, but the profiles did not differ due to the type of FA fed prepartum. The type of MR fed during the first 30 d of life had major effects on both plasma and liver FA profiles, resembling the type of fat fed. Plasma and liver of calves fed LLA MR had greater percentage of medium-chain FA (C12:0 and C14:0), whereas plasma and liver from calves fed HLA MR had greater percentages of linoleic and α-linolenic acids. Dams fed fat or a specific type of FA modified the expression of some genes in liver of calves, particularly those genes involved in biological functions and pathways related to upregulation of lipid metabolism and downregulation of inflammatory responses

  19. Hyaluronic acid synthesis is required for zebrafish tail fin regeneration

    PubMed Central

    Ouyang, Xiaohu; Panetta, Nicholas J.; Talbott, Maya D.; Payumo, Alexander Y.; Halluin, Caroline; Longaker, Michael T.

    2017-01-01

    Using genome-wide transcriptional profiling and whole-mount expression analyses of zebrafish larvae, we have identified hyaluronan synthase 3 (has3) as an upregulated gene during caudal fin regeneration. has3 expression is induced in the wound epithelium within hours after tail amputation, and its onset and maintenance requires fibroblast growth factor, phosphoinositide 3-kinase, and transforming growth factor-ß signaling. Inhibition of hyaluronic acid (HA) synthesis by the small molecule 4-methylumbelliferone (4-MU) impairs tail regeneration in zebrafish larvae by preventing injury-induced cell proliferation. In addition, 4-MU reduces the expression of genes associated with wound epithelium and blastema function. Treatment with glycogen synthase kinase 3 inhibitors rescues 4-MU-induced defects in cell proliferation and tail regeneration, while restoring a subset of wound epithelium and blastema markers. Our findings demonstrate a role for HA biosynthesis in zebrafish tail regeneration and delineate its epistatic relationships with other regenerative processes. PMID:28207787

  20. Total Synthesis of Five Lipoteichoic acids of Clostridium difficile.

    PubMed

    Hogendorf, Wouter F J; Gisch, Nicolas; Schwudke, Dominik; Heine, Holger; Bols, Mikael; Pedersen, Christian Marcus

    2014-10-13

    The emergence of hypervirulent resistant strains have made Clostridium difficile a notorious nosocomial pathogen and has resulted in a renewed interest in preventive strategies, such as vaccines based on (synthetic) cell wall antigens. Recently, the structure of the lipoteichoic acid (LTA) of this species has been elucidated. Additionally, this LTA was found to induce the formation of protective antibodies against C. difficile in rabbits and mice. The LTA from C. difficile is isolated as a microheterogenous mixture, differing in size and composition, impeding any structure-activity relationship studies. To ensure reliable biological results, pure and well-defined synthetic samples are required. In this work the total synthesis of LTAs from C. difficile with defined chain length is described and the initial biological results are presented.

  1. Synthesis and characterization of 2-mercaptoethanesulfonic acid albumin.

    PubMed

    Bauer, H H; Ehmig, S; Engels, J W; Voelcker, G

    1998-06-01

    Autoimmune patients treated with ifosfamide (CAS 3778-73-2) and mesna (2-mercaptoethanesulfonic acid, CAS 3375-50-6) in some cases suffered from severe allergic reactions that were proposed to be due to mesna linked to serum albumin by a disulfide bond. To prove the existence of the hypothetic mesna albumin adduct in vivo it was synthesized: The free thiol group of albumin (molecular mass determined by MALDI spectroscopy: 67009 Da) was converted to S-phenylsulfonyl albumin and reacted with mesna to albumin mesna (molecular mass: 67159 Da). In an alternative synthesis albumin was incubated with mesna at pH 8, 40 degrees C (molecular mass of the adduct: 67166 Da).

  2. Senescence in isolated carnation petals : effects of indoleacetic Acid and inhibitors of protein synthesis.

    PubMed

    Wulster, G; Sacalis, J; Janes, H W

    1982-10-01

    Indoleacetic acid induces senescence in isolated carnation (Dianthus caryophyllus, cv. White Sim) petals, increasing the duration and amount of ethylene production. This effect is inhibited by Actinomycin D, an inhibitor of RNA synthesis, and cycloheximide, a translational inhibitor of protein synthesis. The ability of petals to respond to indoleacetic acid appears to be a function of physiological age. Indoleacetic acid is capable of enhancing ethylene evolution and senescence only in specific portions of the petal.

  3. Efficient ytterbium triflate catalyzed microwave-assisted synthesis of 3-acylacrylic acid building blocks.

    PubMed

    Tolstoluzhsky, Nikita V; Gorobets, Nikolay Yu; Kolos, Nadezhda N; Desenko, Sergey M

    2008-01-01

    The derivatives of 4-(hetero)aryl-4-oxobut-2-enoic acid are useful as building blocks in the synthesis of biologically active compounds. An efficient general protocol for the synthesis of these building blocks was developed. This method combines microwave assistance and ytterbium triflate catalyst and allows the fast preparation of the target acids starting from different (hetero)aromatic ketones and glyoxylic acid monohydrate giving pure products in 52-75% isolated yields.

  4. Enantiospecific Synthesis of a Genetically Encodable Fluorescent Unnatural Amino Acid L-3-(6-Acetylnaphthalen-2-ylamino)-2-aminopropanoic Acid

    PubMed Central

    Xiang, Zheng; Wang, Lei

    2011-01-01

    Fluorescent unnatural amino acids (Uaas), when genetically incorporated into proteins, can provide unique advantages for imaging biological processes in vivo. Synthesis of optically pure L-enantiomer of fluorescent Uaas is crucial for their effective application in live cells. An efficient six-step synthesis of L-3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (L-Anap), a genetically encodable and polarity-sensitive fluorescent Uaa, has been developed. The synthesis takes advantage of a high-yield and enantiospecific Fukuyama-Mitsunobu reaction as the key transformation. PMID:21732687

  5. Synthesis and photochromic property of nanosized amino acid polyoxometalate compounds

    NASA Astrophysics Data System (ADS)

    Sun, Dehui; Zhang, Jilin; Ren, Huijuan; Cui, Zhenfeng

    2009-07-01

    A series of novel nanosized amino acid-polyoxometalate compounds were successfully synthesized using a low temperature solid-state chemical reaction method. Their compositions, structures, morphologies, photochromic properties were characterized by ICP-AES/MS, TG/DTA, FTIR, XRD, SEM and UV-Vis diffuse reflectance spectra (DRS), respectively. The elemental analysis results showed that the compounds ((HThr)7PMo12O42•4H2O, (HTyr)7PMo12O42Â.5H2O, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O) were obtained. The analyses of the TG/DTA, XRD and FTIR confirmed that the four compounds are new phases different from the corresponding reactants and they are composed of the polyoxometalate anions and the corresponding protonated amino acids, respectively. Observation of the SEM revealed that the particle shape (e.g. (HThr)7PMo12O42Â.4H2O nanoplates, (HTyr)7PMo12O42•5H2O nanorods, (HSer)7PMo12O42•5H2O and (HGlu)7PMo12O42•4H2O nanoparticles) depended strongly on the structures of amino acids. This implied that the amino acids can play a structural template agent role in synthesis of the Silverton-type polyoxometalate compounds. After irradiated with ultraviolet light, these samples all exhibited photochromism. Their photochromic mechanism may be explained based on Yamase's photochromic model. These photochromic compounds could be applied to the field of photosensitive materials.

  6. Ribonucleic acid synthesis in yeast. The effect of cycloheximide on the synthesis of ribonucleic acid in Saccharomyces carlsbergensis

    PubMed Central

    de Kloet, S. R.

    1966-01-01

    1. Cycloheximide causes the release of the control amino acids have over RNA synthesis in Saccharomyces carlsbergensis N.C.T.C. 74. 2. The antibiotic causes a gradual deceleration of RNA formation. After incubation for 60min. at 30° RNA synthesis usually proceeds at a rate only a few per cent of that of the untreated control. 3. In the presence of cycloheximide two types of RNA accumulate in the cell: soluble RNA and a high-molecular-weight RNA. The latter has a base composition intermediate between those of yeast DNA and yeast ribosomal RNA, and sediments in a sucrose gradient at a rate faster than that of the 23s ribosomal RNA component. 4. Yeast ribosomal RNA contains methylated bases. Judged from the incorporation of [Me-14C]methionine, the extent of methylation of ribosomal RNA is about 20% of that of the `soluble' RNA fraction. The high-molecular-weight RNA formed in the presence of cycloheximide is less methylated than normal RNA. In this case the sucrose-density-gradient sedimentation patterns of newly methylated and newly synthesized RNA do not coincide. 5. In the presence of cycloheximide, polysomal material accumulates, indicating that messenger RNA is formed. 6. The effect of the antibiotic on protein and RNA synthesis can be abolished by washing of the cells. The RNA that has accumulated during incubation of the cells with the antibiotic is not stable on removal of cycloheximide. 7. The results presented in this study are discussed in relation to the regulation of RNA formation in yeast. PMID:5964958

  7. Amino acids inhibit kynurenic acid formation via suppression of kynurenine uptake or kynurenic acid synthesis in rat brain in vitro.

    PubMed

    Sekine, Airi; Okamoto, Misaki; Kanatani, Yuka; Sano, Mitsue; Shibata, Katsumi; Fukuwatari, Tsutomu

    2015-01-01

    The tryptophan metabolite, kynurenic acid (KYNA), is a preferential antagonist of the α7 nicotinic acetylcholine receptor at endogenous brain concentrations. Recent studies have suggested that increase of brain KYNA levels is involved in psychiatric disorders such as schizophrenia and depression. KYNA-producing enzymes have broad substrate specificity for amino acids, and brain uptake of kynurenine (KYN), the immediate precursor of KYNA, is via large neutral amino acid transporters (LAT). In the present study, to find out amino acids with the potential to suppress KYNA production, we comprehensively investigated the effects of proteinogenic amino acids on KYNA formation and KYN uptake in rat brain in vitro. Cortical slices of rat brain were incubated for 2 h in Krebs-Ringer buffer containing a physiological concentration of KYN with individual amino acids. Ten out of 19 amino acids (specifically, leucine, isoleucine, phenylalanine, methionine, tyrosine, alanine, cysteine, glutamine, glutamate, and aspartate) significantly reduced KYNA formation at 1 mmol/L. These amino acids showed inhibitory effects in a dose-dependent manner, and partially inhibited KYNA production at physiological concentrations. Leucine, isoleucine, methionine, phenylalanine, and tyrosine, all LAT substrates, also reduced tissue KYN concentrations in a dose-dependent manner, with their inhibitory rates for KYN uptake significantly correlated with KYNA formation. These results suggest that five LAT substrates inhibit KYNA formation via blockade of KYN transport, while the other amino acids act via blockade of the KYNA synthesis reaction in brain. Amino acids can be a good tool to modulate brain function by manipulation of KYNA formation in the brain. This approach may be useful in the treatment and prevention of neurological and psychiatric diseases associated with increased KYNA levels.

  8. Long-term ritonavir exposure increases fatty acid and glycerol recycling in 3T3-L1 adipocytes as compensatory mechanisms for increased triacylglycerol hydrolysis.

    PubMed

    Adler-Wailes, Diane C; Guiney, Evan L; Wolins, Nathan E; Yanovski, Jack A

    2010-05-01

    Lipodystrophy with high nonesterified fatty acid (FA) efflux is reported in humans receiving highly active antiretroviral therapy (HAART) to treat HIV infection. Ritonavir, a common component of HAART, alters adipocyte FA efflux, but the mechanism for this effect is not established. To investigate ritonavir-induced changes in FA flux and recycling through acylglycerols, we exposed differentiated murine 3T3-L1 adipocytes to ritonavir for 14 d. FA efflux, uptake, and incorporation into acylglycerols were measured. To identify a mediator of FA efflux, we measured adipocyte triacylglycerol lipase (ATGL) transcript and protein. To determine whether ritonavir-treated adipocytes increased glycerol backbone synthesis for FA reesterification, we measured labeled glycerol and pyruvate incorporation into triacylglycerol (TAG). Ritonavir-treated cells had increased FA efflux, uptake, and incorporation into TAG (all P < 0.01). Ritonavir increased FA efflux without consistently increasing glycerol release or changing TAG mass, suggesting increased partial TAG hydrolysis. Ritonavir-treated adipocytes expressed significantly more ATGL mRNA (P < 0.05) and protein (P < 0.05). Ritonavir increased glycerol (P < 0.01) but not pyruvate (P = 0.41), utilization for TAG backbone synthesis. Consistent with this substrate utilization, glycerol kinase transcript (required for glycerol incorporation into TAG backbone) was up-regulated (P < 0.01), whereas phosphoenolpyruvate carboxykinase transcript (required for pyruvate utilization) was down-regulated (P < 0.001). In 3T3-L1 adipocytes, long-term ritonavir exposure perturbs FA metabolism by increasing ATGL-mediated partial TAG hydrolysis, thus increasing FA efflux, and leads to compensatory increases in FA reesterification with glycerol and acylglycerols. These changes in FA metabolism may, in part, explain the increased FA efflux observed in ritonavir-associated lipodystrophy.

  9. Role of fatty-acid synthesis in dendritic cell generation and function.

    PubMed

    Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

    2013-05-01

    Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

  10. Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

    PubMed Central

    Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

    2013-01-01

    Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

  11. Arsenic exposure disrupts the normal function of the FA/BRCA repair pathway.

    PubMed

    Peremartí, Jana; Ramos, Facundo; Marcos, Ricard; Hernández, Alba

    2014-11-01

    Chronic arsenic exposure is known to enhance the genotoxicity/carcinogenicity of other DNA-damaging agents by inhibiting DNA repair activities. Interference with nucleotide excision repair and base excision repair are well documented, but interactions with other DNA repair pathways are poorly explored so far. The Fanconi anemia FA/BRCA pathway is a DNA repair mechanism required for maintaining genomic stability and preventing cancer. Here, interactions between arsenic compounds and the FA/BRCA pathway were explored by using isogenic FANCD2(-/-) (FA/BRCA-deficient) and FANCD2(+/+) (FA/BRCA-corrected) human fibroblasts. To study whether arsenic disrupts the normal FA/BRCA function, FANCD2(+/+) cells were preexposed to subtoxic concentrations of the trivalent arsenic compounds methylarsonous acid (MMA(III)) and arsenic trioxide (ATO) for 2 weeks. The cellular response to mitomicin-C, hydroxyurea, or diepoxybutane, typical inducers of the studied pathway, was then evaluated and compared to that of FANCD2(-/-) cells. Our results show that preexposure to the trivalent arsenicals MMA(III) and ATO induces in corrected cells, a cellular FA/BRCA-deficient phenotype characterized by hypersensitivity, enhanced accumulation in the G2/M compartment and increased genomic instability--measured as micronuclei. Overall, our data demonstrate that environmentally relevant arsenic exposures disrupt the normal function of the FA/BRCA activity, supporting a novel source of arsenic co- and carcinogenic effects. This is the first study linking arsenic exposure with the FA/BRCA DNA repair pathway.

  12. Synthesis of hybrid hydrazino peptides: protected vs unprotected chiral α-hydrazino acids.

    PubMed

    Suć, Josipa; Jerić, Ivanka

    2015-01-01

    Peptidomimetics based on hydrazino derivatives of α-amino acids represent an important class of peptidic foldamers with promising biological activities, like protease inhibition and antimicrobial activity. However, the lack of straightforward method for the synthesis of optically pure hydrazino acids and efficient incorporation of hydrazino building blocks into peptide sequence hamper wider exploitation of hydrazino peptidomimetics. Here we described the utility of N (α)-benzyl protected and unprotected hydrazino derivatives of natural α-amino acids in synthesis of peptidomimetics. While incorporation of N (α)-benzyl-hydrazino acids into peptide chain and deprotection of benzyl moiety proceeded with difficulties, unprotected hydrazino acids allowed fast and simple construction of hybrid peptidomimetics.

  13. A convenient synthesis of anthranilic acids by Pd-catalyzed direct intermolecular ortho-C-H amidation of benzoic acids.

    PubMed

    Ng, Ka-Ho; Ng, Fo-Ning; Yu, Wing-Yiu

    2012-12-11

    An efficient method for synthesis of anthranilic acids by Pd-catalyzed ortho-C-H amidation of benzoic acids is disclosed. The amidation is proposed to proceed by carboxylate-assisted ortho-C-H palladation to form an arylpalladium(II) complex, followed by nitrene insertion to the Pd-C bond.

  14. ORAL AND INTRAVENOUSLY ADMINISTERED AMINO ACIDS PRODUCE SIMILAR EFFECTS ON MUSCLE PROTEIN SYNTHESIS IN THE ELDERLY

    PubMed Central

    Rasmussen, B.B.; Wolfe, R.R.; Volpi, E.

    2011-01-01

    BACKGROUND Muscle protein synthesis is stimulated in the elderly when amino acid availability is increased. OBJECTIVE To determine which mode of delivery of amino acids (intravenous vs. oral ingestion) is more effective in stimulating the rate of muscle protein synthesis in elderly subjects. DESIGN Fourteen elderly subjects were assigned to one of two groups. Following insertion of femoral arterial and venous catheters, subjects were infused with a primed, continuous infusion of L-[ring-2H5] phenylalanine. Blood samples and muscle biopsies were obtained to measure muscle protein fractional synthesis rate (FSR) with the precursor-product model, phenylalanine kinetics across the leg with the three-pool model, and whole body phenylalanine kinetics. Protein metabolism parameters were measured in the basal period, and during the administration of oral amino acids (n=8) or a similar amount of intravenous amino acids (n=6). RESULTS Enteral and parenteral amino acid administration increased amino acid arterial concentrations and delivery to the leg to a similar extent in both groups. Muscle protein synthesis as measured by both FSR, and the three-pool model, increased during amino acid administration (P < 0.05 vs. basal) in both groups with no differences between groups. Whole body proteolysis did not change with the oral amino acids whereas it increased slightly during parenteral amino acid administration. CONCLUSIONS Increased amino acid availability stimulates the rate of muscle protein synthesis independent of the route of administration (enteral vs. parenteral). PMID:12459885

  15. Amino Acid Synthesis in Seafloor Environments on Icy Worlds

    NASA Astrophysics Data System (ADS)

    Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik

    2016-10-01

    In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.

  16. Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.

    PubMed

    Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi

    2017-03-01

    Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins.

  17. DFT study of the Lewis acid mediated synthesis of 3-acyltetramic acids.

    PubMed

    Mikula, Hannes; Svatunek, Dennis; Skrinjar, Philipp; Horkel, Ernst; Hametner, Christian; Fröhlich, Johannes

    2014-05-01

    The synthesis of 3-acyltetramic acids by C-acylation of pyrrolidine-2,4-diones was studied by density functional theory (DFT). DFT was applied to the mycotoxin tenuazonic acid (TeA), an important representative of these bioactive natural compounds. Lewis acid mediated C-acylation in combination with previous pH-neutral domino N-acylation-Wittig cyclization can be used for the efficient preparation of 3-acyltetramic acids. Nevertheless, quite harsh conditions are still required to carry out this synthetic step, leading to unwanted isomerization of stereogenic centers in some cases. In the presented study, the reaction pathway for the C-acetylation of (5S,6S-5-s-butylpyrrolidine-2,4-dione was studied in terms of mechanism, solvent effects, and Lewis acid activation, in order to obtain an appropriate theoretical model for further investigations. Crucial steps were identified that showed rather high activation barriers and rationalized previously reported experimental discoveries. After in silico optimization, aluminum chlorides were found to be promising Lewis acids that promote the C-acylation of pyrrolidine-2,4-diones, whereas calculations performed in various organic solvents showed that the solvent had only a minor effect on the energy profiles of the considered mechanisms. This clearly indicates that further synthetic studies should focus on the Lewis-acidic mediator rather than other reaction parameters. Additionally, given the results obtained for different reaction routes, the stereochemistry of this C-acylation is discussed. It is assumed that the formation of Z-configured TeA is favored, in good agreement with our previous studies.

  18. TRIM.FaTE Evaluation Report

    EPA Pesticide Factsheets

    The TRIM.FaTE Evaluation Report is composed of three volumes. Volume I presents conceptual, mechanistic, and structural complexity evaluations of various aspects of the model. Volumes II and III present performance evaluation.

  19. Tailored fatty acid synthesis via dynamic control of fatty acid elongation

    SciTech Connect

    Torella, JP; Ford, TJ; Kim, SN; Chen, AM; Way, JC; Silver, PA

    2013-07-09

    Medium-chain fatty acids (MCFAs, 4-12 carbons) are valuable as precursors to industrial chemicals and biofuels, but are not canonical products of microbial fatty acid synthesis. We engineered microbial production of the full range of even-and odd-chain-length MCFAs and found that MCFA production is limited by rapid, irreversible elongation of their acyl-ACP precursors. To address this limitation, we programmed an essential ketoacyl synthase to degrade in response to a chemical inducer, thereby slowing acyl-ACP elongation and redirecting flux from phospholipid synthesis to MCFA production. Our results show that induced protein degradation can be used to dynamically alter metabolic flux, and thereby increase the yield of a desired compound. The strategy reported herein should be widely useful in a range of metabolic engineering applications in which essential enzymes divert flux away from a desired product, as well as in the production of polyketides, bioplastics, and other recursively synthesized hydrocarbons for which chain-length control is desired.

  20. Ligand Binding to the FA3-FA4 Cleft Inhibits the Esterase-Like Activity of Human Serum Albumin

    PubMed Central

    Ascenzi, Paolo; Leboffe, Loris; di Masi, Alessandra; Trezza, Viviana; Fanali, Gabriella; Gioia, Magda; Coletta, Massimo; Fasano, Mauro

    2015-01-01

    The hydrolysis of 4-nitrophenyl esters of hexanoate (NphOHe) and decanoate (NphODe) by human serum albumin (HSA) at Tyr411, located at the FA3-FA4 site, has been investigated between pH 5.8 and 9.5, at 22.0°C. Values of Ks, k+2, and k+2/Ks obtained at [HSA] ≥ 5×[NphOXx] and [NphOXx] ≥ 5×[HSA] (Xx is NphOHe or NphODe) match very well each other; moreover, the deacylation step turns out to be the rate limiting step in catalysis (i.e., k+3 << k+2). The pH dependence of the kinetic parameters for the hydrolysis of NphOHe and NphODe can be described by the acidic pKa-shift of a single amino acid residue, which varies from 8.9 in the free HSA to 7.6 and 7.0 in the HSA:NphOHe and HSA:NphODe complex, respectively; the pK>a-shift appears to be correlated to the length of the fatty acid tail of the substrate. The inhibition of the HSA-Tyr411-catalyzed hydrolysis of NphOHe, NphODe, and 4-nitrophenyl myristate (NphOMy) by five inhibitors (i.e., diazepam, diflunisal, ibuprofen, 3-indoxyl-sulfate, and propofol) has been investigated at pH 7.5 and 22.0°C, resulting competitive. The affinity of diazepam, diflunisal, ibuprofen, 3-indoxyl-sulfate, and propofol for HSA reflects the selectivity of the FA3-FA4 cleft. Under conditions where Tyr411 is not acylated, the molar fraction of diazepam, diflunisal, ibuprofen, and 3-indoxyl-sulfate bound to HSA is higher than 0.9 whereas the molar fraction of propofol bound to HSA is ca. 0.5. PMID:25790235

  1. Synthesis and cytotoxic activity of new betulin and betulinic acid esters with conjugated linoleic acid (CLA).

    PubMed

    Tubek, Barbara; Mituła, Paweł; Niezgoda, Natalia; Kempińska, Katarzyna; Wietrzyk, Joanna; Wawrzeńczyk, Czesław

    2013-04-01

    The synthesis of new ester derivatives of betulin (3a-c) and betulinic acid (4) with conjugated linoleic acid isomers (CLA; in a mixture of 43.4% 9c, 11t; 49.5% 10t, 12c; 7.1% other isomers) is presented. Esterification was carried out with N,N'-dicyclohexylcarbodiimide (DCC) as the coupling agent in the presence of 4-dimethylamino-pyridine (DMAP) in dichloromethane (or pyridine). The in vitro cytotoxic effect of betulin (1), betulinic acid (2), a mixture of CLA isomers and their derivatives (3a-c, 4) was examined using the MTT assay against four cancer cell lines (P388, CEM/C2, CCRF/CEM and HL-60) and the SRB assay on the HT-29 cell line. Ester 4 was the most active among the esters synthesized against the CEM/C2 cell line with an ID50 value 16.9 +/- 6.5 microg/mL. Betulin (1), betulinic acid (2) and CLA were the most active agents against the cancer cell lines studied.

  2. The cathepsin B inhibitor, z-FA-CMK is toxic and readily induced cell death in human T lymphocytes

    SciTech Connect

    Liow, K.Y.; Chow, S.C.

    2013-11-01

    The cathepsin B inhibitor, benzyloxycarbonyl-phenylalanine-alanine-chloromethylketone (z-FA-CMK) was found to be toxic and readily induced cell death in the human T cell line, Jurkat, whereas two other analogs benzyloxycarbonyl-phenylalanine-alanine-fluoromethylketone (z-FA-FMK) and benzyloxycarbonyl-phenylalanine-alanine-diazomethylketone (z-FA-DMK) were not toxic. The toxicity of z-FA-CMK requires not only the CMK group, but also the presence of alanine in the P1 position and the benzyloxycarbonyl group at the N-terminal. Dose–response studies showed that lower concentrations of z-FA-CMK induced apoptosis in Jurkat T cells whereas higher concentrations induced necrosis. In z-FA-CMK-induced apoptosis, both initiator caspases (-8 and -9) and effector caspases (-3, -6 and -7) were processed to their respective subunits in Jurkat T cells. However, only the pro-form of the initiator caspases were reduced in z-FA-CMK-induced necrosis and no respective subunits were apparent. The caspase inihibitor benzyloxycarbonyl-valine-alanine-aspartic acid-(O-methyl)-fluoromehylketone (z-VAD-FMK) inhibits apoptosis and caspase processing in Jurkat T cells treated with low concentration of z-FA-CMK but has no effect on z-FA-CMK-induced necrosis and the loss of initiator caspases. This suggests that the loss of initiator caspases in Jurkat T cells during z-FA-CMK-induced necrosis is not a caspase-dependent process. Taken together, we have demonstrated that z-FA-CMK is toxic to Jurkat T cells and induces apoptosis at low concentrations, while at higher concentrations the cells die of necrosis. - Highlights: • z-FA-CMK is toxic and induce cell death in the human T cells. • z-FA-CMK toxicity requires the CMK group, alanine and the benzyloxycarbonyl group. • z-FA-CMK induced apoptosis at low concentration and necrosis at high concentration.

  3. Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

  4. The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.

    ERIC Educational Resources Information Center

    Simmonds, Richard J.

    1987-01-01

    Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)

  5. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  6. Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

  7. Synthesis of unnatural amino acids from serine derivatives by beta-fragmentation of primary alkoxyl radicals.

    PubMed

    Boto, Alicia; Gallardo, Juan A; Hernández, Dacil; Hernández, Rosendo

    2007-09-14

    The fragmentation of primary alkoxyl radicals has been scarcely used in synthesis since other competing processes (such as oxidation or hydrogen abstraction) usually predominate. However, when serine derivatives were used as substrates, the scission took place in excellent yields. Tandem scission-allylation, -alkylation, or -arylation reactions were subsequently developed. This one-pot methodology was applied to the synthesis of unnatural amino acids, which are useful synthetic blocks or amino acid surrogates in peptidomimetics.

  8. Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

    PubMed

    Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

    2012-05-18

    A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

  9. Synthesis of stable C-linked ferrocenyl amino acids and their use in solution-phase peptide synthesis.

    PubMed

    Philip, Anijamol T; Chacko, Shibin; Ramapanicker, Ramesh

    2015-12-01

    Incorporation of ferrocenyl group to peptides is an efficient method to alter their hydrophobicity. Ferrocenyl group can also act as an electrochemical probe when incorporated onto functional peptides. Most often, ferrocene is incorporated onto peptides post-synthesis via amide, ester or triazole linkages. Stable amino acids containing ferrocene as a C-linked side chain are potentially useful building units for the synthesis of ferrocene-containing peptides. We report here an efficient route to synthesize ferrocene-containing amino acids that are stable and can be used in peptide synthesis. Coupling of 2-ferrocenyl-1,3-dithiane and iodides derived from aspartic acid or glutamic acid using n-butyllithium leads to the incorporation of a ferrocenyl unit to the δ-position or ε-position of an α-amino acid. The reduction or hydrolysis of the dithiane group yields an alkyl or an oxo derivative. The usability of the synthesized amino acids is demonstrated by incorporating one of the amino acids in both C-terminus and N-terminus of tripeptides in solution phase.

  10. Distribution, synthesis, and absorption of kynurenic acid in plants.

    PubMed

    Turski, Michal P; Turska, Monika; Zgrajka, Wojciech; Bartnik, Magdalena; Kocki, Tomasz; Turski, Waldemar A

    2011-05-01

    Kynurenic acid (KYNA) is an endogenous antagonist of the ionotropic glutamate receptors and the α7 nicotinic acetylcholine receptor as well as an agonist of the G-protein-coupled receptor GPR35. In this study, KYNA distribution and synthesis in plants as well as its absorption was researched. KYNA level was determined by means of the high-performance liquid chromatography with fluorescence detection. KYNA was found in leaves, flowers, and roots of tested medicinal herbs: dandelion (Taraxacum officinale), common nettle (Urtica dioica), and greater celandine (Chelidoniummajus). The highest concentration of this compound was detected in leaves of dandelion--a mean value of 0.49 µg/g wet weight. It was shown that KYNA can be synthesized enzymatically in plants from its precursor, L-kynurenine, or absorbed by plants from the soil. Finally, the content of KYNA was investigated in 21 herbal tablets, herbal tea, herbs in sachets, and single herbs in bags. The highest content of KYNA in a maximum daily dose of herbal medicines appeared in St. John's wort--33.75 µg (tablets) or 32.60 µg (sachets). The pharmacological properties of KYNA and its presence in high concentrations in medicinal herbs may suggest that it possesses therapeutic potential, especially in the digestive system and should be considered a new valuable dietary supplement.

  11. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  12. Evolution of abscisic acid synthesis and signaling mechanisms.

    PubMed

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I

    2011-05-10

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized.

  13. WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

    PubMed Central

    Browse, John

    2016-01-01

    Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

  14. Is bacterial fatty acid synthesis a valid target for antibacterial drug discovery?

    PubMed

    Parsons, Joshua B; Rock, Charles O

    2011-10-01

    The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there is not a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements.

  15. Cooperative Brønsted Acid-Type Organocatalysis for the Stereoselective Synthesis of Deoxyglycosides

    PubMed Central

    2016-01-01

    A practical approach for the α-stereoselective synthesis of deoxyglycosides using cooperative Brønsted acid-type organocatalysis has been developed. The method is tolerant of a wide range of glycoside donors and acceptors, and its versatility is exemplified in the one-pot synthesis of a trisaccharide. Mechanistic studies suggest that thiourea-induced acid amplification of the chiral acid via H-bonding is key for the enhancement in reaction rate and yield, while stereocontrol is dependent on the chirality of the acid. PMID:28004941

  16. Exogenous amino acids stimulate net muscle protein synthesis in the elderly.

    PubMed Central

    Volpi, E; Ferrando, A A; Yeckel, C W; Tipton, K D; Wolfe, R R

    1998-01-01

    We have investigated the response of amino acid transport and protein synthesis in healthy elderly individuals (age 71+/-2 yr) to the stimulatory effect of increased amino acid availability. Muscle protein synthesis and breakdown, and amino acid transport were measured in the postabsorptive state and during the intravenous infusion of an amino acid mixture. Muscle-free amino acid kinetics were calculated by means of a three compartment model using data obtained by femoral arterio-venous catheterization and muscle biopsies from the vastus lateralis during the infusion of stable isotope tracers of amino acids. In addition, muscle protein fractional synthetic rate (FSR) was measured. Peripheral amino acid infusion significantly increased amino acid delivery to the leg, amino acid transport, and muscle protein synthesis when measured either with the three compartment model (P < 0.05) or with the traditional precursor-product approach (FSR increased from 0. 0474+/-0.0054 to 0.0940+/-0.0143%/h, P < 0.05). Because protein breakdown did not change during amino acid infusion, a positive net balance of amino acids across the muscle was achieved. We conclude that, although muscle mass is decreased in the elderly, muscle protein anabolism can nonetheless be stimulated by increased amino acid availability. We thus hypothesize that muscle mass could be better maintained with an increased intake of protein or amino acids. PMID:9576765

  17. Studies on potential effects of fumaric acid on rumen microbial fermentation, methane production and microbial community.

    PubMed

    Riede, Susanne; Boguhn, Jeannette; Breves, Gerhard

    2013-01-01

    The greenhouse gas methane (CH4) contributes substantially to global climate change. As a potential approach to decrease ruminal methanogenesis, the effects of different dosages of fumaric acid (FA) on ruminal microbial metabolism and on the microbial community (archaea, bacteria) were studied using a rumen simulation technique (RUSITEC). FA acts as alternative hydrogen acceptor diverting 2H from methanogenesis of archaea towards propionate formation of bacteria. Three identical trials were conducted with 12 fermentation vessels over a period of 14 days. In each trial, four fermentation vessels were assigned to one of the three treatment groups differing in FA dosage: low fumaric acid (LFA), high fumaric acid (HFA) and without FA (control). FA was continuously infused with the buffer. Grass silage and concentrate served as substrate. FA led to decreases in pH and to higher production rates of total short chain fatty acids (SCFA) mediated by increases in propionate for LFA of 1.69 mmol d(-1) and in propionate and acetate production for HFA of 4.49 and 1.10 mmol d(-1), respectively. Concentrations of NH3-N, microbial crude protein synthesis, their efficiency, degradation of crude nutrients and detergent fibre fraction were unchanged. Total gas and CH4 production were not affected by FA. Effects of FA on structure of microbial community by means of single strand conformation polymorphism (SSCP) analyses could not be detected. Given the observed increase in propionate production and the unaffected CH4 production it can be supposed that the availability of reduction equivalents like 2H was not limited by the addition of FA in this study. It has to be concluded from the present study that the application of FA is not an appropriate approach to decrease the ruminal CH4 production.

  18. The inhibitory effect of glycolic acid and lactic acid on melanin synthesis in melanoma cells.

    PubMed

    Usuki, Akiko; Ohashi, Akiko; Sato, Hirofumi; Ochiai, Yasunobu; Ichihashi, Masamitsu; Funasaka, Yoko

    2003-01-01

    Alpha-hydroxy acids (AHAs) such as glycolic acid (GA) and lactic acid (LA) have been reported to be effective in treating pigmentary lesions such as melasma, solar lentigines, and postinflammatory hyperpigmentation. The mechanism of this effect might be due to epidermal remodeling and accelerated desquamation, which would result in quick pigment dispersion. However, the direct effect of AHAs on melanin synthesis has not yet been well studied. To elucidate such a direct effect of AHAs on melanogenesis, we performed melanin assays, growth curve determinations, Northern and Western blotting for melanogenic proteins [tyrosinase, tyrosinase related protein (TRP)-1 and TRP-2], and tyrosinase and, 4-dihydroxyphenylalaninechrome tautomerase enzyme activity assays using mouse B16 and human melanoma cells. GA or LA (at doses of 300 or 500 microg/ml) inhibited melanin formation in similar dose-dependent manner, without affecting cell growth. Although the mRNA and protein expression or molecular size of tyrosinase, TRP-1 and TRP-2 were not affected, tyrosinase activity was inhibited. To see whether GA and/or LA directly inhibit tyrosinase catalytic function, the effect of GA and LA on human tyrosinase purified from the melanosome-rich large granule fraction of human melanoma cells was performed. GA or LA were shown to inhibit tyrosinase enzyme activity directly, but this effect was not due to the acidity of GA or LA, because adjusting the pH to 5.6 (the pH of GA and LA at concentrations of 2500 microg/ml), did not affect tyrosinase activity. Taken together, these results show that GA and LA suppress melanin formation by directly inhibiting tyrosinase activity, an effect independent of their acidic nature. GA and LA might work on pigmentary lesions not only by accelerating the turnover of the epidermis but also by directly inhibiting melanin formation in melanocytes.

  19. Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

    SciTech Connect

    Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

    2014-03-15

    MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H{sub 2}O{sub 2} indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions. Highlights: • 5–45 wt% HPW/MCM-48 mesoporous catalysts were prepared and characterized. • Their catalytic activities for the green synthesis of benzoic acid were investigated. • HPW/MCM-48 was approved to be an efficient catalyst. • 5 wt% HPW/MCM-48 exhibited the highest catalytic activity.

  20. Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

    SciTech Connect

    Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

    1989-04-01

    We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that in control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.

  1. Eicosanoid synthesis in cardiomyocytes: influence of hypoxia, reoxygenation, and polyunsaturated fatty acids.

    PubMed

    Oudot, F; Grynberg, A; Sergiel, J P

    1995-01-01

    The synthesis of eicosanoids was investigated in cultured rat ventricular myocytes. Under normoxia, the cardiomyocytes released 6-ketoprostaglandin F1 alpha (6-keto-PGF1 alpha) and prostaglandin (PG) E2 and smaller amounts of PGF2 alpha and thromboxane B2. Hypoxia enhanced the production of PGE2 and PGF2 alpha, whereas the synthesis of 6-keto-PGF1 alpha was not affected. Conversely, posthypoxic reoxygenation greatly increased the synthesis of 6-keto-PGF1 alpha, whereas the synthesis of PGF2 alpha, was not affected and that of PGE2 was reduced. The cardiomyocyte polyunsaturated fatty acid (PUFA) profile was altered by arachidonic acid or eicosapentaenoic acid and docosahexaenoic acid. Under normoxia, the eicosanoid production appeared to be roughly related to the cell phospholipid arachidonic acid content. Conversely, during posthypoxic reoxygenation, the production of eicosanoids was related to the cell phospholipid n-3 PUFA content, with the n-3-rich cells displaying a marked inhibition of the synthesis. This inhibition was mainly attributed to eicosapentaenoic acid and/or docosapentaenoic acid. Whether this inhibition occurs in vivo during postischemic reperfusion, it may contribute to the beneficial effect of n-3 PUFA on the heart.

  2. Characterization of a novel N-acetylneuraminic acid lyase favoring N-acetylneuraminic acid synthesis

    PubMed Central

    Ji, Wenyan; Sun, Wujin; Feng, Jinmei; Song, Tianshun; Zhang, Dalu; Ouyang, Pingkai; Gu, Zhen; Xie, Jingjing

    2015-01-01

    N-Acetylneuraminic acid lyase (NAL, E.C. number 4.1.3.3) is a Class I aldolase that catalyzes the reversible aldol cleavage of N-acetylneuraminic acid (Neu5Ac) from pyruvate and N-acetyl-D-mannosamine (ManNAc). Due to the equilibrium favoring Neu5Ac cleavage, the enzyme catalyzes the rate-limiting step of two biocatalytic reactions producing Neu5Ac in industry. We report the biochemical characterization of a novel NAL from a “GRAS” (General recognized as safe) strain C. glutamicum ATCC 13032 (CgNal). Compared to all previously reported NALs, CgNal exhibited the lowest kcat/Km value for Neu5Ac and highest kcat/Km values for ManNAc and pyruvate, which makes CgNal favor Neu5Ac synthesis the most. The recombinant CgNal reached the highest expression level (480 mg/L culture), and the highest reported yield of Neu5Ac was achieved (194 g/L, 0.63 M). All these unique properties make CgNal a promising biocatalyst for industrial Neu5Ac biosynthesis. Additionally, although showing the best Neu5Ac synthesis activity among the NAL family, CgNal is more related to dihydrodipicolinate synthase (DHDPS) by phylogenetic analysis. The activities of CgNal towards both NAL's and DHDPS' substrates are fairly high, which indicates CgNal a bi-functional enzyme. The sequence analysis suggests that CgNal might have adopted a unique set of residues for substrates recognition. PMID:25799411

  3. The control of ribonucleic acid synthesis in bacteria. The synthesis and stability of ribonucleic acids in relaxed and stringent amino acid auxotrophs of Escherichia coli.

    PubMed

    Gray, W J; Midgley, J E

    1972-08-01

    The biosynthesis and stability of various RNA fractions was studied in RC(str) and RC(rel) multiple amino acid auxotrophs of Escherichia coli. In conditions of amino acid deprivation, RC(str) mutants were labelled with exogenous nucleotide bases at less than 1% of the rate found in cultures growing normally in supplemented media. Studies by DNA-RNA hybridization and by other methods showed that, during a period of amino acid withdrawal, not more than 60-70% of the labelled RNA formed in RC(str) mutants had the characteristics of mRNA. Evidence was obtained for some degradation of newly formed 16S and 23S rRNA species to heterogeneous material of lower molecular weight. This led to overestimations of the mRNA content of rapidly labelled RNA from such methods as simple examination of sucrose-density-gradient profiles. In RC(rel) strains the absolute and relative rates of synthesis of the various RNA fractions were not greatly affected. However, the stability of about half of the mRNA fraction was increased in RC(rel) strains during amino acid starvation, giving kinetics of mRNA labelling and turnover that were identical with those found in either RC(str) or RC(rel) strains inhibited by high concentrations of chloramphenicol. Coincidence hybridization techniques showed that the mRNA content of amino acid-starved RC(str) auxotrophs was unchanged from that found in normally growing cells. In contrast, RC(rel) strains deprived of amino acids increased their mRNA content about threefold. In such cultures the mRNA content of accumulating newly formed RNA was a constant 16% by wt.

  4. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

    PubMed Central

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-01-01

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

  5. Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running.

    PubMed

    Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

    2016-06-28

    Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d₃-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise.

