Preservation of acidified cucumbers with a natural preservative combination of fumaric acid and allyl isothiocyanate that target lactic acid bacteria and yeasts

USDA-ARS?s Scientific Manuscript database

Without the addition of preservative compounds cucumbers acidified with 150 mM acetic acid with pH adjusted to 3.5 typically undergo fermentation by lactic acid bacteria. Fumaric acid (20 mM) inhibited growth of Lactobacillus plantarum and the lactic acid bacteria present on fresh cucumbers, but sp...

The Growth and Protein Expression of Inflammatory Bowel Disease-Associated Campylobacter concisus Is Affected by the Derivatives of the Food Additive Fumaric Acid.

PubMed

Ma, Rena; Liu, Fang; Yap, Soe F; Lee, Hoyul; Leong, Rupert W; Riordan, Stephen M; Grimm, Michael C; Zhang, Li

2018-01-01

Inflammatory bowel diseases (IBD) are chronic inflammatory conditions of the gastrointestinal tract with multifactorial etiology. Both dietary factors and the microbe Campylobacter concisus have been found to be associated with the condition. The current study examined the effects of sodium fumarate, a neutralized product of the food additives fumaric acid and monosodium fumarate when in the intestinal environment, on the growth of C. concisus to determine the effects of these food additives on IBD-associated bacterial species. Through culture methods and quantification, it was found that neutralized fumaric acid, neutralized monosodium fumarate, and sodium fumarate increased the growth of C. concisus , with the greatest increase in growth at a concentration of 0.4%. Further examination of 50 C. concisus strains on media with added sodium fumarate showed that greatest growth was also achieved at a concentration of 0.4%. At a concentration of 2% sodium fumarate, all strains examined displayed less growth in comparison with those cultured on media without sodium fumarate. Using mass spectrometry, multiple C. concisus proteins showed significant differential expression when cultured on media with and without 0.4% sodium fumarate. The findings presented suggest that patients with IBD should consider avoiding excessive consumption of foods with fumaric acid or its sodium salts, and that the addition of 0.4% sodium fumarate alone to media may assist in the isolation of C. concisus from clinical samples.

Fumaric acid production using renewable resources from biodiesel and cane sugar production processes.

PubMed

Papadaki, Aikaterini; Papapostolou, Harris; Alexandri, Maria; Kopsahelis, Nikolaos; Papanikolaou, Seraphim; de Castro, Aline Machado; Freire, Denise M G; Koutinas, Apostolis A

2018-04-13

The microbial production of fumaric acid by Rhizopus arrhizus NRRL 2582 has been evaluated using soybean cake from biodiesel production processes and very high polarity (VHP) sugar from sugarcane mills. Soybean cake was converted into a nutrient-rich hydrolysate via a two-stage bioprocess involving crude enzyme production via solid state fermentations (SSF) of either Aspergillus oryzae or R. arrhizus cultivated on soybean cake followed by enzymatic hydrolysis of soybean cake. The soybean cake hydrolysate produced using crude enzymes derived via SSF of R. arrhizus was supplemented with VHP sugar and evaluated using different initial free amino nitrogen (FAN) concentrations (100, 200, and 400 mg/L) in fed-batch cultures for fumaric acid production. The highest fumaric acid concentration (27.3 g/L) and yield (0.7 g/g of total consumed sugars) were achieved when the initial FAN concentration was 200 mg/L. The combination of VHP sugar with soybean cake hydrolysate derived from crude enzymes produced by SSF of A. oryzae at 200 mg/L initial FAN concentration led to the production of 40 g/L fumaric acid with a yield of 0.86 g/g of total consumed sugars. The utilization of sugarcane molasses led to low fumaric acid production by R. arrhizus, probably due to the presence of various minerals and phenolic compounds. The promising results achieved through the valorization of VHP sugar and soybean cake suggest that a focused study on molasses pretreatment could lead to enhanced fumaric acid production.

Efficient aspartic acid production by a psychrophile-based simple biocatalyst.

PubMed

Tajima, Takahisa; Hamada, Mai; Nakashimada, Yutaka; Kato, Junichi

2015-10-01

We previously constructed a Psychrophile-based Simple bioCatalyst (PSCat) reaction system, in which psychrophilic metabolic enzymes are inactivated by heat treatment, and used it here to study the conversion of aspartic acid from fumaric acid mediated by the activity of aspartate ammonia-lyase (aspartase). In Escherichia coli, the biosynthesis of aspartic acid competes with that of L-malic acid produced from fumaric acid by fumarase. In this study, E. coli aspartase was expressed in psychrophilic Shewanella livingstonensis Ac10 heat treated at 50 °C for 15 min. The resultant PSCat could convert fumaric acid to aspartic acid without the formation of L-malic acid because of heat inactivation of psychrophilic fumarase activity. Furthermore, alginate-immobilized PSCat produced high yields of aspartic acid and could be re-used nine times. The results of our study suggest that PSCat can be applied in biotechnological production as a new approach to increase the yield of target compounds.

Using organic acids to control subacute ruminal acidosis and fermentation in feedlot cattle fed a high-grain diet.

PubMed

Vyas, D; Beauchemin, K A; Koenig, K M

2015-08-01

The objective of this study was to determine whether supplementing organic acids can prevent incidences of subacute ruminal acidosis (SARA) in beef heifers fed a diet consisting of 8% barley silage and 92% barley grain-based concentrate (DM basis). Ten ruminally cannulated Hereford crossbred heifers (484 ± 25 kg BW) were used in a replicated 5 × 5 Latin square design with 14-d periods including 10 d for dietary adaptation and 4 d for measurements. Dietary treatments included no supplementation (Control), low fumaric acid (61 g/d), high fumaric acid (125 g/d), low malic acid (59 g/d), and high malic acid (134 g/d). Organic acid supplementation had no effect on DMI ( = 0.77). Similarly, no effects were observed on mean ( = 0.74), minimum ( = 0.64), and maximum ( = 0.27) ruminal pH measured continuously for 48 h. Moreover, area under the curve for pH thresholds 6.2 ( = 0.97), 5.8 ( = 0.66), 5.5 ( = 0.55), and 5.2 ( = 0.93) was similar for all treatments. However, malic acid supplementation lowered the amount of time that ruminal pH was <6.2 compared with the Control ( = 0.02) and fumaric acid treatments ( < 0.01). No effects were observed on total VFA concentrations with organic acid supplementation ( = 0.98) compared with the Control, but greater total VFA concentrations were observed with fumaric acid compared with the malic acid treatments ( = 0.02). The population of total culturable bacteria 3 h after feeding was reduced with supplemental malic acid compared with the Control ( = 0.03) and fumaric acid treatments ( = 0.03). However, no effects were observed with organic acid supplementation on lactic acid-utilizing bacteria ( = 0.59). In conclusion, under the conditions of the present study, organic acid supplementation did not have any significant effects on ruminal fermentation parameters compared with the Control and were not effective in preventing SARA in beef cattle fed high-grain diets.

Effects of irradiation and fumaric acid treatment on the inactivation of Listeria monocytogenes and Salmonella typhimurium inoculated on sliced ham

NASA Astrophysics Data System (ADS)

Song, Hyeon-Jeong; Lee, Ji-Hye; Song, Kyung Bin

2011-11-01

To examine the effects of fumaric acid and electron beam irradiation on the inactivation of foodborne pathogens in ready-to-eat meat products, sliced ham was inoculated with Listeria monocytogenes and Salmonella typhimurium. The inoculated ham slices were treated with 0.5% fumaric acid or electron beam irradiation at 2 kGy. Fumaric acid treatment reduced the populations of L. monocytogenes and S. typhimurium by approximately 1 log CFU/g compared to control populations. In contrast, electron beam irradiation decreased the populations of S. typhimurium and L. monocytogenes by 3.78 and 2.42 log CFU/g, respectively. These results suggest that electron beam irradiation is a better and appropriate technique for improving the microbial safety of sliced ham.

Fumaric acid: an overlooked form of fixed carbon in Arabidopsis and other plant species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chia, D.W.; Yoder, T.J.; Reiter, W.D.

2000-10-01

Photoassimilates are used by plants for production of energy, as carbon skeletons and in transport of fixed carbon between different plant organs. Many studies have been devoted to characterizing the factors that. regulate photoassimilate concentrations in different plant species. Most studies examining photoassimilate concentrations in C{sub 3} plants have focused on analyzing starch and soluble sugars. However, work presented here demonstrates that a number of C{sub 3} plants, including the popular model organism Arabidopsis thaliana (L.) Heynh., and agriculturally important plants, such as soybean [Glycine ma (L.) Merr.], contain significant quantities of furnaric acid. In fact, furnaric acid can accumulatemore » to levels of several mg per g fresh weight in A-abidopsis leaves, often exceeding starch and soluble sugar levels. Furnaric acid is a component of the tricarboxylic acid cycle and, like starch and soluble sugars, can be metabolized to yield energy and carbon skeletons for production of other compounds. Fumaric acid concentrations increase with plant age and light intensity in Arabidopsis leaves. Arabidopsis phloem exudates contain significant quantities of fumaric acid, raising the possibility that fumaric acid may function in carbon transport.« less

Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae

PubMed Central

2012-01-01

Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940

Aerobic growth of campylobacter in media supplemented with a-ketoglutaric, lactic, and/or fumaric acids

USDA-ARS?s Scientific Manuscript database

A study was conducted to examine the ability of Campylobacter spp. to grow aerobically in media supplemented with selected organic acids. Basal broth media composed of tryptose, yeast extract, and a mineral-vitamin solution was supplemented with a-ketoglutaric, lactic, and/or fumaric acids. The fina...

Structural investigation of the cocrystal formed between 5-fluorocytosine and fumaric acid based on vibrational spectroscopic technique

NASA Astrophysics Data System (ADS)

Du, Yong; Cai, Qiang; Xue, Jiadan; Zhang, Qi; Qin, Dan

2017-05-01

The vibrational spectra of 5-fluorocytosine, fumaric acid and their cocrystal were measured using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. Experimental THz results show that the cocrystal has distinct fingerprint spectra in terahertz region. The absorption peaks observed in the terahertz spectra of the cocrystal were at 0.61 and 0.91 THz. These are quite different from corresponding raw starting materials. Raman spectra also show similar results about differences between the cocrystal and corresponding raw starting materials. Density functional theory (DFT) was used to simulate the structure of the possible salt form and the cocrystal form between 5-fluorocytosine and fumaric acid. The theoretical terahertz result shows that the cocrystal form has absorption at 0.62 and 0.87 THz, which is in agreement with the experimental result. The theoretical Raman result also indicates that the cocrystal form has more possibilities than the salt form. So, it is more reasonable that the structure between 5-fluorocytosine and fumaric acid could be the corresponding cocrystal form. The characteristic bands of the cocrystal between 5-fluorocytosine and fumaric acid are also assigned based on the simulation results from the DFT calculation.

Structural investigation of the cocrystal formed between 5-fluorocytosine and fumaric acid based on vibrational spectroscopic technique.

PubMed

Du, Yong; Cai, Qiang; Xue, Jiadan; Zhang, Qi; Qin, Dan

2017-05-05

The vibrational spectra of 5-fluorocytosine, fumaric acid and their cocrystal were measured using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. Experimental THz results show that the cocrystal has distinct fingerprint spectra in terahertz region. The absorption peaks observed in the terahertz spectra of the cocrystal were at 0.61 and 0.91THz. These are quite different from corresponding raw starting materials. Raman spectra also show similar results about differences between the cocrystal and corresponding raw starting materials. Density functional theory (DFT) was used to simulate the structure of the possible salt form and the cocrystal form between 5-fluorocytosine and fumaric acid. The theoretical terahertz result shows that the cocrystal form has absorption at 0.62 and 0.87THz, which is in agreement with the experimental result. The theoretical Raman result also indicates that the cocrystal form has more possibilities than the salt form. So, it is more reasonable that the structure between 5-fluorocytosine and fumaric acid could be the corresponding cocrystal form. The characteristic bands of the cocrystal between 5-fluorocytosine and fumaric acid are also assigned based on the simulation results from the DFT calculation. Copyright © 2017 Elsevier B.V. All rights reserved.

High-level production of recombinant trypsin in transgenic rice cell culture through utilization of an alternative carbon source and recycling system.

PubMed

Kim, Nan-Sun; Yu, Hwa-Young; Chung, Nguyen-Duc; Kwon, Tae-Ho; Yang, Moon-Sik

2014-09-01

Productivity of recombinant bovine trypsin using a rice amylase 3D promoter has been studied in transgenic rice suspension culture. Alternative carbon sources were added to rice cell suspension cultures in order to improve the production of recombinant bovine trypsin. It was demonstrated that addition of alternative carbon sources such as succinic acid, fumaric acid and malic acid in the culture medium could increase the productivity of recombinant bovine trypsin 3.8-4.3-fold compared to those in the control medium without carbon sources. The highest accumulated trypsin reached 68.2 mg/L on day 5 in the culture medium with 40 mM fumaric acid. The feasibility of repeated use of the cells for recombinant trypsin production was tested in transgenic rice cell suspension culture with the culture medium containing the combination of variable sucrose concentration and 40 mM fumaric acid. Among the used combinations, the combination of 1% sucrose and 40 mM fumaric acid resulted in a yield of up to 53 mg/L five days after incubation. It also increased 31% (W/W) of dry cell weight and improved 43% of cell viability compared to that in control medium without sucrose. Based on these data, recycling of the trypsin production process with repeated 1% sucrose and 40 mM fumaric acid supplying-harvesting cycles was developed in flask scale culture. Recombinant bovine trypsin could be stably produced with a yield of up to 53-39 mg/L per cycle during five recycling cycles. Copyright © 2014 Elsevier Inc. All rights reserved.

Combined metabolomic and correlation networks analyses reveal fumarase insufficiency altered amino acid metabolism.

PubMed

Hou, Entai; Li, Xian; Liu, Zerong; Zhang, Fuchang; Tian, Zhongmin

2018-04-01

Fumarase catalyzes the interconversion of fumarate and l-malate in the tricarboxylic acid cycle. Fumarase insufficiencies were associated with increased levels of fumarate, decreased levels of malate and exacerbated salt-induced hypertension. To gain insights into the metabolism profiles induced by fumarase insufficiency and identify key regulatory metabolites, we applied a GC-MS based metabolomics platform coupled with a network approach to analyze fumarase insufficient human umbilical vein endothelial cells (HUVEC) and negative controls. A total of 24 altered metabolites involved in seven metabolic pathways were identified as significantly altered, and enriched for the biological module of amino acids metabolism. In addition, Pearson correlation network analysis revealed that fumaric acid, l-malic acid, l-aspartic acid, glycine and l-glutamic acid were hub metabolites according to Pagerank based on their three centrality indices. Alanine aminotransferase and glutamate dehydrogenase activities increased significantly in fumarase deficiency HUVEC. These results confirmed that fumarase insufficiency altered amino acid metabolism. The combination of metabolomics and network methods would provide another perspective on expounding the molecular mechanism at metabolomics level. Copyright © 2017 John Wiley & Sons, Ltd.

Preparation of hydrolytic liquid from dried distiller's grains with solubles and fumaric acid fermentation by Rhizopus arrhizus RH 7-13.

PubMed

Liu, Huan; Yue, Xuemin; Jin, Yuhan; Wang, Meng; Deng, Li; Wang, Fang; Tan, Tianwei

2017-10-01

Fumaric acid production from lignocellulosic materials is an alternative chemicals production system. This work investigated the suitable conditions for hydrolysis of dried distiller's grains with solubles (DDGS). The hydrolytic liquid was subsequently used for the production of fumaric acid. After optimizing the hydrolysis conditions, the most suitable concentration of H 2 SO 4 (2%), hydrolysis temperature (120 °C), hydrolysis time (100min) and solid/liquid ratio (1:10) were obtained. The yield of monosaccharides reached 258 mg/g DDGS and 15.88 g/L glucose, 7.53 g/L xylose and 2.35 g/L arabinose were obtained in unprocessed hydrolytic liquid. The furfural inhibitor in the hydrolytic liquid was also detected and the yield of it was reducing progressively in the pretreatment process. The ferment ability of the hydrolytic liquid from DDGS was tested through the process of fumaric acid production by Rhizopus arrhizus RH 7-13. The unprocessed hydrolytic liquid was not appropriate for the fermentation process. The yield of fumaric acid from the concentrated processed hydrolytic liquid reached 18.93 g/L, which was close to the yield of fermenting 80 g/L glucose. This result indicated that the commonly used carbon resource glucose could to some extent be replaced by processed hydrolytic liquid. Copyright © 2017 Elsevier Ltd. All rights reserved.

Role of HCA₂ (GPR109A) in nicotinic acid and fumaric acid ester-induced effects on the skin.

PubMed

Hanson, Julien; Gille, Andreas; Offermanns, Stefan

2012-10-01

Nicotinic acid (NA) and fumaric acid esters (FAE) such as monomethyl fumarate or dimethyl fumarate are drugs that elicit a cutaneous reaction called flushing as a side effect. NA is used to reduce progression of atherosclerosis through its anti-dyslipidemic activity and lipid-independent mechanisms involving immune cells, whereas FAE are used to treat psoriasis via largely unknown mechanisms. Both, NA and FAE, induce flushing by the activation of the G-protein-coupled receptor (GPCR) Hydroxy-carboxylic acid receptor 2 (HCA₂, GPR109A) in cells of the epidermis. While the wanted effects of NA are at least in part also mediated by HCA₂, it is currently not clear whether this receptor is also involved in the anti-psoriatic effects of FAE. The HCA₂-mediated flushing response to these drugs involves the formation of prostaglandins D₂ and E₂ by Langerhans cells and keratinocytes via COX-1 in Langerhans cells and COX-2 in keratinocytes. This review summarizes recent progress in the understanding of the mechanisms underlying HCA₂-mediated flushing, describes strategies to mitigate it and discusses the potential link between flushing, HCA₂ and the anti-psoriatic effects of FAE. Copyright © 2012 Elsevier Inc. All rights reserved.

Stimulation of Erwinia sp. fumarase and aspartase synthesis by changing medium components.

PubMed

Bagdasaryan, Z N; Aleksanyan, G A; Mirzoyan, A M; Roseiro, J C; Bagdasaryan, S N

2005-05-01

The optimal concentrations of nutrient medium components, aeration conditions, and pH providing for maximum biomass yields, as well as fumarase and L-aspartase activities, during submerged cultivation of Erwinia sp. were determined. The data showed that different concentrations of carbon source (molasses) and pH of the nutrient medium were required to reach the maximum fumarase and L-aspartase activities. Calculations performed by application of the additive lattice model suggested that the combination of these optimized factors would result in 3.2-, 3.4-, and 3.8-fold increases as compared to the experimental means in Erwinia sp. biomass, and L-aspartase and fumarase activities, respectively. The conditions of the fumaric acid biotransformations into L-malic and L-aspartic acids were optimized on the basis of intact Erwinia sp. cells, a fumarase and L-aspartase producer. In the cases of fumarate transformation into L-malic acid and of fumarate transformation into L-aspartic acids, fumarase and L-aspartase activities increased 1.5- and 1.7-fold, respectively. The experimental data were consistent with these estimates to 80% accuracy. In comparison with the additive lattice model, the application of polynomial nonlinear model allowed the between-factor relations to be considered and analyzed, which resulted in 1.1-, 1.27-, and 1.1-fold increases in Erwinia sp. biomass and fumarase and L-aspartase activities for the case of cultivation. In the case of fumarate transformation into L-malic acid, this model demonstrated a 1.7-fold increase in fumarase activity, whereas during fumarate transformation into L-aspartic acid no significant change in aspartase activity was observed.

Complex effect of lignocellulosic biomass pretreatment with 1-butyl-3-methylimidazolium chloride ionic liquid on various aspects of ethanol and fumaric acid production by immobilized cells within SSF.

PubMed

Dotsenko, Anna S; Dotsenko, Gleb S; Senko, Olga V; Stepanov, Nikolay A; Lyagin, Ilya V; Efremenko, Elena N; Gusakov, Alexander V; Zorov, Ivan N; Rubtsova, Ekaterina A

2018-02-01

The pretreatment of softwood and hardwood samples (spruce and hornbeam wood) with 1-butyl-3-methylimidazolium chloride ([Bmim]Cl) was undertaken for further simultaneous enzymatic saccharification of renewable non-food lignocellulosic biomass and microbial fermentation of obtained sugars to ethanol and fumaric acid. A multienzyme cocktail based on cellulases and yeast or fungus cells producing ethanol and fumaric acid were the main objects of [Bmim]Cl influence studies. A complex effect of lignocellulosic biomass pretreatment with [Bmim]Cl on various aspects of the process (both action of cellulases and microbial conversion of hydrolysates to target products) was revealed. Positive effects of the pretreatment with [Bmim]Cl included decreasing the lignin content in the biomass, and increasing the effectiveness of enzymatic hydrolysis and microbial transformation of pretreated biomass. Immobilized cells of both yeasts and fungi possessed improved productive characteristics in the biotransformation of biomass pretreated with [Bmim]Cl to ethanol and fumaric acid. Copyright © 2017 Elsevier Ltd. All rights reserved.

Production of Plant Phthalate and its Hydrogenated Derivative from Bio-Based Platform Chemicals.

PubMed

Lu, Rui; Lu, Fang; Si, Xiaoqin; Jiang, Huifang; Huang, Qianqian; Yu, Weiqiang; Kong, Xiangtao; Xu, Jie

2018-04-06

Direct transformation of bio-based platform chemicals into aromatic dicarboxylic acids and their derivatives, which are widely used for the manufacture of polymers, is of significant importance for the sustainable development of the plastics industry. However, limited successful chemical processes have been reported. This study concerns a sustainable route for the production of phthalate and its hydrogenated derivative from bio-based malic acid and erythritol. The key Diels-Alder reaction is applied to build a substituted cyclohexene structure. The dehydration reaction of malic acid affords fumaric acid with 96.6 % yield, which could be used as the dienophile, and 1,3-butadiene generated in situ through erythritol deoxydehydration serves as the diene. Starting from erythritol and dibutyl fumarate, a 74.3 % yield of dibutyl trans-4-cyclohexene-1,2-dicarboxylate is obtained. The palladium-catalyzed dehydrogenation of the cycloadduct gives a 77.8 % yield of dibutyl phthalate. Dibutyl trans-cyclohexane-1,2-dicarboxylate could be formed in nearly 100 % yield under mild conditions by hydrogenation of the cycloadduct. Furthermore, fumaric acid and fumarate, with trans configurations, were found to be better dienophiles for this Diels-Alder reaction than maleic acid and maleate, with cis configuration, based on the experimental and computational results. This new route will pave the way for the production of environmental friendly plastic materials from plants. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Continuous production of succinic acid by a fumarate-reducing bacterium immobilized in a hollow-fiber bioreactor.

PubMed

Wee, Young-Jung; Yun, Jong-Sun; Kang, Kui-Hyun; Ryu, Hwa-Won

2002-01-01

Enterococcus faecalis RKY1, a fumarate-reducing bacterium, was immobilized in an asymmetric hollow-fiber bioreactor (HFBR) for the continuous production of succinic acid. The cells were inoculated into the shell side of the HFBR, which was operated in transverse mode. Since the pH values in the HFBR declined during continuous operation to about 5.7, it was necessary to change the feed pH from 7.0 to 8.0 after 24 h of operation in order to enhance production of succinic acid. During continuous operation with a medium containing fumarate and glycerol, the productivity of succinate was 3.0-10.9 g/(L x h) with an initial concentration of 30 g/L of fumarate, 4.9-14.9 g/(L x h) with 50 g/L of fumarate, and 7.2-17.1 g/(L x h) with 80 g/L of fumarate for dilution rates between 0.1 and 0.4 h(-1). The maximum productivity of succinate obtained by the HFBR (17.1 g of succinate/[L x h]) was 1.7 times higher than that of the batch bioconversions (9.9 g of succinate/ [L x h]) with 80 g/L of fumarate. Furthermore, the long-term stability of the HFBR was demonstrated with a continuously efficient production of succinate for more than 15 d (360 h).

Simultaneous Production and Recovery of Fumaric Acid from Immobilized Rhizopus oryzae with a Rotary Biofilm Contactor and an Adsorption Column

PubMed Central

Cao, N.; Du, J.; Gong, C. S.; Tsao, G. T.

1996-01-01

An integrated system of simultaneous fermentation-adsorption for the production and recovery of fumaric acid from glucose by Rhizopus oryzae was investigated. The system was constructed such that growing Rhizopus mycelia were self-immobilized on the plastic discs of a rotary biofilm contactor during the nitrogen-rich growth phase. During the nongrowth, production phase, the biofilm was alternately exposed to liquid medium and air upon rotation of the discs in the horizontal fermentation vessel. The product of fermentation, fumaric acid, was removed simultaneously and continuously by a coupled adsorption column, thereby moderating inhibition, enhancing the fermentation rate, and sustaining cell viability. Another beneficial effect of the removal of fumaric acid is release of hydroxyl ions from a polyvinyl pyridine adsorbent into the circulating fermentation broth. This moderates the decrease in pH that would otherwise occur. Polyvinyl pyridine and IRA-900 gave the highest loading for this type of fermentation. This fermentation system is capable of producing fumaric acid with an average yield of 85 g/liter from 100 g of glucose per liter within 20 h under repetitive fed-batch cycles. On a weight yield basis, 91% of the theoretical maximum was obtained with a productivity of 4.25 g/liter/h. This is in contrast to stirred-tank fermentation supplemented with calcium carbonate, whose average weight yield was 65% after 72 h with a productivity of 0.9 g/liter/h. The immobilized reactor was operated repetitively for 2 weeks without loss of biological activity. PMID:16535381

Application of acetate, lactate, and fumarate as electron donors in microbial fuel cell

NASA Astrophysics Data System (ADS)

Vasyliv, Oresta M.; Bilyy, Oleksandr I.; Ferensovych, Yaroslav P.; Hnatush, Svitlana O.

2013-09-01

Microbial fuel cells (MFCs) are devices that use bacteria as the catalysts to oxidize organic and inorganic matter and generate current. Up to now, several classes of extracellular electron transfer mechanisms have been elucidated for various microorganisms. Shewanellaceae and Geobacteraceae families include the most of model exoelectrogenic microorganisms. Desulfuromonas acetoxidans bacterium inhabits aquatic sedimental sulfur-containing environments and is philogenetically close to representatives of Geobacteraceae family. Two chamber microbial fuel cell (0.3 l volume) was constructed with application of D. acetoxidans IMV B-7384 as anode biocatalyst. Acetic, lactic and fumaric acids were separately applied as organic electron donors for bacterial growth in constructed MFC. Bacterial cultivation in MFC was held during twenty days. Lactate oxidation caused electric power production with the highest value up to 0.071 mW on 64 hour of D. acetoxidans IMV B-7384 growth. Addition of acetic and fumaric acids into bacterial growth medium caused maximal power production up to 0.075 and 0.074 mW respectively on the 40 hour of their growth. Increasing of incubation time up to twentieth day caused decrease of generated electric power till 0.018 mW, 0.042 mW and 0.047 mW under usage of lactic, acetic and fumaric acids respectively by investigated bacteria. Power generation by D. acetoxidans IMV B-7384 was more stabile and durable under application of acetic and fumaric acids as electron donors in constructed MFC, than under addition of lactic acid in the same concentration into the growth medium.

Solid-state cocrystal formation between acyclovir and fumaric acid: Terahertz and Raman vibrational spectroscopic studies.

PubMed

Cai, Qiang; Xue, Jiadan; Wang, Qiqi; Du, Yong

2017-11-05

The vibrational spectra of solid-state acyclovir, fumaric acid and their cocrystal have been investigated by using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. In experimental THz spectra, the cocrystal has absorption peaks in 0.65, 0.94 and 1.10THz respectively, while the raw materials are absolutely different in this region. Raman spectra also show similar results about differences between the cocrystal and raw materials. Density functional theory (DFT) was performed to simulate vibrational modes of different theoretical forms between acyclovir and fumaric acid. The calculation of theoretical THz spectra shows that O8C7N1H27 and the carboxyl group COOH establish a dimer theoretical cocrystal form by the hydrogen bonding effect, which makes contributions to the formation of absorption peaks in 0.70, 1.01 and 1.34THz, and agrees well with experimental observations. The theoretical Raman result also indicates that this dimer form matches with experimental results. The characteristic bands of the cocrystal between acyclovir and fumaric acid are also assigned based on the simulation results from the DFT calculation. Copyright © 2017 Elsevier B.V. All rights reserved.

Solid-state cocrystal formation between acyclovir and fumaric acid: Terahertz and Raman vibrational spectroscopic studies

NASA Astrophysics Data System (ADS)

Cai, Qiang; Xue, Jiadan; Wang, Qiqi; Du, Yong

2017-11-01

The vibrational spectra of solid-state acyclovir, fumaric acid and their cocrystal have been investigated by using terahertz time-domain spectroscopy (THz-TDS) and Raman spectroscopy at room temperature. In experimental THz spectra, the cocrystal has absorption peaks in 0.65, 0.94 and 1.10 THz respectively, while the raw materials are absolutely different in this region. Raman spectra also show similar results about differences between the cocrystal and raw materials. Density functional theory (DFT) was performed to simulate vibrational modes of different theoretical forms between acyclovir and fumaric acid. The calculation of theoretical THz spectra shows that O8dbnd C7sbnd N1sbnd H27 and the carboxyl group sbnd COOH establish a dimer theoretical cocrystal form by the hydrogen bonding effect, which makes contributions to the formation of absorption peaks in 0.70, 1.01 and 1.34 THz, and agrees well with experimental observations. The theoretical Raman result also indicates that this dimer form matches with experimental results. The characteristic bands of the cocrystal between acyclovir and fumaric acid are also assigned based on the simulation results from the DFT calculation.

27 CFR 24.182 - Use of acid to correct natural deficiencies.

Code of Federal Regulations, 2014 CFR

2014-04-01

... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2014-04-01 2014-04-01 false Use of acid to correct...

27 CFR 24.182 - Use of acid to correct natural deficiencies.

Code of Federal Regulations, 2011 CFR

2011-04-01

... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2011-04-01 2011-04-01 false Use of acid to correct...

27 CFR 24.182 - Use of acid to correct natural deficiencies.

Code of Federal Regulations, 2012 CFR

2012-04-01

... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2012-04-01 2012-04-01 false Use of acid to correct...

27 CFR 24.182 - Use of acid to correct natural deficiencies.

Code of Federal Regulations, 2013 CFR

2013-04-01

... acid, fumaric acid, malic acid, lactic acid or tartaric acid, or a combination of two or more of these... citric acid for other fruit (including berries). (d) Other use of acid. A winemaker desiring to use an... 27 Alcohol, Tobacco Products and Firearms 1 2013-04-01 2013-04-01 false Use of acid to correct...

Immobilization of Escherichia coli Cells Containing Aspartase Activity with Polyurethane and Its Application for l-Aspartic Acid Production

PubMed Central

Fusee, Murray C.; Swann, Wayne E.; Calton, Gary J.

1981-01-01

Whole cells of Escherichia coli containing aspartase activity were immobilized by mixing a cell suspension with a liquid isocyanate-capped polyurethane prepolymer (Hypol). The immobilized cell preparation was used to convert ammonium fumarate to l-aspartic acid. Properties of the immobilized E. coli cells containing aspartase were investigated with a batch reactor. A 1.67-fold increase in the l-aspartic acid production rate was observed at 37°C as compared to 25°C operating temperature. The pH optimum was broad, ranging from 8.5 to 9.2. Increasing the concentration of ammonium fumarate to 1.5 M from 1.0 M negatively affected the reaction rate. l-Aspartic acid was produced at an average rate of 2.18 × 10−4 mol/min per g (wet weight) of immobilized E. coli cells with a 37°C substrate solution consisting of 1.0 M ammonium fumarate with 1 mM Mg2+ (pH 9.0). PMID:16345865

Bioproduction of L-Aspartic Acid and Cinnamic Acid by L-Aspartate Ammonia Lyase from Pseudomonas aeruginosa PAO1.

PubMed

Patel, Arti T; Akhani, Rekha C; Patel, Manisha J; Dedania, Samir R; Patel, Darshan H

2017-06-01

Aspartase (L-aspartate ammonia lyase, EC 4.3.1.1) catalyses the reversible amination and deamination of L-aspartic acid to fumaric acid which can be used to produce important biochemical. In this study, we have explored the characteristics of aspartase from Pseudomonas aeruginosa PAO1 (PA-AspA). To overproduce PA-AspA, the 1425-bp gene was introduced in Escherichia coli BL21 and purified. A 51.0-kDa protein was observed as a homogenous purified protein on SDS-PAGE. The enzyme was optimally active at pH 8.0 and 35 °C. PA-AspA has retained 56% activity after 7 days of incubation at 35 °C, which displays the hyperthermostablility characteristics of the enzyme. PA-AspA is activated in the presence of metal ions and Mg2+ is found to be most effective. Among the substrates tested for specificity of PA-AspA, L-phenylalanine (38.35 ± 2.68) showed the highest specific activity followed by L-aspartic acid (31.21 ± 3.31) and fumarate (5.42 ± 2.94). K m values for L-phenylalanine, L-aspartic acid and fumarate were 1.71 mM, 0.346 μM and 2 M, respectively. The catalytic efficiency (k cat /K m ) for L-aspartic acid (14.18 s -1  mM -1 ) was higher than that for L-phenylalanine (4.65 s -1  mM -1 ). For bioconversion, from an initial concentration of 1000 mM of fumarate and 30 mM of L-phenylalanine, PA-AspA was found to convert 395.31 μM L-aspartic acid and 3.47 mM cinnamic acid, respectively.

Growth of Campylobacter incubated aerobically in fumarate-pyruvate media or media supplemented with dairy, meat, or soy extracts and peptones.

PubMed

Hinton, Arthur

2016-09-01

The ability of Campylobacter to grow aerobically in media supplemented with fumarate-pyruvate or with dairy, meat, or soy extracts or peptones was examined. Optical densities (OD) of Campylobacter cultured in basal media, media supplemented with fumarate-pyruvate or with 1.0, 2.5, 5.0, or 7.5% beef extract was measured. Growth was also compared in media supplemented with other extracts or peptones. Finally, cfu/mL of Campylobacter recovered from basal media or media supplemented with fumarate-pyruvate, casamino acids, beef extract, soytone, or beef extract and soytone was determined. Results indicated that OD of cultures grown in media supplemented with fumarate-pyruvate or with 5.0 or 7.5% beef extract were higher than OD of isolates grown in basal media or media supplemented with lower concentrations of beef extract. Highest OD were produced by isolates grown in media supplemented with beef extract, peptone from meat, polypeptone, proteose peptone, or soytone. Also, more cfu/mL were recovered from media with fumarate-pyruvate, beef extract, soytone, or beef extract-soytone than from basal media or media with casamino acids. Findings indicate that media supplemented with organic acids, vitamins, and minerals and media supplemented with extracts or peptones containing these metabolites can support aerobic growth of Campylobacter. Published by Elsevier Ltd.

Multi-organ sarcoidosis treatment with fumaric acid esters: a case report and review of the literature.

PubMed

Zouboulis, Christos C; Lippert, Undine; Karagiannidis, Ioannis

2014-01-01

Sarcoidosis is a rare, systemic disease that is characterized by the formation of granulomas in various organs, including the skin. As the etiology remains unknown, the treatment of sarcoidosis is challenging. We present a 47-year-old female patient with progressive, multi-organ sarcoidosis who had a complete clinical improvement of the skin lesions, a moderate reduction in pulmonary opacities on chest X-ray, a marked subjective improvement in general status and pulmonary efficiency and a marked reduction in serum angiotensin-converting enzyme and soluble interleukin-2 receptor after 6 months of therapy with fumaric acid esters. The present case and similar reports in the literature highlight the probable efficacy of fumaric acid esters in the treatment of sarcoidosis and other non-infectious, granulomatous diseases. © 2014 S. Karger AG, Basel.

21 CFR 150.141 - Artificially sweetened fruit jelly.

Code of Federal Regulations, 2011 CFR

2011-04-01

...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

21 CFR 150.141 - Artificially sweetened fruit jelly.

Code of Federal Regulations, 2012 CFR

2012-04-01

...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

21 CFR 150.141 - Artificially sweetened fruit jelly.

Code of Federal Regulations, 2014 CFR

2014-04-01

...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

21 CFR 150.141 - Artificially sweetened fruit jelly.

Code of Federal Regulations, 2013 CFR

2013-04-01

...) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably compensates for... in paragraph (c) of this section, with a jelling ingredient as specified in paragraph (d) of this...

Spectroscopic investigation on cocrystal formation between adenine and fumaric acid based on infrared and Raman techniques

NASA Astrophysics Data System (ADS)

Du, Yong; Fang, Hong Xia; Zhang, Qi; Zhang, Hui Li; Hong, Zhi

2016-01-01

As an important component of double-stranded DNA, adenine has powerful hydrogen-bond capability, due to rich hydrogen bond donors and acceptors existing within its molecular structure. Therefore, it is easy to form cocrystal between adenine and other small molecules with intermolecular hydrogen-bond effect. In this work, cocrystal of adenine and fumaric acid has been characterized as model system by FT-IR and FT-Raman spectral techniques. The experimental results show that the cocrystal formed between adenine and fumaric acid possesses unique spectroscopical characteristic compared with that of starting materials. Density functional theory (DFT) calculation has been performed to optimize the molecular structures and simulate vibrational modes of adenine, fumaric acid and the corresponding cocrystal. Combining the theoretical and experimental vibrational results, the characteristic bands corresponding to bending and stretching vibrations of amino and carbonyl groups within cocrystal are shifted into lower frequencies upon cocrystal formation, and the corresponding bond lengths show some increase due to the effect of intermolecular hydrogen bonding. Different vibrational modes shown in the experimental spectra have been assigned based on the simulation DFT results. The study could provide experimental and theoretical benchmarks to characterize cocrystal formed between active ingredients and cocrystal formers and also the intermolecular hydrogen-bond effect within cocrystal formation process by vibrational spectroscopic techniques.

Carotenoids, but not vitamin A, improve iron uptake and ferritin synthesis by Caco-2 cells from ferrous fumarate and NaFe-EDTA.

PubMed

García-Casal, María N; Leets, Irene

2014-04-01

Due to the high prevalence of iron and vitamin A deficiencies and to the controversy about the role of vitamin A and carotenoids in iron absorption, the objectives of this study were to evaluate the following: (1) the effect of a molar excess of vitamin A as well as the role of tannic acid on iron uptake by Caco-2 cells; (2) iron uptake and ferritin synthesis in presence of carotenoids without pro-vitamin A activity: lycopene, lutein, and zeaxantin; and (3) iron uptake and ferritin synthesis from ferrous fumarate and NaFe-EDTA. Cells were incubated 1 h at 37 °C in PBS pH 5.5, containing (59) Fe and different iron compounds. Vitamin A, ferrous fumarate, β-carotene, lycopene, lutein, zeaxantin, and tannic acid were added to evaluate uptake. Ferritin synthesis was measured 24 h after uptake experiments. Vitamin A had no effect on iron uptake by Caco-2 cells, and was significantly lower from NaFe-EDTA than from ferrous fumarate (15.2 ± 2.5 compared with 52.5 ± 8.3 pmol Fe/mg cell protein, respectively). Carotenoids increase uptake up to 50% from fumarate and up to 300% from NaFe-EDTA, since absorption from this compound is low when administered alone. We conclude the following: (1) There was no effect of vitamin A on iron uptake and ferritin synthesis by Caco-2cells. (2) Carotenoids significantly increased iron uptake from ferrous fumarate and NaFe-EDTA, and were capable of partially overcoming the inhibition produced by tannic acid. (3) Iron uptake by Caco-2 cell from NaFe-EDTA was significantly lower compared to other iron compounds, although carotenoids increased and tannic acid inhibited iron uptake comparably to ferrous fumarate. © 2014 Institute of Food Technologists®

Bioeconomy Initiative at MBI International

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kleff, Susanne, Ph.D.

Di-carboxylic acids have the potential to replace petrochemicals used in the polymer industry (Werpy and Petersen, 2004). MBI developed a process for the production of succinic acid using a proprietary organism. During this work MBI assessed the feasibility to produce other carboxylic acids either using A. succinogenes or other organisms. The development of recombinant A. succinogenes strain derivatives for a mono-carboxylic acid through over-expression of enzymatic activities was successful. Fermentations achieved titers of 58 g/L for this organic acid. Recombinant strains that produced the same acid, but a different stereoisomer, reached titers of 10 g/L. Attempts to increase the titersmore » for this isomer as well as other organic acids were unsuccessful. MBI is looking for commercial partners to pursue the development of recombinant A. succinogenes strains for the production of other organic acids. Attempts to develop recombinant strains of A. succinogenes for fumaric acid production through introduction of various antisense RNA constructs were unsuccessful. Alternative suitable organisms were evaluated and Rhizopus oryzae, a natural fumaric acid producer with potential for process improvements, was selected. A novel fermentation and one-step recovery process was developed that allowed capture of IP, produced titers of >80 g/L with a productivity of 1.8 g/L-h and 57% (g/g glucose) yield. The process was scaled to 2000 L pilot scale. The economic analysis projected a production cost of 72 c/lb. Recycling and re-use of the base was demonstrated and incorporated into the process. The ability of the organism to produce fumaric acid from other carbon sources and biomass hydrolysate was demonstrated. The production of other organic acids was evaluated and techno-economic de-risking roadmap documents were prepared.« less

21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

Code of Federal Regulations, 2011 CFR

2011-04-01

..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

Code of Federal Regulations, 2012 CFR

2012-04-01

..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

Code of Federal Regulations, 2014 CFR

2014-04-01

..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

21 CFR 150.161 - Artificially sweetened fruit preserves and jams.

Code of Federal Regulations, 2013 CFR

2013-04-01

..., spice extract. (2) A vinegar, lemon juice, lime juice, citric acid, lactic acid, malic acid, tartaric acid, fumaric acid, or any combination of two or more of these, in a quantity which reasonably... without water and a jelling ingredient as specified in paragraph (d) of this section. The quantity of the...

An Iterative O-Methyltransferase Catalyzes 1,11-Dimethylation of Aspergillus fumigatus Fumaric Acid Amides.

PubMed

Kalb, Daniel; Heinekamp, Thorsten; Schieferdecker, Sebastian; Nett, Markus; Brakhage, Axel A; Hoffmeister, Dirk

2016-10-04

S-adenosyl-l-methionine (SAM)-dependent methyltransfer is a common biosynthetic strategy to modify natural products. We investigated the previously uncharacterized Aspergillus fumigatus methyltransferase FtpM, which is encoded next to the bimodular fumaric acid amide synthetase FtpA. Structure elucidation of two new A. fumigatus natural products, the 1,11-dimethyl esters of fumaryl-l-tyrosine and fumaryl-l-phenylalanine, together with ftpM gene disruption suggested that FtpM catalyzes iterative methylation. Final evidence that a single enzyme repeatedly acts on fumaric acid amides came from an in vitro biochemical investigation with recombinantly produced FtpM. Size-exclusion chromatography indicated that this methyltransferase is active as a dimer. As ftpA and ftpM homologues are found clustered in other fungi, we expect our work will help to identify and annotate natural product biosynthesis genes in various species. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of an Amperometric Biosensor Platform for the Combined Determination of L-Malic, Fumaric, and L-Aspartic Acid.

PubMed

Röhlen, Désirée L; Pilas, Johanna; Schöning, Michael J; Selmer, Thorsten

2017-10-01

Three amperometric biosensors have been developed for the detection of L-malic acid, fumaric acid, and L -aspartic acid, all based on the combination of a malate-specific dehydrogenase (MDH, EC 1.1.1.37) and diaphorase (DIA, EC 1.8.1.4). The stepwise expansion of the malate platform with the enzymes fumarate hydratase (FH, EC 4.2.1.2) and aspartate ammonia-lyase (ASPA, EC 4.3.1.1) resulted in multi-enzyme reaction cascades and, thus, augmentation of the substrate spectrum of the sensors. Electrochemical measurements were carried out in presence of the cofactor β-nicotinamide adenine dinucleotide (NAD + ) and the redox mediator hexacyanoferrate (III) (HCFIII). The amperometric detection is mediated by oxidation of hexacyanoferrate (II) (HCFII) at an applied potential of + 0.3 V vs. Ag/AgCl. For each biosensor, optimum working conditions were defined by adjustment of cofactor concentrations, buffer pH, and immobilization procedure. Under these improved conditions, amperometric responses were linear up to 3.0 mM for L-malate and fumarate, respectively, with a corresponding sensitivity of 0.7 μA mM -1 (L-malate biosensor) and 0.4 μA mM -1 (fumarate biosensor). The L-aspartate detection system displayed a linear range of 1.0-10.0 mM with a sensitivity of 0.09 μA mM -1 . The sensor characteristics suggest that the developed platform provides a promising method for the detection and differentiation of the three substrates.

Identification and characterization of two new derivatives of chlorogenic acids in Arnica (Arnica montana L.) flowers by high-performance liquid chromatography/tandem mass spectrometry.

PubMed

Jaiswal, Rakesh; Kuhnert, Nikolai

2011-04-27

Arnica montana is a medicinally important plant due to its broad health effects, and it is used in Ayurvedic, Homeopathic, Unani, and folk medicines. We have used LC-MS(n) (n = 2-5) to detect and characterize in Arnica flowers 11 quantitatively minor fumaric and methoxyoxalic acid-containing chlorogenic acids, nine of them not previously reported in nature. These comprise 1,5-dicaffeoyl-3-methoxyoxaloylquinic acid, 1,3-dicaffeoyl-4-methoxyoxaloylquinic acid, 3,5-dicaffeoyl-4-methoxyoxaloylquinic acid, and 1-methoxyoxaloyl-4,5-dicaffeoylquinic acid (M(r) 602); 3-caffeoyl-4-feruloyl-5-methoxyoxaloylquinic acid and 3-feruloyl-4-methoxyoxaloyl-5-caffeoylquinic acid (M(r) 616); 1,5-dicaffeoyl-4-fumaroyl and 1,5-dicaffeoyl-3-fumaroylquinic acid (M(r) 614); 3,5-dicaffeoyl-1,4-dimethoxyoxaloylquinic acid (M(r) 688); and 1-methoxyoxaloyl-3,4,5-tricaffeoylquinic acid and 1,3,4-tricaffeoyl-5-methoxyoxaloylquinic acid (M(r) 764). All of the structures have been assigned on the basis of LC-MS(n) patterns of fragmentation, relative hydrophobicity, and analogy of fragmentation patterns if compared to caffeoylquinic acids. This is the first time when fumaric acid-containing chlorogenic acids are reported in nature.

Spectroscopic investigation on cocrystal formation between adenine and fumaric acid based on infrared and Raman techniques.

PubMed

Du, Yong; Fang, Hong Xia; Zhang, Qi; Zhang, Hui Li; Hong, Zhi

2016-01-15

As an important component of double-stranded DNA, adenine has powerful hydrogen-bond capability, due to rich hydrogen bond donors and acceptors existing within its molecular structure. Therefore, it is easy to form cocrystal between adenine and other small molecules with intermolecular hydrogen-bond effect. In this work, cocrystal of adenine and fumaric acid has been characterized as model system by FT-IR and FT-Raman spectral techniques. The experimental results show that the cocrystal formed between adenine and fumaric acid possesses unique spectroscopical characteristic compared with that of starting materials. Density functional theory (DFT) calculation has been performed to optimize the molecular structures and simulate vibrational modes of adenine, fumaric acid and the corresponding cocrystal. Combining the theoretical and experimental vibrational results, the characteristic bands corresponding to bending and stretching vibrations of amino and carbonyl groups within cocrystal are shifted into lower frequencies upon cocrystal formation, and the corresponding bond lengths show some increase due to the effect of intermolecular hydrogen bonding. Different vibrational modes shown in the experimental spectra have been assigned based on the simulation DFT results. The study could provide experimental and theoretical benchmarks to characterize cocrystal formed between active ingredients and cocrystal formers and also the intermolecular hydrogen-bond effect within cocrystal formation process by vibrational spectroscopic techniques. Copyright © 2015 Elsevier B.V. All rights reserved.

Dihydrolipoyl dehydrogenase as a potential UVB target in skin epidermis; using an integrated approach of label-free quantitative proteomics and targeted metabolite analysis.

PubMed

Moon, Eunjung; Park, Hye Min; Lee, Choong Hwan; Do, Seon-Gil; Park, Jong-Moon; Han, Na-Young; Do, Moon Ho; Lee, Jong Ha; Lee, Hookeun; Kim, Sun Yeou

2015-03-18

Photodamage is extrinsically induced by overexposure to ultraviolet (UV) radiation, and it increases the risk of various skin disorders. Therefore, discovery of novel biomarkers of photodamage is important. In this study, using LC-MS/MS analysis of epidermis from UVB-irradiated hairless mice, we identified 57 proteins whose levels changed after UVB exposure, and selected 7 proteins related to the tricarboxylic acid (TCA) cycle through pathway analysis. Dihydrolipoyl dehydrogenase (DLD) was the only TCA cycle-associated protein that showed a decreased expression after the UVB exposure. We also performed targeted analysis to detect intermediates and products of the TCA cycle using GC-TOF-MS. Interestingly, malic acid and fumaric acid levels significantly decreased in the UVB-treated group. Our results demonstrate that DLD and its associated metabolites, malic acid and fumaric acid, may be candidate biomarkers of UVB-induced skin photoaging. Additionally, we showed that Aloe vera, a natural skin moisturizer, regulated DLD, malic acid and fumaric acid levels in UVB-exposed epidermis. Our strategy to integrate the proteome and targeted metabolite to detect novel UVB targets will lead to a better understanding of skin photoaging and photodamage. Our study also supports that A. vera exerts significant anti-photodamage activity via regulation of DLD, a novel UVB target, in the epidermis. This study is the first example of an integration of proteomic and metabolite analysis techniques to find new biomarker candidates for the regulation of the UVB-induced skin photoaging. DLD, malic acid, and fumaric acid can be used for development of cosmeceuticals and nutraceuticals regulating the change of skin metabolism induced by the UVB overexposure. Moreover, this is also the first attempt to investigate the role of the TCA cycle in photodamaged epidermis. Our integration of the proteomic and targeted metabolite analyses will lead to a better understanding of the unidentified photobiological results from UVB-irradiated models and can elicit new diagnostic and treatment strategies based on altered metabolism. Copyright © 2015. Published by Elsevier B.V.