  6. Both FA- and mPEG-conjugated chitosan nanoparticles for targeted cellular uptake and enhanced tumor tissue distribution

    NASA Astrophysics Data System (ADS)

    Hou, Zhenqing; Zhan, Chuanming; Jiang, Qiwei; Hu, Quan; Li, Le; Chang, Di; Yang, Xiangrui; Wang, Yixiao; Li, Yang; Ye, Shefang; Xie, Liya; Yi, Yunfeng; Zhang, Qiqing

    2011-10-01

    Both folic acid (FA)- and methoxypoly(ethylene glycol) (mPEG)-conjugated chitosan nanoparticles (NPs) had been designed for targeted and prolong anticancer drug delivery system. The chitosan NPs were prepared with combination of ionic gelation and chemical cross-linking method, followed by conjugation with both FA and mPEG, respectively. FA-mPEG-NPs were compared with either NPs or mPEG-/FA-NPs in terms of their size, targeting cellular efficiency and tumor tissue distribution. The specificity of the mPEG-FA-NPs targeting cancerous cells was demonstrated by comparative intracellular uptake of NPs and mPEG-/FA-NPs by human adenocarcinoma HeLa cells. Mitomycin C (MMC), as a model drug, was loaded to the mPEG-FA-NPs. Results show that the chitosan NPs presented a narrow-size distribution with an average diameter about 200 nm regardless of the type of functional group. In addition, MMC was easily loaded to the mPEG-FA-NPs with drug-loading content of 9.1%, and the drug releases were biphasic with an initial burst release, followed by a subsequent slower release. Laser confocal scanning imaging proved that both mPEG-FA-NPs and FA-NPs could greatly enhance uptake by HeLa cells. In vivo animal experiments, using a nude mice xenograft model, demonstrated that an increased amount of mPEG-FA-NPs or FA-NPs were accumulated in the tumor tissue relative to the mPEG-NPs or NPs alone. These results suggest that both FA- and mPEG-conjugated chitosan NPs are potentially prolonged drug delivery system for tumor cell-selective targeting treatments.

  7. Both FA- and mPEG-conjugated chitosan nanoparticles for targeted cellular uptake and enhanced tumor tissue distribution

    PubMed Central

    2011-01-01

    Both folic acid (FA)- and methoxypoly(ethylene glycol) (mPEG)-conjugated chitosan nanoparticles (NPs) had been designed for targeted and prolong anticancer drug delivery system. The chitosan NPs were prepared with combination of ionic gelation and chemical cross-linking method, followed by conjugation with both FA and mPEG, respectively. FA-mPEG-NPs were compared with either NPs or mPEG-/FA-NPs in terms of their size, targeting cellular efficiency and tumor tissue distribution. The specificity of the mPEG-FA-NPs targeting cancerous cells was demonstrated by comparative intracellular uptake of NPs and mPEG-/FA-NPs by human adenocarcinoma HeLa cells. Mitomycin C (MMC), as a model drug, was loaded to the mPEG-FA-NPs. Results show that the chitosan NPs presented a narrow-size distribution with an average diameter about 200 nm regardless of the type of functional group. In addition, MMC was easily loaded to the mPEG-FA-NPs with drug-loading content of 9.1%, and the drug releases were biphasic with an initial burst release, followed by a subsequent slower release. Laser confocal scanning imaging proved that both mPEG-FA-NPs and FA-NPs could greatly enhance uptake by HeLa cells. In vivo animal experiments, using a nude mice xenograft model, demonstrated that an increased amount of mPEG-FA-NPs or FA-NPs were accumulated in the tumor tissue relative to the mPEG-NPs or NPs alone. These results suggest that both FA- and mPEG-conjugated chitosan NPs are potentially prolonged drug delivery system for tumor cell-selective targeting treatments. PMID:22027239

  8. Crystal structure of Spot 14, a modulator of fatty acid synthesis

    SciTech Connect

    Colbert, Christopher L.; Kim, Chai-Wan; Moon, Young-Ah; Henry, Lisa; Palnitkar, Maya; McKean, William B.; Fitzgerald, Kevin; Deisenhofer, Johann; Horton, Jay D.; Kwon, Hyock Joo

    2011-09-06

    Spot 14 (S14) is a protein that is abundantly expressed in lipogenic tissues and is regulated in a manner similar to other enzymes involved in fatty acid synthesis. Deletion of S14 in mice decreased lipid synthesis in lactating mammary tissue, but the mechanism of S14's action is unknown. Here we present the crystal structure of S14 to 2.65 {angstrom} and biochemical data showing that S14 can form heterodimers with MIG12. MIG12 modulates fatty acid synthesis by inducing the polymerization and activity of acetyl-CoA carboxylase, the first committed enzymatic reaction in the fatty acid synthesis pathway. Coexpression of S14 and MIG12 leads to heterodimers and reduced acetyl-CoA carboxylase polymerization and activity. The structure of S14 suggests a mechanism whereby heterodimer formation with MIG12 attenuates the ability of MIG12 to activate ACC.

  9. Thermal synthesis and hydrolysis of polyglyceric acid. [in orgin of life studying

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1989-01-01

    Polyglyceric acid was synthesized by thermal condensation of glyceric acid at 80 C in the presence and absence of two mole percent of sulfuric acid catalyst. The acid catalyst accelerated the polymerization over 100-fold and made possible the synthesis of insoluble polymers of both L- and DL-glyceric acid by heating for less than 1 day. Racemization of L-glyceric acid yielded less than 1 percent D-glyceric acid in condensations carried out at 80 C with catalyst for 1 day and without catalyst for 12 days. The condensation of L-glyceric acid yielded an insoluble polymer much more readily than condensation of DL-glyceric acid. Studies of the hydrolysis of poly-DL-glyceric acid revealed that it was considerably more stable under mild acidic conditions compared to neutral pH. The relationship of this study to the origin of life is discussed.

  10. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  11. 4-Dimenthylaminopyridine or Acid-Catalyzed Synthesis of Esters: A Comparison

    ERIC Educational Resources Information Center

    van den Berg, Annemieke W. C.; Hanefeld, Ulf

    2006-01-01

    A set of highly atom-economic experiments was developed to highlight the differences between acid- and base-catalyzed ester syntheses and to introduce the principles of atom economy. The hydrochloric acid-catalyzed formation of an ester was compared with the 4-dimethylaminopyradine-catalyzed ester synthesis.

  12. Prolonged stimulation of protein synthesis by leucine is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leucine is unique among the amino acids in its ability to enhance protein synthesis by activating translation initiation (Kimball and Jefferson, 2005). Our laboratory has shown that raising leucine to postprandial levels, whilst keeping all other amino acids at the post absorptive, level acutely st...

  13. Pyrazinoic acid decreases the proton motive force, respiratory ATP synthesis activity, and cellular ATP levels.

    PubMed

    Lu, Ping; Haagsma, Anna C; Pham, Hoang; Maaskant, Janneke J; Mol, Selena; Lill, Holger; Bald, Dirk

    2011-11-01

    Pyrazinoic acid, the active form of the first-line antituberculosis drug pyrazinamide, decreased the proton motive force and respiratory ATP synthesis rates in subcellular mycobacterial membrane assays. Pyrazinoic acid also significantly lowered cellular ATP levels in Mycobacterium bovis BCG. These results indicate that the predominant mechanism of killing by this drug may operate by depletion of cellular ATP reserves.

  14. Facile synthesis of nucleic acid-polymer amphiphiles and their self-assembly.

    PubMed

    Jia, Fei; Lu, Xueguang; Tan, Xuyu; Zhang, Ke

    2015-05-07

    A solid-phase synthesis for nucleic acid-polymer amphiphiles is developed. Using this strategy, several DNA-b-polymer amphiphiles are synthesized, and their self-assembly in aqueous solution is investigated. This general method can in principle be extended to nearly all polymers synthesized by atom transfer radical polymerization to produce a variety of nucleic acid-polymer conjugates.

  15. Synthesis of Nucleic Acid and Protein in L Cells Infected with the Agent of Meningopneumonitis

    PubMed Central

    Schechter, Esther M.

    1966-01-01

    Schechter, Esther M. (The University of Chicago, Chicago, Ill.). Synthesis of nucleic acid and protein in L cells infected with the agent of meningopneumonitis. J. Bacteriol. 91:2069–2080. 1966.—Synthesis of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and protein in uninfected L cells and in L cells infected with the meningopneumonitis agent was compared by measuring rates of incorporation of H3-cytidine and C14-lysine into nuclear, cytoplasmic, and agent fractions in successive 5-hr periods during the meningopneumonitis growth cycle. Synthesis of meningopneumonitis DNA, RNA, and protein was first clearly evident in the labeling period 15 to 20 hr after infection, soon after initiation of agent multiplication. The rates of synthesis of agent DNA, RNA, and protein increased logarithmically for a brief period and then declined. However, rates of isotope incorporation into all three meningopneumonitis macromolecules were sustained at near maximal values throughout the remainder of the meningopneumonitis growth cycle. These data are most readily interpreted in terms of multiplication of the meningopneumonitis agent by binary fission. The L cell response to infection was a decreased rate of DNA and RNA synthesis and an accelerated rate of cell death. Host protein synthesis was unaffected. The inhibition of nucleic acid synthesis in infected L cells probably involved competition between host and parasite for nucleic acid precursors. Different sublines of L cells varied greatly in the degree to which their nucleic acid-synthesizing mechanisms were damaged by infection. The cytoplasm of infected L cells contained newly synthesized DNA and RNA that could not be accounted for as intact meningopneumonitis cells. This nucleic acid probably arose from disintegration of the fragile intracellular forms of the meningopneumonitis agent. Images PMID:5937251

  16. Fatty Acid Transporter CD36 Mediates Hypothalamic Effect of Fatty Acids on Food Intake in Rats

    PubMed Central

    Moullé, Valentine S.; Le Foll, Christelle; Philippe, Erwann; Kassis, Nadim; Rouch, Claude; Marsollier, Nicolas; Bui, Linh-Chi; Guissard, Christophe; Dairou, Julien; Lorsignol, Anne; Pénicaud, Luc; Levin, Barry E.; Cruciani-Guglielmacci, Céline; Magnan, Christophe

    2013-01-01

    Variations in plasma fatty acid (FA) concentrations are detected by FA sensing neurons in specific brain areas such as the hypothalamus. These neurons play a physiological role in the control of food intake and the regulation of hepatic glucose production. Le Foll et al. previously showed in vitro that at least 50% of the FA sensing in ventromedial hypothalamic (VMH) neurons is attributable to the interaction of long chain FA with FA translocase/CD36 (CD36). The present work assessed whether in vivo effects of hypothalamic FA sensing might be partly mediated by CD36 or intracellular events such as acylCoA synthesis or β-oxidation. To that end, a catheter was implanted in the carotid artery toward the brain in male Wistar rats. After 1 wk recovery, animals were food-deprived for 5 h, then 10 min infusions of triglyceride emulsion, Intralipid +/− heparin (IL, ILH, respectively) or saline/heparin (SH) were carried out and food intake was assessed over the next 5 h. Experimental groups included: 1) Rats previously injected in ventromedian nucleus (VMN) with shRNA against CD36 or scrambled RNA; 2) Etomoxir (CPT1 inhibitor) or saline co-infused with ILH/SH; and 3) Triacsin C (acylCoA synthase inhibitor) or saline co-infused with ILH/SH. ILH significantly lowered food intake during refeeding compared to SH (p<0.001). Five hours after refeeding, etomoxir did not affect this inhibitory effect of ILH on food intake while VMN CD36 depletion totally prevented it. Triacsin C also prevented ILH effects on food intake. In conclusion, the effect of FA to inhibit food intake is dependent on VMN CD36 and acylCoA synthesis but does not required FA oxidation. PMID:24040150

  17. Size control in the synthesis of 1-6 nm gold nanoparticles using folic acid-chitosan conjugate as a stabilizer

    NASA Astrophysics Data System (ADS)

    Liu, Lili; Zhang, Xianwen; Chaudhuri, Jharna

    2014-09-01

    We report a simple and practical method for the preparation of folic acid (FA)-chitosan functionalized gold nanoparticles (AuNPs) with a very small size (1-6 nm). Sodium borohydride was used as a reducing agent. The size of the AuNPs was controlled by adjusting the mass fraction of FA-chitosan conjugate to Au. The AuNPs were characterized using UV-vis spectroscopy and transmission electron microscopy (TEM). The results indicated that the size distribution of AuNPs decreased ranging from 6 nm to 1 nm with increasing the fraction of FA-chitosan conjugate in the reaction systems.

  18. Total synthesis of racemic and (R) and (S)-4-methoxyalkanoic acids and their antifungal activity.

    PubMed

    Das, Biswanath; Shinde, Digambar Balaji; Kanth, Boddu Shashi; Kamle, Avijeet; Kumar, C Ganesh

    2011-07-01

    The total synthesis of 4-methoxydecanoic acid and 4-methoxyundecanoic acid in racemic and stereoselective [(R) and (S)] forms has been accomplished. For stereoselective synthesis of the compounds (S) and (R)-BINOL complexes have been used to generate the required chiral centres. The antifungal activity of these compounds has been studied against different organisms and the results were found to be impressive. The activity of the compounds in racemic and in stereoselective forms was compared. (R)-4-Methoxydecanoic acid was found to be most potent (MIC: 0.019 mg/mL against Candida albicans MTCC 227, C. albicans MTCC 4748, Aspergillus brasiliensis (niger) MTCC 281 and Issatchenkia orientalis MTCC 3020).

  19. Final Step of Phosphatidic Acid Synthesis in Pea Chloroplasts Occurs in the Inner Envelope Membrane 1

    PubMed Central

    Andrews, Jaen; Ohlrogge, John B.; Keegstra, Kenneth

    1985-01-01

    The second enzyme of phosphatidic acid synthesis from glycerol-3-phosphate, 1-acylglycerophospate acyltransferase, was localized to the inner envelope membrane of pea chloroplasts. The activity of this enzyme was measured by both a coupled enzyme assay and a direct enzyme assay. Using the coupled enzyme assay, phosphatidic acid phosphatase was also localized to the inner envelope membrane, although this enzyme has very low activity in pea chloroplasts. The addition of UDP-galactose to unfractionated pea chloroplast envelope preparations did not result in significant conversion of newly synthesized diacylglycerol to monogalactosyldiacylglycerol. Thus, the envelope synthesized phosphatidic acid may not be involved in galactolipid synthesis in pea chloroplasts. PMID:16664266

  20. Molecular Characterization of a Strawberry FaASR Gene in Relation to Fruit Ripening

    PubMed Central

    Jiang, Yue-ming; Zhao, Ming-lei; Shan, Wei; Kuang, Jian-fei; Lu, Wang-jin

    2011-01-01

    Background ABA-, stress- and ripening-induced (ASR) proteins have been reported to act as a downstream component involved in ABA signal transduction. Although much attention has been paid to the roles of ASR in plant development and stress responses, the mechanisms by which ABA regulate fruit ripening at the molecular level are not fully understood. In the present work, a strawberry ASR gene was isolated and characterized (FaASR), and a polyclonal antibody against FaASR protein was prepared. Furthermore, the effects of ABA, applied to two different developmental stages of strawberry, on fruit ripening and the expression of FaASR at transcriptional and translational levels were investigated. Methodology/Principal Findings FaASR, localized in the cytoplasm and nucleus, contained 193 amino acids and shared common features with other plant ASRs. It also functioned as a transcriptional activator in yeast with trans-activation activity in the N-terminus. During strawberry fruit development, endogenous ABA content, levels of FaASR mRNA and protein increased significantly at the initiation of ripening at a white (W) fruit developmental stage. More importantly, application of exogenous ABA to large green (LG) fruit and W fruit markedly increased endogenous ABA content, accelerated fruit ripening, and greatly enhanced the expression of FaASR transcripts and the accumulation of FaASR protein simultaneously. Conclusions These results indicate that FaASR may be involved in strawberry fruit ripening. The observed increase in endogenous ABA content, and enhanced FaASR expression at transcriptional and translational levels in response to ABA treatment might partially contribute to the acceleration of strawberry fruit ripening. PMID:21915355

  1. Formamide Synthesis through Borinic Acid Catalysed Transamidation under Mild Conditions.

    PubMed

    Dine, Tharwat Mohy El; Evans, David; Rouden, Jacques; Blanchet, Jérôme

    2016-04-18

    A highly efficient and mild transamidation of amides with amines co-catalysed by borinic acid and acetic acid has been reported. A wide range of functionalised formamides was synthesized in excellent yields, including important chiral α-amino acid derivatives, with minor racemisation being observed. Experiments suggested that the reaction rely on a cooperative catalysis involving an enhanced boron-derived Lewis acidity rather than an improved Brønsted acidity of acetic acid.

  2. Role of malic enzyme during fatty acid synthesis in the oleaginous fungus Mortierella alpina.

    PubMed

    Hao, Guangfei; Chen, Haiqin; Wang, Lei; Gu, Zhennan; Song, Yuanda; Zhang, Hao; Chen, Wei; Chen, Yong Q

    2014-05-01

    The generation of NADPH by malic enzyme (ME) was postulated to be a rate-limiting step during fatty acid synthesis in oleaginous fungi, based primarily on the results from research focusing on ME in Mucor circinelloides. This hypothesis is challenged by a recent study showing that leucine metabolism, rather than ME, is critical for fatty acid synthesis in M. circinelloides. To clarify this, the gene encoding ME isoform E from Mortierella alpina was homologously expressed. ME overexpression increased the fatty acid content by 30% compared to that for a control. Our results suggest that ME may not be the sole rate-limiting enzyme, but does play a role, during fatty acid synthesis in oleaginous fungi.

  3. Prebiotic Synthesis of Hydrophobic and Protein Amino Acids

    PubMed Central

    Ring, David; Wolman, Yecheskel; Friedmann, Nadav; Miller, Stanley L.

    1972-01-01

    The formation of amino acids by the action of electric discharges on a mixture of methane, nitrogen, and water with traces of ammonia was studied in detail. The presence of glycine, alanine, α-amino-n-butyric acid, α-aminoisobutyric acid, valine, norvaline, isovaline, leucine, isoleucine, alloisoleucine, norleucine, proline, aspartic acid, glutamic acid, serine, threonine, allothreonine, α-hydroxy-γ-aminobutyric acid, and α,γ-diaminobutyric acid was confirmed by ion-exchange chromatography and gas chromatography-mass spectrometry. All of the primary α-amino acids found in the Murchison Meteorite have been synthesized by this electric discharge experiment. PMID:4501592

  4. [New synthesis of the anticoagulant pentasaccharide idraparinux and preparation of its analogues containing sulfonic acid moieties].

    PubMed

    Herczeg, Mihály

    2012-01-01

    Two novel synthetic pathways were elaborated for the preparation of idraparinux, a heparin-related fully O-sulfated, O-methylated anticoagulant pentasaccharide. Both methods based upon a [2+3] block synthesis utilizing the same trisaccharide acceptor which was coupled to either a uronic acid disaccharide donor or its nonoxidized precursor. Two bioisosteric sulfonic acid analogues of idraparinux were also prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic acid esters were found to be excellent donors and acceptors in the glycosylation reactions. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of the reference compound idraparinux and the new sulfonic acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic acid moiety resulted in a notable decrease in the anti-Xa activity.

  5. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  6. A review on synthesis and characterization of solid acid materials for fuel cell applications

    NASA Astrophysics Data System (ADS)

    Mohammad, Norsyahida; Mohamad, Abu Bakar; Kadhum, Abdul Amir H.; Loh, Kee Shyuan

    2016-08-01

    Solid acids emerged as an electrolyte material for application in fuel cells due to their high protonic conductivity and stability at high temperatures between 100 °C and 250 °C. This paper gives an overview of the different solid acid materials and their properties, such as high protonic conductivity and thermal stability, in relation to phase transitions and mechanisms of proton transport. Various solid acid synthesis methods including aqueous and dry mixing, electrospinning, sol-gel, impregnation and thin-film casting will be discussed, and the impact of synthesis methods on the properties of solid acids will be highlighted. The properties of solid acids synthesized as either single crystals and or polycrystalline powders were identified via X-ray diffraction, nuclear magnetic resonance, thermal analyses, optical microscopy and infrared spectroscopy. A selection of electrolyte-electrode assembly methods and the performance of solid acid fuel cell prototypes are also reviewed.

  7. GPM Video of In-fa

    NASA Video Gallery

    On Nov. 23, GPM saw In-fa dropping rain at an extreme rate of over 266 mm (10.5 inches) per hour in storms just to the northwest of the typhoon's eye where thunderstorms reached altitudes of over 1...

  8. JPRS Report Science & Technology Japan Future Prospects of FA-From FA to IMS

    DTIC Science & Technology

    2007-11-02

    STATEMENT A Approved lor public release; . Distribution Unlimited aa "lbAoa iaod sszs £0T 5S3D0ad sNiib 51? inzz 19980701 126 DTIC QUALITY INSPECTED...5 4. Tasks and Future Prospects of FA 13 5. Proposals 21 6. "Status of FA" Survey and Analysis 24 7.FA-related Vocabulary 31...came to about ¥ 13 trillion. This plant investment included such things as investment in new operations and R&D investment; investment for the purpose

  9. How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2015-01-01

    Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

  10. Synthesis of bile acid monosulphates by the isolated perfused rat kidney.

    PubMed Central

    Summerfield, J A; Gollan, J L; Billing, B H

    1976-01-01

    Perfusion of an isolated rat kidney with labelled bile acids, in a protein-free medium, resulted in the urinary excretion of the labelled bile acid, 3% being converted into polar metabolities in 1h. These metabolities were neither glycine nor taurine conjugates, nor bile acid glucuronides, and on solovolysis yielded the free bile acid. On t.l.c. the metabolite of [24-14C]lithocholic acid had the mobility of lithocholate 3-sulphate. The principal metabolite of [24-14C]chenodeoxycholic acid had the mobility of chenodeoxycholate 7-sulphate; trace amounts appeared as chenodeoxycholate 3-sulphate. [35S]sulphate was incorporated in chenodeoxycholic acid by the kidney, resulting in a similar pattern of sulphation. No disulphate salt of chenodeoxycholic acid was detected. These findings lend support to the hypothesis that renal synthesis may account for some of the bile acid sulphates present in urine in the cholestatic syndrome in man. PMID:942413

  11. Castor phospholipid:diacylglycerol acyltransferase facilitates efficient metabolism of hydroxy fatty acids in transgenic Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Producing unusual fatty acids (FAs) in crop plants has been a long-standing goal of green chemistry. However, expression of the enzymes that catalyze the primary synthesis of these unusual FAs in transgenic plants typically results in low levels of the desired FA. For example, seed-specific expressi...

  12. Folate/NIR 797-conjugated albumin magnetic nanospheres: synthesis, characterisation, and in vitro and in vivo targeting evaluation.

    PubMed

    Tang, Qiusha; An, Yanli; Liu, Dongfang; Liu, Peidang; Zhang, Dongsheng

    2014-01-01

    A practical and effective strategy for synthesis of Folate-NIR 797-conjugated Magnetic Albumin Nanospheres (FA-NIR 797-MAN) was developed. For this strategy, Magnetic Albumin Nanospheres (MAN), composed of superparamagnetic iron oxide nanoparticles (SPIONs) and bovine serum albumin (BSA), were covalently conjugated with folic acid (FA) ligands to enhance the targeting capability of the particles to folate receptor (FR) over-expressing tumours. Subsequently, a near-infrared (NIR) fluorescent dye NIR 797 was conjugated with FA-conjugated MAN for in vivo fluorescence imaging. The FA-NIR 797-MAN exhibited low toxicity to a human nasopharyngeal epidermal carcinoma cell line (KB cells). Additionally, in vitro and in vivo evaluation of the dynamic behaviour and targeting ability of FA-NIR 797-MAN to KB tumours validated the highly selective affinity of FA-NIR 797-MAN for FR-positive tumours. In summary, the FA-NIR 797-MAN prepared here exhibited great potential for tumour imaging, since the near-infrared fluorescence contrast agents target cells via FR-mediated endocytosis. The high fluorescence intensity together with the targeting effect makes FA-NIR 797-MAN a promising candidate for imaging, monitoring, and early diagnosis of cancer at the molecular and cellular levels.

  13. Lewis Acid Promoted Oxonium Ion Driven Carboamination of Alkynes for the Synthesis of 4-Alkoxy Quinolines.

    PubMed

    Gharpure, Santosh J; Nanda, Santosh K; Adate, Priyanka A; Shelke, Yogesh G

    2017-02-17

    Lewis acid mediated multisegment coupling cascade is designed for the synthesis of densely substituted 4-alkoxy quinolines via an oxonium ion triggered alkyne carboamination sequence involving C-C and C-N bond formations. Cyclic ether fused-quinolines could also be accessed using this fast, operationally simple, high yielding, chemoselective and functional group tolerant method. Versatility and utility of this methodology is demonstrated by postfunctionalization of products obtained and its use in synthesis of potent drug molecules.

  14. Copper-mediated arylation with arylboronic acids: Facile and modular synthesis of triarylmethanes

    PubMed Central

    Rao, A Veera Bhadra

    2016-01-01

    Summary A facile and modular synthesis of triarylmethanes was achieved in good yield via a two-step sequence in which the final step is the copper(II)-catalyzed arylation of diarylmethanols with arylboronic acids. By using this protocol a variety of symmetrical and unsymmetrical triarylmethanes were synthesized. As an application of the newly developed methodology, we demonstrate a high-yielding synthesis of the triarylmethane intermediate towards an anti-breast-cancer drug candidate. PMID:27340442

  15. Effect of omega-3 fatty acids on the modification of erythrocyte membrane fatty acid content including oleic acid in peritoneal dialysis patients.

    PubMed

    An, W S; Lee, S M; Son, Y K; Kim, S E; Kim, K H; Han, J Y; Bae, H R; Park, Y

    2012-01-01

    Erythrocyte membrane fatty acids (FA), such as oleic acid, are related to acute coronary syndrome. There is no report about the effect of omega-3 FA on oleic acid in peritoneal dialysis (PD) patients. We hypothesized that omega-3 FA can modify erythrocyte membrane FA, including oleic acid, in PD patients. In a double-blind, randomized, placebo-controlled study, 18 patients who were treated with PD for at least 6 months were randomized to treatment for 12 weeks with omega-3 FA or placebo. Erythrocyte membrane FA content was measured by gas chromatography at baseline and after 12 weeks. The erythrocyte membrane content of eicosapentaenoic acid and docosahexaenoic acid was significantly increased and saturated FA and oleic acid were significantly decreased in the omega-3 FA supplementation group after 12 weeks compared to baseline. In conclusion, erythrocyte membrane FA content, including oleic acid, was significantly modified by omega-3 FA supplementation for 12 weeks in PD patients.

  16. Rh(III)-catalyzed synthesis of sultones through C-H activation directed by a sulfonic acid group.

    PubMed

    Qi, Zisong; Wang, Mei; Li, Xingwei

    2014-09-04

    A new rhodium-catalyzed synthesis of sultones via the oxidative coupling of sulfonic acids with internal alkynes is described. The reaction proceeds via aryl C-H activation assisted by a sulfonic acid group.

  17. Orthogonally Protected Furanoid Sugar Diamino Acids for Solid-Phase Synthesis of Oligosaccharide Mimetics.

    PubMed

    John, Franklin; Wittmann, Valentin

    2015-08-07

    Sugar diamino acids (SDAs), which differ from the widely used sugar amino acids in the presence of a second amino group connected to the carbohydrate core, share structural features of both amino acids and carbohydrates. They can be used for the preparation of linear and branched amide-linked oligosaccharide mimetics. Such oligomers carry free amino groups, which are positively charged at neutral pH, in a spatially defined way and, thus, represent a potential class of aminoglycoside mimetics. We report here the first examples of orthogonally protected furanoid SDAs and their use in solid-phase synthesis. Starting from d-glucose, we developed a divergent synthetic route to three derivatives of 3,5-diamino-3,5-dideoxy-d-ribofuranose. These building blocks are compatible with solid-phase peptide synthesis following the 9-fluorenylmethoxycarbonyl (Fmoc) strategy, which we demonstrate by the synthesis of an SDA tetramer.

  18. New hydroxamic acid derivatives of fluoroquinolones: synthesis and evaluation of antibacterial and anticancer properties.

    PubMed

    Rajulu, Gavara Govinda; Bhojya Naik, Halehatty Seephya; Viswanadhan, Abhilash; Thiruvengadam, Jayaraman; Rajesh, Kondodiyil; Ganesh, Sambasivam; Jagadheshan, Hiriyan; Kesavan, Poonimangadu Koppolu

    2014-01-01

    A series of new hydroxamic acid derivatives (6a-f) at C-3 position of fluoroquinolones were designed and synthesized through multistep synthesis. The design concept involved replacement of the 3-carboxylic acid in fluoquinolones with hydroxamic acid as an acid mimicking group. The synthetic work employed in this work provides a good example for the synthesis of pure hydroxamic acid based fluoroquinolones. The synthesized compounds were characterized by (1)H-NMR, electrospray ionization (ESI)-MS and IR. The new compounds were tested for their in vitro antimicrobial and anti-proliferative activity. Out of the six derivatives, compound 6e exhibited moderate antibacterial activity by inhibiting the growth of Escherichia coli and Klebsiella pneumoniae (MIC: 4.00-8.00 µg/mL). Compounds 6b and 6f displayed good growth inhibition against A549 Lung adenocarcinoma and HCT-116 Colon carcinoma cell lines.

  19. Synthesis of 5,9-hexacosadienoic acid phospholipids. 11. Phospholipid studies of marine organisms.

    PubMed

    Mena, P L; Djerassi, C

    1985-01-01

    The synthesis of phosphatidylcholines (PC), phosphatidylethanolamines (PE) and phosphatidylserines (PS) containing two acyl chains of the naturally occurring sponge fatty acid (5Z,9Z)-5,9-hexacosadienoic acid as well as its hitherto unknown geometrical isomers is described. The PCs were prepared by deacylation of natural lecithins, followed by reacylation with fatty acid anhydrides. The synthesis of mixed-acid PCs is also reported: a diacyl product was converted to the lyso-PC by treatment with phospholipase A2 and subsequent acylation of the secondary hydroxyl group to give the desired mixed-acid PCs. The PEs and the PSs were prepared from the corresponding PCs by enzymatic transphosphatidylation catalyzed by phospholipase D. Structural assignments of the compounds were confirmed by spectroscopy (1H-NMR and MS). Ammonia chemical ionization mass spectrometry provided molecular ion and significant fragment peaks for PCs and PEs.

  20. Synthesis and biological properties of amino acids and peptides containing a tetrazolyl moiety

    NASA Astrophysics Data System (ADS)

    Popova, E. A.; Trifonov, R. E.

    2015-09-01

    Literature data published mainly in the last 15 years on the synthesis and biological properties of amino acid analogues and derivatives containing tetrazolyl moieties are analyzed. Tetrazolyl analogues and derivatives of amino acids and peptides are shown to be promising for medicinal chemistry. Being polynitrogen heterocyclic systems comprising four endocyclic nitrogen atoms, tetrazoles can behave as acids and bases and form strong hydrogen bonds with proton donors (more rarely, with acceptors). They have high metabolic stability and are able to penetrate biological membranes. The review also considers the synthesis and properties of linear and cyclic peptides based on modified amino acids incorporating a tetrazolyl moiety. A special issue is the discussion of the biological properties of tetrazole-containing amino acids and peptides, which exhibit high biological activity and can be used to design new drugs. The bibliography includes 200 references.

  1. Stimulation of Ribonucleic Acid Synthesis by Chloramphenicol in a rel+ Aminoacyl-Transfer Ribonucleic Acid Synthetase Mutant of Escherichia coli

    PubMed Central

    Yegian, Charles D.; Vanderslice, Rebecca W.

    1971-01-01

    Escherichia coli strain 9D3 possesses a highly temperature-sensitive valyl-transfer ribonucleic acid (tRNA) synthetase (EC 6.1.1.9). Since 9D3 is a rel+ strain, it cannot carry out net RNA synthesis at high temperature. A 100-μg amount of chloramphenicol (CAP) per ml added in the absence of valine cannot stimulate RNA synthesis. Either 300 μg of CAP or 100 μg of CAP plus 50 μg of valine per ml, however, promotes nearly maximal RNA synthesis. These results can be understood as follows. (i) Valyl-tRNA is required for net RNA synthesis, (ii) the synthetase lesion is incomplete, (iii) the rate of mutant acylation of tRNAval at high temperature is valine-dependent, and (iv) the CAP concentration determines the rate of residual protein synthesis. Data are also presented which demonstrate that the rate of net RNA synthesis can greatly increase long after the addition of CAP, if the amount of valyl-tRNA increases. PMID:4942766

  2. Aromatic amino acids are utilized and protein synthesis is stimulated during amino acid infusion in the ovine fetus.

    PubMed

    Liechty, E A; Boyle, D W; Moorehead, H; Auble, L; Denne, S C

    1999-06-01

    The purpose of this study was to determine whether the ovine fetus is capable of increased disposal of an amino acid load; if so, would it respond by increased protein synthesis, amino acid catabolism or both? A further purpose of the study was to determine whether the pathways of aromatic amino acid catabolism are functional in the fetus. Late gestation ovine fetuses of well-nourished ewes received an infusion of Aminosyn PF alone (APF), and Aminosyn PF + glycyl-L-tyrosine (APF+GT) at rates estimated to double the intake of these amino acids. The initial study, using APF, was performed at 126 +/- 1.4 d; the APF+GT study was performed at 132 +/- 1.7 d (term = 150 d). Phenylalanine and tyrosine kinetics were determined using both stable and radioactive isotopes. Plasma concentrations of most amino acids, but not tyrosine, increased during both studies; tyrosine concentration increased only during the APF+GT study. Phenylalanine rate of appearance and phenylalanine hydroxylation increased during both studies. Tyrosine rate of appearance increased only during the APF+GT study; tyrosine oxidation did not increase during either study. Fetal protein synthesis increased significantly during both studies, producing a significant increase in fetal protein accretion. Fetal proteolysis was unchanged in response to either amino acid infusion. These results indicate that the fetus responds to an acute increase in amino acid supply primarily by increasing protein synthesis and accretion, with a smaller but significant increase in amino acid catabolism also. Both phenylalanine hydroxylation and tyrosine oxidation are active in the fetus, and the fetus is able to increase phenylalanine hydroxylation rapidly in response to increased supply.

  3. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis.

    PubMed

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C; García-Ruiz, Carmen

    2015-12-08

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy.

  4. Myristic acid potentiates palmitic acid-induced lipotoxicity and steatohepatitis associated with lipodystrophy by sustaning de novo ceramide synthesis

    PubMed Central

    Martínez, Laura; Torres, Sandra; Baulies, Anna; Alarcón-Vila, Cristina; Elena, Montserrat; Fabriàs, Gemma; Casas, Josefina; Caballeria, Joan; Fernandez-Checa, Jose C.; García-Ruiz, Carmen

    2015-01-01

    Palmitic acid (PA) induces hepatocyte apoptosis and fuels de novo ceramide synthesis in the endoplasmic reticulum (ER). Myristic acid (MA), a free fatty acid highly abundant in copra/palmist oils, is a predictor of nonalcoholic steatohepatitis (NASH) and stimulates ceramide synthesis. Here we investigated the synergism between MA and PA in ceramide synthesis, ER stress, lipotoxicity and NASH. Unlike PA, MA is not lipotoxic but potentiated PA-mediated lipoapoptosis, ER stress, caspase-3 activation and cytochrome c release in primary mouse hepatocytes (PMH). Moreover, MA kinetically sustained PA-induced total ceramide content by stimulating dehydroceramide desaturase and switched the ceramide profile from decreased to increased ceramide 14:0/ceramide16:0, without changing medium and long-chain ceramide species. PMH were more sensitive to equimolar ceramide14:0/ceramide16:0 exposure, which mimics the outcome of PA plus MA treatment on ceramide homeostasis, than to either ceramide alone. Treatment with myriocin to inhibit ceramide synthesis and tauroursodeoxycholic acid to prevent ER stress ameliorated PA plus MA induced apoptosis, similar to the protection afforded by the antioxidant BHA, the pan-caspase inhibitor z-VAD-Fmk and JNK inhibition. Moreover, ruthenium red protected PMH against PA and MA-induced cell death. Recapitulating in vitro findings, mice fed a diet enriched in PA plus MA exhibited lipodystrophy, hepatosplenomegaly, increased liver ceramide content and cholesterol levels, ER stress, liver damage, inflammation and fibrosis compared to mice fed diets enriched in PA or MA alone. The deleterious effects of PA plus MA-enriched diet were largely prevented by in vivo myriocin treatment. These findings indicate a causal link between ceramide synthesis and ER stress in lipotoxicity, and imply that the consumption of diets enriched in MA and PA can cause NASH associated with lipodystrophy. PMID:26539645

  5. Insulin rapidly increases diacylglycerol by activating de novo phosphatidic acid synthesis.

    PubMed

    Farese, R V; Konda, T S; Davis, J S; Standaert, M L; Pollet, R J; Cooper, D R

    1987-05-01

    The mechanisms whereby insulin increases diacylglycerol in BC3H-1 myocytes were examined. When [3H]arachidonate labeling of phospholipids was used as an indicator of phospholipase C activation, transient increases in [3H]diacylglycerol were observed between 0.5 and 10 minutes after the onset of insulin treatment. With [3H]glycerol labeling as an indicator of de novo phospholipid synthesis, [3H]diacylglycerol was increased maximally at 1 minute and remained elevated for 20 minutes. [3H]Glycerol-labeled diacylglycerol was largely derived directly from phosphatidic acid. Insulin increased de novo phosphatidic acid synthesis within 5 to 10 seconds; within 1 minute, this synthesis was 60 times greater than that of controls. Thus, the initial increase in diacylglycerol is due to both increased hydrolysis of phospholipids and a burst of de novo phosphatidic acid synthesis. After 5 to 10 minutes, de novo phosphatidic acid synthesis continues as a major source of diacylglycerol. Both phospholipid effects of insulin seem important for generating diacylglycerol and other phospholipid-derived intracellular signaling substances.

  6. Synthesis of alpha-hydroxyphosphonic acids from Lesquerella oil

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Lesquerella oil has been a substance of growing chemical interest, due to the ease with which it is produced and its similarity in structure to castor oil. The primary fatty acid in Lesquerella oil, lesquerolic acid, is very similar to the principal component of castor oil, ricinoleic acid, and may ...

  7. Kinetics of Ethyl Acetate Synthesis Catalyzed by Acidic Resins

    ERIC Educational Resources Information Center

    Antunes, Bruno M.; Cardoso, Simao P.; Silva, Carlos M.; Portugal, Ines

    2011-01-01

    A low-cost experiment to carry out the second-order reversible reaction of acetic acid esterification with ethanol to produce ethyl acetate is presented to illustrate concepts of kinetics and reactor modeling. The reaction is performed in a batch reactor, and the acetic acid concentration is measured by acid-base titration versus time. The…

  8. Stimulation of muscle protein synthesis by prolonged parenteral infusion of leucine is dependent on amino acid availability in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....

  9. Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...

  10. Amino Acid Starvation Has Opposite Effects on Mitochondrial and Cytosolic Protein Synthesis

    PubMed Central

    Pearce, Sarah F.; Rorbach, Joanna; He, Jiuya; Brea-Calvo, Gloria; Minczuk, Michal; Reyes, Aurelio; Holt, Ian J.; Spinazzola, Antonella

    2014-01-01

    Amino acids are essential for cell growth and proliferation for they can serve as precursors of protein synthesis, be remodelled for nucleotide and fat biosynthesis, or be burnt as fuel. Mitochondria are energy producing organelles that additionally play a central role in amino acid homeostasis. One might expect mitochondrial metabolism to be geared towards the production and preservation of amino acids when cells are deprived of an exogenous supply. On the contrary, we find that human cells respond to amino acid starvation by upregulating the amino acid-consuming processes of respiration, protein synthesis, and amino acid catabolism in the mitochondria. The increased utilization of these nutrients in the organelle is not driven primarily by energy demand, as it occurs when glucose is plentiful. Instead it is proposed that the changes in the mitochondrial metabolism complement the repression of cytosolic protein synthesis to restrict cell growth and proliferation when amino acids are limiting. Therefore, stimulating mitochondrial function might offer a means of inhibiting nutrient-demanding anabolism that drives cellular proliferation. PMID:24718614

  11. Synthesis and characterization of bis-thiourea having amino acid derivatives

    NASA Astrophysics Data System (ADS)

    Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah

    2016-11-01

    In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.

  12. A note on the prebiotic synthesis of organic acids in carbonaceous meteorites

    NASA Technical Reports Server (NTRS)

    Kerridge, John F.

    1991-01-01

    Strong similarities between monocarboxylic and hydrocarboxylic acids in the Murchison meteorite suggest corresponding similarities in their origins. However, various lines of evidence apparently implicate quite different precursor compounds in the synthesis of the different acids. These seeming inconsistencies can be resolved by postulating that the apparent precursors also share a related origin. Pervasive D enrichment indicates that this origin was in a presolar molecular cloud. The organic acids themselves were probably synthesized in an aqueous environment on an asteroidal parent body, the hydroxy (and amino) acids by means of the Strecker cyanohydrin reaction.

  13. Integrated acid mine drainage management using fly ash.

    PubMed

    Vadapalli, Viswanath R K; Gitari, Mugera W; Petrik, Leslie F; Etchebers, Olivier; Ellendt, Annabelle

    2012-01-01

    Fly Ash (FA) from a power station in South Africa was investigated to neutralise and remove contaminants from Acid Mine Drainage (AMD). After this primary treatment the insoluble FA residue namely solid residue (SR) was investigated as a suitable mine backfill material by means of strength testing. Moreover, SR was used to synthesise zeolite-P using a two-step synthesis procedure. Furthermore, the zeolite-P was investigated to polish process water from the primary FA-AMD reaction. The main objective of this series of investigations is to achieve zero waste and to propose an integrated AMD management using FA. Fly Ash was mixed with AMD at various predetermined FA-AMD ratios until the mixtures achieved circumneutral pH or higher. The supernatants were then analyzed using Inductively Coupled Plasma Mass Spectrometry (ICP-MS) and Ion Chromatography (IC) for cations and anions respectively. The physical strength testing of SR was carried out by mixing it with 3% Ordinary Portland Cement (OPC) and curing for 410 days. Synthesis of zeolite-P using SR was carried out by two step synthesis procedure: ageing for 24 hours followed by a mild hydrothermal synthesis at 100°C for 4 days. The polishing of process water from primary AMD treatment using FA was ascertained by mixing the process water with zeolite at a liquid to solid ratio of 100:1 for 1 hour. The results indicated that FA can be successfully used to ameliorate AMD. High removal of major AMD contaminants Fe, Al, Mg, Mn and sulphate was achieved with the ash treatment and trace elements such as Zn, Ni, Cu and Pb were also removed by the FA. Strength testing over 410 days indicated that the material gained strength over the testing period. The maximum unconfined compressive strength and elastic modulus was observed to be approximately 0.3 MPa and 150 Mpa respectively. The X-ray diffraction (XRD) analysis of the synthesized product indicated that SR was successfully converted into zeolite-P with some mullite phase

  14. The Use of Ascorbate as an Oxidation Inhibitor in Prebiotic Amino Acid Synthesis: A Cautionary Note

    NASA Astrophysics Data System (ADS)

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO2-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO2 was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO2-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO2-rich atmosphere under the conditions studied.

  15. The use of ascorbate as an oxidation inhibitor in prebiotic amino acid synthesis: a cautionary note.

    PubMed

    Kuwahara, Hideharu; Eto, Midori; Kawamoto, Yukinori; Kurihara, Hironari; Kaneko, Takeo; Obayashi, Yumiko; Kobayashi, Kensei

    2012-12-01

    It is generally thought that the terrestrial atmosphere at the time of the origin of life was CO(2)-rich and that organic compounds such as amino acids would not have been efficiently formed abiotically under such conditions. It has been pointed out, however, that the previously reported low yields of amino acids may have been partially due to oxidation by nitrite/nitrate during acid hydrolysis. Specifically, the yield of amino acids was found to have increased significantly (by a factor of several hundred) after acid hydrolysis with ascorbic acid as an oxidation inhibitor. However, it has not been shown that CO(2) was the carbon source for the formation of the amino acids detected after acid hydrolysis with ascorbic acid. We therefore reinvestigated the prebiotic synthesis of amino acids in a CO(2)-rich atmosphere using an isotope labeling experiment. Herein, we report that ascorbic acid does not behave as an appropriate oxidation inhibitor, because it contributes amino acid contaminants as a consequence of its reactions with the nitrogen containing species and formic acid produced during the spark discharge experiment. Thus, amino acids are not efficiently formed from a CO(2)-rich atmosphere under the conditions studied.

  16. Acyl Meldrum's acid derivatives: application in organic synthesis

    NASA Astrophysics Data System (ADS)

    Janikowska, K.; Rachoń, J.; Makowiec, S.

    2014-07-01

    This review is focused on an important class of Meldrum's acid derivatives commonly known as acyl Meldrum's acids. The preparation methods of these compounds are considered including the recently proposed and rather rarely used ones. The chemical properties of acyl Meldrum's acids are described in detail, including thermal stability and reactions with various nucleophiles. The possible mechanisms of these transformations are analyzed. The bibliography includes 134 references.

  17. Modulation by Amino Acids: Toward Superior Control in the Synthesis of Zirconium Metal-Organic Frameworks.

    PubMed

    Gutov, Oleksii V; Molina, Sonia; Escudero-Adán, Eduardo C; Shafir, Alexandr

    2016-09-12

    The synthesis of zirconium metal-organic frameworks (Zr MOFs) modulated by various amino acids, including l-proline, glycine, and l-phenylalanine, is shown to be a straightforward approach toward functional-group incorporation and particle-size control. High yields in Zr-MOF synthesis are achieved by employing 5 equivalents of the modulator at 120 °C. At lower temperatures, the method provides a series of Zr MOFs with increased particle size, including many suitable for single-crystal X-ray diffraction studies. Furthermore, amino acid modulators can be incorporated at defect sites in Zr MOFs with an amino acid/ligand ratio of up to 1:1, depending on the ligand structure and reaction conditions. The MOFs obtained through amino acid modulation exhibit an improved CO2 -capture capacity relative to nonfunctionalized materials.

  18. Synthesis and biological activity of glutamic acid derivatives.

    PubMed

    Receveur, J M; Guiramand, J; Récasens, M; Roumestant, M L; Viallefont, P; Martinez, J

    1998-01-20

    In order to develop new specific glutamate analogues at metabotropic glutamate receptors, Diels-Alder, 1-4 ionic and radical reactions were performed starting from (2S)-4-methyleneglutamic acid. Preliminary pharmacological evaluation by measuring IP accumulation using rat forebrain synaptoneurosomes has shown that (2S)-4-(2-phthalimidoethyl)glutamic acid (3a), (2S)-4-(4-phthalimidobutyl)glutamic acid (3b) and 1-[(S)-2-amino-2-carboxyethyl]-3,4-dimethylcyclohex-3-ene-1-carbox ylic acid (8) presented moderate antagonist activities.

  19. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  20. Indole-3-acetic Acid Synthesis in Tumorous and Nontumorous Species of Nicotiana 1

    PubMed Central

    Liu, Shih-Tung; Katz, Charles D.; Knight, C. Arthur

    1978-01-01

    The synthesis of indole-3-acetic acid (IAA) in the enzyme extracts of Nicotiana glauca, Nicotiana langsdorffii, their F1 hybrid, their amphidiploid hybrid, and the nontumorous mutant of the hybrid was investigated. Tryptamine, a possible precursor of IAA biosynthesis in Nicotiana tabacum, was not found in the callus tissue of N. glauca, N. langsdorffii, and their F1 hybrid. In petiole slices, the synthesis of IAA progressively increased during 5 hours of incubation in [14C]tryptophan. The rate of synthesis was about equal in the hybrid and N. langsdorffii but lower in N. glauca on either a cell or fresh weight basis. It was also found that tryptophan was about 25 times more efficient than tryptamine in promoting synthesis of IAA in petiole slices. It was found that indoleacetaldehyde oxidase, indoleacetaldehyde reductase, and tryptophan aminotransferase activities were present in all of the species examined; however, tryptophan decarboxylase activity was not found. The tryptophan aminotransferase activity in N. glauca, N. langsdorffii, and the nontumorous mutant required α-ketoglutaric acid and pyridoxal 5-phosphate whereas the addition of pyridoxal 5-phosphate seemed not to increase the enzyme activity in tumor plants. The tryptophan aminotransferase in the amphidiploid hybrid was partially purified by acetone precipitation. The enzyme activity had a temperature optimum at 49 C and a pH optimum at 8.9. It is suggested that there is an indolepyruvic acid pathway in the synthesis of IAA in the Nicotiana species examined. PMID:16660376

  1. Synthesis of phosphonic analogues of carnitine and gamma-amino-beta-hydroxybutyric acid.

    PubMed

    Tadeusiak, Elzbieta J

    2004-12-01

    The involvement of carnitine and gamma-amino-beta-hydroxybutyric acid in the biology of mammalian cells, the physiology of the human body, and some important aspects of medicinal treatment has induced many research groups to develop their pharmacologically potent analogues. Among them are the very important phosphonic analogues: phosphocarnitine and gamma-amino-beta-hydroxypropylphosphonic acid. This mini-review describes the various methodologies used for the synthesis of these compounds.

  2. 5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

    DOEpatents

    Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

    1999-01-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  3. 5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group

    DOEpatents

    Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.

    1999-06-01

    The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

  4. [Genetic code: codon bases--the symbols of amino acid synthesis and catabolism pathways].

    PubMed

    Konyshev, V A

    1983-01-01

    The correlations between genetic codes of amino acids and pathways of synthesis and catabolism of carbon backbone of amino acids are considered. Codes of amino acids which are synthesized from oxoacids of glycolysis, the Krebs cycle and glyoxalic cycle via transamination without any additional chemical reactions, are initiated with guanine (alanine, glutamic and aspartic acids, glycine). Codons of amino acids which are formed on the branches of glycolysis at the level of compounds with three carbon atoms, begin with uracil (phenylalanine, serine, leucine, tyrosine, cysteine, tryptophan). Codes of amino acids formed from aspartate begin with adenine (methionine, isoleucine, threonine, asparagine, lysine, serine), while those of the amino acids formed from the compounds with five carbon atoms (glutamic acid and phosphoribosyl pyrophosphate) begin with cytosine (arginine, proline, glutamine, histidine). The second letter of codons is linked to catabolic pathways of amino acids: most of amino acids entering glycolysis and the Krebs cycle through even-numbered carbon compounds, have adenine and uracil at the second position of codes (A-U type); most of amino acids entering the glycolysis and the Krebs cycle via odd-numbered carbon compounds, have codons with guanine and cytidine at the second position (G-C type). The usage of purine and pyrimidine as the third letter of weak codones in most of amino acids is linked to the enthropy of amino acid formation. A hypothesis claiming that the linear genetic code was assembled from the purine and pyrimidine derivatives which have acted as participants of primitive control of amino acid synthesis and catabolism, is suggested.

  5. Resistance of lung fatty acid synthesis to inhibition by dietary fat in the meal-fed rat.

    PubMed

    Clarke, S D; Wilson, M D; Ibnoughazala, T

    1984-03-01

    One-half of the palmitate utilized by the lung for production of the surfactant phospholipid, dipalmitoyl phosphatidylcholine, originates from de novo palmitate synthesis in the lung. In this report the lung was examined for the influence of dietary fat on the lung de novo fatty acid synthesis pathway. Lung lipogenesis was reduced by fasting and accelerated by carbohydrate refeeding or insulin injection. However, in general lung fatty acid synthesis was unaffected by dietary fat. Supplementing one meal (high glucose diet) with as much as 36% additional fat kilocalories did not suppress lung fatty acid synthesis. An inhibition of fatty acid synthesis resulted from a fat supplement of +60 and +120% of meal kilocalories, but this inhibition was likely due to an attenuated rate of glucose absorption. Ingestion of a high carbohydrate diet supplemented with 10, 17, or 30% added kilocalories as safflower oil or palmitate had no effect on lipogenesis after 10 days. On the other hand, liver fatty acid synthesis and acetyl-CoA carboxylase were selectively suppressed by safflower oil, whereas dietary palmitate was ineffective as an inhibitor of lipogenesis. These data clearly demonstrate that the well-characterized preferential suppression of liver lipogenesis by dietary polyunsaturated fats does not extend to lung tissue, and, more importantly, the inhibition of liver lipogenesis is not secondary to an essential fatty acid deficiency. The marked resistance of lung fatty acid synthesis to inhibition by dietary fat might be a biological protective mechanism to ensure adequate palmitate for dipalmitoyl phosphatidylcholine synthesis.

  6. Synthesis and characterization of L-lactide and polylactic acid (PLA) from L-lactic acid for biomedical applications

    NASA Astrophysics Data System (ADS)

    Rahmayetty, Sukirno, Prasetya, Bambang; Gozan, Misri

    2017-02-01

    Lactide is the monomer for the polymer polylactic acid (PLA) from lactic acid through polycondensation and depolymerization process. The properties of PLA strongly depend on the quality of the lactide monomer from which it is synthesized. Optical purity of lactide produced in depolymerization process confirmed to be L-lactide. The highest yield of crude lactide was 38.5% at temperature 210 °C with average molecular weight (Mn) of oligomer was 2389. Ring opening polymerization of lactide using Candida rugosa lipase as biocatalyst to PLLA synthesis has been achieved to generate useful biomedical materials free from heavy metal.

  7. Improved synthesis of isostearic acid using zeolite catalysts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Isostearic acids are unique and important biobased products with superior properties. Unfortunately, they are not widely utilized in industry because they are produced as byproducts from a process called clay-catalyzed oligomerization of tall oil fatty acids. Generally, this clay method results in...

  8. Synthesis and characterization of hydrogen-bond acidic functionalized graphene

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Han, Qiang; Pan, Yong; Cao, Shuya; Ding, Mingyu

    2014-05-01

    Hexafluoroisopropanol phenyl group functionalized materials have great potential in the application of gas-sensitive materials for nerve agent detection, due to the formation of strong hydrogen-bonding interactions between the group and the analytes. In this paper, take full advantage of ultra-large specific surface area and plenty of carbon-carbon double bonds and hexafluoroisopropanol phenyl functionalized graphene was synthesized through in situ diazonium reaction between -C=C- and p-hexafluoroisopropanol aniline. The identity of the as-synthesis material was confirmed by transmission electron microscopy, Raman spectroscopy, ultraviolet visible spectroscopy, X-ray photoelectron spectroscopy and thermo gravimetric analysis. The synthesis method is simply which retained the excellent physical properties of original graphene. In addition, the novel material can be assigned as an potential candidate for gas sensitive materials towards organophosphorus nerve agent detection.

  9. Asymmetric synthesis of aromatic β-amino acids using ω-transaminase: Optimizing the lipase concentration to obtain thermodynamically unstable β-keto acids.

    PubMed

    Mathew, Sam; Jeong, Seong-Su; Chung, Taeowan; Lee, Sang-Hyeup; Yun, Hyungdon

    2016-01-01

    Synthesized aromatic β-amino acids have recently attracted considerable attention for their application as precursors in many pharmacologically relevant compounds. Previous studies on asymmetric synthesis of aromatic β-amino acids using ω-transaminases could not be done efficiently due to the instability of β-keto acids. In this study, a strategy to circumvent the instability problem of β-keto acids was utilized to generate β-amino acids efficiently via asymmetric synthesis. In this work, thermodynamically stable β-ketoesters were initially converted to β-keto acids using lipase, and the β-keto acids were subsequently aminated using ω-transaminase. By optimizing the lipase concentration, we successfully overcame the instability problem of β-keto acids and enhanced the production of β-amino acids. This strategy can be used as a general approach to efficiently generate β-amino acids from β-ketoesters.

  10. Total synthesis of (±)-epithuriferic acid methyl ester via Diels-Alder reaction.

    PubMed

    Koprowski, Marek; Bałczewski, Piotr; Owsianik, Krzysztof; Różycka-Sokołowska, Ewa; Marciniak, Bernard

    2016-02-07

    In this paper, we have described the first total synthesis of (±)-epithuriferic acid methyl ester from non-natural sources, in four steps (20% overall yield). The key step involves the Diels-Alder reaction of isobenzofuran with methyl 3-(dimethoxyphosphoryl)acrylate which is controlled by "ortho" regio- and endo stereoselectivities due to the COOMe group.

  11. Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids

    PubMed Central

    Cativiela, Carlos; Ordóñez, Mario

    2010-01-01

    The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486

  12. POLYSTYRENE SULFONIC ACID CATALYZED GREENER SYNTHESIS OF HYDRAZONES IN AQUEOUS MEDIUM USING MICROWAVES

    EPA Science Inventory

    An environmentally benign aqueous protocol for the synthesis of cyclic, bi-cyclic, and heterocyclic hydrazones using polystyrene sulfonic acid (PSSA) as a catalyst has been developed; the simple reaction proceeds efficiently in water in the absence of any organic solvent under mi...

  13. Total synthesis of (−)-dihydroprotolichesterenic acid via diastereoselective conjugate addition to chiral fumarates

    PubMed Central

    Hethcox, J. Caleb; Shanahan, Charles S.; Martin, Stephen F.

    2013-01-01

    A diastereoselective conjugate addition of a variety of monoorganocuprates, Li[RCuI], to chiral fumarates to provide funtionalized succinates has been developed. The utility of this reaction is demonstrated in a concise total synthesis of (−)-dihydroprotolichesterenic acid that required only four steps and proceeded in an overall 31% yield. PMID:23539490

  14. Diastereoselective addition of monoorganocuprates to a chiral fumarate: reaction development and synthesis of (-)-dihydroprotolichesterinic acid.

    PubMed

    Hethcox, J Caleb; Shanahan, Charles S; Martin, Stephen F

    2015-09-16

    Recent studies of diastereoselective conjugate additions of monoorganocuprates, Li[RCuI], to chiral γ-alkoxycrotonates and fumarates are disclosed. This methodology was applied to the shortest total synthesis of (-)-dihydroprotolichesterinic acid to date, but several attempts to prepare other succinate-derived natural products, such as pilocarpine and antrodin E, were unsuccessful.

  15. Stimulation of muscle protein synthesis by leucine is dependent on plasma amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reported that a physiological increase in plasma leucine increased translation initiation factor activity during 60- and 120-min leucine infusion. Muscle protein synthesis was stimulated at 60 min but not at 120 min, perhaps due to the decrease (-50%) in plasma essential amino acids (AA). ...

  16. An Overview of Stereoselective Synthesis of α-Aminophosphonic Acids and Derivatives

    PubMed Central

    Ordóñez, Mario; Rojas-Cabrera, Haydée; Cativiela, Carlos

    2009-01-01

    An overview of all methodologies published during the last few years focused to the stereoselective (diastereoselective or enantioselective) synthesis of α-aminophosphonic acids and derivatives is reported. The procedures have been classified according a retrosynthetic strategy and taking into account the formation of each one of the bonds connected to the chiral centre. PMID:20871799

  17. Methods for the synthesis of tritium-labelled fatty acids and their derivatives, oxylipins and steroids

    NASA Astrophysics Data System (ADS)

    Shevchenko, Valerii P.; Nagaev, Igor Yu; Myasoedov, Nikolai F.

    1999-10-01

    The achievements in the field of synthesis and application of tritium-labelled oxylipins, steroids, fatty acids, phospho-, sphingo- and other lipids are reviewed. The importance of these studies for the solution of current problems of biochemistry, biology and pharmacology is exemplified in the application of labelled compounds. The bibliography includes 148 references.

  18. High fatty acid availability after exercise alters the regulation of muscle lipid metabolism.

    PubMed

    Newsom, Sean A; Schenk, Simon; Li, Minghua; Everett, Allison C; Horowitz, Jeffrey F

    2011-06-01

    We previously reported that a single exercise session protects against fatty acid (FA)-induced insulin resistance, perhaps in part through augmented intramyocellular triacylglycerol (IMTG) synthesis. The aim of this study was to examine the effect of elevated FA availability after exercise on factors regulating IMTG metabolism. After exercise (90 minutes, 65% peak oxygen uptake), 7 healthy women (body mass index, 23 ± 1 kg/m(2)) were infused overnight (16 hours) with either a lipid and heparin solution (LIPID, 0.11 g fat per kilogram per hour) or saline (SALINE). We measured resting FA oxidation (indirect calorimetry) and obtained a skeletal muscle biopsy sample the next morning. The 4-fold increase in overnight plasma FA concentration during LIPID increased IMTG by approximately 30% during LIPID vs SALINE. This was accompanied by an approximately 25% greater membrane-associated abundance of the FA transporter FAT/CD36 (P < .01) and an approximately 8% increase in the activity of the IMTG synthesis enzyme glycerol-3-phosphate acyltransferase (GPAT, P < .01). In contrast, resting FA oxidation was not affected. We also found no difference in the protein abundance of GPAT1 and diacylglycerol acyltransferase-1, diacylglycerol acyltransferase activity, or the abundance of the lipid droplet coat proteins (perilipins 2, 3, 4, and 5) between treatments. Our findings suggest that augmented capacity for FA flux into muscle (ie, via membrane-associated FAT/CD36), perhaps together with a slight yet significant increase in activity of a key IMTG synthesis enzyme (GPAT), may enhance IMTG storage when FA availability is high after exercise. The importance of the absence of a change in perilipin protein abundance despite increased muscle lipid storage remains to be determined.

  19. Synthesis of mixed acid anhydrides from methane and carbon dioxide in acid solvents.

    PubMed

    Zerella, Mark; Mukhopadhyay, Sudip; Bell, Alexis T

    2003-09-04

    [reaction: see text] The reaction of CH(4) with CO(2) has been performed in anhydrous acids using VO(acac)(2) and K(2)S(2)O(8) as promoters. NMR analysis establishes that the primary product is a mixed anhydride of acetic acid and the acid solvent. In sulfuric acid, the overall reaction is CH(4) + CO(2) + SO(3) --> CH(3)C(O)-O-SO(3)H. Hydrolysis of the mixed anhydride produces acetic acid and the solvent acid. When trifluoroacetic acid is the solvent, acetic acid is primarily formed via the reaction CH(4) + CF(3)COOH --> CH(3)COOH + CHF(3).

  20. Synthesis of polyacrylic-acid-based thermochromic polymers

    NASA Astrophysics Data System (ADS)

    Srivastava, Jyoti; Alam, Sarfaraz; Mathur, G. N.

    2003-10-01

    Smart materials respond to environmental stimuli with particular changes in some variables (for example temperature, pressure and electric field etc), for that reason they are often called responsive materials. In the present work, we have synthesized thermochromic polymer based on poly acrylic acid cobalt chloride (CoCl2) and phosphoric acid (H3PO4) that visually and reversibly changes color in the temperature range (70 - 130°C). These thermochromic materials can be used as visual sensors of temperature. Thermochromic polymers are based on polyacrylic acid and CoCl2 complex.

  1. Microbiologically produced carboxylic acids used as building blocks in organic synthesis.

    PubMed

    Aurich, Andreas; Specht, Robert; Müller, Roland A; Stottmeister, Ulrich; Yovkova, Venelina; Otto, Christina; Holz, Martina; Barth, Gerold; Heretsch, Philipp; Thomas, Franziska A; Sicker, Dieter; Giannis, Athanassios

    2012-01-01

    Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building blocks. Thereby, our biotechnological goal was the development of process fundamentals regarding the variable use of renewable raw materials, the development of a multi purpose bioreactor and application of a pilot plant with standard equipment for organic acid production to minimize the technological effort. Furthermore the development of new product isolation procedures, with the aim of direct product recovery, capture of products or single step operation, was necessary. The application of robust and approved microorganisms, also genetically modified, capable of using a wide range of substrates as well as producing a large spectrum of products, was of special importance. Microbiologically produced acids, like 2-oxo-glutaric acid and 2-oxo-D-gluconic acid, are useful educts for the chemical synthesis of hydrophilic triazines, spiro-connected heterocycles, benzotriazines, and pyranoic amino acids. The chiral intermediate of the tricarboxylic acid cycle, (2R,3S)-isocitric acid, is another promising compound. For the first time our process provides large quantities of enantiopure trimethyl (2R,3S)-isocitrate which was used in subsequent chemical transformations to provide new chiral entities for further usage in total synthesis and pharmaceutical research.Oxo- and hydroxy-carboxylic acids are of special interest in organic synthesis. However, their introduction by chemical reactions tends to be troublesome especially with regard to stereoselectivity. We describe herein the biotechnological preparation of selected oxo- and hydroxycarboxylic acids under "green" conditions and their use as promising new building

  2. The influence of dietary nitrogen reduction and conjugated linoleic acid supply to dairy cows on fatty acids in milk and their transfer to ripened cheese.

    PubMed

    Schiavon, S; Cesaro, G; Cecchinato, A; Cipolat-Gotet, C; Tagliapietra, F; Bittante, G

    2016-11-01

    The aim of this study was to investigate the consequences of reducing the dietary crude protein content, with or without a supply of protected conjugated linoleic acid (CLA), on the milk fatty acid (FA) yield and recovery in 90d ripened cheese. Twenty mid-lactation Friesian dairy cows were reared for 4 periods of 3wk each in groups of 5, following a 4×4 Latin square design. Cows were fed 4 different rations, consisting of a combination of the 2 dietary crude protein levels [150 (CP15) or 123 (CP12) g of crude protein/kg of dry matter], with or without a conjugated linoleic acid supply (80g/d, providing 5.57 and 5.40g/d of C18:2 cis-9,trans-11 and C18:2 trans-10,cis-12, respectively). Milk yield was recorded. Twice in each period, milk samples were analyzed for protein, fat, and lactose content, and 10 L milk samples (pooled by group) were processed to produce 96 cheeses, which were ripened for 90d. Milk and cheese fat were analyzed for their FA profiles. Milk and cheese FA were expressed as daily yields and relative proportions, and nutrient recoveries were computed. Dietary crude protein reduction had small or no effects on the yield and relative presence of FA in milk and cheese, except for a small increase in mid-chain branched saturated fatty acids. The CLA supply strongly reduced the yield of various categories of FA, and had major effects on short-chain FA of de novo synthesis, leading to changes in the relative proportions of the various FA in milk and cheese. The addition of CLA tended to reduce uniformly the recovery of all milk constituents and of short-, medium-, and long-chain FA groups, but we observed large differences among individual FA with apparent recoveries ranging between 640 and 1,710g/kg. The highest recoveries were found for polyunsaturated long-chain FA, the lowest for saturated or monounsaturated short- or medium-chain FA. A notable rearrangement of these FA components, particularly the minor ones, took place during ripening.

  3. Synthesis of deuterated [D32 ]oleic acid and its phospholipid derivative [D64 ]dioleoyl-sn-glycero-3-phosphocholine.

    PubMed

    Darwish, Tamim A; Luks, Emily; Moraes, Greta; Yepuri, Nageshwar R; Holden, Peter J; James, Michael

    2013-01-01

    Oleic acid and its phospholipid derivatives are fundamental to the structure and function of cellular membranes. As a result, there has been increasing interest in the availability of their deuterated forms for many nuclear magnetic resonance, infrared, mass spectroscopy and neutron scattering studies. Here, we present for the first time a straightforward, large-scale (gram quantities) synthesis of highly deuterated [D32 ]oleic acid by using multiple, yet simple and high yielding reactions. The precursors for the synthesis of [D32 ]oleic acid are [D14 ]azelaic acid and [D17 ]nonanoic acid, which were obtained by complete deuteration (>98% D) of their (1) H forms by using metal catalysed hydrothermal H/D exchange reactions. The oleic acid was produced with ca. 94% D isotopic purity and with no contamination by the trans-isomer (elaidic acid). The subsequent synthesis of [D64 ]dioleoyl-sn-glycero-3-phosphocholine from [D32 ]oleic acid is also described.

  4. Veterinary Medicine and Omics (Veterinomics): Metabolic Transition of Milk Triacylglycerol Synthesis in Sows from Late Pregnancy to Lactation.

    PubMed

    Lv, Yantao; Guan, Wutai; Qiao, Hanzhen; Wang, Chaoxian; Chen, Fang; Zhang, Yinzhi; Liao, Zhichao

    2015-10-01

    Mammalian milk is a key source of lipids, providing not only important calories but also essential fatty acids. Veterinary medicine and omics systems sciences intersection, termed as "veterinomics" here, has received little attention to date but stands to offer much promise for building bridges between human and animal health. We determined the changes in porcine mammary genes and proteomics expression associated with milk triacylglycerol (TAG) synthesis and secretion from late pregnancy to lactation. TAG content and fatty acid (FA) composition were determined in porcine colostrum (the 1st day of lactation) and milk (the 17th day of lactation). The mammary transcriptome for 70 genes and 13 proteins involved in TAG synthesis and secretion from six sows, each at d -17(late pregnancy), d 1(early lactation), and d 17 (peak lactation) relative to parturition were analyzed using quantitative real-time PCR and Western blot analyses. The TAG content and the concentrations of de novo synthesized FAs, saturated FAs, and monounsaturated FAs were higher in milk than in colostrum (p<0.05). Robust upregulation with high relative mRNA abundance was evident during lactation for genes associated with FA uptake (VLDLR, LPL, CD36), FA activation (ACSS2, ACSL3), and intracellar transport (FABP3), de novo FA synthesis (ACACA, FASN), FA elongation (ELOVL1), FA desaturation (SCD, FADS1), TAG synthesis (GPAM, AGPAT1, LPIN1, DGAT1), lipid droplet formation (BTN2A1, XDH, PLIN2), and transcription factors and nuclear receptors (SREBP1, SCAP, INSIG1/2). In conclusion, a wide variety of lipogenic genes and proteins regulate the channeling of FAs towards milk TAG synthesis and secretion in porcine mammary gland tissue. These findings inform future omics strategies to increase milk fat production and lipid profile and attest to the rise of both veterinomics and lipidomics in postgenomics life sciences.

  5. Far-red light photoacclimation (FaRLiP) in Synechococcus sp. PCC 7335: I. Regulation of FaRLiP gene expression.

    PubMed

    Ho, Ming-Yang; Gan, Fei; Shen, Gaozhong; Zhao, Chi; Bryant, Donald A

    2017-02-01

    Far-red light photoacclimation (FaRLiP) is a mechanism that allows some cyanobacteria to utilize far-red light (FRL) for oxygenic photosynthesis. During FaRLiP, cyanobacteria remodel photosystem (PS) I, PS II, and phycobilisomes while synthesizing Chl d, Chl f, and far-red-absorbing phycobiliproteins, and these changes enable these organisms to use FRL for growth. In this study, a conjugation-based genetic system was developed for Synechococcus sp. PCC 7335. Three antibiotic cassettes were successfully used to generate knockout mutations in genes in Synechococcus sp. PCC 7335, which should allow up to three gene loci to be modified in one strain. This system was used to delete the rfpA, rfpB, and rfpC genes individually, and characterization of the mutants demonstrated that these genes control the expression of the FaRLiP gene cluster in Synechococcus sp. PCC 7335. The mutant strains exhibited some surprising differences from similar mutants in other FaRLiP strains. Notably, mutations in any of the three master transcription regulatory genes led to enhanced synthesis of phycocyanin and PS II. A time-course study showed that acclimation of the photosynthetic apparatus from that produced in white light to that produced in FRL occurs very slowly over a period 12-14 days in this strain and that it is associated with a substantial reduction (~34 %) in the chlorophyll a content of the cells. This study shows that there are differences in the detailed responses of cyanobacteria to growth in FRL in spite of the obvious similarities in the organization and regulation of the FaRLiP gene cluster.

  6. Synthesis of Site-Specifically (13)C Labeled Linoleic Acids.

    PubMed

    Offenbacher, Adam R; Zhu, Hui; Klinman, Judith P

    2016-10-12

    Soybean lipoxygenase-1 (SLO-1) catalyzes the C-H abstraction from the reactive carbon (C-11) in linoleic acid as the first and rate-determining step in the formation of alkylhydroperoxides. While previous labeling strategies have focused on deuterium labeling to ascertain the primary and secondary kinetic isotope effects for this reaction, there is an emerging interest and need for selectively enriched (13)C isotopologues. In this report, we present synthetic strategies for site-specific (13)C labeled linoleic acid substrates. We take advantage of a Corey-Fuchs formyl to terminal (13)C-labeled alkyne conversion, using (13)CBr4 as the labeling source, to reduce the number of steps from a previous fatty acid (13)C synthetic labeling approach. The labeled linoleic acid substrates are useful as nuclear tunneling markers and for extracting active site geometries of the enzyme-substrate complex in lipoxygenase.

  7. [Clarification on publications concerning the synthesis of acetylsalicylic acid].

    PubMed

    Lafont, O

    1996-01-01

    Charles Frédéric Gerhardt (1816-1856) mentioned in his Traité de chimie Organique (1854) a publication, in French (realized in 1852 but published in 1853) entitled "Researches on anhydrous organic acids" in which, was reported the reaction of sodium salicylate with acetyl chloride. He thought that the reaction product was an acid anhydride, but obtained really crude acetylsalicylic acid. Later on, but also in 1853, a publication in german, by the same author related the same experiments. Surprisingly only the second publication has been mentioned in most of the historical studies on the subject. Acetyl salicylic acid was identified and synthesised in 1859 by von Gilm by another method and the product obtained by Gerhardt was identified to it in 1869.

  8. Nalidixic Acid and Macromolecular Metabolism in Tetrahymena pyriformis: Effects on Protein Synthesis

    PubMed Central

    de Castro, J. F.; Carvalho, J. F. O.; Moussatché, N.; de Castro, F. T.

    1975-01-01

    A study on the effect of nalidixic acid on macromolecular metabolism, particularly of protein, in Tetrahymena pyriformis was performed. It was shown that the compound is a potent inhibitor of deoxyribonucleic acid, ribonucleic acid, and protein synthesis for this organism. A conspicuous breakdown of polysomes, accompanied by the accumulation of 80S ribosomes, occurred in cells incubated for 10 min with the drug; polysome formation was prevented. The accumulating 80S particles were shown to be run-off ribosomal units. The incorporation of amino acids by a cell-free system is not affected by nalidixic acid. In nonproliferating cells the incorporation was also not prevented, unless the cells were previously incubated with the drug. These results are discussed in terms of the possible mechanism of action of nalidixic acid in T. pyriformis. PMID:807153

  9. Synthesis of an indole analog of folic acid

    SciTech Connect

    Shengeliya, M.S.; Avramenko, V.G.; Kuleshova, L.N.; Ershova, Yu.A.; Chernov, V.A.; Surorov, N.N.

    1987-06-01

    The authors study the replacement of the p-aminobenzoic acid (PABA) moiety. The authors synthesized an indole analog of folic acid, namely dimethyl N-(5-(2'-amino-4'-oxo-6'-pteridinyl)methylaminoindol-2-yl)glutamate. The physicochemical properties and the chemical shifts in the PMR spectra of the compounds obtained are shown. The examination of the compound for antitumor activity was carried out using rats and mice.

  10. Synthesis of multifunctional Ag@Au@phenol formaldehyde resin particles loaded with folic acids for photothermal therapy.

    PubMed

    Yang, Ping; Xu, Qi-Zhi; Jin, Sheng-Yu; Lu, Yang; Zhao, Yang; Yu, Shu-Hong

    2012-07-23

    Multifunctional Ag@Au@ phenol formaldehyde resin (PFR) particles loaded with folic acids (FA) have been designed for killing tumor cells through photothermy conversion under the irradiation of near-infrared (NIR) light. Possessing the virtue of good fluorescence, low toxicity, and good targeting, the nanocomposite consists of an Ag core, an Au layer, a PFR shell, and folic acids on the PFR shell. The Ag@PFR core-shell structure can be prepared with a simple hydrothermal method after preheating. We then filled the PFR shell with a layer of Au by heating and modified the shell with polyelectrolyte to change its surface charge state. To capture tumor cells actively, FA molecules were attached onto the surface of the Ag@Au@PFR particles in the presence of 1-ethyl-3-(3-dimethly aminopropyl) carbodiimide (EDAC) and N-hydroxysuccinimide (NHS). Owing to the excellent property of Au NPs and Ag NPs as photothermal conversion agents, the Ag@Au@ PFR@FA particles can be utilized to kill tumor cells when exposed to NIR light.

  11. Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli.

    PubMed

    Howard, Thomas P; Middelhaufe, Sabine; Moore, Karen; Edner, Christoph; Kolak, Dagmara M; Taylor, George N; Parker, David A; Lee, Rob; Smirnoff, Nicholas; Aves, Stephen J; Love, John

    2013-05-07

    Biofuels are the most immediate, practical solution for mitigating dependence on fossil hydrocarbons, but current biofuels (alcohols and biodiesels) require significant downstream processing and are not fully compatible with modern, mass-market internal combustion engines. Rather, the ideal biofuels are structurally and chemically identical to the fossil fuels they seek to replace (i.e., aliphatic n- and iso-alkanes and -alkenes of various chain lengths). Here we report on production of such petroleum-replica hydrocarbons in Escherichia coli. The activity of the fatty acid (FA) reductase complex from Photorhabdus luminescens was coupled with aldehyde decarbonylase from Nostoc punctiforme to use free FAs as substrates for alkane biosynthesis. This combination of genes enabled rational alterations to hydrocarbon chain length (Cn) and the production of branched alkanes through upstream genetic and exogenous manipulations of the FA pool. Genetic components for targeted manipulation of the FA pool included expression of a thioesterase from Cinnamomum camphora (camphor) to alter alkane Cn and expression of the branched-chain α-keto acid dehydrogenase complex and β-keto acyl-acyl carrier protein synthase III from Bacillus subtilis to synthesize branched (iso-) alkanes. Rather than simply reconstituting existing metabolic routes to alkane production found in nature, these results demonstrate the ability to design and implement artificial molecular pathways for the production of renewable, industrially relevant fuel molecules.

  12. Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli

    PubMed Central

    Howard, Thomas P.; Middelhaufe, Sabine; Moore, Karen; Edner, Christoph; Kolak, Dagmara M.; Taylor, George N.; Parker, David A.; Lee, Rob; Smirnoff, Nicholas; Aves, Stephen J.; Love, John

    2013-01-01

    Biofuels are the most immediate, practical solution for mitigating dependence on fossil hydrocarbons, but current biofuels (alcohols and biodiesels) require significant downstream processing and are not fully compatible with modern, mass-market internal combustion engines. Rather, the ideal biofuels are structurally and chemically identical to the fossil fuels they seek to replace (i.e., aliphatic n- and iso-alkanes and -alkenes of various chain lengths). Here we report on production of such petroleum-replica hydrocarbons in Escherichia coli. The activity of the fatty acid (FA) reductase complex from Photorhabdus luminescens was coupled with aldehyde decarbonylase from Nostoc punctiforme to use free FAs as substrates for alkane biosynthesis. This combination of genes enabled rational alterations to hydrocarbon chain length (Cn) and the production of branched alkanes through upstream genetic and exogenous manipulations of the FA pool. Genetic components for targeted manipulation of the FA pool included expression of a thioesterase from Cinnamomum camphora (camphor) to alter alkane Cn and expression of the branched-chain α-keto acid dehydrogenase complex and β-keto acyl-acyl carrier protein synthase III from Bacillus subtilis to synthesize branched (iso-) alkanes. Rather than simply reconstituting existing metabolic routes to alkane production found in nature, these results demonstrate the ability to design and implement artificial molecular pathways for the production of renewable, industrially relevant fuel molecules. PMID:23610415

  13. Metabolism of oleic acid in differentiating BFC-1 preadipose cells.

    PubMed

    Abumrad, N A; Forest, C; Regen, D M; Barnella, U S; Melki, S A

    1991-07-01

    Incorporation of [3H]oleate and [14C]glucose into cellular lipids was studied in the preadipose cell line BFC-1 to determine flux changes that accompany the adipose conversion process. Dilution of oleate by intracellular fatty acids (FA) was estimated from the 3H/14C incorporation ratios and from relating steady-state radioactivity in diglycerides to their measured cellular levels. The data indicated that exogenous FA mixed with less than 1% of endogenous FA on its pathway to esterification. Conversion of preadipocytes to adipocytes increased uptake of FA and glucose by approximately 3-fold and synthesis of diglycerides and triglycerides by 5- and 16-fold, respectively, with little if any increase of phospholipid synthesis. A 50% drop in 3H/14C incorporation ratio indicated a doubling of the rate at which endogenous FA mixed with the exogenous FA that had entered the cell. Adipocytes compared with preadipocytes exhibited a 50% greater cell diameter and a doubling of intracellular water volume and of protein and phospholipid levels, reflecting cellular enlargement consequent to the arrest of cell division that precedes adipose conversion. Diglyceride levels were also increased in adipocytes, however, since their turnover was fast, as indicated by rapid equilibration of diglyceride labeling; the increase reflected changes in their relative rates of synthesis and disposal. Diglyceride levels related to cell phospholipid, and other indexes of cell size remained constant. This indicated that the supply of diglycerides was tightly coupled to the synthesis of triglycerides and phospholipids, which suggested feedback regulation of diglyceride formation. The studies provide a methodological approach to measurement and interpretation of rates of lipid deposition in cultured cells.

  14. Effects of omega-3 fatty acids on orexigenic and anorexigenic modulators at the onset of anorexia.

    PubMed

    Ramos, Eduardo J B; Romanova, Irina V; Suzuki, Susumu; Chen, Chung; Ugrumov, Michael V; Sato, Tomoi; Goncalves, Carolina G; Meguid, Michael M

    2005-06-07

    In cancer anorexia, a decrease in food intake (FI) occurs concomitant with changes in orexigenic peptides such as neuropeptide Y (NPY) and anorexigenic peptides such as alpha-melanocyte-stimulating hormone (alpha-MSH) and anorexigenic neurotransmitter serotonin. omega-3 Fatty acid (omega-3FA) inhibits cytokine synthesis, and delays tumor appearance, tumor growth, and onset of anorexia in tumor-bearing rats. We hypothesize that, in cancer anorexia, omega-3FA is associated with quantitative reversal of hypothalamic NPY, alpha-MSH, and serotonin receptor (5-HT(1B)-receptor) enhancing FI. Fischer rats were divided into: MCA tumor bearing fed chow (TB-Chow) or omega-3FA diet (TB-omega-3FA) and controls: non-tumor bearing fed chow (NTB-Chow) or omega-3FA diet (NTB-omega-3FA). Rats were euthanized at anorexia and brains were removed for hypothalamic immunohistochemical study, using NPY, alpha-MSH, and 5-HT(1B)-receptor-specific antibodies and slides assessed by image analysis. Immunostaining specificity was controlled by omission of primary or secondary antibodies and pre-absorption test. At anorexia, FI decreased (P < 0.05) in TB-Chow but did not change in TB-omega-3FA rats. In TB-omega-3FA vs. TB-Chow, NPY immunoreactivity increased 38% in arcuate nucleus (ARC; P < 0.05), and 50% in magnocellular paraventricular nucleus (mPVN; P < 0.05). alpha-MSH decreased 64% in ARC and 29% in mPVN (P < 0.05). 5-HT(1B)-receptor immunoreactivity decreased 13% only in supraoptic nucleus (P < 0.05). No immunoreactivity was found in the control sections. omega-3FA modified hypothalamic peptides and 5-HT-(1B)-receptor immunoreactivity at anorexia, concomitant with an increase in FI, were probably mediated by omega-3FA inhibition of tumor-induced cytokines.

  15. Synthesis and biological activity of alkynoic acids derivatives against mycobacteria

    PubMed Central

    Vilchèze, Catherine; Leung, Lawrence W.; Bittman, Robert; Jacobs, William R.