Fumaric Acid Esters Do Not Reduce Inflammatory NF-κB/p65 Nuclear Translocation, ICAM-1 Expression and T-Cell Adhesiveness of Human Brain Microvascular Endothelial Cells.

PubMed

Haarmann, Axel; Nehen, Mathias; Deiß, Annika; Buttmann, Mathias

2015-08-13

Dimethyl fumarate (DMF) is approved for disease-modifying treatment of patients with relapsing-remitting multiple sclerosis. Animal experiments suggested that part of its therapeutic effect is due to a reduction of T-cell infiltration of the central nervous system (CNS) by uncertain mechanisms. Here we evaluated whether DMF and its primary metabolite monomethyl fumarate (MMF) modulate pro-inflammatory intracellular signaling and T-cell adhesiveness of nonimmortalized single donor human brain microvascular endothelial cells at low passages. Neither DMF nor MMF at concentrations of 10 or 50 µM blocked the IL-1β-induced nuclear translocation of NF-κB/p65, whereas the higher concentration of DMF inhibited the nuclear entry of p65 in human umbilical vein endothelium cultured in parallel. DMF and MMF also did not alter the IL-1β-stimulated activation of p38 MAPK in brain endothelium. Furthermore, neither DMF nor MMF reduced the basal or IL-1β-inducible expression of ICAM-1. In accordance, both fumaric acid esters did not reduce the adhesion of activated Jurkat T cells to brain endothelium under basal or inflammatory conditions. Therefore, brain endothelial cells probably do not directly mediate a potential blocking effect of fumaric acid esters on the inflammatory infiltration of the CNS by T cells.

21 CFR 177.2420 - Polyester resins, cross-linked.

Code of Federal Regulations, 2011 CFR

2011-04-01

... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) INDIRECT FOOD ADDITIVES: POLYMERS Substances for Use Only... this section: (1) Acids: Adipic. Fatty acids, and dimers thereof, from natural sources. Fumaric...

21 CFR 177.2420 - Polyester resins, cross-linked.

Code of Federal Regulations, 2010 CFR

2010-04-01

... (CONTINUED) FOOD FOR HUMAN CONSUMPTION (CONTINUED) INDIRECT FOOD ADDITIVES: POLYMERS Substances for Use Only... this section: (1) Acids: Adipic. Fatty acids, and dimers thereof, from natural sources. Fumaric...

Recent advances in the biomedical applications of fumaric acid and its ester derivatives: The multifaceted alternative therapeutics.

PubMed

Das, Ratul Kumar; Brar, Satinder Kaur; Verma, Mausam

2016-04-01

Several lines of evidence have demonstrated the potential biomedical applications of fumaric acid (FA) and its ester derivatives against many human disease conditions. Fumaric acid esters (FAEs) have been licensed for the systemic treatment of the immune-mediated disease psoriasis. Biogen Idec Inc. announced about the safety and efficacy of the formulation FAE (BG-12) for treating RRMS (relapsing-remitting multiple sclerosis). Another FAE formulation DMF (dimethyl fumarate) was found to be capable of reduction in inflammatory cardiac conditions, such as autoimmune myocarditis and ischemia and reperfusion. DMF has also been reported to be effective as a potential neuroprotectant against the HIV-associated neurocognitive disorders (HAND). Many in vivo studies carried out on rat and mice models indicated inhibitory effects of fumaric acid on carcinogenesis of different origins. Moreover, FAEs has emerged as an important matrix ingredient in the fabrication of biodegradable scaffolds for tissue engineering applications. Drug delivery vehicles composed of FAEs have shown promising results in delivering some leading drug molecules. Apart from these specific applications and findings, many more studies on FAEs have revealed new therapeutic potentials with the scope of clinical applications. However, until now, this scattered vital information has not been written into a collective account and analyzed for minute details. The aim of this paper is to review the advancement made in the biomedical application of FA and FAEs and to focus on the clinical investigation and molecular interpretation of the beneficial effects of FA and FAEs. Copyright © 2015 Institute of Pharmacology, Polish Academy of Sciences. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

Absolute configuration of a chiral CHD group via neutron diffraction: confirmation of the absolute stereochemistry of the enzymatic formation of malic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bau, R.; Brewer, I.; Chiang, M.Y.

Neutron diffraction has been used to monitor the absolute stereochemistry of an enzymatic reaction. (-)(2S)malic-3-d acid was prepared by the action of fumarase on fumaric acid in D/sub 2/O. After a large number of cations were screened, it was found that (+)(R)..cap alpha..-phenylethylamine forms the large crystals necessary for a neutron diffraction analysis. The subsequent structure determination showed that (+)(R)..cap alpha..-phenylethylammonium (-)(2S)malate-3-d has an absolute configuration of R at the CHD site. This result confirms the absolute stereochemistry of fumarate-to-malate transformation as catalyzed by the enzyme fumarase.

Studies on potential effects of fumaric acid on rumen microbial fermentation, methane production and microbial community.

PubMed

Riede, Susanne; Boguhn, Jeannette; Breves, Gerhard

2013-01-01

The greenhouse gas methane (CH4) contributes substantially to global climate change. As a potential approach to decrease ruminal methanogenesis, the effects of different dosages of fumaric acid (FA) on ruminal microbial metabolism and on the microbial community (archaea, bacteria) were studied using a rumen simulation technique (RUSITEC). FA acts as alternative hydrogen acceptor diverting 2H from methanogenesis of archaea towards propionate formation of bacteria. Three identical trials were conducted with 12 fermentation vessels over a period of 14 days. In each trial, four fermentation vessels were assigned to one of the three treatment groups differing in FA dosage: low fumaric acid (LFA), high fumaric acid (HFA) and without FA (control). FA was continuously infused with the buffer. Grass silage and concentrate served as substrate. FA led to decreases in pH and to higher production rates of total short chain fatty acids (SCFA) mediated by increases in propionate for LFA of 1.69 mmol d(-1) and in propionate and acetate production for HFA of 4.49 and 1.10 mmol d(-1), respectively. Concentrations of NH3-N, microbial crude protein synthesis, their efficiency, degradation of crude nutrients and detergent fibre fraction were unchanged. Total gas and CH4 production were not affected by FA. Effects of FA on structure of microbial community by means of single strand conformation polymorphism (SSCP) analyses could not be detected. Given the observed increase in propionate production and the unaffected CH4 production it can be supposed that the availability of reduction equivalents like 2H was not limited by the addition of FA in this study. It has to be concluded from the present study that the application of FA is not an appropriate approach to decrease the ruminal CH4 production.

Addition of fumaric acid and sodium benzoate as an alternative method to achieve a 5-log reduction of Escherichia coli O157:H7 populations in apple cider.

PubMed

Comes, Justin E; Beelman, Robert B

2002-03-01

A study was conducted to develop a preservative treatment capable of the Food and Drug Administration-mandated 5-log reduction of Escherichia coli O157:H7 populations in apple cider. Unpreserved apple cider was treated with generally recognized as safe acidulants and preservatives before inoculation with E. coli O157:H7 in test tubes and subjected to mild heat treatments (25, 35, and 45 degrees C) followed by refrigerated storage (4 degrees C). Fumaric acid had significant (P < 0.05) bactericidal effect when added to cider at 0.10% (wt/vol) and adjusted to pH 3.3, but citric and malic acid had no effect. Strong linear correlation (R2 = 0.96) between increasing undissociated fumaric acid concentrations and increasing log reductions of E. coli O157:H7 in apple cider indicated the undissociated acid to be the bactericidal form. The treatment that achieved the 5-log reduction in three commercial ciders was the addition of fumaric acid (0.15%, wt/vol) and sodium benzoate (0.05%, wt/vol) followed by holding at 25 degrees C for 6 h before 24 h of refrigeration at 4 degrees C. Subsequent experiments revealed that the same preservatives added to cider in flasks resulted in a more than 5-log reduction in less than 5 and 2 h when held at 25 and 35 degrees C, respectively. The treatment also significantly (P < 0.05) reduced total aerobic counts in commercial ciders to populations less than those of pasteurized and raw ciders from the same source (after 5 and 21 days of refrigerated storage at 4 degrees C, respectively). Sensory evaluation of the same ciders revealed that consumers found the preservative-treated cider to be acceptable.

BG 12: BG 00012, BG 12/Oral Fumarate, FAG-201, second-generation fumarate derivative--Fumapharm/Biogen Idec.

PubMed

2005-01-01

Fumapharm AG has developed a second-generation fumarate (fumaric acid) derivative, BG 12 [BG 00012, FAG-201, BG 12/Oral Fumarate], for the oral treatment of psoriasis. Biogen Idec is currently evaluating the product in clinical trials as an oral treatment for multiple sclerosis (phase II) and psoriasis (phase III) trials.BG 12 has an immunomodulatory mechanism of action. It seems that this product has been developed to reduce the adverse effects associated with a first-generation product containing fumaric acid esters (mixed dimethylfumarate and monoethylfumarate salts), Fumaderm. Fumaderm was approved in Germany in August 1994 and is currently the leading oral systemic therapy for moderate-to-severe psoriasis in Germany. One of the problems associated with Fumaderm capsules has been its gastrointestinal adverse effects (including diarrhoea and nausea). In September 2003, Biogen (now Biogen Idec) licensed exclusive worldwide rights (excluding Germany) from Fumapharm to develop and market BG 12. Biogen plans to collaborate with Fumapharm to accelerate phase III development for psoriasis and the registration programme worldwide. Financial terms of the agreement were not disclosed. Development plans for BG 12 include other autoimmune and inflammatory disorders, such as multiple sclerosis. In November 2003, Biogen and IDEC Pharmaceuticals merged to form Biogen Idec. Fumapharm completed phase II trials of this second-generation fumarate derivative for psoriasis prior to licensing of the product to Biogen, also with positive results.

Growth and Metabolism of Lactic Acid Bacteria during and after Malolactic Fermentation of Wines at Different pH

PubMed Central

Davis, C. R.; Wibowo, D. J.; Lee, T. H.; Fleet, G. H.

1986-01-01

Commercially produced red wines were adjusted to pH 3.0, 3.2, 3.5, 3.7, or 4.0 and examined during and after malolactic fermentation for growth of lactic acid bacteria and changes in the concentrations of carbohydrates, organic acids, amino acids, and acetaldehyde. With one exception, Leuconostoc oenos conducted the malolactic fermentation in all wines and was the only species to occur in wines at pH below 3.5. Malolactic fermentation by L. oenos was accompanied by degradation of malic, citric, and fumaric acids and production of lactic and acetic acids. The concentrations of arginine, histidine, and acetaldehyde also decreased at this stage, but the behavior of hexose and pentose sugars was complicated by other factors. Pediococcus parvulus conducted the malolactic fermentation in one wine containing 72 mg of total sulfur dioxide per liter. Fumaric and citric acids were not degraded during this malolactic fermentation, but hexose sugars were metabolized. P. parvulus and species of Lactobacillus grew after malolactic fermentation in wines with pH adjusted above 3.5. This growth was accompanied by the utilization of wine sugars and production of lactic and acetic acids. PMID:16347015

Nematicidal Activity of Kojic Acid Produced by Aspergillus oryzae against Meloidogyne incognita.

PubMed

Kim, Tae Yoon; Jang, Ja Yeong; Jeon, Sun Jeong; Lee, Hye Won; Bae, Chang-Hwan; Yeo, Joo Hong; Lee, Hyang Burm; Kim, In Seon; Park, Hae Woong; Kim, Jin-Cheol

2016-08-28

The fungal strain EML-DML3PNa1 isolated from leaf of white dogwood (Cornus alba L.) showed strong nematicidal activity with juvenile mortality of 87.6% at a concentration of 20% fermentation broth filtrate at 3 days after treatment. The active fungal strain was identified as Aspergillus oryzae, which belongs to section Flavi, based on the morphological characteristics and sequence analysis of the ITS rDNA, calmodulin (CaM), and β-tubulin (BenA) genes. The strain reduced the pH value to 5.62 after 7 days of incubation. Organic acid analysis revealed the presence of citric acid (515.0 mg/kg), malic acid (506.6 mg/kg), and fumaric acid (21.7 mg/kg). The three organic acids showed moderate nematicidal activities, but the mixture of citric acid, malic acid, and fumaric acid did not exhibit the full nematicidal activity of the culture filtrate of EML- DML3PNa1. Bioassay-guided fractionation coupled with (1)H- and (13)C-NMR and EI-MS analyses led to identification of kojic acid as the major nematicidal metabolite. Kojic acid exhibited dose-dependent mortality and inhibited the hatchability of M. incognita, showing EC50 values of 195.2 µg/ml and 238.3 µg/ml, respectively, at 72 h postexposure. These results suggest that A. oryzae EML-DML3PNa1 and kojic acid have potential as a biological control agent against M. incognita.

Cocrystals of acyclovir with promising physicochemical properties.

PubMed

Sarkar, Anindita; Rohani, Sohrab

2015-01-01

Cocrystal forming ability of antiviral drug acyclovir (ACV) with different coformers was studied. Three cocrystals containing ACV with fumaric acid, malonic acid, and DL-tartaric acid were isolated. Methods of cocrystallization included grinding with dropwise solvent addition and solvent evaporation. The cocrystals were characterized by powder X-ray diffraction, differential scanning calorimetry, and thermogravimetric analysis. The crystal structure of the cocrystal with fumaric acid as conformer was determined by single crystal X-ray diffraction. Formation of supramolecular synthon was observed in the cocrystal. Stability with respect to relative humidity for the three cocrystals was evaluated. The aqueous solubility of the ACV-cocrystal materials was significantly improved with a maximum of malonic acid cocrystal, which was about six times more soluble at 35°C compared with that of parent ACV. The dissolution profile indicates that at any particular dissolution time, the concentration of cocrystals in the solution was higher than that of the parent ACV, and malonic acid cocrystals had a maximum release of about twice than the hydrated ACV. © 2014 Wiley Periodicals, Inc. and the American Pharmacists Association.

Development of Repair Materials for Avulsive Combat-Type Maxillofacial Injuries.

DTIC Science & Technology

1981-11-01

sone. A sample of 0.2702 grams of the resulting corn- nitic acid. tsocitric acid, alpha - ketoglutaric acid. suc- position was shaped into the form of a...polylactic acid and inorganic materials such as calcium carbonate or calcium sulfate. The chemistry of the system proposed for development includes...acid and high molecular weight poly(propylene fumarate) were synthesized at Dynatech to be used as organic fillers. Inorganic fil- lers such as calcium

Interconversion of biologically important carboxylic acids by radiation

NASA Technical Reports Server (NTRS)

Negron-Mendoza, A.; Ponnamperuma, C.

1978-01-01

The interconversion of a group of biologically important polycarboxylic acids (acetic, fumaric, malic, malonic, succinic, citric, isocitric, tricarballylic) under gamma-ray or ultraviolet radiation was investigated. The formation of high molecular weight compounds was observed in all cases. Succinic acid was formed in almost all radiolysis experiments. Citric, malonic, and succinic acids appeared to be relatively insensitive to radiation. Interconversion of the polycarboxylic acids studied may have occurred under the effect of radiation in the prebiotic earth.

Simultaneous determination of furfural and its degradation products, furoic acid and maleic acid, in transformer oil by the reversed-phase vortex-assisted liquid-liquid microextraction followed by high-performance liquid chromatography.

PubMed

Wang, Yifan; Li, Haiyan; Yang, Zhen; Zhang, Weijie; Hua, Jia

2017-12-01

To explore why the use of furfural as a transformer oil-paper insulation aging characteristic is problematic in real world application, we developed a method for the simultaneous determination of furfural, furoic acid, and maleic acid in transformer oil by reversed-phase vortex-assisted liquid-liquid microextraction combined with high-performance liquid chromatography. The conditions for the proposed method were optimized, and the obtained extract can be directly analyzed by high-performance liquid chromatography. The detection limits (signal-to-noise ratio = 3) of the method ranged from 1.0 to 4.6 μg/L, the enrichment factors for furfural, furoic acid, maleic acid, and fumaric acid were 4.6, 25.1, 15.6, and 17.5, respectively, and the recovery rates for three analytes (fumaric acid was undetected) range from 82.1 to 106.2%. The contents of furfural, furoic acid, and maleic acid resulted from accelerated aging of transformer insulation oil-paper were measured using the present method for the first time, and the aging samples were analyzed by liquid chromatography with mass spectrometry for the identification of furoic acid and maleic acid in the aging transformer oil samples. Using the optimal method, the target products of samples at different aging time were tracked and measured. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bis(PheOH) maleic acid amide-fumaric acid amide photoizomerization induces microsphere-to-gel fiber morphological transition: the photoinduced gelation system.

PubMed

Frkanec, Leo; Jokić, Milan; Makarević, Janja; Wolsperger, Kristina; Zinić, Mladen

2002-08-21

The photoinduced gelation system based on 1 (non-gelling) to 2 (gelling) molecular photoisomerization in water results by microspheres (1) to gel fibers (2) transformation at the supramolecular level.

Intrinsic Anaerobic Bioremediation of Hydrocarbons in Contaminated Subsurface Plumes and Marine Sediments

NASA Astrophysics Data System (ADS)

Nanny, M. A.; Nanny, M. A.; Suflita, J. M.; Suflita, J. M.; Davidova, I.; Kropp, K.; Caldwell, M.; Philp, R.; Gieg, L.; Rios-Hernandez, L. A.

2001-05-01

In recent years, several classes of petroleum hydrocarbons contaminating subsurface and marine environments have been found susceptible to anaerobic biodegradation using novel mechanisms entirely distinct from aerobic metabolic pathways. For example, the anaerobic decay of toluene can be initiated by the addition of the aryl methyl group to the double bond of fumarate, resulting in a benzylsuccinic acid metabolite. Our work has shown that an analogous mechanism also occurs with ethylbenzene and the xylene isomers, yielding 3-phenyl-1,2-butane dicarboxylic acid and methylbenzylsuccinic acid, respectively. Moreover, these metabolites have been detected in contaminated environments. Most recently, we have identified metabolites resulting from the initial attack of H26- or D26-n-dodecane during degradation by a sulfate-reducing bacterial culture. Using GC-MS, these metabolites were identified as fatty acids that result from C-H or C-D addition across the double bond of fumarate to give dodecylsuccinic acids in which all 26 protons or deuteriums of the parent alkane were retained. Further, when this enrichment culture was challenged with hexane or decane, hexylsuccinic acid or decylsuccinic acid were identified as resulting metabolites. Similarly, the study of an ethylcyclopentane-degrading sulfate-reducing enrichment produced a metabolite, which is consistent with the addition of fumarate to the parent substrate. These novel anaerobic addition products are characterized by similar, distinctive mass spectral (MS) features (ions specific to the succinic acid portion of the molecule) that can potentially be used to probe contaminated environments for evidence of intrinsic remediation of hydrocarbons. Indeed, analyses of water extracts from two gas condensate-contaminated sites resulted in the tentative detection of alkyl- and cycloalkylsuccinic acids ranging from C3 to C9, including ethylcyclopentyl-succinic acid. In water extracts collected from an area underlying a petroleum production plant, MS profiles consistent with the addition products of methylcycloalkenes were observed. This work helps attests to: 1) the extrapolatability of laboratory results to the field, 2) the unifying metabolic features for the anaerobic destruction of diverse types of hydrocarbons, and 3) how this information can be used to assess the intrinsic bioremediation processes in petroleum-contaminated environments.

The effect of change in pH on the solubility of iron bis-glycinate chelate and other iron compounds.

PubMed

García-Casal, M N; Layrisse, M

2001-03-01

The effect of a pH change from 2 to 6 was tested on the solubility of ferrous sulfate, ferrous fumarate, iron bis-glycine chelate (Ferrochel) and sodium-iron ethylenediaminetetraacetic acid (NaFeEDTA). It was found that at pH 2 ferrous sulfate, Ferrochel and NaFeEDTA were completely soluble and only 75% of iron from ferrous fumarate was soluble. When pH was raised to 6, iron from amino acid chelate and NaFeEDTA remained completely soluble while solubility from ferrous sulfate and ferrous fumarate decreased 64 and 74%, respectively compared to the amount of iron initially soluble at pH 2. These results suggest that iron solubility from iron bis-glycine chelate and NaFeEDTA is not affected by pH changes within the ranges tested, probably because iron remained associated to the respective compounds.

46 CFR Table I to Part 150 - Alphabetical List of Cargoes

Code of Federal Regulations, 2014 CFR

2014-10-01

... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

46 CFR Table I to Part 150 - Alphabetical List of Cargoes

Code of Federal Regulations, 2013 CFR

2013-10-01

... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

46 CFR Table I to Part 150 - Alphabetical List of Cargoes

Code of Federal Regulations, 2010 CFR

2010-10-01

... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

46 CFR Table I to Part 150 - Alphabetical List of Cargoes

Code of Federal Regulations, 2011 CFR

2011-10-01

... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

46 CFR Table I to Part 150 - Alphabetical List of Cargoes

Code of Federal Regulations, 2012 CFR

2012-10-01

... (C17+) alkanoic acid 34 CUS CFT Corn syrup 43 CSY Cottonseed oil, fatty acid 34 CFY Creosote 21 2 CCT... tar 33 COR OCT Coal tar distillate 33 CDL Coal tar, high temperature 33 CHH Coal tar pitch 33 CTP... MTM Formaldehyde solution 19 2 FMS Formamide 10 FAM Formic acid 4 2 FMA Fructose solution 43 Fumaric...

Dicarboxylic acids generated by thermal alteration of kerogen and humic acids

NASA Technical Reports Server (NTRS)

Kawamura, Kimitaka; Kaplan, I. R.

1987-01-01

Significant amounts (up to 2 percent of organic geopolymers) of low-molecular-weight (LMW) dicarboxylic acids (C2-C10) have been detected during thermal alteration (270 C, 2 h) of kerogens and humic acids isolated from young or ancient lithified sediments. Their distribution is characterized by the predominance of oxalic acid followed by succinic, fumaric, and methylsuccinic acids. These acids are probably released by the breakdown of macromolecular structures, which have incorporated biogenic organic compounds, including diacids, during early digenesis in sediments. Because of their reactivity, LMW diacids may play geochemically important roles under natural conditions.

Molecular docking and molecular dynamics simulations of fumarate hydratase and its mutant H235N complexed with pyromellitic acid and citrate.

PubMed

Subasri, S; Chaudhary, Santosh Kumar; Sekar, K; Kesherwani, Manish; Velmurugan, D

2017-12-01

Fumarase catalyzes the reversible, stereospecific hydration/dehydration of fumarate to L-malate during the Kreb's cycle. In the crystal structure of the tetrameric fumarase, it was found that some of the active site residues S145, T147, N188 G364 and H235 had water-mediated hydrogen bonding interactions with pyromellitic acid and citrate which help to the protonation state for the conversion of fumarate to malate. When His 235 is mutated with Asn (H235N), water-mediated interactions were lost due to the shifting of active site water molecule by 0.7 Å away. Molecular dynamics (MD) simulations were also carried out by NAMD and analyzed using Assisted Model Building with Energy Refinement (AMBER) program to better understand the conformational stability and other aspects during the binding of pyromellitic acid and citrate with native and mutant FH. The role of hydrogen bonds and hydrophobic interactions was also analyzed. The present study confirms that the H235N mutation has a major effect on the catalytic activity of fumarase which is evident from the biochemical studies.

Environmental Compliance Assessment System (USA ECAS)

DTIC Science & Technology

1991-09-01

Fuberidazole 100/10,000 3878-19-1 Fulminic acid , mercu- 10 P065 628-86-4 ry(I1) salt Fumaric acid 5000 110-17-8 Furan, tetrahydro- 1000 LT213 109-99-9 Furan...etc.)? S. Does the installation have any bulk acid storage? 6. Does the installation store batteries and/or have a battery reclamation point? I...gas turbines (greater than 1 MBtuhr) - bulk gasoline terminals - municipal waste combustors - sulfuric and nitric acid plants - rotogravure printers

Protein and metabolic engineering for the production of organic acids.

PubMed

Liu, Jingjing; Li, Jianghua; Shin, Hyun-Dong; Liu, Long; Du, Guocheng; Chen, Jian

2017-09-01

Organic acids are natural metabolites of living organisms. They have been widely applied in the food, pharmaceutical, and bio-based materials industries. In recent years, biotechnological routes to organic acids production from renewable raw materials have been regarded as very promising approaches. In this review, we provide an overview of current developments in the production of organic acids using protein and metabolic engineering strategies. The organic acids include propionic acid, pyruvate, itaconic acid, succinic acid, fumaric acid, malic acid and citric acid. We also expect that rapid developments in the fields of systems biology and synthetic biology will accelerate protein and metabolic engineering for microbial organic acid production in the future. Copyright © 2017. Published by Elsevier Ltd.

Overexpression of a C4-dicarboxylate transporter is the key for rerouting citric acid to C4-dicarboxylic acid production in Aspergillus carbonarius.

PubMed

Yang, Lei; Christakou, Eleni; Vang, Jesper; Lübeck, Mette; Lübeck, Peter Stephensen

2017-03-14

C 4 -dicarboxylic acids, including malic acid, fumaric acid and succinic acid, are valuable organic acids that can be produced and secreted by a number of microorganisms. Previous studies on organic acid production by Aspergillus carbonarius, which is capable of producing high amounts of citric acid from varieties carbon sources, have revealed its potential as a fungal cell factory. Earlier attempts to reroute citric acid production into C 4 -dicarboxylic acids have been with limited success. In this study, a glucose oxidase deficient strain of A. carbonarius was used as the parental strain to overexpress a native C 4 -dicarboxylate transporter and the gene frd encoding fumarate reductase from Trypanosoma brucei individually and in combination. Impacts of the introduced genetic modifications on organic acid production were investigated in a defined medium and in a hydrolysate of wheat straw containing high concentrations of glucose and xylose. In the defined medium, overexpression of the C 4 -dicarboxylate transporter alone and in combination with the frd gene significantly increased the production of C 4 -dicarboxylic acids and reduced the accumulation of citric acid, whereas expression of the frd gene alone did not result in any significant change of organic acid production profile. In the wheat straw hydrolysate after 9 days of cultivation, similar results were obtained as in the defined medium. High amounts of malic acid and succinic acid were produced by the same strains. This study demonstrates that the key to change the citric acid production into production of C 4 -dicarboxylic acids in A. carbonarius is the C 4 -dicarboxylate transporter. Furthermore it shows that the C 4 -dicarboxylic acid production by A. carbonarius can be further increased via metabolic engineering and also shows the potential of A. carbonarius to utilize lignocellulosic biomass as substrates for C 4 -dicarboxylic acid production.

The Path of Carbon in Photosynthesis VIII. The Role of Malic Acid

DOE R&D Accomplishments Database

Bassham, James A.; Benson, Andrew A.; Calvin, Melvin

1950-01-25

Malonate has been found to inhibit the formation of malic acid during short periods of photosynthesis with radioactive carbon dioxide. This result, together with studies which show the photosynthetic cycle to be operating normally at the same time, indicates that malic acid is not an intermediate in photosynthesis but is probably closely related to some intermediate of the cycle. Absence of labeled succinic and fumaric acids in these experiments, in addition to the failure of malonate to inhibit photosynthesis, precludes the participation of these acids as intermediates in photosynthesis.

21 CFR 177.1520 - Olefin polymers.

Code of Federal Regulations, 2011 CFR

2011-04-01

... by reaction with fumaric acid in the absence of free radical initiators. Such polymers shall contain... acid in the absence of free radical initiators. Such polymers shall contain not more than 4.5 percent... tube for preheated, oxygen-free nitrogen, and an outlet tube located 1 inch off center. Nitrogen is fed...

21 CFR 177.1520 - Olefin polymers.

Code of Federal Regulations, 2010 CFR

2010-04-01

... by reaction with fumaric acid in the absence of free radical initiators. Such polymers shall contain... acid in the absence of free radical initiators. Such polymers shall contain not more than 4.5 percent... tube for preheated, oxygen-free nitrogen, and an outlet tube located 1 inch off center. Nitrogen is fed...

Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition.

PubMed

Sciacovelli, Marco; Gonçalves, Emanuel; Johnson, Timothy Isaac; Zecchini, Vincent Roberto; da Costa, Ana Sofia Henriques; Gaude, Edoardo; Drubbel, Alizee Vercauteren; Theobald, Sebastian Julian; Abbo, Sandra Riekje; Tran, Maxine Gia Binh; Rajeeve, Vinothini; Cardaci, Simone; Foster, Sarah; Yun, Haiyang; Cutillas, Pedro; Warren, Anne; Gnanapragasam, Vincent; Gottlieb, Eyal; Franze, Kristian; Huntly, Brian; Maher, Eamonn Richard; Maxwell, Patrick Henry; Saez-Rodriguez, Julio; Frezza, Christian

2016-08-31

Mutations of the tricarboxylic acid cycle enzyme fumarate hydratase cause hereditary leiomyomatosis and renal cell cancer. Fumarate hydratase-deficient renal cancers are highly aggressive and metastasize even when small, leading to a very poor clinical outcome. Fumarate, a small molecule metabolite that accumulates in fumarate hydratase-deficient cells, plays a key role in cell transformation, making it a bona fide oncometabolite. Fumarate has been shown to inhibit α-ketoglutarate-dependent dioxygenases that are involved in DNA and histone demethylation. However, the link between fumarate accumulation, epigenetic changes, and tumorigenesis is unclear. Here we show that loss of fumarate hydratase and the subsequent accumulation of fumarate in mouse and human cells elicits an epithelial-to-mesenchymal-transition (EMT), a phenotypic switch associated with cancer initiation, invasion, and metastasis. We demonstrate that fumarate inhibits Tet-mediated demethylation of a regulatory region of the antimetastatic miRNA cluster mir-200ba429, leading to the expression of EMT-related transcription factors and enhanced migratory properties. These epigenetic and phenotypic changes are recapitulated by the incubation of fumarate hydratase-proficient cells with cell-permeable fumarate. Loss of fumarate hydratase is associated with suppression of miR-200 and the EMT signature in renal cancer and is associated with poor clinical outcome. These results imply that loss of fumarate hydratase and fumarate accumulation contribute to the aggressive features of fumarate hydratase-deficient tumours.

Metabolic engineering in the biotechnological production of organic acids in the tricarboxylic acid cycle of microorganisms: Advances and prospects.

PubMed

Yin, Xian; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Liu, Long; Chen, Jian

2015-11-01

Organic acids, which are chemically synthesized, are also natural intermediates in the metabolic pathways of microorganisms, among which the tricarboxylic acid (TCA) cycle is the most crucial route existing in almost all living organisms. Organic acids in the TCA cycle include citric acid, α-ketoglutaric acid, succinic acid, fumaric acid, l-malic acid, and oxaloacetate, which are building-block chemicals with wide applications and huge markets. In this review, we summarize the synthesis pathways of these organic acids and review recent advances in metabolic engineering strategies that enhance organic acid production. We also propose further improvements for the production of organic acids with systems and synthetic biology-guided metabolic engineering strategies. Copyright © 2015 Elsevier Inc. All rights reserved.

[Not Available].

PubMed

Burgot, J L

1978-04-01

Maleic, fumaric, tartaric, glutaric and adipic acids are titrated directly with sodium hydroxide by means of an automatic thermometric titrimeter. The titration curves have two break-points, corresponding to the successive neutralization of the two acid groups. Previous standardization permits measurement of the heats of neutralization, from which the enthalpies of dissociation can be deduced. From 0.3 to 1 mmole of acid can be titrated with a relative standard deviation of about 3%.

Cocrystals of the antimalarial drug 11-azaartemisinin with three alkenoic acids of 1:1 or 2:1 stoichiometry.

PubMed

Nisar, Madiha; Wong, Lawrence W Y; Sung, Herman H Y; Haynes, Richard K; Williams, Ian D

2018-06-01

The stoichiometry, X-ray structures and stability of four pharmaceutical cocrystals previously identified from liquid-assisted grinding (LAG) of 11-azaartemisinin (11-Aza; systematic name: 1,5,9-trimethyl-14,15,16-trioxa-11-azatetracyclo[10.3.1.0 4,13 .0 8,13 ]hexadecan-10-one) with trans-cinnamic (Cin), maleic (Mal) and fumaric (Fum) acids are herein reported. trans-Cinnamic acid, a mono acid, forms 1:1 cocrystal 11-Aza:Cin (1, C 15 H 23 NO 4 ·C 9 H 8 O 2 ). Maleic acid forms both 1:1 cocrystal 11-Aza:Mal (2, C 15 H 23 NO 4 ·C 4 H 4 O 4 ), in which one COOH group is involved in self-catenation, and 2:1 cocrystal 11-Aza 2 :Mal (3, 2C 15 H 23 NO 4 ·C 4 H 4 O 4 ). Its isomer, fumaric acid, only affords 2:1 cocrystal 11-Aza 2 :Fum (4). All cocrystal formation appears driven by acid-lactam R 2 2 (8) heterosynthons with short O-H...O=C hydrogen bonds [O...O = 2.56 (2) Å], augmented by weaker C=O...H-N contacts. Despite a better packing efficiency, cocrystal 3 is metastable with respect to 2, probably due to a higher conformational energy for the maleic acid molecule in its structure. In each case, the microcrystalline powders from LAG were useful in providing seeding for the single-crystal growth.

Determination of the structure and catalytic mechanism of sorghum bicolor caffeoyl-CoA O-methyltransferase

USDA-ARS?s Scientific Manuscript database

Although cold acclimation is a key process in plants from temperate climates, the mechanisms sensing low temperature remain obscure. Here, we show that the accumulation of the organic acid fumaric acid, mediated by the cytosolic fumarase FUM2, is essential for cold acclimation of metabolism in the c...

21 CFR 172.822 - Sodium lauryl sulfate.

Code of Federal Regulations, 2012 CFR

2012-04-01

... acid-acidulated dry beverage base whereby the additive does not exceed 25 parts per million of the finished beverage and such beverage base is not for use in a food for which a standard of identity established under section 401 of the Act precludes such use. (ii) Fumaric acid-acidulated fruit juice drinks...

ORGANIC REACTIONS IN THE SOLID STATE AND IN SOLID SOLUTIONS.

DTIC Science & Technology

on the reactions of phthalic acid and acetanilide , various acyl anilides, and ring-substituted acetanilides . Exploratory experiments were also...performed between ring-substituted acetanilides and succinic, glutaric, maleic and fumaric acids. The influence of imidazole as a catalyst of the...transacylation reaction of phthalic anhydride and acetanilide is also reported. (Author)

Fumarate hydratase is a critical metabolic regulator of hematopoietic stem cell functions.

PubMed

Guitart, Amelie V; Panagopoulou, Theano I; Villacreces, Arnaud; Vukovic, Milica; Sepulveda, Catarina; Allen, Lewis; Carter, Roderick N; van de Lagemaat, Louie N; Morgan, Marcos; Giles, Peter; Sas, Zuzanna; Gonzalez, Marta Vila; Lawson, Hannah; Paris, Jasmin; Edwards-Hicks, Joy; Schaak, Katrin; Subramani, Chithra; Gezer, Deniz; Armesilla-Diaz, Alejandro; Wills, Jimi; Easterbrook, Aaron; Coman, David; So, Chi Wai Eric; O'Carroll, Donal; Vernimmen, Douglas; Rodrigues, Neil P; Pollard, Patrick J; Morton, Nicholas M; Finch, Andrew; Kranc, Kamil R

2017-03-06

Strict regulation of stem cell metabolism is essential for tissue functions and tumor suppression. In this study, we investigated the role of fumarate hydratase (Fh1), a key component of the mitochondrial tricarboxylic acid (TCA) cycle and cytosolic fumarate metabolism, in normal and leukemic hematopoiesis. Hematopoiesis-specific Fh1 deletion (resulting in endogenous fumarate accumulation and a genetic TCA cycle block reflected by decreased maximal mitochondrial respiration) caused lethal fetal liver hematopoietic defects and hematopoietic stem cell (HSC) failure. Reexpression of extramitochondrial Fh1 (which normalized fumarate levels but not maximal mitochondrial respiration) rescued these phenotypes, indicating the causal role of cellular fumarate accumulation. However, HSCs lacking mitochondrial Fh1 (which had normal fumarate levels but defective maximal mitochondrial respiration) failed to self-renew and displayed lymphoid differentiation defects. In contrast, leukemia-initiating cells lacking mitochondrial Fh1 efficiently propagated Meis1 / Hoxa9 -driven leukemia. Thus, we identify novel roles for fumarate metabolism in HSC maintenance and hematopoietic differentiation and reveal a differential requirement for mitochondrial Fh1 in normal hematopoiesis and leukemia propagation. © 2017 Guitart et al.

Top Value Added Chemicals from Biomass - Volume I, Results of Screening for Potential Candidates from Sugars and Synthesis Gas

DOE Office of Scientific and Technical Information (OSTI.GOV)

None

2004-08-01

This report identifies twelve building block chemicals that can be produced from sugars via biological or chemical conversions. The twelve building blocks can be subsequently converted to a number of high-value bio-based chemicals or materials. Building block chemicals, as considered for this analysis, are molecules with multiple functional groups that possess the potential to be transformed into new families of useful molecules. The twelve sugar-based building blocks are 1,4-diacids (succinic, fumaric and malic), 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glucaric acid, glutamic acid, itaconic acid, levulinic acid, 3-hydroxybutyrolactone, glycerol, sorbitol, and xylitol/arabinitol.

Top Value Added Chemicals from Biomass: Volume I -- Results of Screening for Potential Candidates from Sugars and Synthesis Gas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Werpy, T.; Petersen, G.

2004-08-01

This report identifies twelve building block chemicals that can be produced from sugars via biological or chemical conversions. The twelve building blocks can be subsequently converted to a number of high-value bio-based chemicals or materials. Building block chemicals, as considered for this analysis, are molecules with multiple functional groups that possess the potential to be transformed into new families of useful molecules. The twelve sugar-based building blocks are 1,4-diacids (succinic, fumaric and malic), 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glucaric acid, glutamic acid, itaconic acid, levulinic acid, 3-hydroxybutyrolactone, glycerol, sorbitol, and xylitol/arabinitol.

Enhanced rhizosphere colonization of beneficial Bacillus amyloliquefaciens SQR9 by pathogen infection.

PubMed

Liu, Yunpeng; Zhang, Nan; Qiu, Meihua; Feng, Haichao; Vivanco, Jorge M; Shen, Qirong; Zhang, Ruifu

2014-04-01

Root exudates play important roles in root-soil microorganism interactions and can mediate tripartite interactions of beneficial microorganisms-plant-pathogen in the rhizosphere. However, the roles of organic acid components in this process have not been well studied. In this study the colonization of a plant growth-promoting rhizobacterium, Bacillus amyloliquefaciens SQR9, on cucumber root infected by Fusarium oxysporum f. sp. cucumerinum J. H. Owen (FOC) was investigated. Chemotaxis and biofilm formation response of SQR9 to root exudates and their organic acid components were analysed. Infection of FOC on cucumber had a positive effect (3.30-fold increase) on the root colonization of SQR9 compared with controls. Root secretion of citric acid (2.3 ± 0.2 μM) and fumaric acid (5.7 ± 0.5 μM) was enhanced in FOC-infected cucumber plants. Bacillus amyloliquefaciens SQR9 exhibited enhanced chemotaxis to root exudates of FOC-infected cucumber seedlings. Further experiments demonstrated that citric acid acts as a chemoattractant and fumaric acid as a stimulator of biofilm formation in this process. These results suggest that root exudates mediate the interaction of cucumber root and rhizosphere strain B. amyloliquefaciens SQR9 and enhance its root colonization. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Characteristics of organic acids in the fruit of different pumpkin species.

PubMed

Nawirska-Olszańska, Agnieszka; Biesiada, Anita; Sokół-Łętowska, Anna; Kucharska, Alicja Z

2014-04-01

The aim of the research was to determine the composition of organic acids in fruit of different cultivars of three pumpkin species. The amount of acids immediately after fruit harvest and after 3 months of storage was compared. The content of organic acids in the examined pumpkin cultivars was assayed using the method of high performance liquid chromatography (HPLC). Three organic acids (citric acid, malic acid, and fumaric acid) were identified in the cultivars, whose content considerably varied depending on a cultivar. Three-month storage resulted in decreased content of the acids in the case of cultivars belonging to Cucurbita maxima and Cucurbita pepo species, while a slight increase was recorded for Cucurbita moschata species. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Shoe contact dermatitis from dimethyl fumarate: clinical manifestations, patch test results, chemical analysis, and source of exposure.

PubMed

Giménez-Arnau, Ana; Silvestre, Juan Francisco; Mercader, Pedro; De la Cuadra, Jesus; Ballester, Isabel; Gallardo, Fernando; Pujol, Ramón M; Zimerson, Erik; Bruze, Magnus

2009-11-01

The methyl ester form of fumaric acid named dimethyl fumarate (DMF) is an effective mould-growth inhibitor. Its irritating and sensitizing properties were demonstrated in animal models. Recently, DMF has been identified as responsible for furniture contact dermatitis in Europe. To describe the clinical manifestations, patch test results, shoe chemical analysis, and source of exposure to DMF-induced shoe contact dermatitis. Patients with suspected shoe contact dermatitis were studied in compliance with the Declaration of Helsinki. Patch test results obtained with their own shoe and the European baseline series, acrylates and fumaric acid esters (FAE), were recorded according to international guidelines. The content of DMF in shoes was analysed with gas chromatography and mass spectrometry. Acute, immediate irritant contact dermatitis and non-immunological contact urticaria were observed in eight adults and two children, respectively. All the adult patients studied developed a delayed sensitization demonstrated by a positive patch testing to DMF < or = 0.1% in pet. Cross-reactivity with other FAEs and acrylates was observed. At least 12 different shoe brands were investigated. The chemical analysis from the available shoes showed the presence of DMF. DMF in shoes was responsible for severe contact dermatitis. Global preventive measures for avoiding contact with DMF are necessary.

Anaerobic Carbon Metabolism by the Tricarboxylic Acid Cycle 1

PubMed Central

Vanlerberghe, Greg C.; Horsey, Anne K.; Weger, Harold G.; Turpin, David H.

1989-01-01

Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH4+ in the dark under anaerobic conditions. Addition of NH4+ to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO2 efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenolpyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H14CO3− to anaerobic cells assimilating NH4+ results in the incorporation of radiolabel into the α-carboxyl carbon of glutamic acid. Incorporation of radiolabel into glutamic acid is not simply a short-term phenomenon following NH4+ addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply α-ketoglutarate for glutamate production. During dark aerobic NH4+ assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH4+ assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH4+ assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity. PMID:16667215

Metabolically based liver damage pathophysiology in patients with urea cycle disorders - A new hypothesis.

PubMed

Ivanovski, Ivan; Ješić, Miloš; Ivanovski, Ana; Garavelli, Livia; Ivanovski, Petar

2017-11-28

The underlying pathophysiology of liver dysfunction in urea cycle disorders (UCDs) is still largely elusive. There is some evidence that the accumulation of urea cycle (UC) intermediates are toxic for hepatocyte mitochondria. It is possible that liver injury is directly caused by the toxicity of ammonia. The rarity of UCDs, the lack of checking of iron level in these patients, superficial knowledge of UC and an underestimation of the metabolic role of fumaric acid, are the main reasons that are responsible for the incomprehension of the mechanism of liver injury in patients suffering from UCDs. Owing to our routine clinical practice to screen for iron overload in severely ill neonates, with the focus on the newborns suffering from acute liver failure, we report a case of citrullinemia with neonatal liver failure and high blood parameters of iron overload. We hypothesize that the key is in the decreased-deficient fumaric acid production in the course of UC in UCDs that causes several sequentially intertwined metabolic disturbances with final result of liver iron overload. The presented hypothesis could be easily tested by examining the patients suffering from UCDs, for liver iron overload. This could be easily performed in countries with a high population and comprehensive national register for inborn errors of metabolism. Providing the hypothesis is correct, neonatal liver damage in patients having UCD can be prevented by the supplementation of pregnant women with fumaric or succinic acid, prepared in the form of iron supplementation pills. After birth, liver damage in patients having UCDs can be prevented by supplementation of these patients with zinc fumarate or zinc succinylate, as well.

Insights into the glycyl radical enzyme active site of benzylsuccinate synthase: a computational study.

PubMed

Bharadwaj, Vivek S; Dean, Anthony M; Maupin, C Mark

2013-08-21

The fumarate addition reaction, catalyzed by the enzyme benzylsuccinate synthase (BSS), is considered to be one of the most intriguing and energetically challenging reactions in biology. BSS belongs to the glycyl radical enzyme family and catalyzes the fumarate addition reaction, which enables microorganisms to utilize hydrocarbons as an energy source under anaerobic conditions. Unfortunately, the extreme sensitivity of the glycyl radical to oxygen has hampered the structural and kinetic characterization of BSS, thereby limiting our knowledge on this enzyme. To enhance our molecular-level understanding of BSS, a computational approach involving homology modeling, docking studies, and molecular dynamics (MD) simulations has been used to deduce the structure of BSS's catalytic subunit (BSSα) and illuminate the molecular basis for the fumarate addition reaction. We have identified two conserved and distinct binding pockets at the BSSα active site: a hydrophobic pocket for toluene binding and a polar pocket for fumaric acid binding. Subsequent dynamical and energetic evaluations have identified Glu509, Ser827, Leu390, and Phe384 as active site residues critical for substrate binding. The orientation of substrates at the active site observed in MD simulations is consistent with experimental observations of the syn addition of toluene to fumaric acid. It is also found that substrate binding tightens the active site and restricts the conformational flexibility of the thiyl radical, leading to hydrogen transfer distances conducive to the proposed reaction mechanism. The stability of substrates at the active site and the occurrence of feasible radical transfer distances between the thiyl radical, substrates, and the active site glycine indicate a substrate-assisted radical transfer pathway governing fumarate addition.

A Soluble NADH-Dependent Fumarate Reductase in the Reductive Tricarboxylic Acid Cycle of Hydrogenobacter thermophilus TK-6▿

PubMed Central

Miura, Akane; Kameya, Masafumi; Arai, Hiroyuki; Ishii, Masaharu; Igarashi, Yasuo

2008-01-01

Fumarate reductase (FRD) is an enzyme that reduces fumarate to succinate. In many organisms, it is bound to the membrane and uses electron donors such as quinol. In this study, an FRD from a thermophilic chemolithoautotrophic bacterium, Hydrogenobacter thermophilus TK-6, was purified and characterized. FRD activity using NADH as an electron donor was not detected in the membrane fraction but was found in the soluble fraction. The purified enzyme was demonstrated to be a novel type of FRD, consisting of five subunits. One subunit showed high sequence identity to the catalytic subunits of known FRDs. Although the genes of typical FRDs are assembled in a cluster, the five genes encoding the H. thermophilus FRD were distant from each other in the genome. Furthermore, phylogenetic analysis showed that the H. thermophilus FRD was located in a distinct position from those of known soluble FRDs. This is the first report of a soluble NADH-dependent FRD in Bacteria and of the purification of a FRD that operates in the reductive tricarboxylic acid cycle. PMID:18757546

A soluble NADH-dependent fumarate reductase in the reductive tricarboxylic acid cycle of Hydrogenobacter thermophilus TK-6.

PubMed

Miura, Akane; Kameya, Masafumi; Arai, Hiroyuki; Ishii, Masaharu; Igarashi, Yasuo

2008-11-01

Fumarate reductase (FRD) is an enzyme that reduces fumarate to succinate. In many organisms, it is bound to the membrane and uses electron donors such as quinol. In this study, an FRD from a thermophilic chemolithoautotrophic bacterium, Hydrogenobacter thermophilus TK-6, was purified and characterized. FRD activity using NADH as an electron donor was not detected in the membrane fraction but was found in the soluble fraction. The purified enzyme was demonstrated to be a novel type of FRD, consisting of five subunits. One subunit showed high sequence identity to the catalytic subunits of known FRDs. Although the genes of typical FRDs are assembled in a cluster, the five genes encoding the H. thermophilus FRD were distant from each other in the genome. Furthermore, phylogenetic analysis showed that the H. thermophilus FRD was located in a distinct position from those of known soluble FRDs. This is the first report of a soluble NADH-dependent FRD in Bacteria and of the purification of a FRD that operates in the reductive tricarboxylic acid cycle.

Anaerobic carbon metabolism by the tricarboxylic acid cycle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vanlerberghe, G.C.; Horsey, A.K.; Weger, H.G.

Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH{sub 4}{sup +} in the dark under anaerobic conditions. Addition of NH{sub 4}{sup +} to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO{sub 2} efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenspyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H{sup 14}CO{sub 3}{sup {minus}} to anaerobic cells assimilating NH{sub 4}{sup +} results in the incorporation of radiolabel into the {alpha}-carboxyl carbon of glutamic acid. Incorporationmore » of radiolabel into glutamic acid is not simply a short-term phenomenon following NH{sub 4}{sup +} addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply {alpha}ketoglutarate for glutamate production. During dark aerobic NH{sub 4}{sup +} assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH{sub 4}{sup +} assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH{sub 4}{sup +} assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity.« less

Anaerobic Carbon Metabolism by the Tricarboxylic Acid Cycle : Evidence for Partial Oxidative and Reductive Pathways during Dark Ammonium Assimilation.

PubMed

Vanlerberghe, G C; Horsey, A K; Weger, H G; Turpin, D H

1989-12-01

Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH(4) (+) in the dark under anaerobic conditions. Addition of NH(4) (+) to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO(2) efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenolpyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H(14)CO(3) (-) to anaerobic cells assimilating NH(4) (+) results in the incorporation of radiolabel into the alpha-carboxyl carbon of glutamic acid. Incorporation of radiolabel into glutamic acid is not simply a short-term phenomenon following NH(4) (+) addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply alpha-ketoglutarate for glutamate production. During dark aerobic NH(4) (+) assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH(4) (+) assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH(4) (+) assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity.

Organic acids from root exudates of banana help root colonization of PGPR strain Bacillus amyloliquefaciens NJN-6

PubMed Central

Yuan, Jun; Zhang, Nan; Huang, Qiwei; Raza, Waseem; Li, Rong; Vivanco, Jorge M.; Shen, Qirong

2015-01-01

The successful colonization of plant growth promoting rhizobacteria (PGPR) in the rhizosphere is an initial and compulsory step in the protection of plants from soil-borne pathogens. Therefore, it is necessary to evaluate the role of root exudates in the colonization of PGPR. Banana root exudates were analyzed by high pressure liquid chromatography (HPLC) which revealed exudates contained several organic acids (OAs) including oxalic, malic and fumaric acid. The chemotactic response and biofilm formation of Bacillus amyloliquefaciens NJN-6 were investigated in response to OA’s found in banana root exudates. Furthermore, the transcriptional levels of genes involved in biofilm formation, yqxM and epsD, were evaluated in response to OAs via quantitative reverse transcriptase polymerase chain reaction (qRT-PCR). Results suggested that root exudates containing the OAs both induced the chemotaxis and biofilm formation in NJN-6. In fact, the strongest chemotactic and biofilm response was found when 50 μM of OAs were applied. More specifically, malic acid showed the greatest chemotactic response whereas fumaric acid significantly induced biofilm formation by a 20.7–27.3% increase and therefore biofilm formation genes expression. The results showed banana root exudates, in particular the OAs released, play a crucial role in attracting and initiating PGPR colonization on the host roots. PMID:26299781

Fumarate is an epigenetic modifier that elicits epithelial-to-mesenchymal transition

PubMed Central

Sciacovelli, Marco; Gonçalves, Emanuel; Isaac Johnson, Timothy; Roberto Zecchini, Vincent; da Costa, Ana Sofia Henriques; Gaude, Edoardo; Vercauteren Drubbel, Alizee; Julian Theobald, Sebastian; Abbo, Sandra; Tran, Maxine; Rajeeve, Vinothini; Cardaci, Simone; Foster, Sarah; Yun, Haiyang; Cutillas, Pedro; Warren, Anne; Gnanapragasam, Vincent; Gottlieb, Eyal; Franze, Kristian; Huntly, Brian; Richard Maher, Eamonn; Henry Maxwell, Patrick; Saez-Rodriguez, Julio; Frezza, Christian

2016-01-01

Mutations of the tricarboxylic acid cycle (TCA cycle) enzyme fumarate hydratase (FH) cause Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC)1. FH-deficient renal cancers are highly aggressive and metastasise even when small, leading to an abysmal clinical outcome2. Fumarate, a small molecule metabolite that accumulates in FH-deficient cells, plays a key role in cell transformation, making it a bona fide oncometabolite3. Fumarate was shown to inhibit α-ketoglutarate (aKG)-dependent dioxygenases involved in DNA and histone demethylation4,5. However, the link between fumarate accumulation, epigenetic changes, and tumorigenesis is unclear. Here we show that loss of FH and the subsequent accumulation of fumarate elicits an epithelial-to-mesenchymal-transition (EMT), a phenotypic switch associated with cancer initiation, invasion, and metastasis6. We demonstrate that fumarate inhibits Tet-mediated demethylation of a regulatory region of the antimetastatic miRNA cluster6 miR-200ba429, leading to the expression of EMT-related transcription factors and enhanced migratory properties. These epigenetic and phenotypic changes are recapitulated by the incubation of FH-proficient cells with cell-permeable fumarate. Loss of FH is associated with suppression of miR-200 and EMT signature in renal cancer patients, and is associated with poor clinical outcome. These results imply that loss of FH and fumarate accumulation contribute to the aggressive features of FH-deficient tumours. PMID:27580029

Top Value Added Chemicals From Biomass: I. Results of Screening for Potential Candidates from Sugars and Synthesis Gas

DOE Office of Scientific and Technical Information (OSTI.GOV)

Werpy, Todd A.; Holladay, John E.; White, James F.

2004-11-01

This report identifies twelve building block chemicals that can be produced from sugars via biological or chemical conversions. The twelve building blocks can be subsequently converted to a number of high-value bio-based chemicals or materials. Building block chemicals, as considered for this analysis, are molecules with multiple functional groups that possess the potential to be transformed into new families of useful molecules. The twelve sugar-based building blocks are 1,4-diacids (succinic, fumaric and malic), 2,5-furan dicarboxylic acid, 3-hydroxy propionic acid, aspartic acid, glucaric acid, glutamic acid, itaconic acid, levulinic acid, 3-hydroxybutyrolactone, glycerol, sorbitol, and xylitol/arabinitol. In addition to building blocks, themore » report outlines the central technical barriers that are preventing the widespread use of biomass for products and chemicals.« less

A study of the properties of compacts from silicified microcrystalline celluloses.

PubMed

Muzíková, Jitka; Nováková, Petra

2007-07-01

The paper deals with a study of tensile strength and disintegration time of compacts made from silicified microcrystalline celluloses, Prosolv SMCC 90, and Prosolv HD 90, in dependence on compression force, addition of two types of lubricants, and two active ingredients. The lubricants were magnesium stearate and sodium stearyl fumarate in a concentration of 0.5%, the active ingredients being ascorbic acid and acetylsalicylic acid in a concentration of 50%. Prosolv SMCC 90 proved to be better compatible than Prosolv HD 90; the compacts were of higher strength, which was markedly increased with increasing compression force. Prosolv HD 90 was more sensitive to additions of lubricants, and a greater decrease in strength was recorded due to the influence of sodium stearyl fumarate. The effect of lubricants on the strength of compacts in the presence of active ingredients was not identical. The disintegration time of compacts from Prosolv HD 90 without as well as with lubricants was shorter than from Prosolv SMCC 90 and was increasing with increasing compression force. Disintegration time was increased with added lubricants, and it was markedly shortened by addition of active ingredients. Compacts containing ascorbic acid possessed a shorter disintegration time than those containing acetylsalicylic acid, and it was not markedly influenced by the presence of lubricants.

Anaerobic Fermentation for Production of Carboxylic Acids as Bulk Chemicals from Renewable Biomass.

PubMed

Wang, Jufang; Lin, Meng; Xu, Mengmeng; Yang, Shang-Tian

Biomass represents an abundant carbon-neutral renewable resource which can be converted to bulk chemicals to replace petrochemicals. Carboxylic acids have wide applications in the chemical, food, and pharmaceutical industries. This chapter provides an overview of recent advances and challenges in the industrial production of various types of carboxylic acids, including short-chain fatty acids (acetic, propionic, butyric), hydroxy acids (lactic, 3-hydroxypropionic), dicarboxylic acids (succinic, malic, fumaric, itaconic, adipic, muconic, glucaric), and others (acrylic, citric, gluconic, pyruvic) by anaerobic fermentation. For economic production of these carboxylic acids as bulk chemicals, the fermentation process must have a sufficiently high product titer, productivity and yield, and low impurity acid byproducts to compete with their petrochemical counterparts. System metabolic engineering offers the tools needed to develop novel strains that can meet these process requirements for converting biomass feedstock to the desirable product.

FUM2, a Cytosolic Fumarase, Is Essential for Acclimation to Low Temperature in Arabidopsis thaliana1[OPEN

PubMed Central

Dyson, Beth C.; Miller, Matthew A.E.; Feil, Regina; Rattray, Nicholas; Bowsher, Caroline G.

2016-01-01

Although cold acclimation is a key process in plants from temperate climates, the mechanisms sensing low temperature remain obscure. Here, we show that the accumulation of the organic acid fumaric acid, mediated by the cytosolic fumarase FUM2, is essential for cold acclimation of metabolism in the cold-tolerant model species Arabidopsis (Arabidopsis thaliana). A nontargeted metabolomic approach, using gas chromatography-mass spectrometry, identifies fumarate as a key component of the cold response in this species. Plants of T-DNA insertion mutants, lacking FUM2, show marked differences in their response to cold, with contrasting responses both in terms of metabolite concentrations and gene expression. The fum2 plants accumulated higher concentrations of phosphorylated sugar intermediates and of starch and malate. Transcripts for proteins involved in photosynthesis were markedly down-regulated in fum2.2 but not in wild-type Columbia-0. Plants of fum2 show a complete loss of the ability to acclimate photosynthesis to low temperature. We conclude that fumarate accumulation plays an essential role in low temperature sensing in Arabidopsis, either indirectly modulating metabolic or redox signals or possibly being itself directly involved in cold sensing. PMID:27440755

Copper Efflux Is Induced during Anaerobic Amino Acid Limitation in Escherichia coli To Protect Iron-Sulfur Cluster Enzymes and Biogenesis

PubMed Central

Fung, Danny Ka Chun; Lau, Wai Yin; Chan, Wing Tat

2013-01-01

Adaptation to changing environments is essential to bacterial physiology. Here we report a unique role of the copper homeostasis system in adapting Escherichia coli to its host-relevant environment of anaerobiosis coupled with amino acid limitation. We found that expression of the copper/silver efflux pump CusCFBA was significantly upregulated during anaerobic amino acid limitation in E. coli without the supplement of exogenous copper. Inductively coupled plasma mass spectrometry analysis of the total intracellular copper content combined with transcriptional assay of the PcusC-lacZ reporter in the presence of specific Cu(I) chelators indicated that anaerobic amino acid limitation led to the accumulation of free Cu(I) in the periplasmic space of E. coli, resulting in Cu(I) toxicity. Cells lacking cusCFBA and another copper transporter, copA, under this condition displayed growth defects and reduced ATP production during fumarate respiration. Ectopic expression of the Fe-S cluster enzyme fumarate reductase (Frd), or supplementation with amino acids whose biosynthesis involves Fe-S cluster enzymes, rescued the poor growth of ΔcusC cells. Yet, Cu(I) treatment did not impair the Frd activity in vitro. Further studies revealed that the alternative Fe-S cluster biogenesis system Suf was induced during the anaerobic amino acid limitation, and ΔcusC enhanced this upregulation, indicating the impairment of the Fe-S cluster assembly machinery and the increased Fe-S cluster demands under this condition. Taken together, we conclude that the copper efflux system CusCFBA is induced during anaerobic amino acid limitation to protect Fe-S cluster enzymes and biogenesis from the endogenously originated Cu(I) toxicity, thus facilitating the physiological adaptation of E. coli. PMID:23893112

Anaerobic Respiration Using a Complete Oxidative TCA Cycle Drives Multicellular Swarming in Proteus mirabilis

PubMed Central

Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.

2012-01-01

ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869

Unsuspected task for an old team: succinate, fumarate and other Krebs cycle acids in metabolic remodeling.

PubMed

Bénit, Paule; Letouzé, Eric; Rak, Malgorzata; Aubry, Laetitia; Burnichon, Nelly; Favier, Judith; Gimenez-Roqueplo, Anne-Paule; Rustin, Pierre

2014-08-01

Seventy years from the formalization of the Krebs cycle as the central metabolic turntable sustaining the cell respiratory process, key functions of several of its intermediates, especially succinate and fumarate, have been recently uncovered. The presumably immutable organization of the cycle has been challenged by a number of observations, and the variable subcellular location of a number of its constitutive protein components is now well recognized, although yet unexplained. Nonetheless, the most striking observations have been made in the recent period while investigating human diseases, especially a set of specific cancers, revealing the crucial role of Krebs cycle intermediates as factors affecting genes methylation and thus cell remodeling. We review here the recent advances and persisting incognita about the role of Krebs cycle acids in diverse aspects of cellular life and human pathology. Copyright © 2014 Elsevier B.V. All rights reserved.

Liquid Hydrogenation of Maleic Anhydride with Pd/C Catalyst at Low Pressure and Temperature in Batch Reactor.

PubMed

Kim, Ji Sun; Baek, Jae Ho; Ryu, Young Bok; Hong, Seong-Soo; Lee, Man Sig

2015-01-01

Succinic acid (SA) produced from hydrogenation of maleic anhydride (MAN) is used widely in manufacturing of pharmaceuticals, agrochemicals, surfactants and detergent, green solvent and biodegradable plastic. In this study, we performed that liquid hydrogenation of MAN to SA with 5 wt% Pd supported on activated carbon (Pd/C) at low pressure and temperature. The synthesis of SA was performed in aqueous solution while varying temperature, pressure, catalytic amount and agitation speed. We confirmed that the composition of the products consisting of SA, maleic acid (MA), fumaric acid (FA) and malic acid (MLA) depends on the process. The catalytic characteristics were analyzed by TGA, TEM.

Gateways to clinical trials.

PubMed

Tomillero, A; Moral, M A

2009-04-01

(+)-Dapoxetine hydrochloride, [(123)I]-BZA, 9-Aminocamptothecin; Abacavir sulfate/lamivudine, Adalimumab, Adefovir dipivoxil, Alemtuzumab, Alvocidib hydrochloride, Ambrisentan, Amsilarotene, Anacetrapib, Anakinra, Apricitabine, Aripiprazole, Arsenic trioxide, Atazanavir sulfate, Atazanavir/ritonavir, Atrasentan, Azacitidine; Banoxantrone, Bazedoxifene acetate, Bevacizumab, Bexarotene, Biphasic insulin aspart, Bortezomib, Bosentan, Bromfenac; Cachectin, Calcipotriol/betamethasone dipropionate, Canakinumab, Carfilzomib, CAT-354, CCX-282, Certolizumab pegol, Cetuximab, Choline fenofibrate, Clevudine, Clofarabine, CNTO-328, Corifollitropin alfa, Crofelemer; Daptomycin, Darbepoetin alfa, Darunavir, Dasatinib, Decitabine, Deferasirox, Denosumab, Duloxetine hydrochloride, Dutasteride; Emtricitabine, Enfuvirtide, Entecavir, Epoetin zeta, Erlotinib hydrochloride, Escitalopram oxalate, Eslicarbazepine acetate, Eszopiclone, Etravirine, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; Farglitazar, Febuxostat, Fosamprenavir calcium, FX-06; Gabapentin enacarbil, Gefitinib; HIVIS DNA; Imatinib mesylate, INCB- 18424, Indacaterol, Inotuzumab ozogamicin, Insulin detemir; JNJ-26854165; Lacosamide, Landiolol, Laromustine, Lenalidomide, Liposomal doxorubicin, L-NAME, Lopinavir, Lopinavir/ritonavir, Lumiracoxib; Maraviroc, Mepolizumab, Methoxy polyethylene glycol- epoetin-beta, Miglustat, MK-0493, MVA-CMDR, Mycophenolic acid sodium salt; Natalizumab, Nepafenac, Neratinib, Neridronic acid, Nesiritide, Nilotinib hydrochloride monohydrate; Olmesartan medoxomil, Omacetaxine mepesuccinate, Omalizumab; Paclitaxel poliglumex, Palifermin, Patupilone, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Peginterferon alfa-2b/ ribavirin, Pemetrexed disodium, PHA-848125, Pitavastatin calcium, Posaconazole, Povidone-iodine liposome complex, Prasugrel, Pregabalin, Prucalopride; Raltegravir potassium, Retigabine, Revaprazan hydrochloride, rhFSH, Rilpivirine, Rivaroxaban, Romidepsin, Rosuvastatin calcium, RWJ-676070; SAR-109659, Sitagliptin phosphate monohydrate, Sorafenib, Stavudine/Lamivudine/Nevirapine, Sunitinib malate; Tadalafil, Telaprevir, Telbivudine, Tenofovir disoproxil fumarate, Tenofovir disoproxil fumarate/emtricitabine, Tenofovir disoproxil fumarate/emtricitabine/efavirenz, Teriparatide, Tigecycline, Tiotropium bromide, Tipifarnib, Tipranavir, Tocilizumab, Trifluridine/TPI; UP-780; Vandetanib, Vardenafil hydrochloride hydrate, Vatalanib succinate, Vitespen, Vorinostat; Yttrium 90 (90Y) ibritumomab tiuxetan; Zoledronic acid monohydrate. Copyright 2009 Prous Science, S.A.U. or its licensors. All rights reserved.

A comparative pharmacokinetic and tolerability analysis of the novel orotic acid salt form of tenofovir disoproxil and the fumaric acid salt form in healthy subjects

PubMed Central

Kim, Yu Kyong; Choi, Mun Ju; Oh, Tae Young; Yu, Kyung-Sang; Lee, SeungHwan

2017-01-01

A novel orotic acid salt form of tenofovir disoproxil (DA-2802) was developed and is expected to replace the fumaric acid salt form. The pharmacokinetic (PK) characteristics and tolerability profiles of DA-2802 were compared to those of tenofovir disoproxil fumarate (TDF, Viread®) in healthy subjects. A randomized, open-label, single-dose study was conducted in 36 healthy subjects using a two-treatment, two-period, and two-sequence crossover design. Subjects received a single oral dose of 319 mg DA-2802 or 300 mg TDF, during each period, with a 7-day washout. Serial blood samples were collected pre-dosing and up to 72 hours post-dosing in each period, for determination of serum tenofovir concentration, which was measured by ultra-performance liquid chromatography-tandem mass spectrometry. A non-compartmental method was used to obtain PK parameters of tenofovir. For comparison between the two tenofovir disoproxil salts, the 90% confidence intervals (90% CIs) of geometric mean ratios of DA-2802 to TDF for the maximum concentration (Cmax) and the area under the concentration–time curve to the last quantifiable concentration (AUC0–t) were determined. The tolerability profiles of tenofovir were assessed by evaluation of adverse events and vital signs, physical examination, ECG, and clinical laboratory tests. The serum tenofovir concentration–time profiles of DA-2802 or TDF were comparable in 32 subjects who completed the study. In both profiles, a two-compartmental elimination with first-order elimination kinetics in the terminal phase was reported in a few subjects, showing a secondary peak in the initial phase of elimination. The geometric mean ratio (90% CI) of DA-2802 to TDF was 0.898 (0.815–0.990) for Cmax and 0.904 (0.836–0.978) for AUC0–t. There were no clinically significant findings in the tolerability assessments. DA-2802 showed comparable PK characteristics and tolerability profiles to TDF. PMID:29158663

Salt formation improved the properties of a candidate drug during early formulation development.

PubMed

Sigfridsson, Kalle; Ahlqvist, Matti; Lindsjö, Martin; Paulsson, Stefan

2018-07-30

The purpose of this study was to investigate if AZD5329, a dual neurokinin NK1/2 receptor antagonist, is a suitable candidate for further development as an oral immediate release (IR) solid dosage form as a final product. The neutral form of AZD5329 has only been isolated as amorphous material. In order to search for a solid material with improved physical and chemical stability and more suitable solid-state properties, a salt screen was performed. Crystalline material of a maleic acid salt and a fumaric acid salt of AZD5329 were obtained. X-ray powder diffractiometry, thermogravimetric analysis, differential scanning calorimetry and dynamic vapor sorption were used to investigate the physicochemical characteristics of the two salts. The fumarate salt of AZD5329 is anhydrous, the crystallization is reproducible and the hygroscopicity is acceptable. Early polymorphism assessment work using slurry technique did not reveal any better crystal modification or crystallinity for the fumarate salt. For the maleate salt, the form isolated originally was found to be a solvate, but an anhydrous form was found in later experiments; by suspension in water or acetone, by drying of the solvate to 100-120 °C or by subjecting the solvate form to conditions of 40 °C/75%RH for 3 months. The dissolution behavior and the chemical stability (in aqueous solutions, formulations and solid-state) of both salts were also studied and found to be satisfactory. The compound displays sensitivity to low pH, and the salt of the maleic acid, which is the stronger acid, shows more degradation during stability studies, in line with this observation. The presented data indicate that the substance fulfils basic requirements for further development of an IR dosage form, based on the characterization on crystalline salts of AZD5329. Copyright © 2018 Elsevier B.V. All rights reserved.

An NMR-Based Metabolomic Approach to Investigate the Effects of Supplementation with Glutamic Acid in Piglets Challenged with Deoxynivalenol

PubMed Central

Ren, Wenkai; Yin, Jie; Hu, Jiayu; Duan, Jielin; Liu, Gang; Tan, Bie; Xiong, Xia; Oso, Abimbola Oladele; Adeola, Olayiwola; Yao, Kang; Yin, Yulong; Li, Tiejun

2014-01-01

Deoxynivalenol (DON) has various toxicological effects in humans and pigs that result from the ingestion of contaminated cereal products. This study was conducted to investigate the protective effects of dietary supplementation with glutamic acid on piglets challenged with DON. A total of 20 piglets weaned at 28 d of age were randomly assigned to receive 1 of 4 treatments (5 piglets/treatment): 1) basal diet, negative control (NC); 2) basal diet +4 mg/kg DON (DON); 3) basal diet +2% (g/g) glutamic acid (GLU); 4) basal diet +4 mg/kg DON +2% glutamic acid (DG). A 7-d adaptation period was followed by 30 days of treatment. A metabolite analysis using nuclear magnetic resonance spectroscopy (1H-NMR)-based metabolomic technology and the determination of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities for plasma, as well as the activity of Caspase-3 and the proliferation of epithelial cells were conducted. The results showed that contents of low-density lipoprotein, alanine, arginine, acetate, glycoprotein, trimethylamine-N-oxide (TMAO), glycine, lactate, and urea, as well as the glutamate/creatinine ratio were higher but high-density lipoprotein, proline, citrate, choline, unsaturated lipids and fumarate were lower in piglets of DON treatment than that of NC treatment (P<0.05). Compared with DON treatment, dietary supplementation with glutamic acid increased the plasma concentrations of proline, citrate, creatinine, unsaturated lipids, and fumarate, and decreased the concentrations of alanine, glycoprotein, TMAO, glycine, and lactate, as well as the glutamate/creatinine ratio (P<0.05). Addition glutamic acid to DON treatment increased the plasma activities of SOD and GSH-Px and the proliferating cell nuclear antigen (PCNA) labeling indexes for the jejunum and ileum (P<0.05). These novel findings indicate that glutamic acid has the potential to repair the injuries associated with oxidative stress as well as the disturbances of energy and amino acid metabolism induced by DON. PMID:25502722

An NMR-based metabolomic approach to investigate the effects of supplementation with glutamic acid in piglets challenged with deoxynivalenol.

PubMed

Wu, Miaomiao; Xiao, Hao; Ren, Wenkai; Yin, Jie; Hu, Jiayu; Duan, Jielin; Liu, Gang; Tan, Bie; Xiong, Xia; Oso, Abimbola Oladele; Adeola, Olayiwola; Yao, Kang; Yin, Yulong; Li, Tiejun

2014-01-01

Deoxynivalenol (DON) has various toxicological effects in humans and pigs that result from the ingestion of contaminated cereal products. This study was conducted to investigate the protective effects of dietary supplementation with glutamic acid on piglets challenged with DON. A total of 20 piglets weaned at 28 d of age were randomly assigned to receive 1 of 4 treatments (5 piglets/treatment): 1) basal diet, negative control (NC); 2) basal diet +4 mg/kg DON (DON); 3) basal diet +2% (g/g) glutamic acid (GLU); 4) basal diet +4 mg/kg DON +2% glutamic acid (DG). A 7-d adaptation period was followed by 30 days of treatment. A metabolite analysis using nuclear magnetic resonance spectroscopy (1H-NMR)-based metabolomic technology and the determination of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities for plasma, as well as the activity of Caspase-3 and the proliferation of epithelial cells were conducted. The results showed that contents of low-density lipoprotein, alanine, arginine, acetate, glycoprotein, trimethylamine-N-oxide (TMAO), glycine, lactate, and urea, as well as the glutamate/creatinine ratio were higher but high-density lipoprotein, proline, citrate, choline, unsaturated lipids and fumarate were lower in piglets of DON treatment than that of NC treatment (P<0.05). Compared with DON treatment, dietary supplementation with glutamic acid increased the plasma concentrations of proline, citrate, creatinine, unsaturated lipids, and fumarate, and decreased the concentrations of alanine, glycoprotein, TMAO, glycine, and lactate, as well as the glutamate/creatinine ratio (P<0.05). Addition glutamic acid to DON treatment increased the plasma activities of SOD and GSH-Px and the proliferating cell nuclear antigen (PCNA) labeling indexes for the jejunum and ileum (P<0.05). These novel findings indicate that glutamic acid has the potential to repair the injuries associated with oxidative stress as well as the disturbances of energy and amino acid metabolism induced by DON.

Gateways to clinical trials.

PubMed

Tomillero, A; Moral, M A

2010-05-01

O(6)-Benzylguanine; (-)-Gossypol; Abatacept, AC-2592, Adalimumab, AIDSVAX gp120 B/E, Alemtuzumab, Aliskiren fumarate, ALVAC E120TMG, Ambrisentan, Amlodipine, Anakinra, Aripiprazole, Armodafinil, Atomoxetine hydrochloride, Avotermin; Bevacizumab, BIBW-2992, Bortezomib, Bosentan, Botulinum toxin type B; Canakinumab, CAT-354, Ciclesonide, CMV gB vaccine, Corifollitropin alfa, Daptomycin, Darbepoetin alfa, Dasatinib, Denosumab; EndoTAG-1, Eplerenone, Esomeprazole sodium, Eszopiclone, Etoricoxib, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; F-50040, Fesoterodine fumavate, Fondaparinux sodium, Fulvestrant; Gabapentin enacarbil, Golimumab; Imatinib mesylate, Inhalable human insulin, Insulin glargine, Ivabradine hydrochloride; Lercanidipine hydrochloride/enalapril maleate, Levosimendan, Liposomal vincristine sulfate, Liraglutide; MDV-3100, Mometasone furoate/formoterol fumavate, Multiepitope CTL peptide vaccine, Mycophenolic acid sodium salt, Nabiximols, Natalizumab, Nesiritide; Obeticholic acid, Olmesartan medoxomil, Omalizumab, Omecamtiv mecarbil; Paclitaxel-eluting stent, Paliperidone, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Peginterferon alfa-2b/ ribavirin, Pemetrexed disodium, Polymyxin B nonapeptide, PORxin-302, Prasugrel, Pregabalin, Pridopidine; Ranelic acid distrontium salt, Rasagiline mesilate, rDEN4delta30-4995, Recombinant human relaxin H2, rhFSH, Rilonacept, Rolofylline, Rosiglitazone maleate/metformin hydrochloride, Rosuvastatin calcium, Rotigotine; Salcaprozic acid sodium salt, Sirolimus-eluting stent, Sitagliptin phosphate monohydrate, Sitaxentan sodium, Sorafenib, Sunitinib malate; Tadalafil, Tapentadol hydrochloride, Temsirolimus, Tenofovir, Tenofovir disoproxil fumarate, Teriparatide, Tiotropium bromide, Tocilizumab, Tolvaptan, Tozasertib, Treprostinil sodium; Ustekinumab; Vardenafil hydrochloride hydrate, Varenicline tartrate, Vatalanib succinate, Voriconazole, Vorinostat; Zotarolimus-eluting stent. Copyright 2010 Prous Science, S.A.U. or its licensors. All rights reserved.

Microbial biosynthesis and secretion of l-malic acid and its applications.

PubMed

Chi, Zhe; Wang, Zhi-Peng; Wang, Guang-Yuan; Khan, Ibrar; Chi, Zhen-Ming

2016-01-01

l-Malic acid has many uses in food, beverage, pharmaceutical, chemical and medical industries. It can be produced by one-step fermentation, enzymatic transformation of fumaric acid to l-malate and acid hydrolysis of polymalic acid. However, the process for one-step fermentation is preferred as it has many advantages over any other process. The pathways of l-malic acid biosynthesis in microorganisms are partially clear and three metabolic pathways including non-oxidative pathway, oxidative pathway and glyoxylate cycle for the production of l-malic acid from glucose have been identified. Usually, high levels of l-malate are produced under the nitrogen starvation conditions, l-malate, as a calcium salt, is secreted from microbial cells and CaCO3 can play an important role in calcium malate biosynthesis and regulation. However, it is still unclear how it is secreted into the medium. To enhance l-malate biosynthesis and secretion by microbial cells, it is very important to study the mechanisms of l-malic acid biosynthesis and secretion at enzymatic and molecular levels.

[Faba bean fusarium wilt (Fusarium oxysporum )control and its mechanism in different wheat varieties and faba bean intercropping system].

PubMed

Dong, Yan; Dong, Kun; Zheng, Yi; Tang, Li; Yang, Zhi-Xian

2014-07-01

Field experiment and hydroponic culture were conducted to investigate effects of three wheat varieties (Yunmai 42, Yunmai 47 and Mianyang 29) and faba bean intercropping on the shoot biomass, disease index of fusarium wilt, functional diversity of microbial community and the amount of Fusarium oxysporum in rhizosphere of faba bean. Contents and components of the soluble sugars, free amino acids and organic acids in the root exudates were also examined. Results showed that, compared with monocropped faba bean, shoot biomass of faba bean significantly increased by 16.6% and 13.4%, disease index of faba bean fusarium wilt significantly decreased by 47.6% and 23.3% as intercropped with Yunmai 42 and Yunmai 47, but no significant differences of both shoot biomass and disease index were found as intercropped with Mianyang 29. Compared with monocropped faba bean, the average well color development (AWCD value) and total utilization ability of carbon sources of faba bean significantly increased, the amount of Fusarium oxysporum of faba bean rhizosphere significantly decreased, and the microbial community structures of faba bean rhizosphere changed as intercropped with YM42 and YM47, while no significant effects as intercropped with MY29. Total contents of soluble sugar, free amino acids and organic acids in root exudates were in the trend of MY29>YM47>YM42. Contents of serine, glutamic, glycine, valine, methionine, phenylalanine, lysine in root exudates of MY29 were significantly higher than that in YM42 and YM47. The arginine was detected only in the root exudates of YM42 and YM47, and leucine was detected only in the root exudates of MY29. Six organic acids of tartaric acid, malic acid, citric acid, succinic acid, fumaric acid, t-aconitic acid were detected in root exudates of MY29 and YM47, and four organic acids of tartaric acid, malic acid, citric acid, fumaric acid were detected in root exudates of YM42. Malic acid content in root exudates of YM47 and MY29 was significantly higher than that of YM42. In conclusion, intercropping influenced the microbial activity and substrate utilization of soil microorganisms, altered the microbial community diversity in rhizosphere of faba bean, reduced the amount of F. oxysporum and disease index of faba bean fusarium wilt, and promoted faba bean growth. Effects of intercropping on disease control were influenced by the intercropped wheat variety, suggesting that the differences of root exudates of wheat were important factors that affected soil-borne diseases control in intercropping.

Apple juice composition: sugar, nonvolatile acid, and phenolic profiles.

PubMed

Lee, H S; Wrolstad, R E

1988-01-01

Apples from Michigan, Washington, Argentina, Mexico, and New Zealand were processed into juice; the 8 samples included Golden Delicious, Jonathan, Granny Smith, and McIntosh varieties. Liquid chromatography was used for quantitation of sugars (glucose, fructose, sucrose, and sorbitol), nonvolatile acids (malic, quinic, citric, shikimic, and fumaric), and phenolics (chlorogenic acid and hydroxymethylfurfural [HMF]). Other determinations included pH, 0Brix, and L-malic acid. A number of compositional indices for these authentic juices, e.g., chlorogenic acid content, total malic - L-malic difference, and the HMF:chlorogenic ratio, were at variance with recommended standards. The phenolic profile was shown to be particularly influenced by gelatin fining, with peak areas decreasing by as much as 50%. The L-malic:total malic ratio serves as a better index for presence of synthetic malic acid than does the difference between the 2 determinations. No apparent differences in chemical composition could be attributed to geographic origin.

Organic acids influence iron uptake in the human epithelial cell line Caco-2.

PubMed

Salovaara, Susan; Sandberg, Ann-Sofie; Andlid, Thomas

2002-10-09

It has previously been suggested that organic acids enhance iron absorption. We have studied the effect of nine organic acids on the absorption of Fe(II) and Fe(III) in the human epithelial cell line Caco-2. The effect obtained was dose-dependent, and the greatest increase (43-fold) was observed for tartaric acid (4 mmol/L) on Fe(III) (10 micromol/L). Tartaric, malic, succinic, and fumaric acids enhanced Fe(II) and Fe(III) uptake. Citric and oxalic acid, on the other hand, inhibited Fe(II) uptake but enhanced Fe(III) uptake. Propionic and acetic acid increased the Fe(II) uptake, but had no effect on Fe(III) uptake. Our results show a correlation between absorption pattern and chemical structure; e.g. hydroxyl groups, in addition to carboxyls, were connected with a positive influence. The results may be important for elucidating factors affecting iron bioavailability in the small intestine and for the development of foods with improved iron bioavailability.

Microbiologically Influenced Corrosion: an Update

DTIC Science & Technology

2014-01-01

with simulated YM waters stressed the importance of nitrate in groundwater as an inhibitor for localised corrosion.63 Little59 reviewed the data and...8 In the absence of sulphate, many SRB ferment organic acids and alcohols. Some SRB can reduce nitrate, sulphite, thiosul- phate or fumarate, in

Identification and characterization of a novel fumarase gene by metagenome expression cloning from marine microorganisms

PubMed Central

2010-01-01

Background Fumarase catalyzes the reversible hydration of fumarate to L-malate and is a key enzyme in the tricarboxylic acid (TCA) cycle and in amino acid metabolism. Fumarase is also used for the industrial production of L-malate from the substrate fumarate. Thermostable and high-activity fumarases from organisms that inhabit extreme environments may have great potential in industry, biotechnology, and basic research. The marine environment is highly complex and considered one of the main reservoirs of microbial diversity on the planet. However, most of the microorganisms are inaccessible in nature and are not easily cultivated in the laboratory. Metagenomic approaches provide a powerful tool to isolate and identify enzymes with novel biocatalytic activities for various biotechnological applications. Results A plasmid metagenomic library was constructed from uncultivated marine microorganisms within marine water samples. Through sequence-based screening of the DNA library, a gene encoding a novel fumarase (named FumF) was isolated. Amino acid sequence analysis revealed that the FumF protein shared the greatest homology with Class II fumarate hydratases from Bacteroides sp. 2_1_33B and Parabacteroides distasonis ATCC 8503 (26% identical and 43% similar). The putative fumarase gene was subcloned into pETBlue-2 vector and expressed in E. coli BL21(DE3)pLysS. The recombinant protein was purified to homogeneity. Functional characterization by high performance liquid chromatography confirmed that the recombinant FumF protein catalyzed the hydration of fumarate to form L-malate. The maximum activity for FumF protein occurred at pH 8.5 and 55°C in 5 mM Mg2+. The enzyme showed higher affinity and catalytic efficiency under optimal reaction conditions: Km= 0.48 mM, Vmax = 827 μM/min/mg, and kcat/Km = 1900 mM/s. Conclusions We isolated a novel fumarase gene, fumF, from a sequence-based screen of a plasmid metagenomic library from uncultivated marine microorganisms. The properties of FumF protein may be ideal for the industrial production of L-malate under higher temperature conditions. The identification of FumF underscores the potential of marine metagenome screening for novel biomolecules. PMID:21092234

Age-Related Alterations in the Metabolic Profile in the Hippocampus of the Senescence-Accelerated Mouse Prone 8: A Spontaneous Alzheimer's Disease Mouse Model

PubMed Central

Wang, Hualong; Lian, Kaoqi; Han, Bing; Wang, Yanyong; Kuo, Sheng-Han; Geng, Yuan; Qiang, Jing; Sun, Meiyu; Wang, Mingwei

2015-01-01

Alzheimer's disease (AD), the most common age-dependent neurodegenerative disorder, produces a progressive decline in cognitive function. The metabolic mechanism of AD has emerged in recent years. In this study, we used multivariate analyses of gas chromatography-mass spectrometry measurements to determine that learning and retention-related metabolic profiles are altered during aging in the hippocampus of the senescence-accelerated mouse prone 8 (SAMP8). Alterations in 17 metabolites were detected in mature and aged mice compared to young mice (13 decreased and 4 increased metabolites), including metabolites related to dysfunctional lipid metabolism (significantly increased cholesterol, oleic acid, and phosphoglyceride levels), decreased amino acid (alanine, serine, glycine, aspartic acid, glutamate, and gamma-aminobutyric acid), and energy-related metabolite levels (malic acid, butanedioic acid, fumaric acid, and citric acid), and other altered metabolites (increased N-acetyl-aspartic acid and decreased pyroglutamic acid, urea, and lactic acid) in the hippocampus. All of these alterations indicated that the metabolic mechanisms of age-related cognitive impairment in SAMP8 mice were related to multiple pathways and networks. Lipid metabolism, especially cholesterol metabolism, appears to play a distinct role in the hippocampus in AD. PMID:24284365

Identification and characterization of five new classes of chlorogenic acids in burdock (Arctium lappa L.) roots by liquid chromatography/tandem mass spectrometry.

PubMed

Jaiswal, Rakesh; Kuhnert, Nikolai

2011-01-01

Burdock (Arcticum lappa L.) roots are used in folk medicine and also as a vegetable in Asian countries especially Japan, Korea, and Thailand. We have used LC-MS(n) (n = 2-4) to detect and characterize in burdock roots 15 quantitatively minor fumaric, succinic, and malic acid-containing chlorogenic acids, 11 of them not previously reported in nature. These comprise 3-succinoyl-4,5-dicaffeoyl or 1-succinoyl-3,4-dicaffeoylquinic acid, 1,5-dicaffeoyl-3-succinoylquinic acid, 1,5-dicaffeoyl-4-succinoylquinic acid, and 3,4-dicaffeoyl-5-succinoylquinic acid (M(r) 616); 1,3-dicaffeoyl-5-fumaroylquinic acid and 1,5-dicaffeoyl-4-fumaroylquinic acid (M(r) 614); 1,5-dicaffeoyl-3-maloylquinic acid, 1,4-dicaffeoyl-3-maloylquinic acid, and 1,5-dicaffeoyl-4-maloylquinic acid (M(r) 632); 1,3,5-tricaffeoyl-4-succinoylquinic acid (M(r) 778); 1,5-dicaffeoyl-3,4-disuccinoylquinic acid (M(r) 716); 1,5-dicaffeoyl-3-fumaroyl-4-succinoylquinic acid and 1-fumaroyl-3,5-dicaffeoyl-4-succinoylquinic acid (M(r) 714); dicaffeoyl-dimaloylquinic acid (M(r) 748); and 1,5-dicaffeoyl-3-succinoyl-4-dimaloylquinic acid (M(r) 732). All the structures have been assigned on the basis of LC-MS(n) patterns of fragmentation, relative hydrophobicity, and analogy of fragmentation patterns if compared to caffeoylquinic acids.

Evaluation of three pumpkin species: correlation with physicochemical, antioxidant properties and classification using SPME-GC-MS and E-nose methods.

PubMed

Zhou, Chun-Li; Mi, Li; Hu, Xue-Yan; Zhu, Bi-Hua

2017-09-01

To ascertain the most discriminant variables for three pumpkin species principal component analysis (PCA) was performed. Twenty-four parameters (pH, conductivity, sucrose, glucose, total soluble solids, L* , a* , b* , individual weight, edible rate, firmness, citric acid, fumaric acid, l-ascorbic acid, malic acid, PPO activity, POD activity, total flavonoids, vitamin E, total phenolics, DPPH, FRAP, β-carotene, and aroma) were considered. The studied pumpkin species were Cucurbita maxima , Cucurbita moschata , and Cucurbita pepo . Three pumpkin species were classified by PCA based on aroma, physicochemical and antioxidant properties because the sum of PC1 and PC2 were both greater than 85% (85.06 and 93.64% respectively). Results were validated by the PCA and showed that PPO activity, total flavonoid, sucrose, glucose, TSS, a* , pH, malic acid, vitamin E, DPPH, FRAP and β-carotene, and aroma are highly useful parameters to classify pumpkin species.

Nutritional and Biochemical Profiling of Leucopaxillus candidus (Bres.) Singer Wild Mushroom.

PubMed

Vieira, Vanessa; Barros, Lillian; Martins, Anabela; Ferreira, Isabel C F R

2016-01-15

The wild mushroom Leucopaxillus candidus (Bres.) Singer was studied for the first time to obtain information about its chemical composition, nutritional value and bioactivity. Free sugars, fatty acids, tocopherols, organic and phenolic acids were analysed by chromatographic techniques coupled to different detectors. L. candidus methanolic extract was tested regarding antioxidant potential (reducing power, radical scavenging activity and lipid peroxidation inhibition). L. candidus was shown to be an interesting species in terms of nutritional value, with high content in proteins and carbohydrates, but low fat levels, with the prevalence of polyunsaturated fatty acids. Mannitol was the most abundant free sugar and β-tocopherol was the main tocopherol isoform. Other compounds detected were oxalic and fumaric acids, p-hydroxybenzoic and cinnamic acids. The methanolic extract revealed antioxidant activity and did not show hepatoxicity in porcine liver primary cells. The present study provides new information about L. candidus.

Metabolomic profiling in inner ear fluid by gas chromatography/mass spectrometry in guinea pig cochlea.

PubMed

Fujita, Takeshi; Yamashita, Daisuke; Irino, Yasuhiro; Kitamoto, Junko; Fukuda, Yuriko; Inokuchi, Go; Hasegawa, Shingo; Otsuki, Naoki; Yoshida, Masaru; Nibu, Ken-ichi

2015-10-08

The composition and homeostasis of inner ear fluids are important in hearing function. The purpose of this study was to perform metabolomic analysis of the inner ear fluid in guinea pig cochlea, which has not been previously reported in literature, using gas chromatography/mass spectrometry (GC/MS). Seventy-seven kinds of metabolites were detected in the inner ear fluid. Six metabolites, ascorbic acid, fructose, galactosamine, inositol, pyruvate+oxaloacetic acid, and meso-erythritol, were significantly more abundant, and nine metabolites, phosphate, valine, glycine, glycerol, ornithine, glucose, citric acid+isocitric acid, mannose, and trans-4-hydroxy-L-proline, were less abundant in the inner ear fluid than in plasma. The levels of ten metabolites, 3-hydroxy-butyrate, glycerol, fumaric acid, galactosamine, pyruvate+oxaloacetic acid, phosphate, meso-erythritol, citric acid+isocitric acid, mannose, and inositol, in the inner ear fluid significantly changed after loud noise exposure. These observations may help to elucidate various clinical conditions of sensorineural hearing loss, including noise-induced hearing loss. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Safety of Systemic Agents for the Treatment of Pediatric Psoriasis.

PubMed

Bronckers, Inge M G J; Seyger, Marieke M B; West, Dennis P; Lara-Corrales, Irene; Tollefson, Megha; Tom, Wynnis L; Hogeling, Marcia; Belazarian, Leah; Zachariae, Claus; Mahé, Emmanuel; Siegfried, Elaine; Philipp, Sandra; Szalai, Zsuzsanna; Vleugels, Ruth Ann; Holland, Kristen; Murphy, Ruth; Baselga, Eulalia; Cordoro, Kelly; Lambert, Jo; Alexopoulos, Alex; Mrowietz, Ulrich; Kievit, Wietske; Paller, Amy S

2017-11-01

Use of systemic therapies for moderate to severe psoriasis in children is increasing, but comparative data on their use and toxicities are limited. To assess patterns of use and relative risks of systemic agents for moderate to severe psoriasis in children. A retrospective review was conducted at 20 centers in North America and Europe, and included all consecutive children with moderate to severe psoriasis who used systemic medications or phototherapy for at least 3 months from December 1, 1990, to September 16, 2014. The minimal core data set included age, sex, severity of psoriasis, systemic interventions, monitoring, adverse events (AEs), and reason for discontinuation. For 390 children (203 girls and 187 boys; mean [SD] age at diagnosis, 8.4 [3.7] years) with psoriasis who used 1 or more systemic medications, the mean interval between diagnosis and starting systemic therapy was 3.0 years. Methotrexate was used by 270 patients (69.2%), biologic agents (primarily etanercept) by 106 (27.2%), acitretin by 57 (14.6%), cyclosporine by 30 (7.7%), fumaric acid esters by 19 (4.9%), and more than 1 medication was used by 73 (18.7%). Of 270 children taking methotrexate, 130 (48.1%) reported 1 or more AEs associated with methotrexate, primarily gastrointestinal (67 [24.8%]). Folic acid 6 days per week (odds ratio, 0.16; 95% CI, 0.06-0.41; P < .001) or 7 days per week (OR, 0.21; 95% CI, 0.08-0.58; P = .003) protected against gastrointestinal AEs more than once-weekly folic acid, regardless of the total weekly dosage. Methotrexate-associated hepatic transaminase elevations were associated with obesity (35 of 270 patients [13.0%]), but a folic acid regimen was not. Injection site reactions occurred in 20 of 106 patients (18.9%) treated with tumor necrosis factor inhibitors, but did not lead to discontinuation of treatment. Having 1 or more AEs related to medication, gastrointestinal AE, laboratory abnormality, or AE leading to discontinuation of the drug was more likely with methotrexate than tumor necrosis factor inhibitors, but having 1 or more infections related to medication (predominantly upper airway) was less likely. Six patients developed a serious treatment-related AE (methotrexate, 3; fumaric acid esters, 2; and adalimumab, 1), but methotrexate and biologic agents were taken for a mean duration that was 2-fold greater than the mean duration for cyclosporine or fumaric acid esters. No patient developed tuberculosis or a malignant neoplasm. Medication-related AEs occur less often with tumor necrosis factor inhibitors than with methotrexate. Folic acid administration 6 or 7 times per week protected more against methotrexate-induced gastrointestinal AEs than did weekly administration. A prospective registry is needed to track the long-term risks of systemic agents for pediatric psoriasis.

Stability of monacolin K and citrinin and biochemical characterization of red-koji vinegar during fermentation.

PubMed

Hsieh, Chia-Wen; Lu, Yi-Ru; Lin, Shu-Mei; Lai, Tzu-Yuan; Chiou, Robin Y-Y

2013-07-31

Red-koji vinegar is a Monascus -involved and acetic acid fermentation-derived traditional product, in which the presence of monacolin K and citrinin has attracted public attention. In this study, red-koji wine was prepared as the substrate and artificially supplemented with monacolin K and citrinin and subjected to vinegar fermentation with Acetobacter starter. After 30 days of fermentation, 43.0 and 98.1% of the initial supplements of monacolin K and citrinin were decreased, respectively. During fermentation, acetic acid contents increased, accompanied by decreases of ethanol and lactic acid contents and pH values. The contents of free amino acids increased while the contents of other organic acids, including fumaric acid, citric acid, succinic acid, and tartaric acid, changed limitedly. Besides, increased levels of total phenolics in accordance with increased antioxidative potency, α,α-diphenyl-β-picrylhydrazyl scavenging, and xanthine oxidase inhibitory (XOI) activities were detected. It is of merit that most citrinin was eliminated and >50% of the monacolin K was retained; contents of free amino acids and total phenolics along with antioxidant and XOI activities of the red-koji vinegar were increased after fermentation.

Capillary electrophoretic study of dibasic acids of different structures: Relation to separation of oxidative intermediates in remediation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Z.; Cocke, D.L.

Dicarboxylic acids are important in environmental chemistry because they are intermediates in oxidative processes involved in natural remediation and waste management processes such as oxidative detoxification and advanced oxidation. Capillary electrophoresis (CE), a promising technique for separating and analyzing these intermediates, has been used to examine a series of dibasic acids of different structures and conformations. This series includes malonic acid, succinic acid, glutaric acid, adipic acid, pimelic acid, maleic acid, fumaric acid, phthalic acid, and trans, trans-muconic acid. The CE parameters as well as structural variations (molecular structure and molecular isomers, buffer composition, pH, applied voltage, injection mode, current,more » temperature, and detection wavelength) that affect the separations and analytical results have been examined in this study. Those factors that affect the separation have been delineated. Among these parameters, the pH has been found to be the most important, which affects the double-layer of the capillary wall, the electro-osmotic flow and analyte mobility. The optimum pH for separating these dibasic acids, as well as the other parameters are discussed in detail and related to the development of methods for analyzing oxidation intermediates in oxidative waste management procedures.« less

The genome sequence of Geobacter metallireducens: features of metabolism, physiology and regulation common and dissimilar to Geobacter sulfurreducens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aklujkar, Muktak; Krushkal, Julia; DiBartolo, Genevieve

Background. The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results. The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recentlymore » in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion. The genomic evidence suggests that metabolism, physiology Background. The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results. The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recently in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion. The genomic evidence suggests that metabolism, physiology and regulation of gene expression in G. metallireducens may be dramatically different from other Geobacteraceae.« less

Enhancing Aerobic Growth of Campylobacter in Media Supplemented with Organic Acids

USDA-ARS?s Scientific Manuscript database

The effect of agar and sodium bicarbonate (NaHCO3) concentration on aerobic growth of Campylobacter in was determined. A fumarate-pyruvate medium was supplemented with 0.0 to 0.2% agar and inoculated with Campylobacter coli, Campylobacter fetus, or Campylobacter jejuni. Portions of the inoculated me...

Two Crystallographic Laboratory and Computational Exercises for Undergraduates.

ERIC Educational Resources Information Center

Lessinger, Leslie

1988-01-01

Describes two introductory exercises designed to teach the fundamental ideas and methods of crystallography, and to convey some important features of inorganic and organic crystal structures to students in an advanced laboratory course. Exercises include "The Crystal Structure of NiO" and "The Crystal Structure of Beta-Fumaric Acid." (CW)

[Preparation and application on compound excipient of sodium stearyl fumarate and plasdone S-630].

PubMed

Jiang, Yan-Rong; Zhang, Zhen-Hai; Jia, Xiao-Bin

2013-01-01

The compound excipient containing sodium stearyl fumarate and plasdone S-630 was prepared by applying spray drying method. The basic physical properties of compound excipient were studied by solubility test, scanning electron microscope, differential scanning calorimeter, X-ray diffraction and Fourier transform infra-red spectroscopy. The effect of compound excipient on moisture absorption and ferulic acid in vitro dissolution of spray drying power of angelica were investigated. The results showed that the chemical constituents of compound excipient did not change before and after spray drying. The water soluble compound excipient can improve significantly moisture absorption and has application prospect.

Poly(fumaric-co-sebacic anhydride). A degradation study as evaluated by FTIR, DSC, GPC and X-ray diffraction.