    2015-01-01

    2-alkynoic acids have bactericidal activity against Mycobacterium smegmatis but their activity fall sharply as the length of the carbon chain increased. In this study, derivatives of 2- alkynoic acids were synthesized and tested against fast- and slow-growing mycobacteria. Their activity was first evaluated in M. smegmatis against their parental 2-alkynoic acids, as well as isoniazid, a first-line antituberculosis drug. The introduction of additional unsaturation or heteroatoms into the carbon chain enhanced the antimycobacterial activity of longer chain alkynoic acids (more than 19 carbons long). In contrast, although the modification of the carboxylic group did not improve the antimycobacterial activity, it significantly reduced the toxicity of the compounds against eukaryotic cells. Importantly, 4-(alkylthio)but-2-ynoic acids, had better bactericidal activity than the parental 2-alkynoic acids and on a par with isoniazid against the slow-grower Mycobacterium bovis BCG. These compounds had also low toxicity against eukaryotic cells, suggesting that they could be potential therapeutic agents against other types of topical mycobacterial infections causing skin diseases including Mycobacterium abscessus, Mycobacterium ulcerans, and Mycobacterium leprae. Moreover, they provide a possible scaffold for future drug development. PMID:26256431

  16. Bioengineering of bacterial polymer inclusions catalyzing the synthesis of N-acetylneuraminic acid.

    PubMed

    Hooks, David O; Blatchford, Paul A; Rehm, Bernd H A

    2013-05-01

    N-Acetylneuraminic acid is produced by alkaline epimerization of N-acetylglucosamine to N-acetylmannosamine and then subsequent condensation with pyruvate catalyzed by free N-acetylneuraminic acid aldolase. The high-alkaline conditions of this process result in the degradation of reactants and products, while the purification of free enzymes to be used for the synthesis reaction is a costly process. The use of N-acetylglucosamine 2-epimerase has been seen as an alternative to the alkaline epimerization process. In this study, these two enzymes involved in N-acetylneuraminic acid production were immobilized to biopolyester beads in vivo in a one-step, cost-efficient process of production and isolation. Beads with epimerase-only, aldolase-only, and combined epimerase/aldolase activity were recombinantly produced in Escherichia coli. The enzymatic activities were 32 U, 590 U, and 2.2 U/420 U per gram dry bead weight, respectively. Individual beads could convert 18% and 77% of initial GlcNAc and ManNAc, respectively, at high substrate concentrations and near-neutral pH, demonstrating the application of this biobead technology to fine-chemical synthesis. Beads establishing the entire N-acetylneuraminic acid synthesis pathway were able to convert up to 22% of the initial N-acetylglucosamine after a 50-h reaction time into N-acetylneuraminic acid.

  17. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases.

  18. Synthesis and Bioactivity of (R)-Ricinoleic Acid Derivatives: A Review.

    PubMed

    Pabiś, Sylwia; Kula, Józef

    2016-01-01

    (R)-Ricinoleic acid (RA) [(12R,9Z)-hydroxyoctadecenoic acid], the main compound of castor seed oil, because of its unusual structure readily undergoes multi-directional chemical and biochemical transformations to produce derivatives with the retained carbon skeleton or with its degradation. Many of these are of high biological activity, as documented by an in vitro study, and possess therapeutic potential. This review article provides an overview of the recent developments in the area of synthesis of RA based compounds with anticancer and antimicrobial activities. Moreover, the antiinflammatory and analgesic properties of some ricinoleic acid derivatives are also highlighted.

  19. Gibberellic Acid-Induced Synthesis of Protease by Isolated Aleurone Layers of Barley 1

    PubMed Central

    Jacobsen, John V.; Varner, J. E.

    1967-01-01

    The production of protease by isolated aleurone layers of barley in response to gibberellic acid has been examined. The protease arises in the aleurone layer and is mostly released from the aleurone cells. The courses of release of amylase and protease from aleurone layers, the dose responses to gibberellic acid and the effects of inhibitors on the production of both enzymes are parallel. As is the case for amylase, protease is made de novo in response to the hormone. These data give some credence to the hypothesis that the effect of gibberellic acid is to promote the simultaneous synthesis and secretion of a group of hydrolases. PMID:16656695

  20. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  1. Double-helical nucleic acids with cross-linked strands: synthesis and applications in molecular biology

    NASA Astrophysics Data System (ADS)

    Antsypovitch, Sergei I.; Oretskaya, Tat'yana S.

    1998-03-01

    Data on the methods employed for cross-linking of DNA strands and for the synthesis of oligonucleotide duplexes with cross-links between strands are summarised. Existing methods are systematised; their advantages and drawbacks are discussed. The examples of applications of DNA duplexes with covalently cross-linked chains for the study of protein-nucleic acid recognition and mechanisms of action of nucleic acid-binding proteins for gaining information about the spatial structure of nucleic acids, and for the solution of other problems of molecular biology are given. The bibliography includes 131 references.

  2. Recent advances in the synthesis and application of fluorescent α-amino acids.

    PubMed

    Harkiss, Alexander H; Sutherland, Andrew

    2016-09-26

    Fluorescence spectroscopy has become a powerful technique for probing a range of complex biological processes including enzyme mechanisms and protein-protein interactions. While the application of this technique uses a number of strategies, many of these rely on the use of fluorescent α-amino acids. This review highlights the recent synthetic methods developed for the incorporation of highly conjugated chromophores into the side-chain of α-amino acids and the application of these compounds as probes for imaging in medicine and biology. In particular, the design and synthesis of α-amino acids bearing coumarin, flavone and polyaromatic derived chromophores is described.

  3. Enzymatic Synthesis of Nucleic Acids with Defined Regioisomeric 2'-5' Linkages.

    PubMed

    Cozens, Christopher; Mutschler, Hannes; Nelson, Geoffrey M; Houlihan, Gillian; Taylor, Alexander I; Holliger, Philipp

    2015-12-14

    Information-bearing nucleic acids display universal 3'-5' linkages, but regioisomeric 2'-5' linkages occur sporadically in non-enzymatic RNA synthesis and may have aided prebiotic RNA replication. Herein we report on the enzymatic synthesis of both DNA and RNA with site-specific 2'-5' linkages by an engineered polymerase using 3'-deoxy- or 3'-O-methyl-NTPs as substrates. We also report the reverse transcription of the resulting modified nucleic acids back to 3'-5' linked DNA with good fidelity. This enables a fast and simple method for "structural mutagenesis" by the position-selective incorporation of 2'-5' linkages, whereby nucleic acid structure and function may be probed through local distortion by regioisomeric linkages while maintaining the wild-type base sequence as we demonstrate for the 10-23 RNA endonuclease DNAzyme.

  4. Enantiomeric deoxycholic acid: total synthesis, characterization, and preliminary toxicity toward colon cancer cell lines.

    PubMed

    Katona, Bryson W; Rath, Nigam P; Anant, Shrikant; Stenson, William F; Covey, Douglas F

    2007-11-23

    Deoxycholic acid (DCA) is an endogenous secondary bile acid implicated in numerous pathological conditions including colon cancer formation and progression and cholestatic liver disease. DCA involvement in these disease processes results partly from its ability to modulate signaling cascades within the cell, presumably through both direct receptor activation and general detergent mediated membrane changes. To further explore DCA induced changes in cell signaling, we completed a total synthesis of enantiomeric deoxycholic acid (ent-DCA) from achiral 2-methyl-1,3-cyclopentanedione. Using a modified method of the synthesis of ent-testosterone that proceeds through the (R)-(-)-Hajos-Parrish ketone, we have completed the successful synthesis of ent-DCA in 25 steps with a yield of 0.3% with all stereochemical assignments of the product confirmed by X-ray crystallography. Our studies toward this synthesis also uncovered the methodology for the development of a novel A,B-cis steroidal skeleton system containing a C3-C9 single bond as well as conditions to selectively ketalize the typically less reactive 12-carbonyl in poly-keto A,B-cis androgens. The critical micelle concentration (cmc) of ent-DCA, determined by a dye solubilization method, was identical to the cmc of natural DCA. Toxicity studies toward HT-29 and HCT-116 human colon cancer cell lines demonstrated that ent-DCA had similar effects on proliferation, yet showed a markedly decreased ability to induce apoptosis as compared to natural DCA.

  5. The promoting effects of geniposidic acid and aucubin in Eucommia ulmoides Oliver leaves on collagen synthesis.

    PubMed

    Li, Y; Sato, T; Metori, K; Koike, K; Che, Q M; Takahashi, S

    1998-12-01

    We have reported that collagen synthesis was stimulated by the administration of a hot water extract from the leaves of Eucommia ulmoides OLIVER, Eucommiaceae (Du-Zhong leaves) in false aged model rats. In this paper, we set out to examine the compounds in Du-Zhong leaves that stimulated collagen synthesis in false aged model rats. In experiment 1, a methanol extract of Du-Zhong leaves also stimulated collagen synthesis in aged model rats. An acetone fraction was derived from the methanol extract by silica gel chromatography in experiment 2. The acetone fraction mainly contained iridoides mono-glycosides such as geniposidic acid and aucubin. The administration of geniposidic acid or aucubin stimulated collagen synthesis in aged model rats in experiments 3 and 4 (significance (p<0.05)). The reported pharmacological effects of Du-Zhong leaves, including healing organs and strengthening bone and muscle, are closely related to collagen metabolism. It appears that geniposidic acid and aucubin are the actual compounds in Du-Zhong which caused the effect in our experiments.

  6. Five Decades with Polyunsaturated Fatty Acids: Chemical Synthesis, Enzymatic Formation, Lipid Peroxidation and Its Biological Effects

    PubMed Central

    Catalá, Angel

    2013-01-01

    I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074

  7. One-Pot synthesis of phosphorylated mesoporous carbon heterogeneous catalysts with tailored surface acidity

    SciTech Connect

    Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T; Bauer, Christopher; Wang, Xiqing; Veith, Gabriel M; Dai, Sheng

    2012-01-01

    Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contents were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.

  8. Novel chemical synthesis of ginkgolic acid (13:0) and evaluation of its tyrosinase inhibitory activity.

    PubMed

    Fu, Yuanqing; Hong, Shan; Li, Duo; Liu, Songbai

    2013-06-05

    A novel efficient synthesis of ginkgolic acid (13:0) from abundant 2,6-dihydroxybenzoic acid was successfully developed through a state-of-the-art palladium-catalyzed cross-coupling reaction and catalytic hydrogenation with an overall yield of 34% in five steps. The identity of the synthesized ginkgolic acid (13:0) was confirmed by nuclear magnetic resonance, mass spectrometry, infrared, and high-performance liquid chromatography. The reaction sequence of this method can be readily extended to the synthesis of other ginkgolic acids. The synthesized ginkgolic acid (13:0) exhibited promising anti-tyrosinase activity (IC₅₀ = 2.8 mg/mL) that was not correlated to antioxidant activity as probed by 1,1-diphenyl-2-picrylhydrazyl, 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), ferric reducing ability of plasma, and oxygen radical absorbance capacity assays. The synthetic strategy developed in this work will significantly facilitate biological studies of ginkgolic acids that have great potential applications in food and pharmaceuticals.

  9. Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

    NASA Technical Reports Server (NTRS)

    Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

    2011-01-01

    Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

  10. Fatty acid composition of muscle fat and enzymes of storage lipid synthesis in whole muscle from beef cattle.

    PubMed

    Kazala, E Chris; Lozeman, Fred J; Mir, Priya S; Aalhus, Jennifer L; Schmutz, Sheila M; Weselake, Randall J

    2006-11-01

    Enhanced intramuscular fat content (i.e., marbling) in beef is a desirable trait, which can result in increased product value. This study was undertaken with the aim of revealing biochemical factors associated with the marbling trait in beef cattle. Samples of longissimus lumborum (LL) and pars costalis diaphragmatis (PCD) were taken from a group of intact crossbred males and females at slaughter, lipids extracted, and the resulting FAME examined for relationships with marbling fat deposition. For LL, significant associations were found between degree of marbling and myristic (14:0, r = 0.55, P < 0.01), palmitic (16:0, r = 0.80, P < 0.001), stearic (18:0, r = -0.58, P < 0.01), and oleic (18:1c-9, r = 0.79, P < 0.001) acids. For PCD, significant relationships were found between marbling and palmitic (r = 0.71, P < 0.001) and oleic (r = 0.74, P < 0.001) acids. Microsomal fractions prepared from PCD muscle were assayed for diacylglycerol acyltransferase (DGAT), lysophosphatidic acid acyltransferase (LPAAT), and phosphatidic acid phosphatase-1 (PAP-1) activity, and the results examined for relationships with degree of intramuscular fat deposition. None of the enzyme activities from PCD displayed an association with marbling fat content, but DGAT specific activity showed significant positive associations with LPAAT (r = 0.54, P < 0.01), total PAP (r = 0.66, P < 0.001), and PAP-1 (r = 0.63, P < 0.01) specific activities. The results on FA compositions of whole muscle tissues provide insight into possible enzyme action associated with the production of specific FA. The increased proportion of oleic acid associated with enhanced lipid content of whole muscle is noteworthy given the known health benefits of this FA.

  11. Synthesis of asymmetric tetracarboxylic acids and corresponding dianhydrides

    NASA Technical Reports Server (NTRS)

    Chuang, Chun-Hua (Inventor)

    2008-01-01

    This invention relates to processes for preparing asymmetrical biphenyl tetracarboxylic acids and the corresponding asymmetrical dianhydrides, namely 2,3,3',4'-biphenyl dianhydride (a-BPDA), 2,3,3',4'-benzophenone dianhydride (a-BTDA) and 3,4'-methylenediphthalic anhydride (-MDPA). By cross-coupling reactions of reactive metal substituted o-xylenes or by cross-coupling o-xylene derivatives in the presence of catalysts, this invention specifically produces asymmetrical biphenyl intermediates that are subsequently oxidized or hydrolyzed and oxidized to provide asymmetric biphenyl tetracarboxylic acids in comparatively high yields. These asymmetrical biphenyl tetracarboxylic acids are subsequently converted to the corresponding asymmetrical dianhydrides without contamination by symmetrical biphenyl dianhydrides.

  12. The use of supported acidic ionic liquids in organic synthesis.

    PubMed

    Skoda-Földes, Rita

    2014-06-26

    Catalysts obtained by the immobilisation of acidic ionic liquids (ILs) on solid supports offer several advantages compared to the use of catalytically active ILs themselves. Immobilisation may result in an increase in the number of accessible active sites of the catalyst and a reduction of the amount of the IL required. The ionic liquid films on the carrier surfaces provide a homogeneous environment for catalytic reactions but the catalyst appears macroscopically as a dry solid, so it can simply be separated from the reaction mixture. As another advantage, it can easily be applied in a continuous fixed bed reactor. In the present review the main synthetic strategies towards the preparation of supported Lewis acidic and Brønsted acidic ILs are summarised. The most important characterisation methods and structural features of the supported ionic liquids are presented. Their efficiency in catalytic reactions is discussed with special emphasis on their recyclability.

  13. Remarkable features of ovarian morphology and reproductive hormones in insulin-resistant Zucker fatty (fa/fa) rats

    PubMed Central

    2010-01-01

    Background Zucker fatty (fa/fa) rats are a well-understood model of obesity and hyperinsulinemia. It is now thought that obesity/hyperinsulinemia is an important cause of endocrinological abnormality, but to date there have been no reports on the changes in ovarian morphology or the ovarian androgen profile in rat models of obesity and insulin resistance. Methods In this study we investigated the effects of obesity and hyperinsulinemia on ovarian morphology and the hormone profile in insulin-resistant Zucker fatty rats (5, 8, 12 and 16 weeks of age, n = 6-7). Results Ovaries from 5-week-old fatty rats had significantly greater total and atretic follicle numbers, and higher atretic-to-total follicle ratios than those from lean rats. Ovaries from 12- and 16-week-old fatty rats showed interstitial cell hyperplasia and numerous cysts with features of advanced follicular atresia. In addition, serum testosterone and androstenedione levels significantly declined in fatty rats from age 8 to 16 weeks, so that fatty rats showed significantly lower levels of serum testosterone (12 and 16 weeks) and androstenedione (all weeks) than lean rats. This may reflect a reduction of androgen synthesis during follicular atresia. Serum adiponectin levels were high in immature fatty rats, and although the levels declined significantly as they matured, it remained significantly higher in fatty rats than in lean rats. On the other hand, levels of ovarian adiponectin and its receptors were significantly lower in mature fatty rats than in lean mature rats or immature fatty rats. Conclusions Our findings indicate that ovarian morphology and hormone profiles are significantly altered by the continuous insulin resistance in Zucker fatty rats. Simultaneously, abrupt reductions in serum and ovarian adiponectin also likely contribute to the infertility seen in fatty rats. PMID:20576113

  14. Survival, Deoxyribonucleic Acid Breakdown, and Synthesis in Salmonella typhimurium as Compared with Escherichia coli B Strains

    PubMed Central

    Hudnik-Plevnik, Tamara A.; Djordjević, Nadežda

    1970-01-01

    Salmonella typhimurium LT-2 was compared with radioresistant (B/r) and radiosensitive (Bs−2) strains of Escherichia coli in respect to the survival, deoxyribonucleic acid (DNA) breakdown, and DNA synthesis after X irradiation. It is shown that S. typhimurium LT-2 is about four times more sensitive than E. coli B/r but less sensitive than Bs−2. The DNA breakdown is in S. typhimurium LT-2 lower than the postirradiation breakdown of DNA in both E. coli strains and DNA synthesis proceeds in this bacterium in spite of a much lower survival, as in the radioresistant E. coli B/r. PMID:4916313

  15. Convenient and Scalable Synthesis of Fmoc-Protected Peptide Nucleic Acid Backbone

    PubMed Central

    Feagin, Trevor A.; Shah, Nirmal I.; Heemstra, Jennifer M.

    2012-01-01

    The peptide nucleic acid backbone Fmoc-AEG-OBn has been synthesized via a scalable and cost-effective route. Ethylenediamine is mono-Boc protected, then alkylated with benzyl bromoacetate. The Boc group is removed and replaced with an Fmoc group. The synthesis was performed starting with 50 g of Boc anhydride to give 31 g of product in 32% overall yield. The Fmoc-protected PNA backbone is a key intermediate in the synthesis of nucleobase-modified PNA monomers. Thus, improved access to this molecule is anticipated to facilitate future investigations into the chemical properties and applications of nucleobase-modified PNA. PMID:22848796

  16. Folic acid bio-inspired route for facile synthesis of AuPt nanodendrites as enhanced electrocatalysts for methanol and ethanol oxidation reactions

    NASA Astrophysics Data System (ADS)

    Wang, Ai-Jun; Ju, Ke-Jian; Zhang, Qian-Li; Song, Pei; Wei, Jie; Feng, Jiu-Ju

    2016-09-01

    Folic acid (FA), as an important biomolecule in cell division and growth, is firstly employed as the structure director and stabilizing agent for controlled synthesis of uniform Au65Pt35 nanodendrites (NDs) by a one-pot wet-chemical bio-inspired route at room temperature. No pre-seed, template, organic solvent, polymer, surfactant or complex instrument is involved. The products are mainly characterized by transmission electron microscopy (TEM), high angle annular dark-field scanning transmission electron microscopy (HAADF-STEM), X-ray diffraction (XRD), and X-Ray photoelectron spectroscopy (XPS). The architectures have enlarged electrochemically active surface area (60.6 m2 gPt-1), enhanced catalytic activity and durability for methanol and ethanol oxidation in contrast with commercial Pt black and the other AuPt alloys by tuning the molar ratios of Au to Pt (e.g., Au31Pt69 and Au82Pt18 nanoparticles). This strategy would be applied to fabricate other bimetallic nanocatalysts in fuel cells.

  17. Hydrothermal synthesis of hollow silica spheres under acidic conditions.

    PubMed

    Yu, Qiyu; Wang, Pengpeng; Hu, Shi; Hui, Junfeng; Zhuang, Jing; Wang, Xun

    2011-06-07

    It is well-known that silica can be etched in alkaline media or in a unique hydrofluoric acid (HF) solution, which is widely used to prepare various kinds of hollow nanostructures (including silica hollow structures) via silica-templating methods. In our experiments, we found that stöber silica spheres could be etched in generic acidic media in a well-controlled way under hydrothermal conditions, forming well-defined hollow/rattle-type silica spheres. Furthermore, some salts such as NaCl and Na(2)SO(4) were found to be favorable for the formation of hollow/rattle-type silica spheres.

  18. Recent Advances in Substrate-Controlled Asymmetric Induction Derived from Chiral Pool α-Amino Acids for Natural Product Synthesis.

    PubMed

    Paek, Seung-Mann; Jeong, Myeonggyo; Jo, Jeyun; Heo, Yu Mi; Han, Young Taek; Yun, Hwayoung

    2016-07-21

    Chiral pool α-amino acids have been used as powerful tools for the total synthesis of structurally diverse natural products. Some common naturally occurring α-amino acids are readily available in both enantiomerically pure forms. The applications of the chiral pool in asymmetric synthesis can be categorized prudently as chiral sources, devices, and inducers. This review specifically examines recent advances in substrate-controlled asymmetric reactions induced by the chirality of α-amino acid templates in natural product synthesis research and related areas.

  19. The Synthesis and Evaluation of Arctigenin Amino Acid Ester Derivatives.

    PubMed

    Cai, En-Bo; Yang, Li-Min; Jia, Cai-Xia; Zhang, Wei-Yuan; Zhao, Yan; Li, Wei; Song, Xing-Zhuo; Zheng, Man-Ling

    2016-10-01

    The use of arctigenin (ARG), a traditional medicine with many pharmacological activities, has been restricted due to its poor solubility in water. Five amino acid derivatives of ARG have been synthesized using glycine, o-alanine, valine, leucine, and isoleucine, which have t-butyloxy carbonyl (BOC) as a protective group. In this study, we examined the effects of removing these protective groups. The results showed that the amino acid derivatives have better solubility and nitrite-clearing ability than ARG. Among the compounds tested, the amino acid derivatives without protective group were the best. Based on these results, ARG and its two amino acid derivatives without protective group (ARG8, ARG10) were selected to evaluate their anti-tumor activity in vivo at a dosage of 40 mg/kg. The results indicated that ARG8 and ARG10 both exhibit more anti-tumor activity than ARG in H22 tumor-bearing mice. The tumor inhibition rates of ARG8 and ARG10 were 69.27 and 43.58%, which was much higher than ARG. Furthermore, the mice treated with these compounds exhibited less damage to the liver, kidney and immune organs compared with the positive group. Furthermore, ARG8 and ARG10 improved the serum cytokine levels significantly compared to ARG. In brief, this study provides a method to improve the water solubility of drugs, and we also provide a reference basis for new drug development.

  20. Synthesis and physical properties of isostearic acids and their esters

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Saturated branched-chain fatty acids (sbc-FAs) are found as minor constituents in several natural fats and oils. Sbc-FAs are of interest since they have lower melting points than their linear counterparts and exhibit good oxidative stability; properties that make them ideally suited in a number of ...

  1. Synthesis of 9-oxononanoic acid, a precursor for biopolymers.

    PubMed

    Otte, Konrad B; Kirtz, Marko; Nestl, Bettina M; Hauer, Bernhard

    2013-11-01

    Polymers based on renewable resources have become increasingly important. The natural functionalization of fats and oils enables an easy access to interesting monomeric building blocks, which in turn transform the derivative biopolymers into high-performance materials. Unfortunately, interesting building blocks of medium-chain length are difficult to obtain by traditional chemical means. Herein, a biotechnological pathway is established that could provide an environmentally suitable and sustainable alternative. A multiple enzyme two-step one-pot process efficiently catalyzed by a coupled 9S-lipoxygenase (St-LOX1, Solanum tuberosum) and 9/13-hydroperoxide lyase (Cm-9/13HPL, Cucumis melo) cascade reaction is proposed as a potential route for the conversion of linoleic acid into 9-oxononanoic acid, which is a precursor for biopolymers. Lipoxygenase catalyzes the insertion of oxygen into linoleic acid through a radical mechanism to give 9S-hydroperoxy-octadecadienoic acid (9S-HPODE) as a cascade intermediate, which is subsequently cleaved by the action of Cm-9/13HPL. This one-pot process afforded a yield of 73 % combined with high selectivity. The best reaction performance was achieved when lipoxygenase and hydroperoxide lyase were applied in a successive rather than a simultaneous manner. Green leaf volatiles, which are desired flavor and fragrance products, are formed as by-products in this reaction cascade. Furthermore, we have investigated the enantioselectivity of 9/13-HPLs, which exhibited a strong preference for 9S-HPODE over 9R-HPODE.

  2. Synthesis of copper sulphide nanoparticles in carboxylic acids as solvent.

    PubMed

    Armelao, Lidia; Camozzo, Daniele; Gross, Silvia; Tondello, Eugenio

    2006-02-01

    A novel method for the preparation of CuS nanoparticles based on the fast nucleation of the sulphide has been developed. The particles have been synthesized by reaction of thioacetic acid with water and copper carboxylates (acetate, propionate) in the corresponding carboxylic acid (acetic, propionic) as a solvent. The use of carboxylic acids presents several advantages: (i) the hydrolysis of the C-S bond is favoured thus producing a fast CuS supersaturation and a high nucleation rate; (ii) the mobility of the precursor molecules is limited so that nucleation events are favoured with respect to particle growth; (iii) the low dielectric constant of the medium stabilises the nanoparticles dispersion by reducing the critical coagulation concentration. The prepared nanoparticles were investigated by UV-Vis spectroscopy, X-ray photoelectron spectroscopy, atomic force microscopy and dynamic light scattering. The nanoparticle suspensions are clear and characterized by a blue-shifted adsorption edge with respect to bulk CuS. Light scattering measurements performed on acetic acid suspensions evidence the formation of monodispersed nanoparticles with an average diameter of about 5 nm.

  3. First Synthesis of 1,4-Dimethoxy-2-Naphthoxyacetic acid.

    PubMed

    Chinea, Kimberly; Banerjee, Ajoy K

    2015-07-01

    2-Acetyl-1-hydroxynaphthalene was converted into 1,4-dimethoxy-2-naphthoxyacetic acid in seven steps (methylation, Bayer-Villiger oxidation, hydrolysis, bromination, methylation, alkylation and hydrolysis). 2-Hydroxy-1,4-naphthoquinone on acetylation, aromatization, methylation and hydrolysis, respectively, also yielded the title compound.

  4. Evolutionary distinctiveness of fatty acid and polyketide synthesis in eukaryotes

    PubMed Central

    Kohli, Gurjeet S; John, Uwe; Van Dolah, Frances M; Murray, Shauna A

    2016-01-01

    Fatty acids, which are essential cell membrane constituents and fuel storage molecules, are thought to share a common evolutionary origin with polyketide toxins in eukaryotes. While fatty acids are primary metabolic products, polyketide toxins are secondary metabolites that are involved in ecologically relevant processes, such as chemical defence, and produce the adverse effects of harmful algal blooms. Selection pressures on such compounds may be different, resulting in differing evolutionary histories. Surprisingly, some studies of dinoflagellates have suggested that the same enzymes may catalyse these processes. Here we show the presence and evolutionary distinctiveness of genes encoding six key enzymes essential for fatty acid production in 13 eukaryotic lineages for which no previous sequence data were available (alveolates: dinoflagellates, Vitrella, Chromera; stramenopiles: bolidophytes, chrysophytes, pelagophytes, raphidophytes, dictyochophytes, pinguiophytes, xanthophytes; Rhizaria: chlorarachniophytes, haplosporida; euglenids) and 8 other lineages (apicomplexans, bacillariophytes, synurophytes, cryptophytes, haptophytes, chlorophyceans, prasinophytes, trebouxiophytes). The phylogeny of fatty acid synthase genes reflects the evolutionary history of the organism, indicating selection to maintain conserved functionality. In contrast, polyketide synthase gene families are highly expanded in dinoflagellates and haptophytes, suggesting relaxed constraints in their evolutionary history, while completely absent from some protist lineages. This demonstrates a vast potential for the production of bioactive polyketide compounds in some lineages of microbial eukaryotes, indicating that the evolution of these compounds may have played an important role in their ecological success. PMID:26784357

  5. An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

    PubMed

    Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

    2014-05-20

    Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies.

  6. Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2

    PubMed Central

    Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing

    2016-01-01

    Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850

  7. Synthesis and Biological Evaluation of Novel Phosphatidylcholine Analogues Containing Monoterpene Acids as Potent Antiproliferative Agents

    PubMed Central

    Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna

    2016-01-01

    The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666

  8. Progressive familial intrahepatic cholestasis and inborn errors of bile acid synthesis.

    PubMed

    Jankowska, Irena; Socha, Piotr

    2012-06-01

    Progressive familial intrahepatic cholestasis (PFIC), types 1, 2 and 3, are due to defects in genes involved in bile secretion (FIC1, BSEP, MDR3). PFIC and inborn errors of bile acid synthesis (IEBAS) often present in infancy with cholestasis. The distinctive feature of PFIC 1 and 2 and IEBAS is a normal level of GGT, while IEBAS are suspected in patients with low plasma bile acids concentration. Molecular testing, urinary bile acid analysis (IEBAS), liver biopsy and immuno-staining are used for the diagnosis. Some patients with PFIC can be successfully treated with ursodeoxycholic acid or partial external biliary diversion. IEBAS is treated with cholic acid. Liver transplantation is required for cirrhosis with liver failure. Hepatocarcinoma has been reported in PFIC2.

  9. Synthesis of medronic acid monoesters and their purification by high-performance countercurrent chromatography or by hydroxyapatite

    PubMed Central

    Vepsäläinen, Jouko; Turhanen, Petri A

    2016-01-01

    Summary We achieved the synthesis of important medronic acid monoalkyl esters via the dealkylation of mixed trimethyl monoalkyl esters of medronic acid. Two methods were developed for the purification of medronic acid monoesters: 1) small scale (10–20 mg) purification by using hydroxyapatite and 2) large scale (tested up to 140 mg) purification by high-performance countercurrent chromatography (HPCCC). PMID:27829921

  10. Fmoc/Trt-amino acids: comparison to Fmoc/tBu-amino acids in peptide synthesis.

    PubMed

    Barlos, K; Gatos, D; Koutsogianni, S

    1998-03-01

    Model peptides containing the nucleophilic amino acids Trp and Met have been synthesized with the application of Fmoc/Trt- and Fmoc/tBu-amino acids, for comparison. The deprotection of the peptides synthesized using Fmoc/Trt-amino acids in all cases leads to crude peptides of higher purity than that of the same peptides synthesized using Fmoc/tBu-amino acids.

  11. Developmental aspects and factors influencing the synthesis and status of ascorbic Acid in the pig.

    PubMed

    Mahan, D C; Ching, S; Dabrowski, K

    2004-01-01

    Ascorbic acid synthesis in the pig occurs at mid-pregnancy, but activity of the enzyme l-gulono-gamma-lactone oxidase (GLO) declines thereafter during gestation and remains low when the pig nurses the sow. During late gestation the ascorbic acid concentration in the fetus increases, but serum and liver ascorbic acid concentration in the sow declines without affecting the dam's liver GLO activity. It is presumed that as gestation progresses an increased amount of maternal ascorbic acid is transferred to the fetus and to the mammary gland. Colostrum and milk are rich sources of the vitamin and supply the nursing pig with ascorbic acid. The available data suggest that high amounts of ascorbic acid appear to suppress liver GLO activity in the pig. Upon weaning, when exogenous vitamin C is generally not provided, liver GLO activity and serum ascorbic acid increases. During the initial periods postweaning, some reports have indicated growth benefits of supplemental vitamin C. Body tissues differ in their concentrations of ascorbic acid, but tissues of high metabolic need generally have greater concentrations. The corpus luteum in the female, the testis in the male, and the adrenal glands in all pigs contain greater concentrations of the vitamin. Knockout genes preventing ascorbic acid synthesis in pigs have demonstrated poor skeletal and collagen formation and poor antioxidant protection. Under periods of stress ascorbic acid declines in the adrenal, but the pig rapidly recovers to its resting state once the stressor agent is removed. Although there are periods when supplemental vitamin C has been shown to promote pig performance (e.g., during high environmental stress and early postweaning), supplemental vitamin C has not been shown to routinely enhance pig performance.

  12. Fatty Acid Synthesis Intermediates Represent Novel Noninvasive Biomarkers of Prostate Cancer Chemoprevention by Phenethyl Isothiocyanate.

    PubMed

    Singh, Krishna B; Singh, Shivendra V

    2017-03-14

    Increased de novo synthesis of fatty acids is a distinctive feature of prostate cancer, which continues to be a leading cause of cancer-related deaths among American men. Therefore, inhibition of de novo fatty acid synthesis represents an attractive strategy for chemoprevention of prostate cancer. We have shown previously that dietary feeding of phenethyl isothiocyanate (PEITC), a phytochemical derived from edible cruciferous vegetables such as watercress, inhibits incidence and burden of poorly-differentiated prostate cancer in Transgenic Adenocarcinoma of Mouse Prostate (TRAMP) model. The present study was designed to test the hypothesis of whether fatty acid intermediate(s) can serve as noninvasive biomarker(s) of prostate cancer chemoprevention by PEITC using archived plasma and tumor specimens from the TRAMP study as well as cellular models of prostate cancer. Exposure of prostate cancer cells (LNCaP and 22Rv1) to pharmacological concentrations of PEITC resulted in downregulation of key fatty acid metabolism proteins, including acetyl-CoA carboxylase 1 (ACC1), fatty acid synthase (FASN), and carnitine palmitoyltransferase 1A (CPT1A). The mRNA expression of FASN and CPT1A as well as acetyl-CoA levels were decreased by PEITC treatment in both cell lines. PEITC administration to TRAMP mice also resulted in a significant decrease in tumor expression of FASN protein. Consistent with these findings, the levels of total free fatty acids, total phospholipids, triglyceride, and ATP were significantly lower in the plasma and/or prostate tumors of PEITC-treated TRAMP mice compared with controls. The present study is the first to implicate inhibition of fatty acid synthesis in prostate cancer chemoprevention by PEITC.

  13. Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.

    PubMed

    Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M

    2012-03-27

    In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages.

  14. Akt Phosphorylation and Regulation of Transketolase Is a Nodal Point for Amino Acid Control of Purine Synthesis

    PubMed Central

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T.; Phan, Tony; Pilz, Renate B.; Boss, Gerry R.

    2014-01-01

    SUMMARY The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mTORC2 and IκB kinase regulate Akt activity, and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the non-oxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the non-oxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for two days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a new mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  15. Synthesis of repressible acid phosphatase in Saccharomyces cerevisiae under conditions of enzyme instability.

    PubMed Central

    Bostian, K A; Lemire, J M; Halvorson, H O

    1982-01-01

    The synthesis of repressible acid phosphatase in Saccharomyces cerevisiae was examined under conditions of blocked derepression as described by Toh-e et al. (Mol. Gen. Genet. 162:139-149, 1978). Based on a genetic and biochemical analysis of the phenomenon these authors proposed a new regulatory model for acid phosphatase expression involving a simultaneous interaction of regulatory factors in the control of structural gene transcription. We demonstrate here that under growth conditions that fail to produce acid phosphatase the enzyme is readily inactivated. Furthermore, we demonstrate under these conditions the production of acid phosphatase mRNA which is active both in vitro and in vivo in the synthesis of enzyme. This eliminates any step prior to translation of acid phosphatase polypeptide as an explanation for the phenomenon. We interpret our results for the block in appearance of acid phosphatase as a result of both deaccelerated growth and cellular biosynthesis during derepression, accompanied by an enhanced instability of the enzyme. Images PMID:7050664

  16. Role of ferrocyanides in the prebiotic synthesis of α-amino acids.

    PubMed

    Ruiz-Bermejo, Marta; Osuna-Esteban, Susana; Zorzano, María-Paz

    2013-06-01

    We investigated the synthesis of α-amino acids under possible prebiotic terrestrial conditions in the presence of dissolved iron (II) in a simulated prebiotic ocean. An aerosol-liquid cycle with a prebiotic atmosphere is shown to produce amino acids via Strecker synthesis with relatively high yields. However, in the presence of iron, the HCN was captured in the form of a ferrocyanide, partially inhibiting the formation of amino acids. We showed how HCN captured as Prussian Blue (or another complex compound) may, in turn, have served as the HCN source when exposed to UV radiation, allowing for the sustained production of amino acids in conjunction with the production of oxyhydroxides that precipitate as by-products. We conclude that ferrocyanides and related compounds may have played a significant role as intermediate products in the prebiotic formation of amino acids and oxyhydroxides, such as those that are found in iron-containing soils and that the aerosol cycle of the primitive ocean may have enhanced the yield of the amino acid production.

  17. Nucleic acid and protein synthesis during lateral root initiation in Marsilea quadrifolia (Marsileaceae)

    NASA Technical Reports Server (NTRS)

    Lin, B. L.; Raghavan, V.

    1991-01-01

    The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.

  18. Protein and Ribonucleic Acid Synthesis During the Diploid Life Cycle of Allomyces arbuscula

    PubMed Central

    Burke, Daniel J.; Seale, Thomas W.; McCarthy, Brian J.

    1972-01-01

    The diploid life cycle of Allomyces arbuscula may be divided into four parts: spore induction, germination, vegetative growth, and mitosporangium formation. Spore induction, germination, and mitosporangium formation are insensitive to inhibition of actinomycin D, probably indicating that stable, pre-existing messenger ribonucleic acid (RNA) is responsible for these developmental events. Protein synthesis is necessary during the entire life cycle except for cyst formation. A system for obtaining synchronous germination of mitospores is described. During germination there is a characteristic increase in the rate of synthesis of RNA and protein although none of the other morphogenetic changes occurring during the life cycle are necessarily accompanied by an appreciable change in the rate of macromolecular synthesis. PMID:4113121

  19. Concise synthesis of the A/BCD-ring fragment of gambieric acid A

    PubMed Central

    Fuwa, Haruhiko; Fukazawa, Ryo; Sasaki, Makoto

    2014-01-01

    Gambieric acid A (GAA) and its congeners belong to the family of marine polycyclic ether natural products. Their highly complex molecular architecture and unique biological activities have been of intense interest within the synthetic community. We have previously reported the first total synthesis, stereochemical reassignment, and preliminary structure–activity relationships of GAA. Here we disclose a concise synthesis of the A/BCD-ring fragment of GAA. The synthesis started from our previously reported synthetic intermediate that represents the A/B-ring. The C-ring was synthesized via an oxiranyl anion coupling and a 6-endo cyclization, and the D-ring was forged by means of an oxidative lactonization and subsequent palladium-catalyzed functionalization of the lactone ring. In this manner, the number of linear synthetic steps required for the construction of the C- and D-rings was reduced from 22 to 11. PMID:25629027

  20. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    NASA Astrophysics Data System (ADS)

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-Ichi

    2015-02-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  1. Synthesis and Verification of Biobased Terephthalic Acid from Furfural

    PubMed Central

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-01-01

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon. PMID:25648201

  2. Synthesis and verification of biobased terephthalic acid from furfural.

    PubMed

    Tachibana, Yuya; Kimura, Saori; Kasuya, Ken-ichi

    2015-02-04

    Exploiting biomass as an alternative to petrochemicals for the production of commodity plastics is vitally important if we are to become a more sustainable society. Here, we report a synthetic route for the production of terephthalic acid (TPA), the monomer of the widely used thermoplastic polymer poly(ethylene terephthalate) (PET), from the biomass-derived starting material furfural. Biobased furfural was oxidised and dehydrated to give maleic anhydride, which was further reacted with biobased furan to give its Diels-Alder (DA) adduct. The dehydration of the DA adduct gave phthalic anhydride, which was converted via phthalic acid and dipotassium phthalate to TPA. The biobased carbon content of the TPA was measured by accelerator mass spectroscopy and the TPA was found to be made of 100% biobased carbon.

  3. Synthesis and antifungal activity of bile acid-derived oxazoles.

    PubMed

    Fernández, Lucía R; Svetaz, Laura; Butassi, Estefanía; Zacchino, Susana A; Palermo, Jorge A; Sánchez, Marianela

    2016-04-01

    Peracetylated bile acids (1a-g) were used as starting materials for the preparation of fourteen new derivatives bearing an oxazole moiety in their side chain (6a-g, 8a-g). The key step for the synthetic path was a Dakin-West reaction followed by a Robinson-Gabriel cyclodehydration. A simpler model oxazole (12) was also synthesized. The antifungal activity of the new compounds (6a-g) as well as their starting bile acids (1a-g) was tested against Candida albicans. Compounds 6e and 6g showed the highest percentages of inhibition (63.84% and 61.40% at 250 μg/mL respectively). Deacetylation of compounds 6a-g, led to compounds 8a-g which showed lower activities than the acetylated derivatives.

  4. Enzymatic synthesis of palm olein-based fatty thiohydroxamic acids.

    PubMed

    Al-Mulla, Emad A Jaffar; Yunus, Wan Md Zin Wan; Ibrahim, Nor Azowa Bt; Rahman, Mohd Zaki Ab

    2010-01-01

    Fatty thiohydroxamic acids (FTAs) have been successfully synthesized from palm olein and thiohydroxamic acid by a one-step lipase catalyzed reaction. The use of immobilized lipase (Lipozyme RMIM) as the catalyst for the preparation reaction provides an easy isolation of the enzyme from the products and other components in the reaction mixture. The FTAs were characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The highest conversion percentage (95 %) was obtained when the process was carried out for 30 hours using urea to palm oil ratio of 6.0: 1.0 at 40 °C. The method employed offers several advantages such as renewable and abundant of the raw material, simple reaction procedure, environmentally friendly process and high yield of the product.

  5. First synthesis of thia steroids from cholic acid.

    PubMed

    Ibrahim-Ouali, Malika; Rocheblave, Luc

    2010-10-01

    Heterosteroids remain interesting due to their potential biological activities. This prompted us to synthesize novel thia steroids possessing the heteroatom in the A-ring. We set out to describe a new and versatile method for preparing 3-thia steroids from cholic acid via a selective oxidation of one hydroxyl group, a Baeyer-Villiger oxidation and a photolysis as the key steps. The characteristic (1)H and (13)C NMR spectroscopic features of the synthesized compounds are reported.

  6. An approach for the synthesis of nakamuric acid

    PubMed Central

    Wang, Xiaolei; Chen, Chuo

    2014-01-01

    The biosynthesis of dimeric pyrrole–imidazole alkaloids is likely mediated by enzyme-catalyzed reversible single-electron transfer (SET) cycloaddition. We now show that Ir(ppy)3 can promote SET-mediated formal [2+2] and [4+2] cycloaddition reactions of pyrrole–imidazole alkaloids-related substrates under photolytic conditions. This biomimetic approach is useful for the construction of the core skeleton of nakamuric acid and sceptrin. PMID:25983349

  7. Synthesis and characterization of fatty hydroxamic acids from triacylglycerides.

    PubMed

    Hoidy, Wisam H; Ahmad, Mansor B; Al-Mulla, Emad A Jaffar; Yunus, Wan Md Zin Wan; Ibrahim, Nor azowa Bt

    2010-01-01

    In this study, fatty haydroxamic acids (FHAs), which have biological activities as antibiotics and antifungal, have been synthesized via refluxing of triacylglycrides, palm olein, palm stearin or corn oil with hydroxylamine hydrochloride. The products were characterized using the complex formation test of hydroxamic acid group with zinc(I), copper(II) and iron(III), various technique methods including nuclear magnetic resonance ((1)H NMR) spectroscopy, Fourier transform infrared (FTIR) spectroscopy and elemental analysis. Parameters that may affect the conversion of oils to FHAs including the effect of reaction time, effect of organic solvent and effect of hydro/oil molar issue were also investigated in this study. Results of characterization indicate that FHAs were successfully produced from triacylglycrides. The conversion percentages of palm stearin, palm olein and corn oil into their fatty hydroxamic acids are 82, 81 and 78, respectively. Results also showed that hexane is the best organic solvent to produce the FHAs from the three oils used in this study. The optimum reaction time to achieve the maximum conversion percentage of the oils to FHAs was found to be 10 hours for all the three oils, while the optimum molar ration of hydro/to oil was found to be 7:1 for all the different three oils.

  8. Synthesis, crystal structure and computational studies of 4-nitrobenzylphosphonic acid

    NASA Astrophysics Data System (ADS)

    Wilk, Magdalena; Jarzembska, Katarzyna N.; Janczak, Jan; Hoffmann, Józef; Videnova-Adrabinska, Veneta

    2014-09-01

    4-Nitrobenzylphosphonic acid (1a) has been synthesized and structurally characterized by vibrational spectroscopy (IR and Raman) and single-crystal X-ray diffraction. Additionally, Hirshfeld surface analysis and computational methods have been used to compare the intermolecular interactions in the crystal structures of 1a and its carboxylic analogue, 4-nitrobenzylcarboxylic acid (4-NBCA). The crystal structure analysis of 1a has revealed that the acid molecules are extended into helical chains along the b axis using one of the hydrogen bonds established between phosphonic groups. The second (P)Osbnd H⋯O(P) hydrogen bond cross-links the inversion-related chains to form a thick monolayer with phosphonic groups arranged inwards and aromatic rings outwards. The nitro groups serve to link the neighbouring monolayers by weak Csbnd H⋯O(N) hydrogen bonds. Computations have confirmed the great contribution of electrostatic interactions for the crystal lattice stability. The cohesive energy, computed for the crystal structure of 1a exceeds 200 kJ mol-1 in magnitude and is nearly twice as large as that of 4-NBCA. The calculated cohesive energy values have been further related to the results of thermal analyses.

  9. Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

    PubMed

    Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

    2016-08-01

    Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

  10. LC/MS/MS identification of some folic acid degradation products after E-beam irradiation

    NASA Astrophysics Data System (ADS)

    Araújo, M. M.; Marchioni, E.; Zhao, M.; Kuntz, F.; Di Pascoli, T.; Villavicencio, A. L. C. H.; Bergaentzle, M.

    2012-08-01

    Folates belong to the B vitamin group based on the parental compound folic acid (FA). They are involved in important biochemical processes like DNA synthesis and repair. FA is composed of a pteridine ring, p-aminobenzoic acid and glutamate moieties. The human metabolism is not able to synthesize folates and therefore obtain them from diet. FA, a synthetic vitamin, is used as a food fortificant because of its low price, relative stability and increased bioavailability compared to natural folate forms. FA is known to be a sensitive compound easily degradable in aqueous solution by ultraviolet and visible light towards various by-products. Irradiation is a process for preservation of foods that uses accelerated electrons, gamma rays or X-rays. Irradiation is proposed for the treatment of various food products, eliminating or reducing pathogens and insects, increasing the storage time and replacing chemical fumigants. This study concerns the identification of degradation products of FA after E-beam irradiation. FA aqueous solutions were irradiated with a Van de Graaff electrons beam accelerator (2 MeV, 100 μA current, 20 cm scan width, dose rate about 2 kGy/s). Applied doses were between 0 (control) and 10.0 kGy. Absorbed doses were monitored with FWT 60.00 radiochromic dosimeters.

  11. A branched chain amino acid metabolite drives vascular transport of fat and causes insulin resistance

    PubMed Central

    Jang, Cholsoon; Oh, Sungwhan F; Wada, Shogo; Rowe, Glenn C; Liu, Laura; Chan, Mun Chun; Rhee, James; Hoshino, Atsushi; Kim, Boa; Ibrahim, Ayon; Baca, Luisa G; Kim, Esl; Ghosh, Chandra C; Parikh, Samir M; Jiang, Aihua; Chu, Qingwei; Forman, Daniel E.; Lecker, Stewart H.; Krishnaiah, Saikumari; Rabinowitz, Joshua D; Weljie, Aalim M; Baur, Joseph A; Kasper, Dennis L; Arany, Zoltan

    2016-01-01

    Epidemiological and experimental data implicate branched chain amino acids (BCAAs) in the development of insulin resistance, but the mechanisms underlying this link remain unclear.1–3 Insulin resistance in skeletal muscle stems from excess accumulation of lipid species4, a process that requires blood-borne lipids to first traverse the blood vessel wall. Little is known, however, of how this trans-endothelial transport occurs or is regulated. Here, we leverage PGC-1α, a transcriptional coactivator that regulates broad programs of FA consumption, to identify 3-hydroxy-isobutyrate (3-HIB), a catabolic intermediate of the BCAA valine, as a novel paracrine regulator of trans-endothelial fatty acids (FA) transport. 3-HIB is secreted from muscle cells, activates endothelial FA transport, stimulates muscle FA uptake in vivo, and promotes muscle lipid accumulation and insulin resistance in animals. Conversely, inhibiting the synthesis of 3-HIB in muscle cells blocks the promotion of endothelial FA uptake. 3-HIB levels are elevated in muscle from db/db mice and from subjects with diabetes. These data thus unveil a novel mechanism that regulates trans-endothelial flux of FAs, revealing 3-HIB as a new bioactive signaling metabolite that links the regulation of FA flux to BCAA catabolism and provides a mechanistic explanation for how increased BCAA catabolic flux can cause diabetes. PMID:26950361

  12. Acid Gradient across Plasma Membrane Can Drive Phosphate Bond Synthesis in Cancer Cells: Acidic Tumor Milieu as a Potential Energy Source

    PubMed Central

    Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

    2015-01-01

    Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623

  13. Loss of Nuclear Receptor SHP Impairs but Does Not Eliminate Negative Feedback Regulation of Bile Acid Synthesis

    PubMed Central

    Kerr, Thomas A.; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W.; Schwarz, Margrit

    2014-01-01

    Summary The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  14. Stimulation of skeletal muscle protein synthesis in neonatal pigs by long-term infusion of leucine is amino acid dependent

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Infusing leucine for 1 hr increases skeletal muscle protein synthesis in neonatal pigs, but this is not sustained for 2 h unless the leucine-induced fall in amino acids is prevented. We aimed to determine whether continuous leucine infusion can stimulate protein synthesis for a prolonged period whe...

  15. Synthesis of a Homologous Series of Side Chain Extended Orthogonally-Protected Aminooxy-Containing Amino Acids

    PubMed Central

    Liu, Fa; Thomas, Joshua; Burke, Terrence R.

    2008-01-01

    Practical methodology is reported for the synthesis of a homologous series of side chain extended amino acids containing aminooxy functionality bearing orthogonal protection suitable for Fmoc peptide synthesis. These reagents may be useful for the preparation of libraries containing fragments joined by peptide linkers. PMID:19122755

  16. Choroidal retinoic acid synthesis: a possible mediator between refractive error and compensatory eye growth.

    PubMed

    Mertz, J R; Wallman, J

    2000-04-01

    Research over the past two decades has shown that the growth of young eyes is guided by vision. If near- or far-sightedness is artificially imposed by spectacle lenses, eyes of primates and chicks compensate by changing their rate of elongation, thereby growing back to the pre-lens optical condition. Little is known about what chemical signals might mediate between visual effects on the retina and alterations of eye growth. We present five findings that point to choroidal retinoic acid possibly being such a mediator. First, the chick choroid can convert retinol into all-trans-retinoic acid at the rate of 11 +/- 3 pmoles mg protein(-1) hr(-1), compared to 1.3 +/- 0.3 for retina/RPE and no conversion for sclera. Second, those visual conditions that cause increased rates of ocular elongation (diffusers or negative lens wear) produce a sharp decrease in all-trans-retinoic acid synthesis to levels barely detectable with our assay. In contrast, visual conditions which result in decreased rates of ocular elongation (recovery from diffusers or positive lens wear) produce a four- to five-fold increase in the formation of all-trans-retinoic acid. Third, the choroidal retinoic acid is found bound to a 28-32 kD protein. Fourth, a large fraction of the choroidal retinoic acid synthesized in culture is found in a nucleus-enriched fraction of sclera. Finally, application of retinoic acid to cultured sclera at physiological concentrations produced an inhibition of proteoglycan production (as assessed by measuring sulfate incorporation) with a EC50 of 8 x 10(-7) M. These results show that the synthesis of choroidal retinoic acid is modulated by those visual manipulations that influence ocular elongation and that this retinoic acid may reach the sclera in concentrations adequate to modulate scleral proteoglycan formation.

  17. Inhibition of fatty acid and cholesterol synthesis by stimulation of AMP-activated protein kinase.

    PubMed

    Henin, N; Vincent, M F; Gruber, H E; Van den Berghe, G

    1995-04-01

    AMP-activated protein kinase is a multisubstrate protein kinase that, in liver, inactivates both acetyl-CoA carboxylase, the rate-limiting enzyme of fatty acid synthesis, and 3-hydroxy-3-methyl-glutaryl-CoA reductase, the rate-limiting enzyme of cholesterol synthesis. AICAR (5-amino 4-imidazolecarboxamide ribotide, ZMP) was found to stimulate up to 10-fold rat liver AMP-activated protein kinase, with a half-maximal effect at approximately 5 mM. In accordance with previous observations, addition to suspensions of isolated rat hepatocytes of 50-500 microM AICAriboside, the nucleoside corresponding to ZMP, resulted in the accumulation of millimolar concentrations of the latter. This was accompanied by a dose-dependent inactivation of both acetyl-CoA carboxylase and 3-hydroxy-3-methylglutaryl-CoA reductase. Addition of 50-500 microM AICAriboside to hepatocyte suspensions incubated in the presence of various substrates, including glucose and lactate/pyruvate, caused a parallel inhibition of both fatty acid and cholesterol synthesis. With lactate/pyruvate (10/1 mM), half-maximal inhibition was obtained at approximately 100 microM, and near-complete inhibition at 500 microM AICAriboside. These findings open new perspectives for the simultaneous control of triglyceride and cholesterol synthesis by pharmacological stimulators of AMP-activated protein kinase.

  18. In situ synthesis of peptide nucleic acids in porous silicon for drug delivery and biosensing.

    PubMed

    Beavers, Kelsey R; Mares, Jeremy W; Swartz, Caleb M; Zhao, Yiliang; Weiss, Sharon M; Duvall, Craig L

    2014-07-16

    Peptide nucleic acids (PNA) are a unique class of synthetic molecules that have a peptide backbone and can hybridize with nucleic acids. Here, a versatile method has been developed for the automated, in situ synthesis of PNA from a porous silicon (PSi) substrate for applications in gene therapy and biosensing. Nondestructive optical measurements were performed to monitor single base additions of PNA initiated from (3-aminopropyl)triethoxysilane attached to the surface of PSi films, and mass spectrometry was conducted to verify synthesis of the desired sequence. Comparison of in situ synthesis to postsynthesis surface conjugation of the full PNA molecules showed that surface mediated, in situ PNA synthesis increased loading 8-fold. For therapeutic proof-of-concept, controlled PNA release from PSi films was characterized in phosphate buffered saline, and PSi nanoparticles fabricated from PSi films containing in situ grown PNA complementary to micro-RNA (miR) 122 generated significant anti-miR activity in a Huh7 psiCHECK-miR122 cell line. The applicability of this platform for biosensing was also demonstrated using optical measurements that indicated selective hybridization of complementary DNA target molecules to PNA synthesized in situ on PSi films. These collective data confirm that we have established a novel PNA-PSi platform with broad utility in drug delivery and biosensing.

  19. Stimulation of phosphatidic acid of calcium influx and cyclic GMP synthesis in neuroblastoma cells.

    PubMed

    Ohsako, S; Deguchi, T

    1981-11-10

    Phosphatidic acid added to the medium markedly elevated intracellular cyclic GMP content in cultured neuroblastoma N1E 115 cells. There was a significant elevation of cyclic GMP with 1 micrograms/ml and a maximum (70-fold) elevation with 100 micrograms/ml of phosphatidic acid. Other natural phospholipids did not increase, or increased only slightly, the cyclic GMP content in the cells. The elevation of cyclic GMP content by phosphatidic acid was absolutely dependent on extracellular calcium. Phosphatidic acid stimulated the influx of calcium into neuroblastoma cells 2- to 5-fold. The pattern of the calcium influx induced by phosphatidic acid was comparable to that of cyclic GMP elevation. The stimulation of calcium influx by phosphatidic acid was also observed in cultured heart cells, indicating that phosphatidic acid acts as a calcium ionophore or opens a specific calcium-gate in a variety of cell membranes. Treatment of neuroblastoma cells with phospholipase C increased 32Pi labeling of phosphatidic acid, stimulated the influx of calcium, and elevated the cyclic GMP content in the cells. Thus exogenous as well as endogenous phosphatidic acid stimulates the translocation of calcium across cell membranes and, as a consequence, induces the synthesis of cyclic GMP in the neuroblastoma cells.

  20. Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

    NASA Technical Reports Server (NTRS)

    Nakashima, T.; Fox, S. W.

    1980-01-01

    The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

  1. Fatty Acid Synthesis and Control of Caspase 2 in Prostate Cancer

    DTIC Science & Technology

    2013-05-01

    July 2011- 30 June 2012 4 . TITLE AND SUBTITLE 5a. CONTRACT NUMBER Fatty Acid Synthesis and control of Caspase 2 in Prostate Cancer 5b. GRANT...Introduction…………………………………………………………….………..….. 4 Body………………………………………………………………………………….. 4 -6 Key Research Accomplishments...combination  with  inhibitors  of  NADPH  production   ( DHEA ),  fatty  acid  synthesis,  (C75,  C93,  cerulenin)  and  CaMKII

  2. Synthesis and in vitro Evaluation of Polymeric Prodrug of Ibuprofen with Amino Acid Spacer.

    PubMed

    Redasani, Vivekkumar K; Bari, Sanjay B

    2015-01-01

    The present work is an agreement with simple and efficient method of improving the therapeutic efficacy of ibuprofen by masking its acidic moiety. It aims to reduce gastrointestinal side effects by controlling the rate, duration and site of release. This is achieved by synthesis and evaluation of polymeric prodrug of ibuprofen with natural polymer sodium alginate. The synthesis was supported by N-protected serine as spacer due to chemical incompatibility of drug and polymer. Synthesized prodrug was characterized for confirmation of said structures. The in-vitro dissolution profile of ibuprofen-alginate prodrug showed that the release of the drug is significantly higher in case of pH 7.2 buffer as compared to ibuprofen, which might be due to ester group adjacent to drug get hydrolyzed. The hydrolysis was found to be with faster rate in alkaline media than that of in acidic media.

  3. Synthesis, biological activity, and bioavailability of moschamine, a safflomide-type phenylpropenoic acid amide found in Centaurea cyanus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...

  4. Ribonucleic Acid and Protein Synthesis During Germination of Myxococcus xanthus Myxospores

    PubMed Central

    Juengst, Fredrick W.; Dworkin, Martin

    1973-01-01

    Ribonucleic acid (RNA) and protein synthesis during myxospore germination were examined. When RNA synthesis was inhibited more than 90% by either actinomycin D (Act D) or rifampin, germination was prevented. The data were consistent with the interpretation that rifampin did not interfere with protein synthesis in any way other than by inhibition of messenger RNA formation. Act D concentrations as high as 20 μg/ml did not totally inhibit RNA synthesis. In the presence of 8 μg of Act D/ml, germinating myxospores synthesized transfer RNA, 16S RNA, and 23S RNA. Evidence was presented which indicated that messenger RNA was also synthesized early in the germination period both in the presence and absence of 8 μg of Act D/ml. One explanation for the escape synthesis of RNA in germinating myxospores is that Act D exerts a differential effect on the transcription of larger versus smaller cistrons, the latter having a lower probability of binding Act D. We have found that in the presence of 8 μg of Act D/ml, escape RNA synthesis in myxospores was 25% for 23S RNA, 55% for 16S RNA, and more than 90% for 4S RNA. We have shown that germination of myxospores requires both RNA and protein synthesis during the first 25 to 35 min in germination medium. This finding does not support the earlier suggestion by Ramsey and Dworkin that a stable germination messenger RNA is required for germination of the myxospores of Myxococcus xanthus. PMID:4690965

  5. Synthesis, Preliminary Bioevaluation and Computational Analysis of Caffeic Acid Analogues

    PubMed Central

    Liu, Zhiqian; Fu, Jianjun; Shan, Lei; Sun, Qingyan; Zhang, Weidong

    2014-01-01

    A series of caffeic acid amides were designed, synthesized and evaluated for anti-inflammatory activity. Most of them exhibited promising anti-inflammatory activity against nitric oxide (NO) generation in murine macrophage RAW264.7 cells. A 3D pharmacophore model was created based on the biological results for further structural optimization. Moreover, predication of the potential targets was also carried out by the PharmMapper server. These amide analogues represent a promising class of anti-inflammatory scaffold for further exploration and target identification. PMID:24857914

  6. Regulation of L-ascorbic acid content in strawberry fruits

    PubMed Central

    Cruz-Rus, Eduardo; Amaya, Iraida; Sánchez-Sevilla, José F.; Botella, Miguel A.; Valpuesta, Victoriano

    2011-01-01

    Plants have several L-ascorbic acid (AsA) biosynthetic pathways, but the contribution of each one to the synthesis of AsA varyies between different species, organs, and developmental stages. Strawberry (Fragaria×ananassa) fruits are rich in AsA. The pathway that uses D-galacturonate as the initial substrate is functional in ripe fruits, but the contribution of other pathways to AsA biosynthesis has not been studied. The transcription of genes encoding biosynthetic enzymes such as D-galacturonate reductase (FaGalUR) and myo-inositol oxygenase (FaMIOX), and the AsA recycling enzyme monodehydroascorbate reductase (FaMDHAR) were positively correlated with the increase in AsA during fruit ripening. Fruit storage for 72 h in a cold room reduced the AsA content by 30%. Under an ozone atmosphere, this reduction was 15%. Ozone treatment increased the expression of the FaGalUR, FaMIOX, and L-galactose-1-phosphate phosphatase (FaGIPP) genes, and transcription of the L-galactono-1,4-lactone dehydrogenase (FaGLDH) and FAMDHAR genes was higher in the ozone-stored than in the air-stored fruits. Analysis of AsA content in a segregating population from two strawberry cultivars showed high variability, which did not correlate with the transcription of any of the genes studied. Study of GalUR protein in diverse cultivars of strawberry and different Fragaria species showed that a correlation between GalUR and AsA content was apparent in most cases, but it was not general. Three alleles were identified in strawberry, but any sequence effect on the AsA variability was eliminated by analysis of the allele-specific expression. Taken together, these results indicate that FaGalUR shares the control of AsA levels with other enzymes and regulatory elements in strawberry fruit. PMID:21561953

  7. Total synthesis of gracilioether F. Development and application of Lewis acid promoted ketene–alkene [2+2] cycloadditions and late-stage C—H oxidation

    SciTech Connect

    Rasik, Christopher M.; Brown, M. Kevin

    2014-12-22

    The first synthesis of gracilioether F, a polyketide natural product with an unusual tricyclic core and five contiguous stereocenters, is described. Key steps of the synthesis include a Lewis acid promoted ketene–alkene [2+2] cycloaddition and a late-stage carboxylic acid directed C(sp³)—H oxidation. The synthesis requires only eight steps from norbornadiene.

  8. Polyanionic Carboxyethyl Peptide Nucleic Acids (ce-PNAs): Synthesis and DNA Binding

    PubMed Central

    Kirillova, Yuliya; Boyarskaya, Nataliya; Dezhenkov, Andrey; Tankevich, Mariya; Prokhorov, Ivan; Varizhuk, Anna; Eremin, Sergei; Esipov, Dmitry; Smirnov, Igor; Pozmogova, Galina

    2015-01-01

    New polyanionic modifications of polyamide nucleic acid mimics were obtained. Thymine decamers were synthesized from respective chiral α- and γ-monomers, and their enantiomeric purity was assessed. Here, we present the decamer synthesis, purification and characterization by MALDI-TOF mass spectrometry and an investigation of the hybridization properties of the decamers. We show that the modified γ-S-carboxyethyl-T10 PNA forms a stable triplex with polyadenine DNA. PMID:26469337

  9. Selective synthesis of thioethers in the presence of a transition-metal-free solid Lewis acid.

    PubMed

    Santoro, Federica; Mariani, Matteo; Zaccheria, Federica; Psaro, Rinaldo; Ravasio, Nicoletta

    2016-01-01

    The synthesis of thioethers starting from alcohols and thiols in the presence of amorphous solid acid catalysts is reported. A silica alumina catalyst with a very low content in alumina gave excellent results in terms of both activity and selectivity also under solvent-free conditions. The reaction rate follows the electron density of the carbinol atom in the substrate alcohol and yields up to 99% and can be obtained for a wide range of substrates under mild reaction conditions.

  10. Aminochlorination in water: first Brønsted acid-promoted synthesis of vicinal chloramines.

    PubMed

    Wu, Xue-Liang; Wang, Guan-Wu

    2007-11-23

    A practical and scaleable route for the regio- and diastereoselective synthesis of vicinal chloramines from electron-deficient olefins and Chloramine-T promoted by Brønsted acids in water has been realized for the first time. This novel protocol is efficient, mild, ecofriendly, and broadly applicable for the aminochlorination of various electron-deficient olefins including alpha,beta-unsaturated ketones, cinnamate, and cinnamide. Water represents as a privileged solvent for the aminochlorination reaction in our system.

  11. Synthesis of 2-(hetero)aryl-5-(trimethylsilylethynyl)oxazoles from (hetero)arylacrylic acids.

    PubMed

    Pankova, Alena S; Stukalov, Alexander Yu; Kuznetsov, Mikhail A

    2015-04-17

    A three-step method for the synthesis of 2-(hetero)aryl-5-(trimethylsilylethynyl)oxazoles is described. Easily accessible bis(trimethylsilyl)acetylene and acrylic acid derivatives are used as starting materials for the preparation of mono- and disubstituted 5-(trimethylsilyl)pent-1-en-4-yn-3-ones. Oxidative phthalimidoaziridination of these enynones provides the key 2-acyl-1-phthalimidoaziridines that are further utilized in the thermal expansion of the three-membered ring to furnish the target functionalizable oxazoles.

  12. Synthesis and biological evaluation of new salvinorin A analogues incorporating natural amino acids.

    PubMed

    Fichna, Jakub; Lewellyn, Kevin; Yan, Feng; Roth, Bryan L; Zjawiony, Jordan K

    2011-01-01

    The synthesis and in vitro evaluation of a new series of salvinorin A analogues substituted at the C(2) position with natural amino acids is reported. Compound 12, containing Val, displayed high affinity and full agonist activity at the kappa-opioid receptor. Analogues with bulky and/or aromatic residues were inactive, showing the importance of size and electronegativity of C(2)-substituents for binding affinity of salvinorin A derivatives.

  13. One-step synthesis of 1-chloro-3-arylacetone derivatives from arylacetic acids.

    PubMed

    Zacuto, Michael J; Dunn, Robert F; Figus, Margaret

    2014-09-19

    A practical one-step method has been developed to prepare α-chloroketones from readily available, inexpensive phenylacetic acid derivatives. The method utilizes the unique reactivity of an intermediate Mg-enolate dianion, which displays selectivity for the carbonyl carbon of chloromethyl carbonyl electrophiles. Decarboxylation of the intermediate occurs spontaneously during the reaction quench. The utility of the reaction products has been demonstrated through the total synthesis of the natural product cimiracemate B.

  14. Selective synthesis of thioethers in the presence of a transition-metal-free solid Lewis acid

    PubMed Central

    Santoro, Federica; Mariani, Matteo; Zaccheria, Federica; Psaro, Rinaldo

    2016-01-01

    The synthesis of thioethers starting from alcohols and thiols in the presence of amorphous solid acid catalysts is reported. A silica alumina catalyst with a very low content in alumina gave excellent results in terms of both activity and selectivity also under solvent-free conditions. The reaction rate follows the electron density of the carbinol atom in the substrate alcohol and yields up to 99% and can be obtained for a wide range of substrates under mild reaction conditions. PMID:28144333

  15. Synthesis and cytotoxicity of A-homo-lactam derivatives of cholic acid and 7-deoxycholic acid.

    PubMed

    Huang, Yanmin; Chen, Sijing; Cui, Jianguo; Gan, Chunfang; Liu, Zhiping; Wei, Yingliang; Song, Huachan

    2011-06-01

    Using cholic acid and deoxycholic acid as starting materials, a series of 3-aza-A-homo-4-one bile acid and 7-deoxycholic acid derivatives were synthesized by the esterification, oxidation, reduction, oximation and Beckman rearrangement etc. The cytotoxicity of the synthesized compounds against MGC 7901 (human ventriculi carcinoma cell line), hela (human cervical carcinoma cell line), SMMC 7404 (human liver carcinoma cell line) were investigated. The results showed that bile acid and 7-deoxycholic-acid derivatives with 3-aza-A-homo-4-one configuration bearing a 6-hydroximino or 12-hydroximino group displayed a distinct cytotoxicity to Hela tumor cell line. In particular, the IC(50) values of the compounds 6 and 13 were 14.3 and 24.3 μmol/L against Hela human tumor cell line respectively. The information obtained from the studies may be useful for the design of novel chemotherapeutic drugs.

  16. Oleic acid coated magnetic nano-particles: Synthesis and characterizations

    SciTech Connect

    Panda, Biswajit Goyal, P. S.

    2015-06-24

    Magnetic nano particles of Fe{sub 3}O{sub 4} coated with oleic acid were synthesized using wet chemical route, which involved co-precipitation of Fe{sup 2+} and Fe{sup 3+} ions. The nano particles were characterized using XRD, TEM, FTIR, TGA and VSM. X-ray diffraction studies showed that nano particles consist of single phase Fe{sub 3}O{sub 4} having inverse spinel structure. The particle size obtained from width of Bragg peak is about 12.6 nm. TEM analysis showed that sizes of nano particles are in range of 6 to 17 nm with a dominant population at 12 - 14 nm. FTIR and TGA analysis showed that -COOH group of oleic acid is bound to the surface of Fe{sub 3}O{sub 4} particles and one has to heat the sample to 278° C to remove the attached molecule from the surface. Further it was seen that Fe{sub 3}O{sub 4} particles exhibit super paramagnetism with a magnetization of about 53 emu/ gm.

  17. Synthesis and bioactivity of analogues of the marine antibiotic tropodithietic acid

    PubMed Central

    Rabe, Patrick; Klapschinski, Tim A; Brock, Nelson L; Citron, Christian A; D’Alvise, Paul; Gram, Lone

    2014-01-01

    Summary Tropodithietic acid (TDA) is a structurally unique sulfur-containing antibiotic from the Roseobacter clade bacterium Phaeobacter inhibens DSM 17395 and a few other related species. We have synthesised several structural analogues of TDA and used them in bioactivity tests against Staphylococcus aureus and Vibrio anguillarum for a structure–activity relationship (SAR) study, revealing that the sulfur-free analogue of TDA, tropone-2-carboxylic acid, has an antibiotic activity that is even stronger than the bioactivity of the natural product. The synthesis of this compound and of several analogues is presented and the bioactivity of the synthetic compounds is discussed. PMID:25161739

  18. Integrated process of distillation with side reactors for synthesis of organic acid esters

    DOEpatents

    Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri; Miller, Dennis J; Lira, Carl T

    2015-11-04

    An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.

  19. Development of electrochemical folic acid sensor based on hydroxyapatite nanoparticles

    NASA Astrophysics Data System (ADS)

    Kanchana, P.; Sekar, C.

    2015-02-01

    We report the synthesis of hydroxyapatite (HA) nanoparticles (NPs) by a simple microwave irradiation method and its application as sensing element for the precise determination of folic acid (FA) by electrochemical method. The structure and composition of the HA NPs characterized using XRD, FTIR, Raman and XPS. SEM and EDX studies confirmed the formation of elongated spherical shaped HA NPs with an average particle size of about 34 nm. The HA NPs thin film on glassy carbon electrode (GCE) were deposited by drop casting method. Electrocatalytic behavior of FA in the physiological pH 7.0 was investigated by cyclic voltammetry (CV), linear sweep voltammetry (LSV) and chronoamperometry. The fabricated HA/GCE exhibited a linear calibration plot over a wide FA concentration ranging from 1.0 × 10-7 to 3.5 × 10-4 M with the detection limit of 75 nM. In addition, the HA NPs modified GCE showed good selectivity toward the determination of FA even in the presence of a 100-fold excess of ascorbic acid (AA) and 1000-fold excess of other common interferents. The fabricated biosensor exhibits good sensitivity and stability, and was successfully applied for the determination of FA in pharmaceutical samples.

  20. Oxidation-resistant acidic resins prepared by partial carbonization as cocatalysts in synthesis of adipic acid.

    PubMed

    Wei, Huijuan; Li, Hongbian; Liu, Yangqing; Jin, Peng; Wang, Xiangyu; Li, Baojun

    2012-08-01

    The oxidation-resistant acidic resins are of great importance for the catalytic oxidation systems. In this paper, the oxidatively stable acidic resins are obtained from the cation ion exchange resins (CIERs) through the thermal treatment in N(2) atmosphere. The structure and properties of the thermally treated CIERs were characterized by chemical analysis, Fourier transform infrared (FT-IR) spectra, acid capacity measurement and scanning electron microscope (SEM). The thermally treated CIERs possess high acid capacity up to 4.09 mmol g(-1). A partial carbonization is observed in the thermal treatment process of CIERs, but the morphology of resin spheres maintains well. The as-prepared CIERs are used as solid acids to assist the hydrogen peroxide oxidation of cyclohexene to adipic acid (ADA) with tungstic acid as the catalyst precursor. The improved yields of ADA in the recycling reaction are obtained in the presence of acidic CIERs. Meanwhile, the unproductive decomposition of H(2)O(2) is effectively suppressed. The high yields of ADA (about 81%) are kept by the thermally treated CIERs even after the fifth cycle. The thermally treated CIERs exhibit excellent acid-catalytic performance and possess remarkable oxidation-resistant capability.

  1. A novel and highly regioselective synthesis of new carbamoylcarboxylic acids from dianhydrides.

    PubMed

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N'-disubstituted 4,4'-carbonylbis(carbamoylbenzoic) acids and N,N'-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3',4,4'-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS.

  2. A Novel and Highly Regioselective Synthesis of New Carbamoylcarboxylic Acids from Dianhydrides

    PubMed Central

    Ochoa-Terán, Adrián; Estrada-Manjarrez, Jesús; Martínez-Quiroz, Marisela; Landey-Álvarez, Marco A.; Alcántar Zavala, Eleazar; Pina-Luis, Georgina; Santacruz Ortega, Hisila; Gómez-Pineda, Luis Enrique; Ramírez, José-Zeferino; Chávez, Daniel; Montes Ávila, Julio; Labastida-Galván, Victoria; Ordoñez, Mario

    2014-01-01

    A regioselective synthesis has been developed for the preparation of a series of N,N′-disubstituted 4,4′-carbonylbis(carbamoylbenzoic) acids and N,N′-disubstituted bis(carbamoyl) terephthalic acids by treatment of 3,3′,4,4′-benzophenonetetracarboxylic dianhydride (1) and 1,2,4,5-benzenetetracarboxylic dianhydride (2) with arylalkyl primary amines (A-N). The carbamoylcarboxylic acid derivatives were synthesized with good yield and high purity. The specific reaction conditions were established to obtain carbamoyl and carboxylic acid functionalities over the thermodynamically most favored imide group. Products derived from both anhydrides 1 and 2 were isolated as pure regioisomeric compounds under innovative experimental conditions. The chemo- and regioselectivity of products derived from dianhydrides were determined by NMR spectroscopy and confirmed by density functional theory (DFT). All products were characterized by NMR, FTIR, and MS. PMID:24511299

  3. Systems-level metabolic flux profiling identifies fatty acid synthesis as a target for antiviral therapy

    PubMed Central

    Munger, Joshua; Bennett, Bryson D; Parikh, Anuraag; Feng, Xiao-Jiang; McArdle, Jessica; Rabitz, Herschel A; Shenk, Thomas; Rabinowitz, Joshua D

    2010-01-01

    Viruses rely on the metabolic network of their cellular hosts to provide energy and building blocks for viral replication. We developed a flux measurement approach based on liquid chromatography–tandem mass spectrometry to quantify changes in metabolic activity induced by human cytomegalovirus (HCMV). This approach reliably elucidated fluxes in cultured mammalian cells by monitoring metabolome labeling kinetics after feeding cells 13C-labeled forms of glucose and glutamine. Infection with HCMV markedly upregulated flux through much of the central carbon metabolism, including glycolysis. Particularly notable increases occurred in flux through the tricarboxylic acid cycle and its efflux to the fatty acid biosynthesis pathway. Pharmacological inhibition of fatty acid biosynthesis suppressed the replication of both HCMV and influenza A, another enveloped virus. These results show that fatty acid synthesis is essential for the replication of two divergent enveloped viruses and that systems-level metabolic flux profiling can identify metabolic targets for antiviral therapy. PMID:18820684

  4. Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

    PubMed

    Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

    2016-08-01

    The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).

  5. Acid synthesis of luminescent amine-functionalized or erbium-doped silica spheres for biological applications.

    PubMed

    Enrichi, Francesco; Trave, Enrico; Bersani, Marco

    2008-03-01

    In this work we discuss and investigate the morphological and optical properties of luminescent silica spheres which can have interesting applications in bioimaging and biosensing. The spheres are synthesized following an acid route by the hydrolysis and condensation of tetraethylortosilicate (TEOS) and can be functionalized by incorporation of aminopropyl-triethoxysilane (APTES) during the synthesis, inducing a significant luminescence that can be attributed to a recombination mechanism from localized organic defects related to -NH(2) groups. It is shown that the acid synthesis route produces very regular spherical particles, but their diameter vary in the range of 200-4,000 nm. The luminescence properties have been investigated and optimized by variation of the annealing temperature for the functionalized spheres, obtaining the most efficient PL emission after a thermal treatment of 1 h at 600 degrees C in air. Moreover, the possibility to introduce rare earths like erbium in the spheres was also studied and the corresponding Er(3) luminescence emission at 1.53 microm is reported in terms of intensity and lifetime, pointing out that erbium can be easily and efficiently incorporated during the acid synthesis giving high PL intensity with a good lifetime of 3.9 ms.

  6. In vitro synthesis of the unit that links teichoic acid to peptidoglycan.

    PubMed

    Hancock, I; Baddiley, J

    1976-03-01

    The role of cytidine diphosphate (CDP)-glycerol in gram-positive bacteria whose walls lack poly(glycerol phosphate) was investigated. Membrane preparations from Staphylococcus aureus H, Bacillus subtilis W23, and Micrococcus sp. 2102 catalyzed the incorporation of glycerol phosphate residues from radioactive CDP-glycerol into a water-soluble polymer. In toluenized cells of Micrococcus sp. 2102, some of this product became linked to the wall. In each case, maximum incorporation of glycerol phosphate residues required the presence of the nucleotide precursors of wall teichoic acid and of uridine diphosphate-N-acetylglucosamine. In membrane preparations capable of synthesizing peptidoglycan, vancomycin caused a decrease in the incorporation of isotope from CDP-glycerol into polymer. Synthesis of the poly (glycerol phosphate) unit thus depended at an early stage on the concomitant synthesis of wall teichoic acid and later on the synthesis of peptidoglycan. It is concluded that CDP-glycerol is the biosynthetic precursor of the tri(glycerol phosphate) linkage unit between teichoic acid and peptidoglycan that has recently been characterized in S. aureus H.

  7. Δ(9)-Tetrahydrocannabinolic acid synthase production in Pichia pastoris enables chemical synthesis of cannabinoids.

    PubMed

    Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K

    2015-10-10

    Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale.

  8. Novel sol-gel synthesis of acidic MgF(2-x)(OH)(x) materials.

    PubMed

    Wuttke, Stefan; Coman, Simona M; Scholz, Gudrun; Kirmse, Holm; Vimont, Alexandré; Daturi, Maro; Schroeder, Sven L M; Kemnitz, Erhard

    2008-01-01

    Novel magnesium fluorides have been prepared by a new fluorolytic sol-gel synthesis for fluoride materials based on aqueous HF. By changing the amount of water at constant stoichiometric amount of HF, it is possible to tune the surface acidity of the resulting partly hydroxylated magnesium fluorides. These materials possess medium-strength Lewis acid sites and, by increasing the amount of water, Brønsted acid sites as well. Magnesium hydroxyl groups normally have a basic nature and only with this new synthetic route is it possible to create Brønsted acidic magnesium hydroxyl groups. XRD, MAS NMR, TEM, thermal analysis, and elemental analysis have been applied to study the structure, composition, and thermal behaviour of the bulk materials. XPS measurements, FTIR with probe molecules, and the determination of N(2)/Ar adsorption-desorption isotherms have been carried out to investigate the surface properties. Furthermore, activity data have indicated that the tuning of the acidic properties makes these materials versatile catalysts for different classes of reactions, such as the synthesis of (all-rac)-[alpha]-tocopherol through the condensation of 2,3,6-trimethylhydroquinone (TMHQ) with isophytol (IP).

  9. Ionic liquids as novel solvents for the synthesis of sugar fatty acid ester.

    PubMed

    Mai, Ngoc Lan; Ahn, Kihun; Bae, Sang Woo; Shin, Dong Woo; Morya, Vivek Kumar; Koo, Yoon-Mo

    2014-12-01

    Sugar fatty acid esters are bio-surfactants known for their non-toxic, non-ionic, and high biodegradability . With great emulsifying and conditioning effects, sugar fatty acids are widely used in the food, pharmaceutical, and cosmetic industries. Biosynthesis of sugar fatty acid esters has attracted growing attention in recent decades. In this study, the enzymatic synthesis of sugar fatty acid esters in ionic liquids was developed, optimized, and scaled up. Reaction parameters affecting the conversion yield of lipase-catalyzed synthesis of glucose laurate from glucose and vinyl laurate (i.e. temperature, vinyl laurate/glucose molar ratio, and enzyme loads) were optimized by response surface methodology (RSM). In addition, production was scaled up to 2.5 L, and recycling of enzyme and ionic liquids was investigated. The results showed that under optimal reaction conditions (66.86 °C, vinyl laurate/glucose molar ratio of 7.63, enzyme load of 73.33 g/L), an experimental conversion yield of 96.4% was obtained which is close to the optimal value predicted by RSM (97.16%). A similar conversion yield was maintained when the reaction was carried out at 2.5 L. Moreover, the enzymes and ionic liquids could be recycled and reused effectively for up to 10 cycles. The results indicate the feasibility of ionic liquids as novel solvents for the biosynthesis of sugar fatty acid esters.

  10. Relationships between pyruvate decarboxylation and branched-chain volatile acid synthesis in Ascaris mitochondria.

    PubMed

    Komuniecki, R; Komuniecki, P R; Saz, H J

    1981-10-01

    The rate of 14CO2 evolution from 1-[14C]pyruvate by intact Ascaris mitochondria was very slow, but increased with increasing concentrations of pyruvate. At all concentrations of pyruvate, in an aerobic environment, pyruvate decarboxylation was stimulated greatly by the addition of fumarate, malate, or succinate. However, under anaerobic conditions, only malate and fumarate stimulated pyruvate decarboxylation; succinate had no effect. This implies that the aerobic metabolism of succinate, presumably to other dicarboxylic acids, may be required for the stimulation. Incubation of sonicated mitochondria with pyruvate plus fumarate, under rate-limiting concentrations of NAD+, resulted in approximately equal quantities of pyruvate utilized and succinate formed, suggesting that pyruvate oxidation and fumarate reduction may be linked. Branched-chain, volatile fatty acids were not formed during incubations with either malate or succinate, or succinate plus acetate. However, incubations of intact Ascaris mitochondria with pyruvate plus succinate yielded 2-methylbutyrate and 2-methylvalerate, whereas incubations with pyruvate plus propionate yielded almost exclusively 2-methylvalerate. Oxygen dramatically inhibited the synthesis of the branched-chain acids from succinate plus pyruvate, attesting to the apparent anaerobic nature of Ascaris mitochondrial metabolism. Significantly, the addition of glucose plus ADP stimulated the formation of all volatile fatty acids. Therefore, the synthesis of branched-chain acids may be related directly to increased energy generation. Alternatively, they may function in the regulatory role of maintaining the mitochondrial redox balance.

  11. Synthesis of non-aggregated nicotinic acid coated magnetite nanorods via hydrothermal technique

    NASA Astrophysics Data System (ADS)

    Attallah, Olivia A.; Girgis, E.; Abdel-Mottaleb, Mohamed M. S. A.

    2016-02-01

    Non-aggregated magnetite nanorods with average diameters of 20-30 nm and lengths of up to 350 nm were synthesized via in situ, template free hydrothermal technique. These nanorods capped with different concentrations (1, 1.5, 2 and 2.5 g) of nicotinic acid (vitamin B3); possessed good magnetic properties and easy dispersion in aqueous solutions. Our new synthesis technique maintained the uniform shape of the nanorods even with increasing the coating material concentration. The effect of nicotinic acid on the shape, particle size, chemical structure and magnetic properties of the prepared nanorods was evaluated using different characterization methods. The length of nanorods increased from 270 nm to 350 nm in nicotinic acid coated nanorods. Goethite and magnetite phases with different ratios were the dominant phases in the coated samples while a pure magnetite phase was observed in the uncoated one. Nicotinic acid coated magnetic nanorods showed a significant decrease in saturation magnetization than uncoated samples (55 emu/g) reaching 4 emu/g in 2.5 g nicotinic acid coated sample. The novel synthesis technique proved its potentiality to prepare coated metal oxides with one dimensional nanostructure which can function effectively in different biological applications.

  12. Synthesis of side chain N,N'-diaminoalkylated derivatives of basic amino acids for application in solid-phase peptide synthesis.