PubMed

Santos, C A; Freedman, B D; Leach, K J; Press, D L; Scarpulla, M; Mathiowitz, E

1999-06-28

The degradation of three poly(fumaric-co-sebacic anhydride) [P(FA:SA)] copolymers is examined in a composition of microspheres made by the hot melt encapsulation process. The emergence of low molecular weight oligomers occurs during degradation of the copolymer microspheres, as evidenced by a variety of characterization methods. Characterization was conducted to determine the extent of degradation of the polyanhydride microspheres using Fourier-transform infrared spectroscopy (FTIR), gel permeation chromatography (GPC), differential scanning calorimetry (DSC) and X-ray diffraction. It is demonstrated that degradation of P(FA:SA) is greatly accelerated at basic pH, yet there is little difference between degradation in neutral and acidic buffers. A good correlation exists between the results of each characterization method, which allows a better understanding of the degradation process and the resulting formation of low molecular weight oligomers in poly(fumaric-co-sebacic anhydride).

Study on US/O3 mechanism in p-chlorophenol decomposition

PubMed Central

Xu, Xian-wen; Xu, Xin-hua; Shi, Hui-xiang; Wang, Da-hui

2005-01-01

Study on the effects of sonolysis, ozonolysis and US/O3 system on the decomposition of p-chlorophenol in aqueous solutions indicated that in the cases of US/O3 system, individual ozonolysis and sonolysis, the decomposition rate of p-chlorophenol reached 78.78%, 56.20%, 2.79% after a 16-min reaction while its CODcr (chemical oxygen demand) removal rate was 97.02%, 62.17%, 3.67% after a 120-min reaction. The decomposition reaction of p-chlorophenol follows pseudo-first-order kinetics. The enhancement factors of p-chlorophenol and its CODcr under US/O3 system reached 63% and 237% respectively. The main intermediates during the decomposition include catechol, hydroquinone, p-benzoquinone, phenol, fumaric acid, maleic acid, oxalic acid and formic acid. The decomposition mechanism of p-chlorophenol was also discussed. PMID:15909343

Toxicity of Select Organic Acids to the Slightly Thermophilic Acidophile Acidithiobaccillus Caldus

DOE Office of Scientific and Technical Information (OSTI.GOV)

John E Aston; William A Apel; Brady D Lee

2009-02-01

Acidithiobacillus caldus is a thermophilic acidophile found in commercial biomining, acid mine drainage systems, and natural environments. Previous work has characterized A. caldus as a chemolithotrophic autotroph capable of utilizing reduced sulfur compounds under aerobic conditions. Organic acids are especially toxic to chemolithotrophs in low-pH environments, where they diffuse more readily into the cell and deprotonate within the cytoplasm. In the present study, the toxic effects of oxaloacetate, pyruvate, 2-ketoglutarate, acetate, malate, succinate, and fumarate on A. caldus strain BC13 were examined under batch conditions. All tested organic acids exhibited some inhibitory effect. Oxaloacetate was observed to inhibit growth completelymore » at a concentration of 250 µM, whereas other organic acids were completely inhibitory at concentrations of between 1,000 and 5,000 µM. In these experiments, the measured concentrations of organic acids decreased with time, indicating uptake or assimilation by the cells. Phospholipid fatty acid analyses indicated an effect of organic acids on the cellular envelope. Notable differences included an increase in cyclic fatty acids in the presence of organic acids, indicating possible instability of the cellular envelope. This was supported by field emission scanning-electron micrographs showing blebbing and sluffing in cells grown in the presence of organic acids.« less

Non-Targeted Metabolomics Analysis of Golden Retriever Muscular Dystrophy-Affected Muscles Reveals Alterations in Arginine and Proline Metabolism, and Elevations in Glutamic and Oleic Acid In Vivo.

PubMed

Abdullah, Muhammad; Kornegay, Joe N; Honcoop, Aubree; Parry, Traci L; Balog-Alvarez, Cynthia J; O'Neal, Sara K; Bain, James R; Muehlbauer, Michael J; Newgard, Christopher B; Patterson, Cam; Willis, Monte S

2017-07-29

Like Duchenne muscular dystrophy (DMD), the Golden Retriever Muscular Dystrophy (GRMD) dog model of DMD is characterized by muscle necrosis, progressive paralysis, and pseudohypertrophy in specific skeletal muscles. This severe GRMD phenotype includes moderate atrophy of the biceps femoris (BF) as compared to unaffected normal dogs, while the long digital extensor (LDE), which functions to flex the tibiotarsal joint and serves as a digital extensor, undergoes the most pronounced atrophy. A recent microarray analysis of GRMD identified alterations in genes associated with lipid metabolism and energy production. We, therefore, undertook a non-targeted metabolomics analysis of the milder/earlier stage disease GRMD BF muscle versus the more severe/chronic LDE using GC-MS to identify underlying metabolic defects specific for affected GRMD skeletal muscle. Untargeted metabolomics analysis of moderately-affected GRMD muscle (BF) identified eight significantly altered metabolites, including significantly decreased stearamide (0.23-fold of controls, p = 2.89 × 10 -3 ), carnosine (0.40-fold of controls, p = 1.88 × 10 -2 ), fumaric acid (0.40-fold of controls, p = 7.40 × 10 -4 ), lactamide (0.33-fold of controls, p = 4.84 × 10 -2 ), myoinositol-2-phosphate (0.45-fold of controls, p = 3.66 × 10 -2 ), and significantly increased oleic acid (1.77-fold of controls, p = 9.27 × 10 -2 ), glutamic acid (2.48-fold of controls, p = 2.63 × 10 -2 ), and proline (1.73-fold of controls, p = 3.01 × 10 -2 ). Pathway enrichment analysis identified significant enrichment for arginine/proline metabolism (p = 5.88 × 10 -4 , FDR 4.7 × 10 -2 ), where alterations in L-glutamic acid, proline, and carnosine were found. Additionally, multiple Krebs cycle intermediates were significantly decreased (e.g., malic acid, fumaric acid, citric/isocitric acid, and succinic acid), suggesting that altered energy metabolism may be underlying the observed GRMD BF muscle dysfunction. In contrast, two pathways, inosine-5'-monophosphate (VIP Score 3.91) and 3-phosphoglyceric acid (VIP Score 3.08) mainly contributed to the LDE signature, with two metabolites (phosphoglyceric acid and inosine-5'-monophosphate) being significantly decreased. When the BF and LDE were compared, the most significant metabolite was phosphoric acid, which was significantly less in the GRMD BF compared to control and GRMD LDE groups. The identification of elevated BF oleic acid (a long-chain fatty acid) is consistent with recent microarray studies identifying altered lipid metabolism genes, while alterations in arginine and proline metabolism are consistent with recent studies identifying elevated L-arginine in DMD patient sera as a biomarker of disease. Together, these studies demonstrate muscle-specific alterations in GRMD-affected muscle, which illustrate previously unidentified metabolic changes.

Impaired Malate and Fumarate Accumulation Due to the Mutation of the Tonoplast Dicarboxylate Transporter Has Little Effects on Stomatal Behavior.

PubMed

Medeiros, David B; Barros, Kallyne A; Barros, Jessica Aline S; Omena-Garcia, Rebeca P; Arrivault, Stéphanie; Sanglard, Lílian M V P; Detmann, Kelly C; Silva, Willian Batista; Daloso, Danilo M; DaMatta, Fábio M; Nunes-Nesi, Adriano; Fernie, Alisdair R; Araújo, Wagner L

2017-11-01

Malate is a central metabolite involved in a multiplicity of plant metabolic pathways, being associated with mitochondrial metabolism and playing significant roles in stomatal movements. Vacuolar malate transport has been characterized at the molecular level and is performed by at least one carrier protein and two channels in Arabidopsis ( Arabidopsis thaliana ) vacuoles. The absence of the Arabidopsis tonoplast Dicarboxylate Transporter (tDT) in the tdt knockout mutant was associated previously with an impaired accumulation of malate and fumarate in leaves. Here, we investigated the consequences of this lower accumulation on stomatal behavior and photosynthetic capacity as well as its putative metabolic impacts. Neither the stomatal conductance nor the kinetic responses to dark, light, or high CO 2 were highly affected in tdt plants. In addition, we did not observe any impact on stomatal aperture following incubation with abscisic acid, malate, or citrate. Furthermore, an effect on photosynthetic capacity was not observed in the mutant lines. However, leaf mitochondrial metabolism was affected in the tdt plants. Levels of the intermediates of the tricarboxylic acid cycle were altered, and increases in both light and dark respiration were observed. We conclude that manipulation of the tonoplastic organic acid transporter impacted mitochondrial metabolism, while the overall stomatal and photosynthetic capacity were unaffected. © 2017 American Society of Plant Biologists. All Rights Reserved.

Leccinum molle (Bon) Bon and Leccinum vulpinum Watling: The First Study of Their Nutritional and Antioxidant Potential.

PubMed

Reis, Filipa S; Barros, Lillian; Martins, Anabela; Vasconcelos, M Helena; Morales, Patricia; Ferreira, Isabel C F R

2016-02-20

This work presents the chemical profile of two edible species of mushrooms from the genus Leccinum: Leccinum molle (Bon) Bon and Leccinum vulpinum Watling, both harvested on the outskirts of Bragança (Northeastern Portugal). Both species were prepared and characterized regarding their content in nutrients (i.e., free sugars, fatty acids and vitamins), non-nutrients (i.e., phenolic and other organic acids) and antioxidant activity. To the best of our knowledge, no previous studies on the chemical characterization and bioactivity of these species have been undertaken. Accordingly, this study intends to increase the available information concerning edible mushroom species, as well as to highlight another important factor regarding the conservation of the mycological resources--their potential as sources of nutraceutical/pharmaceutical compounds. Overall, both species revealed similar nutrient profiles, with low fat levels, fructose, mannitol and trehalose as the foremost free sugars, and high percentages of mono- and polyunsaturated fatty acids. They also revealed the presence of bioactive compounds, namely phenolic (e.g., gallic acid, protocatechuic acid and p-hydroxybenzoic acid) and organic acids (e.g., citric and fumaric acids) and presented antioxidant properties.

Progressive multifocal leukoencephalopathy in patients treated with fumaric acid esters: a review of 19 cases.

PubMed

Gieselbach, Robbert-Jan; Muller-Hansma, Annemarie H; Wijburg, Martijn T; de Bruin-Weller, Marjolein S; van Oosten, Bob W; Nieuwkamp, Dennis J; Coenjaerts, Frank E; Wattjes, Mike P; Murk, Jean-Luc

2017-06-01

Progressive multifocal leukoencephalopathy (PML) is a rare and potentially fatal condition caused by a brain infection with JC polyomavirus (JCV). PML develops almost exclusively in immunocompromised patients and has recently been associated with use of fumaric acid esters (FAEs), or fumarates. We reviewed the literature and the Dutch and European pharmacovigilance databases in order to identify all available FAE-associated PML cases and distinguish possible common features among these patients. A total of 19 PML cases associated with FAE use were identified. Five cases were associated with FAE use for multiple sclerosis and 14 for psoriasis. Ten patients were male and nine were female. The median age at PML diagnosis was 59 years. The median duration of FAE therapy to PML symptom onset or appearance of first PML lesion on brain imaging was 31 months (range 6-110). In all cases a certain degree of lymphocytopenia was reported. The median duration of lymphocytopenia to PML symptom onset was 23 months (range 6-72). The median lymphocyte count at PML diagnosis was 414 cells/µL. CD4 and CD8 counts were reported in ten cases, with median cell count of 137 and 39 cells/µL, respectively. Three patients died (16% mortality). The association between occurrence of PML in patients with low CD4 and CD8 counts is reminiscent of PML cases in the HIV population and suggests that loss of T cells is the most important risk factor.

Direct measurement of backflux between oxaloacetate and fumarate following pyruvate carboxylation.

PubMed

Brekke, Eva; Walls, Anne B; Nørfeldt, Lasse; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula

2012-01-01

Pyruvate carboxylation (PC) is thought to be the major anaplerotic reaction for the tricarboxylic acid cycle and is necessary for de novo synthesis of amino acid neurotransmitters. In the brain, the main enzyme involved is pyruvate carboxylase, which is predominantly located in astrocytes. Carboxylation leads to the formation of oxaloacetate, which condenses with acetyl coenzyme A to form citrate. However, oxaloacetate may also be converted to malate and fumarate before being regenerated. This pathway is termed the oxaloacetate-fumarate-flux or backflux. Carbon isotope-based methods for quantification of activity of PC lead to underestimation when backflux is not taken into account and critical errors have been made in the interpretation of results from metabolic studies. This study was conducted to establish the degree of backflux after PC in cerebellar and neocortical astrocytes. Astrocyte cultures from cerebellum or neocortex were incubated with either [3-(13) C] or [2-(13) C]glucose, and extracts were analyzed using mass spectrometry or nuclear magnetic resonance spectroscopy. Substantial PC compared with pyruvate dehydrogenase activity was observed, and extensive backflux was demonstrated in both types of astrocytes. The extent of backflux varied between the metabolites, reaffirming that metabolism is highly compartmentalized. By applying our calculations to published data, we demonstrate the existence of backflux in vivo in cat, rat, mouse, and human brain. Thus, backflux should be taken into account when calculating the magnitude of PC to allow for a more precise evaluation of cerebral metabolism. Copyright © 2011 Wiley Periodicals, Inc.

Crystal growth, structural, spectral, thermal, linear and nonlinear optical characterization of a new organic nonlinear chiral compound: L-tryptophan-fumaric acid-water (1/1/1) suitable for laser frequency conversion

NASA Astrophysics Data System (ADS)

Peer Mohamed, M.; Jayaprakash, P.; Nageshwari, M.; Rathika Thaya Kumari, C.; Sangeetha, P.; Sudha, S.; Mani, G.; Lydia Caroline, M.

2017-08-01

A new organic active nonlinear optical crystal L-tryptophan fumaric acid water (1/1/1), (C15H17N2 O7. H2O)(LTFAW), consisting of zwitterion tryptophan molecule in conjunction with a fumaric acid molecule and a water molecule was grown by slow solvent evaporation technique from aqueous solution. The organic chromophore crystallizes from water in its zwitterions exhibiting tabular habit in monoclinic system with acentric space group C2 (Z = 4). The sharp peaks observed in Powder X-ray diffractogram depicts the crystalline nature. The presence of functional groups in the grown crystal was analyzed using FT-IR spectrum. The carbon and hydrogen environment in molecular structure was investigated using FT-NMR technique using deuterated DMSO solution. Ultraviolet-visible spectral analysis reveal that the crystal possess lower cut-off wavelength down to 275 nm, is a key factor to exhibit Second Harmonic Generation (SHG) signal. The direct optical band gap is evaluated to be 5.28 eV from the UV absorption profile. The evaluation of optical constants by employing UV-visible absorbance data such as, extinction coefficient, reflectance, refractive index, optical conductivity are supportive towards good performance as NLO devices. Temperature of decomposition was investigated using thermogravimetric analysis/differential thermal analysis techniques (TG/DTA). The luminescence profile exhibited two peaks (362 nm, 683 nm) due to the donation of protons from carboxylic group to amino group. The nonlinear optical behavior from the noncentrosymmetric crystal was observed by the generation of frequency doubled (2ω) optical radiation when subjected to pulsed Nd:YAG laser (1064 nm, 10 ns, 10 Hz) using Kurtz-Perry method. The variation of dielectric constant (εʹ) and dielectric loss (εʹʹ) vs. Log f for the title compound was analysed at a few selected temperatures and frequencies.

The gut microbiota modulates host energy and lipid metabolism in mice[S

PubMed Central

Velagapudi, Vidya R.; Hezaveh, Rahil; Reigstad, Christopher S.; Gopalacharyulu, Peddinti; Yetukuri, Laxman; Islam, Sama; Felin, Jenny; Perkins, Rosie; Borén, Jan; Orešič, Matej; Bäckhed, Fredrik

2010-01-01

The gut microbiota has recently been identified as an environmental factor that may promote metabolic diseases. To investigate the effect of gut microbiota on host energy and lipid metabolism, we compared the serum metabolome and the lipidomes of serum, adipose tissue, and liver of conventionally raised (CONV-R) and germ-free mice. The serum metabolome of CONV-R mice was characterized by increased levels of energy metabolites, e.g., pyruvic acid, citric acid, fumaric acid, and malic acid, while levels of cholesterol and fatty acids were reduced. We also showed that the microbiota modified a number of lipid species in the serum, adipose tissue, and liver, with its greatest effect on triglyceride and phosphatidylcholine species. Triglyceride levels were lower in serum but higher in adipose tissue and liver of CONV-R mice, consistent with increased lipid clearance. Our findings show that the gut microbiota affects both host energy and lipid metabolism and highlights its role in the development of metabolic diseases. PMID:20040631

Production of Succinic Acid from Citric Acid and Related Acids by Lactobacillus Strains

PubMed Central

Kaneuchi, Choji; Seki, Masako; Komagata, Kazuo

1988-01-01

A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, α-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli. PMID:16347795

Production of succinic Acid from citric Acid and related acids by lactobacillus strains.

PubMed

Kaneuchi, C; Seki, M; Komagata, K

1988-12-01

A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, alpha-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli.

Nuclear magnetic resonance (NMR) studies on the biosynthesis of fusaric acid from Fusarium oxysporum f. sp. vasinfectum.

PubMed

Stipanovic, Robert D; Wheeler, Michael H; Puckhaber, Lorraine S; Liu, Jinggao; Bell, Alois A; Williams, Howard J

2011-05-25

Fusarium oxysporum is a fungal pathogen that attacks many important plants. Uniquely pathogenic strains of F. oxysporum f. sp. vasinfectum were inadvertently imported into the United States on live cottonseed for dairy cattle feed. These strains produce exceptionally high concentrations of the phytotoxin fusaric acid. Thus, fusaric acid may be a critical component in the pathogenicity of these biotypes. This study investigated the biosynthesis of fusaric acid using (13)C-labeled substrates including [1,2-(13)C(2)]acetate as well as (13)C- and (15)N-labeled aspartate and [(15)N]glutamine. The incorporation of labeled substrates is consistent with the biosynthesis of fusaric acid from three acetate units at C5-C6, C7-C8, and C9-C10, with the remaining carbons being derived from aspartate via oxaloacetate and the TCA cycle; the oxaloacetate originates in part by transamination of aspartate, but most of the oxaloacetate is derived by deamination of aspartate to fumarate by aspartase. The nitrogen from glutamine is more readily incorporated into fusaric acid than that from aspartate.

Haloarchaea Endowed with Phosphorus Solubilization Attribute Implicated in Phosphorus Cycle

PubMed Central

Yadav, Ajar Nath; Sharma, Divya; Gulati, Sneha; Singh, Surender; Dey, Rinku; Pal, Kamal Krishna; Kaushik, Rajeev; Saxena, Anil Kumar

2015-01-01

Archaea are unique microorganisms that are present in ecological niches of high temperature, pH and salinity. A total of 157 archaea were obtained from thirteen sediment, water and rhizospheric soil samples collected from Rann of Kutch, Gujarat, India. With an aim to screen phosphate solubilizing archaea, a new medium was designed as Haloarchaea P Solubilization (HPS) medium. The medium supported the growth and P solubilization activity of archaea. Employing the HPS medium, twenty isolates showed the P-solubilization. Phosphate solubilizing archaea were identified as seventeen distinct species of eleven genera namely Haloarcula, Halobacterium, Halococcus, Haloferax, Halolamina, Halosarcina, Halostagnicola, Haloterrigena, Natrialba, Natrinema and Natronoarchaeum. Natrinema sp. strain IARI-WRAB2 was identified as the most efficient P-solubilizer (134.61 mg/L) followed by Halococcus hamelinensis strain IARI-SNS2 (112.56 mg/L). HPLC analysis detected seven different kinds of organic acids, namely: gluconic acid, citric acid, formic acid, fumaric acid succinic acid, propionic acid and tartaric acid from the cultures of these isolates. These phosphate solubilizing halophilic archaea may play a role in P nutrition to vegetation growing in these hypersaline soils. This is the first report for these haloarchaea to solubilize considerable amount of P by production of organic acids and lowering of pH. PMID:26216440

Metabolic changes associated with tumor metastasis, part 2: Mitochondria, lipid and amino acid metabolism.

PubMed

Porporato, Paolo E; Payen, Valéry L; Baselet, Bjorn; Sonveaux, Pierre

2016-04-01

Metabolic alterations are a hallmark of cancer controlling tumor progression and metastasis. Among the various metabolic phenotypes encountered in tumors, this review focuses on the contributions of mitochondria, lipid and amino acid metabolism to the metastatic process. Tumor cells require functional mitochondria to grow, proliferate and metastasize, but shifts in mitochondrial activities confer pro-metastatic traits encompassing increased production of mitochondrial reactive oxygen species (mtROS), enhanced resistance to apoptosis and the increased or de novo production of metabolic intermediates of the TCA cycle behaving as oncometabolites, including succinate, fumarate, and D-2-hydroxyglutarate that control energy production, biosynthesis and the redox state. Lipid metabolism and the metabolism of amino acids, such as glutamine, glutamate and proline are also currently emerging as focal control points of cancer metastasis.

Exudation of organic acids by Lupinus albus and Lupinus angustifolius as affected by phosphorus supply

NASA Astrophysics Data System (ADS)

Hentschel, Werner; Wiche, Oliver

2016-04-01

In phytomining and phytoremediation research mixed cultures of bioenergy crops with legumes hold promise to enhance availability of trace metals and metalloids in the soil plant system. This is due to the ability of certain legumes to mobilize trace elements during acquisition of nutrients making these elements available for co-cultured species. The legumes achieve this element mobilization by exudating carboxylates and enzymes as well as by lowering the pH value in the rhizosphere. The aim of our research was to determine characteristics and differences in the exudation of Lupinus albus and Lupinus angustifolius regarding to quantitative as to qualitative aspects. Especially the affection by phosphorus (P) supply was a point of interest. Thus we conducted laboratory batch experiments, wherein the plants were grown over four weeks under controlled light, moisture and nutritional conditions on sand as substrate. Half of the plants were supplied with 12 mg P per kg substrate, the other half were cultivated under a total lack of P. After cultivation the plants were transferred from the cultivation substrate into a 0,05 mmolṡL-1 CaCl2 solution. After two hours the plants were removed, moist and dry mass off shoots and roots were measured together with the root length (Tennants' method). Concentrations of exudated carboxylates in the CaCl2 solution were determined via IC (column: Metrosept OrganicAcids, eluent 0.5 molṡL-1 H2SO4 + 15% acetone, pH=3; 0.5 mLṡmin-1). As a result four different organic acids were identified (citric acid, fumaric acid, tartaric acid, malic acid) in concentration ranges of 0.15 mgṡL-1 (fumaric acid) to 9.21 mgṡL-1 (citric acid). Lupinus angustifolius showed a higher exudation rate (in nmol per cm root length per hour) than Lupinus albus in the presence of phosphorus (e.g. regarding citric acid: 1.99 vs 0.64 nmolṡ(gṡh)-1). However, as the root complexity and length of L. albus were far higher than of L. angustifolius, the total amount of exudated organic acids per plant of L. albus was higher than of L.angustifolius. Thus L.albus should be addressed as the more exudation effective plant in comparison to L.angustifolius (could be addressed as the more efficient one). Since organic acids in the rhizosphere of intermingling root systems of intercropped species play a key role during mobilization of trace metals our result clearly show that L.albus is most suitable for intercropping in a sense of phytoremediation and phytomining. These studies have been carried out in the framework of the PhytoGerm project financed by the Federal Ministry of Education and Research, Germany.

Experimental design for extraction and quantification of phenolic compounds and organic acids in white "Vinho Verde" grapes.

PubMed

Dopico-García, M S; Valentão, P; Guerra, L; Andrade, P B; Seabra, R M

2007-01-30

An experimental design was applied for the optimization of extraction and clean-up processes of phenolic compounds and organic acids from white "Vinho Verde" grapes. The developed analytical method consisted in two steps: first a solid-liquid extraction of both phenolic compounds and organic acids and then a clean-up step using solid-phase extraction (SPE). Afterwards, phenolic compounds and organic acids were determined by high-performance liquid chromatography (HPLC) coupled to a diode array detector (DAD) and HPLC-UV, respectively. Plackett-Burman design was carried out to select the significant experimental parameters affecting both the extraction and the clean-up steps. The identified and quantified phenolic compounds were: quercetin-3-O-glucoside, quercetin-3-O-rutinoside, kaempferol-3-O-rutinoside, isorhamnetin-3-O-glucoside, quercetin, kaempferol and epicatechin. The determined organic acids were oxalic, citric, tartaric, malic, shikimic and fumaric acids. The obtained results showed that the most important variables were the temperature (40 degrees C) and the solvent (acid water at pH 2 with 5% methanol) for the extraction step and the type of sorbent (C18 non end-capped) for the clean-up step.

Rumen microbial response in production of CLA and methane to safflower oil in association with fish oil or/and fumarate.

PubMed

Li, Xiang Z; Long, Rui J; Yan, Chang G; Lee, Hong G; Kim, Young J; Song, Man K

2011-06-01

Supplementation effect of fish oil and/or fumarate on production of conjugated linoleic acid (CLA) and methane by rumen microbes was examined when incubated with safflower oil. One hundred and twenty milligrams of safflower oil (SO), safflower oil with 24 mg fish oil (SOFO), safflower oil with 24 mmol/L fumarate (SOFA), or safflower oil with 24 mg fish oil and 24 mmol/L fumarate (SOFOFA) were added to the 90 mL culture solution. The culture solution was also made without any supplements (control). The SOFA and SOFOFA increased pH and propionate (C3) compared to other treatments from 3 h incubation time. An accumulated amount of total methane (CH(4) ) for 12 h incubation was decreased by all the supplements compared to control. The concentrations of c9,t11CLA for all the incubation times were increased in the treatments of SOFO, SOFA and SOFOFA compared to SO. The highest concentration of c9,t11CLA was observed from SOFOFA among all the treatments at all incubation times. Overall data indicate that supplementation of combined fumarate and/or fish oil when incubated with safflower oil could depress CH(4) generation and increase production of C(3) and CLA under the condition of current in vitro study. © 2011 The Authors; Animal Science Journal © 2011 Japanese Society of Animal Science.

Metabolomic Response to Huanglongbing: Role of Carboxylic Compounds in Citrus sinensis Response to 'Candidatus Liberibacter asiaticus' and Its Vector, Diaphorina citri.

PubMed

Killiny, Nabil; Nehela, Yasser

2017-08-01

Huanglongbing, a destructive disease of citrus, is caused by the fastidious bacterium 'Candidatus Liberibacter asiaticus' and transmitted by Asian citrus psyllid, Diaphorina citri. The impact of 'Ca. L. asiaticus' infection or D. citri infestation on Valencia sweet orange (Citrus sinensis) leaf metabolites was investigated using gas chromatography mass spectrometry, followed by gene expression analysis for 37 genes involved in jasmonic acid (JA), salicylic acid (SA), and proline-glutamine pathways. The total amino acid abundance increased after 'Ca. L. asiaticus' infection, while the total fatty acids increased dramatically after infestation with D. citri, compared with control plants. Seven amino acids (glycine, l-isoleucine, l-phenylalanine, l-proline, l-serine, l-threonine, and l-tryptophan) and five organic acids (benzoic acid, citric acid, fumaric acid, SA, and succinic acid) increased in 'Ca. L. asiaticus'-infected plants. On the other hand, the abundance of trans-JA and its precursor α-linolenic increased in D. citri-infested plants. Surprisingly, the double attack of both D. citri infestation and 'Ca. L. asiaticus' infection moderated the metabolic changes in all chemical classes studied. In addition, the gene expression analysis supported these results. Based on these findings, we suggest that, although amino acids such as phenylalanine are involved in citrus defense against 'Ca. L. asiaticus' infection through the activation of an SA-mediated pathway, fatty acids, especially α-linolenic acid, are involved in defense against D. citri infestation via the induction of a JA-mediated pathway.

In vitro assessment of potential intestinal absorption of some phenolic families and carboxylic acids from commercial instant coffee samples.

PubMed

López-Froilán, R; Ramírez-Moreno, E; Podio, N S; Pérez-Rodríguez, M L; Cámara, M; Baroni, M V; Wunderlin, D A; Sánchez-Mata, M C

2016-06-15

Coffee is one of the most consumed beverages in the world, being a source of bioactive compounds as well as flavors. Hydroxycinnamic acids, flavonols, and carboxylic acids have been studied in the samples of instant coffee commercialized in Spain. The studies about contents of food components should be complemented with either in vitro or in vivo bioaccessibility studies to know the amount of food components effectively available for functions in the human body. In this sense, a widely used in vitro model has been applied to assess the potential intestinal absorption of phenolic compounds and organic acids. The contents of hydroxycinnamic acids and flavonols were higher in instant regular coffee samples than in the decaffeinated ones. Bioaccessible phenolic compounds in most analyzed samples account for 20-25% of hydroxycinnamic acids and 17-26% of flavonols. This could mean that a great part of them can remain in the gut, acting as potential in situ antioxidants. Quinic, acetic, pyroglutamic, citric and fumaric acids were identified in commercial instant coffee samples. Succinic acid was found in the coffee blend containing chicory. All carboxylic acids showed a very high bioaccessibility. Particularly, acetic acid and quinic acid were found in higher contents in the samples treated with the in vitro simulation of gastrointestinal processes, compared to the original ones, which can be explained by their cleavage from chlorogenic acid during digestion. This is considered as a positive effect, since quinic acid is considered as an antioxidant inducer.

Anaerobic organic acid metabolism of Candida zemplinina in comparison with Saccharomyces wine yeasts.

PubMed

Magyar, Ildikó; Nyitrai-Sárdy, Diána; Leskó, Annamária; Pomázi, Andrea; Kállay, Miklós

2014-05-16

Organic acid production under oxygen-limited conditions has been thoroughly studied in the Saccharomyces species, but practically never investigated in Candida zemplinina, which seems to be an acidogenic species under oxidative laboratory conditions. In this study, several strains of C. zemplinina were tested for organic acid metabolism, in comparison with Saccharomyces cerevisiae, Saccharomyces uvarum and Candida stellata, under fermentative conditions. Only C. stellata produced significantly higher acidity in simple minimal media (SM) with low sugar content and two different nitrogen sources (ammonia or glutamic acid) at low level. However, the acid profile differed largely between the Saccharomyces and Candida species and showed inverse types of N-dependence in some cases. Succinic acid production was strongly enhanced on glutamic acid in Saccharomyces species, but not in Candida species. 2-oxoglutarate production was strongly supported on ammonium nitrogen in Candida species, but remained low in Saccharomyces. Candida species, C. stellata in particular, produced more pyruvic acid regardless of N-sources. From the results, we concluded that the anaerobic organic acid metabolisms of C. zemplinina and C. stellata are different from each other and also from that of the Saccharomyces species. In the formation of succinic acid, the oxidative pathway from glutamic acid seems to play little or no role in C. zemplinina. The reductive branch of the TCA cycle, however, produces acidic intermediates (malic, fumaric, and succinic acid) in a level comparable with the production of the Saccharomyces species. An unidentified organic acid, which was produced on glutamic acid only by the Candida species, needs further investigation. Copyright © 2014 Elsevier B.V. All rights reserved.

Non-Targeted Metabolomics Analysis of Golden Retriever Muscular Dystrophy-Affected Muscles Reveals Alterations in Arginine and Proline Metabolism, and Elevations in Glutamic and Oleic Acid In Vivo

PubMed Central

Abdullah, Muhammad; Kornegay, Joe N.; Honcoop, Aubree; Parry, Traci L.; Balog-Alvarez, Cynthia J.; Muehlbauer, Michael J.; Newgard, Christopher B.; Patterson, Cam

2017-01-01

Background: Like Duchenne muscular dystrophy (DMD), the Golden Retriever Muscular Dystrophy (GRMD) dog model of DMD is characterized by muscle necrosis, progressive paralysis, and pseudohypertrophy in specific skeletal muscles. This severe GRMD phenotype includes moderate atrophy of the biceps femoris (BF) as compared to unaffected normal dogs, while the long digital extensor (LDE), which functions to flex the tibiotarsal joint and serves as a digital extensor, undergoes the most pronounced atrophy. A recent microarray analysis of GRMD identified alterations in genes associated with lipid metabolism and energy production. Methods: We, therefore, undertook a non-targeted metabolomics analysis of the milder/earlier stage disease GRMD BF muscle versus the more severe/chronic LDE using GC-MS to identify underlying metabolic defects specific for affected GRMD skeletal muscle. Results: Untargeted metabolomics analysis of moderately-affected GRMD muscle (BF) identified eight significantly altered metabolites, including significantly decreased stearamide (0.23-fold of controls, p = 2.89 × 10−3), carnosine (0.40-fold of controls, p = 1.88 × 10−2), fumaric acid (0.40-fold of controls, p = 7.40 × 10−4), lactamide (0.33-fold of controls, p = 4.84 × 10−2), myoinositol-2-phosphate (0.45-fold of controls, p = 3.66 × 10−2), and significantly increased oleic acid (1.77-fold of controls, p = 9.27 × 10−2), glutamic acid (2.48-fold of controls, p = 2.63 × 10−2), and proline (1.73-fold of controls, p = 3.01 × 10−2). Pathway enrichment analysis identified significant enrichment for arginine/proline metabolism (p = 5.88 × 10−4, FDR 4.7 × 10−2), where alterations in L-glutamic acid, proline, and carnosine were found. Additionally, multiple Krebs cycle intermediates were significantly decreased (e.g., malic acid, fumaric acid, citric/isocitric acid, and succinic acid), suggesting that altered energy metabolism may be underlying the observed GRMD BF muscle dysfunction. In contrast, two pathways, inosine-5′-monophosphate (VIP Score 3.91) and 3-phosphoglyceric acid (VIP Score 3.08) mainly contributed to the LDE signature, with two metabolites (phosphoglyceric acid and inosine-5′-monophosphate) being significantly decreased. When the BF and LDE were compared, the most significant metabolite was phosphoric acid, which was significantly less in the GRMD BF compared to control and GRMD LDE groups. Conclusions: The identification of elevated BF oleic acid (a long-chain fatty acid) is consistent with recent microarray studies identifying altered lipid metabolism genes, while alterations in arginine and proline metabolism are consistent with recent studies identifying elevated L-arginine in DMD patient sera as a biomarker of disease. Together, these studies demonstrate muscle-specific alterations in GRMD-affected muscle, which illustrate previously unidentified metabolic changes. PMID:28758940

Automated Control of the Organic and Inorganic Composition of Aloe vera Extracts Using (1)H NMR Spectroscopy.

PubMed

Monakhova, Yulia B; Randel, Gabriele; Diehl, Bernd W K

2016-09-01

Recent classification of Aloe vera whole-leaf extract by the International Agency for Research and Cancer as a possible carcinogen to humans as well as the continuous adulteration of A. vera's authentic material have generated renewed interest in controlling A. vera. The existing NMR spectroscopic method for the analysis of A. vera, which is based on a routine developed at Spectral Service, was extended. Apart from aloverose, glucose, malic acid, lactic acid, citric acid, whole-leaf material (WLM), acetic acid, fumaric acid, sodium benzoate, and potassium sorbate, the quantification of Mg(2+), Ca(2+), and fructose is possible with the addition of a Cs-EDTA solution to sample. The proposed methodology was automated, which includes phasing, baseline-correction, deconvolution (based on the Lorentzian function), integration, quantification, and reporting. The NMR method was applied to 41 A. vera preparations in the form of liquid A. vera juice and solid A. vera powder. The advantages of the new NMR methodology over the previous method were discussed. Correlation between the new and standard NMR methodologies was significant for aloverose, glucose, malic acid, lactic acid, citric acid, and WLM (P < 0.0001, R(2) = 0.99). NMR was found to be suitable for the automated simultaneous quantitative determination of 13 parameters in A. vera.

Drug-induced Fanconi syndrome associated with fumaric acid esters treatment for psoriasis: a case series.

PubMed

Balak, Deepak M W; Bouwes Bavinck, Jan Nico; de Vries, Aiko P J; Hartman, Jenny; Neumann, Hendrik A Martino; Zietse, Robert; Thio, Hok Bing

2016-02-01

Fumaric acid esters (FAEs), an oral immunomodulating treatment for psoriasis and multiple sclerosis, have been anecdotally associated with proximal renal tubular dysfunction due to a drug-induced Fanconi syndrome. Few data are available on clinical outcomes of FAE-induced Fanconi syndrome. Descriptive case series with two cases of Fanconi syndrome associated with FAE treatment diagnosed at two Dutch university nephrology departments, three cases reported at the Dutch and German national pharmacovigilance databases and six previously reported cases. All 11 cases involved female patients with psoriasis. The median age at the time of onset was 38 years [interquartile range (IQR) 37-46]. Patients received long-term FAEs treatment with a median treatment duration of 60 months (IQR 28-111). Laboratory tests were typically significant for low serum levels of phosphate and uric acid, while urinalysis showed glycosuria and proteinuria. Eight (73%) patients had developed a hypophosphataemic osteomalacia and three (27%) had pathological bone fractures. All patients discontinued FAEs, while four (36%) patients were treated with supplementation of phosphate and/or vitamin D. Five (45%) patients had persisting symptoms despite FAEs discontinuation. FAEs treatment can cause drug-induced Fanconi syndrome, but the association has been reported infrequently. Female patients with psoriasis treated long term with FAEs seem to be particularly at risk. Physicians treating patients with FAEs should be vigilant and monitor for the potential occurrence of Fanconi syndrome. Measurement of the urinary albumin:total protein ratio is a suggested screening tool for tubular proteinuria in Fanconi syndrome.

Flavor Compounds in Pixian Broad-Bean Paste: Non-Volatile Organic Acids and Amino Acids.

PubMed

Lin, Hongbin; Yu, Xiaoyu; Fang, Jiaxing; Lu, Yunhao; Liu, Ping; Xing, Yage; Wang, Qin; Che, Zhenming; He, Qiang

2018-05-29

Non-volatile organic acids and amino acids are important flavor compounds in Pixian broad-bean paste, which is a traditional Chinese seasoning product. In this study, non-volatile organic acids, formed in the broad-bean paste due to the metabolism of large molecular compounds, are qualitatively and quantitatively determined by high-performance liquid chromatography (HPLC). Amino acids, mainly produced by hydrolysis of soybean proteins, were determined by the amino acid automatic analyzer. Results indicated that seven common organic acids and eighteen common amino acids were found in six Pixian broad-bean paste samples. The content of citric acid was found to be the highest in each sample, between 4.1 mg/g to 6.3 mg/g, and malic acid were between 2.1 mg/g to 3.6 mg/g ranked as the second. Moreover, fumaric acid was first detected in fermented bean pastes albeit with a low content. For amino acids, savory with lower sour taste including glutamine (Gln), glutamic acid (Glu), aspartic acid (Asp) and asparagines (Asn) were the most abundant, noted to be 6.5 mg/g, 4.0 mg/g, 6.4 mg/g, 4.9 mg/g, 6.2 mg/g and 10.2 mg/g, and bitter taste amino acids followed. More importantly, as important flavor materials in Pixian broad-bean paste, these two groups of substances are expected to be used to evaluate and represent the flavor quality of Pixian broad-bean paste. Moreover, the results revealed that citric acid, glutamic acid, methionine and proline were the most important flavor compounds. These findings are agreat contribution for evaluating the quality and further assessment of Pixian broad-bean paste.

Temperature shift experiments suggest that metabolic impairment and enhanced rates of photorespiration decrease organic acid levels in soybean leaflets exposed to supra-optimal growth temperatures

USDA-ARS?s Scientific Manuscript database

Citrate, malate, malonate, fumarate and succinate in soybean leaflets decreased 40 to 80% when plants were grown continuously in controlled environment chambers at 36/28 compared to 28/20 °C. Glycerate was not temperature responsive in this study. Temperature effects on the above mentioned organi...

Metabolic potential of fatty acid oxidation and anaerobic respiration by abundant members of Thaumarchaeota and Thermoplasmata in deep anoxic peat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Xueju; Handley, Kim M.; Gilbert, Jack A.

2015-12-01

To probe the metabolic potential of abundant Archaea in boreal peats, we reconstructed two near-complete archaeal genomes, affiliated with Thaumarchaeota group 1.1c (bin Fn1, 8% abundance), which was a genomically unrepresented group, and Thermoplasmata (bin Bg1, 26% abundance), from metagenomic data acquired from deep anoxic peat layers. Each of the near-complete genomes encodes the potential to degrade long-chain fatty acids (LCFA) via β-oxidation. Fn1 has the potential to oxidize LCFA either by syntrophic interaction with methanogens or by coupling oxidation with anaerobic respiration using fumarate as a terminal electron acceptor (TEA). Fn1 is the first Thaumarchaeota genome without an identifiablemore » carbon fixation pathway, indicating that this mesophilic phylum encompasses more diverse metabolisms than previously thought. Furthermore, we report genetic evidence suggestive of sulfite and/or organosulfonate reduction by Thermoplasmata Bg1. In deep peat, inorganic TEAs are often depleted to extremely low levels, yet the anaerobic respiration predicted for two abundant archaeal members suggests organic electron acceptors such as fumarate and organosulfonate (enriched in humic substances) may be important for respiration and C mineralization in peatlands.« less

Raman spectroscopy based screening of IgG positive and negative sera for dengue virus infection

NASA Astrophysics Data System (ADS)

Bilal, M.; Saleem, M.; Bial, Maria; Khan, Saranjam; Ullah, Rahat; Ali, Hina; Ahmed, M.; Ikram, Masroor

2017-11-01

A quantitative analysis for the screening of immunoglobulin-G (IgG) positive human sera samples is presented for the dengue virus infection. The regression model was developed using 79 samples while 20 samples were used to test the performance of the model. The R-square (r 2) value of 0.91 was found through a leave-one-sample-out cross validation method, which shows the validity of this model. This model incorporates the molecular changes associated with IgG. Molecular analysis based on regression coefficients revealed that myristic acid, coenzyme-A, alanine, arabinose, arginine, vitamin C, carotene, fumarate, galactosamine, glutamate, lactic acid, stearic acid, tryptophan and vaccenic acid are positively correlated with IgG; while amide III, collagen, proteins, fatty acids, phospholipids and fucose are negatively correlated. For blindly tested samples, an excellent agreement has been found between the model predicted, and the clinical values of IgG. The parameters, which include sensitivity, specificity, accuracy and the area under the receiver operator characteristic curve, are found to be 100%, 83.3%, 95% and 0.99, respectively, which confirms the high quality of the model.

Comparison of the skin sensitizing potential of unsaturated compounds as assessed by the murine local lymph node assay (LLNA) and the guinea pig maximization test (GPMT).

PubMed

Kreiling, R; Hollnagel, H M; Hareng, L; Eigler, D; Lee, M S; Griem, P; Dreessen, B; Kleber, M; Albrecht, A; Garcia, C; Wendel, A

2008-06-01

The skin sensitization potential of eight unsaturated and one saturated lipid (bio)chemicals was tested in both the LLNA and the GPMT to address the hypothesis that chemicals with unsaturated carbon-carbon double bonds may result in a higher number of unspecific (false positive) results in the LLNA compared to the GPMT. Seven substances (oleic acid, linoleic acid, linolenic acid, undecylenic acid, maleic acid, squalene and octinol) gave clear positive results in the LLNA (stimulation index (SI)> or = 3) and thus would require labelling as skin sensitizer. Fumaric acid and succinic acid gave clearly negative results. In the GPMT, besides some sporadic skin reactions, reproducible skin reactions indicating an allergic response were found in a few animals for four test substances. Based on the GPMT results, only undecylenic acid would have to be classified and labelled as a skin sensitizer according to the European Dangerous Substance Directive (67/548/EEC) (results for linoleic acid were inconclusive), while the other seven test substances would not require labelling. Possible mechanisms for unspecific skin cell stimulation and lymph node responses are discussed. In conclusion, the suitability of the LLNA for unsaturated compounds bearing structural similarity to the tested substances should be carefully considered and the GPMT should remain available as an accepted test method for skin sensitization hazard identification.

Evaluation of Malolactic Bacteria Isolated from Oregon Wines †

PubMed Central

Henick-Kling, T.; Sandine, W. E.; Heatherbell, D. A.

1989-01-01

Oregon is a cool wine-producing region where grapes characteristically contain high concentrations of organic acids. To reduce the natural acidity and increase the microbiological stability and flavor complexity of the wine, malolactic fermentation is encouraged. In this study, strains of Leuconostoc oenos indigenous to Oregon wines were evaluated for their suitability to conduct malolactic fermentation in Oregon wines. Tests determined the malolactic activity of the Oregon isolates in comparison with commercial strains ML-34, PSU-1, MLT-kli, and ens 44-40 under various temperature and pH conditions. Sensitivities to sulfur dioxide, ethanol, and fumaric acid also were determined. Two Oregon strains, Er-1a and Ey-2d, were selected for commercial winemaking tests because they had greater malolactic activity under conditions of low pH (3.0) and low temperature (15 and 8°C), respectively. PMID:16347992

Content of selected elements and low-molecular-weight organic acids in fruiting bodies of edible mushroom Boletus badius (Fr.) Fr. from unpolluted and polluted areas.

PubMed

Mleczek, Mirosław; Magdziak, Zuzanna; Gąsecka, Monika; Niedzielski, Przemysław; Kalač, Pavel; Siwulski, Marek; Rzymski, Piotr; Zalicka, Sylwia; Sobieralski, Krzysztof

2016-10-01

The aim of the study was to (i) investigate the potential of edible mushroom Boletus badius (Fr.) Fr. to accumulate 53 elements from unpolluted acidic sandy soil and polluted alkaline flotation tailing sites in Poland, (ii) to estimate the low-molecular-weight organic acid (LMWOA) profile and contents in fruit bodies, and finally (iii) to explore the possible relationship between elements and LMWOA content in mushrooms. The content of most elements in fruiting bodies collected from the flotation tailings was significantly higher than in mushrooms from the unpolluted soils. The occurrence of elements determined in fruiting bodies of B. badius has been varied (from 0.01 mg kg -1 for Eu, Lu, and Te up to 18,932 mg kg -1 for K). The results established the high importance of element contents in substrate. Among ten organic acids, nine have been found in wide range: from below 0.01 mg kg -1 for fumaric acid to 14.8 mg g -1 for lactic acid. Lactic and succinic acids were dominant in both areas, and citric acid was also in high content in polluted area. The correlation between element contents and the individual and total content of LMWOAs was confirmed.

Study of structural, surface and hydrogen storage properties of boric acid mediated metal (sodium)-organic frameworks

NASA Astrophysics Data System (ADS)

Ozer, Demet; Köse, Dursun A.; Sahin, Onur; Oztas, Nursen A.

2018-04-01

Three boric acid mediated metal organic frameworks were synthesized by solution method with using succinic acid, fumaric acid and acetylene dicarboxylic acid as a ligand source and sodium as a metal source. The complexes were characterized by FT-IR, powder XRD, elemental analyses and single crystal measurements. The complexes with the formula, C4H18B2Na2O14, C4H16B2Na2O14 and C4H14B2Na2O14 were successfully obtained. BET surface area of complexes were calculated and found as 13.474 m2/g for catena-(tetrakis(μ2-hydroxo)-(μ2-trihydrogen borate)-(μ2-succinato)-di-sodium boric acid solvate), 1.692 m2/g for catena-(tetrakis(μ2-hydroxo)-(μ2-trihydrogen borate)-(μ2-fumarato)-di-sodium boric acid solvate) and 5.600 m2/g for catena-(tetrakis(μ2-hydroxo)-(μ2-trihydrogen borate)-(μ2-acetylenedicarboxylato)-di-sodium boric acid solvate). Hydrogen storage capacities of the complexes were also studied at 77 K 1 bar pressure and found as 0.108%, 0.033%, 0.021% by mass. When different ligands were used, the pore volume, pore width and surface area of the obtained complexes were changed. As a consequence, hydrogen storage capacities also changed.

Metabolomic Analyses of Blood Plasma after Oral Administration of D-Glucosamine Hydrochloride to Dogs

PubMed Central

Osaki, Tomohiro; Azuma, Kazuo; Kurozumi, Seiji; Takamori, Yoshimori; Tsuka, Takeshi; Imagawa, Tomohiro; Okamoto, Yoshiharu; Minami, Saburo

2012-01-01

D-Glucosamine hydrochloride (GlcN∙HCl) is an endogenous amino monosaccharide synthesized from glucose that is useful in the treatment of joint diseases in both humans and animals. The aim of this study was to examine amino acid metabolism in dogs after oral administration of GlcN∙HCl. Accelerated fumarate respiration and elevated plasma levels of lactic acid and alanine were observed after administration. These results suggest that oral administration of GlcN∙HCl induces anaerobic respiration and starvation in cells, and we hypothesize that these conditions promote cartilage regeneration. Further studies are required to evaluate the expression of transforming growth factor-beta (TGF-β). PMID:23015778

The preparation and evaluation of salt forms of linogliride with reduced solubilities as candidates for extended release.

PubMed

Chrzanowski, Frank A; Ahmad, Kaleem

2017-03-01

Salts of linogliride with reduced solubilities were prepared and evaluated as potential candidates for extended-release oral dosage forms. A once-daily dose of 300-800 mg was intended. Seven acids were selected: p-acetamidobenzoic, benzoic, p-hydroxybenzoic, 3-hydroxy-2-naphthoic, 1-napsylic, pamoic, and p-toluenesulfonic acids but only four salts were able to be prepared in suitable quantities for evaluation: linogliride pamoate, p-hydroxybenzoate, 3-hydroxy-2-naphthoate, and 1-napsylate. The pH-solubility profiles of the four new salts, free base, and fumarate salt were compared over the pH 1.43-8.3 range and the intrinsic dissolution rates of the four new salts and the free base were determined at pH 1.43, 4.4, and 7.5. The range of the pH-solubility profile and intrinsic dissolution rates of the p-hydroxybenzoate salt were less than the free base and fumarate and higher than the other three new salts. The pH-solubilities and intrinsic dissolution rates of the 1-napsylate salt were pH-independent. The solubilities and intrinsic dissolution rates of the pamoate and 3-hydroxy-2-naphthoate were higher at pH 1.4-3.4 than at higher pH. At pH 4.4 and higher, the solubilities were essentially the same, in the 1-2 mg/mL range. The intrinsic dissolution rates were also very low and not very different. Dissolution studies with capsules containing 800 mg doses of the pamoate, 1-napsylate, free base, and fumarate performed in a dissolution medium of pH beginning at 2.2 and ending at 6.8 demonstrated that the pamoate and 1-napsylate salt forms dissolved slower and could be useful as extended-release forms.