    PubMed

    Pitteloud, Jean-Philippe; Bionda, Nina; Cudic, Predrag

    2013-01-01

    Despite the enormous therapeutic potential, the clinical use of peptides has been limited by their poor bioavailability and low stability under physiological conditions. Hence, efforts have been undertaken to alter peptide structure in ways to improve their pharmacological properties. Inspired by the importance of basic amino acids in biological systems and the remarkable versatility displayed by lysine during the synthesis of complex peptide scaffolds, this chapter describes a simple procedure that enables rapid access to protected N,N'-diaminoalkylated basic amino acid building blocks suitable for standard solid-phase peptide synthesis. This procedure allows preparation of symmetrical, as well as unsymmetrical, dialkylated amino acid derivatives that can be further modified, enhancing their synthetic utility. The suitability of the synthesized branched basic amino acid building blocks for use in standard solid-phase peptide synthesis has been demonstrated by synthesis of an indolicidin analog in which the lysine residue was substituted with its synthetic polyamino derivate. The substitution provided indolicidin analog with increase net positive charge, more ordered secondary structure in biological membranes mimicking conditions, and enhanced antibacterial activity without altering hemolytic activity. Taking into consideration the increasing interest for peptides with unusual structural features due to their improved biological properties, the described synthesis of polyfunctional amino acid building blocks is of particular practical value.

  13. The effects of borate minerals on the synthesis of nucleic acid bases, amino acids and biogenic carboxylic acids from formamide.

    PubMed

    Saladino, Raffaele; Barontini, Maurizio; Cossetti, Cristina; Di Mauro, Ernesto; Crestini, Claudia

    2011-08-01

    The thermal condensation of formamide in the presence of mineral borates is reported. The products afforded are precursors of nucleic acids, amino acids derivatives and carboxylic acids. The efficiency and the selectivity of the reaction was studied in relation to the elemental composition of the 18 minerals analyzed. The possibility of synthesizing at the same time building blocks of both genetic and metabolic apparatuses, along with the production of amino acids, highlights the interest of the formamide/borate system in prebiotic chemistry.

  14. Synthesis and characterization of agricultural controllable humic acid superabsorbent.

    PubMed

    Gao, Lijuan; Wang, Shiqiang; Zhao, Xuefei

    2013-12-01

    Humic acid superabsorbent polymer (P(AA/AM-HA)) and superabsorbent polymer (P(AA/AM)) were synthesized by aqueous solution polymerization method using acrylic acid (AA), acrylamide (AM) and humic acid (HA) as raw material. The effects of N,N'-methylenebisacrylamide (MBA) crosslinking agent, potassium peroxydisulfate (KPS) initiator, reaction temperature, HA content, ratio of AA to AM, concentration of monomer and neutralization of AA on water absorption were investigated. Absorption and desorption ratios of nitrogen fertilizer and phosphate fertilizer were also investigated by determination of absorption and desorption ratio of NH4(+), PO4(3-) on P(AA/AM-HA) and P(AA/AM). The P(AA/AM-HA) and P(AA/AM) were characterized by Fourier translation infrared spectroscopy, biological photomicroscope and scanning electron microscopy (SEM). The optimal conditions obtained were as follows: the weight ratio of MBA to AA and AM was 0.003; the weight ratio of KPS to AA and AM was 0.008; the weight ratio of HA to AA was 0.1; the mole ratio of AM to AA is 0.1; the mole ratio of NaOH to AA is 0.9; the reaction temperature was 60°C. P(AA/AM-HA) synthesized under optimal conditions, has a good saline tolerance, its water absorbency in distilled water and 0.9 wt.% saline solution is 1180 g/g and 110 g/g, respectively. P(AA/AM-HA) achieves half saturation in 6.5 min. P(AA/AM-HA) is superior to P(AA/AM) on absorption of NH4(+), PO4(3-). The SEM micrograph of P(AA/AM-HA) shows a fine alveolate structure. The biological optical microscope micrograph of P(AA/AM-HA) shows a network structure. Graft polymerization between P(AA/AM) and HA was demonstrated by infrared spectrum. The P(AA/AM-HA) superabsorbent has better absorbing ability of water and fertilizer, electrolytic tolerance and fewer cost than P(AA/AM) superabsorbent.

  15. Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

    PubMed Central

    Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

    1983-01-01

    Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

  16. The Synthesis and Isolation of N-Tert-Butyl-2-Phenylsuccinamic Acid and N-Tert-Butyl-3-Phenylsuccinamic Acid: An Undergraduate Organic Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis

    2004-01-01

    The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…

  17. Differential modulation of citrate synthesis and release by fatty acids in perfused working rat hearts.

    PubMed

    Vincent, Genevieve; Bouchard, Bertrand; Khairallah, Maya; Des Rosiers, Christine

    2004-01-01

    The objective of this study was to test the effect of increasing fatty acid concentrations on substrate fluxes through pathways leading to citrate synthesis and release in the heart. This was accomplished using semirecirculating work-performing rat hearts perfused with substrate mixtures mimicking the in situ milieu (5.5 mM glucose, 8 nM insulin, 1 mM lactate, 0.2 mM pyruvate, and 0.4 mM oleate-albumin) and 13C methods. Raising the fatty acid concentration from 0.4 to 1 mM with long-chain oleate or medium-chain octanoate resulted in a lowering ( approximately 20%) of cardiac output and efficiency with unaltered O2 consumption. At the metabolic level, beyond the expected effects of high fatty acid levels on the contribution of pyruvate decarboxylation (reduced >3-fold) and beta-oxidation (enhanced approximately 3-fold) to citrate synthesis, there was also a 2.4-fold lowering of anaplerotic pyruvate carboxylation. Despite the dual inhibitory effect of high fatty acids on pyruvate decarboxylation and carboxylation, tissue citrate levels were twofold higher, but citrate release rates remained unchanged at 11-14 nmol/min, representing <0.5% of citric acid cycle flux. A similar trend was observed for most metabolic parameters after oleate or octanoate addition. Together, these results emphasize a differential modulation of anaplerotic pyruvate carboxylation and citrate release in the heart by fatty acids. We interpret the lack of effects of high fatty acid concentrations on citrate release rates as suggesting that, under physiological conditions, this process is maximal, probably limited by the activity of its mitochondrial or plasma membrane transporter. Limited citrate release at high fatty acid concentrations may have important consequences for the heart's fuel metabolism and function.

  18. Synthesis of acid-base bifunctional mesoporous materials by oxidation and thermolysis

    SciTech Connect

    Yu, Xiaofang; Zou, Yongcun; Wu, Shujie; Liu, Heng; Guan, Jingqi; Kan, Qiubin

    2011-06-15

    Graphical abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst. The obtained sample of SO{sub 3}H-MCM-41-NH{sub 2} containing amine and sulfonic acids exhibits excellent catalytic activity in aldol condensation reaction. Research highlights: {yields} Synthesize acid-base bifunctional mesoporous materials SO{sub 3}H-MCM-41-NH{sub 2}. {yields} Oxidation and then thermolysis to generate acidic site and basic site. {yields} Exhibit good catalytic performance in aldol condensation reaction between acetone and various aldehydes. -- Abstract: A novel and efficient method has been developed for the synthesis of acid-base bifunctional catalyst SO{sub 3}H-MCM-41-NH{sub 2}. This method was achieved by co-condensation of tetraethylorthosilicate (TEOS), 3-mercaptopropyltrimethoxysilane (MPTMS) and (3-triethoxysilylpropyl) carbamicacid-1-methylcyclohexylester (3TAME) in the presence of cetyltrimethylammonium bromide (CTAB), followed by oxidation and then thermolysis to generate acidic site and basic site. X-ray diffraction (XRD) and transmission electron micrographs (TEM) show that the resultant materials keep mesoporous structure. Thermogravimetric analysis (TGA), X-ray photoelectron spectra (XPS), back titration, solid-state {sup 13}C CP/MAS NMR and solid-state {sup 29}Si MAS NMR confirm that the organosiloxanes were condensed as a part of the silica framework. The bifunctional sample (SO{sub 3}H-MCM-41-NH{sub 2}) containing amine and sulfonic acids exhibits excellent acid-basic properties, which make it possess high activity in aldol condensation reaction between acetone and various aldehydes.

  19. Synthesis and biological activity of hydroxylated derivatives of linoleic acid and conjugated linoleic acids.

    PubMed

    Li, Zhen; Tran, Van H; Duke, Rujee K; Ng, Michelle C H; Yang, Depo; Duke, Colin C

    2009-03-01

    Allylic hydroxylated derivatives of the C18 unsaturated fatty acids were prepared from linoleic acid (LA) and conjugated linoleic acids (CLAs). The reaction of LA methyl ester with selenium dioxide (SeO(2)) gave mono-hydroxylated derivatives, 13-hydroxy-9Z,11E-octadecadienoic acid, 13-hydroxy-9E,11E-octadecadienoic acid, 9-hydroxy-10E,12Z-octadecadienoic acid and 9-hydroxy-10E,12E-octadecadienoic acid methyl esters. In contrast, the reaction of CLA methyl ester with SeO(2) gave di-hydroxylated derivatives as novel products including, erythro-12,13-dihydroxy-10E-octadecenoic acid, erythro-11,12-dihydroxy-9E-octadecenoic acid, erythro-10,11-dihydroxy-12E-octadecenoic acid and erythro-9,10-dihydroxy-11E-octadecenoic acid methyl esters. These products were purified by normal-phase short column vacuum chromatography followed by high-performance liquid chromatography (HPLC). Their chemical structures were characterized by liquid chromatography-mass spectrometry (LC-MS) and nuclear magnetic resonance spectroscopy (NMR). The allylic hydroxylated derivatives of LA and CLA exhibited moderate in vitro cytotoxicity against a panel of human cancer cell lines including chronic myelogenous leukemia K562, myeloma RPMI8226, hepatocellular carcinoma HepG2 and breast adenocarcinoma MCF-7 cells (IC(50) 10-75 microM). The allylic hydroxylated derivatives of LA and CLA also showed toxicity to brine shrimp with LD(50) values in the range of 2.30-13.8 microM. However these compounds showed insignificant toxicity to honeybee at doses up to 100 microg/bee.

  20. Synthesis of 11-Thialinoleic Acid and 14-Thialinoleic Acid, Inhibitors of Soybean and Human Lipoxygenases

    PubMed Central

    Jacquot, Cyril; McGinley, Chris M.; Plata, Erik; Holman, Theodore R.

    2010-01-01

    Lipoxygenases catalyse the oxidation of polyunsaturated fatty acids and have been invoked in many diseases including cancer, atherosclerosis and Alzheimer’s disease. Currently, no X-ray structures are available with substrate or substrate analogues bound in a productive conformation. Such structures would be very useful for examining interactions between substrate and active site residues. Reported here are the syntheses of linoleic acid analogues containing a sulphur atom at the 11 or 14 positions. The key steps in the syntheses were the incorporation of sulphur using nucleophilic attack of metallated alkynes on electrophilic sulphur compounds and the subsequent stereospecific tantalum-mediated reduction of the alkynylsulphide to the cis-alkenylsulphide. Kinetic assays performed with soybean lipoxygenase-1 showed that both 11-thialinoleic acid and 14-thialinoleic acid were competitive inhibitors with respect to linoleic acid with Ki values of 22 and 35 µM, respectively. On the other hand, 11-thialinoleic acid was a noncompetitive inhibitor with respect to arachidonic acid with Kis and Kii values of 48 and 36 µM, respectively. 11-Thialinoleic acid was also a noncompetitive inhibitor of human 15-lipoxygenase-1 with arachidonic acid (Kis = 11.4 µM, Kii = 18.1 µM) or linoleic acid as substrate (Kis = 20.1 µM, Kii = 20.0 µM), and a competitive inhibitor of human 12-lipoxygenase with arachidonic acid as substrate (Ki = 2.5 µM). The presence of inhibitor did not change the regioselectivity of soybean lipoxygenase-1, human 12- or 15-lipoxygenase-1. PMID:18972057

  1. Control of the Synthesis of Macromolecules During Amino Acid and Thymine Starvation in Bacillus subtilis

    PubMed Central

    Anraku, Naoyo; Landman, Otto E.

    1968-01-01

    Studies of Maaløe, Lark, and others with amino acid- and thymine-starved cultures revealed successive steps in the biosynthesis of Escherichia coli chromosomes. In this study, the corresponding mechanisms in Bacillus subtilis 168 were examined. Using a strain requiring both thymine and tryptophan, we found that, 3 hr after the start of amino acid starvation, when the deoxyribonucleic acid (DNA) content of the culture had increased 40 to 50%, DNA synthesis ceased. After 4 to 5 hr, 100% of the cells were immune to thymineless death; their chromosomes had presumably been completed. Immune cultures slowly incorporated 3H-thymine. Thymine incorporation increased 20-fold 30 min after readdition of amino acids, indicating reinitiation of chromosome synthesis. Simultaneous presence of amino acids and thymine was required for reinitiation. If 5-bromouracil (5-BU) was added instead of thymine, newly replicated DNA segments could be separated by centrifugation in CsCl. Analysis of the CsCl fractions by a transformation assay showed that the order in which the markers were synthesized was ade-16, thr-5, leu-8, metB5. Less than half the chromosomes started resynthesis synchronously in 5-BU. Nevertheless, chromosome alignment in the amino acid-starved culture is probably very good: marker frequency analysis of its DNA gives the same normalized frequencies as DNA from “perfectly” aligned spores. Full viability is maintained in the chromosome-arrested culture for 10 hr in thymine-free medium in the absence or presence of amino acids. In the latter condition, protein synthesis proceeds, and the cells filament and become more lysozyme-sensitive. Such cells must be incubated and plated on hypertonic or on slow-growth media; otherwise, they undergo “quasiosmotic” thymineless death. This death is thus apparently not directly attributable to any damage of chromosomal DNA. Further, weakening of the teichoic acid portion of the cell wall is not involved, since 32P incorporation

  2. Omega-6 and omega-3 fatty acids metabolism pathways in the body of pigs fed diets with different sources of fatty acids.

    PubMed

    Skiba, Grzegorz; Poławska, Ewa; Sobol, Monika; Raj, Stanisława; Weremko, Dagmara

    2015-01-01

    This study was carried out on 24 gilts (♀ Polish Large White × ♂ Danish Landrace) grown with body weight (BW) of 60 to 105 kg. The pigs were fed diets designed on the basis of a standard diet (appropriate for age and BW of pigs) where a part of the energy content was replaced by different fat supplements: linseed oil in Diet L, rapeseed oil in Diet R and fish oil in Diet F (6 gilts per dietary treatment). The fat supplements were sources of specific fatty acids (FA): in Diet L α-linolenic acid (C18:3 n-3, ALA); in Diet R linoleic acid (C18:2 n-6, LA) and in Diet F eicosapentaenoic acid (C20:5 n-3, EPA), docosapentaenoic acid (C22:5 n-3, DPA) and docosahexaenoic acid (C22:6 n-3, DHA). The protein, fat and total FA contents in the body did not differ among groups of pigs. The enhanced total intake of LA and ALA by pigs caused an increased deposition of these FA in the body (p < 0.01) and an increased potential body pool of these acids for further metabolism/conversions. The conversion efficiency of LA and ALA from the feed to the pig's body differed among groups (p < 0.01) and ranged from 64.4% to 67.2% and from 69.4% to 81.7%, respectively. In Groups L and R, the level of de novo synthesis of long-chain polyunsaturated FA was higher than in Group F. From the results, it can be concluded that the efficiency of deposition is greater for omega-3 FA than for omega-6 FA and depends on their dietary amount. The level of LA and ALA intake influences not only their deposition in the body but also the end products of the omega-3 and omega-6 pathways.

  3. Synthesis and cytotoxic evaluation of novel paraconic acid analogs.

    PubMed

    Le Floch, Camille; Le Gall, Erwan; Léonel, Eric; Martens, Thierry; Cresteil, Thierry

    2011-12-01

    A novel class of 2,3-tri- and tetrasubstituted γ-butyrolactones analogous to paraconic acids has been synthesized in one step using a straightforward three-component reaction among aryl bromides, dimethyl itaconate and carbonyl compounds. The in vitro cytotoxic activity of representative compounds has been evaluated against a panel of human cancer cell lines (KB, HCT116, MCF7, HL60). While most molecules exhibit a low to moderate background activity on both KB and HL60 cancer cell lines, one compound shows increased antiproliferative activities against both cell lines with IC(50) values in the 10(-7)-10(-6)mol/L range. An extended evaluation indicated that this compound also inhibits PC3, SK-OV3, MCF7R and HL60R cell growth in the same fashion.

  4. Radiation synthesis of nanosilver nanohydrogels of poly(methacrylic acid)

    NASA Astrophysics Data System (ADS)

    Gupta, Bhuvanesh; Gautam, Deepti; Anjum, Sadiya; Saxena, Shalini; Kapil, Arti

    2013-11-01

    Nanosilver nanohydrogels (nSnH) of poly(methacrylic acid) were synthesized and stabilized using gamma irradiation. The main objective of this study was to develop silver nanoparticles and to evaluate the antimicrobial activity. Radiation helps in the polymerization, crosslinking and reduction of silver nitrate as well. Highly stable and uniformly distributed silver nanoparticles have been obtained within hydrogel network by water in oil nanoemulsion polymerization and were evaluated by dynamic light scattering (DLS) and transmission electron microscopy (TEM) respectively. TEM showed almost spherical and uniform distribution of silver nanoparticles through the hydrogel network. The mean size of silver nanoparticles ranging is 10-50 nm. The nanohydrogels showed good swelling in water. Antibacterial studies of nSnH suggest that it can be a good candidate as coating material in biomedical applications.

  5. Synthesis and cholinesterase inhibition of cativic acid derivatives.

    PubMed

    Alza, Natalia P; Richmond, Victoria; Baier, Carlos J; Freire, Eleonora; Baggio, Ricardo; Murray, Ana Paula

    2014-08-01

    Alzheimer's disease (AD) is a neurodegenerative disorder associated with memory impairment and cognitive deficit. Most of the drugs currently available for the treatment of AD are acetylcholinesterase (AChE) inhibitors. In a preliminary study, significant AChE inhibition was observed for the ethanolic extract of Grindelia ventanensis (IC₅₀=0.79 mg/mL). This result prompted us to isolate the active constituent, a normal labdane diterpenoid identified as 17-hydroxycativic acid (1), through a bioassay guided fractionation. Taking into account that 1 showed moderate inhibition of AChE (IC₅₀=21.1 μM), selectivity over butyrylcholinesterase (BChE) (IC₅₀=171.1 μM) and that it was easily obtained from the plant extract in a very good yield (0.15% w/w), we decided to prepare semisynthetic derivatives of this natural diterpenoid through simple structural modifications. A set of twenty new cativic acid derivatives (3-6) was prepared from 1 through transformations on the carboxylic group at C-15, introducing a C2-C6 linker and a tertiary amine group. They were tested for their inhibitory activity against AChE and BChE and some structure-activity relationships were outlined. The most active derivative was compound 3c, with an IC₅₀ value of 3.2 μM for AChE. Enzyme kinetic studies and docking modeling revealed that this inhibitor targeted both the catalytic active site and the peripheral anionic site of this enzyme. Furthermore, 3c showed significant inhibition of AChE activity in SH-SY5Y human neuroblastoma cells, and was non-cytotoxic.

  6. Expanding the amino acid repertoire of ribosomal polypeptide synthesis via the artificial division of codon boxes

    NASA Astrophysics Data System (ADS)

    Iwane, Yoshihiko; Hitomi, Azusa; Murakami, Hiroshi; Katoh, Takayuki; Goto, Yuki; Suga, Hiroaki

    2016-04-01

    In ribosomal polypeptide synthesis the library of amino acid building blocks is limited by the manner in which codons are used. Of the proteinogenic amino acids, 18 are coded for by multiple codons and therefore many of the 61 sense codons can be considered redundant. Here we report a method to reduce the redundancy of codons by artificially dividing codon boxes to create vacant codons that can then be reassigned to non-proteinogenic amino acids and thereby expand the library of genetically encoded amino acids. To achieve this, we reconstituted a cell-free translation system with 32 in vitro transcripts of transfer RNASNN (tRNASNN) (S = G or C), assigning the initiator and 20 elongator amino acids. Reassignment of three redundant codons was achieved by replacing redundant tRNASNNs with tRNASNNs pre-charged with non-proteinogenic amino acids. As a demonstration, we expressed a 32-mer linear peptide that consists of 20 proteinogenic and three non-proteinogenic amino acids, and a 14-mer macrocyclic peptide that contains more than four non-proteinogenic amino acids.

  7. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  8. Oxidative cleavage of erucic acid for the synthesis of brassylic acid

    SciTech Connect

    Mohammed J. Nasrullah; Pooja Thapliyal; Erica N. Pfarr; Nicholas S. Dusek; Kristofer L. Schiele; James A. Bahr

    2010-10-29

    The main focus of this work is to synthesize Brassylic Acid (BA) using oxidative cleavage of Erucic Acid (EA). Crambe (Crambe abyssinica) is an industrial oilseed grown in North Dakota. Crambe has potential as an industrial fatty acid feedstock as a source of Erucic acid (EA). It has approximately 50-60 % of EA, a C{sub 22} monounsaturated fatty acid. Oxidative cleavage of unsaturated fatty acids derived from oilseeds produces long chain (9, 11, and 13 carbon atoms) dibasic and monobasic acids. These acids are known commercial feedstocks for the preparation of nylons, polyesters, waxes, surfactants, and perfumes. Other sources of EA are Rapeseed seed oil which 50-60 % of EA. Rapeseed is grown outside USA. The oxidative cleavage of EA was done using a high throughput parallel pressure reactor system. Kinetics of the reaction shows that BA yields reach a saturation at 12 hours. H{sub 2}WO{sub 4} was found to be the best catalyst for the oxidative cleavage of EA. High yields of BA were obtained at 80 C with bubbling of O{sub 2} or 10 bar of O{sub 2} for 12 hours.

  9. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    1999-01-01

    A process of preparing an acid addition salt of delta-aminolevulinic acid comprising: dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures thereof to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing said alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  10. Synthesis of an acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, L.

    1999-05-25

    A process is disclosed for preparing an acid addition salt of delta-aminolevulinic acid comprising. The process involves dissolving a lower alkyl 5-bromolevulinate and an alkali metal diformylamide in an organic solvent selected from the group consisting of acetonitrile, methanol, tetrahydrofuran, 2-methyltetrahydrofuran and methylformate or mixtures to form a suspension of an alkyl 5-(N,N-diformylamino) levulinate ester; and hydrolyzing the alkyl 5-(N,N-diformylamino) levulinate with an inorganic acid to form an acid addition salt of delta-amino levulinic acid.

  11. Synthesis and Physical Properties of Estolide Ester Using Saturated Fatty Acid and Ricinoleic Acid

    PubMed Central

    Salimon, Jumat; Nallathamby, Neeranjini; Salih, Nadia; Abdullah, Bashar Mudhaffar

    2011-01-01

    A study was conveyed to produce estolide ester using ricinoleic acid as the backbone. The ricinoleic acid reacted with saturated fatty acid from C8–C18. These reactions were conducted under vacuum at 60°C for 24 h without solvent. The reaction used acid catalyst, sulphuric acid. The new saturate ricinoleic estolide esters show superior low-temperature properties (−52 ± 0.08°C) and high flash point (>300°C). The yield of the neat estolide esters ranged from 52% to 96%. The viscosity range was 51 ± 0.08 to 86 ± 0.01 cp. These new saturated estolide esters were also compared with saturated branched estolide esters. PMID:22007150

  12. Digestion and deposition of individual fatty acids in growing-finishing pigs fed diets containing either beef tallow or sunflower oil.

    PubMed

    Mitchaothai, J; Everts, H; Yuangklang, C; Wittayakun, S; Vasupen, K; Wongsuthavas, S; Srenanul, P; Hovenier, R; Beynen, A C

    2008-08-01

    The apparent digestibility and deposition in carcass of individual dietary fatty acids (FA) were determined in growing-finishing pigs fed diets containing either beef tallow or sunflower oil. The beef tallow was rich in saturated FA (SFA) and the sunflower oil had a high content of polyunsaturated FA (PUFA). A total of 39 barrows was used. The experimental diets contained 5% (w/w) of the variable fat source and were fed ad libitum. The dietary fat type had no effect (p > 0.05) on growth performance, even though the apparent digestibilities of crude fat and crude protein were higher (p < 0.05) in the animals fed sunflower oil. The pigs fed the sunflower oil diet showed higher apparent digestibilities (p < 0.05) of the sum of SFA, monounsaturated FA (MUFA) and PUFA, but had a lower digestibility (p < 0.05) of stearic acid. The intakes of individual digestible FA were derived feed intake data, FA contents of the diets and the digestibility of individual FA. For the entire feeding period of 13 weeks, the ratio of deposition in carcass to intake of digestible FA was increased (p < 0.05) for palmitic and stearic acid in the pigs fed sunflower oil, but the ratios for oleic acid and linoleic acid were decreased (p < 0.001). In the pigs fed sunflower oil instead of beef tallow, the deposition:intake ratio was raised for the SFA (p < 0.001), but diminished for the MUFA (p < 0.05). The calculated minimum de novo synthesis of SFA was increased (p < 0.05) and that of MUFA decreased (p < 0.05) in the pigs fed sunflower oil. It is concluded that the feeding of a diet with sunflower oil instead of beef tallow improved apparent digestibility of SFA, MUFA and PUFA, increased the deposition:digestible intake ratio for SFA, but lowered that for MUFA and PUFA.

  13. Enantiopure synthesis of dihydrobenzo[1,4]-oxazine-3-carboxylic acids and a route to benzoxazinyl oxazolidinones.

    PubMed

    Malhotra, Rajesh; Dey, Tushar K; Basu, Sourav; Hajra, Saumen

    2015-03-21

    A two step protocol is developed for the efficient synthesis of enantiopure N-Boc-dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 from serine derived cyclic sulfamidate via intramolecular arylamination. The RuPhos Palladacycle along with additional RuPhos ligand is found to be an efficient catalyst for the arylamination of β-(2-bromoaryloxy)amino acids 3 to provide easy and direct access to a variety of dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids 4 with complete retention of enantiopurity in moderate to high yields. Dihydrobenzo[b]-1,4-oxazine-3-carboxylic acids are not only important unnatural amino acids, but are key precursors for the synthesis of important compounds such as benzoxazinyl oxazolidinones. A general approach for the synthesis of benzoxazinyl oxazolidinone is presented.

  14. The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.

    PubMed

    Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S

    2015-08-21

    The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.

  15. Synthesis and Characterization of Hybrid Hyaluronic Acid-Gelatin Hydrogels

    PubMed Central

    Camci-Unal, Gulden; Cuttica, Davide; Annabi, Nasim; Demarchi, Danilo; Khademhosseini, Ali

    2013-01-01

    Biomimetic hybrid hydrogels have generated broad interest in tissue engineering and regenerative medicine. Hyaluronic acid (HA) and gelatin (hydrolyzed collagen) are naturally derived polymers and biodegradable under physiological conditions. Moreover, collagen and HA are major components of the extracellular matrix (ECM) in most of the tissues (e.g. cardiovascular, cartilage, neural). When used as a hybrid material, HA-gelatin hydrogels may enable mimicking the ECM of native tissues. Although HA-gelatin hybrid hydrogels are promising biomimetic substrates, their material properties have not been thoroughly characterized in the literature. Herein, we generated hybrid hydrogels with tunable physical and biological properties by using different concentrations of HA and gelatin. The physical properties of the fabricated hydrogels including swelling ratio, degradation, and mechanical properties were investigated. In addition, in vitro cellular responses in both two and three dimensional (2D and 3D) culture conditions were assessed. It was found that the addition of gelatin methacrylate (GelMA) into HA methacrylate (HAMA) promoted cell spreading in the hybrid hydogels. Moreover, the hybrid hydrogels showed significantly improved mechanical properties compared to their single component analogs. The HAMA-GelMA hydrogels exhibited remarkable tunability behavior and may be useful for cardiovascular tissue engineering applications. PMID:23419055

  16. Template-directed synthesis of oligoguanylic acids - Metal ion catalysis

    NASA Technical Reports Server (NTRS)

    Bridson, P. K.; Fakhrai, H.; Lohrmann, R.; Orgel, L. E.; Van Roode, M.

    1981-01-01

    The effects of Zn(2+), Pb(2+) and other metal ions on the efficiency and stereo-selectivity of the template-directed oligomerization of guanosine 5'-phosphorimidazolide are investigated. Reactions were run in the presence of a polyC template in a 2,6-lutidine buffer, and products analyzed by high-performance liquid chromatography on an RPC-5 column. The presence of the Pb(2+) ion is found to lead to the formation of 2'-5' linked oligomers up to the 40-mer, while Zn(2+) favors the formation of predominantly 3'-5' linked oligomers up to the 35-mer. When amounts of uracil, cytidine or adenosine 5'-phosphorimidazole equal to those of the guanosine derivative are included in the reaction mixture, the incorrect base is incorporated into the oligomer about 10% of the time with a Pb(2+) catalyst, but less than 0.5% of the time with Zn(2+). The Sn(2+), Sb(3+) and Bi(3+) ions are also found to promote the formation of 2'-5' oligomers, although not as effectively as Pb(2+), while no metal ions other than Zn(2+) promote the formation of the 3'-5' oligomers. The results may be important for the understanding of the evolution of nucleic acid replication in the absence of enzymes.

  17. The effects of retinoic acid on immunoglobulin synthesis: Role of interleukin 6

    SciTech Connect

    Ballow, M.; Xiang, Shunan; Wang, Weiping; Brodsky, L. |

    1996-05-01

    Retinoic acid (RA) and its parent compound, retinol (ROH, vitamin A), have been recognized as important immunopotentiating agents. Previous studies from our laboratory have demonstrated that PA can augment formalin-treated Staphylococcus aureus (SAC) stimulated immunoglobulin (Ig) synthesis of cord blood mononuclear cells (CBMC). To determine the mechanism(s) by which RA modulates Ig synthesis, we studied the effects of RA on B cells and cytokine production. The addition of RA (10{sup -5} to 10{sup -10} M) to Epstein-Barr virus (EBV)-transformed B-cell clones derived from either adult or cord blood B cells augmented Ig secretion twofold. In contrast, cell proliferation was inhibited as measured by {sup 3}H-thymidine incorporation. We evaluated two cytokines known to be constitutively produced by EBV cell lines, IL-1 and IL-6. While RA had no effect on IL-1 production, IL-6 synthesis was greatly enhanced (20- to 45-fold), which was also reflected by an increase in steady-state mRNA levels for IL-6 but not TNF-{alpha} or TGF-{beta} on Northern blot analysis. Polyclonal rabbit anti-IL-6 antibodies were used to block the augmenting effects of RA on Ig synthesis of adenoidal B cells. RA-induced augmentation in IgG and IgA synthesis was blocked 58 and 29%, respectively, by anti-IL-6 antibodies. These studies suggest that the enhancing effects of RA on Ig synthesis are mediated, at least in part, by the autocrine or paracrine effects of IL-6 on B-cell differentiation. 37 refs., 5 figs.

  18. Synthesis of tricyclic indole-2-carboxylic [correction of caboxylic] acids as potent NMDA-glycine antagonists.

    PubMed

    Katayama, S; Ae, N; Nagata, R

    2001-05-18

    The practical synthesis of a series of tricyclic indole-2-carboxylic acids, 7-chloro-3-arylaminocarbonylmethyl-1,3,4,5-tetrahydrobenz[cd]indole-2-carboxylic acids, as a new class of potent NMDA-glycine antagonists is described. The synthetic route to the key intermediate 12a comprises a regioselective iodination of 4-chloro-2-nitrotoluene, modified Reissert indole synthesis, Jeffery's Heck-type reaction with allyl alcohol, Wittig-Horner-Emmons reaction, and iodination at the indole C-3 position. The key step in the route is an intramolecular cyclization of 12a to give the tricyclic indole structure. Two methods of cyclization, (1) an intramolecular radical cyclization of 12a and (2) a sequence of intramolecular Heck reaction of 12a followed by a 1,4-reduction, were performed. The resulting tricyclic indole diester 13a was selectively hydrolyzed to afford the desired tricyclic indole monocarboxylic acid 16 on a multihundred gram scale without any chromatographic purifications. Optical resolution of 16 to (-)-isomer 17 and (+)-isomer 18 was carried out, and the resulting isomers were derivatized, respectively. Evaluation of the optically active derivatives for affinity to the NMDA-glycine binding site using the radio ligand binding assay with [(3)H]-5,7-dichlorokynurenic acid revealed that the derivatives of (-)-isomer 17 were more potent than the others and that especially substituted anilide (-)-isomer 24 (K(i) = 0.8 nM) showed high affinity.

  19. Downregulation of de Novo Fatty Acid Synthesis in Subcutaneous Adipose Tissue of Moderately Obese Women.

    PubMed

    Guiu-Jurado, Esther; Auguet, Teresa; Berlanga, Alba; Aragonès, Gemma; Aguilar, Carmen; Sabench, Fàtima; Armengol, Sandra; Porras, José Antonio; Martí, Andreu; Jorba, Rosa; Hernández, Mercè; del Castillo, Daniel; Richart, Cristóbal

    2015-12-16

    The purpose of this work was to evaluate the expression of fatty acid metabolism-related genes in human adipose tissue from moderately obese women. We used qRT-PCR and Western Blot to analyze visceral (VAT) and subcutaneous (SAT) adipose tissue mRNA expression involved in de novo fatty acid synthesis (ACC1, FAS), fatty acid oxidation (PPARα, PPARδ) and inflammation (IL6, TNFα), in normal weight control women (BMI < 25 kg/m², n = 35) and moderately obese women (BMI 30-38 kg/m², n = 55). In SAT, ACC1, FAS and PPARα mRNA expression were significantly decreased in moderately obese women compared to controls. The downregulation reported in SAT was more pronounced when BMI increased. In VAT, lipogenic-related genes and PPARα were similar in both groups. Only PPARδ gene expression was significantly increased in moderately obese women. As far as inflammation is concerned, TNFα and IL6 were significantly increased in moderate obesity in both tissues. Our results indicate that there is a progressive downregulation in lipogenesis in SAT as BMI increases, which suggests that SAT decreases the synthesis of fatty acid de novo during the development of obesity, whereas in VAT lipogenesis remains active regardless of the degree of obesity.

  20. Steroselective synthesis and application of L-( sup 15 N) amino acids

    SciTech Connect

    Unkefer, C.J. ); Lodwig, S.N. . Div. of Science)

    1991-01-01

    We have developed two general approaches to the stereoselective synthesis of {sup 15}N- and {sup 13}C-labeled amino acids. First, labeled serine, biosynthesized using the methylotrophic bacterium M. extorquens AM1, serves as a chiral precursor for the synthesis of other amino acids. For example, pyridoxal phosphate enzymes can be used for the conversion of L-({alpha}-{sup 15}N)serine to L-({alpha}-{sup 15}N)tyrosine, L-({alpha}-{sup 15}N)tryptophan, and L-({alpha}-{sup 15}N)cysteine. In the second approach, developed by Oppolzer and Tamura, an electrophilic amination'' reagent, 1-chloro-1-nitrosocyclohexane, was used to convert chiral enolates into L-{alpha}-amino acids. We prepared 1-chloro-1-({sup 15}N) nitrosocyclohexane and used it to aminate chiral enolates to produce L-({alpha}-{sup 15}N)amino acids. The stereoselectivity of this scheme using the Oppolzer sultam chiral auxiliary is remarkable, producing enantiomer ratios of 200 to 1. 22 refs., 4 figs.

  1. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  2. Synthesis of fluorescent D-amino acids (FDAAs) and their use for probing peptidoglycan synthesis and bacterial growth in situ

    PubMed Central

    Kuru, Erkin; Tekkam, Srinivas; Hall, Edward

    2015-01-01

    Fluorescent D-amino acids (FDAAs) are efficiently incorporated into the peptidoglycan of diverse bacterial species at the sites of active peptidoglycan biosynthesis, allowing specific and covalent probing of bacterial growth with minimal perturbation. Here, we provide a protocol for the synthesis of four FDAAs emitting light in blue, green or red and for their use in peptidoglycan labeling of live bacteria. Our modular synthesis protocol gives easy access to a library of different FDAAs made with commercially available fluorophores. FDAAs can be synthesized in a typical chemistry laboratory in 2–3 days. The simple labeling procedure involves addition of the FDAAs to the bacterial sample for the desired labeling duration and stopping further label incorporation by fixation or by washing away excess dye. We discuss several scenarios for the use of these labels including short or long labeling durations, and the combination of different labels in pure culture or complex environmental samples. Depending on the experiment, FDAA labeling can take as little as 30 s for a rapidly growing species such as Escherichia coli. PMID:25474031

  3. Thyroid hormone activation of retinoic acid synthesis in hypothalamic tanycytes

    PubMed Central

    Stoney, Patrick N.; Helfer, Gisela; Rodrigues, Diana; Morgan, Peter J.

    2015-01-01

    Thyroid hormone (TH) is essential for adult brain function and its actions include several key roles in the hypothalamus. Although TH controls gene expression via specific TH receptors of the nuclear receptor class, surprisingly few genes have been demonstrated to be directly regulated by TH in the hypothalamus, or the adult brain as a whole. This study explored the rapid induction by TH of retinaldehyde dehydrogenase 1 (Raldh1), encoding a retinoic acid (RA)‐synthesizing enzyme, as a gene specifically expressed in hypothalamic tanycytes, cells that mediate a number of actions of TH in the hypothalamus. The resulting increase in RA may then regulate gene expression via the RA receptors, also of the nuclear receptor class. In vivo exposure of the rat to TH led to a significant and rapid increase in hypothalamic Raldh1 within 4 hours. That this may lead to an in vivo increase in RA is suggested by the later induction by TH of the RA‐responsive gene Cyp26b1. To explore the actions of RA in the hypothalamus as a potential mediator of TH control of gene regulation, an ex vivo hypothalamic rat slice culture method was developed in which the Raldh1‐expressing tanycytes were maintained. These slice cultures confirmed that TH did not act on genes regulating energy balance but could induce Raldh1. RA has the potential to upregulate expression of genes involved in growth and appetite, Ghrh and Agrp. This regulation is acutely sensitive to epigenetic changes, as has been shown for TH action in vivo. These results indicate that sequential triggering of two nuclear receptor signalling systems has the capability to mediate some of the functions of TH in the hypothalamus. GLIA 2016;64:425–439 PMID:26527258

  4. Synthesis and anticancer activity of novel fluorinated asiatic acid derivatives.

    PubMed

    Gonçalves, Bruno M F; Salvador, Jorge A R; Marín, Silvia; Cascante, Marta

    2016-05-23

    A series of novel fluorinated Asiatic Acid (AA) derivatives were successfully synthesized, tested for their antiproliferative activity against HeLa and HT-29 cell lines, and their structure activity relationships were evaluated. The great majority of fluorinated derivatives showed stronger antiproliferative activity than AA in a concentration dependent manner. The most active compounds have a pentameric A-ring containing an α,β-unsaturated carbonyl group. The compounds with better cytotoxic activity were then evaluated against MCF-7, Jurkat, PC-3, A375, MIA PaCa-2 and BJ cell lines. Derivative 14 proved to be the most active compound among all tested derivatives and its mechanism of action was further investigated in HeLa cell line. The results showed that compound 14 induced cell cycle arrest in G0/G1 stage as a consequence of up-regulation of p21(cip1/waf1) and p27(kip1) and down-regulation of cyclin D3 and Cyclin E. Furthermore, compound 14 was found to induce caspase driven-apoptosis with activation of caspases-8 and caspase-3 and the cleavage of PARP. The cleavage of Bid into t-Bid, the up-regulation of Bax and the down-regulation of Bcl-2 were also observed after treatment of HeLa cells with compound 14. Taken together, these mechanistic studies revealed the involvement of extrinsic and intrinsic pathways in the apoptotic process induced by compound 14. Importantly, the antiproliferative activity of this compound on the non-tumor BJ human fibroblast cell line is weaker than in the tested cancer cell lines. The enhanced potency (between 45 and 90-fold more active than AA in a panel of cancer cell lines) and selectivity of this new AA derivative warrant further preclinical evaluation.

  5. Direct synthesis of formic acid from carbon dioxide by hydrogenation in acidic media

    PubMed Central

    Moret, Séverine; Dyson, Paul J.; Laurenczy, Gábor

    2014-01-01

    The chemical transformation of carbon dioxide into useful products becomes increasingly important as CO2 levels in the atmosphere continue to rise as a consequence of human activities. In this article we describe the direct hydrogenation of CO2 into formic acid using a homogeneous ruthenium catalyst, in aqueous solution and in dimethyl sulphoxide (DMSO), without any additives. In water, at 40 °C, 0.2 M formic acid can be obtained under 200 bar, however, in DMSO the same catalyst affords 1.9 M formic acid. In both solvents the catalysts can be reused multiple times without a decrease in activity. Worldwide demand for formic acid continues to grow, especially in the context of a renewable energy hydrogen carrier, and its production from CO2 without base, via the direct catalytic carbon dioxide hydrogenation, is considerably more sustainable than the existing routes. PMID:24886955

  6. Effect of nitric acid concentrations on synthesis and stability of maghemite nanoparticles suspension.

    PubMed

    Nurdin, Irwan; Johan, Mohd Rafie; Yaacob, Iskandar Idris; Ang, Bee Chin

    2014-01-01

    Maghemite (γ-Fe2O3) nanoparticles have been synthesized using a chemical coprecipitation method at different nitric acid concentrations as an oxidizing agent. Characterization of all samples performed by several techniques including X-ray diffraction (XRD), transmission electron microscopy (TEM), alternating gradient magnetometry (AGM), thermogravimetric analysis (TGA), dynamic light scattering (DLS), and zeta potential. The XRD patterns confirmed that the particles were maghemite. The crystallite size of all samples decreases with the increasing concentration of nitric acid. TEM observation showed that the particles have spherical morphology with narrow particle size distribution. The particles showed superparamagnetic behavior with decreased magnetization values at the increasing concentration of nitric acid. TGA measurement showed that the stability temperature decreases with the increasing concentration of nitric acid. DLS measurement showed that the hydrodynamic particle sizes decrease with the increasing concentration of nitric acid. Zeta potential values show a decrease with the increasing concentration of nitric acid. The increasing concentration of nitric acid in synthesis of maghemite nanoparticles produced smaller size particles, lower magnetization, better thermal stability, and more stable maghemite nanoparticles suspension.

  7. Chemical synthesis and biological evaluation of ω-hydroxy polyunsaturated fatty acids.

    PubMed

    Hwang, Sung Hee; Wagner, Karen; Xu, Jian; Yang, Jun; Li, Xichun; Cao, Zhengyu; Morisseau, Christophe; Lee, Kin Sing Stephen; Hammock, Bruce D

    2017-02-01

    ω-Hydroxy polyunsaturated fatty acids (PUFAs), natural metabolites from arachidonic acid (ARA), eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) were prepared via convergent synthesis approach using two key steps: Cu-mediated CC bond formation to construct methylene skipped poly-ynes and a partial alkyne hydrogenation where the presence of excess 2-methyl-2-butene as an additive that is proven to be critical for the success of partial reduction of the poly-ynes to the corresponding cis-alkenes without over-hydrogenation. The potential biological function of ω-hydroxy PUFAs in pain was evaluated in naive rats. Following intraplantar injection, 20-hydroxyeicosatetraenoic acid (20-HETE, ω-hydroxy ARA) generated an acute decrease in paw withdrawal thresholds in a mechanical nociceptive assay indicating pain, but no change was observed from rats which received either 20-hydroxyeicosapentaenoic acid (20-HEPE, ω-hydroxy EPA) or 22-hydroxydocosahexaenoic acid (22-HDoHE, ω-hydroxy DHA). We also found that both 20-HEPE and 22-HDoHE are more potent than 20-HETE to activate murine transient receptor potential vanilloid receptor1 (mTRPV1).

  8. Induction of human choriogonadotropin in HeLa-cell cultures by aliphatic monocarboxylates and inhibitors of deoxyribonucleic acid synthesis

    PubMed Central

    Ghosh, Nimai K.; Rukenstein, Adriana; Cox, Rody P.

    1977-01-01

    The ectopic production of the glycopeptide hormone human placental choriogonadotropin by HeLa65 cells was measured by radioimmunoassay with antiserum against the β-subunit of choriogonadotropin and with the 125I-labelled β-subunit as a tracer antigen. Choriogonadotropin synthesis was markedly (500-fold) stimulated by sodium butyrate. Kinetic studies and the use of an inhibitor of protein synthesis, cycloheximide, indicated that protein synthesis was required for this induction. Investigation of the efficiency of 22 aliphatic short-chain fatty acids and derivatives in causing increased choriogonadotropin synthesis by HeLa cells showed stringent structural requirements. Induction of choriogonadotropin synthesis in HeLa cells was not restricted to butyrate. Other aliphatic acids (propionate, isobutyrate, valerate and hexanoate) were also capable of inducing choriogonadotropin synthesis at 10–50% of the efficiency of butyrate. Hydroxy derivatives of monocarboxylate inducers, related mono- and di-carboxylic acids, alcohols, amines, ketones, esters and sulphoxide were ineffective in increasing choriogonadotropin production by HeLa cells. A saturated C4 straight-chain acid without substituent hydroxyl groups but with a methyl group at one end and a carboxyl moiety at the other appeared to be most efficient in activating choriogonadotropin production. A second clonal line of HeLa cells, HeLa71, showed a higher constitutive synthesis of choriogonadotropin than HeLa65 cells, which was also markedly increased by butyrate. Butyrate and other aliphatic monocarboxylate inducers of choriogonadotropin synthesis inhibited HeLa-cell growth and DNA synthesis. This inhibition of DNA replication may be related to the mechanism of choriogonadotropin synthesis, since two well-characterized anti-neoplastic inhibitors of DNA synthesis, hydroxyurea and 1-β-d-arabinofuranosylcytosine, also stimulated a 300-fold increase in choriogonadotropin synthesis in HeLa cells and were synergistic

  9. Synthesis and structural characterisation of amides from picolinic acid and pyridine-2,6-dicarboxylic acid

    PubMed Central

    Devi, Prarthana; Barry, Sarah M.; Houlihan, Kate M.; Murphy, Michael J.; Turner, Peter; Jensen, Paul; Rutledge, Peter J.

    2015-01-01

    Coupling picolinic acid (pyridine-2-carboxylic acid) and pyridine-2,6-dicarboxylic acid with N-alkylanilines affords a range of mono- and bis-amides in good to moderate yields. These amides are of interest for potential applications in catalysis, coordination chemistry and molecular devices. The reaction of picolinic acid with thionyl chloride to generate the acid chloride in situ leads not only to the N-alkyl-N-phenylpicolinamides as expected but also the corresponding 4-chloro-N-alkyl-N-phenylpicolinamides in the one pot. The two products are readily separated by column chromatography. Chlorinated products are not observed from the corresponding reactions of pyridine-2,6-dicarboxylic acid. X-Ray crystal structures for six of these compounds are described. These structures reveal a general preference for cis amide geometry in which the aromatic groups (N-phenyl and pyridyl) are cis to each other and the pyridine nitrogen anti to the carbonyl oxygen. Variable temperature 1H NMR experiments provide a window on amide bond isomerisation in solution. PMID:25954918

  10. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    PubMed

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress.

  11. Rates of synthesis and degradation of ribosomal ribonucleic acid during differentiation of Dictyostelium discoideum.

    PubMed Central

    Mangiarotti, G; Altruda, F; Lodish, H F

    1981-01-01

    Synthesis of ribosomes and ribosomal ribonucleic acid (RNA) continued during differentiation of Dictyostelium discoideum concurrently with extensive turnover of ribosomes synthesized during both growth and developmental stages. We show here that the rate of synthesis of 26S and 17S ribosomal RNA during differentiation was less than 15% of that in growing cells, and by the time of sorocarp formation only about 25% of the cellular ribosomes had been synthesized during differentiation. Ribosomes synthesized during growth and differentiation were utilized in messenger RNA translation to the same extent; about 50% of each class were on polyribosomes. Ribosome degradation is apparently an all-or-nothing process, since virtually all 80S monosomes present in developing cells could be incorporated into polysomes when growth conditions were restored. By several criteria, ribosomes synthesized during growth and differentiation were functionally indistinguishable. Our data, together with previously published information on changes in the messenger RNA population during differentiation, indicate that synthesis of new ribosomes is not necessary for translation of developmentally regulated messenger RNA. We also establish that the overall rate of messenger RNA synthesis during differentiation is less than 15% of that in growing cells. PMID:6965093

  12. Rates of synthesis and degradation of ribosomal ribonucleic acid during differentiation of Dictyostelium discoideum.

    PubMed

    Mangiarotti, G; Altruda, F; Lodish, H F

    1981-01-01

    Synthesis of ribosomes and ribosomal ribonucleic acid (RNA) continued during differentiation of Dictyostelium discoideum concurrently with extensive turnover of ribosomes synthesized during both growth and developmental stages. We show here that the rate of synthesis of 26S and 17S ribosomal RNA during differentiation was less than 15% of that in growing cells, and by the time of sorocarp formation only about 25% of the cellular ribosomes had been synthesized during differentiation. Ribosomes synthesized during growth and differentiation were utilized in messenger RNA translation to the same extent; about 50% of each class were on polyribosomes. Ribosome degradation is apparently an all-or-nothing process, since virtually all 80S monosomes present in developing cells could be incorporated into polysomes when growth conditions were restored. By several criteria, ribosomes synthesized during growth and differentiation were functionally indistinguishable. Our data, together with previously published information on changes in the messenger RNA population during differentiation, indicate that synthesis of new ribosomes is not necessary for translation of developmentally regulated messenger RNA. We also establish that the overall rate of messenger RNA synthesis during differentiation is less than 15% of that in growing cells.

  13. Wickerhamiella brachini f.a., sp. nov., Wickerhamiella pterostichi f.a., sp. nov. and Wickerhamiella qilinensis f.a., sp. nov., three yeast species isolated from insects.

    PubMed

    Liu, Xiao-Jing; Wang, Yun; Ren, Yong-Cheng; Hui, Feng-Li

    2016-10-01

    Eight strains representing three novel yeast species were isolated from insects distributed in three localities in Nanyang, Henan Province, Central China during 2014 and 2015. Sequence analysis of the D1/D2 domains of the large subunit (LSU) rRNA gene revealed that these species are members of the Wickerhamiella clade. These three novel species have a greater than 2.5 % difference from each other or their closest known species in the D1/D2 sequences. The three yeast species can also be separated from their closest known species in terms of physiological characteristics. Moreover, a sexual state could not be found in these three novel yeast species on various sporulation media. Therefore, the three novel species are described as Wickerhamiella brachini f.a., sp. nov. (type strain, NYNU 15885T=CICC 33092T=CBS 14176T), Wickerhamiellapterostichi f.a., sp. nov. (type strain, NYNU 15896T=CICC 33093T=CBS 14177T) and Wickerhamiellaqilinensis f.a., sp. nov. (type strain, NYNU 146103T=CICC 33062T=CBS 13929T). The MycoBank numbers of Wickerhamiella brachini f.a., sp. nov., Wickerhamiellapterostichi f.a., sp. nov. and Wickerhamiellaqilinensis f.a., sp. nov. are MB 816962, MB 816963 and MB 816964, respectively.

  14. Synthesis and anticoagulant activity of bioisosteric sulfonic-Acid analogues of the antithrombin-binding pentasaccharide domain of heparin.

    PubMed

    Herczeg, Mihály; Lázár, László; Bereczky, Zsuzsanna; Kövér, Katalin E; Timári, István; Kappelmayer, János; Lipták, András; Antus, Sándor; Borbás, Anikó

    2012-08-20

    Two pentasaccharide sulfonic acids that were related to the antithrombin-binding domain of heparin were prepared, in which two or three primary sulfate esters were replaced by sodium-sulfonatomethyl moieties. The sulfonic-acid groups were formed on a monosaccharide level and the obtained carbohydrate sulfonic-acid esters were found to be excellent donors and acceptors in the glycosylation reactions. Throughout the synthesis, the hydroxy groups to be methylated were masked in the form of acetates and the hydroxy groups to be sulfated were masked with benzyl groups. The disulfonic-acid analogue was prepared in a [2+3] block synthesis by using a trisaccharide disulfonic acid as an acceptor and a glucuronide disaccharide as a donor. For the synthesis of the pentasaccharide trisulfonic acid, a more-efficient approach, which involved elongation of the trisaccharide acceptor with a non-oxidized precursor of the glucuronic acid followed by post-glycosidation oxidation at the tetrasaccharide level and a subsequent [1+4] coupling reaction, was elaborated. In vitro evaluation of the anticoagulant activity of these new sulfonic-acid derivatives revealed that the disulfonate analogue inhibited the blood-coagulation-proteinase factor Xa with outstanding efficacy; however, the introduction of the third sulfonic-acid moiety resulted in a notable decrease in the anti-Xa activity. The difference in the biological activity of the disulfonic- and trisulfonic-acid counterparts could be explained by the different conformation of their L-iduronic-acid residues.

  15. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.

    1986-01-01

    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  16. Amino acid metabolism and protein synthesis in lactating rats fed on a liquid diet.

    PubMed Central

    Barber, T; García de la Asunción, J; Puertes, I R; Viña, J R

    1990-01-01

    1. Amino acid metabolism was studied in control virgin rats, lactating rats and virgin rats protein-pair-fed with the lactating rats (high-protein virgin rats). 2. Urinary excretion of nitrogen and urea was higher in lactating than in control virgin rats, and in high-protein virgin rats it was higher than in lactating rats. 3. The activities of urea-cycle enzymes (units/g) were higher in high-protein virgin than in lactating rats, except for arginase. In lactating rats the activities of carbamoyl-phosphate synthase, ornithine carbamoyltransferase and argininosuccinate synthase were lower than in control virgin rats. When the liver size is considered, the activities in lactating rats were similar to those in high-protein virgin rats, except for arginase. 4. N-Acetylglutamate content was higher in high-protein virgin rats than in the other two groups. 5. The rate of urea synthesis from precursors by isolated hepatocytes was higher in high-protein virgin rats than in the other two groups. 6. The flooding-dose method (L-[4-3H]phenylalanine) for measuring protein synthesis was used. The absolute synthesis rates of mammary gland, liver and small-intestinal mucosa were higher in lactating rats than in the other two groups, and in high-protein virgin rats than in control virgin rats 7. These results show that the increased needs for amino acids during lactation are met by hyperphagia and by a nitrogen-sparing mechanism. PMID:2396994

  17. Synthesis of goethite in solutions of artificial seawater and amino acids: a prebiotic chemistry study

    NASA Astrophysics Data System (ADS)

    Carneiro, Cristine E. A.; Ivashita, Flávio F.; de Souza, Ivan Granemann; de Souza, Cláudio M. D.; Paesano, Andrea; da Costa, Antonio C. S.; di Mauro, Eduardo; de Santana, Henrique; Zaia, Cássia T. B. V.; Zaia, Dimas A. M.

    2013-04-01

    This study investigated the synthesis of goethite under conditions resembling those of the prebiotic Earth. The artificial seawater used contains all the major elements as well as amino acids (α-Ala, β-Ala, Gly, Cys, AIB) that could be found on the prebiotic Earth. The spectroscopic methods (FT-IR, EPR, Raman), scanning electron microscopy (SEM) and X-ray diffraction showed that in any condition Gly and Cys favoured the formation of goethite, artificial seawater plus β-Ala and distilled water plus AIB favoured the formation of hematite and for the other synthesis a mixture of goethite and hematite were obtained. Thus in general no protein amino acids (β-Ala, AIB) favoured the formation of hematite. As shown by surface enhanced Raman spectroscopy (SERS) spectra the interaction between Cys and Fe3+ of goethite is very complex, involving decomposition of Cys producing sulphur, as well as interaction of carboxylic group with Fe3+. SERS spectra also showed that amino/CN and C-CH3 groups of α-Ala are interacting with Fe3+ of goethite. For the other samples the shifting of several bands was observed. However, it was not possible to say which amino acid groups are interacting with Fe3+. The pH at point of zero charge of goethites increased with artificial seawater and decreased with amino acids. SEM images showed when only goethite was synthesized the images of the samples were acicular and when only hematite was synthesized the images of the samples were spherical. SEM images for the synthesis of goethite with Cys were spherical crystal aggregates with radiating acicular crystals. The highest resonance line intensities were obtained for the samples where only hematite was obtained. Electron paramagnetic resonance (EPR) and Mössbauer spectra showed for the synthesis of goethite with artificial seawater an isomorphic substitution of iron by seawater cations. Mössbauer spectra also showed that for the synthesis goethite in distilled water plus Gly only goethite was

  18. Functional characterization of FaNIP1;1 gene, a ripening-related and receptacle-specific aquaporin in strawberry fruit.

    PubMed

    Molina-Hidalgo, Francisco J; Medina-Puche, Laura; Gelis, Samuel; Ramos, José; Sabir, Farzana; Soveral, Graça; Prista, Catarina; Iglesias-Fernández, Raquel; Caballero, José L; Muñoz-Blanco, Juan; Blanco-Portales, Rosario

    2015-09-01

    Strawberry fruit (Fragaria × ananassa) is a soft fruit with high water content at ripe stage (more than 90% of its fresh weight). Aquaporins play an important role in plant water homeostasis, through the facilitation of water transport and solutes. We report the role played by FaNIP1;1 in the receptacle ripening process. The analysis by qRT-PCR of FaNIP1;1 showed that this gene is mainly expressed in fruit receptacle and has a ripening-related expression pattern that was accompanied by an increase in both the abscisic acid and water content of the receptacle throughout fruit ripening. Moreover, FaNIP1;1 was induced in situations of water deficit. Additionally, we show that FaNIP1;1 expression was positively regulated by abscisic acid and negatively regulated by auxins. The water transport capacity of FaNIP1;1 was determined by a stopped-flow spectroscopy in yeast over-expressing FaNIP1;1. Glycerol, H2O2 and boron transport were also demonstrated in yeast. On the other hand, GFP-FaNIP1;1 fusion protein was located in plasma membrane. In conclusion, FaNIP1;1 seems to play an important role increasing the plasma membrane permeability, that allows the water accumulation in the strawberry fruit receptacle throughout the ripening process.

  19. Polyamines are essential for the synthesis of 2-ricinoleoyl phosphatidic acid in developing seeds of castor.

    PubMed

    Tomosugi, Mitsuhiro; Ichihara, Ken'ichi; Saito, Kazumi

    2006-01-01

    The major fatty acid component of castor (Ricinus communis L.) oil is ricinoleic acid (12-hydroxy-cis-9-octadecenoic acid), and unsaturated hydroxy acid accounts for >85% of the total fatty acids in triacylglycerol (TAG). TAG had a higher ricinoleate content at position 2 than at positions 1 and 3. Although lysophosphatidic acid (LPA) acyltransferase (EC 2.3.1.51), which catalyzes acylation of LPA at position 2, was expected to utilize ricinoleoyl-CoA preferentially over other fatty acyl-CoAs, no activity was found for ricinoleoyl-CoA in vitro at concentrations at which other unsaturated acyl-CoAs were incorporated rapidly. However, activity for ricinoleoyl-CoA appeared with addition of polyamines (putrescine, spermidine, and spermine), while polyamines decreased the rates of incorporation of other acyl-CoAs into position 2. The order of effect of polyamines on LPA acyltransferase activity was spermine > spermidine > putrescine. At concentrations of spermine and spermidine of >0.1 mM, ricinoleoyl-CoA served as an effective substrate for LPA acyltransferase reaction. The concentrations of spermine and spermidine in the developing seeds were estimated at approximately 0.09 and approximately 0.63 mM, respectively. These stimulatory effects for incorporation of ricinoleate were specific to polyamines, but basic amino acids were ineffective as cations. In contrast, in microsomes from safflower seeds that do not contain ricinoleic acid, spermine and spermidine stimulated the LPA acyltransferase reaction for all acyl-CoAs tested, including ricinoleoyl-CoA. Although the fatty acid composition of TAG depends on both acyl-CoA composition in the cell and substrate specificity of acyltransferases, castor bean polyamines are crucial for incorporation of ricinoleate into position 2 of LPA. Polyamines are essential for synthesis of 2-ricinoleoyl phosphatidic acid in developing castor seeds.

  20. A strategy for the solution-phase parallel synthesis of N-(pyrrolidinylmethyl)hydroxamic acids.

    PubMed

    Takayanagi, M; Flessner, T; Wong, C H

    2000-06-16

    Both five- and six-membered iminocyclitols have proven to be useful transition-state analogue inhibitors of glycosidases. They also mimic the transition-state sugar moiety of the nucleoside phosphate sugar in glycosyltransferase-catalyzed reactions. Described here is the development of a general strategy toward the parallel synthesis of a five-membered iminocyclitol linked to a hydroxamic acid group designed to mimic the transition state of GDP-fucose complexed with Mn(II) in fucosyltransferase reactions. The iminocyclitol 8 containing a protected hydroxylamine unit was prepared from D-mannitol. The hydroxamic acid moiety was introduced via the reaction of 8 with various acid chlorides. The strategy is generally applicable to the construction of libraries for identification of glycosyltransferase inhibitors.

  1. Facile synthesis of PtAu alloy nanoparticles with high activity for formic acid oxidation

    SciTech Connect

    Zhang, Sheng; Shao, Yuyan; Yin, Geping; Lin, Yuehe

    2010-02-15

    We report the facile synthesis of carbon supported PtAu alloy nanoparticles with high electrocatalytic activity as the anode catalyst for direct formic acid fuel cells (DFAFCs). PtAu alloy nanopaticles are synthesized by co-reducing HAuCl4 and H2PtCl6 with NaBH4 in the presence of sodium citrate and then the nanoparticles are deposited on Vulcan XC-72R carbon support (PtAu/C). The obtained catalysts are characterized with X-ray diffraction (XRD) and transmission electron microscope (TEM), which reveal PtAu alloy formation with an average diameter of 4.6 nm. PtAu/C exhibits 8 times higher catalytic activity toward formic acid oxidation than Pt/C. The enhanced activity of PtAu/C catalyst is attributed to noncontinuous Pt sites formed in the presence of the neighbored Au sites, which promotes direct oxidation of formic acid by avoiding poison CO.

  2. A plausible simultaneous synthesis of amino acids and simple peptides on the primordial Earth.

    PubMed

    Parker, Eric T; Zhou, Manshui; Burton, Aaron S; Glavin, Daniel P; Dworkin, Jason P; Krishnamurthy, Ramanarayanan; Fernández, Facundo M; Bada, Jeffrey L

    2014-07-28

    Following his seminal work in 1953, Stanley Miller conducted an experiment in 1958 to study the polymerization of amino acids under simulated early Earth conditions. In the experiment, Miller sparked a gas mixture of CH4, NH3, and H2O, while intermittently adding the plausible prebiotic condensing reagent cyanamide. For unknown reasons, an analysis of the samples was not reported. We analyzed the archived samples for amino acids, dipeptides, and diketopiperazines by liquid chromatography, ion mobility spectrometry, and mass spectrometry. A dozen amino acids, 10 glycine-containing dipeptides, and 3 glycine-containing diketopiperazines were detected. Miller's experiment was repeated and similar polymerization products were observed. Aqueous heating experiments indicate that Strecker synthesis intermediates play a key role in facilitating polymerization. These results highlight the potential importance of condensing reagents in generating diversity within the prebiotic chemical inventory.

  3. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.

    PubMed

    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J

    2014-04-25

    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism.

  4. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress.

    PubMed

    Simón, María Victoria; Agnolazza, Daniela L; German, Olga Lorena; Garelli, Andrés; Politi, Luis E; Agbaga, Martin-Paul; Anderson, Robert E; Rotstein, Nora P

    2016-03-01

    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here, we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat and hydrogen peroxide (H2 O2 ). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in retina photoreceptors, and its precursor, eicosapentaenoic acid (EPA) have multiple beneficial effects. Here, we show that retina neurons in vitro express the desaturase FADS2 and can synthesize DHA from EPA. Moreover, addition of EPA to these cultures protects photoreceptors from oxidative stress and promotes their differentiation through its metabolization to DHA.

  5. Docosahexaenoic acid synthesis from alpha-linolenic acid is inhibited by diets high in polyunsaturated fatty acids.

    PubMed

    Gibson, R A; Neumann, M A; Lien, E L; Boyd, K A; Tu, W C

    2013-01-01

    The conversion of the plant-derived omega-3 (n-3) α-linolenic acid (ALA, 18:3n-3) to the long-chain eicosapentaenoic acid (EPA, 20:5n-3) and docosahexaenoic acid (DHA, 22:6n-3) can be increased by ALA sufficient diets compared to ALA deficient diets. Diets containing ALA above an optimal level result in no further increase in DHA levels in animals and humans. The present study evaluates means of maximizing plasma DHA accumulation by systematically varying both linoleic acid (LA, 18:2n-6) and ALA dietary level. Weanling rats were fed one of 54 diets for three weeks. The diets varied in the percentage of energy (en%) of LA (0.07-17.1 en%) and ALA (0.02-12.1 en%) by manipulating both the fat content and the balance of vegetable oils. The peak of plasma phospholipid DHA (>8% total fatty acids) was attained as a result of feeding a narrow dietary range of 1-3 en% ALA and 1-2 en% LA but was suppressed to basal levels (∼2% total fatty acids) at dietary intakes of total polyunsaturated fatty acids (PUFA) above 3 en%. We conclude it is possible to enhance the DHA status of rats fed diets containing ALA as the only source of n-3 fatty acids but only when the level of dietary PUFA is low (<3 en%).

  6. Synthesis and characterization of m- and p-methylbenzyl-mercapturic acids derived from m- and p-xylenes.

    PubMed

    Tanaka, M; Noda, T; Moriwaki, H; Tsujimoto, Y

    1997-06-01

    Chemical synthesis and physical properties of two mercapturic acids suggested as urinary metabolites of m- and p-xylenes are described. These compounds may be used for the identification and quantitative determination by high-performance liquid chromatography of the corresponding mercapturic acids in urine.

  7. The Synthesis of a Dipeptide from its Component Amino Acids: Protecting Groups in the Elementary Organic Laboratory.

    ERIC Educational Resources Information Center

    Young, Paul E.; Campbell, Andrew

    1982-01-01

    A simple, three-step procedure for synthesizing a dipeptide from its component amino acids is described. The dipeptide synthesized uses inexpensive amino acids having hydrocarbon side-chains and can be observed in E/Z forms by nuclear magnetic resonance spectroscopy. Each step in the synthesis produces white crystalline products using standard…

  8. Leucine and alpha-Ketoisocaproic acid, but not norleucine, stimulate skeletal muscle protein synthesis in neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The branched-chain amino acid, leucine, acts as a nutrient signal to stimulate protein synthesis in skeletal muscle of young pigs. However, the chemical structure responsible for this effect has not been identified. We have shown that the other branched-chain amino acids, isoleucine and valine, are ...

  9. Asymmetric synthesis of allylic sulfonic acids: enantio- and regioselective iridium-catalyzed allylations of Na2SO3.

    PubMed

    Liu, Wei; Zhao, Xiao-ming; Zhang, Hong-bo; Zhang, Liang; Zhao, Ming-zhu

    2014-12-15

    An enantioselective allylation reaction of allylic carbonates with sodium sulfite (Na2 SO3 ) catalyzed by Ir complex was accomplished, providing allylic sulfonic acids in good to excellent yields with a high level of enantio- and regioselectivities. (R)-2-Phenyl-2-sulfoacetic acid, a key intermediate for the synthesis of Cefsulodin and Sulbenicillin, was synthesized as well.

  10. Glycerine and levulinic acid: renewable co-substrates for the fermentative synthesis of short-chain poly(hydroxyalkanoate) biopolymers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Glycerine and levulinic acid were used alone and in combination for the fermentative synthesis of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHB/V) biopolymers. Shake-flask cultures of Pseudomonas oleovorans NRRL B-14682 containing different glycerine:levulinic acid ratios (1%, w/v total carbon ...

  11. Synthesis and optimization ring opening of monoepoxide linoleic acid using p-toluenesulfonic acid.

    PubMed

    Salimon, Jumat; Abdullah, Bashar Mudhaffar; Yusop, Rahimi M; Salih, Nadia; Yousif, Emad

    2013-01-01

    Biolubricant base oils, 9,12-hydroxy-10,13-oleioxy-12-octadecanoic acid (HYOOA) was synthesized based on the esterification reaction of Monoepoxide linoleic acid 9(12)-10(13)-monoepoxy 12(9)-octadecanoic acid (MEOA) with oleic acid (OA) and catalyzed by p-Toluenesulfonic acid. The optimum conditions for the experiment using D-optimal design to obtain high yield% of 84.61, conversion% of 83.54 and lowest OOC% of 0.05 were predicted at OA/MEOA ratio of 0.2:1 (mol/mol), PTSA/MEOA ratio of 0.4:1 (mol/mol), reaction temperature at 110°C, and reaction time at 4.5 h. The FTIR peaks of HYOOA indicate the disappearance of the absorption band at 820 cm(-1), which belongs to the oxirane ring. (13)C and (1)H NMR spectra analyses confirmed the result of HYOOA with appearance carbon-ester (C = O) chemical shift at 174.1 ppm and at 4.06 ppm for (13)C and (1)H NMR respectively.

  12. Formation of Amino Acid Thioesters for Prebiotic Peptide Synthesis: Catalysis By Amino Acid Products

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.; DeVincenzi, Donald L. (Technical Monitor)

    1999-01-01

    The origin of life can be described as a series of events in which a prebiotic chemical process came increasingly under the control of its catalytic products. In our search for this prebiotic process that yielded catalytic takeover products (such as polypeptides), we have been investigating a reaction system that generates peptide-forming amino acid thioesters from formaldehyde, glycolaldehyde, and ammonia in the presence of thiols. As shown below, this model process begins by aldol condensation of formaldehyde and glycolaldehyde to give trioses and releases. These sugars then undergo beta-dehydration yielding their respective alpha-ketoaldehydes. Addition of ammonia to the alpha-ketoaldehydes yields imines which can either: (a) rearrange in the presence of thesis to give amino acid thioesters or (be react with another molecule of aldehyde to give imidazoles. This 'one-pot' reaction system operates under mild aqueous conditions, and like modem amino acid biosynthesis, uses sugar intermediates which are converted to products by energy-yielding redox reactions. Recently, we discovered that amino acids, such as the alanine reaction product, catalyze the first and second steps of the process. In the presence of ammonia the process also generates other synthetically useful products, like the important biochemical -- pyruvic acid.

  13. Cell proliferation and progesterone synthesis depend on lipid metabolism in bovine granulosa cells.

    PubMed

    Elis, Sebastien; Desmarchais, Alice; Maillard, Virginie; Uzbekova, Svetlana; Monget, Philippe; Dupont, Joëlle

    2015-03-15

    In dairy cows, lipids are essential to support energy supplies for all biological functions, especially during early lactation. Lipid metabolism is crucial for sustaining proper reproductive function. Alteration of lipid metabolism impacts follicular development and affects oocyte developmental competence. Indeed, nonesterified fatty acids are able to decrease granulosa cell (GC) proliferation and affect estradiol synthesis, thus potentially affecting follicular growth and viability. The objective of this study was to assess the impact of lipid metabolism on bovine GCs, through the use of the lipid metabolism inhibitors etomoxir, an inhibitor of fatty acid (FA) oxidation through inhibition of carnitine palmitoyl transferase 1 (CPT1), and C75, an inhibitor of FA synthesis through inhibition of fatty acid synthase. We showed that etomoxir and C75 significantly inhibited DNA synthesis in vitro; C75 also significantly decreased progesterone synthesis. Both inhibitors significantly reduced AMPK (5' adenosine monophosphate-activated protein kinase) and acetyl-CoA carboxylase phosphorylation. Etomoxir also affected the AKT (protein kinase B) signaling pathway. Combined, these data suggest that both FA oxidation and synthesis are important for the bovine GCs to express a proliferative and steroidogenic phenotype and, thus, for sustaining follicular growth. Despite these findings, it is important to note that the changes caused by the inhibitors of FA metabolism on GCs in vitro are globally mild, suggesting that lipid metabolism is not as critical in GCs as was observed in the oocyte-cumulus complex. Further studies are needed to investigate the detailed mechanisms by which lipid metabolism interacts with GC functions.

  14. Effect of diacylglycerol acyltransferase 2 overexpression in 3T3-L1 is associated to an increase in mono-unsaturated fatty acid accumulation

    PubMed Central

    2014-01-01

    Background Fatty acid (FA) composition is the most important parameter affecting the flavor and nutritional value of the meat. The final and the only committed step in the biosynthesis of triglycerides is catalyzed by diacylglycerol acyltransferase 2 (DGAT2). The role of DGAT2 in lipid accumulation has been demonstrated in adipocytes, However, little is known about the effect of DGAT2 on the FA composition of these cells. Methods To investigate the role of DGAT2 in regulating lipid accumulation, FA composition and the expression of adipogenic genes, we cloned the open reading frame of the porcine DGAT2 gene and established 3T3-L1 cells that overexpressed DGAT2. Cells were then cultured in differentiation medium (DM) without FA, with a mixture of FAs (FA-DM), or containing a 13C stable isotope-labeled FA mixture (IFA-DM). The FA composition of adipocytes was analyzed by gas chromatography–mass spectrometry and gas chromatography-isotope ratio mass spectrometry. Quantitative PCR and western blotting were employed to detect expression of adipogenic genes in 3T3-L1 adipocytes cultured with FA-DM for 12 d. Results The triacylglyceride (TAG) content was significantly higher in 3T3-L1 adipocytes overexpressing DGAT2 than in control cells. When cultured in DM or FA-DM for 12 d, cells overexpressing DGAT2 showed a higher proportion of unsaturated FAs (C16:1 and C18:1). However, when cells overexpressing DGAT2 were cultured with FA-DM for 30 min, the FA composition was almost identical to that of controls. Further, the proportion of stable isotope-labeled FAs were similar in 3T3-L1 adipocytes overexpressing DGAT2 and control cells cultured in IFA-DM for 12 d. These results collectively indicate that the higher proportion of mono-unsaturated FAs, C16:1 and C18:1, may originate from de novo FA synthesis but not from the uptake of specific FAs from the medium. This hypothesis is further supported by evidence that both mRNA and protein expression of genes involved in FA

  15. Erythrocyte membrane fatty acids in multiple myeloma patients.

    PubMed

    Jurczyszyn, Artur; Czepiel, Jacek; Gdula-Argasińska, Joanna; Czapkiewicz, Anna; Biesiada, Grażyna; Dróżdż, Mirosław; Perucki, William; Castillo, Jorge J

    2014-10-01

    Mounting data show that fatty acids (FA) and fatty acid synthase (FAS) function could be potential targets for multiple myeloma (MM) therapy. Our study aimed at comparing the FA composition of erythrocyte membranes of MM patients and healthy controls. MM patients had higher saturated FA and n-6 polyunsaturated FA (PUFA) and lower monounsaturated, n-3 PUFA and trans-FA indices than controls. The n-3/n-6 PUFA ratio was lower in MM patients and there was distinct clustering of variants of individual FA in MM patients. The FA content of erythrocyte membrane could serve as a diagnostic and/or predictive biomarker in MM.

  16. Simple synthesis of luminescent CdSe quantum dots from ascorbic acid and selenium dioxide.

    PubMed

    Wang, Yilin; Yu, Meihua; Yang, Kun; Lu, Jianping; Chen, Linqing

    2015-12-01

    A simple, low-cost and convenient method was developed for the synthesis of highly luminescent CdSe quantum dots (QDs) in an aqueous medium. Compared with previous methods, this synthesis was carried out in one pot using ascorbic acid (C6H8O6) to replace NaBH4 or N2H4·H2O as a reductant, and selenium dioxide to replace selenium or its other hazardous, expensive and unstable compounds as a precursor. The mechanism of CdSe QDs formation was elucidated. The influence of various experimental variables, including refluxing time, Cd/MSA and Cd/Se molar ratios, on the luminescent properties of the QDs were systematically investigated. X-Ray powder diffraction and transmission electron microscopy characterization indicated that the QDs had a pure cubic zinc-blended structure with a spherical shape.

  17. High-yield synthesis of bioactive ethyl cinnamate by enzymatic esterification of cinnamic acid.

    PubMed

    Wang, Yun; Zhang, Dong-Hao; Zhang, Jiang-Yan; Chen, Na; Zhi, Gao-Ying

    2016-01-01

    In this paper, Lipozyme TLIM-catalyzed synthesis of ethyl cinnamate through esterification of cinnamic acid with ethanol was studied. In order to increase the yield of ethyl cinnamate, several media, including acetone, isooctane, DMSO and solvent-free medium, were investigated in this reaction. The reaction showed a high yield by using isooctane as reaction medium, which was found to be much higher than the yields reported previously. Furthermore, several parameters such as shaking rate, water activity, reaction temperature, substrate molar ratio and enzyme loading had important influences on this reaction. For instance, when temperature increased from 10 to 50 °C, the initial reaction rate increased by 18 times and the yield of ethyl cinnamate increased by 6.2 times. Under the optimum conditions, lipase-catalyzed synthesis of ethyl cinnamate gave a maximum yield of 99%, which was of general interest for developing industrial processes for the preparation of ethyl cinnamate.

  18. SYNTHESIS AND CHARACTERIZATION OF SUBSTITUTED POLY(STYRENE)-b-POLY(ACRYLIC ACID) BLOCK COPOLYMER MICELLES

    SciTech Connect

    Pickel, Deanna L; Pickel, Joseph M; Devenyi, Jozsef; Britt, Phillip F

    2009-01-01

    Block copolymer micelle synthesis and characterization has been extensively studied. In particular, most studies have focused on the properties of the hydrophilic corona due to the micelle corona structure s impact on the biodistribution and biocompatibility. Unfortunately, less attention has been given to the effect of the core block on the micelle stability, morphology, and the rate of diffusion of small molecules from the core. This investigation is focused on the synthesis of block copolymers composed of meta-substituted styrenes and acrylic acid by Atom Transfer Radical Polymerization. Micelles with cores composed of substituted styrenes having Tgs ranging from -30 to 100 oC have been prepared and the size and shape of these micelles were characterized by Static and Dynamic Light Scattering and TEM. In addition, the critical micelle concentration and rate of diffusion of small molecules from the core were determined by fluorimetry using pyrene as the probe.

  19. Challenges in the Synthesis of a Unique Mono-Carboxylic Acid Antibiotic (+)-Zincophorin

    PubMed Central

    Song, Zhenlei; Lohse, Andrew G.; Hsung, Richard P.

    2009-01-01

    (+)-Zincophorin, also referred to as M144255 or griseochellin, is a polyoxygenated ionophoric antibiotic that was isolated from Streptomyces griseus in 1984. It possesses strong in vivo activity against Gram-positive bacteria and Clostridium coelchii. Its methyl ester was reported in a patent as having strong inhibitory properties against influenza WSN/virus with reduced toxicity for the host cell. Its ability to strongly bind with Zn2+, which is also present in its X-ray structure, is the basis for its name. Over the last two decades, (+)-zincophorin h as attracted an impressive array of synthetic efforts including Danishefsky's first total synthesis along with two recent elegant total syntheses reported by Cossy and Miyashita as well as our own formal total synthesis. This Account provides a comparison of the different synthetic efforts on this novel mono-carboxylic acid antibiotic and documents its interesting isolation, structure determination, and biological activities. PMID:19642422

  20. Challenges in the synthesis of a unique mono-carboxylic acid antibiotic, (+)-zincophorin.

    PubMed

    Song, Zhenlei; Lohse, Andrew G; Hsung, Richard P

    2009-04-01

    (+)-Zincophorin, also referred to as M144255 or griseocholin, is a polyoxygenated ionophoric antibiotic that was isolated from Streptomyces griseus in 1984. It possesses strong in vivo activity against Gram-positive bacteria and Clostridium coelchii. Its methyl ester was reported in a patent as having strong inhibitory properties against influenza WSN/virus with reduced toxicity for the host cell. Its ability to strongly bind with Zn2+, which is also present in its X-ray structure, is the basis for its name. Over the last two decades, (+)-zincophorin has attracted an impressive array of synthetic efforts including Danishefsky's first total synthesis, along with two recent elegant total syntheses reported by Cossy and Miyashita as well as our own formal total synthesis. This review provides a comparison of the different synthetic efforts on this novel mono-carboxylic acid antibiotic and documents its interesting isolation, structure determination, and biological activities.

  1. Engineering methylaspartate ammonia lyase for the asymmetric synthesis of unnatural amino acids

    NASA Astrophysics Data System (ADS)

    Raj, Hans; Szymański, Wiktor; de Villiers, Jandré; Rozeboom, Henriëtte J.; Veetil, Vinod Puthan; Reis, Carlos R.; de Villiers, Marianne; Dekker, Frank J.; de Wildeman, Stefaan; Quax, Wim J.; Thunnissen, Andy-Mark W. H.; Feringa, Ben L.; Janssen, Dick B.; Poelarends, Gerrit J.

    2012-06-01

    The redesign of enzymes to produce catalysts for a predefined transformation remains a major challenge in protein engineering. Here, we describe the structure-based engineering of methylaspartate ammonia lyase (which in nature catalyses the conversion of 3-methylaspartate to ammonia and 2-methylfumarate) to accept a variety of substituted amines and fumarates and catalyse the asymmetric synthesis of aspartic acid derivatives. We obtained two single-active-site mutants, one exhibiting a wide nucleophile scope including structurally diverse linear and cyclic alkylamines and one with broad electrophile scope including fumarate derivatives with alkyl, aryl, alkoxy, aryloxy, alkylthio and arylthio substituents at the C2 position. Both mutants have an enlarged active site that accommodates the new substrates while retaining the high stereo- and regioselectivity of the wild-type enzyme. As an example, we demonstrate a highly enantio- and diastereoselective synthesis of threo-3-benzyloxyaspartate (an important inhibitor of neuronal excitatory glutamate transporters in the brain).

  2. Selective use of palmitic acid over stearic acid for synthesis of phosphatidylcholine and phosphatidylglycerol in lung

    SciTech Connect

    Tsao, F.H.

    1986-11-01

    The incorporation of (/sup 3/H)palmitic acid and (/sup 14/C)stearic acid into phospholipids in rabbit lung tissue was studied. Under equal molar concentrations of palmitate and stearate, palmitate was incorporated to the 1- and 2-positions of phosphatidylcholine (PC) and phosphatidylglycerol (PG) 2-3 times more than stearate. By contrast, palmitate was 30% less than stearate in phosphatidylethanolamine, phosphatidylinositol and phosphatidylserine. These results suggest that preferential utilization of palmitate over stearate, rather than substrate availability, determines the high content of palmitoyl at the 1- and 2-positions of PC and PG in lung.

  3. One-step synthesis of boronic acid functionalized gold nanoclusters for photoluminescence sensing of dopamine

    NASA Astrophysics Data System (ADS)

    Chen, Huide; Liu, Chunxiu; Xia, Yunsheng

    2017-03-01

    This study is the first to report one-step synthesis of boronic acid functionalized gold nanoclusters (AuNCs) using mixed ligands of 4-mercaptophenylboronic acid (MPBA) and glutathione. Furthermore, the emission color of the products can be fancily tuned from green to near-infrared by simply changing the proportion of the two stabilizers. In basic media, dopamine (DA) molecules themselves polymerize each other and form polydopamine with large amounts of cis-diol groups, which then react with boronic acid groups on the AuNC’s surface based on the formation of boronate esters. As a result, the photoluminescence of the AuNCs is well quenched by the electron transfer effect. Accordingly, DA molecules are assayed from 0.5 to 9 μM, and the detection limit is as low as 0.1 μM. The as-prepared AuNCs exhibit high selectivity; the existing biomolecules including various amino acids, ascorbic acid, uric acid, glucose, etc, do not interfere with the assay. The proposed method is successfully applied to the assay of DA in human serum, indicating its practical potential.

  4. Effect of penicillin on fatty acid synthesis and excretion in Streptococcus mutans BHT

    SciTech Connect

    Brissette, J.L.; Pieringer, R.A.