The genome sequence of Geobacter metallireducens: features of metabolism, physiology and regulation common and dissimilar to Geobacter sulfurreducens

PubMed Central

2009-01-01

Background The genome sequence of Geobacter metallireducens is the second to be completed from the metal-respiring genus Geobacter, and is compared in this report to that of Geobacter sulfurreducens in order to understand their metabolic, physiological and regulatory similarities and differences. Results The experimentally observed greater metabolic versatility of G. metallireducens versus G. sulfurreducens is borne out by the presence of more numerous genes for metabolism of organic acids including acetate, propionate, and pyruvate. Although G. metallireducens lacks a dicarboxylic acid transporter, it has acquired a second putative succinate dehydrogenase/fumarate reductase complex, suggesting that respiration of fumarate was important until recently in its evolutionary history. Vestiges of the molybdate (ModE) regulon of G. sulfurreducens can be detected in G. metallireducens, which has lost the global regulatory protein ModE but retained some putative ModE-binding sites and multiplied certain genes of molybdenum cofactor biosynthesis. Several enzymes of amino acid metabolism are of different origin in the two species, but significant patterns of gene organization are conserved. Whereas most Geobacteraceae are predicted to obtain biosynthetic reducing equivalents from electron transfer pathways via a ferredoxin oxidoreductase, G. metallireducens can derive them from the oxidative pentose phosphate pathway. In addition to the evidence of greater metabolic versatility, the G. metallireducens genome is also remarkable for the abundance of multicopy nucleotide sequences found in intergenic regions and even within genes. Conclusion The genomic evidence suggests that metabolism, physiology and regulation of gene expression in G. metallireducens may be dramatically different from other Geobacteraceae. PMID:19473543

Drug-induced Fanconi syndrome associated with fumaric acid esters treatment for psoriasis: a case series

PubMed Central

Balak, Deepak M.W.; Bouwes Bavinck, Jan Nico; de Vries, Aiko P.J.; Hartman, Jenny; Neumann, Hendrik A. Martino; Zietse, Robert; Thio, Hok Bing

2016-01-01

Background Fumaric acid esters (FAEs), an oral immunomodulating treatment for psoriasis and multiple sclerosis, have been anecdotally associated with proximal renal tubular dysfunction due to a drug-induced Fanconi syndrome. Few data are available on clinical outcomes of FAE-induced Fanconi syndrome. Methods Descriptive case series with two cases of Fanconi syndrome associated with FAE treatment diagnosed at two Dutch university nephrology departments, three cases reported at the Dutch and German national pharmacovigilance databases and six previously reported cases. Results All 11 cases involved female patients with psoriasis. The median age at the time of onset was 38 years [interquartile range (IQR) 37–46]. Patients received long-term FAEs treatment with a median treatment duration of 60 months (IQR 28–111). Laboratory tests were typically significant for low serum levels of phosphate and uric acid, while urinalysis showed glycosuria and proteinuria. Eight (73%) patients had developed a hypophosphataemic osteomalacia and three (27%) had pathological bone fractures. All patients discontinued FAEs, while four (36%) patients were treated with supplementation of phosphate and/or vitamin D. Five (45%) patients had persisting symptoms despite FAEs discontinuation. Conclusions FAEs treatment can cause drug-induced Fanconi syndrome, but the association has been reported infrequently. Female patients with psoriasis treated long term with FAEs seem to be particularly at risk. Physicians treating patients with FAEs should be vigilant and monitor for the potential occurrence of Fanconi syndrome. Measurement of the urinary albumin:total protein ratio is a suggested screening tool for tubular proteinuria in Fanconi syndrome. PMID:26798466

Chemical assessment and in vitro antioxidant capacity of Ficus carica latex.

PubMed

Oliveira, Andreia P; Silva, Luís R; Ferreres, Federico; Guedes de Pinho, Paula; Valentão, Patrícia; Silva, Branca M; Pereira, José A; Andrade, Paula B

2010-03-24

Ficus species possess latex-like material within their vasculatures, affording protection and self-healing from physical attacks. In this work, metabolite profiling was performed on Ficus carica latex. Volatiles profile was determined by HS-SPME/GC-IT-MS, with 34 compounds being identified, distributed by distinct chemical classes: 5 aldehydes, 7 alcohols, 1 ketone, 9 monoterpenes, 9 sesquiterpenes and 3 other compounds. Sesquiterpenes constituted the most abundant class in latex (ca. 91% of total identified compounds). Organic acids composition was also characterized, by HPLC-UV, and oxalic, citric, malic, quinic, shikimic and fumaric acids were determined. Malic and shikimic acids were present in higher amounts (ca. 26%, each). The antioxidant potential of this material was checked by distinct in vitro chemical assays. A concentration-dependent activity was noticed against DPPH, nitric oxide and superoxide radicals. Additionally, acetylcholinesterase inhibitory capacity was evaluated, but a weak effect was found.

Nitrogen Metabolism in Plant Cell Suspension Cultures

PubMed Central

Behrend, Josef; Mateles, Richard I.

1976-01-01

Tobacco cells (Nicotiana tabacum) are capable of growth on ammonia as a sole nitrogen source only when succinate, malate, fumarate, citrate, α-ketoglutarate, glutamate, or pyruvate is added to the growth medium. A ratio between the molar concentrations of ammonia to succinate (as a complementary organic acid) in the growth medium of 1.5 was optimal. Succinate had no effect on the rate of uptake of ammonia from the medium into the cells although it did affect the intracellular concentration of ammonia. However, the changes were not sufficient to explain inhibition of growth as being due to ammonia toxicity. The radioactivity from 14C-succinate was incorporated into malate, glutamate, and aspartate within 2 minutes. It appears that the role of organic acids is neither connected to ammonium transport nor to relief of ammonia toxicity, but may be related to the need for additional carbon skeletons for synthesis of amino acids. PMID:16659706

Primary Metabolism and Medium-Chain Fatty Acid Alterations Precede Long-Chain Fatty Acid Changes Impacting Neutral Lipid Metabolism in Response to an Anticancer Lysophosphatidylcholine Analogue in Yeast.

PubMed

Tambellini, Nicolas P; Zaremberg, Vanina; Krishnaiah, Saikumari; Turner, Raymond J; Weljie, Aalim M

2017-10-06

The nonmetabolizable lysophosphatidylcholine (LysoPC) analogue edelfosine is the prototype of a class of compounds being investigated for their potential as selective chemotherapeutic agents. Edelfosine targets membranes, disturbing cellular homeostasis. Is not clear at this point how membrane alterations are communicated between intracellular compartments leading to growth inhibition and eventual cell death. In the present study, a combined metabolomics/lipidomics approach for the unbiased identification of metabolic pathways altered in yeast treated with sublethal concentrations of the LysoPC analogue was employed. Mass spectrometry of polar metabolites, fatty acids, and lipidomic profiling was used to study the effects of edelfosine on yeast metabolism. Amino acid and sugar metabolism, the Krebs cycle, and fatty acid profiles were most disrupted, with polar metabolites and short-medium chain fatty acid changes preceding long and very long-chain fatty acid variations. Initial increases in metabolites such as trehalose, proline, and γ-amino butyric acid with a concomitant decrease in metabolites of the Krebs cycle, citrate and fumarate, are interpreted as a cellular attempt to offset oxidative stress in response to mitochondrial dysfunction induced by the treatment. Notably, alanine, inositol, and myristoleic acid showed a steady increase during the period analyzed (2, 4, and 6 h after treatment). Of importance was the finding that edelfosine induced significant alterations in neutral glycerolipid metabolism resulting in a significant increase in the signaling lipid diacylglycerol.

Monitoring of the fermentation media of citric acid by the trimethylsilyl derivatives of the organic acids formed.

PubMed

Ghassempour, Alireza; Nojavan, Saeed; Talebpour, Zahra; Amiri, Ali Asghar; Najafi, Nahid Mashkouri

2004-10-20

In this approach, a derivatization method is described for monitoring of organic acids in fermentation media without any separation step. The aqueous phase of fermentation media was evaporated and heated in a silylation reagent to form trimethylsilyl (TMS) derivatives. The silylated compounds are analyzed by 29Si nuclear magnetic resonance (29Si NMR) and gas chromatography-mass spectrometry (GC-MS). 29Si NMR can qualitatively monitor the components produced in the Krebs cycle. Quantification of these compounds is investigated by using selected ion monitoring mode of mass spectrometry. In this mode, mass to charge (m/z) values of their [M - 15]+ ions, which are 465, 275, 247, 221, 335, 251, and 313 of TMS derivatives of citric, alpha-ketoglutaric, succinic, fumaric, l-malic, oxaloacetic, and palmitic (as an internal standard), acids, respectively, are used. The limit of detection and the linear working range for derivatized citric acid were found to be 0.1 mg L(-1) and 10-3 x 10(4) mg L(-1). The relative standard deviation of the method for five replicates was 2.1%. The average recovery efficiency for citric acid added to culture media was approximately 97.2%. Quantitative results of GC-MS are compared with those obtained by an ultraviolet-visible method. Copyright 2004 American Chemical Society

Biomass-derived monomers for performance-differentiated fiber reinforced polymer composites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rorrer, Nicholas A.; Vardon, Derek R.; Dorgan, John R.

Nearly all polymer resins used to manufacture critically important fiber reinforced polymer (FRP) composites are petroleum sourced. In particular, unsaturated polyesters (UPEs) are widely used as matrix materials and are often based on maleic anhydride, a four-carbon, unsaturated diacid. Typically, maleic anhydride is added as a reactant in a conventional step-growth polymerization to incorporate unsaturation throughout the backbone of the UPE, which is then dissolved in a reactive diluent (styrene is widely used) infused into a fiber mat and cross-linked. Despite widespread historical use, styrene has come under scrutiny due to environmental and health concerns; in addition, many conceivable UPEsmore » are not soluble in styrene. In this study, we demonstrate that renewably-sourced monomers offer the ability to overcome these issues and improve overall composite performance. The properties of poly(butylene succinate)-based UPEs incorporating maleic anhydride are used as a baseline for comparison against UPEs derived from fumaric acid, cis, cis-muconate, and trans, trans-muconate, all of which can be obtained biologically. The resulting biobased UPEs are combined with styrene, methacrylic acid, or a mixture of methacrylic acid and cinnaminic acid, infused into woven fiberglass and cross-linked with the addition of a free-radical initiator and heat. This process produces a series of partially or fully bio-derived composites. Overall, the muconate-containing UPE systems exhibit a more favorable property suite than the maleic anhydride and fumaric acid counterparts. In all cases at the same olefinic monomer loading, the trans, trans-muconate polymers exhibit the highest shear modulus, storage modulus, and glass transition temperature indicating stronger and more thermally resistant materials. They also exhibit the lowest loss modulus indicating a greater adhesion to the glass fibers. The use of a mixture of methacrylic and cinnaminic acid as the reactive diluent results in a FRP composite with properties that can be matched to reinforced composites prepared with styrene. Significantly, at one-third the monomer loading (corresponding to two-thirds the number of double bonds), trans, trans-muconate produces approximately the same storage modulus and glass transition temperature as maleic anhydride, while exhibiting a superior loss modulus. Altogether, this work demonstrates the novel synthesis of performance-differentiated FRP composites using renewably-sourced monomers.« less

Biomass-derived monomers for performance-differentiated fiber reinforced polymer composites

DOE PAGES

Rorrer, Nicholas A.; Vardon, Derek R.; Dorgan, John R.; ...

2017-03-14

Nearly all polymer resins used to manufacture critically important fiber reinforced polymer (FRP) composites are petroleum sourced. In particular, unsaturated polyesters (UPEs) are widely used as matrix materials and are often based on maleic anhydride, a four-carbon, unsaturated diacid. Typically, maleic anhydride is added as a reactant in a conventional step-growth polymerization to incorporate unsaturation throughout the backbone of the UPE, which is then dissolved in a reactive diluent (styrene is widely used) infused into a fiber mat and cross-linked. Despite widespread historical use, styrene has come under scrutiny due to environmental and health concerns; in addition, many conceivable UPEsmore » are not soluble in styrene. In this study, we demonstrate that renewably-sourced monomers offer the ability to overcome these issues and improve overall composite performance. The properties of poly(butylene succinate)-based UPEs incorporating maleic anhydride are used as a baseline for comparison against UPEs derived from fumaric acid, cis, cis-muconate, and trans, trans-muconate, all of which can be obtained biologically. The resulting biobased UPEs are combined with styrene, methacrylic acid, or a mixture of methacrylic acid and cinnaminic acid, infused into woven fiberglass and cross-linked with the addition of a free-radical initiator and heat. This process produces a series of partially or fully bio-derived composites. Overall, the muconate-containing UPE systems exhibit a more favorable property suite than the maleic anhydride and fumaric acid counterparts. In all cases at the same olefinic monomer loading, the trans, trans-muconate polymers exhibit the highest shear modulus, storage modulus, and glass transition temperature indicating stronger and more thermally resistant materials. They also exhibit the lowest loss modulus indicating a greater adhesion to the glass fibers. The use of a mixture of methacrylic and cinnaminic acid as the reactive diluent results in a FRP composite with properties that can be matched to reinforced composites prepared with styrene. Significantly, at one-third the monomer loading (corresponding to two-thirds the number of double bonds), trans, trans-muconate produces approximately the same storage modulus and glass transition temperature as maleic anhydride, while exhibiting a superior loss modulus. Altogether, this work demonstrates the novel synthesis of performance-differentiated FRP composites using renewably-sourced monomers.« less

Metabolism of organic acids, nitrogen and amino acids in chlorotic leaves of 'Honeycrisp' apple (Malus domestica Borkh) with excessive accumulation of carbohydrates.

PubMed

Wang, Huicong; Ma, Fangfang; Cheng, Lailiang

2010-07-01

Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.

Simultaneous Determination of Formoterol Fumarate and Budesonide Epimers in Metered Dose Inhaler Using Ion-Pair Chromatography.

PubMed

Salem, Y A; Shaldam, M A; El-Sherbiny, D T; El-Wasseef, D R; El-Ashry, S M

2017-11-01

A simple, accurate and valid ion-pairing chromatographic method was developed for the simultaneous determination of formoterol fumarate (FF) and budesonide (BUD) epimers in metered dose inhaler. The separation was performed on C-18 column using mobile phase consisting of acetonitrile:0.05 M sodium acetate buffer (40:60% v/v) containing 0.03% sodium dodecyl sulfate adjusted to pH 3.1 using increasing volumes of either TEA or orthophosphoric acid isocratically eluted at 1.0 mL/min. Quantitation was achieved with UV detection at 214 nm. The retention times were 3.22, 6.41 and 6.91 min for formoterol fumarate, budesonide epimers B and A, respectively. The linearity range was 0.05-5.0 μg/mL for formoterol fumarate and 0.5-50.0 μg/mL for budesonide. The method was validated for, linearity; lower limit of quantification, lower limit of detection accuracy and precision. The proposed method is rapid (7 min), reproducible (RSD < 2.0%) and achieves satisfactory resolution between FF and BUD B (resolution factor = 12.07). The mean recoveries of the analytes in metered dose inhaler (99.97 and 99.83% for FF and BUD, respectively) were satisfactory. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Anaplerotic therapy in propionic acidemia.

PubMed

Longo, Nicola; Price, Leisa B; Gappmaier, Eduard; Cantor, Nancy L; Ernst, Sharon L; Bailey, Carrie; Pasquali, Marzia

2017-09-01

Propionic acidemia is a rare metabolic disorder caused by a deficiency of propionyl- CoA carboxylase, the enzyme converting propionyl-CoA to methylmalonyl-CoA that subsequently enters the citric acid cycle as succinyl-CoA. Patients with propionic acidemia cannot metabolize propionic acid, which combines with oxaloacetate to form methylcitric acid. This, with the defective supply of succinyl-CoA, may lead to a deficiency in citric acid cycle intermediates. The objective of this study was to determine whether supplements with glutamine (400mg/kg per day), citrate (7.5mEq/kg per day), or ornithine α-ketoglutarate (400mg/kg per day) (anaplerotic agents that could fill up the citric acid cycle) would affect plasma levels of glutamine and ammonia, the urinary excretion of Krebs cycle intermediates, and the clinical outcome in 3 patients with propionic acidemia. Each supplement was administered daily for four weeks with a two week washout period between supplements. The supplement that produced the most favorable changes was supplemented for 30 weeks following the initial study period and then for a 2 year extension. The urinary excretion of the Krebs cycle intermediates, α-ketoglutarate, succinate, and fumarate increased significantly compared to baseline during citrate supplementation, but not with the other two supplements. For this reason, citrate supplements were continued in the second part of the study. The urinary excretion of methylcitric acid and 3-hydroxypropionic acid did not change with any intervention. No significant changes in ammonia or glutamine levels were observed with any supplement. However, supplementation with any anaplerotic agents normalized the physiological buffering of ammonia by glutamate, with plasma glutamate and alanine levels significantly increasing, rather than decreasing with increasing ammonia levels. No significant side effects were observed with any therapy and safety labs (blood counts, chemistry and thyroid profile) remained unchanged. Motor and cognitive development was severely delayed before the trial and did not change significantly with therapy. Hospitalizations per year did not change during the trial period, but decreased significantly (p<0.05) in the 2years following the study (when citrate was continued) compared to the 2years before and during the study. These results indicate that citrate entered the Krebs cycle providing successful anaplerotic therapy by increasing levels of the downstream intermediates of the Krebs cycle: α-ketoglutarate, succinate and fumarate. Citrate supplements were safe and might have contributed to reduce hospitalizations in patients with propionic acidemia. Copyright © 2017 Elsevier Inc. All rights reserved.

Value of acid metabolic products in identification of certain corynebacteria.

PubMed Central

Reddy, C A; Kao, M

1978-01-01

Acid metabolic products of 23 strains of human and animal pathogenic corynebacteria, representing eight different species, were determined by gas chromatography. The results showed that the species examined were metabolically heterogeneous and could be presumptively identified based on the acid products produced. Corynebacterium equi did not produce any acids; C. renale produced lactate; and C. pyogenes produced major amounts of lactate, variable amounts of acetate, and minor amounts of succinate and pyruvate. C. kutscheri produced propionate and lactate as major products and pyruvate and oxalacetate as minor products. C. diphtheriae and C. pseudotuberculosis produced major amounts of propionate, acetate, and formate. In addition, C. pseudotuberculosis produced major amounts of pyruvate and minor amounts of succinate, lactate, and oxalacetate, whereas C. diphtheriae strains produced minor but variable amounts of lactate, succinate, fumarate, pyruvate, and oxalacetate. C. bovis produced aicd products similar to those of C. pyogenes but was readily distinguishable from the latter by the lack of hemolysis on blood agar, colony morphology, catalase reaction, and biochemicals. C. suis characteristically produced major amounts of ethanol, acetate, and formate and minor amounts of lactate and succinate but no propionate. PMID:96126

Non-volatile taste components of several cultivated mushrooms.

PubMed

Li, Wen; Gu, Zhen; Yang, Yan; Zhou, Shuai; Liu, Yanfang; Zhang, Jingsong

2014-01-15

Five species of dried mushrooms are commercially available in China, namely Agrocybe cylindracea, Pleurotus cystidiosus, Agaricus blazei, Pleurotus eryngii, and Coprinus comatus, and their nonvolatile taste components were studied. Trehalose (12.23-301.63mg/g) and mannitol (12.37-152.11mg/g) were considered as the major mushroom sugar/polyol in the five test species. The total free amino acid levels ranged from 4.09 to 22.73mg/g. MSG-like components contents ranged from 0.97 to 4.99mg/g. 5'-Nucleotide levels ranged from 1.68mg/g in P. eryngii to 3.79mg/g in C. comatus. Fumaric acid (96.11mg/g) in P. cystidiosus were significantly higher compared with the other mushrooms, and citric acid (113.13mg/g), as the highest of any organic acid among the five mushrooms, were found in A. blazei. Equivalent umami concentrations values in these five test mushrooms ranged from 11.19 to 88.37g/100g dry weight. A. blazei, C.comatus and A. cylindracea possessed highly strong umami taste. Copyright © 2013 Elsevier Ltd. All rights reserved.

Phenotypic and genomic survey on organic acid utilization profile of Pseudomonas mendocina strain S5.2, a vineyard soil isolate.

PubMed

Chong, Teik Min; Chen, Jian-Woon; See-Too, Wah-Seng; Yu, Choo-Yee; Ang, Geik-Yong; Lim, Yan Lue; Yin, Wai-Fong; Grandclément, Catherine; Faure, Denis; Dessaux, Yves; Chan, Kok-Gan

2017-12-01

Root exudates are chemical compounds that are released from living plant roots and provide significant energy, carbon, nitrogen and phosphorus sources for microbes inhabiting the rhizosphere. The exudates shape the microflora associated with the plant, as well as influences the plant health and productivity. Therefore, a better understanding of the trophic link that is established between the plant and the associated bacteria is necessary. In this study, a comprehensive survey on the utilization of grapevine and rootstock related organic acids were conducted on a vineyard soil isolate which is Pseudomonas mendocina strain S5.2. Phenotype microarray analysis has demonstrated that this strain can utilize several organic acids including lactic acid, succinic acid, malic acid, citric acid and fumaric acid as sole growth substrates. Complete genome analysis using single molecule real-time technology revealed that the genome consists of a 5,120,146 bp circular chromosome and a 252,328 bp megaplasmid. A series of genetic determinants associated with the carbon utilization signature of the strain were subsequently identified in the chromosome. Of note, the coexistence of genes encoding several iron-sulfur cluster independent isoenzymes in the genome indicated the importance of these enzymes in the events of iron deficiency. Synteny and comparative analysis have also unraveled the unique features of D-lactate dehydrogenase of strain S5.2 in the study. Collective information of this work has provided insights on the metabolic role of this strain in vineyard soil rhizosphere.

Chemical characteristics of dicarboxylic acids and related organic compounds in PM2.5 during biomass-burning and non-biomass-burning seasons at a rural site of Northeast China.

PubMed

Cao, Fang; Zhang, Shi-Chun; Kawamura, Kimitaka; Liu, Xiaoyan; Yang, Chi; Xu, Zufei; Fan, Meiyi; Zhang, Wenqi; Bao, Mengying; Chang, Yunhua; Song, Wenhuai; Liu, Shoudong; Lee, Xuhui; Li, Jun; Zhang, Gan; Zhang, Yan-Lin

2017-12-01

Fine particulate matter (PM2.5) samples were collected using a high-volume air sampler and pre-combusted quartz filters during May 2013 to January 2014 at a background rural site (47 ∘ 35 N, 133 ∘ 31 E) in Sanjiang Plain, Northeast China. A homologous series of dicarboxylic acids (C 2 -C 11 ) and related compounds (oxoacids, α-dicarbonyls and fatty acids) were analyzed by using a gas chromatography (GC) and GC-MS method employing a dibutyl ester derivatization technique. Intensively open biomass-burning (BB) episodes during the harvest season in fall were characterized by high mass concentrations of PM2.5, dicarboxylic acids and levoglucosan. During the BB period, mass concentrations of dicarboxylic acids and related compounds were increased by up to >20 times with different factors for different organic compounds (i.e., succinic (C 4 ) acid > oxalic (C 2 ) acid > malonic (C 3 ) acid). High concentrations were also found for their possible precursors such as glyoxylic acid (ωC 2 ), 4-oxobutanoic acid, pyruvic acid, glyoxal, and methylglyoxal as well as fatty acids. Levoglucosan showed strong correlations with carbonaceous aerosols (OC, EC, WSOC) and dicarboxylic acids although such good correlations were not observed during non-biomass-burning seasons. Our results clearly demonstrate biomass burning emissions are very important contributors to dicarboxylic acids and related compounds. The selected ratios (e.g., C 3 /C 4 , maleic acid/fumaric acid, C 2 /ωC 2 , and C 2 /levoglucosan) were used as tracers for secondary formation of organic aerosols and their aging process. Our results indicate that organic aerosols from biomass burning in this study are fresh without substantial aging or secondary production. The present chemical characteristics of organic compounds in biomass-burning emissions are very important for better understanding the impacts of biomass burning on the atmosphere aerosols. Copyright © 2017 Elsevier Ltd. All rights reserved.

The Path of Carbon in Photosynthesis VII. Respiration and Photosynthesis

DOE R&D Accomplishments Database

Benson, A. A.; Calvin, M.

1949-07-21

The relationship of respiration to photosynthesis in barley seedling leaves and the algae, Chlorella and Scenedesmus, has been investigated using radioactive carbon dioxide and the techniques of paper chromatography and radioautography. The plants are allowed to photosynthesize normally for thirty seconds in c{sup 14}O{sub 2} after which they are allowed to respire in air or helium in the light or dark. Respiration of photosynthetic intermediates as evidenced by the appearance of labeled glutomic, isocitric, fumaric and succinic acids is slower in the light than in the dark. Labeled glycolic acid is observed in barley and algae. It disappears rapidly in the dark and is maintained and increased in quantity in the light in C0{sub 2}-free air.

L-Asparaginase Production by the Rumen Anaerobe Vibrio succinogenes

PubMed Central

Kafkewitz, David; Goodman, David

1974-01-01

The rumen anaerobe Vibrio succinogenes possesses a constitutive L-asparaginase. The amount of enzyme produced is affected by the compound supplied to the organism to generate the fumaric acid it requires as a terminal electron acceptor. When nitrate is provided as the terminal electron acceptor, the amount of enzyme produced is affected by the compound provided to satisfy the nutritional requirement of the organism for succinic acid. Specific activities of up to 8.4 IU/mg of protein in cell-free extracts have been obtained. This specific activity is higher than has been previously reported for any organism. The enzyme has an apparent Km of 1.7 × 10-5 M and low activity towards L-glutamine when assayed at pH 8.5. PMID:4855647

Nutritional or pharmacological activation of HCA(2) ameliorates neuroinflammation.

PubMed

Offermanns, Stefan; Schwaninger, Markus

2015-04-01

Neuroinflammation is a pathology common to many neurological diseases, including multiple sclerosis (MS) and stroke. However, therapeutic attempts to modulate neuroinflammation have proved difficult. Neuroinflammatory cells express HCA2, a receptor for the endogenous neuroprotective ketone body β-hydroxybutyrate (BHB) as well as for the drugs dimethyl fumarate (DMF) and nicotinic acid, which have established efficacy in the treatment of MS and experimental stroke, respectively. This review summarizes the evidence that HCA2 is involved in the therapeutic effects of DMF, nicotinic acid, and ketone bodies in reducing neuroinflammation. Furthermore, we discuss the mechanisms underlying the beneficial effects of HCA2 activation in neuroinflammatory diseases and the therapeutic potential of recently developed synthetic ligands of HCA2. Copyright © 2015 Elsevier Ltd. All rights reserved.

Geobiology of Marine Magnetotactic Bacteria

DTIC Science & Technology

2006-06-01

acids (e.g. lactate, acetate, oxalate , succinate, fumarate, malate, and citrate) which are continually transported into the soil, in part due to the...microbial mats, and hydrothermal vent waters. J Environ Monit 3: 61-66. 177 Lyons TW (1997) Sulfur isotopic trends and pathways of iron sulfide formation in...case in sediments, microbial mats, and hydrothermal vent waters. J Environ Monit 3: 61-66. 200 O’Sullivan DW, Hanson Jr AK, Kester DR (1997) The

Desulfosporosinus acididurans sp. nov.: an acidophilic sulfate-reducing bacterium isolated from acidic sediments.

PubMed

Sánchez-Andrea, Irene; Stams, Alfons J M; Hedrich, Sabrina; Ňancucheo, Ivan; Johnson, D Barrie

2015-01-01

Three strains of sulfate-reducing bacteria (M1(T), D, and E) were isolated from acidic sediments (White river and Tinto river) and characterized phylogenetically and physiologically. All three strains were obligately anaerobic, mesophilic, spore-forming straight rods, stained Gram-negative and displayed variable motility during active growth. The pH range for growth was 3.8-7.0, with an optimum at pH 5.5. The temperature range for growth was 15-40 °C, with an optimum at 30 °C. Strains M1(T), D, and E used a wide range of electron donors and acceptors, with certain variability within the different strains. The nominated type strain (M1(T)) used ferric iron, nitrate, sulfate, elemental sulfur, and thiosulfate (but not arsenate, sulfite, or fumarate) as electron acceptors, and organic acids (formate, lactate, butyrate, fumarate, malate, and pyruvate), alcohols (glycerol, methanol, and ethanol), yeast extract, and sugars (xylose, glucose, and fructose) as electron donors. It also fermented some substrates such as pyruvate and formate. Strain M1(T) tolerated up to 50 mM ferrous iron and 10 mM aluminum, but was inhibited by 1 mM copper. On the basis of phenotypic, phylogenetic, and genetic characteristics, strains M1(T), D, and E represent a novel species within the genus Desulfosporosinus, for which the name Desulfosporosinus acididurans sp. nov. is proposed. The type strain is M1(T) (=DSM 27692(T) = JCM 19471(T)). Strain M1(T) was the first acidophilic SRB isolated, and it is the third described species of acidophilic SRB besides Desulfosporosinus acidiphilus and Thermodesulfobium narugense.

UV and γ-ray resistance of poly(N-methylmaleimide-alt-isobutene) and poly(diisopropyl fumarate) as transparent polymer films

NASA Astrophysics Data System (ADS)

Imaizumi, Ryota; Furuta, Masakazu; Okamura, Haruyuki; Matsumoto, Akikazu

2017-09-01

UV and γ-ray resistance of transparent polymers obtained by radical polymerization of maleic and fumaric acid derivatives, i.e., an alternating copolymer of N-methylmaleimide and isobutene (PMI) and poly(diisopropyl fumarate) (PDiPF), was investigated. Transmittance in UV and visible regions of these polymers were examined after UV irradiation and compared with the results for poly(methyl methacrylate) (PMMA) and polycarbonate (PC) as conventional transparent polymers. The order of stability toward UV irradiation was PMMA≈PDiPF>PMI>>PC, deduced from changes in the transmittance of 380 nm light. Tensile mechanical properties, such as elastic modulus, maximum strength, and elongation values of PMI, PDiPF, and PMMA were also investigated after UV and γ-radiation. UV irradiation induced the side chain scission of PMI and PDiPF via Norrish I type reaction as well as crosslinking by combination between formed polymer radicals, leading to deterioration in their optical and mechanical properties. γ-radiation induced significant changes in molecular weight and mechanical properties of the polymers. In conclusion, PMI exhibited unchanged mechanical properties and PDiPF maintained its high transparency under various irradiation conditions.

Contribution of the tricarboxylic acid (TCA) cycle and the glyoxylate shunt in Saccharomyces cerevisiae to succinic acid production during dough fermentation.

PubMed

Rezaei, Mohammad N; Aslankoohi, Elham; Verstrepen, Kevin J; Courtin, Christophe M

2015-07-02

Succinic acid produced by yeast during bread dough fermentation can significantly affect the rheological properties of the dough. By introducing mutations in the model S288C yeast strain, we show that the oxidative pathway of the TCA cycle and the glyoxylate shunt contribute significantly to succinic acid production during dough fermentation. More specifically, deletion of ACO1 and double deletion of ACO1 and ICL1 resulted in a 36 and 77% decrease in succinic acid levels in fermented dough, respectively. Similarly, double deletion of IDH1 and IDP1 decreased succinic acid production by 85%, while also affecting the fermentation rate. By contrast, double deletion of SDH1 and SDH2 resulted in a two-fold higher succinic acid accumulation compared to the wild-type. Deletion of fumarate reductase activity (FRD1 and OSM1) in the reductive pathway of the TCA cycle did not affect the fermentation rate and succinic acid production. The changes in the levels of succinic acid produced by mutants Δidh1Δidp1 (low level) and Δsdh1Δsdh2 (high level) in fermented dough only resulted in small pH differences, reflecting the buffering capacity of dough at a pH of around 5.1. Moreover, Rheofermentometer analysis using these mutants revealed no difference in maximum dough height and gas retention capacity with the dough prepared with S288C. The impact of the changed succinic acid profile on the organoleptic or antimicrobial properties of bread remains to be demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.

Organic acids, sugars, vitamin C content and some pomological characteristics of eleven hawthorn species (Crataegus spp.) from Turkey.

PubMed

Gundogdu, Muttalip; Ozrenk, Koray; Ercisli, Sezai; Kan, Tuncay; Kodad, Ossama; Hegedus, Attila

2014-05-30

The Hawthorn (Crateagus sp.) mostly occurs around the temperate region of the world with a high number of species, producing a fruit with numerous beneficial effects for human health. The aim of the study was to determine organic acid and sugar contents in the fruit of a number of hawthorn species grown in Erzincan province of Turkey. Citric acid was the predominant organic acid in all hawthorn species and C. pseudoheterophylla had the highest citric acid content (23.688 g/100 g). There were not statistically significant differences among hawthorn species (except C. atrosanguinea Pojark) in terms of fumaric acid content. C.pontica C.Koch had a higher content of vitamin C (9.418 mg/100 g) compared to other species. Fructose was the predominant sugar component in all species and C. monogyna subsp. monogyna Joiq had the highest fructose content (18.378 g/100 g). The high fruit quality of the studied species indicates the importance of this fruit in human nutrition as a natural source. The study revealed that there were differences in terms of fruit characteristics among hawthorn species and thus better quality hawthorn genotypes can be selected within the species. Hence, this study is considered to be a valuable reference for forthcoming studies. The high fruit quality of the studied species indicates the importance of this fruit in human nutrition as a natural source.

Growth yields and fermentation balance of Bacteroides fragilis cultured in glucose-enriched medium.

PubMed

Frantz, J C; McCallum, R E

1979-03-01

Bacteroides fragilis is an obligate anaerobic bacterium classified with the gram-negative, non-sporeforming bacilli and is the Bacteroides species most frequently isolated from human infections. In the present study, experiments were designed to investigate growth characteristics of B. fragilis in a complex medium. In a minimal defined medium, which was employed for comparison purposes, B. fragilis grew with a generation time of 2 h. Growth of the organism in glucose-enriched medium used in the present study was superior. Maximum generation time was 60 min. Total and viable cells (colony-forming units) were 8.9 x 10(9) and 2.1 x 10(9), respectively, at maximum measurable growth. The molar growth yield (Ym) was 51.5. Growth yields were found to reach a maximum 2 to 3 h before maximum growth and to vary with respect to the phase of growth. Estimates of the fermentation products indicated that glucose was the sole energy substrate. Major products included acetic acid, propionic acid, lactic acid, and succinic acid. Other products included ethyl alcohol, pyruvic acid, and fumaric acid. No attempt was made to recover CO2 or formic acid. The OR balances from two experiments were 0.013 and -0.093 and the respective carbon recoveries were 6.268 and 6.241. The results of the present study show that B. fragilis is capable of rapid rates of growth in vitro by using glucose as the sole energy source.

Effect of an acid filler on hydrolysis and biodegradation of poly-lactic acid (PLA)

NASA Astrophysics Data System (ADS)

Iozzino, Valentina; Speranza, Vito; Pantani, Roberto

2015-12-01

The use of biodegradable polymers is certainly an excellent strategy to solve many of the problems related to the disposal of the traditional polymers, whose accumulation in the environment is harmful and damaging. In order to optimize the use of biodegradable polymers, it is very important to understand and control the transformation processes, the structures and the morphologies resulting from the process conditions used to produce the articles and, not least, the biodegradation. The latter is strictly dependent on the just mentioned variables. The poly-lactic acid, PLA, is a biodegradable polymer. Many studies have been carried out on the degradation process of this polymer. In the course of this work we performed degradation tests on the PLA, with a specific D-isomer content, having amorphous structure, and in particular of biodegradation and hydrolysis. An acid chemical, fumaric acid, was added to PLA with the objective of controlling the rate of hydrolysis and of biodegradation. The hydrolysis process was followed, as function of time, by means of different techniques: pH variation, variation of weight of samples and variation of crystallinity degree and glass transition temperature using DSC analysis. The samples were also analyzed in terms of biodegradability by means of a homemade respirometer apparatus, in controlled composting conditions.

Vonoprazan fumarate, a novel potassium-competitive acid blocker, in the management of gastroesophageal reflux disease: safety and clinical evidence to date

PubMed Central

Sugano, Kentaro

2018-01-01

Potassium-competitive acid blocker (P-CAB) is a class of drug that competitively blocks the potassium-binding site of H+, K+-adenosine triphosphate (ATP)ase. Although the history of this class of drugs started over 30 years ago, clinical use of two P-CABs, revaprazan and vonoprazan, were only recently approved in Korea and Japan, respectively. Among them, vonoprazan has several advantages over conventional proton-pump inhibitors (PPIs), including rapid onset of action, long duration of acid suppression, fewer interindividual variations in terms of acid suppression, and minimum dietary influence on its action. These advantages of vonoprazan have been proved in clinical trials conducted for license approvals for several acid-related diseases. In this review article, current evidence of vonoprazan in the management of gastroesophageal reflux disease (GERD) will be summarized. Since the clinical trial data, as well as postmarketed clinical data, have consistently demonstrated superiority of vonoprazan over conventional PPIs in terms of achieving healing of mucosal breaks and maintaining the healing, it may provide an excellent, if not complete, option for fulfilling some of the unmet needs for current GERD therapy. The safety problem of vonoprazan is also discussed, as more pronounced hypergastrinemia inevitably ensues with its use. PMID:29383028

A fermentative approach towards optimizing directed biosynthesis of fumaric acid by Rhizopus oryzae 1526 utilizing apple industry waste biomass.

PubMed

Das, Ratul Kumar; Brar, Satinder Kaur; Verma, Mausam

2015-12-01

The present research account deals with the bioproduction of fumaric acid (FA) from apple pomace ultrafiltration sludge (APUS) and apple pomace (AP) through fermentation. The filamentous fungus Rhizopus oryzae 1526 was used as a biocatalyst and its morphological impact on FA production was analysed in detail. For submerged fermentation, 40 g L(-1) of total solids concentration of APUS, pH 6.0, 30 °C, 200 rpm flask shaking speed and 72 h of incubation were found to be optimum for FA production (25.2 ± 1.0 g L(-1), 0.350 g (L(-1) h(-1))). Broth viscosity (cP), residual reducing sugar (g L(-1)) and ethanol (g L(-1)) produced as by-product, were also analysed. Plastic trays were used for solid state fermentation and at optimized level of moisture and incubation period, 52 ± 2.67 g FA per kg dry weight of AP was obtained. Changes in the total phenolic content (mg g(-1) dry weight of AP) were monitored at regular intervals. Utilization of APUS and AP for the directed synthesis of the high-value platform chemical FA by the fungal strain R. oryzae 1526 was an excellent display of fungal physiological and morphological control over a fermentative product. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Gateways to Clinical Trials.

PubMed

Bayés, M; Rabasseda, X; Prous, J R

2002-09-01

Gateways to Clinical Trials is a guide to the most recent clinical trials in current literature and congresses. The data in the following tables has been retrieved from the Clinical Studies knowledge area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: Adalimumab, aeroDose insulin inhaler, agomelatine, alendronic acid sodium salt, aliskiren fumarate, alteplase, amlodipine, aspirin, atazanavir; Bacillus Calmette-Guérin, basiliximab, BQ-788, bupropion hydrochloride; Cabergoline, caffeine citrate, carbamazepine, carvedilol, celecoxib, cyclosporine, clopidogrel hydrogensulfate, colestyramine; Dexamethasone, diclofenac sodium, digoxin, dipyridamole, docetaxel, dutasteride; Eletriptan, enfuvirtidie, eplerenone, ergotamine tartrate, esomeprazole magnesium, estramustine phosphate sodium; Finasteride, fluticasone propionate, fosinopril sodium; Ganciclovir, GBE-761-ONC, glatiramer acetate, gliclazide, granulocyte-CSF; Heparin sodium, human isophane insulin (pyr), Hydrochlorothiazide; Ibuprofen, inhaled insulin, interferon alfa, interferon beta-1a; Laminvudine, lansoprazole, lisinopril, lonafarnib, losartan potassium, lumiracoxib; MAb G250, meloxicam methotrexate, methylprednisolone aceponate, mitomycin, mycophenolate mofetil; Naproxen sodium, natalizumab, nelfinavir mesilate, nemifitide ditriflutate, nimesulide; Omalizumab, omapatrilat, omeprazole, oxybutynin chloride; Pantoprazole sodium, paracetamol, paroxetine, pentoxifylline, pergolide mesylate, permixon, phVEGF-A165, pramipexole hydrochloride, prasterone, prednisone, probucol, propiverine hydrochloride; Rabeprazole sodium, resiniferatoxin, risedronate sodium, risperidone, rofecoxib rosiglitazone maleate, ruboxistaurin mesilate hydrate; Selegiline transdermal system, sertraline, sildenafil citrate, streptokinase; Tadalafil, tamsulosin hydrochloride, technosphere/Insulin, tegaserod maleate, tenofovir disoproxil fumarate, testosterone heptanoate, testosterone undecanoate, tipifarnib, tolterodine tartrate, topiramate, troglitazone; Ursodeoxycholic acid; Valdecoxib, valsartan, vardenafil, venlafaxine hydrochloride, VX-745.

Crystal Structures and Phase Relationships of 2 Polymorphs of 1,4-Diazabicyclo[3.2.2]nonane-4-Carboxylic Acid 4-Bromophenyl Ester Fumarate, A Selective α-7 Nicotinic Receptor Partial Agonist.

PubMed

Robert, Benoît; Perrin, Marc-Antoine; Barrio, Maria; Tamarit, Josep-Lluis; Coquerel, Gérard; Ceolin, René; Rietveld, Ivo B

2016-01-01

Two polymorphs of the 1:1 fumarate salt of 1,4-diazabicyclo[3.2.2]nonane-4-carboxylic acid 4-bromophenyl ester, developed for the treatment of cognitive symptoms of schizophrenia and Alzheimer disease, have been characterized. The 2 crystal structures have been solved, and their phase relationships have been established. The space group of form I is P2₁/c with a unit-cell volume of 1811.6 (5) Å(3) with Z = 4. The crystals of form I were 2-component nonmerohedral twins. The space group of form II is P2₁/n with a unit-cell volume of 1818.6 (3) Å(3) with Z = 4. Relative stabilities have been inferred from experimental and topological P-T diagrams exhibiting an overall enantiotropic relationship between forms I and II although the solid-solid transition has never been observed. The slope of the I-II equilibrium in the P-T diagram is negative, form II is the stable phase below the solid-solid transition temperature of 371 K, and form I exhibits a stable melting equilibrium. The I-II transition temperature has been obtained from the intersection of the sublimation curves of the 2 solid forms. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Determination of low-molecular-weight organic acids in non-small cell lung cancer with a new liquid chromatography-tandem mass spectrometry method.

PubMed

Klupczynska, Agnieszka; Plewa, Szymon; Dyszkiewicz, Wojciech; Kasprzyk, Mariusz; Sytek, Natalia; Kokot, Zenon J

2016-09-10

As compared to other classes of metabolites, determination of organic acids is an underrepresented field in cancer research and till now there has been a lack of appropriate analytical procedure for determination of serum levels of organic acids potentially associated with cancer development. The aim of the study was to develop a new rapid liquid chromatography-tandem mass spectrometry method for the quantification of six low-molecular-weight organic acids in human serum and to apply this method in an analysis of samples collected from non-small cell lung cancer (NSCLC) patients and a matched control group. The samples were prepared by solid phase extraction (Clean-up CUQAX, UCT). Chromatography was conducted on a Synergi Hydro-RP column (Phenomenex) and a gradient run of 15min. Detection was performed using a negative multiple reaction monitoring mode. The calibration ranges were as follows: 0.24-38.42μmol/L for 2-hydroxybutyric acid, 0.09-17.23μmol/L for fumaric acid, 0.08-15.13μmol/L for glutaric acid, 0.11-2.22mmol/L for lactic acid, 0.39-30.98μmol/L for pyroglutamic acid, and 0.08-16.93μmol/L for succinic acid. Mean relative recovery range was 85.99-114.42% and the determined intra- and inter day coefficients of variation were ≤14%. Among the studied acids, pyroglutamic acid showed the best discriminating potential and enabled to identify accurately NSCLC patients and control subjects regardless of the cancer stage. Further investigations of serum organic acids may allow us to better understand the underlying mechanisms involved in NSCLC and develop novel means of its detection and treatment. The developed method may be also a valuable tool to study metabolic changes associated with other types of cancer. Copyright © 2016 Elsevier B.V. All rights reserved.

Effects of different culture conditions on biological potential and metabolites production in three Penicillium isolates.

PubMed

Reis, Filipa S; Ćirić, Ana; Stojković, Dejan; Barros, Lillian; Ljaljević-Grbić, Milica; Soković, Marina; Ferreira, Isabel C F R

2015-02-01

The genus Penicillium is well known for its importance in drug and food production. Certain species are produced on an industrial scale for the production of antibiotics (e.g. penicillin) or for insertion in food (e.g. cheese). In the present work, three Penicillium species, part of the natural mycobiota growing on various food products were selected - P. ochrochloron, P. funiculosum and P. verrucosum var. cyclopium. The objective of our study was to value these species from the point of view of production of bioactive metabolites. The species were obtained after inoculation and growth in Czapek and Malt media. Both mycelia and culture media were analyzed to monitor the production of different metabolites by each fungus and their release to the culture medium. The concentrations of sugars, organic acids, phenolic acids and tocopherols were determined. Antioxidant activity of the phenolic extracts was evaluated, as also the antimicrobial activity of phenolic acids, organic acids and tocopherols extracts. Rhamnose, xylose, fructose and trehalose were found in all the mycelia and culture media; the prevailing organic acids were oxalic and fumaric acids, and protocatechuic and p-hydroxybenzoic acids were the most common phenolic acids; γ-tocopherol was the most abundant vitamin E isoform. Generally, the phenolic extracts corresponding to the mycelia samples revealed higher antioxidant activity. Concerning the antimicrobial activity there were some fluctuations, however all the studied species revealed activity against the tested strains. Therefore, the in-vitro bioprocesses can be an alternative for the production of bioactive metabolites that can be used by pharmaceutical industry.

Unsaturated fatty acids show clear elicitation responses in a modified local lymph node assay with an elicitation phase, and test positive in the direct peptide reactivity assay.

PubMed

Yamashita, Kunihiko; Shinoda, Shinsuke; Hagiwara, Saori; Miyazaki, Hiroshi; Itagaki, Hiroshi

2015-12-01

The Organisation for Economic Co-operation and Development (OECD) Test Guidelines (TG) adopted the murine local lymph node assay (LLNA) and guinea pig maximization test (GPMT) as stand-alone skin sensitization test methods. However, unsaturated carbon-carbon double-bond and/or lipid acids afforded false-positive results more frequently in the LLNA compared to those in the GPMT and/or in human subjects. In the current study, oleic, linoleic, linolenic, undecylenic, fumaric, maleic, and succinic acid and squalene were tested in a modified LLNA with an elicitation phase (LLNA:DAE), and in a direct peptide reactivity assay (DPRA) to evaluate their skin-sensitizing potential. Oleic, linoleic, linolenic, undecylenic and maleic acid were positive in the LLNA:DAE, of which three, linoleic, linolenic, and maleic acid were positive in the DPRA. Furthermore, the results of the cross-sensitizing tests using four LLNA:DAE-positive chemicals were negative, indicating a chemical-specific elicitation response. In a previous report, the estimated concentration needed to produce a stimulation index of 3 (EC3) of linolenic acid, squalene, and maleic acid in the LLNA was < 10%. Therefore, these chemicals were classified as moderate skin sensitizers in the LLNA. However, the skin-sensitizing potential of all LLNA:DAE-positive chemicals was estimated as weak. These results suggested that oleic, linoleic, linolenic, undecylenic, and maleic acid had skin-sensitizing potential, and that the LLNA overestimated the skin-sensitizing potential compared to that estimated by the LLNA:DAE.

Mineral and metabolic profiles in tea leaves and flowers during flower development.

PubMed

Jia, Sisi; Wang, Yu; Hu, Jianhui; Ding, Zhaotang; Liang, Qing; Zhang, Yinfei; Wang, Hui

2016-09-01

Tea [Camellia sinensis (L.) O. Kuntze] is one of the most popular non-alcoholic beverage crops in the world, and the physiological processes and gene regulations involved in development in tea plants have been well characterized. However, relatively little is known about the metabolic changes combined with mineral distributions that occur during flower development. Here we detected the contents of 11 elements in tea leaves and flowers and found that, some of them, especially phosphorus, sulfur and copper, showed significant changes during tea flowering. We also detected 122 metabolites in tea leaves and flowers and found that, 72 of them showed significant differences between flowers and leaves, of which sugars, organic acids, and flavonoids dominated. The sugars, such as trehalose and galactose, all accumulated in tea flowers, and the organic acids, such as malic acid, citric acid and fumaric acid involved in TCA cycle. The flavonoids, like epicatechin, catechin gallate and epigallocatechin, were more abundant in leaves. Furthermore, we found that the contents of 33 metabolites changed during the development of flowers. Especially, citric acid, phenylalanine and most flavonoids decreased while fructose and galactose increased during flowering stages in flowers. We also analyzed the correlations between the ions and metabolites and found that, some mineral nutrients including phosphorus, sulfur, manganese and zinc had close relations to organic acids, flavonoids, sugars and several amino acids during flowering. We mapped the metabolic pathway according to the KEGG database. This work will serve as the foundation for a systems biology approach to the understanding of mineral metabolism. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Occurrence of Polyphenols, Organic Acids, and Sugars among Diverse Elderberry Genotypes Grown in Three Missouri (USA) Locations

PubMed Central

Thomas, A.L.; Byers, P.L.; Gu, S.; Avery, J.D.; Kaps, M.; Datta, A.; Fernando, L.; Grossi, P.; Rottinghaus, G.E.