    1985-03-01

    Treatment of exponentially growing cultures of Streptococcus mutans BHT with growth-inhibitory concentrations (0.2 microgram/ml) of benzylpenicillin stimulates the incorporation of (2-/sup 14/C) acetate into lipids excreted by the cells by as much as 69-fold, but does not change the amount of /sup 14/C incorporated into intracellular lipids. At this concentration of penicillin cellular lysis does not occur. The radioactive label is incorporated exclusively into the fatty acid moieties of the glycerolipids. During a 4-hr incubation in the presence of penicillin, the extracellular fatty acid ester concentration increases 1.5 fold, even though there is no growth or cellular lysis. An indication of the relative rate of fatty acid synthesis was most readily obtained by placing S. mutans BHT in a buffer containing /sup 14/C-acetate. Under these nongrowing conditions free fatty acids are the only lipids labeled, a factor which simplifies the assay. The addition of glycerol to the buffer causes all of the nonesterified fatty acids to be incorporated into glycerolipid. The cells excrete much of the lipid whether glycerol is present or not. Addition of penicillin to the nongrowth supporting buffer system does not stimulate the incorporation of (/sup 14/C)-acetate into fatty acids.

  5. Facile one-pot synthesis of gold nanoparticles using tannic acid and its application in catalysis

    NASA Astrophysics Data System (ADS)

    Aswathy Aromal, S.; Philip, Daizy

    2012-04-01

    The paper reports a simple and efficient method for the synthesis of stable, nearly spherical gold nanoparticles using tannic acid as both the reducing and stabilizing agent. The nanoparticles are characterized by UV-visible spectroscopy, transmission electron microscopy (TEM), EDX and X-ray diffraction (XRD) analysis. The influence of tannic acid on the control of size and shape of gold nanoparticles is reported. Upon an increase in the concentration of tannic acid, there is a shift in the shape of nanoparticles as evidenced by the change in bandwidth and peak position of the surface plasmon resonance (SPR) band. Also, it is found that tannic acid ceases to act as a reducing agent beyond the limit of 10 mL (6×10-3 M) for 30 mL of HAuCl4 (1.3×10-3 M). On increasing the quantity of tannic acid, nucleation is favored in the initial stages and thereafter growth supersedes nucleation. The stable colloids obtained by this method are found to consist of nanoparticles with average size 8 and 12 nm. The crystallinity of the sample with fcc phase is observed from TEM, SAED and XRD pattern. Involvement of carboxylic acid group in capping of gold nanoparticles is evident from the FTIR spectrum. The application of the synthesized nanoparticles as catalyst in the reduction of 4-Nitrophenol to 4-Aminophenol is also reported.

  6. Vitamin B-6 restriction impairs fatty acid synthesis in cultured human hepatoma (HepG2) cells

    PubMed Central

    Zhao, Mei; Ralat, Maria A.; da Silva, Vanessa; Garrett, Timothy J.; Melnyk, Stephan; James, S. Jill

    2013-01-01

    Vitamin B-6 deficiency has been reported to alter n-6 and n-3 fatty acid profiles in plasma and tissue lipids; however, the mechanisms underlying such metabolic changes remain unclear. The objective of this study was to determine the effects of vitamin B-6 restriction on fatty acid profiles and fatty acid synthesis in HepG2 cells. Cells were cultured for 6 wk in media with four different vitamin B-6 concentrations (10, 20, 50, and 2,000 nM added pyridoxal, representing deficient, marginal, adequate, and supraphysiological conditions) that induced a range of steady-state cellular concentrations of pyridoxal phosphate. Total cellular lipid content was greatest in the deficient (10 nM pyridoxal) medium. The percentage of arachidonic acid and the ratio of arachidonic acid to linoleic acid in the total lipid fraction were ∼15% lower in vitamin B-6-restricted cells, which suggests that vitamin B-6 restriction affects n-6 fatty acid interconversions. Metabolic flux studies indicated significantly lower fractional synthesis rate of oleic acid and arachidonic acid at 10, 20, and 50 nM pyridoxal, whereas that of eicosapentaenoic acid was lower in the cells cultured in 10 nM pyridoxal. Additionally, relative mRNA expressions of Δ5 and Δ6 desaturases were 40–50% lower in vitamin B-6-restricted cells. Overall, these findings suggest that vitamin B-6 restriction alters unsaturated fatty acid synthesis, particularly n-6 and n-3 polyunsaturated fatty acid synthesis. These results and observations of changes in human plasma fatty acid profiles caused by vitamin B-6 restriction suggest a mechanism by which vitamin B-6 inadequacy influences the cardiovascular risk. PMID:23211517

  7. Loss of glycogen debranching enzyme AGL drives bladder tumor growth via induction of hyaluronic acid synthesis

    PubMed Central

    Guin, Sunny; Ru, Yuanbin; Agarwal, Neeraj; Lew, Carolyn R.; Owens, Charles; Comi, Giacomo P.; Theodorescu, Dan

    2015-01-01

    Purpose We demonstrated that Amylo-alpha-1-6-glucosidase-4-alpha-glucanotransferase (AGL) is a tumor growth suppressor and prognostic marker in human bladder cancer. Here we determine how AGL loss enhances tumor growth, hoping to find therapeutically tractable targets/pathways that could be used in patients with low AGL expressing tumors. Experimental Design We transcriptionally profiled bladder cell lines with different AGL expression. By focusing on transcripts overexpressed as a function of low AGL and associated with adverse clinicopathologic variables in human bladder tumors, we sought to increase the chances of discovering novel therapeutic opportunities. Results One such transcript was hyaluronic acid synthase 2 (HAS2), an enzyme responsible for hyaluronic acid (HA) synthesis. HAS2 expression was inversely proportional to that of AGL in bladder cancer cells and immortalized and normal urothelium. HAS2 driven HA synthesis was enhanced in bladder cancer cells with low AGL and this drove anchorage dependent and independent growth. siRNA mediated depletion of HAS2 or inhibition of HA synthesis by 4-Methylumbelliferone (4MU) abrogated in vitro and xenograft growth of bladder cancer cells with low AGL. AGL and HAS2 mRNA expression in human tumors was inversely correlated in patient datasets. Patients with high HAS2 and low AGL tumor mRNA expression had poor survival lending clinical support to xenograft findings that HAS2 drives growth of tumors with low AGL. Conclusion Our study establishes HAS2 mediated HA synthesis as a driver of growth of bladder cancer with low AGL and provides preclinical rationale for personalized targeting of HAS2/HA signaling in patients with low AGL expressing tumors. PMID:26490312

  8. Fusidic Acid Targets Elongation Factor G in Several Stages of Translocation on the Bacterial Ribosome*

    PubMed Central

    Borg, Anneli; Holm, Mikael; Shiroyama, Ikue; Hauryliuk, Vasili; Pavlov, Michael; Sanyal, Suparna; Ehrenberg, Måns

    2015-01-01

    The antibiotic fusidic acid (FA) targets elongation factor G (EF-G) and inhibits ribosomal peptide elongation and ribosome recycling, but deeper mechanistic aspects of FA action have remained unknown. Using quench flow and stopped flow experiments in a biochemical system for protein synthesis and taking advantage of separate time scales for inhibited (10 s) and uninhibited (100 ms) elongation cycles, a detailed kinetic model of FA action was obtained. FA targets EF-G at an early stage in the translocation process (I), which proceeds unhindered by the presence of the drug to a later stage (II), where the ribosome stalls. Stalling may also occur at a third stage of translocation (III), just before release of EF-G from the post-translocation ribosome. We show that FA is a strong elongation inhibitor (K50% ≈ 1 μm), discuss the identity of the FA targeted states, and place existing cryo-EM and crystal structures in their functional context. PMID:25451927

  9. Lipase-catalyzed hydrolysis of TG containing acetylenic FA.

    PubMed

    Jie, Marcel S F Lie Ken; Fua, Xun; Lau, Maureen M L; Chye, M L

    2002-10-01

    Hydrolysis of symmetrical acetylenic TG of type AAA [viz., glycerol tri-(4-decynoate), glycerol tri-(6-octadecynoate), glycerol tri-(9-octadecynoate), glycerol tri-(10-undecynoate), and glycerol tri-(13-docosynoate)] in the presence of eight microbial lipases was studied. Novozyme 435 (Candida antarctica), an efficient enzyme for esterification, showed a significant resistance in the hydrolysis of glycerol tri-(9-octadecynoate) and glycerol tri-(13-docosynoate). Hydrolysis of acetylenic TG with Lipolase 100T (Humicola lanuginosa) was rapidly accomplished. Lipase PS-D (Pseudomonas cepacia) showed a fair resistance toward the hydrolysis of glycerol tri-(6-octadecynoate) only, which reflected its ability to recognize the delta6 positional isomer of 18:1. Lipase CCL (Candida cylindracea, syn. C. rugosa) and AY-30 (C. rugosa) were able to catalyze the release of 10-undecynoic acid and 9-octadecynoic acid from the corresponding TG, but less readily the 13-docosynoic acid in the case of glycerol tri-(13-docosynoate). The two lipases CCL and AY-30 were able to distinguish the small difference in structure of fatty acyl moieties in the TG substrate. To confirm this trend, three regioisomers of mixed acetylenic TG of type ABC (containing one each of delta6, delta9, and delta13 acetylenic FA in various positions) were prepared and hydrolyzed with CCL and AY-40. The results reconfirmed the observation that AY-30 and CCL were able to distinguish the slight differences in the molecular structure (position of the acetylenic bond and chain length) of the acyl groups in the TG during the hydrolysis of such TG substrates.

  10. Synthesis of docosahexaenoic acid from eicosapentaenoic acid in retina neurons protects photoreceptors from oxidative stress

    PubMed Central

    Simón, María Victoria; Agnolazza, Daniela L.; German, Olga Lorena; Garelli, Andrés; Politi, Luis E.; Agbaga, Martin-Paul; Anderson, Robert E.; Rotstein, Nora P.

    2015-01-01

    Oxidative stress is involved in activating photoreceptor death in several retinal degenerations. Docosahexaenoic acid (DHA), the major polyunsaturated fatty acid in the retina, protects cultured retina photoreceptors from apoptosis induced by oxidative stress and promotes photoreceptor differentiation. Here we investigated whether eicosapentaenoic acid (EPA), a metabolic precursor to DHA, had similar effects and whether retinal neurons could metabolize EPA to DHA. Adding EPA to rat retina neuronal cultures increased opsin expression and protected photoreceptors from apoptosis induced by the oxidants paraquat (PQ) and hydrogen peroxide (H2O2). Palmitic, oleic, and arachidonic acids had no protective effect, showing the specificity for DHA. We found that EPA supplementation significantly increased DHA percentage in retinal neurons, but not EPA percentage. Photoreceptors and glial cells expressed Δ6 desaturase (FADS2), which introduces the last double bond in DHA biosynthetic pathway. Pre-treatment of neuronal cultures with CP-24879 hydrochloride, a Δ5/Δ6 desaturase inhibitor, prevented EPA-induced increase in DHA percentage and completely blocked EPA protection and its effect on photoreceptor differentiation. These results suggest that EPA promoted photoreceptor differentiation and rescued photoreceptors from oxidative stress-induced apoptosis through its elongation and desaturation to DHA. Our data show, for the first time, that isolated retinal neurons can synthesize DHA in culture. PMID:26662863

  11. Facile synthesis of graphene from graphite using ascorbic acid as reducing agent

    NASA Astrophysics Data System (ADS)

    Andrijanto, Eko; Shoelarta, Shoerya; Subiyanto, Gatot; Rifki, Sadur

    2016-04-01

    Graphene has attracted a tremendous attention in recent years due to its unique properties such as mechanical, thermal, optical and electrical properties. However, a large scale production of this material is still an issue and subjected to intense research efforts. Here, we show a simple and green approach of the graphene synthesis from graphene oxide using ascorbic acid as reduction agent. A facile synthesis of graphene (rGO) through chemical oxidation of graphite into graphene oxide (GO) was described using modified Hummers method (Improved Tour Method/ITM). The ITM method does not produce toxic gas and the temperature of the oxidation is easily controlled using ice bath. The synthesized of graphene oxide was highly soluble and stable in water. The reduction of graphene oxide into graphene was performed using ascorbic acid (AA) in mild condition. The combined ITM method and green reduction using ascorbic acid open the avenue of replacing hydrazine in the reduction of graphite oxide into graphene and may be very important step for bulk production of graphene.

  12. Deoxycholate Bile Acid Directed Synthesis of Branched Au Nanostructures for Near Infrared Photothermal Ablation

    PubMed Central

    Kim, Dong-Hyun; Larson, Andrew C.

    2015-01-01

    We report an approach for simple, reproducible and high-yield synthesis of branched GNPs directed by deoxycholate bile acid supramolecular aggregates in Au solution. A growth process involving stepwise trapping of the GNP seeds and Au ions in the deoxycholate bile acid solution yields multiple-branched GNPs. Upon NIR laser irradiation strong NIR absorption for branched GNPs induced photothermal-heating to destroy tumor cells. Subsequently, these branched GNPs were bio-functionalized with cRGD cell penetrating-targeting peptides for photothermal cancer treatment applications. Branched GNPs conjugated with cRGD peptides enhanced internalization of the branched GNPs in BxPC3 human pancreatic adenocarcinoma cells and effectively ablated BxPC3 cells when irradiated with a NIR laser (808 nm). Their potential use as photothermal transducing agents was demonstrated in in vivo settings using a pancreatic cancer xenograft model. The tumors were effectively ablated with cRGD-branched GNPs injection and laser exposure without any observation of tumor recurrence. This firstly reported method for deoxycholate bile acid directed synthesis of branched GNPs opens new possibilities for the production of strong NIR absorbing nanostructures for selective nanophotothermolisys of cancer cells and the further design of novel materials with customized spectral and structural properties for broader applications. PMID:25934288

  13. Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

    PubMed Central

    Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

    2011-01-01

    Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

  14. Synthesis and antimicrobial activities of new higher amino acid Schiff base derivatives of 6-aminopenicillanic acid and 7-aminocephalosporanic acid

    NASA Astrophysics Data System (ADS)

    Özdemir (nee Güngör), Özlem; Gürkan, Perihan; Özçelik, Berrin; Oyardı, Özlem

    2016-02-01

    Novel β-lactam derivatives (1c-3c) (1d-3d) were produced by using 6-aminopenicillanic acid (6-APA), 7-aminocephalosporanic acid (7-ACA) and the higher amino acid Schiff bases. The synthesized compounds were characterized by elemental analysis, IR, 1H/13C NMR and UV-vis spectra. Antibacterial activities of all the higher amino acid Schiff bases (1a-3a) (1b-3b) and β-lactam derivatives were screened against three gram negative bacteria (Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, Acinetobacter baumannii RSKK 02026), three gram positive bacteria (Staphylococcus aureus ATCC 25923, Enterococcus faecalis ATCC 07005, Bacillus subtilis ATCC 6633) and their drug-resistant isolates by using broth microdilution method. Two fungi (Candida albicans and Candida krusei) were used for antifungal activity.

  15. Synthesis of boron suboxide from boron and boric acid under mild pressure and temperature conditions

    SciTech Connect

    Jiao, Xiaopeng; Jin, Hua; Ding, Zhanhui; Yang, Bin; Lu, Fengguo; Zhao, Xudong; Liu, Xiaoyang; Peng, Liping

    2011-05-15

    Graphical abstract: Well-crystallized and icosahedral B{sub 6}O crystals were prepared by reacting boron and boric acid at milder reaction conditions (1 GPa and 1300 {sup o}C for 2 h) as compared to previous work.. Research highlights: {yields} Well-crystallized icosahedral B{sub 6}O was synthesized by reacting boric acid and boron. {yields} The synthesis conditions (1 GPa and 1300 {sup o}C for 2 h) are milder in comparison with previous work. {yields} The more practical synthesis method may make B{sub 6}O as a potential substitute for diamond in industry. -- Abstract: Boron suboxide (B{sub 6}O) was synthesized by reacting boron and boric acid (H{sub 3}BO{sub 3}) at pressures between 1 and 10 GPa, and at temperatures between 1300 and 1400 {sup o}C. The B{sub 6}O samples prepared were icosahedral with diameters ranging from 20 to 300 nm. Well-crystallized and icosahedral crystals with an average size of {approx}100 nm can be obtained at milder reaction conditions (1 GPa and 1300 {sup o}C for 2 h) as compared to previous work. The bulk B{sub 6}O sample was stable in air at 600 {sup o}C and then slowly oxidized up to 1000 {sup o}C. The relatively mild synthetic conditions developed in this study provide a more practical synthesis of B{sub 6}O, which may potentially be used as a substitute for diamond in industry as a new superhard material.

  16. Microbial synthesis of polyhydroxyalkanoate using seaweed-derived crude levulinic acid as co-nutrient.

    PubMed

    Bera, Anupam; Dubey, Sonam; Bhayani, Khushbu; Mondal, Dibyendu; Mishra, Sandhya; Ghosh, Pushpito K

    2015-01-01

    Production of polyhydroxyalkanoates (PHAs) from Jatropha biodiesel residues, namely crude glycerol and oil cake hydrolysate, has been reported previously. Halomonas hydrothermalis (MTCC accession no. 5445; NCBI Genbank accession no. GU938192), a wild marine strain, was used in the bio-synthesis. The present study was initiated to vary the properties of the polymer. Seaweed-derived crude levulinic acid (SDCLA), containing formic acid, residual sugars and dissolved minerals additionally, was proposed as co-feed along with the biodiesel residues. Experiments were conducted at 100mL scale in batch process. Whereas the PHA yield was only 0.40 ± 0.01 g when only biodiesel residues were employed, it rose to 1.07 ± 0.02 g in presence of 0.35% (w/v) of SDCLA. The corresponding carbon utilisation efficiencies were 29.3% and 57.5%, respectively. 3-Hydroxy valerate incorporation in the PHA was pronounced in presence of SDCLA, with associated changes in polymer properties. The microbial synthesis fared poorly when SDCLA was substituted with pure levulinic acid. Thus, Halomonas hydrothermalis had a poor response to levulinic acid, as such, and other constituents present in SDCLA appear to have played a vital role in bacterial cell division and accumulation of PHA. Biodegradability tests in moist soil were also conducted as part of the study. Marine microalgal cultivation for biodiesel and seaweed cultivation for fuels may help generate biodiesel residues and crude levulinic acid in proximity, which would open up the possibility of large scale PHA manufacture in efficient and practical manner in the future through the methodology of the present study.

  17. Lyso(bis)phosphatidic acid: a preferred donor of arachidonic acid for macrophage-synthesis of eicosanoids

    SciTech Connect

    Cochran, F.; Roddick, V.; Connor, J.; Waite, M.

    1986-05-01

    In order to dissect mechanisms of arachidonic acid (20:4) metabolism, two cell populations were investigated, resident (AM) and Bacillus Calmette-Guerin-activated (BCG-AM) rabbit alveolar macrophages. After purified AM were labeled overnight with (/sup 3/H)20:4, radioactivity was localized primarily within lyso(bis)phosphatidic acid (L(bis)PA) (13.1%), phosphatidylethanolamine (PE) (22.8%) and phosphatidylcholine (PC) (26.7%), with lesser amounts recovered in phosphatidyl-serine (PS) plus phosphatidylinositol (PI) (9.2%). By contrast, analysis of the phospholipid classes from prelabeled BCG-AM revealed that the mass of L(bis)PA as well as its (/sup 3/H)20:4 content was profoundly decreased while other BCG-AM phospholipids remained unchanged. When (/sup 3/H)20:4-labeled AM were stimulated with 1 ..mu..M 12-0-tetradecanoyl-phorbol-13-acetate (TPA), a loss of (/sup 3/H)20:4 was observed from L(bis)PA, PE, PC, and PS/PI with a corresponding increase in eicosanoid synthesis. BCG-AM exposed to either TPA or 3.8 ..mu..M Ca/sup +2/ ionophore A23187 liberated (/sup 3/H)20:4 solely from Pe and PC. BCG-AM, which exhibited depressed eicosanoid formation, consistently failed to deacylate (/sup 3/H)20:4 from L(bis)PA or PI. Their evidence suggests that the diminution of eicosanoid synthesis by BCG-AM may be due to the reduction of 20:4 contained within specific phospholipid pools, namely L(bis)PA.

  18. Merging Photoredox and Nickel Catalysis: The Direct Synthesis of Ketones by the Decarboxylative Arylation of α-Oxo Acids.

    PubMed

    Chu, Lingling; Lipshultz, Jeffrey M; MacMillan, David W C

    2015-06-26

    The direct decarboxylative arylation of α-oxo acids has been achieved by synergistic visible-light-mediated photoredox and nickel catalysis. This method offers rapid entry to aryl and alkyl ketone architectures from simple α-oxo acid precursors via an acyl radical intermediate. Significant substrate scope is observed with respect to both the oxo acid and arene coupling partners. This mild decarboxylative arylation can also be utilized to efficiently access medicinal agents, as demonstrated by the rapid synthesis of fenofibrate.

  19. Precious-Metal-Free Heteroarylation of Azlactones: Direct Synthesis of α-Pyridyl, α-Substituted Amino Acid Derivatives.

    PubMed

    Johnson, Tarn C; Marsden, Stephen P

    2016-10-21

    A one-pot, three-component synthesis of α-pyridyl, α-substituted amino acid derivatives is described. The key transformation is a direct, precious-metal-free heteroarylation of readily available, amino acid derived azlactones with electrophilically activated pyridine N-oxides. The resulting intermediates can be used directly as efficient acylating agents for a range of nucleophiles, leading to the heteroarylated amino acid derivatives in a single vessel.

  20. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9.

  1. Liver oxidation and inflammation in Fa/Fa rats fed glucomannan/spirulina-surimi.

    PubMed

    Vázquez-Velasco, Miguel; González-Torres, Laura; López-Gasco, Patricia; Bastida, Sara; Benedí, Juana; Sánchez-Reus, María Isabel; González-Muñoz, María José; Sánchez-Muniz, Francisco J

    2014-09-15

    The effect of high-fat squid-surimi diets enriched in glucomannan or glucomannan-spirulina on lipemia, liver glutathione status, antioxidant enzymes and inflammation biomarkers was determined in Zucker Fa/Fa rats. Groups of eight rats each received for 7weeks the squid-surimi control (C), glucomannan-enriched squid-surimi (G) and glucomannan-spirulina enriched squid-surimi (GS). Liver weight, cytochrome P450 7A1 expression and cholesterolemia were decreased in G and GS vs. C, improving glutathione red-ox index (p<0.05). G also showed increased glutathione reductase (GR) levels vs. C, but reduced the endothelial (eNOS) and increased the inducible nitric oxide synthase (iNOS) and tumor necrosis factor-alpha (TNF-α) levels (p<0.05). The GS diet improved superoxide dismutase, catalase, glutathione peroxidase and GR activities and eNOS, iNOS and TNF-α levels (p<0.05). The glucomannan enriched surimi-diet induced hypocholesterolemic, antioxidant and proinflammatory effects, while the addition of 3g/kg spirulina kept those hypocholesterolemic and antioxidant effects but reduced the inflammation observed.

  2. Preparation of bifunctional isocyanate hydroxamate linkers: Synthesis of carbamate and urea tethered polyhydroxamic acid chelators

    PubMed Central

    Fernando, Rasika; Shirley, Jonathan M.; Torres, Emilio; Jacobs, Hollie K.; Gopalan, Aravamudan S.

    2012-01-01

    Two novel bifunctional N-methylhydroxamate-isocyanate linkers 20 and 21 were prepared in good yield and high purity from the corresponding amine salts using a biphasic reaction with phosgene. The facile ring opening reaction of N-Boc lactams using the anion of O-benzylhydroxylamine gave the protected amino hydroxamates 6a and 6c in good yields. The selective methylation of the hydroxamate nitrogen in the presence of the N-Boc group in these intermediates could be readily accomplished. The utility of the linkers was clearly demonstrated by the synthesis of the carbamate-tethered trishydroxamic acid 27 and the urea-tethered 29 PMID:23162172

  3. Facile synthesis of a fullerene-barbituric acid derivative and supramolecular catalysis of its photoinduced dimerization.

    PubMed

    McClenaghan, Nathan D; Absalon, Christelle; Bassani, Dario M

    2003-10-29

    A straightforward synthesis of a fullerene derivative appended with a barbituric acid molecular recognition motif is described. The presence of two nonself-complementary hydrogen-bonding sites is shown to be conducive to the construction of supramolecular assemblies. In the presence of a melamine derivative possessing complementary hydrogen-bonding sites, enhanced efficiency toward photodimerization of the fullerene moiety is observed. This represents the first example of intermolecular photodimerization of a fullerene derivative in homogeneous solution, made possible by the formation of supramolecular assemblies in which the fullerenes are maintained in close proximity.

  4. Synthesis of carboxymethylcellulose/acrylic acid hydrogels with superabsorbent properties by radiation-initiated crosslinking

    NASA Astrophysics Data System (ADS)

    Fekete, Tamás; Borsa, Judit; Takács, Erzsébet; Wojnárovits, László

    2016-07-01

    Superabsorbent hydrogels were prepared by gamma irradiation from aqueous solutions of carboxymethylcellulose (CMC) and acrylic acid (AAc) with varying CMC:AAc ratio. By partially replacing the CMC with AAc the gelation increased and led to a higher gel fraction and lower water uptake. Moreover, the gelation required significantly milder synthesis conditions. Decreasing both the dose and the solute concentration in the presence of AAc led to gels with higher gel fraction and higher degree of swelling compared to pure CMC gels. Increasing the AAc content up to 10% proved to be very effective, while very high AAc content (over 50%) hindered the gelation process.

  5. Enantioselective Synthesis of β-Arylamines via Chiral Phosphoric Acid-Catalyzed Asymmetric Reductive Amination.

    PubMed

    Kim, Kyung-Hee; Lee, Chun-Young; Cheon, Cheol-Hong

    2015-06-19

    A new method for the synthesis of chiral β-aryl amines via chiral phosphoric acid-catalyzed enantioselective reductive amination of benzyl methyl ketone derivatives with Hantzsch ester was developed. Various chiral β-aryl amines were obtained in high yields and with good to high enantioselectivities. This transformation is applicable to gram-scale reactions, and the catalyst loading can be reduced to 1 mol % without sacrificing any catalytic efficacy. Furthermore, the resulting β-aryl amine was successfully converted into a tetrahydroisoquinoline compound without any loss of enantioselectivity.

  6. Microwave-assisted polyol synthesis of carbon nitride dots from folic acid for cell imaging.

    PubMed

    Guan, Weiwei; Gu, Wei; Ye, Ling; Guo, Chenyang; Su, Su; Xu, Pinxiang; Xue, Ming

    2014-01-01

    A green, one-step microwave-assisted polyol synthesis was employed to prepare blue luminescent carbon nitride dots (CNDs) using folic acid molecules as both carbon and nitrogen sources. The as-prepared CNDs had an average size of around 4.51 nm and could be well dispersed in water. Under excitation at 360 nm, the CNDs exhibited a strong blue luminescence and the quantum yield was estimated to be 18.9%, which is greater than that of other reported CNDs. Moreover, the CNDs showed low cytotoxicity and could efficiently label C6 glioma cells, demonstrating their potential in cell imaging.

  7. Role of fatty acids in Bacillus environmental adaptation

    PubMed Central

    Diomandé, Sara E.; Nguyen-The, Christophe; Guinebretière, Marie-Hélène; Broussolle, Véronique; Brillard, Julien

    2015-01-01

    The large bacterial genus Bacillus is widely distributed in the environment and is able to colonize highly diverse niches. Some Bacillus species harbor pathogenic characteristics. The fatty acid (FA) composition is among the essential criteria used to define Bacillus species. Some elements of the FA pattern composition are common to Bacillus species, whereas others are specific and can be categorized in relation to the ecological niches of the species. Bacillus species are able to modify their FA patterns to adapt to a wide range of environmental changes, including changes in the growth medium, temperature, food processing conditions, and pH. Like many other Gram-positive bacteria, Bacillus strains display a well-defined FA synthesis II system that is equilibrated with a FA degradation pathway and regulated to efficiently respond to the needs of the cell. Like endogenous FAs, exogenous FAs may positively or negatively affect the survival of Bacillus vegetative cells and the spore germination ability in a given environment. Some of these exogenous FAs may provide a powerful strategy for preserving food against contamination by the Bacillus pathogenic strains responsible for foodborne illness. PMID:26300876

  8. Discovery and Synthesis of Amino Acids Modified Deoxycholic Acid Derivatives and in Vitro Antiproliferative Evaluation.

    PubMed

    Zhao, Chunhui; Zhao, Peizhe; Feng, Bin; Hou, Xiyan; Zhao, Longxuan

    2017-03-01

    A series of deoxycholic acid (DCA) derivatives bearing amino acid moiety has been synthesized and investigated for their potential antiproliferative activities. DCA derivative compounds were synthesized by a two or three step synthetic approach. Their bioactivities were evaluated using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) method and Western blotting analysis on three tumor cell lines A549 (human lung cancer cell line), MCF-7 (human breast cancer cell line) and HeLa (human cervical carcinoma cell). The novel derivatives DCA3d, DCA5a, DCA5b, DCA5c, and DCA5d were found to be promising antiproliferative agents. Furthermore, DCA5b showed the greatest cytotoxic activity by induction of apoptosis. These compounds show potentiality for further optimization as antitumor drugs.

  9. Epigenetics and development of food allergy (FA) in early childhood.

    PubMed

    Hong, Xiumei; Wang, Xiaobin

    2014-09-01

    This review aims to highlight the latest advance on epigenetics in the development of food allergy (FA) and to offer future perspectives. FA, a condition caused by an immunoglobulin (Ig) E-mediated hypersensitivity reaction to food, has emerged as a major clinical and public health problem worldwide in light of its increasing prevalence, potential fatality, and significant medical and economic impact. Current evidence supports that epigenetic mechanisms are involved in immune regulation and that the epigenome may represent a key "missing piece" of the etiological puzzle for FA. There are a growing number of population-based epigenetic studies on allergy-related phenotypes, mostly focused on DNA methylation. Previous studies mostly applied candidate-gene approaches and have demonstrated that epigenetic marks are associated with multiple allergic diseases and/or with early-life exposures relevant to allergy development (such as early-life smoking exposure, air pollution, farming environment, and dietary fat). Rapid technological advancements have made unbiased genome-wide DNA methylation studies highly feasible, although there are substantial challenge in study design, data analyses, and interpretation of findings. In conclusion, epigenetics represents both an important knowledge gap and a promising research area for FA. Due to the early onset of FA, epigenetic studies of FA in prospective birth cohorts have the potential to better understand gene-environment interactions and underlying biological mechanisms in FA during critical developmental windows (preconception, in utero, and early childhood) and may lead to new paradigms in the diagnosis, prevention, and management of FA and provide novel targets for future drug discovery and therapies for FA.

  10. Selective synthesis and labeling of the polysialic acid capsule in Escherichia coli K1 strains with mutations in nanA and neuB.

    PubMed Central

    Vimr, E R

    1992-01-01

    The enzymes required for polysialic acid capsule synthesis in Escherichia coli K1 are encoded by region 2 neu genes of the multigenic kps cluster. To facilitate analysis of capsule synthesis and translocation, an E. coli K1 strain with mutations in nanA and neuB, affecting sialic acid degradation and synthesis, respectively, was constructed by transduction. The acapsular phenotype of the mutant was corrected in vivo by exogenous addition of sialic acid. By blocking sialic acid degradation, the nanA mutation allows intracellular metabolite accumulation, while the neuB mutation prevents dilution by the endogenous sialic acid pool and allows capsule synthesis to be controlled experimentally by the exogenous addition of sialic acid to the growth medium. Complementation was detected by bacteriophage K1F adsorption or infectivity assays. Polysialic acid translocation was observed within 2 min after addition of sialic acid to the growth medium, demonstrating the rapidity in vivo of sialic acid transport, activation, and polymerization and translocation of polysaccharide to the cell surface. Phage adsorption was not inhibited by chloramphenicol, demonstrating that de novo protein synthesis was not required for polysialic acid synthesis or translocation at 37 degrees C. Exogenous radiolabeled sialic acid was incorporated exclusively into capsular polysaccharide. The polymeric nature of the labeled capsular material was confirmed by gel permeation chromatography and susceptibility of sialyl polymers to K1F endo-N-acylneuraminidase. The ability to experimentally manipulate capsule expression provides new approaches for investigating polysialic acid synthesis and membrane translocation mechanisms. PMID:1400168

  11. Glutamate dehydrogenase (RocG) in Bacillus licheniformis WX-02: Enzymatic properties and specific functions in glutamic acid synthesis for poly-γ-glutamic acid production.

    PubMed

    Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen

    2017-04-01

    Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis.

  12. Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

    PubMed Central

    Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao

    2011-01-01

    Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

  13. Synthesis, saccharide-binding and anti-cancer cell proliferation properties of arylboronic acid derivatives of indoquinolines.

    PubMed

    Meng, Junxiu; Yu, Shaoqing; Wan, Shengbiao; Ren, Sumei; Jiang, Tao

    2011-11-01

    A facile synthesis of a series of saccharide-binding arylboronic acid derivatives of indoloquinoline was described. The key synthetic steps were polyphosphoric acid-mediated cyclization, chlorinative aromatization, and amidation. Mass spectrometry experiments revealed these synthetic arylboronic acid derivatives of indoquinolines could bind to biologically important carbohydrates (sialic acid, fucose, glucose, and galactose) by forming boronate di-esters in alkaline aqueous solution. Most of the arylboronic acid derivatives of indoquinolines inhibited human breast cancer cell (MDA-231) proliferation at a concentration of 5 μm, whereas the compound 17 exhibited highest percentages (76.74%) of the cancer cell proliferation inhibition.

  14. Investigation of Lewis acid versus Lewis base catalysis in asymmetric cyanohydrin synthesis.

    PubMed

    North, Michael; Omedes-Pujol, Marta; Williamson, Courtney

    2010-10-04

    The asymmetric addition of trimethylsilyl cyanide to aldehydes can be catalysed by Lewis acids and/or Lewis bases, which activate the aldehyde and trimethylsilyl cyanide, respectively. It is not always apparent from the structure of the catalyst whether Lewis acid or Lewis base catalysis predominates. To investigate this in the context of using salen complexes of titanium, vanadium and aluminium as catalysts, a Hammett analysis of asymmetric cyanohydrin synthesis was undertaken. When Lewis acid catalysis is dominant, a significantly positive reaction constant is observed, whereas reactions dominated by Lewis base catalysis give much smaller reaction constants. [{Ti(salen)O}(2)] was found to show the highest degree of Lewis acid catalysis, whereas two [VO(salen)X] (X=EtOSO(3) or NCS) complexes both displayed lower degrees of Lewis acid catalysis. In the case of reactions catalysed by [{Al(salen)}(2)O] and triphenylphosphine oxide, a non-linear Hammett plot was observed, which is indicative of a change in mechanism with increasing Lewis base catalysis as the carbonyl compound becomes more electron-deficient. These results suggested that the aluminium complex/triphenylphosphine oxide catalyst system should also catalyse the asymmetric addition of trimethylsilyl cyanide to ketones and this was found to be the case.

  15. Semi-synthesis of new antimicrobial esters from the natural oleanolic and maslinic acids.

    PubMed

    Chouaïb, Karim; Hichri, Fayçal; Nguir, Asma; Daami-Remadi, Majda; Elie, Nicolas; Touboul, David; Ben Jannet, Hichem; Hamza, M'hamed Ali

    2015-09-15

    In this article, we report an effective procedure for the selective isolation of oleanolic acid 1 and maslinic acid 2 (3.4 and 8.5mg/g DW, respectively) from pomace olive (Olea europaea L.) using an ultrasonic bath, and the synthesis of a series of new triterpenic acid esters. The compounds were characterized by their spectral data and were evaluated for their antimicrobial activity. Among the compounds tested, those having sulfur and chlorine atoms were found to be antibacterial. They showed activity against two Gram-positive bacteria Staphylococcus aureus and Enterococcus faecalis and two Gram-negative bacteria Escherichia coli and Pseudomonas aeruginosa (MICs within a range of 5-25μg/mL). The fungus Penicillium italicum was found to be the most sensitive to both sulfur derivatives: (3β)-3-((thiophene-2-carbonyl)oxy)-olean-12-en-28-oic acid (1a) (IZ=22mm) and (2α,3β-2,3-bis((thiophene-2-carbonyl)oxy)olean-12-en-28-oic acid (2a) (IZ=24mm).

  16. Prebiotic synthesis in atmospheres containing CH4, CO, and CO2. I - Amino acids

    NASA Technical Reports Server (NTRS)

    Schlesinger, G.; Miller, S. L.

    1983-01-01

    The prebiotic synthesis of amino acids, HCN, H2CO, and NH3 using a spark discharge on various simulated primitive earth atmospheres at 25 C is investigated. Various mixtures of CH4, CO, CO2, N2, NH3, H2O, and H2 were utilized in different experiments. The yields of amino acids (1.2-4.7 percent based on the carbon) are found to be approximately independent of the H2/CH4 ratio and the presence of NH3, and a wide variety of amino acids are obtained. Glycine is found to be almost the only amino acid produced from CO and CO2 model atmospheres, with the maximum yield being about the same for the three carbon sources at high H2/carbon ratios,whereas CH4 is superior at low H2/carbon ratios. In addition, it is found that the directly synthesized NH3 together with the NH3 obtained from the hydrolysis of HCN, nitriles, and urea could have been a major source of ammonia in the atmosphere and oceans of the primitive earth. It is determined that prebiotic syntheses from HCN and H2CO to give products such as purines and sugars and some amino acids could have occurred in primitive atmospheres containing CO and CO2 provided the H2/CO and H2/CO2 ratios were greater than about 1.0.

  17. Influence of dietary long-chain PUFA on premature baboon lung FA and dipalmitoyl PC composition.

    PubMed

    Chao, Angela Chueh; Ziadeh, Bassem I; Diau, Guan-Yeu; Wijendran, Vasuki; Sarkadi-Nagy, Eszter; Hsieh, Andrea T; Nathanielsz, Peter W; Brenna, J Thomas

    2003-04-01

    One of the major survival challenges of premature birth is production of lung surfactant. The lipid component of surfactant, dipalmitoyl PC (DPPC), increases in concentration in the period before normal term birth via a net shift in FA composition away from unsaturates. We investigated the influence of dietary DHA and arachidonic acid (AA) on lung FA composition and DPPC concentration in term and preterm baboons. Pregnant animals/neonates were randomized to one of four groups: breast-fed (B), term formula-fed (T-, preterm formula-fed (P-, and preterm fed formula supplemented with DHA-AA (P+). Breast milk contained 0.68%wt DHA and the P+ group formula contained 0.61%wt DHA. In the preterm groups (P- and P+), pregnant females received a course of antenatal corticosteroids. At the adjusted age of 4 wk, neonate lung tissue was harvested, and FA composition and DPPC were analyzed. Palmitate was approximately 28%wt of lung total FA and no significant differences were found among the four treatment groups. In contrast, DPPC in the B group lung tissue was significantly greater than DPPC in the unsupplemented groups, but not compared with the P+ group. The B and P+ groups were not significantly different in DHA and AA, but were different compared with the unsupplemented (T, P-) groups. These results indicate that LCP supplementation increases lung DHA and AA, without compromising overall lung 16:0 or DPPC. The shift in FA composition toward greater unsaturation in the groups consuming LCP supported improved surfactant lipid concentration in preterm neonate lungs.

  18. Mutation of L-2,3-diaminopropionic acid synthase genes blocks staphyloferrin B synthesis in Staphylococcus aureus

    PubMed Central

    2011-01-01

    Background Staphylococcus aureus synthesizes two siderophores, staphyloferrin A and staphyloferrin B, that promote iron-restricted growth. Previous work on the biosynthesis of staphyloferrin B has focused on the role of the synthetase enzymes, encoded from within the sbnA-I operon, which build the siderophore from the precursor molecules citrate, alpha-ketoglutarate and L-2,3-diaminopropionic acid. However, no information yet exists on several other enzymes, expressed from the biosynthetic cluster, that are thought to be involved in the synthesis of the precursors (or synthetase substrates) themselves. Results Using mutants carrying insertions in sbnA and sbnB, we show that these two genes are essential for the synthesis of staphyloferrin B, and that supplementation of the growth medium with L-2,3-diaminopropionic acid can bypass the block in staphyloferrin B synthesis displayed by the mutants. Several mechanisms are proposed for how the enzymes SbnA, with similarity to cysteine synthase enzymes, and SbnB, with similarity to amino acid dehydrogenases and ornithine cyclodeaminases, function together in the synthesis of this unusual nonproteinogenic amino acid L-2,3-diaminopropionic acid. Conclusions Mutation of either sbnA or sbnB result in abrogation of synthesis of staphyloferrin B, a siderophore that contributes to iron-restricted growth of S. aureus. The loss of staphyloferrin B synthesis is due to an inability to synthesize the unusual amino acid L-2,3-diaminopropionic acid which is an important, iron-liganding component of the siderophore structure. It is proposed that SbnA and SbnB function together as an L-Dap synthase in the S. aureus cell. PMID:21906287

  19. Design and synthesis of an Fmoc-SPPS-compatible amino acid building block mimicking the transition state of phosphohistidine phosphatase.

    PubMed

    Eerland, Martijn F; Hedberg, Christian

    2012-02-17

    The synthesis of a sulfonamide-based transition-state (TS) analogue of enzymatic phosphohistidine dephosphorylation as an amino acid building block is presented, together with the proof-of-concept of its incorporation into peptides. Key features include final global acidolytic protective group removal as well as full compatibility with standard Fmoc solid-phase peptide synthesis (SPPS). The peptides are designed as inhibitors of phosphohistidine phosphatase and as a pull-down probe for identification of phosphohistidine phosphatases, respectively.

  20. Synthesis of nucleotide–amino acid conjugates designed for photo-CIDNP experiments by a phosphotriester approach

    PubMed Central

    Morozova, Olga B; Silnikov, Vladimir N; Yurkovskaya, Alexandra V

    2013-01-01

    Summary Conjugates of 2’-deoxyguanosine, L-tryptophan and benzophenone designed to study pathways of fast radical reactions by the photo Chemically Induced Dynamic Nuclear Polarization (photo-CIDNP) method were obtained by the phosphotriester block liquid phase synthesis. The phosphotriester approach to the oligonucleotide synthesis was shown to be a versatile and economic strategy for preparing the required amount of high quality samples of nucleotide–amino acid conjugates. PMID:24367455