2016-01-01

Elderberry (Sambucus spp.) is an emerging horticultural crop used in a variety of foods, wines, and dietary supplements. A better understanding of the elderberry juice complex including its putative health-promoting compounds in relation to genetic and environmental parameters is needed. A multi-location planting of nine elderberry genotypes was established in 2008 at three geographically-diverse sites in Missouri, USA. Fruits were harvested from replicated plots 2009-2011, frozen, and later prepared for laboratory analysis. Polyphenols, organic acids, and sugars were quantified by HPLC and the results evaluated for response to genotype, site, and year. The American genotypes ‘Ocoee’ and ‘Ozark’ were consistently higher in chlorogenic acids compared to other genotypes, whereas ‘Ocoee’ was significantly higher in rutin than ‘Ozark’. The European ‘Marge’ was significantly higher in isoquercitrin and other flavonoids compared to most North American genotypes. Significant differences in polyphenols were also detected among sites and production years. Malic, citric, and tartaric acids varied significantly among genotypes, sites, and years, whereas succinic, shikimic, and fumaric acids generally did not. Levels of lactic, acetic, and propionic acids were negligible in most samples. The American genotype ‘Ocoee’ was higher in citric and tartaric acids, while lower in malic acid. The sugars glucose and fructose also responded significantly to genotype, site, and year. ‘Ocoee’, ‘Ozark’, and ‘Marge’ perform very well in Missouri horticulturally and appear to have additional potential as cultivars based on their unique juice characteristics. PMID:27156707

Degradation of clofibric acid in acidic aqueous medium by electro-Fenton and photoelectro-Fenton.

PubMed

Sirés, Ignasi; Arias, Conchita; Cabot, Pere Lluís; Centellas, Francesc; Garrido, José Antonio; Rodríguez, Rosa María; Brillas, Enric

2007-01-01

Acidic aqueous solutions of clofibric acid (2-(4-chlorophenoxy)-2-methylpropionic acid), the bioactive metabolite of various lipid-regulating drugs, have been degraded by indirect electrooxidation methods such as electro-Fenton and photoelectro-Fenton with Fe(2+) as catalyst using an undivided electrolytic cell with a Pt anode and an O(2)-diffusion cathode able to electrogenerate H(2)O(2). At pH 3.0 about 80% of mineralization is achieved with the electro-Fenton method due to the efficient production of oxidant hydroxyl radical from Fenton's reaction between Fe(2+) and H(2)O(2), but stable Fe(3+) complexes are formed. The photoelectro-Fenton method favors the photodecomposition of these species under UVA irradiation, reaching more than 96% of decontamination. The mineralization current efficiency increases with rising metabolite concentration up to saturation and with decreasing current density. The photoelectro-Fenton method is then viable for treating acidic wastewaters containing this pollutant. Comparative degradation by anodic oxidation (without Fe(2+)) yields poor decontamination. Chloride ion is released during all degradation processes. The decay kinetics of clofibric acid always follows a pseudo-first-order reaction, with a similar rate constant in electro-Fenton and photoelectro-Fenton that increases with rising current density, but decreases at greater metabolite concentration. 4-Chlorophenol, 4-chlorocatechol, 4-chlororesorcinol, hydroquinone, p-benzoquinone and 1,2,4-benzenetriol, along with carboxylic acids such as 2-hydroxyisobutyric, tartronic, maleic, fumaric, formic and oxalic, are detected as intermediates. The ultimate product is oxalic acid, which forms very stable Fe(3+)-oxalato complexes under electro-Fenton conditions. These complexes are efficiently photodecarboxylated in photoelectro-Fenton under the action of UVA light.

Salt and cocrystals of sildenafil with dicarboxylic acids: solubility and pharmacokinetic advantage of the glutarate salt.

PubMed

Sanphui, Palash; Tothadi, Srinu; Ganguly, Somnath; Desiraju, Gautam R

2013-12-02

Sildenafil is a drug used to treat erectile dysfunction and pulmonary arterial hypertension. Because of poor aqueous solubility of the drug, the citrate salt, with improved solubility and pharmacokinetics, has been marketed. However, the citrate salt requires an hour to reach its peak plasma concentration. Thus, to improve solubility and bioavailability characteristics, cocrystals and salts of the drug have been prepared by treating aliphatic dicarboxylic acids with sildenafil; the N-methylated piperazine of the drug molecule interacts with the carboxyl group of the acid to form a heterosynthon. Salts are formed with oxalic and fumaric acid; salt monoanions are formed with succinic and glutaric acid. Sildenafil forms cocrystals with longer chain dicarboxylic acids such as adipic, pimelic, suberic, and sebacic acids. Auxiliary stabilization via C-H···O interactions is also present in these cocrystals and salts. Solubility experiments of sildenafil cocrystal/salts were carried out in 0.1N HCl aqueous medium and compared with the solubility of the citrate salt. The glutarate salt and pimelic acid cocrystal dissolve faster than the citrate salt in a two hour dissolution experiment. The glutarate salt exhibits improved solubility (3.2-fold) compared to the citrate salt in water. Solubilities of the binary salts follow an inverse correlation with their melting points, while the solubilities of the cocrystals follow solubilities of the coformer. Pharmacokinetic studies on rats showed that the glutarate salt exhibits doubled plasma AUC values in a single dose within an hour compared to the citrate salt. The high solubility of glutaric acid, in part originating from the strained conformation of the molecule and its high permeability, may be the reason for higher plasma levels of the drug.

Acidification of apple and orange hosts by Penicillium digitatum and Penicillium expansum.

PubMed

Vilanova, L; Viñas, I; Torres, R; Usall, J; Buron-Moles, G; Teixidó, N

2014-05-16

New information about virulence mechanisms of Penicillium digitatum and Penicillium expansum could be an important avenue to control fungal diseases. In this study, the ability of P. digitatum and P. expansum to enhance their virulence by locally modulating the pH of oranges and apples was evaluated. For each host, pH changes with a compatible pathogen and a non-host pathogen were recorded, and the levels of different organic acids were evaluated to establish possible relationships with host pH modifications. Moreover, fruits were harvested at three maturity stages to determine whether fruit maturity could affect the pathogens' virulence. The pH of oranges and apples decreased when the compatible pathogens (P. digitatum and P. expansum, respectively) decayed the fruit. The main organic acid detected in P. digitatum-decayed oranges was galacturonic acid produced as a consequence of host maceration in the rot development process. However, the obtained results showed that this acid was not responsible for the pH decrease in decayed orange tissue. The mixture of malic and citric acids could at least contribute to the acidification of P. digitatum-decayed oranges. The pH decrease in P. expansum decayed apples is related to the accumulation of gluconic and fumaric acids. The pH of oranges and apples was not affected when the non-host pathogen was not able to macerate the tissues. However, different organic acid contents were detected in comparison to healthy tissues. The main organic acids detected in P. expansum-oranges were oxalic and gluconic and in P. digitatum-apples were citric, gluconic and galacturonic. Further research is needed to identify the pathogenicity factors of both fungi because the contribution of organic acids has profound implications. Copyright © 2014 Elsevier B.V. All rights reserved.

Comparison of ion-pair chromatography and capillary zone electrophoresis for the assay of organic acids as markers of abnormal metabolism.

PubMed

Wang, Shu-Ping; Liao, Chiou-Shyi

2004-10-08

The abnormal organic acids in urine are closely related with physiological metabolism. To determinate the low-molecular-mass metabolites in human biological fluids, although there were some previous reports by both of capillary electrophoresis and ion-exchange high-performance liquid chromatography, but it was rarely found by reverse phase of liquid chromatography using ion pair reagent. The objective of this study was aimed to suggest and compare two methods, an additional chromatographic method-ion-pair chromatography (IPC) and a sharp capillary zone electrophoresis (CZE), to determinate organic acids, acting as the abnormal metabolic markers, namely uric acid, orotic acid, pyruvic acid, alpha-ketoglutaric acid, fumaric acid, and hippuric acid. The proposed method of IPC possessed both the extreme stability for column and the good results of reproducibility, linearity and detection limit. The optimum mobile phase was 22% methanol and 10 mM tetra-n-butyl ammonium hydrogen sulfate (pH 4) by gradient elution. As well as the optimum condition of CZE was 5% acetonitrile and 0.5 mM CTAB in phosphate buffer. From the results, CZE showed better recovery and sharp lucid electropherogram. Finally, the two proposed analytical methods were applied to assay human urine with direct and spiked analysis. CZE showed good potency to overcome the sample-to sample variation with standard deviation less than 10%. By comparison results of urinary spiked analysis between IPC and CZE by statistical paired t-test, the results were evaluated no significant difference under P < 0.05. The quantitative linearity of both methods was fitted in application of clinical biological analysis even with 50-fold dilution.

Gateways to clinical trials.

PubMed

Tomillero, A; Moral, M A

2010-06-01

[¹¹C]RAC; (18)F-Fluoromisonidazole; 89-12; 9-[¹⁸F]Fluoropropyl-(+)-dihydrotetrabenazine; Adalimumab, Adecatumumab, ADMVA, ADXS-11-001, Aflibercept, Agatolimod sodium, AGS-004, Alglucosidase alfa, Aliskiren fumarate, Alvocidib hydrochloride, AMG-108, AMG-853, Apixaban, Aripiprazole, Armodafinil, Atazanavir sulfate, Atomoxetine hydrochloride; Bevacizumab, BioMatrix Flex drug eluting stent, Biphasic insulin aspart, Bortezomib, Bosentan; Caspofungin acetate, Cediranib, Cetuximab, ChimeriVax-Dengue, Choriogonadotropin alfa, Cinacalcet hydrochloride, Cizolirtine citrate, Clofarabine, Cocaine conjugate vaccine, CX-717; Darbepoetin alfa, Dasatinib, Decitabine, Denosumab, Desvenlafaxine succinate, Dexamethasone sodium phosphate, Dienogest, Diphencyprone, Doripenem, DTaP-HepB-IPV, Dutasteride; E-7010, Ecallantide, Ecstasy, Eicosapentaenoic acid/docosahexaenoic acid, Emtricitabine, Enfuvirtide, Erlotinib hydrochloride, Eszopiclone, Etonogestrel/ethinyl estradiol, Etoricoxib, Everolimus, Everolimus-eluting coronary stent EVT-201, Ezetimibe, Ezetimibe/simvastatin; Ferumoxytol, Fesoterodine fumavate, Figitumumab, Filgrastim, Fingolimod hydrochloride, Fluticasone furoate, Fluval P, Fluzone, Fondaparinux sodium, Fulvestrant, Fungichromin; Gamma-hydroxybutyrate sodium, Gefitinib, GHB-01L1, GLY-230, GSK-1349572; Hib-MenCY-TT, Hib-TT, HPV-6/11/16/18, Hydrocodone bitartrate; IC-51, Icatibant acetate, Imatinib mesylate, Immunoglobulin intravenous (human), Indetanib, Influenza A (H1N1) 2009 Monovalent Vaccine, Inhalable human insulin, Insulin glargine, Insulin glulisine, Interferon-beta, Ispinesib mesylate, Ixabepilone; Laromustine, Latanoprost/timolol maleate, L-Citrulline, Lenalidomide, Lexatumumab, Linezolid, Lopinavir/ritonavir, Lutropin alfa; Mapatumumab, MDX-066, MDX-1388, Mepolizumab, Methoxy polyethylene glycol-epoetin-beta, Metreleptin, Micafungin sodium, Mometasone furoate/oxymetazoline hydrochloride, Mx-dnG1, Mycophenolic acid sodium salt; Nabiximols, Natalizumab, Nemonoxacin, Norelgestromin/ethinyl estradiol; Oblimersen sodium, Ocriplasmin, Olmesartan medoxomil, Omacetaxine mepesuccinate; Paclitaxel-eluting stent, Pagoclone, Paliperidone, Panitumumab, Pazopanib hydrochloride, PCV7, Pegaptanib octasodium, Peginterferon alfa-2a, Peginterferon alfa-2b/ ribavirin, Pegvisomant, Pemetrexed disodium, Perifosine, Pimecrolimus, Pitavastatin calcium, Plerixafor hydrochloride, Plitidepsin, Posaconazole, Pregabalin, Progesterone capriate; Raltegravir potassium, Ramucirumab, Ranelic acid distrontium salt, Rasburicase, Recombinant Bet V1, Recombinant human insulin, rhFSH, Rolofylline, Romidepsin, Romiplostim, Rosuvastatin calcium; Sapacitabine, Sevelamer carbonate, Sinecatechins, Sirolimus-eluting stent, Sitagliptin phosphate monohydrate, SN-29244, Sorafenib, Sugammadex sodium, Sunitinib malate; Tadalafil, Tafenoquine, Talnetant, Tanezumab, Tapentadol hydrochloride, Tasocitinib citrate, Technosphere/Insulin, Telcagepant, Tenofovir disoproxil fumarate, Teriparatide, Ticagrelor, Tigecycline, Tiotropium bromide, Tipifarnib, Tocilizumab, TS-041; Ulipristal acetate, Urtoxazumab, Ustekinumab; Vandetanib, Varenicline tartrate, Vicriviroc, Voriconazole, Vorinostat, VRC-HIVADV014-00-VP, VRC-HIVDNA016-00-VP; Zoledronic acid monohydrate. Copyright 2010 Prous Science, S.A.U. or its licensors. All rights reserved.

Effect of glycine nitrogen on lettuce growth under soilless culture: a metabolomics approach to identify the main changes occurred in plant primary and secondary metabolism.

PubMed

Yang, Xiao; Feng, Lei; Zhao, Li; Liu, Xiaosong; Hassani, Danial; Huang, Danfeng

2018-01-01

Lettuce is a significant source of antioxidants and bioactive compounds. Nitrate is a cardinal fertilizer in horticulture and influences vegetable yield and quality; however, the negative effects of nitrate on the biosynthesis of flavonoids require further study. It is expected that using fertilizers containing organic nitrogen (N) could promote the synthesis of health-promoting compounds. Lettuces were hydroponically cultured in media containing 9 mmol L -1 nitrate or 9 mmol L -1 glycine for 4 weeks. Primary and secondary metabolites were analyzed using gas chromatography/mass spectrometry (GC/MS) and ultra-performance liquid chromatography/ion mobility spectrometry/quadrupole time-of-flight mass spectrometry (UPLC/IMS/QTOF-MS). Data analysis revealed that 29 metabolites were significantly altered between nitrate and glycine treatments. Metabolites were tentatively identified by comparison with online databases, literature and standards and using collision cross-section values. Significant differences in flavonoid biosynthesis, phenolic biosynthesis and the tricarboxylic acid (TCA) cycle response were observed between N sources. Compared with nitrate, glycine promoted accumulation of glycosylated flavonoids (quercetin 3-glucoside, quercetin 3-(6″-malonyl-glucoside), luteolin 7-glucuronide, luteolin 7-glucoside), ascorbic acid and amino acids (l-valine, l-leucine, l-glutamine, asparagine, l-serine, l-ornithine, 4-aminobutanoic acid, l-phenylalanine) but reduced phenolic acids (dihydroxybenzoic acid hexose isomers 1 and 2, chicoric acid, chicoric acid isomer 1) and TCA intermediates (fumaric, malic, citric and succinic acids). The novel methodology applied in this study can be used to characterize metabolites in lettuce. Accumulation of glycosylated flavonoids, amino acids and ascorbic acid in response to glycine supply provides strong evidence supporting the idea that using amino acids as an N source alters the nutritional value of vegetable crops. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Biofilm reactors for industrial bioconversion processes: employing potential of enhanced reaction rates

PubMed Central

Qureshi, Nasib; Annous, Bassam A; Ezeji, Thaddeus C; Karcher, Patrick; Maddox, Ian S

2005-01-01

This article describes the use of biofilm reactors for the production of various chemicals by fermentation and wastewater treatment. Biofilm formation is a natural process where microbial cells attach to the support (adsorbent) or form flocs/aggregates (also called granules) without use of chemicals and form thick layers of cells known as "biofilms." As a result of biofilm formation, cell densities in the reactor increase and cell concentrations as high as 74 gL-1 can be achieved. The reactor configurations can be as simple as a batch reactor, continuous stirred tank reactor (CSTR), packed bed reactor (PBR), fluidized bed reactor (FBR), airlift reactor (ALR), upflow anaerobic sludge blanket (UASB) reactor, or any other suitable configuration. In UASB granular biofilm particles are used. This article demonstrates that reactor productivities in these reactors have been superior to any other reactor types. This article describes production of ethanol, butanol, lactic acid, acetic acid/vinegar, succinic acid, and fumaric acid in addition to wastewater treatment in the biofilm reactors. As the title suggests, biofilm reactors have high potential to be employed in biotechnology/bioconversion industry for viable economic reasons. In this article, various reactor types have been compared for the above bioconversion processes. PMID:16122390

Effects of Lactobacilli and lactose on Salmonella typhimurium colonisation and microbial fermentation in the crop of the young turkey.

PubMed

Cutler, S A; Rasmussen, M A; Hensley, M J; Wilhelms, K W; Griffith, R W; Scanes, C G

2005-12-01

1. Three experiments were performed to examine the effects of Lactobacilli and lactose on microbial fermentation and Salmonella enterica serovar Typhimurium colonisation in the crop of the young turkey. 2. The following carboxylic acids were detected in the crop ingesta: formic, acetic, butyric, lactic, valeric, caproic, oxalic, phenyl acetic, succinic and fumaric; propionic, isobutyric and isovaleric acids were not detectable. 3. At the beginning of the night, there were considerable quantities of ingesta in the crop of young turkeys. During the scotophase, there were progressive reductions in the contents and pH. Moreover, there were linear increases in the concentration of lactic, valeric and caproic acids (by approximately 7-fold over 8 h). Much smaller changes in crop pH were observed in the study where dietary treatments of Lactobacilli were not included. 4. Chronic addition of lactose or Lactobacilli to the diet exerted modest effects on the carboxylic acid concentration in the crop contents but did not consistently influence colonisation of the crop by Salmonella enterica serovar Typhimurium. 5. Young turkeys confine eating to the hours of illumination (photophase) with a peak in consumption prior to the subjective dusk.

Hydrocarbon activation under sulfate-reducing and methanogenic conditions proceeds by different mechanisms.

NASA Astrophysics Data System (ADS)

Head, Ian; Gray, Neil; Aitken, Caroline; Sherry, Angela; Jones, Martin; Larter, Stephen

2010-05-01

Microbial degradation of alkanes typically involves their conversion to fatty acids which are then catabolised by beta-oxidation. The critical step in this process is activation of the hydrocarbon. Under oxic conditions this is catalyzed by monooxygenase enzymes with the formation of long chain alcohols. In the absence of oxygen alternative alkane activation mechanisms have been observed or proposed. Fumarate addition to alkanes to form alkyl succinates is considered a central process in anaerobic hydrocarbon degradation. Comparative studies of crude oil degradation under sulphate-reducing and methanogenic conditions revealed distinctive patterns of compound class removal and metabolite formation. Alkyl succinates derived from C7 to C26 n-alkanes and branched chain alkanes were found in abundance in sulfate-reducing systems but these were not detected during methanogenic crude oil degradation. Only one other mechanism of alkane activation has been elucidated to date. This involves addition of carbon derived from bicarbonate/CO2 to C-3 of an alkane chain to form a 2-ethylalkane with subsequent removal of the ethyl group leading to the formation of a fatty acid 1 carbon shorter than the original alkane. 2-ethylalkanes have never been detected as metabolites of anaerobic alkane degradation and were not detected in crude oil-degrading methanogenic systems. Due to the range of alkanes present in crude oil it was not possible to infer the generation of C-odd acids from C-even alkanes which is characteristic of the C-3 carboxylation mechanism. Furthermore genes homologous to alkysuccinate synthetases were not detected in the methanogenic hydrocarbon degrading community by pyrosequencing of total DNA extracted from methanogenic enrichments cultures. beta-oxidation genes were detected and intriguingly, alcohol and aldehyde dehydrogenase genes were present. This offers the possibility that alkane activation in the methanogenic system does not proceed via acid metabolites, but may be initiated by an anaerobic hydroxylation reaction. This is not unprecedented and hydroxylation of ethylbenzene has been demonstrated. However the C-H bond dissociation energy of alkanes is typically considered too high to readily permit alkane hydroxylation. It is however clear that alkane activation in these methanogenic crude oil-degrading systems involves mechanisms other than the well-known fumarate-addition reactions.

Physiology of Growth and Sporulation in Bacillus cereus I. Effect of Glutamic and Other Amino Acids

PubMed Central

Buono, F.; Testa, R.; Lundgren, D. G.

1966-01-01

Buono, F. (Syracuse University, Syracuse, N.Y.), R. Testa, and D. G. Lundgren. Physiology of growth and sporulation in Bacillus cereus. I. Effect of glutamic and other amino acids. J. Bacteriol. 91:2291–2299. 1966.—Growth and sporulation were studied in Bacillus cereus by use of an active culture technique and a synthetic medium. A high level of glutamic acid (70 mm) was required for optimal growth and glucose oxidation followed by sporulation even though relatively little glutamic acid was consumed (14 mm). Optimal growth occurred with a combination of 14 mm glutamic acid and 56 mm (NH4)2SO4, aspartic acid, or alanine. Ornithine or arginine at 70 mm could replace glutamic acid in the synthetic medium without affecting the normal growth cycle. Glutamic acid was not replaced by any other amino acid, by (NH4)2SO4, or by a combination of either α-ketoglutarate or pyruvate plus (NH4)2SO4. Enzyme assays of cell-free extracts prepared from cells harvested at different times were used to study the metabolism of glutamic acid. Glutamic-oxaloacetic and glutamic-pyruvate transaminases were completely activated (or derepressed) during early stages of sporulation (period of 6 to 8 hr). Alanine dehydrogenase responded in a similar manner, but the levels of this enzyme were much higher throughout the culture cycle. Neither glutamic dehydrogenase nor α-ketoglutarate dehydrogenase was detected. Sporulation in a replacement salts medium was studied with cells harvested at different times from the synthetic medium. Cultures 2 to 6 hr old were unable to sporulate in the replacement salts medium unless glutamic acid (7.0 mm) was present. By the 6th hr, cells were in the early stages of sporulation, showing spore septa development. Cultures 8 hr old sporulated in the replacement salts medium. Other metabolic intermediates able to replace glutamic acid in the replacement salts medium were alanine, aspartic acid, and glutamine at equimolar concentrations. Also, ammonium ions in combination with pyruvic, oxaloacetic, α-ketoglutaric, or fumaric acid replaced glutamic acid. The likely role of these metabolites is discussed. PMID:4957615

Reduction of an E. coli O157:H7 and Salmonella composite on fresh strawberries by varying antimicrobial washes and vacuum perfusion.

PubMed

Gurtler, Joshua B; Bailey, Rebecca B; Jin, Tony Z; Fan, Xuetong

2014-10-17

A 2011 outbreak of hemorrhagic colitis, which resulted in the death of two individuals, was associated with contaminated strawberries. A study was conducted to identify antimicrobial washes effective at reducing E. coli O157:H7 and Salmonella enterica from the surface of fresh whole strawberries during two-minute immersion washes. Twenty-seven antimicrobial treatments were tested. Vacuum perfusion was applied to strawberries during chlorine and peracetic acid treatments to promote infiltration of sanitizer into porous strawberry tissue. Strawberries were inoculated to 7.1logCFU/strawberry with a seven-strain bacterial composite, consisting of three strains of E. coli O157:H7 and four serovars of Salmonella enterica. Berries were air-dried for 2h and immersed in circulating antimicrobial solutions for 120s at 22°C. Four treatments reduced ≥3.0logCFU/strawberry, including (a) 1% acetic acid+1% H2O2, (b) 30% ethanol+1% H2O2, (c) 90ppm peracetic acid, and (d) 1% lactic acid+1% H2O2. Two additional treatments that reduced 2.8logCFU/strawberry were (a) 40% ethanol, and (b) 1% each of phosphoric+fumaric acids. Eight treatments reduced 2.0-2.6logCFU/strawberry. Five treatments reduced <1.45CFU/strawberry, including (a) 1% citric acid, (b) 1% lactic acid, (c) 1% acetic acid, (d) 0.5% each of acetic+citric acids and (e) 0.5% each of acetic+lactic acids. The use of vacuum perfusion with 200ppm chlorine or 90ppm peracetic acid did not reduce greater populations of pathogens than did the same treatments without vacuum perfusion. Fourteen treatments reduced no more pathogens (p<0.05) than did sterile deionized water. Results from this study provide some options for end-point decontamination of strawberries for retail operations just prior to serving to customers. Published by Elsevier B.V.

Trans-hemispheric contribution of C2-C10 α, ω-dicarboxylic acids, and related polar compounds to water-soluble organic carbon in the western Pacific aerosols in relation to photochemical oxidation reactions

NASA Astrophysics Data System (ADS)

SempéRé, Richard; Kawamura, Kimitaka

2003-06-01

Marine aerosol samples were collected during a western Pacific cruise covering the latitude range between 35°N and 40°S (140°E-180°E). They were analyzed for total carbon (TC), total nitrogen (TN), water-soluble organic carbon (WSOC) along with the molecular distributions of C2-C10 α, ω-dicarboxylic acids, and related polar compounds, mainly, ω-oxocarboxylic acids (C2-C9) and α-dicarbonyls (C2-C3). Oxalic acid (C2) was the most abundant followed by malonic (C3) and succinic (C4) acids. The total diacid concentration range was 7-605 ng m-3 (av. 85 ng m-3) and the diacid-carbon accounted for 2-15% (average 8%) of WSOC which comprised 29-55% (average 40%) of TC. Dry depositions of total diacids over the northern and southern Pacific Ocean were estimated to be 256-1907 μg m-2 yr-1 (average 735; n = 4) and 22-396 μg m-2 yr-1 (average 134; n = 14), respectively, whereas the air-to-sea flux of oxalic acid was 18-1351 μg m-2 yr-1 (average 466 μg m-2 yr-1) and 7.5-275 μg m-2 yr-1 (average 75 μg m-2 yr-1) in the Northern and Southern Hemispheres. We observed that the concentration ratios of diacid-C/WSOC, azelaic acid (C9)/ω-oxononanoic acid, maleic acid (iC4cis)/fumaric (iC4trans) acid and succinic acid (C4)/total diacids were correlated with air temperature. These findings showed that the intensity of photochemical oxidation reactions and thus the variation in sunlight intensity characterized here by air temperature, significantly control the molecular distribution of water-soluble organic compounds during the long-range transport of anthropogenic and/or biogenic higher molecular weight organic compounds.

Efficient Formation of Light-Absorbing Polymeric Nanoparticles from the Reaction of Soluble Fe(III) with C4 and C6 Dicarboxylic Acids.

PubMed

Tran, Ashley; Williams, Geoffrey; Younus, Shagufta; Ali, Nujhat N; Blair, Sandra L; Nizkorodov, Sergey A; Al-Abadleh, Hind A

2017-09-05

The role of transition metals in the formation and aging of secondary organic aerosol (SOA) from aliphatic and aromatic precursors in heterogeneous/multiphase reactions is not well understood. The reactivity of soluble Fe(III) toward known benzene photooxidation products that include fumaric (trans-butenedioic) and muconic (trans,trans-2,4-hexadienedioic) acids was investigated. Efficient formation of brightly colored nanoparticles was observed that are mostly rod- or irregular-shaped depending on the structure of the organic precursor. The particles were characterized for their optical properties, growth rate, elemental composition, iron content, and oxidation state. Results indicate that these particles have mass absorption coefficients on the same order as black carbon and larger than that of biomass burning aerosols. The particles are also amorphous in nature and consist of polymeric chains of Fe centers complexed to carboxylate groups. The oxidation state of Fe was found to be in between Fe(III) and Fe(II) in standard compounds. The organic reactant to iron molar ratio and pH were found to affect the particle growth rate. Control experiments using maleic acid (cis-butenedioic acid) and succinic acid (butanedioic acid) produced no particles. The formation of particles reported herein could account for new pathways that lead to SOA and brown carbon formation mediated by transition metals. In addition, the multiple chemically active components in these particles (iron, organics, and acidic groups) may have an effect on their chemical reactivity (enhanced uptake of trace gases, catalysis, and production of reactive oxygen species) and their likely poor cloud/ice nucleation properties.

Integrative Metabolic Signatures for Hepatic Radiation Injury

PubMed Central

Su, Gang; Meng, Fan; Liu, Laibin; Mohney, Robert; Kulkarni, Shilpa; Guha, Chandan

2015-01-01

Background Radiation-induced liver disease (RILD) is a dose-limiting factor in curative radiation therapy (RT) for liver cancers, making early detection of radiation-associated liver injury absolutely essential for medical intervention. A metabolomic approach was used to determine metabolic signatures that could serve as biomarkers for early detection of RILD in mice. Methods Anesthetized C57BL/6 mice received 0, 10 or 50 Gy Whole Liver Irradiation (WLI) and were contrasted to mice, which received 10 Gy whole body irradiation (WBI). Liver and plasma samples were collected at 24 hours after irradiation. The samples were processed using Gas Chromatography/Mass Spectrometry and Liquid Chromatography/Mass Spectrometry. Results Twenty four hours after WLI, 407 metabolites were detected in liver samples while 347 metabolites were detected in plasma. Plasma metabolites associated with 50 Gy WLI included several amino acids, purine and pyrimidine metabolites, microbial metabolites, and most prominently bradykinin and 3-indoxyl-sulfate. Liver metabolites associated with 50 Gy WLI included pentose phosphate, purine, and pyrimidine metabolites in liver. Plasma biomarkers in common between WLI and WBI were enriched in microbial metabolites such as 3 indoxyl sulfate, indole-3-lactic acid, phenyllactic acid, pipecolic acid, hippuric acid, and markers of DNA damage such as 2-deoxyuridine. Metabolites associated with tryptophan and indoles may reflect radiation-induced gut microbiome effects. Predominant liver biomarkers in common between WBI and WLI were amino acids, sugars, TCA metabolites (fumarate), fatty acids (lineolate, n-hexadecanoic acid) and DNA damage markers (uridine). Conclusions We identified a set of metabolomic markers that may prove useful as plasma biomarkers of RILD and WBI. Pathway analysis also suggested that the unique metabolic changes observed after liver irradiation was an integrative response of the intestine, liver and kidney. PMID:26046990

Insights into the Anaerobic Biodegradation Pathway of n-Alkanes in Oil Reservoirs by Detection of Signature Metabolites

PubMed Central

Bian, Xin-Yu; Maurice Mbadinga, Serge; Liu, Yi-Fan; Yang, Shi-Zhong; Liu, Jin-Feng; Ye, Ru-Qiang; Gu, Ji-Dong; Mu, Bo-Zhong

2015-01-01

Anaerobic degradation of alkanes in hydrocarbon-rich environments has been documented and different degradation strategies proposed, of which the most encountered one is fumarate addition mechanism, generating alkylsuccinates as specific biomarkers. However, little is known about the mechanisms of anaerobic degradation of alkanes in oil reservoirs, due to low concentrations of signature metabolites and lack of mass spectral characteristics to allow identification. In this work, we used a multidisciplinary approach combining metabolite profiling and selective gene assays to establish the biodegradation mechanism of alkanes in oil reservoirs. A total of twelve production fluids from three different oil reservoirs were collected and treated with alkali; organic acids were extracted, derivatized with ethanol to form ethyl esters and determined using GC-MS analysis. Collectively, signature metabolite alkylsuccinates of parent compounds from C1 to C8 together with their (putative) downstream metabolites were detected from these samples. Additionally, metabolites indicative of the anaerobic degradation of mono- and poly-aromatic hydrocarbons (2-benzylsuccinate, naphthoate, 5,6,7,8-tetrahydro-naphthoate) were also observed. The detection of alkylsuccinates and genes encoding for alkylsuccinate synthase shows that anaerobic degradation of alkanes via fumarate addition occurs in oil reservoirs. This work provides strong evidence on the in situ anaerobic biodegradation mechanisms of hydrocarbons by fumarate addition. PMID:25966798

Fanconi Anemia complementation group C protein in metabolic disorders.

PubMed

Nepal, Manoj; Ma, Chi; Xie, Guoxiang; Jia, Wei; Fei, Peiwen

2018-06-21

Given importance of 22-Fanconi Anemia (FA) proteins together to act in a signaling pathway in preventing deleterious clinical symptoms, e.g. severe bone marrow failure, congenital defects, an early onset of aging and cancer, studies on each FA protein become increasingly attractive. However, an unbiased and systematic investigation of cellular effects resulting from each FA protein is missing. Here, we report roles of FA complementation C group protein (FANCC) in the protection from metabolic disorders. This study was prompted by the diabetes-prone feature displayed in FANCC knockout mice, which is not typically shown in patients with FA. We found that in cells expressing FANCC at different levels, there are representative alterations in metabolites associated with aging (glycine, citrulline, ornithine, L-asparagine, L-tyrosine, L-arginine, L-glutamine, L-leucine, L-isoleucine, L-valine, L-proline and L-alanine), Diabetes Mellitus (DM) (carbon monoxide, collagens, fatty acids, D-glucose, fumaric acid, 2-oxoglutaric acid, C3), inflammation (inosine, L-arginine, L-isoleucine, L-leucine, L-lysine, L-phenylalanine, hypoxanthine, L-methionine), and cancer ( L-methionine, sphingomyelin, acetyl-L-carnitine, L-aspartic acid, L-glutamic acid, niacinamide, phospho-rylethanolamine). We also found that FANCC can act in an FA-pathway-independent manner in tumor suppression. Collectively, featured-metabolic alterations are readouts of functional mechanisms underlying reduced tumorigenicity driven by FANCC, demonstrating close links among cancer, aging, inflammation and DM.

Design of oral agents for the management of multiple sclerosis: benefit and risk assessment for dimethyl fumarate

PubMed Central

Nicholas, Jacqueline Ann; Boster, Aaron Lee; Imitola, Jaime; O’Connell, Colleen; Racke, Michael Karl

2014-01-01

Dimethyl fumarate (DMF) is the most recent oral disease-modifying therapy approved by the US Food and Drug Administration and is indicated for the treatment of relapsing forms of multiple sclerosis (MS). Prior to approval for use in MS, DMF and its active metabolite, monomethyl fumarate, had been used for decades as two of the fumaric acid esters in Fumaderm®, a medication used in Europe for the treatment of psoriasis. The unique mechanism of action of DMF remains under evaluation; however, it has been shown to act through multiple pathways leading to shifts away from the Th1 proinflammatory response to the less inflammatory Th2 response. Preliminary data suggest that DMF may induce neuroprotective effects in central nervous system white matter, although further studies are needed to demonstrate these effects on inflammatory demyelination. The DMF Phase III clinical trials demonstrated its efficacy with regard to a reduction in the annualized relapse rate and reductions in new or enlarging T2 lesions and numbers of gadolinium-enhancing lesions on magnetic resonance imaging. DMF has a well-defined safety profile, given the experience with its use in the treatment of psoriasis, and more recently from the DMF clinical trials program and post-marketing era for treatment of MS. The safety profile and oral mode of administration of DMF place it as an attractive first-line therapy option for the treatment of relapsing forms of MS. Long-term observational studies will be needed to determine the effects of DMF on progression of disability in MS. PMID:25045248

Retrospective data collection of psoriasis treatment with fumaric acid esters in children and adolescents in Germany (KIDS FUTURE study).

PubMed

Reich, Kristian; Hartl, Christoph; Gambichler, Thilo; Zschocke, Ina

2016-01-01

Given that there is no standard systemic treatment for children and adolescents with plaque psoriasis, this non-interventional, multicenter, retrospective study collected data on the efficacy and safety of long-term treatment with fumaric acid esters (FAEs) in this particular patient group. In patients younger than 18 years of age at the start of FAE treatment, data on efficacy and safety was retrospectively collected for at least 36 months. Data from 127 patients (aged 6-17 years) was collected for treatment durations of up to 60 months. Physician's Global Assessment, Psoriasis Area and Severity Index, and Body Surface Area showed marked improvement in the first six months. After 36 months, these parameters had, on average, improved by up to two-thirds of baseline values. Thirty-seven patients experienced at least one adverse event (AE), which was FAE-related in 36 individuals. Three AEs (proteinuria (one case), flushing (two cases)) persisted during the observation period while on treatment. Fifteen AEs led to the discontinuation of therapy; nearly all of these cases were related to gastrointestinal disorders. The KIDS FUTURE study - for the first time - included a larger population of children and adolescents with psoriasis who were treated with FAEs. The data obtained suggests that long-term FAE therapy in this patient group may be effective and safe. The results are currently being verified in an ongoing clinical study. © 2015 Deutsche Dermatologische Gesellschaft (DDG). Published by John Wiley & Sons Ltd.

Reinvestigation of Brevibacterium sp. Strain KY-4313 as a Source of Canthaxanthin

PubMed Central

Nelis, H. J.; De Leenheer, A. P.

1989-01-01

The hydrocarbon-utilizing Brevibacterium sp. strain KY-4313 was reevaluated for its potential to produce canthaxanthin, a carotenoid pigment of strong commercial interest. Three approaches were used to optimize the canthaxanthin yield from this organism, i.e., the preparation of mutants, the addition of supposedly carotenogenic chemicals to the growth medium, and growth promotion. Following treatment of the parent strain with N-nitrosomethylurea, a presumed mutant was isolated which showed a 32% increase in cellular canthaxanthin content. No effective carotenogenic chemicals were found in connection with hydrocarbon fermentations, in which mainly growth promotion through periodic medium renewal proved conducive to enhanced pigment production. Carotenogenesis could be stimulated in brain heart infusion broth by adding alcohols or retinol. Improved growth in this medium was generally not associated with higher canthaxanthin yields. Both superior growth and pigment levels were obtained in a newly designed medium based on fumaric acid-molasses. The maximum yields of canthaxanthin in shake flasks were (in milligrams per liter) 4.2 (brain heart infusion broth plus propanol-zinc sulfate), 3.6 (hydrocarbon medium), and 9.3 (fumaric acid-molasses), which represent a significant improvement over the originally reported optimal result (1 mg/liter). The corresponding yields of echinenone, the direct precursor of canthaxanthin, were 1.2, 1.6, and 2.3 mg/liter, respectively. Two-liter hydrocarbon batch fermentations involving medium renewal maximally produced 7.2 mg of canthaxanthin and 3.7 mg of echinenone per liter. PMID:16348027

Colonization on Cucumber Root and Enhancement of Chlorimuron-ethyl Degradation in the Rhizosphere by Hansschlegelia zhihuaiae S113 and Root Exudates.

PubMed

Zhang, Hao; Chen, Feng; Zhao, Hua-Zhu; Lu, Jia-Sen; Zhao, Meng-Jun; Hong, Qing; Huang, Xing

2018-05-09

The colonization of Hansschlegelia zhihuaiae S113 and its degradation of the herbicide chlorimuron-ethyl in the cucumber rhizosphere was investigated. The results reveal that S113 colonized the cucumber roots (2.14 × 10 5 cells per gram of roots) and were able to survive in the rhizosphere (maintained for 20 d). The root exudates promoted colonization on roots and increased the degradation of chlorimuron-ethyl by S113. Five organic acids in cucumber-root exudates were detected and identified by HPLC. Citric acid and fumaric acid significantly stimulated S113 colonization on cucumber roots, with 18.4 and 15.5% increases, respectively, compared with the control. After irrigation with an S113 solution for 10 days, chlorimuron-ethyl could not be detected in the roots, seedlings, or rhizosphere soil, which allowed for improved cucumber growth. Therefore, the degradation mechanism of chlorimuron-ethyl residues by S113 in the rhizosphere could be applied in situ for the bioremediation of chlorimuron-ethyl contaminated soil to ensure crop safety.

Metabolic behavior and enzymatic aspects of denitrifying EBPR sludge in a continuous-flow anaerobic-anoxic system.

PubMed

Zafiriadis, Ilias; Ntougias, Spyridon; Kapagiannidis, Anastasios G; Aivasidis, Alexander

2013-10-01

The metabolic aspects of enhanced biological phosphorus removal (EBPR) were investigated for the first time in a continuous-flow anaerobic-anoxic plant fed with acetate, propionate, or substrates which are involved in the tricarboxylic acid and/or glyoxylate cycle, i.e., fumarate, malate, or oxaloacetate, as the sole carbon source. Although the polyphosphate-accumulating organisms (PAOs) population remained stable with any carbon source examined, no typical EBPR metabolism was observed during fumarate, malate, or oxaloacetate utilization. Specific enzymatic activities related to EBPR were determined in activated sludge homogenates and directly correlated with the nutrient metabolic rates. The experimental results indicated the direct involvement of alkaline phosphatase, pyrophosphatase, and exopolyphosphatase in the denitrifying EBPR process. Metabolic aspects of glyoxylate cycle enzymes are discussed with regard to the biomass anaerobic and anoxic activity. Process performance was highly influenced by the kind of substrate utilized, indicating that specific metabolic pathways should be followed to favor efficient EBPR.

Metabolomics and transcriptomics profiles reveal the dysregulation of the tricarboxylic acid cycle and related mechanisms in prostate cancer.

PubMed

Shao, Yaping; Ye, Guozhu; Ren, Shancheng; Piao, Hai-Long; Zhao, Xinjie; Lu, Xin; Wang, Fubo; Ma, Wang; Li, Jia; Yin, Peiyuan; Xia, Tian; Xu, Chuanliang; Yu, Jane J; Sun, Yinghao; Xu, Guowang

2018-07-15

Genetic alterations drive metabolic reprograming to meet increased biosynthetic precursor and energy demands for cancer cell proliferation and survival in unfavorable environments. A systematic study of gene-metabolite regulatory networks and metabolic dysregulation should reveal the molecular mechanisms underlying prostate cancer (PCa) pathogenesis. Herein, we performed gas chromatography-mass spectrometry (GC-MS)-based metabolomics and RNA-seq analyses in prostate tumors and matched adjacent normal tissues (ANTs) to elucidate the molecular alterations and potential underlying regulatory mechanisms in PCa. Significant accumulation of metabolic intermediates and enrichment of genes in the tricarboxylic acid (TCA) cycle were observed in tumor tissues, indicating TCA cycle hyperactivation in PCa tissues. In addition, the levels of fumarate and malate were highly correlated with the Gleason score, tumor stage and expression of genes encoding related enzymes and were significantly related to the expression of genes involved in branched chain amino acid degradation. Using an integrated omics approach, we further revealed the potential anaplerotic routes from pyruvate, glutamine catabolism and branched chain amino acid (BCAA) degradation contributing to replenishing metabolites for TCA cycle. Integrated omics techniques enable the performance of network-based analyses to gain a comprehensive and in-depth understanding of PCa pathophysiology and may facilitate the development of new and effective therapeutic strategies. © 2018 UICC.

Skeletal Muscle Acute and Chronic Metabolic Response to Essential Amino Acid Supplementation in Hypertriglyceridemic Older Adults

PubMed Central

Marquis, Bryce J; Hurren, Nicholas M; Carvalho, Eugenia; Kim, Il-Young; Schutzler, Scott; Azhar, Gohar; Wolfe, Robert R; Børsheim, Elisabet

2017-01-01

Abstract Background: Supplementation with essential amino acids (EAAs) + arginine is a promising nutritional approach to decrease plasma triglyceride (TG) concentrations, which are an independent risk factor for ischemic heart disease. Objective: The objective of this study was to examine the effects of 8 wk of EAA supplementation on skeletal muscle basal metabolite concentrations and changes in metabolic response to acute EAA intake, with an emphasis on mitochondrial metabolism, in adults with elevated TGs to better understand the mechanisms of lowering plasma TGs. Methods: Older adults with elevated plasma TG concentrations were given 22 g EAAs to ingest acutely before and after an 8-wk EAA supplementation period. Skeletal muscle biopsy samples were collected before and after acute EAA intake, both pre- and postsupplementation (4 biopsy samples), and targeted metabolomic analyses of organic acids and acylcarnitines were conducted on the specimens. Results: Acute EAA intake resulted in increased skeletal muscle acylcarnitine concentrations associated with oxidative catabolism of the supplement components, with the largest increases found in acylcarnitines of branched-chain amino acid oxidative catabolism, including isovaleryl-carnitine (2200%) and 2-methylbutyryl-carnitine (2400%). The chronic EAA supplementation resulted in a 19% decrease in plasma TGs along with accumulation of long-chain acylcarnitines myristoyl- (90%) and stearoyl- (120%) carnitine in skeletal muscle and increases in succinyl-carnitine (250%) and the late-stage tricarboxylic acid cycle intermediates fumarate (44%) and malate (110%). Conclusions: Supplementation with EAAs shows promise as an approach for moderate reduction in plasma TGs. Changes in skeletal muscle metabolites suggest incomplete fatty acid oxidation and increased anaplerosis, which suggests a potential bottleneck in fatty acid metabolism.

Organic Acids: The Pools of Fixed Carbon Involved in Redox Regulation and Energy Balance in Higher Plants

PubMed Central

Igamberdiev, Abir U.; Eprintsev, Alexander T.

2016-01-01

Organic acids are synthesized in plants as a result of the incomplete oxidation of photosynthetic products and represent the stored pools of fixed carbon accumulated due to different transient times of conversion of carbon compounds in metabolic pathways. When redox level in the cell increases, e.g., in conditions of active photosynthesis, the tricarboxylic acid (TCA) cycle in mitochondria is transformed to a partial cycle supplying citrate for the synthesis of 2-oxoglutarate and glutamate (citrate valve), while malate is accumulated and participates in the redox balance in different cell compartments (via malate valve). This results in malate and citrate frequently being the most accumulated acids in plants. However, the intensity of reactions linked to the conversion of these compounds can cause preferential accumulation of other organic acids, e.g., fumarate or isocitrate, in higher concentrations than malate and citrate. The secondary reactions, associated with the central metabolic pathways, in particularly with the TCA cycle, result in accumulation of other organic acids that are derived from the intermediates of the cycle. They form the additional pools of fixed carbon and stabilize the TCA cycle. Trans-aconitate is formed from citrate or cis-aconitate, accumulation of hydroxycitrate can be linked to metabolism of 2-oxoglutarate, while 4-hydroxy-2-oxoglutarate can be formed from pyruvate and glyoxylate. Glyoxylate, a product of either glycolate oxidase or isocitrate lyase, can be converted to oxalate. Malonate is accumulated at high concentrations in legume plants. Organic acids play a role in plants in providing redox equilibrium, supporting ionic gradients on membranes, and acidification of the extracellular medium. PMID:27471516

Knocking down mitochondrial iron transporter (MIT) reprograms primary and secondary metabolism in rice plants

PubMed Central

Vigani, Gianpiero; Bashir, Khurram; Ishimaru, Yasuhiro; Lehmann, Martin; Casiraghi, Fabio Marco; Nakanishi, Hiromi; Seki, Motoaki; Geigenberger, Peter; Zocchi, Graziano; Nishizawa, Naoko K.

2016-01-01

Iron (Fe) is an essential micronutrient for plant growth and development, and its reduced bioavailability strongly impairs mitochondrial functionality. In this work, the metabolic adjustment in the rice (Oryza sativa) mitochondrial Fe transporter knockdown mutant (mit-2) was analysed. Biochemical characterization of purified mitochondria from rice roots showed alteration in the respiratory chain of mit-2 compared with wild-type (WT) plants. In particular, proteins belonging to the type II alternative NAD(P)H dehydrogenases accumulated strongly in mit-2 plants, indicating that alternative pathways were activated to keep the respiratory chain working. Additionally, large-scale changes in the transcriptome and metabolome were observed in mit-2 rice plants. In particular, a strong alteration (up-/down-regulation) in the expression of genes encoding enzymes of both primary and secondary metabolism was found in mutant plants. This was reflected by changes in the metabolic profiles in both roots and shoots of mit-2 plants. Significant alterations in the levels of amino acids belonging to the aspartic acid-related pathways (aspartic acid, lysine, and threonine in roots, and aspartic acid and ornithine in shoots) were found that are strictly connected to the Krebs cycle. Furthermore, some metabolites (e.g. pyruvic acid, fumaric acid, ornithine, and oligosaccharides of the raffinose family) accumulated only in the shoot of mit-2 plants, indicating possible hypoxic responses. These findings suggest that the induction of local Fe deficiency in the mitochondrial compartment of mit-2 plants differentially affects the transcript as well as the metabolic profiles in root and shoot tissues. PMID:26685186

Inhibition of sarcolemmal FAT/CD36 by sulfo-N-succinimidyl oleate rapidly corrects metabolism and restores function in the diabetic heart following hypoxia/reoxygenation

PubMed Central

Mansor, Latt S.; Sousa Fialho, Maria da Luz; Yea, Georgina; Coumans, Will A.; West, James A.; Kerr, Matthew; Carr, Carolyn A.; Luiken, Joost J.F.P.; Glatz, Jan F.C.; Evans, Rhys D.; Griffin, Julian L.; Tyler, Damian J.; Clarke, Kieran

2017-01-01

Aims The type 2 diabetic heart oxidizes more fat and less glucose, which can impair metabolic flexibility and function. Increased sarcolemmal fatty acid translocase (FAT/CD36) imports more fatty acid into the diabetic myocardium, feeding increased fatty acid oxidation and elevated lipid deposition. Unlike other metabolic modulators that target mitochondrial fatty acid oxidation, we proposed that pharmacologically inhibiting fatty acid uptake, as the primary step in the pathway, would provide an alternative mechanism to rebalance metabolism and prevent lipid accumulation following hypoxic stress. Methods and results Hearts from type 2 diabetic and control male Wistar rats were perfused in normoxia, hypoxia and reoxygenation, with the FAT/CD36 inhibitor sulfo-N-succinimidyl oleate (SSO) infused 4 min before hypoxia. SSO infusion into diabetic hearts decreased the fatty acid oxidation rate by 29% and myocardial triglyceride concentration by 48% compared with untreated diabetic hearts, restoring fatty acid metabolism to control levels following hypoxia-reoxygenation. SSO infusion increased the glycolytic rate by 46% in diabetic hearts during hypoxia, increased pyruvate dehydrogenase activity by 53% and decreased lactate efflux rate by 56% compared with untreated diabetic hearts during reoxygenation. In addition, SSO treatment of diabetic hearts increased intermediates within the second span of the Krebs cycle, namely fumarate, oxaloacetate, and the FAD total pool. The cardiac dysfunction in diabetic hearts following decreased oxygen availability was prevented by SSO-infusion prior to the hypoxic stress. Infusing SSO into diabetic hearts increased rate pressure product by 60% during hypoxia and by 32% following reoxygenation, restoring function to control levels. Conclusions Diabetic hearts have limited metabolic flexibility and cardiac dysfunction when stressed, which can be rapidly rectified by reducing fatty acid uptake with the FAT/CD36 inhibitor, SSO. This novel therapeutic approach not only reduces fat oxidation but also lipotoxicity, by targeting the primary step in the fatty acid metabolism pathway. PMID:28419197

Protein-protein interactions and metabolite channelling in the plant tricarboxylic acid cycle

PubMed Central

Zhang, Youjun; Beard, Katherine F. M.; Swart, Corné; Bergmann, Susan; Krahnert, Ina; Nikoloski, Zoran; Graf, Alexander; Ratcliffe, R. George; Sweetlove, Lee J.; Fernie, Alisdair R.; Obata, Toshihiro

2017-01-01

Protein complexes of sequential metabolic enzymes, often termed metabolons, may permit direct channelling of metabolites between the enzymes, providing increased control over metabolic pathway fluxes. Experimental evidence supporting their existence in vivo remains fragmentary. In the present study, we test binary interactions of the proteins constituting the plant tricarboxylic acid (TCA) cycle. We integrate (semi-)quantitative results from affinity purification-mass spectrometry, split-luciferase and yeast-two-hybrid assays to generate a single reliability score for assessing protein–protein interactions. By this approach, we identify 158 interactions including those between catalytic subunits of sequential enzymes and between subunits of enzymes mediating non-adjacent reactions. We reveal channelling of citrate and fumarate in isolated potato mitochondria by isotope dilution experiments. These results provide evidence for a functional TCA cycle metabolon in plants, which we discuss in the context of contemporary understanding of this pathway in other kingdoms. PMID:28508886

Different Polar Metabolites and Protein Profiles between High- and Low-Quality Japanese Ginjo Sake

PubMed Central

Takahashi, Kei; Kohno, Hiromi

2016-01-01

Japanese ginjo sake is a premium refined sake characterized by a pleasant fruity apple-like flavor and a sophisticated taste. Because of technical difficulties inherent in brewing ginjo sake, off-flavors sometimes occur. However, the metabolites responsible for off-flavors as well as those present or absent in higher quality ginjo sake remain uncertain. Here, the relationship between 202 polar chemical compounds in sake identified using capillary electrophoresis coupled with time-of-flight mass spectrometry and its organoleptic properties, such as quality and off-flavor, was examined. First, we found that some off-flavored sakes contained higher total amounts of metabolites than other sake samples. The results also identified that levels of 2-oxoglutaric acid and fumaric acid, metabolites in the tricarboxylic acid cycle, were highly but oppositely correlated with ginjo sake quality. Similarly, pyridoxine and pyridoxamine, co-enzymes for amino transferase, were also highly but oppositely correlated with ginjo sake quality. Additionally, pyruvic acid levels were associated with good quality as well. Compounds involved in the methionine salvage cycle, oxidative glutathione derivatives, and amino acid catabolites were correlated with low quality. Among off-flavors, an inharmonious bitter taste appeared attributable to polyamines. Furthermore, protein analysis displayed that a diversity of protein components and yeast protein (triosephosphate isomerase, TPI) leakage was linked to the overall metabolite intensity in ginjo sake. This research provides insight into the relationship between sake components and organoleptic properties. PMID:26939054

Electrochemical destruction of trans-cinnamic acid by advanced oxidation processes: kinetics, mineralization, and degradation route.

PubMed

Flores, Nelly; Thiam, Abdoulaye; Rodríguez, Rosa María; Centellas, Francesc; Cabot, Pere Lluís; Garrido, José Antonio; Brillas, Enric; Sirés, Ignasi

2017-03-01

Acidic solutions of trans-cinnamic acid at pH 3.0 have been comparatively treated by anodic oxidation with electrogenerated H 2 O 2 (AO-H 2 O 2 ), electro-Fenton (EF), and photoelectro-Fenton (PEF). The electrolytic experiments were carried out with a boron-doped diamond (BDD)/air-diffusion cell. The substrate was very slowly abated by AO-H 2 O 2 because of its low reaction rate with oxidizing • OH produced from water discharge at the BDD anode. In contrast, its removal was very rapid and at similar rate by EF and PEF due to the additional oxidation by • OH in the bulk, formed from Fenton's reaction between cathodically generated H 2 O 2 and added Fe 2+ . The AO-H 2 O 2 treatment yielded the lowest mineralization. The EF process led to persistent final products like Fe(III) complexes, which were quickly photolyzed upon UVA irradiation in PEF to give an almost total mineralization with 98 % total organic carbon removal. The effect of current density and substrate concentration on all the mineralization processes was examined. Gas chromatography-mass spectrometry (GC-MS) analysis of electrolyzed solutions allowed identifying five primary aromatics and one heteroaromatic molecule, whereas final carboxylic acids like fumaric, acetic, and oxalic were quantified by ion exclusion high-performance liquid chromatography (HPLC). From all the products detected, a degradation route for trans-cinnamic acid is proposed.

Regulation of autotrophic CO2 fixation in the archaeon Thermoproteus neutrophilus.

PubMed

Ramos-Vera, W Hugo; Labonté, Valérie; Weiss, Michael; Pauly, Julia; Fuchs, Georg

2010-10-01

Thermoproteus neutrophilus, a hyperthermophilic, chemolithoautotrophic, anaerobic crenarchaeon, uses a novel autotrophic CO(2) fixation pathway, the dicarboxylate/hydroxybutyrate cycle. The regulation of the central carbon metabolism was studied on the level of whole cells, enzyme activity, the proteome, transcription, and gene organization. The organism proved to be a facultative autotroph, which prefers organic acids as carbon sources that can easily feed into the metabolite pools of this cycle. Addition of the preferred carbon sources acetate, pyruvate, succinate, and 4-hydroxybutyrate to cultures resulted in stimulation of the growth rate and a diauxic growth response. The characteristic enzyme activities of the carbon fixation cycle, fumarate hydratase, fumarate reductase, succinyl coenzyme A (CoA) synthetase, and enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA, were differentially downregulated in the presence of acetate and, to a lesser extent, in the presence of other organic substrates. This regulation pattern correlated well with the differential expression profile of the proteome as well as with the transcription of the encoding genes. The genes encoding phosphoenolpyruvate (PEP) carboxylase, fumarate reductase, and four enzymes catalyzing the conversion of succinyl-CoA to crotonyl-CoA are clustered. Two putative operons, one comprising succinyl-CoA reductase plus 4-hydroxybutyrate-CoA ligase genes and the other comprising 4-hydroxybutyryl-CoA dehydratase plus fumarate reductase genes, were divergently transcribed into leaderless mRNAs. The promoter regions were characterized and used for isolating DNA binding proteins. Besides an Alba protein, a 18-kDa protein characteristic for autotrophic Thermoproteales that bound specifically to the promoter region was identified. This system may be suitable for molecular analysis of the transcriptional regulation of autotrophy-related genes.

Dimethyl Fumarate Protects Neural Stem/Progenitor Cells and Neurons from Oxidative Damage through Nrf2-ERK1/2 MAPK Pathway.

PubMed

Wang, Qin; Chuikov, Sergei; Taitano, Sophina; Wu, Qi; Rastogi, Arjun; Tuck, Samuel J; Corey, Joseph M; Lundy, Steven K; Mao-Draayer, Yang

2015-06-17

Multiple sclerosis (MS) is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS). Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12) is an oral formulation of the fumaric acid esters (FAE), containing the active metabolite dimethyl fumarate (DMF). Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF) on mouse and rat neural stem/progenitor cells (NPCs) and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2) treatment. In addition, utilizing the reactive oxygen species (ROS) assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2) at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1). Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS).

Dimethyl Fumarate Protects Neural Stem/Progenitor Cells and Neurons from Oxidative Damage through Nrf2-ERK1/2 MAPK Pathway

PubMed Central

Wang, Qin; Chuikov, Sergei; Taitano, Sophina; Wu, Qi; Rastogi, Arjun; Tuck, Samuel J.; Corey, Joseph M.; Lundy, Steven K.; Mao-Draayer, Yang

2015-01-01

Multiple sclerosis (MS) is the most common multifocal inflammatory demyelinating disease of the central nervous system (CNS). Due to the progressive neurodegenerative nature of MS, developing treatments that exhibit direct neuroprotective effects are needed. Tecfidera™ (BG-12) is an oral formulation of the fumaric acid esters (FAE), containing the active metabolite dimethyl fumarate (DMF). Although BG-12 showed remarkable efficacy in lowering relapse rates in clinical trials, its mechanism of action in MS is not yet well understood. In this study, we reported the potential neuroprotective effects of dimethyl fumarate (DMF) on mouse and rat neural stem/progenitor cells (NPCs) and neurons. We found that DMF increased the frequency of the multipotent neurospheres and the survival of NPCs following oxidative stress with hydrogen peroxide (H2O2) treatment. In addition, utilizing the reactive oxygen species (ROS) assay, we showed that DMF reduced ROS production induced by H2O2. DMF also decreased oxidative stress-induced apoptosis. Using motor neuron survival assay, DMF significantly promoted survival of motor neurons under oxidative stress. We further analyzed the expression of oxidative stress-induced genes in the NPC cultures and showed that DMF increased the expression of transcription factor nuclear factor-erythroid 2-related factor 2 (Nrf2) at both levels of RNA and protein. Furthermore, we demonstrated the involvement of Nrf2-ERK1/2 MAPK pathway in DMF-mediated neuroprotection. Finally, we utilized SuperArray gene screen technology to identify additional anti-oxidative stress genes (Gstp1, Sod2, Nqo1, Srxn1, Fth1). Our data suggests that analysis of anti-oxidative stress mechanisms may yield further insights into new targets for treatment of multiple sclerosis (MS). PMID:26090715

Dry cereals fortified with electrolytic iron or ferrous fumarate are equally effective in breast-fed infants.

PubMed

Ziegler, Ekhard E; Fomon, Samuel J; Nelson, Steven E; Jeter, Janice M; Theuer, Richard C

2011-02-01

Precooked, instant (dry) infant cereals in the US are fortified with electrolytic iron, a source of low reactivity and suspected low bioavailability. Iron from ferrous fumarate is presumed to be more available. In this study, we compared a dry infant rice cereal (Cereal L) fortified with electrolytic iron (54.5 mg iron/100 g cereal) to a similar cereal (Cereal M) fortified with ferrous fumarate (52.2 mg Fe/100 g) for efficacy in maintaining iron status and preventing iron deficiency (ID) in breast-fed infants. Ascorbic acid was included in both cereals. In this prospective, randomized double-blind trial, exclusively breast-fed infants were enrolled at 1 mo and iron status was determined periodically. At 4 mo, 3 infants had ID anemia and were excluded. Ninety-five infants were randomized at 4 mo, and 69 (36 Cereal L, 33 Cereal M) completed the intervention at 9 mo. From 4 to 9 mo, they consumed daily one of the study cereals. With each cereal, 2 infants had mild ID, a prevalence of 4.2%, but no infant developed ID anemia. There were no differences in iron status between study groups. Iron intake from the study cereals was (mean ± SD) 1.21 ± 0.31 mg⋅kg(-1)⋅d(-1) from Cereal L and 1.07 ± 0.40 mg⋅kg(-1)⋅d(-1) from Cereal M. Eleven infants had low birth iron endowment (plasma ferritin < 55 μg/L at 2 mo) and 54% of these infants had ID with or without anemia by 4 mo. We conclude that electrolytic iron and ferrous fumarate were equally efficacious as fortificants of this infant cereal.

Nanoparticles as strengthening agents in polymer systems

NASA Astrophysics Data System (ADS)

Shahid, Naureen

2005-11-01

Carboxylate-substituted alumina nanoparticles are produced solvent free using mechanical shear. The general nature of this method has been demonstrated for L-lysine-, stearate, and p-hydroxybenzoate-derived materials. The reaction rate and particle size is controlled by a combination of temperature and shear rate. The nanoparticles are spectroscopically equivalent to those reported from aqueous syntheses, however, the average particle size can be decreased and the particle size distribution narrowed depending on the reaction conditions. Lysine and p-hydroxybenzoato alumoxanes have been introduced in carbon fiber reinforced epoxide resin composites. Different preparation conditions have been studied to obtain composite with enhanced performances that are ideal for the motor sports and aerospace industries. A new composite material has been fabricated utilizing surface-modified carboxylate alumoxane nanoparticles and the biodegradable polymer poly(propylene fumarate)/poly(propylene fumarate)-diacrylate (PPF/PPF-DA). For this study, composites were prepared using various functional groups including: a surfactant alumoxane to enhance nanoparticle dispersion into the polymer; an activated-alumoxane to enhance nanoparticle interaction with the polymer matrix; a mixed alumoxane containing both activated and surfactant groups. Nanocomposites prepared with all types of alumoxane, as well as blank polymer resin and unmodified boehmite, underwent mechanical testing and were characterized by SEM and microprobe analysis. A nanocomposite composed of mixed alumoxane nanoparticles dispersed in PPF/PPF-DA exhibited increased flexural modulus compared to polymer resin alone, and a significant enhancement over both the activated and surfacted alumoxanes. Boric acid is used as the cross-linking agent in oil well drilling industry even though the efficacy of the borate ion, [B(OH)4]- , as a cross-linking agent is poor. The reaction product of boric acid and the polysaccharide guaran (the major component of guar gum) has been investigated by 11B NMR spectroscopy. By comparison with the 11B NMR of boric acid and phenyl boronic acid complexes of 1,2-diols [HOCMe2CMe2OH, cis-C6H 10(OH)2, trans-C6H10(OH) 2, o-C6H4(OH)2], 1,3-diols (neol-H2), monosaccharides (L-fucose, mannose and galactose) and disaccharides (celloboise and sucrose) it is found that the guaran polymer is cross-linked via a borate complex of two 1,2-diols both forming chelate 5-membered ring cycles, this contrasts with previous proposals. (Abstract shortened by UMI.)

Impact of fumaric acid esters on cardiovascular risk factors and depression in psoriasis: a prospective pilot study.

PubMed

Schmieder, Astrid; Poppe, Manuel; Hametner, Christian; Meyer-Schraml, Hanna; Schaarschmidt, Marthe-Lisa; Findeisen, Peter; Benoit, Sandrine; Bauer, Boris; Schmid, Sybille; Goebeler, Matthias; Goerdt, Sergij; Ludwig-Peitsch, Wiebke K

2015-07-01

Patients with psoriasis have an increased risk of cardiovascular disease that is partly attributable to chronic systemic inflammation. The aim of our prospective pilot study was to investigate the impact of fumaric acid esters (FAE), a first-line systemic antipsoriatic treatment in Germany, on cardiovascular risk parameters. Participants with moderate-to-severe psoriasis from the University Medical Center Mannheim and the University Hospital Würzburg were treated with FAE for 16 weeks according to standard dosage recommendations. Disease severity, life quality and depression scores as well as biomarkers of inflammation, lipid and glucose metabolism were assessed prior to initiation of FAE and after 16 weeks. Out of 39 participants recruited, 27 completed the study. 44% of all participants and 63% of those completing the 16-week treatment achieved PASI 50 response and 27 or 37% PASI 75 response. Clinical improvement was paralleled by significant improvement in quality of life, high treatment satisfaction and significant reduction of depressive symptoms. Adverse events, most frequently mild gastrointestinal complaints, flush and lymphocytopenia occurred in 89%. FAE did not modify glucose metabolism or inflammatory parameters substantially. However, a highly significant increase in serum levels of the atheroprotective cytokine adiponectin was noted after 16 weeks (median 4.7 vs. 8.9 µg/ml; p = 0.0002). Our study demonstrates a significant beneficial impact of FAE on adiponectin, indicating a potential cardioprotective effect. It will be interesting to verify this finding in larger cohorts and to assess the long-term influence of FAE on cardiovascular risk and disease.

Mitochondria dysfunctions under Fe and S deficiency: is citric acid involved in the regulation of adaptive responses?

PubMed

Vigani, Gianpiero; Pii, Youry; Celletti, Silvia; Maver, Mauro; Mimmo, Tanja; Cesco, Stefano; Astolfi, Stefania

2018-05-01

Within the last years, extensive information has been accumulated on the reciprocal influence between S and Fe nutrition at both physiological and molecular level in several plant species, but the mechanisms regulating S and Fe sensing and signaling are not fully understood. Fe and S interact for the building of Fe-S clusters, and mitochondria is one of the cellular compartments where Fe-S cluster assembly takes place. Therefore, it would be expected that mitochondria might play a central role in the regulation of Fe and S interaction. The Fe deficiency-induced alteration in the synthesis of mitochondria-derived carboxylic acids, such as citric acid, and the evidence that such molecules have already been identified as important players of metabolite signaling in several organisms, further support this hypothesis. Tomato plants were grown under single or combined Fe and S deficiency with the aim of verifying whether mitochondria activities played a role in Fe/S interaction. Both Fe and S deficiencies determined similar alteration of respiratory chain activity: a general decrease of Fe-S containing complexes as well as an increase of alternative NAD(P)H activities was observed in both Fe and S deficient-plants. However, the content of Krebs cycle-related organic acids in roots was substantially different in response to treatments, being the accumulation of citric acid always increased, while the others (i.e. succinic, malic, fumaric acids) always decreased. Interestingly, citric acid levels significantly correlated with the expression of some Fe and S deficiency induced genes. Our results contribute to existing knowledge on the complexity of the S/Fe interaction, suggesting a model in which endogenous alteration of citric acid content in plant tissues might act as signal molecule for the regulation of some nuclear-encoded and nutrient-responsive genes and also provide a basis for further study of the mechanism underlying S and Fe sensing and signalling. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Effect of heavy metals and organic matter on root exudates (low molecular weight organic acids) of herbaceous species: An assessment in sand and soil conditions under different levels of contamination.

PubMed

Montiel-Rozas, M M; Madejón, E; Madejón, P

2016-09-01

Bioavailability of heavy metals can be modified by different root exudates. Among them, low molecular weight organic acids (LMWOAs) play an important role in this process. Three plant species (Poa annua, Medicago polymorpha and Malva sylvestris), potentially used for phytoremediation, have been assessed for both metal uptake and LMWOAs excretion in contaminated environments with different concentrations of Cd, Cu and Zn. The experiments have been carried out in washed sand and in three contaminated soils where two organic amendments were added (biosolid compost and alperujo compost). The most abundant LMWOAs excreted by all studied plants were oxalic and malic acids, although citric and fumaric acids were also detected. The general tendency was that plants responded to an increase of heavy metal stress releasing higher amounts of LMWOAs. This is an efficient exclusion mechanism reducing the metal uptake and allowing the plant growth at high levels of contamination. In the experiment using wash sand as substrate, the organic acids composition and quantity depended mainly on plant species and metal contamination. M. polymorpha was the species that released the highest concentrations of LMWOAs, both in sand and in soils with no amendment addition, whereas a decrease of these acids was observed with the addition of amendments. Our results established a clear effect of organic matter on the composition and total amount of LMWOAs released. The increase of organic matter and nutrients, through amendments, improved the soil quality reducing phytotoxicity. As a result, organic acids exudates decreased and were solely composed of oxalic acid (except for M. polymorpha). The release of LMWOAs has proved to be an important mechanism against heavy metal stress, unique to each species and modifiable by means of organic amendment addition. Copyright © 2016 Elsevier Ltd. All rights reserved.

Engineering E. coli strain for conversion of short chain fatty acids to bioalcohols

PubMed Central

2013-01-01

Background Recent progress in production of various biofuel precursors and molecules, such as fatty acids, alcohols and alka(e)nes, is a significant step forward for replacing the fossil fuels with renewable fuels. A two-step process, where fatty acids from sugars are produced in the first step and then converted to corresponding biofuel molecules in the second step, seems more viable and attractive at this stage. We have engineered an Escherichia coli strain to take care of the second step for converting short chain fatty acids into corresponding alcohols by using butyrate kinase (Buk), phosphotransbutyrylase (Ptb) and aldehyde/alcohol dehydrogenase (AdhE2) from Clostridium acetobutylicum. Results The engineered E. coli was able to convert butyric acid and other short chain fatty acids of chain length C3 to C7 into corresponding alcohols and the efficiency of conversion varied with different E. coli strain type. Glycerol proved to be a better donor of ATP and electron as compared to glucose for converting butyric acid to butanol. The engineered E. coli was able to tolerate up to 100 mM butyric acid and produced butanol with the conversion rate close to 100% under anaerobic condition. Deletion of native genes, such as fumarate reductase (frdA) and alcohol dehydrogenase (adhE), responsible for side products succinate and ethanol, which act as electron sink and could compete with butyric acid uptake, did not improve the butanol production efficiency. Indigenous acyl-CoA synthetase (fadD) was found to play no role in the conversion of butyric acid to butanol. Engineered E. coli was cultivated in a bioreactor under controlled condition where 60 mM butanol was produced within 24 h of cultivation. A continuous bioreactor with the provision of cell recycling allowed the continuous production of butanol at the average productivity of 7.6 mmol/l/h until 240 h. Conclusions E. coli engineered with the pathway from C. acetobutylicum could efficiently convert butyric acid to butanol. Other short chain fatty acids with the chain length of C3 to C7 were also converted to the corresponding alcohols. The ability of engineered strain to convert butyric acid to butanol continuously demonstrates commercial significance of the system. PMID:24020887

Effect of Organic and Conventional Management on Bio-Functional Quality of Thirteen Plum Cultivars (Prunus salicina Lindl.).

PubMed

Cuevas, Francisco Julián; Pradas, Inmaculada; Ruiz-Moreno, María José; Arroyo, Francisco Teodoro; Perez-Romero, Luis Felipe; Montenegro, José Carlos; Moreno-Rojas, José Manuel

2015-01-01

In this study, thirteen Japanese plum cultivars (Prunus salicina Lindl.) grown under conventional and organic conditions were compared to evaluate the influence of the culture system on bioactive compounds. Their organic acids content (malic, citric, tartaric, succinic, shikimic, ascorbic and fumaric acid), total polyphenols, total anthocyanins, total carotenoids and antioxidant capacity (FRAP, ABTS) were evaluated. The study was performed during two consecutive seasons (2012 and 2013) in two experimental orchards located at the IFAPA centre Las Torres-Tomejil (Seville, SW Spain). The culture system affected all the studied parameters except for total carotenoid content. The organic plums had significantly higher polyphenol and anthocyanin concentrations and a greater antioxidant capacity. Additionally, significant differences between cultivars were also found. 'Showtime' and 'Friar' were the cultivars with the highest polyphenol concentration and antioxidant capacity. 'Black Amber' had the highest anthocyanin content and 'Larry Ann' and 'Songold' the highest carotenoid content. 'Sapphire' and 'Black amber' were the cultivars with the highest concentration of ascorbic acid. Our results showed a strong year effect. In conclusion, organic management had an impact on the production of phytochemical compounds in plums.

Effect of Organic and Conventional Management on Bio-Functional Quality of Thirteen Plum Cultivars (Prunus salicina Lindl.)

PubMed Central

Cuevas, Francisco Julián; Pradas, Inmaculada; Ruiz‐Moreno, María José; Arroyo, Francisco Teodoro; Perez-Romero, Luis Felipe; Montenegro, José Carlos; Moreno‐Rojas, José Manuel

2015-01-01

In this study, thirteen Japanese plum cultivars (Prunus salicina Lindl.) grown under conventional and organic conditions were compared to evaluate the influence of the culture system on bioactive compounds. Their organic acids content (malic, citric, tartaric, succinic, shikimic, ascorbic and fumaric acid), total polyphenols, total anthocyanins, total carotenoids and antioxidant capacity (FRAP, ABTS) were evaluated. The study was performed during two consecutive seasons (2012 and 2013) in two experimental orchards located at the IFAPA centre Las Torres-Tomejil (Seville, SW Spain). The culture system affected all the studied parameters except for total carotenoid content. The organic plums had significantly higher polyphenol and anthocyanin concentrations and a greater antioxidant capacity. Additionally, significant differences between cultivars were also found. ‘Showtime’ and ‘Friar’ were the cultivars with the highest polyphenol concentration and antioxidant capacity. ‘Black Amber’ had the highest anthocyanin content and ‘Larry Ann’ and ‘Songold’ the highest carotenoid content. ‘Sapphire’ and ‘Black amber’ were the cultivars with the highest concentration of ascorbic acid. Our results showed a strong year effect. In conclusion, organic management had an impact on the production of phytochemical compounds in plums. PMID:26313546

The Compositional HJ-Biplot—A New Approach to Identifying the Links among Bioactive Compounds of Tomatoes

PubMed Central

Hernández Suárez, Marcos; Molina Pérez, Daniel; Rodríguez-Rodríguez, Elena M.; Díaz Romero, Carlos; Espinosa Borreguero, Francisco; Galindo-Villardón, Purificación

2016-01-01

Tomatoes have been described as a functional food because of their particular composition of different bioactive compounds. In this study, the proximate composition, minerals and trace elements, and antioxidant compounds were determined in two tomato cultivars (Mariana and Dunkan) that were grown in Gran Canaria (Spain) either conventionally or hydroponically. Although compositional data of this type require being subjected to the specific statistical techniques of compositional analysis, this approach has not usually been considered in this context. In the present case, a compositional Mann–Whitney U test of the data showed significant differences for each factor (cultivar and cultivation system) in several of the compositional variables studied. For the differences between cultivars, these parameters were the protein, Mg, lycopene, ascorbic acid, citric acid, and fumaric acid contents. For the differences between cultivation systems, they were mainly those of the mineral and trace elements group. Although one-year data are insufficient to make clear relationship among compounds because more repetitions in several localities and years are necessary, the compositional HJ-biplot (in which the links provide estimates of the linear relationship among variables) results agreed with other scientific results about linear relationship among some compounds analyzed. PMID:27827839

Comparative analysis of Danggui and European Danggui using nuclear magnetic resonance-based metabolic fingerprinting.

PubMed

Li, Zhen-Yu; Zhang, Zheng-Zheng; Du, Guan-Hua; Qin, Xue-Mei

2015-01-25

Danggui is a widely used herbal drug in traditional Chinese medicine, and adulteration with European Danggui is frequently encountered in the market. We compared the chemical compositions and biological effects of Danggui and European Danggui using proton nuclear magnetic resonance spectroscopy coupled with multivariate analysis. Results showed that Danggui and European Danggui differed in both primary and secondary metabolites. Danggui contained higher levels of alanine, γ-aminobutyrate, adenosine, arginine, sucrose, α-glucose, β-glucose, tryptophan, and cis-Z,Z'-3a.7a',7a.3a'-dihydroxyligustilide than European Danggui. Meanwhile, European Danggui contained higher contents of valine, proline, fumaric acid, phenylalanine, nicotinamide derivative, Z-butylidenephthalide, coniferyl ferulate, ferulic acid, Z-ligustilide, and Z,Z-6,6'7,3a-diligustilide than Danggui. A blood deficiency model was used to compare the biological effects of the two drugs. Despite its higher levels of Z-ligustilide and ferulic acid, European Danggui showed a weaker blood enriching effect than Danggui. Thus, the bioactive compounds responsible for the blood enriching effect in Danggui and their possible synergistic effects should be further studied. Copyright © 2014 Elsevier B.V. All rights reserved.

Adjustment of growth and central metabolism to a mild but sustained nitrogen-limitation in Arabidopsis.

PubMed

Tschoep, Hendrik; Gibon, Yves; Carillo, Petronia; Armengaud, Patrick; Szecowka, Marek; Nunes-Nesi, Adriano; Fernie, Alisdair R; Koehl, Karin; Stitt, Mark

2009-03-01

We have established a simple soil-based experimental system that allows a small and sustained restriction of growth of Arabidopsis by low nitrogen (N). Plants were grown in a large volume of a peat-vermiculite mix that contained very low levels of inorganic N. As a control, inorganic N was added in solid form to the peat-vermiculite mix, or plants were grown in conventional nutrient-rich solids. The low N growth regime led to a sustained 20% decrease of the relative growth rate over a period of 2 weeks, resulting in a two- to threefold decrease in biomass in 35- to 40-day-old plants. Plants in the low N regime contained lower levels of nitrate, lower nitrate reductase activity, lower levels of malate, fumarate and other organic acids and slightly higher levels of starch, as expected from published studies of N-limited plants. However, their rosette protein content was unaltered, and total and many individual amino acid levels increased compared with N-replete plants. This metabolic phenotype reveals that Arabidopsis responds adaptively to low N by decreasing the rate of growth, while maintaining the overall protein content, and maintaining or even increasing the levels of many amino acids.

Long-term trend of dicarboxylic acids, ketoacids and dicarbonyls in the marine aerosols over the western North Pacific in 2001-2006

NASA Astrophysics Data System (ADS)

Kawamura, K.; Tachibana, E.; Mochida, M.

2006-12-01

To understand a long-range atmospheric transport of water-soluble organics in the western North Pacific, remote marine aerosols were collected on weekly basis at a subtropical island (Chichijima, 142E; 27N) from 2001 to 2006 using a high volume air sampler and pre-combusted quartz filter. The island is located in the boundary of westerly and trade wind regimes. The aerosols were analyzed for dicarboxylic acids, ketoacids and dicarbonyls employing butyl ester derivatization followed by GC determination. Homologous saturated diacids (C2-C11) were detected with a predominance of oxalic (C2) acid followed by malonic (C3) and succinic (C4) acids as well as unsaturated diacids, including maleic (M), fumaric (F), phthalic acids. Ketoacids and dicarbonyls were also detected. Concentrations of total diacids fluctuated significantly in a range of 10-600 ngm-3 with winter/spring maximum and summer minimum. The winter/spring maximum can be explained by a combinattion of enhanced emissions of polluted aerosols and their precursors in Asia and the intensified westerlies over the North Pacific in the season. Seasonal trends of the molecular compositions were also found. For example, concentration ratios of C3 to C4 acid showed a maximum in summer, indicating more oxidation of longer-chain diacids to shorter ones. M/F ratios increased from summer to winter as a result of photochemically-induced isomerization of cis and trans configuration of unsaturated diacids. On the other hand, azelaic acid (C9) relative to other diacids showed a sharp increase in summer. Because C9 is a specific photo-oxidation product of unsaturated fatty acid such as oleic acid, this demonstrates an enhanced sea-to- air emission of unsaturated fatty acids in summer followed by photochemical oxidation. Long-term trends of diacids and related compounds in the aerosols will be discussed for 2001 to 2006. The results will also be compared with those obtained at the same site for 1990 to 1993 to detect long-term changes in the organic aerosol compositions that might be happened over the western North Pacific due to the enhanced human activity in East Asia.

Photocatalytic ozonation of terephthalic acid: a by-product-oriented decomposition study.

PubMed

Fuentes, Iliana; Rodríguez, Julia L; Poznyak, Tatyana; Chairez, Isaac

2014-11-01

Terephthalic acid (TA) is considered as a refractory model compound. For this reason, the TA degradation usually requires a prolonged reaction time to achieve mineralization. In this study, vanadium oxide (VxOy) supported on titanium oxide (TiO2) served as a photocatalyst in the ozonation of the TA with light-emitting diodes (LEDs), having a bandwidth centered at 452 nm. The modified catalyst (VxOy/TiO2) in combination with ozone and LEDs improved the TA degradation and its by-products. The results obtained by this system were compared with photolysis, single ozonation, catalytic ozonation, and photocatalytic ozonation of VxOy/TiO2 with UV lamp. The LED-based photocatalytic ozonation showed almost the same decomposition efficiency of the TA, but it was better in comparison with the use of UV lamp. The oxalic acid accumulation, as the final product of the TA decomposition, was directly influenced by either the presence of VxOy or/and the LED irradiation. Several by-products formed during the TA degradation, such as muconic, fumaric, and oxalic acids, were identified. Besides, two unidentified by-products were completely removed during the observed time (60 min). It was proposed that the TA elimination in the presence of VxOy/TiO2 as catalyst was carried out by the combination of different mechanisms: molecular ozone reaction, indirect mechanism conducted by ·OH, and the surface complex formation.

Aminiphilus circumscriptus gen. nov., sp. nov., an anaerobic amino-acid-degrading bacterium from an upflow anaerobic sludge reactor.

PubMed

Díaz, C; Baena, S; Fardeau, M-L; Patel, B K C

2007-08-01

Strain ILE-2(T) was isolated from an upflow anaerobic sludge bed reactor treating brewery wastewater. The motile, non-sporulating, slightly curved cells (2-4 x 0.1 microm) stained Gram-negative and grew optimally at 42 degrees C and pH 7.1 with 0.5 % NaCl. The strain required yeast extract for growth and fermented Casamino acids, peptone, isoleucine, arginine, lysine, alanine, valine, glutamate, histidine, glutamine, methionine, malate, fumarate, glycerol and pyruvate to acetate, propionate and minor amounts of branched-chain fatty acids. Carbohydrates, formate, acetate, propionate, butyrate, isovalerate, methanol, ethanol, 1-propanol, butanol, lactate, succinate, starch, casein, gelatin, xylan and a number of other amino acids were not utilized. The DNA G+C content of strain ILE-2(T) was 52.7 mol%. 16S rRNA gene sequence analysis revealed that ILE-2(T) was distantly related to members of the genera Aminobacterium (83 % similarity) and Aminomonas (85 % similarity) in the family Syntrophomonadaceae, order Clostridiales, phylum Firmicutes. On the basis of the results of our polyphasic analysis, strain ILE-2(T) represents a novel species and genus within the family Syntrophomonadaceae, for which the name Aminiphilus circumscriptus gen. nov., sp. nov. is proposed. The type strain of Aminiphilus circumscriptus is ILE-2(T) (=DSM 16581(T) =JCM 14039(T)).

Syntrophus aciditrophicus sp. nov., a new anaerobic bacterium that degrades fatty acids and benzoate in syntrophic association with hydrogen-using microorganisms

NASA Technical Reports Server (NTRS)

Jackson, B. E.; Bhupathiraju, V. K.; Tanner, R. S.; Woese, C. R.; McInerney, M. J.

1999-01-01

Strain SBT is a new, strictly anaerobic, gram-negative, nonmotile, non-sporeforming, rod-shaped bacterium that degrades benzoate and certain fatty acids in syntrophic association with hydrogen/formate-using microorganisms. Strain SBT produced approximately 3 mol of acetate and 0.6 mol of methane per mol of benzoate in coculture with Methanospirillum hungatei strain JF1. Saturated fatty acids, some unsaturated fatty acids, and methyl esters of butyrate and hexanoate also supported growth of strain SBT in coculture with Desulfovibrio strain G11. Strain SBT grew in pure culture with crotonate, producing acetate, butyrate, caproate, and hydrogen. The molar growth yield was 17 +/- 1 g cell dry mass per mol of crotonate. Strain SBT did not grow with fumarate, iron(III), polysulfide, or oxyanions of sulfur or nitrogen as electron acceptors with benzoate as the electron donor. The DNA base composition of strain SBT was 43.1 mol% G+C. Analysis of the 16 S rRNA gene sequence placed strain SBT in the delta-subdivision of the Proteobacteria, with sulfate-reducing bacteria. Strain SBT was most closely related to members of the genus Syntrophus. The clear phenotypic and genotypic differences between strain SBT and the two described species in the genus Syntrophus justify the formation of a new species, Syntrophus aciditrophicus.

Knocking down mitochondrial iron transporter (MIT) reprograms primary and secondary metabolism in rice plants.

PubMed

Vigani, Gianpiero; Bashir, Khurram; Ishimaru, Yasuhiro; Lehmann, Martin; Casiraghi, Fabio Marco; Nakanishi, Hiromi; Seki, Motoaki; Geigenberger, Peter; Zocchi, Graziano; Nishizawa, Naoko K

2016-03-01

Iron (Fe) is an essential micronutrient for plant growth and development, and its reduced bioavailability strongly impairs mitochondrial functionality. In this work, the metabolic adjustment in the rice (Oryza sativa) mitochondrial Fe transporter knockdown mutant (mit-2) was analysed. Biochemical characterization of purified mitochondria from rice roots showed alteration in the respiratory chain of mit-2 compared with wild-type (WT) plants. In particular, proteins belonging to the type II alternative NAD(P)H dehydrogenases accumulated strongly in mit-2 plants, indicating that alternative pathways were activated to keep the respiratory chain working. Additionally, large-scale changes in the transcriptome and metabolome were observed in mit-2 rice plants. In particular, a strong alteration (up-/down-regulation) in the expression of genes encoding enzymes of both primary and secondary metabolism was found in mutant plants. This was reflected by changes in the metabolic profiles in both roots and shoots of mit-2 plants. Significant alterations in the levels of amino acids belonging to the aspartic acid-related pathways (aspartic acid, lysine, and threonine in roots, and aspartic acid and ornithine in shoots) were found that are strictly connected to the Krebs cycle. Furthermore, some metabolites (e.g. pyruvic acid, fumaric acid, ornithine, and oligosaccharides of the raffinose family) accumulated only in the shoot of mit-2 plants, indicating possible hypoxic responses. These findings suggest that the induction of local Fe deficiency in the mitochondrial compartment of mit-2 plants differentially affects the transcript as well as the metabolic profiles in root and shoot tissues. © The Author 2015. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Alternative Oxidase Isoforms Are Differentially Activated by Tricarboxylic Acid Cycle Intermediates.

PubMed

Selinski, Jennifer; Hartmann, Andreas; Deckers-Hebestreit, Gabriele; Day, David A; Whelan, James; Scheibe, Renate

2018-02-01

The cyanide-insensitive alternative oxidase (AOX) is a non-proton-pumping ubiquinol oxidase that catalyzes the reduction of oxygen to water and is posttranslationally regulated by redox mechanisms and 2-oxo acids. Arabidopsis ( Arabidopsis thaliana ) possesses five AOX isoforms (AOX1A-AOX1D and AOX2). AOX1D expression is increased in aox1a knockout mutants from Arabidopsis (especially after restriction of the cytochrome c pathway) but cannot compensate for the lack of AOX1A, suggesting a difference in the regulation of these isoforms. Therefore, we analyzed the different AOX isoenzymes with the aim to identify differences in their posttranslational regulation. Seven tricarboxylic acid cycle intermediates (citrate, isocitrate, 2-oxoglutarate, succinate, fumarate, malate, and oxaloacetate) were tested for their influence on AOX1A, AOX1C, and AOX1D wild-type protein activity using a refined in vitro system. AOX1C is insensitive to all seven organic acids, AOX1A and AOX1D are both activated by 2-oxoglutarate, but only AOX1A is additionally activated by oxaloacetate. Furthermore, AOX isoforms cannot be transformed to mimic one another by substituting the variable cysteine residues at position III in the protein. In summary, we show that AOX isoforms from Arabidopsis are differentially fine-regulated by tricarboxylic acid cycle metabolites (most likely depending on the amino-terminal region around the highly conserved cysteine residues known to be involved in regulation by the 2-oxo acids pyruvate and glyoxylate) and propose that this is the main reason why they cannot functionally compensate for each other. © 2018 American Society of Plant Biologists. All Rights Reserved.

High abundances of water-soluble dicarboxylic acids, ketocarboxylic acids and α-dicarbonyls in the mountain aerosols over the North China Plain during wheat burning season

NASA Astrophysics Data System (ADS)

Kawamura, K.; Tachibana, E.; Okuzawa, K.; Aggarwal, S. G.; Kanaya, Y.; Wang, Z. F.

2013-02-01

Aerosol (TSP) samples were collected at the summit of Mount Tai (elevation: 1534 m a.s.l., 36.25° N; 117.10° E) located in the North China Plain using a high-volume air sampler and pre-combusted quartz filters. Sampling was conducted on day/night or 3 h basis in the period from 29 May to 28 June 2006 during the field burning of wheat straw residue and the post-burning season. The filter samples were analyzed for low molecular weight dicarboxylic acids, ketoacids and α-dicarbonyls using capillary gas chromatography (GC) and GC-MS employing water extraction and butyl ester derivatization. Dicarboxylic acids (C2-C11, 220-6070 ng m-3) were characterized by a predominance of oxalic (C2) acid (105-3920 ng m-3) followed by succinic (C4) or malonic (C3) acid. Unsaturated aliphatic diacids, including maleic (M), isomaleic (iM) and fumaric (F) acid, were also detected together with aromatic diacids (phthalic, iso-phthalic and tere-phthalic acids). ω-Oxocarboxylic acids (C2-C9, 24-610 ng m-3) were detected as the second most abundant compound class with the predominance of glyoxylic acid (11-360 ng m-3), followed by α-ketoacid (pyruvic acid, 3-140 ng m-3) and α-dicarbonyls (glyoxal, 1-230 ng m-3 and methylglyoxal, 2-120 ng m-3). We found that these levels (> 6000 ng m-3 for diacids) are several times higher than those reported in Chinese megacities at ground levels. The concentrations of diacids increased from late May to early June showing a maximum on 7 June and then significantly decreased during 8-11 June when the wind direction shifted from northeasterly to northerly. Similar temporal trends were found for ketocarboxylic acids and α-dicarbonyls as well as total carbon (TC) and water-soluble organic carbon (WSOC). The temporal variations of water-soluble organics were interpreted by the direct emission from the field burning products of agricultural wastes (wheat straw) in the North China Plain and the subsequent photochemical oxidation of volatile and semi-volatile organic precursors emitted from field burning. This study demonstrates that the field burning of agricultural wastes in early summer strongly influenced the air quality of the free troposphere over the North China Plain.

Aquatic photolysis: photolytic redox reactions between goethite and adsorbed organic acids in aqueous solutions

USGS Publications Warehouse

Goldberg, M.C.; Cunningham, K.M.; Weiner, Eugene R.

1993-01-01

Photolysis of mono and di-carboxylic acids that are adsorbed onto the surface of the iron oxyhydroxide (goethite) results in an oxidation of the organic material and a reduction from Fe(III) to Fe(II) in the iron complex. There is a subsequent release of Fe2+ ions into solution. At constant light flux and constant solution light absorption, the factors responsible for the degree of photolytic reaction include: the number of lattice sites that are bonded by the organic acid; the rate of acid readsorption to the surface during photolysis; the conformation and structure of the organic acid; the degree of oxidation of the organic acid; the presence or absence of an ??-hydroxy group on the acid, the number of carbons in the di-acid chain and the conformation of the di-acid. The ability to liberate Fe(III) at pH 6.5 from the geothite lattice is described by the lyotropic series: tartrate>citrate> oxalate > glycolate > maleate > succinate > formate > fumarate > malonate > glutarate > benzoate = butanoate = control. Although a larger amount of iron is liberated, the series is almost the same at pH 5.5 except that oxalate > citrate and succinate > maleate. A set of rate equations are given that describe the release of iron from the goethite lattice. It was observed that the pH of the solution increases during photolysis if the solutions are not buffered. There is evidence to suggest the primary mechanism for all these reactions is an electron transfer from the organic ligand to the Fe(III) in the complex. Of all the iron-oxyhydroxide materials, crystalline goethite is the least soluble in water; yet, this study indicates that in an aqueous suspension, iron can be liberated from the goethite lattice. Further, it has been shown that photolysis can occur in a multiphase system at the sediment- water interface which results in an oxidation of the organic species and release of Fe2+ to solution where it becomes available for further reaction. ?? 1993.

Molecular compositions and decadal trends of dicarboxylic acids, ketoacids, α-dicarbonyls in the marine aerosols from Chichi-Jima Island in the western North Pacific

NASA Astrophysics Data System (ADS)

Kawamura, K.; Tachibana, E.

2010-12-01

A rapid industrial development in China and East Asian countries for last two decades may have seriously changed the air quality of the North Pacific. To better understand a long-term atmospheric changes of organic aerosols in the western North Pacific, we collected marine aerosol samples on weekly basis at a remote island, Chichijima (27°04'E; 142°13'N) in 2001-2010. The island is located in the boundary of westerly and easterly wind regimes. The aerosol samples were analyzed for dicarboxylic acids, ketoacids and α-dicarbonyls employing butyl ester derivatization followed by GC determination, together with total carbon (TC) and water-soluble organic carbon (WSOC). Homologous series of saturated diacids (C2-C11) were detected with a predominance of oxalic (C2) acid followed by malonic (C3) and succinic (C4) acids. Unsaturated diacids, including maleic (M), fumaric (F), phthalic, and iso-/tere-phthalic acids, were also detected together with ketoacids and α-dicarbonyls. Concentrations of total diacids fluctuated significantly in a range of 10-600 ngm-3 with winter/spring maximum and summer minimum. The maximum was explained by a combination of enhanced emissions of polluted aerosols and their precursors in Asia and enhanced atmospheric transport to the North Pacific due to the intensified westerly winds in winter/spring. Concentration ratios of C3 to C4 diacid (range 0.2-28, av. 2.8) showed a maximum during summer, indicating more oxidation of longer-chain diacids to shorter ones. Azelaic acid (C9) that is a specific photo-oxidation product of unsaturated fatty acid such as oleic acid showed a sharp increase relative to other diacids in summer, suggesting enhanced sea-to-air emission of unsaturated fatty acids followed by photochemical oxidation during summer. On the other hand, M/F ratios (range 0-8.7, av. 1.1) significantly decreased from winter to summer due to photochemical cis-to-trans isomerization. We also discuss decadal trends in the concentrations of diacids and related compounds as well as TC and WSOC, and their compositions and relative abundances.

Capsicum chinensis L. growth and nutraceutical properties are enhanced by biostimulants in a long-term period: chemical and metabolomic approaches

PubMed Central

Ertani, Andrea; Pizzeghello, Diego; Francioso, Ornella; Sambo, Paolo; Sanchez-Cortes, Santiago; Nardi, Serenella

2014-01-01

Two biostimulants, one derived from alfalfa plants (AH) and the other obtained from red grape (RG), were chemically characterized using enzyme linked immuno-sorbent assays, Fourier transform infrared (FT-IR) and Raman spectroscopies. Two doses (50 and 100 mL L−1 for RG, and 25 and 50 mL L−1 for AH) of biostimulants were applied to Capsicum chinensis L. plants cultivated in pots inside a tunnel. The experimental design consisted of the factorial combination of treatment (no biostimulant, plus AH, plus RG) at three doses (zero, low, and high) and two time-course applications (at the second and fourth week after transplantation) and the effects were recorded at flowering and maturity. Both biostimulants contained different amounts of indoleacetic acid and isopentenyladenosine; the AH spectra exhibited amino acid functional groups in the peptidic structure, while the RG spectra showed the presence of polyphenols, such as resveratrol. These results revealed that at flowering, RG and AH increased the weights of fresh leaves and fruits and the number of green fruits, whereas at maturity, the biostimulants most affected the fresh weight and number of red fruits. At flowering, the leaves of the treated plants contained high amounts of epicatechin, ascorbic acid, quercetin, and dihydrocapsaicin. At maturity, the leaves of the treated plants exhibited elevated amounts of fructose, glucose, chlorogenic, and ferulic acids. Moreover, green fruits exhibited a high content of chlorogenic acid, p-hydroxybenzoic acid, p-coumaric acid and antioxidant activity, while both AH- and RG-treated red fruits were highly endowed in capsaicin. The 1H high-resolution magic-angle spinning (HRMAS)-nuclear magnetic resonance (NMR) spectra of red fruits revealed that both products induced a high amount of NADP+, whereas RG also increased glucose, fumarate, ascorbate, thymidine and high molecular weight species. Our results suggested that AH and RG promoted plant growth and the production of secondary metabolites, such as phenols. PMID:25136346

Effect of Bulk MoS₂ on the Metabolic Profile of Yeast.

PubMed

Yu, Yadong; Yang, Qi; Wu, Na; Tang, Hanlin; Yi, Yanliang; Wang, Gaihong; Ge, Yilin; Zong, Jiajun; Madzak, Catherine; Zhao, Ye; Jiang, Ling; Huang, He

2018-06-01

MoS2, a kind of two-dimensional material with unique performances, has been widely used in many fields. However, an in-depth understanding of its toxicity is still needed, let alone its effects on the environmental microorganism. Herein, we used different methods, including metabolomics technology, to investigate the influence of bulk MoS2 (BMS) on yeast cells. The results indicated that high concentrations (1 mg/L and more) of BMS could destroy cell membrane and induce ROS accumulation. When exposed to a low concentration of BMS (0.1 mg/L), the intracellular concentrations of many metabolites (e.g., fumaric acid, lysine) increased. However, most of their concentrations descended significantly as the yeast cells were treated with BMS of high concentrations (1 mg/L and more). Metabolomics analysis further revealed that exposure to high concentrations of BMS could significantly affect some metabolic pathways such as amino acid and citrate cycle related metabolism. These findings will be beneficial for MoS2 toxicity assessment and further applications.

Effect of high pressure treatment on metabolite profile of marinated meat in soy sauce.

PubMed

Yang, Yang; Ye, Yangfang; Wang, Ying; Sun, Yangying; Pan, Daodong; Cao, Jinxuan

2018-02-01

Marinated meat in soy sauce was produced using hind leg by washing, rubbing salt, marinating with soy sauce and spices, and air dry-ripening for 15d. The effect of high pressure (HP) (150 and 300MPa for 15min) on the metabolite profiles of products was characterized using 1 H NMR and multivariate data analysis. The results showed that the metabonome was dominated by 26 metabolites, including amino acids, sugars, organic acids, nucleic aides and their derivatives. PC1 and PC2 explained a total of 75.4 and 11.9% of variables, respectively. HP treatments increased most of the metabolites, especially PC1, glutamate, sugars, nucleotides, anserine, lactate and creatine compared to the control. The increase of metabolites under HP was not dependent on pressure level except for alanine, lactate, acetate, formate, fumarate, glucose and 5'-IMP. These findings demonstrated that HP treatment at 150MPa was economical to improve the taste of marinated meat in soy sauce. Copyright © 2017 Elsevier Ltd. All rights reserved.

Development of Competence of Haemophilus influenzae

PubMed Central

Spencer, Hugh T.; Herriott, Roger M.

1965-01-01

Spencer, Hugh T. (The Johns Hopkins University School of Hygiene and Public Health, Baltimore, Md.), and Roger M. Herriott. Development of competence of Haemophilus influenzae. J. Bacteriol. 90:911–920. 1965.—A chemically defined nongrowth medium was developed for the induction of competence of Haemophilus influenzae by a stepdown procedure. Cells grown logarithmically in Heart Infusion Broth became competent after being transferred to a medium which consisted of amino acids, sodium fumarate, and inorganic salts. Chloramphenicol (2 μg/ml) or l-valine (1 μg/ml) in the nongrowth medium inhibited development of competence. The inhibitory action of l-valine was reversed by comparable concentrations of l-isoleucine. Kinetic studies of the development of competence showed a variable capacity of competent cells to take up deoxyribonucleic acid and reaffirmed earlier findings that competence was not transmissible in H. influenzae. Addition of nicotinamide adenine dinucleotide, thiamine, calcium pantothenate, uracil, and hypoxanthine to the medium for competence resulted in a minimal growth medium in which reduced levels of competence were developed. PMID:5294817

Identification of crude-oil components and microorganisms that cause souring under anaerobic conditions.

PubMed

Hasegawa, R; Toyama, K; Miyanaga, K; Tanji, Y

2014-02-01

Oil souring has important implications with respect to energy resources. Understanding the physiology of the microorganisms that play a role and the biological mechanisms are both important for the maintenance of infrastructure and mitigation of corrosion processes. The objective of this study was to identify crude-oil components and microorganisms in oil-field water that contribute to crude-oil souring. To identify the crude-oil components and microorganisms that are responsible for anaerobic souring in oil reservoirs, biological conversion of crude-oil components under anaerobic conditions was investigated. Microorganisms in oil field water in Akita, Japan degraded alkanes and aromatics to volatile fatty acids (VFAs) under anaerobic conditions, and fermenting bacteria such as Fusibacter sp. were involved in VFA production. Aromatics such as toluene and ethylbenzene were degraded by sulfate-reducing bacteria (Desulfotignum sp.) via the fumarate-addition pathway and not only degradation of VFA but also degradation of aromatics by sulfate-reducing bacteria was the cause of souring. Naphthenic acid and 2,4-xylenol were not converted.

Products of Dark CO2 Fixation in Pea Root Nodules Support Bacteroid Metabolism 1

PubMed Central

Rosendahl, Lis; Vance, Carroll P.; Pedersen, Walther B.

1990-01-01

Products of the nodule cytosol in vivo dark [14C]CO2 fixation were detected in the plant cytosol as well as in the bacteroids of pea (Pisum sativum L. cv “Bodil”) nodules. The distribution of the metabolites of the dark CO2 fixation products was compared in effective (fix+) nodules infected by a wild-type Rhizobium leguminosarum (MNF 300), and ineffective (fix−) nodules of the R. leguminosarum mutant MNF 3080. The latter has a defect in the dicarboxylic acid transport system of the bacterial membrane. The 14C incorporation from [14C]CO2 was about threefold greater in the wild-type nodules than in the mutant nodules. Similarly, in wild-type nodules the in vitro phosphoenolpyruvate carboxylase activity was substantially greater than that of the mutant. Almost 90% of the 14C label in the cytosol was found in organic acids in both symbioses. Malate comprised about half of the total cytosol organic acid content on a molar basis, and more than 70% of the cytosol radioactivity in the organic acid fraction was detected in malate in both symbioses. Most of the remaining 14C was contained in the amino acid fraction of the cytosol in both symbioses. More than 70% of the 14C label found in the amino acids of the cytosol was incorporated in aspartate, which on a molar basis comprised only about 1% of the total amino acid pool in the cytosol. The extensive 14C labeling of malate and aspartate from nodule dark [14C]CO2 fixation is consistent with the role of phosphoenolpyruvate carboxlase in nodule dark CO2 fixation. Bacteroids from the effective wild-type symbiosis accumulated sevenfold more 14C than did the dicarboxylic acid transport defective bacteroids. The bacteroids of the effective MNF 300 symbiosis contained the largest proportion of the incorporated 14C in the organic acids, whereas ineffective MNF 3080 bacteroids mainly contained 14C in the amino acid fraction. In both symbioses a larger proportion of the bacteroid 14C label was detected in malate and aspartate than their corresponding proportions of the organic acids and amino acids on a molar basis. The proportion of 14C label in succinate, 2-oxogultarate, citrate, and fumarate in the bacteroids of the wild type greatly exceeded that of the dicarboxylate uptake mutant. The results indicate a central role for nodule cytosol dark CO2 fixation in the supply of the bacteroids with dicarboxylic acids. PMID:16667422

High abundances of water-soluble dicarboxylic acids, ketocarboxylic acids and α-dicarbonyls in the mountaintop aerosols over the North China Plain during wheat burning season

NASA Astrophysics Data System (ADS)

Kawamura, K.; Tachibana, E.; Okuzawa, K.; Aggarwal, S. G.; Kanaya, Y.; Wang, Z. F.

2013-08-01

Aerosol (TSP) samples were collected at the summit of Mount Tai (elevation: 1534 m a.s.l., 36.25° N, 117.10° E) located in the North China Plain using a high-volume air sampler and pre-combusted quartz filters. Sampling was conducted on day/night or 3 h basis in the period from 29 May to 28 June 2006 during the field burning of wheat straw residue and the post-burning season. The filter samples were analyzed for low-molecular-weight dicarboxylic acids, ketoacids and α-dicarbonyls using capillary gas chromatography (GC) and GC-MS employing water extraction and butyl ester derivatization. Molecular distributions of dicarboxylic acids (C2-C11, 220-6070 ng m-3) were characterized by a predominance of oxalic (C2) acid (105-3920 ng m-3) followed by succinic (C4) or malonic (C3) acid. Unsaturated aliphatic diacids, including maleic (M), isomaleic (iM) and fumaric (F) acids, were also detected together with aromatic diacids (phthalic, isophthalic and terephthalic acids). ω-oxocarboxylic acids (C2-C9, 24-610 ng m-3) were detected as the second most abundant compound class with the predominance of glyoxylic acid (11-360 ng m-3), followed by α-ketoacid (pyruvic acid, 3-140 ng m-3) and α-dicarbonyls (glyoxal, 1-230 ng m-3 and methylglyoxal, 2-120 ng m-3). We found that these levels (>6000 ng m-3 for diacids) are several times higher than those reported in Chinese megacities at ground levels. The concentrations of diacids increased from late May to early June, showing a maximum on 7 June, and then significantly decreased during the period 8-11 June, when the wind direction shifted from southerly to northerly. Similar temporal trends were found for ketocarboxylic acids and α-dicarbonyls as well as total carbon (TC) and water-soluble organic carbon (WSOC). The temporal variations of water-soluble organics were interpreted by the direct emission from the field burning of agricultural wastes (wheat straw) in the North China Plain and the subsequent photochemical oxidation of volatile and semi-volatile organic precursors emitted from field burning as well as dark ozonolysis of volatile organic compounds and other organics, accretion reactions and oxidation of nonvolatile organics such as unsaturated fatty acids. This study demonstrates that the field burning of agricultural wastes in early summer strongly influenced the air quality of the free troposphere over the North China Plain.

Metabolomic Analysis of Alfalfa (Medicago sativa L.) Root-Symbiotic Rhizobia Responses under Alkali Stress.

PubMed

Song, Tingting; Xu, Huihui; Sun, Na; Jiang, Liu; Tian, Pu; Yong, Yueyuan; Yang, Weiwei; Cai, Hua; Cui, Guowen

2017-01-01

Alkaline salts (e.g., NaHCO 3 and Na 2 CO 3 ) causes more severe morphological and physiological damage to plants than neutral salts (e.g., NaCl and Na 2 SO 4 ) due to differences in pH. The mechanism by which plants respond to alkali stress is not fully understood, especially in plants having symbotic relationships such as alfalfa ( Medicago sativa L.). Therefore, a study was designed to evaluate the metabolic response of the root-nodule symbiosis in alfalfa under alkali stress using comparative metabolomics. Rhizobium-nodulized (RI group) and non-nodulized (NI group) alfalfa roots were treated with 200 mmol/L NaHCO 3 and, roots samples were analyzed for malondialdehydyde (MDA), proline, glutathione (GSH), superoxide dismutase (SOD), and peroxidase (POD) content. Additionally, metabolite profiling was conducted using gas chromatography combined with time-of-flight mass spectrometry (GC/TOF-MS). Phenotypically, the RI alfalfa exhibited a greater resistance to alkali stress than the NI plants examined. Physiological analysis and metabolic profiling revealed that RI plants accumulated more antioxidants (SOD, POD, GSH), osmolytes (sugar, glycols, proline), organic acids (succinic acid, fumaric acid, and alpha-ketoglutaric acid), and metabolites that are involved in nitrogen fixation. Our pairwise metabolomics comparisons revealed that RI alfalfa plants exhibited a distinct metabolic profile associated with alkali putative tolerance relative to NI alfalfa plants. Data provide new information about the relationship between non-nodulized, rhizobium-nodulized alfalfa and alkali resistance.

Metabolomic Analysis of Alfalfa (Medicago sativa L.) Root-Symbiotic Rhizobia Responses under Alkali Stress

PubMed Central

Song, Tingting; Xu, Huihui; Sun, Na; Jiang, Liu; Tian, Pu; Yong, Yueyuan; Yang, Weiwei; Cai, Hua; Cui, Guowen

2017-01-01

Alkaline salts (e.g., NaHCO3 and Na2CO3) causes more severe morphological and physiological damage to plants than neutral salts (e.g., NaCl and Na2SO4) due to differences in pH. The mechanism by which plants respond to alkali stress is not fully understood, especially in plants having symbotic relationships such as alfalfa (Medicago sativa L.). Therefore, a study was designed to evaluate the metabolic response of the root-nodule symbiosis in alfalfa under alkali stress using comparative metabolomics. Rhizobium-nodulized (RI group) and non-nodulized (NI group) alfalfa roots were treated with 200 mmol/L NaHCO3 and, roots samples were analyzed for malondialdehydyde (MDA), proline, glutathione (GSH), superoxide dismutase (SOD), and peroxidase (POD) content. Additionally, metabolite profiling was conducted using gas chromatography combined with time-of-flight mass spectrometry (GC/TOF-MS). Phenotypically, the RI alfalfa exhibited a greater resistance to alkali stress than the NI plants examined. Physiological analysis and metabolic profiling revealed that RI plants accumulated more antioxidants (SOD, POD, GSH), osmolytes (sugar, glycols, proline), organic acids (succinic acid, fumaric acid, and alpha-ketoglutaric acid), and metabolites that are involved in nitrogen fixation. Our pairwise metabolomics comparisons revealed that RI alfalfa plants exhibited a distinct metabolic profile associated with alkali putative tolerance relative to NI alfalfa plants. Data provide new information about the relationship between non-nodulized, rhizobium-nodulized alfalfa and alkali resistance. PMID:28744296

Carboxylic acids permeases in yeast: two genes in Kluyveromyces lactis.

PubMed

Lodi, Tiziana; Fontanesi, Flavia; Ferrero, Iliana; Donnini, Claudia

2004-09-15

Two new genes KlJEN1 and KlJEN2 were identified in Kluyveromyces lactis. The deduced structure of their products is typical of membrane-bound carriers and displays high similarity to Jen1p, the monocarboxylate permease of Saccharomyces cerevisiae. Both KlJEN1 and KlJEN2 are under the control of glucose repression mediated by FOG1 and FOG2, corresponding to S. cerevisiae GAL83 and SNF1 respectively, and KlCAT8, proteins involved in glucose signalling cascade in K. lactis. KlJEN1, but not KlJEN2, is induced by lactate. KlJEN2 in contrast is expressed at high level in ethanol and succinate. The physiological characterization of null mutants showed that KlJEN1 is the functional homologue of ScJEN1, whereas KlJEN2 encodes a dicarboxylic acids transporter. In fact, KlJen1p [transporter classification (TC) number: 2.A.1.12.2.] is required for lactate uptake and therefore for growth on lactate. KlJen2p is required for succinate transport, as demonstrated by succinate uptake experiments and by inability of Kljen2 mutant to grow on succinate. This carrier appears to transport also malate and fumarate because the Kljen2 mutant cannot grow on these substrates and the succinate uptake is competed by these carboxylic acids. We conclude that KlJEN2 is the first yeast gene shown to encode a dicarboxylic acids permease.

Formulation and development of pH-independent/dependent sustained release matrix tablets of ondansetron HCl by a continuous twin-screw melt granulation process.

PubMed

Patil, Hemlata; Tiwari, Roshan V; Upadhye, Sampada B; Vladyka, Ronald S; Repka, Michael A

2015-12-30

The objective of the present study was to develop pH-independent/dependent sustained release (SR) tablets of ondansetron HCl dihydrate (OND), a selective 5-HT3 receptor antagonist that is used for prevention of nausea and vomiting caused by chemotherapy, radiotherapy and postoperative treatment. The challenge with the OND API is its pH-dependent solubility and relatively short elimination half-life. Therefore, investigations were made to solve these problems in the current study. Formulations were prepared using stearic acid as a binding agent via a melt granulation process in a twin-screw extruder. The micro-environmental pH of the tablet was manipulated by the addition of fumaric acid to enhance the solubility and release of OND from the tablet. The in vitro release study demonstrated sustained release for 24h with 90% of drug release in formulations using stearic acid in combination with ethyl cellulose, whereas 100% drug release in 8h for stearic acid-hydroxypropylcellulose matrices. The formulation release kinetics was correlated to the Higuchi diffusion model and a non-Fickian drug release mechanism. The results of the present study demonstrated for the first time the pH dependent release from hydrophilic-lipid matrices as well as pH independent release from hydrophobic-lipid matrices for OND SR tablets manufactured by means of a continuous melt granulation technique utilizing a twin-screw extruder. Copyright © 2015 Elsevier B.V. All rights reserved.

Gateways to clinical trials.

PubMed

Bayés, M; Rabasseda, X; Prous, J R

2007-12-01

Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables has been retrieved from the Clinical Trials Knowledge Area of Prous Science Intergrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: 249553, 2-Methoxyestradiol; Abatacept, Adalimumab, Adefovir dipivoxil, Agalsidase beta, Albinterferon alfa-2b, Aliskiren fumarate, Alovudine, Amdoxovir, Amlodipine besylate/atorvastatin calcium, Amrubicin hydrochloride, Anakinra, AQ-13, Aripiprazole, AS-1404, Asoprisnil, Atacicept, Atrasentan; Belimumab, Bevacizumab, Bortezomib, Bosentan, Botulinum toxin type B, Brivaracetam; Catumaxomab, Cediranib, Cetuximab, cG250, Ciclesonide, Cinacalcet hydrochloride, Curcumin, Cypher; Darbepoetin alfa, Denosumab, Dihydrexidine; Eicosapentaenoic acid/docosahexaenoic acid, Entecavir, Erlotinib hydrochloride, Escitalopram oxalate, Etoricoxib, Everolimus, Ezetimibe; Febuxostat, Fenspiride hydrochloride, Fondaparinux sodium; Gefitinib, Ghrelin (human), GSK-1562902A; HSV-tk/GCV; Iclaprim, Imatinib mesylate, Imexon, Indacaterol, Insulinotropin, ISIS-112989; L-Alanosine, Lapatinib ditosylate, Laropiprant; Methoxy polyethylene glycol-epoetin-beta, Mipomersen sodium, Motexafin gadolinium; Natalizumab, Nimotuzumab; OSC, Ozarelix; PACAP-38, Paclitaxel nanoparticles, Parathyroid Hormone-Related Protein-(1-36), Pasireotide, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Pemetrexed disodium, Pertuzumab, Picoplatin, Pimecrolimus, Pitavastatin calcium, Plitidepsin; Ranelic acid distrontium salt, Ranolazine, Recombinant human relaxin H2, Regadenoson, RFB4(dsFv)-PE38, RO-3300074, Rosuvastatin calcium; SIR-Spheres, Solifenacin succinate, Sorafenib, Sunitinib malate; Tadalafil, Talabostat, Taribavirin hydrochloride, Taxus, Temsirolimus, Teriparatide, Tiotropium bromide, Tipifarnib, Tirapazamine, Tocilizumab; UCN-01, Ularitide, Uracil, Ustekinumab; V-260, Vandetanib, Vatalanib succinate, Vernakalant hydrochloride, Vorinostat; YM-155; Zileuton, Zoledronic acid monohydrate.

Solar photoelectro-Fenton degradation of the herbicide 4-chloro-2-methylphenoxyacetic acid optimized by response surface methodology.

PubMed

Garcia-Segura, Sergi; Almeida, Lucio Cesar; Bocchi, Nerilso; Brillas, Enric

2011-10-30

A central composite rotatable design and response surface methodology (RSM) were used to optimize the experimental variables of the solar photoelectro-Fenton (SPEF) treatment of the herbicide 4-chloro-2-methylphenoxyacetic acid (MCPA). The experiments were made with a flow plant containing a Pt/air-diffusion reactor coupled to a solar compound parabolic collector (CPC) under recirculation of 10 L of 186 mg L(-1) MCPA solutions in 0.05 M Na(2)SO(4) at a liquid flow rate of 180 L h(-1) with an average UV irradiation intensity of about 32 Wm(-2). The optimum variables found for the SPEF process were 5.0 A, 1.0mM Fe(2+) and pH 3.0 after 120 min of electrolysis. Under these conditions, 75% of mineralization with 71% of current efficiency and 87.7 k Wh kg(-1) TOC of energy consumption were obtained. MCPA decayed under the attack of generated hydroxyl radicals following a pseudo-first-order kinetics. Hydroxyl radicals also destroyed 4-chloro-2-methylphenol, methylhydroquinone and methyl-p-benzoquinone detected as aromatic by-products. Glycolic, maleic, fumaric, malic, succinic, tartronic, oxalic and formic acids were identified as generated carboxylic acids, which form Fe(III) complexes that are quickly photodecarboxylated by the UV irradiation of sunlight at the CPC photoreactor. A reaction sequence for the SPEF degradation of MCPA was proposed. Copyright © 2011 Elsevier B.V. All rights reserved.

Anti-trypanosomal activities and structural chemical properties of selected compound classes.

PubMed

Ponte-Sucre, Alicia; Bruhn, Heike; Schirmeister, Tanja; Cecil, Alexander; Albert, Christian R; Buechold, Christian; Tischer, Maximilian; Schlesinger, Susanne; Goebel, Tim; Fuß, Antje; Mathein, Daniela; Merget, Benjamin; Sotriffer, Christoph A; Stich, August; Krohne, Georg; Engstler, Markus; Bringmann, Gerhard; Holzgrabe, Ulrike

2015-02-01

Potent compounds do not necessarily make the best drugs in the market. Consequently, with the aim to describe tools that may be fundamental for refining the screening of candidates for animal and preclinical studies and further development, molecules of different structural classes synthesized within the frame of a broad screening platform were evaluated for their trypanocidal activities, cytotoxicities against murine macrophages J774.1 and selectivity indices, as well as for their ligand efficiencies and structural chemical properties. To advance into their modes of action, we also describe the morphological and ultrastructural changes exerted by selected members of each compound class on the parasite Trypanosoma brucei. Our data suggest that the potential organelles targeted are either the flagellar pocket (compound 77, N-Arylpyridinium salt; 15, amino acid derivative with piperazine moieties), the endoplasmic reticulum membrane systems (37, bisquaternary bisnaphthalimide; 77, N-Arylpyridinium salt; 68, piperidine derivative), or mitochondria and kinetoplasts (88, N-Arylpyridinium salt; 68, piperidine derivative). Amino acid derivatives with fumaric acid and piperazine moieties (4, 15) weakly inhibiting cysteine proteases seem to preferentially target acidic compartments. Our results suggest that ligand efficiency indices may be helpful to learn about the relationship between potency and chemical characteristics of the compounds. Interestingly, the correlations found between the physico-chemical parameters of the selected compounds and those of commercial molecules that target specific organelles indicate that our rationale might be helpful to drive compound design toward high activities and acceptable pharmacokinetic properties for all compound families.

Alternative energy production pathways in Taenia crassiceps cysticerci in vitro exposed to a benzimidazole derivative (RCB20).

PubMed

Fraga, Carolina Miguel; Da Costa, Tatiane Luiza; De Castro, Ana Maria; Reynoso-Ducoing, Olivia; Ambrosio, Javier; Hernández-Campos, Alicia; Castillo, Rafael; Vinaud, Marina Clare

2016-04-01

Biochemical studies of benzimidazole derivatives are important to determine their mode of action and activity against parasites. The lack of antihelminthic alternatives to treat parasitic infections and albendazole resistance cases make the search for new antiparasitary drugs of utmost importance. The 6-chloro-5-(1-naphthyloxy)-2-(trifluoromethyl)-1H-benzimidazole (RCB20) is a benzimidazole derivative with promising effect. This study evaluated the effect of different concentrations of RCB20 in the alternative energetic pathway of in vitro Taenia crassiceps cysticerci. The parasites were in vitro exposed to 6.5 and 13 µM of RCB20 and albendazole sulfoxide (ABZSO). The quantification of acetate, acetoacetate, β-hydroxybutyrate, fumarate and propionate was performed by high-performance liquid chromatography. The quantification of urea, creatinine and total proteins was performed by spectrophotometry. The increase in β-hydroxybutyrate reflects the enhancement of the fatty acid oxidation in the treated groups. Volatile fatty acids secretion, acetate and propionate, was increased in the treated groups. The secretion mechanisms of the treated parasites were impaired due to organic acids increased concentrations in the cysticerci. It is possible to conclude that the metabolic effect on alternative energetic pathways is slightly increased in the parasites treated with RCB20 than the ones treated with ABZSO.

In Folio Respiratory Fluxomics Revealed by 13C Isotopic Labeling and H/D Isotope Effects Highlight the Noncyclic Nature of the Tricarboxylic Acid “Cycle” in Illuminated Leaves1[W

PubMed Central

Tcherkez, Guillaume; Mahé, Aline; Gauthier, Paul; Mauve, Caroline; Gout, Elizabeth; Bligny, Richard; Cornic, Gabriel; Hodges, Michael

2009-01-01

While the possible importance of the tricarboxylic acid (TCA) cycle reactions for leaf photosynthesis operation has been recognized, many uncertainties remain on whether TCA cycle biochemistry is similar in the light compared with the dark. It is widely accepted that leaf day respiration and the metabolic commitment to TCA decarboxylation are down-regulated in illuminated leaves. However, the metabolic basis (i.e. the limiting steps involved in such a down-regulation) is not well known. Here, we investigated the in vivo metabolic fluxes of individual reactions of the TCA cycle by developing two isotopic methods, 13C tracing and fluxomics and the use of H/D isotope effects, with Xanthium strumarium leaves. We provide evidence that the TCA “cycle” does not work in the forward direction like a proper cycle but, rather, operates in both the reverse and forward directions to produce fumarate and glutamate, respectively. Such a functional division of the cycle plausibly reflects the compromise between two contrasted forces: (1) the feedback inhibition by NADH and ATP on TCA enzymes in the light, and (2) the need to provide pH-buffering organic acids and carbon skeletons for nitrate absorption and assimilation. PMID:19675152

The Energy Metabolism in Caenorhabditis elegans under The Extremely Low-Frequency Electromagnetic Field Exposure

NASA Astrophysics Data System (ADS)

Shi, Zhenhua; Yu, Hui; Sun, Yongyan; Yang, Chuanjun; Lian, Huiyong; Cai, Peng

2015-02-01

A literal mountain of documentation generated in the past five decades showing unmistakable health hazards associated with extremely low-frequency electromagnetic fields (ELF-EMFs) exposure. However, the relation between energy mechanism and ELF-EMF exposure is poorly understood. In this study, Caenorhabditis elegans was exposed to 50 Hz ELF-EMF at intensities of 0.5, 1, 2, and 3 mT, respectively. Their metabolite variations were analyzed by GC-TOF/MS-based metabolomics. Although minimal metabolic variations and no regular pattern were observed, the contents of energy metabolism-related metabolites such as pyruvic acid, fumaric acid, and L-malic acid were elevated in all the treatments. The expressions of nineteen related genes that encode glycolytic enzymes were analyzed by using quantitative real-time PCR. Only genes encoding GAPDH were significantly upregulated (P < 0.01), and this result was further confirmed by western blot analysis. The enzyme activity of GAPDH was increased (P < 0.01), whereas the total intracellular ATP level was decreased. While no significant difference in lifespan, hatching rate and reproduction, worms exposed to ELF-EMF exhibited less food consumption compared with that of the control (P < 0.01). In conclusion, C. elegans exposed to ELF-EMF have enhanced energy metabolism and restricted dietary, which might contribute to the resistance against exogenous ELF-EMF stress.

The complex allosteric and redox regulation of the fumarate hydratase and malate dehydratase reactions of Arabidopsis thaliana Fumarase 1 and 2 gives clues for understanding the massive accumulation of fumarate.

PubMed

Zubimendi, Juan P; Martinatto, Andrea; Valacco, Maria P; Moreno, Silvia; Andreo, Carlos S; Drincovich, María F; Tronconi, Marcos A

2018-06-01

Arabidopsis thaliana possesses two fumarase genes (FUM), AtFUM1 (At2g47510) encoding for the mitochondrial Krebs cycle-associated enzyme and AtFUM2 (At5g50950) for the cytosolic isoform required for fumarate massive accumulation. Here, the comprehensive biochemical studies of AtFUM1 and AtFUM2 shows that they are active enzymes with similar kinetic parameters but differential regulation. For both enzymes, fumarate hydratase (FH) activity is favored over the malate dehydratase (MD) activity; however, MD is the most regulated activity with several allosteric activators. Oxalacetate, glutamine, and/or asparagine are modulators causing the MD reaction to become preferred over the FH reaction. Activity profiles as a function of pH suggest a suboptimal FUM activity in Arabidopsis cells; moreover, the direction of the FUM reaction is sensitive to pH changes. Under mild oxidation conditions, AtFUMs form high mass molecular aggregates, which present both FUM activities decreased to a different extent. The biochemical properties of oxidized AtFUMs (oxAtFUMs) were completely reversed by NADPH-supplied Arabidopsis leaf extracts, suggesting that the AtFUMs redox regulation can be accomplished in vivo. Mass spectrometry analyses indicate the presence of an active site-associated intermolecular disulfide bridge in oxAtFUMs. Finally, a phylogenetic approach points out that other plant species may also possess cytosolic FUM2 enzymes mainly encoded by paralogous genes, indicating that the evolutionary history of this trait has been drawn through a process of parallel evolution. Overall, according to our results, a multilevel regulatory pattern of FUM activities emerges, supporting the role of this enzyme as a carbon flow monitoring point through the organic acid metabolism in plants. © 2018 Federation of European Biochemical Societies.

Highly efficient chiral resolution of DL-arginine by cocrystal formation followed by recrystallization under preferential-enrichment conditions.

PubMed

Iwama, Sekai; Kuyama, Kazunori; Mori, Yuko; Manoj, Kochunnoonny; Gonnade, Rajesh G; Suzuki, Katsuaki; Hughes, Colan E; Williams, P Andrew; Harris, Kenneth D M; Veesler, Stéphane; Takahashi, Hiroki; Tsue, Hirohito; Tamura, Rui

2014-08-11

An excellent chiral symmetry-breaking spontaneous enantiomeric resolution phenomenon, denoted preferential enrichment, was observed on recrystallization of the 1:1 cocrystal of dl-arginine and fumaric acid, which is classified as a racemic compound crystal with a high eutectic ee value (>95 %), under non-equilibrium crystallization conditions. On the basis of temperature-controlled video microscopy and in situ time-resolved solid-state (13) C NMR spectroscopic studies on the crystallization process, a new mechanism of phase transition that can induce preferential enrichment is proposed. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Proteomics analysis of high lipid-producing strain Mucor circinelloides WJ11: an explanation for the mechanism of lipid accumulation at the proteomic level.

PubMed

Tang, Xin; Zan, Xinyi; Zhao, Lina; Chen, Haiqin; Chen, Yong Q; Chen, Wei; Song, Yuanda; Ratledge, Colin

2016-02-11

The oleaginous fungus, Mucor circinelloides, is attracting considerable interest as it produces oil rich in γ-linolenic acid. Nitrogen (N) deficiency is a common strategy to trigger the lipid accumulation in oleaginous microorganisms. Although a simple pathway from N depletion in the medium to lipid accumulation has been elucidated at the enzymatic level, global changes at protein levels upon N depletion have not been investigated. In this study, we have systematically analyzed the changes at the levels of protein expression in M. circinelloides WJ11, a high lipid-producing strain (36 %, lipid/cell dry weight), during lipid accumulation. Proteomic analysis demonstrated that N depletion increased the expression of glutamine synthetase, involved in ammonia assimilation, for the supply of cellular nitrogen but decreased the metabolism of amino acids. Upon N deficiency, many proteins (e.g., fructose-bisphosphate aldolase, glyceraldehyde-3-phosphate dehydrogenase, enolase, pyruvate kinase) involved in glycolytic pathway were up-regulated while proteins involved in the tricarboxylic acid cycle (e.g., isocitrate dehydrogenase, succinyl-CoA ligase, succinate dehydrogenase, fumarate hydratase) were down-regulated, indicating this activity was retarded thereby leading to a greater flux of carbon into fatty acid biosynthesis. Moreover, glucose-6-phosphate dehydrogenase, transaldolase and transketolase, which participate in the pentose phosphate pathway, were up-regulated, leading to the increased production of NADPH, the reducing power for fatty acid biosynthesis. Furthermore, protein and nucleic acid metabolism were down-regulated and some proteins involved in energy metabolism, signal transduction, molecular chaperone and redox homeostasis were up-regulated upon N depletion, which may be the cellular response to the stress produced by the onset of N deficiency. N limitation increased those expressions of the proteins involved in ammonia assimilation but decreased that involved in the biosynthesis of amino acids. Upon N deprivation, the glycolytic pathway was up-regulated, while the activity of the tricarboxylic acid cycle was retarded, thus, leading more carbon flux to fatty acid biosynthesis. Moreover, the pentose phosphate pathway was up-regulated, then this would increase the production of NADPH. Together, coordinated regulation of central carbon metabolism upon N limitation, provides more carbon flux to acetyl-CoA and NADPH for fatty acid biosynthesis.

Ecotypic variability in the metabolic response of seeds to diurnal hydration-dehydration cycles and its relationship to seed vigor.

PubMed

Bai, Bing; Sikron, Noga; Gendler, Tanya; Kazachkova, Yana; Barak, Simon; Grafi, Gideon; Khozin-Goldberg, Inna; Fait, Aaron

2012-01-01

Seeds in the seed bank experience diurnal cycles of imbibition followed by complete dehydration. These conditions pose a challenge to the regulation of germination. The effect of recurring hydration-dehydration (Hy-Dh) cycles were tested on seeds from four Arabidopsis thaliana accessions [Col-0, Cvi, C24 and Ler]. Diurnal Hy-Dh cycles had a detrimental effect on the germination rate and on the final percentage of germination in Col-0, Cvi and C24 ecotypes, but not in the Ler ecotype, which showed improved vigor following the treatments. Membrane permeability measured by ion conductivity was generally increased following each Hy-Dh cycle and was correlated with changes in the redox status represented by the GSSG/GSH (oxidized/reduced glutathione) ratio. Among the ecotypes, Col-0 seeds displayed the highest membrane permeability, whilst Ler was characterized by the greatest increase in electrical conductivity following Hy-Dh cycles. Following Dh 2 and Dh 3, the respiratory activity of Ler seeds significantly increased, in contrast to the other ecotypes, indicative of a dramatic shift in metabolism. These differences were associated with accession-specific content and patterns of change of (i) cell wall-related laminaribiose and mannose; (ii) fatty acid composition, specifically of the unsaturated oleic acid and α-linoleic acid; and (iii) asparagine, ornithine and the related polyamine putrescine. Furthermore, in the Ler ecotype the content of the tricarboxylic acid (TCA) cycle intermediates fumarate, succinate and malate increased in response to dehydration, in contrast to a decrease in the other three ecotypes. These findings provide a link between seed respiration, energy metabolism, fatty acid β-oxidation, nitrogen mobilization and membrane permeability and the improved germination of Ler seeds following Hy-Dh cycles.

Electrochemical synthesis of formic acid from CO2 catalyzed by Shewanella oneidensis MR-1 whole-cell biocatalyst.

PubMed

Le, Quang Anh Tuan; Kim, Hee Gon; Kim, Yong Hwan

2018-09-01

The electro-biocatalytic conversion of CO 2 into formic acid using whole-cell and isolated biocatalysts is useful as an alternative route for CO 2 sequestration. In this study, Shewanella oneidensis MR-1 (S. oneidensis MR-1), a facultative aerobic bacterium that has been extensively studied for its utility as biofuel cells as well as for the detoxification of heavy metal oxides (i.e., MnO 2 , uranium), has been applied for the first time as a whole-cell biocatalyst for formic acid synthesis from gaseous CO 2 and electrons supplied from an electrode. S. oneidensis MR-1, when aerobically grown in Luria-Bertani (LB) medium, exhibited its ability as a whole-cell biocatalyst for the conversion of CO 2 into formic acid with moderate productivity of 0.59 mM h -1 for 24 h. In addition, an optimization of growth conditions of S. oneidensis MR-1 resulted in a remarkable increase in productivity. The CO 2 reduction reaction catalyzed by S. oneidensis MR-1, when anaerobically grown in newly optimized LB medium supplemented with fumarate and nitrate, exhibited 3.2-fold higher productivity (1.9 mM h -1 for 72 h) compared to that grown aerobically in only LB medium. Furthermore, the average conversion rate of formic acid synthesis catalyzed by S. oneidensis MR-1 when grown in the optimal medium over a period of 72 h was 3.8 mM h -1  g -1 wet-cell, which is 9.6-fold higher than that catalyzed by Methylobacterium extorquens AM1 whole-cells in our previous study. Copyright © 2018 Elsevier Inc. All rights reserved.

Temperature enhanced succinate production concurrent with increased central metabolism turnover in the cyanobacterium Synechocystis sp. PCC 6803.

PubMed

Hasunuma, Tomohisa; Matsuda, Mami; Kato, Yuichi; Vavricka, Christopher John; Kondo, Akihiko

2018-05-27

Succinate is a versatile petrochemical compound that can be produced by microorganisms, often from carbohydrate based carbon sources. Phototrophic cyanobacteria including Synechocystis sp. PCC 6803 can more efficiently produce organic acids such as succinate without sugar supplementation, via photosynthetic production of glycogen followed by glycogen utilization, typically under dark conditions. In this study, Synechocystis 6803 bioproduction of organic acids under dark anoxic conditions was found to increase with elevation of temperature from 30 °C to 37 °C. The further enhancement of succinate bioproduction by overexpression of the rate limiting enzyme phosphoenolpyruvate carboxylase resulted in improved glycogen utilization. To gain more insight into the mechanisms underlying the increased organic acid output, a novel temperature dependent metabolomics analysis was performed. Adenylate energy charge was found to decrease along with elevating temperature, while central metabolites glucose 6-phosphate, fructose 6-phosphate, fructose 1,6-bisphosphate, glycerol 3-phosphate, malate, fumarate and succinate increased. Temperature dependent 13 C-labeling metabolomics analysis further revealed a glycolysis to TCA bottleneck, which could be overcome by addition of CO 2 , leading to even higher organic acid production. Optimization of initial cell concentration to 25 g-dry cell weight/L, in combination with 100 mM NaHCO 3 supplementation, afforded a succinate titer of over 1.8 g/L, the highest reported autotrophic succinate titer. Succinate titers remained high after additional knockout of ackA, resulting in the highest reported autotrophic D-lactate titer as well. The optimization of Synechocystis 6803 organic acid production therefore holds significant promise for CO 2 capture and utilization. Copyright © 2018 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

Salmonella enterica serovar Typhimurium mutants unable to convert malate to pyruvate and oxaloacetate are avirulent and immunogenic in BALB/c mice.

PubMed

Mercado-Lubo, Regino; Leatham, Mary P; Conway, Tyrrell; Cohen, Paul S

2009-04-01

Previously, we showed that the Salmonella enterica serovar Typhimurium SR-11 tricarboxylic acid (TCA) cycle must operate as a complete cycle for full virulence after oral infection of BALB/c mice (M. Tchawa Yimga, M. P. Leatham, J. H. Allen, D. C. Laux, T. Conway, and P. S. Cohen, Infect. Immun. 74:1130-1140, 2006). In the same study, we showed that for full virulence, malate must be converted to both oxaloacetate and pyruvate. Moreover, it was recently demonstrated that blocking conversion of succinyl-coenzyme A to succinate attenuates serovar Typhimurium SR-11 but does not make it avirulent; however, blocking conversion of succinate to fumarate renders it completely avirulent and protective against subsequent oral infection with the virulent serovar Typhimurium SR-11 wild-type strain (R. Mercado-Lubo, E. J. Gauger, M. P. Leatham, T. Conway, and P. S. Cohen, Infect. Immun. 76:1128-1134, 2008). Furthermore, the ability to convert succinate to fumarate appeared to be required only after serovar Typhimurium SR-11 became systemic. In the present study, evidence is presented that serovar Typhimurium SR-11 mutants that cannot convert fumarate to malate or that cannot convert malate to both oxaloacetate and pyruvate are also avirulent and protective in BALB/c mice. These results suggest that in BALB/c mice, the malate that is removed from the TCA cycle in serovar Typhimurium SR-11 for conversion to pyruvate must be replenished by succinate or one of its precursors, e.g., arginine or ornithine, which might be available in mouse phagocytes.

Relative bioavailability of iron and folic acid from a new powdered supplement compared to a traditional tablet in pregnant women

PubMed Central

Hartman-Craven, Brenda; Christofides, Anna; O'Connor, Deborah L; Zlotkin, Stanley

2009-01-01

Background Deficiencies of iron and folic acid during pregnancy can lead to adverse outcomes for the fetus, thus supplements are recommended. Adherence to current tablet-based supplements is documented to be poor. Recently a powdered form of micronutrients has been developed which may decrease side-effects and thus improve adherence. However, before testing the efficacy of the supplement as an alternate choice for supplementation during pregnancy, the bioavailability of the iron needs to be determined. Our objective was to measure the relative bioavailability of iron and folic acid from a powdered supplement that can be sprinkled on semi-solid foods or beverages versus a traditional tablet supplement in pregnant women. Methods Eighteen healthy pregnant women (24 – 32 weeks gestation) were randomized to receive the supplements in a crossover design. Following ingestion of each supplement, the changes (over baseline) in serum iron and folate over 8 hours were determined. The powdered supplement contained 30 mg of iron as micronized dispersible ferric pyrophosphate with an emulsifier coating and 600 μg folic acid; the tablet contained 27 mg iron from ferrous fumarate and 1000 μg folic acid. Results Overall absorption of iron from the powdered supplement was significantly lower than the tablet (p = 0.003). There was no difference in the overall absorption of folic acid between supplements. Based on the differences in the area under the curve and doses, the relative bioavailability of iron from powdered supplement was lower than from the tablet (0.22). Conclusion The unexpected lower bioavailability of iron from the powdered supplement is contrary to previously published reports. However, since pills and capsules are known to be poorly accepted by some women during pregnancy, it is reasonable to continue to explore alternative micronutrient delivery systems and forms of iron for this purpose. Trial Registration ClinicalTrials.gov NCT00789490 PMID:19635145

Potential drugs which activate nuclear factor E2-related factor 2 signaling to prevent diabetic cardiovascular complications: A focus on fumaric acid esters.

PubMed

Zhou, Shanshan; Jin, Jingpeng; Bai, Tao; Sachleben, Leroy R; Cai, Lu; Zheng, Yang

2015-08-01

Diabetes and its cardiovascular complications have been a major public health issue. These complications are mainly attributable to a severe imbalance between free radical and reactive oxygen species production and the antioxidant defense systems. Nuclear factor E2-related factor 2 (Nrf2) is a transcription factor that controls the basal and inducible expression of a battery of antioxidant enzyme genes and other cyto-protective phase II detoxifying enzymes. As a result, Nrf2 has gained great attention as a promising drug target for preventing diabetic cardiovascular complications. And while animal studies have shown that several Nrf2 activators manifest a potential to efficiently prevent the diabetic complications, their use in humans has not been approved due to the lack of substantial evidence regarding safety and efficacy of the Nrf2 activation. We provide here a brief review of a few clinically-used drugs that can up-regulate Nrf2 with the potential of extending their usage to diabetic patients for the prevention of cardiovascular complications and conclude with a closer inspection of dimethyl fumarate and its mimic members. Copyright © 2015 Elsevier Inc. All rights reserved.

The Variations of Glycolysis and TCA Cycle Intermediate Levels Grown in Iron and Copper Mediums of Trichoderma harzianum.

PubMed

Tavsan, Zehra; Ayar Kayali, Hulya

2015-05-01

The efficiency of optimal metabolic function by microorganism depends on various parameters, especially essential metal supplementation. In the present study, the effects of iron and copper metals on metabolism were investigated by determination of glycolysis and tricarboxylic acid (TCA) cycle metabolites' levels with respect to the metal concentrations and incubation period in Trichoderma harzianum. The pyruvate and citrate levels of T. harzianum increased up to 15 mg/L of copper via redirection of carbon flux though glycolysis by suppression of pentose phosphate pathway (PPP). However, the α-ketoglutarate levels decreased at concentration higher than 5 mg/L of copper to overcome damage of oxidative stress. The fumarate levels correlated with the α-ketoglutarate levels because of substrate limitation. Besides, in T. harzianum cells grown in various concentrations of iron-containing medium, the intracellular pyruvate, citrate, and α-ketoglutarate levels showed positive correlation with iron concentration due to modifying of expression of glycolysis and TCA cycle enzymes via a mechanism involving cofactor or allosteric regulation. However, as a result of consuming of prior substrates required for fumarate production, its levels rose up to 10 mg/L.

Reduced expression of fumarate hydratase in clear cell renal cancer mediates HIF-2α accumulation and promotes migration and invasion.

PubMed

Sudarshan, Sunil; Shanmugasundaram, Karthigayan; Naylor, Susan L; Lin, Shu; Livi, Carolina B; O'Neill, Christine F; Parekh, Dipen J; Yeh, I-Tien; Sun, Lu-Zhe; Block, Karen

2011-01-01

Germline mutations of FH, the gene that encodes for the tricarboxylic acid TCA (TCA) cycle enzyme fumarate hydratase, are associated with an inherited form of cancer referred to as Hereditary Leiomyomatosis and Renal Cell Cancer (HLRCC). Individuals with HLRCC are predisposed to the development of highly malignant and lethal renal cell carcinoma (RCC). The mechanisms of tumorigenesis proposed have largely focused on the biochemical consequences of loss of FH enzymatic activity. While loss of the tumor suppressor gene von Hippel Lindau (VHL) is thought to be an initiating event for the majority of RCCs, a role for FH in sporadic renal cancer has not been explored. Here we report that FH mRNA and protein expression are reduced in clear cell renal cancer, the most common histologic variant of kidney cancer. Moreover, we demonstrate that reduced FH leads to the accumulation of hypoxia inducible factor- 2α (HIF-2α), a transcription factor known to promote renal carcinogenesis. Finally, we demonstrate that overexpression of FH in renal cancer cells inhibits cellular migration and invasion. These data provide novel insights into the tumor suppressor functions of FH in sporadic kidney cancer.

Coupled transport of p-aminohippurate by rat kidney basolateral membrane vesicles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pritchard, J.B.

p-Aminohippuric acid (PAH) transport by basolateral membrane (BLM) vesicles isolated from rat renal cortex was stimulated very little by a Na{sup +} gradient (out > in). However, when micromolar concentrations of glutaric acid or {alpha}-ketoglutaric acid were added in the presence of a out > in Na{sup +} gradient, PAH uptake was accelerated >20-fold and an overshoot of greater than fivefold was produced. Other anions, e.g., fumarate, stimulated PAH uptake very modestly under these conditions, and that stimulation was totally prevented by short circuiting, i.e., with K{sup +} (in = out) and valinomycin. Glutarate-stimulated uptake was inhibited by 4-acetamide-4{prime}-({sup 14}C)-isothiocyanostilbene-2,2{prime}-disulfonicmore » acid (SITS) and probenecid and was slightly stimulated by the imposition of an inside-negative membrane potential. Furthermore, even in the absence of a Na{sup +} gradient, glutarate-loaded vesicles exhibited a marked acceleration of ({sup 3}H)-PAH uptake (5-fold) and a modest overshoot (2.5-fold). These results suggest an indirect coupling of BLM PAH uptake to the Na{sup +} gradient by a cyclic accumulation (Na{sup +}-dependent) of glutarate followed by its efflux from the vesicle in exchange for PAH. This coupled system was absent in apical membranes. Thus net secretory transport of PAH may entail Na{sup +}-dependent, glutarate-driven PAH uptake at the BLM, followed by the exit of PAH into the lumen down its electrochemical gradient, probably in exchange for other anions, e.g., {sup 36}Cl{sup {minus}}, HCO{sub 3}{sup {minus}}, or OH{sup {minus}}.« less

Collection and chemical composition of phloem sap from Citrus sinensis L. Osbeck (sweet orange).

PubMed

Hijaz, Faraj; Killiny, Nabil

2014-01-01

Through utilizing the nutrient-rich phloem sap, sap feeding insects such as psyllids, leafhoppers, and aphids can transmit many phloem-restricted pathogens. On the other hand, multiplication of phloem-limited, uncultivated bacteria such as Candidatus Liberibacter asiaticus (CLas) inside the phloem of citrus indicates that the sap contains all the essential nutrients needed for the pathogen growth. The phloem sap composition of many plants has been studied; however, to our knowledge, there is no available data about citrus phloem sap. In this study, we identified and quantified the chemical components of phloem sap from pineapple sweet orange. Two approaches (EDTA enhanced exudation and centrifugation) were used to collect phloem sap. The collected sap was derivatized with methyl chloroformate (MCF), N-methyl-N- [tert-butyl dimethylsilyl]-trifluroacetamide (MTBSTFA), or trimethylsilyl (TMS) and analyzed with GC-MS revealing 20 amino acids and 8 sugars. Proline, the most abundant amino acid, composed more than 60% of the total amino acids. Tryptophan, tyrosine, leucine, isoleucine, and valine, which are considered essential for phloem sap-sucking insects, were also detected. Sucrose, glucose, fructose, and inositol were the most predominant sugars. In addition, seven organic acids including succinic, fumaric, malic, maleic, threonic, citric, and quinic were detected. All compounds detected in the EDTA-enhanced exudate were also detected in the pure phloem sap using centrifugation. The centrifugation technique allowed estimating the concentration of metabolites. This information expands our knowledge about the nutrition requirement for citrus phloem-limited bacterial pathogen and their vectors, and can help define suitable artificial media to culture them.

Collection and Chemical Composition of Phloem Sap from Citrus sinensis L. Osbeck (Sweet Orange)

PubMed Central

Hijaz, Faraj; Killiny, Nabil

2014-01-01

Through utilizing the nutrient-rich phloem sap, sap feeding insects such as psyllids, leafhoppers, and aphids can transmit many phloem-restricted pathogens. On the other hand, multiplication of phloem-limited, uncultivated bacteria such as Candidatus Liberibacter asiaticus (CLas) inside the phloem of citrus indicates that the sap contains all the essential nutrients needed for the pathogen growth. The phloem sap composition of many plants has been studied; however, to our knowledge, there is no available data about citrus phloem sap. In this study, we identified and quantified the chemical components of phloem sap from pineapple sweet orange. Two approaches (EDTA enhanced exudation and centrifugation) were used to collect phloem sap. The collected sap was derivatized with methyl chloroformate (MCF), N-methyl-N- [tert-butyl dimethylsilyl]-trifluroacetamide (MTBSTFA), or trimethylsilyl (TMS) and analyzed with GC-MS revealing 20 amino acids and 8 sugars. Proline, the most abundant amino acid, composed more than 60% of the total amino acids. Tryptophan, tyrosine, leucine, isoleucine, and valine, which are considered essential for phloem sap-sucking insects, were also detected. Sucrose, glucose, fructose, and inositol were the most predominant sugars. In addition, seven organic acids including succinic, fumaric, malic, maleic, threonic, citric, and quinic were detected. All compounds detected in the EDTA-enhanced exudate were also detected in the pure phloem sap using centrifugation. The centrifugation technique allowed estimating the concentration of metabolites. This information expands our knowledge about the nutrition requirement for citrus phloem-limited bacterial pathogen and their vectors, and can help define suitable artificial media to culture them. PMID:25014027

Ixodes scapularis Tick Cells Control Anaplasma phagocytophilum Infection by Increasing the Synthesis of Phosphoenolpyruvate from Tyrosine.

PubMed

Cabezas-Cruz, Alejandro; Espinosa, Pedro J; Obregón, Dasiel A; Alberdi, Pilar; de la Fuente, José

2017-01-01

The obligate intracellular pathogen, Anaplasma phagocytophilum , is the causative agent of life-threatening diseases in humans and animals. A. phagocytophilum is an emerging tick-borne pathogen in the United States, Europe, Africa and Asia, with increasing numbers of infected people and animals every year. It is increasingly recognized that intracellular pathogens modify host cell metabolic pathways to increase infection and transmission in both vertebrate and invertebrate hosts. Recent reports have shown that amino acids are central to the host-pathogen metabolic interaction. In this study, a genome-wide search for components of amino acid metabolic pathways was performed in Ixodes scapularis , the main tick vector of A. phagocytophilum in the United States, for which the genome was recently published. The enzymes involved in the synthesis and degradation pathways of the twenty amino acids were identified. Then, the available transcriptomics and proteomics data was used to characterize the mRNA and protein levels of I. scapularis amino acid metabolic pathway components in response to A. phagocytophilum infection of tick tissues and ISE6 tick cells. Our analysis was focused on the interplay between carbohydrate and amino acid metabolism during A. phagocytophilum infection in ISE6 cells. The results showed that tick cells increase the synthesis of phosphoenolpyruvate (PEP) from tyrosine to control A. phagocytophilum infection. Metabolic pathway analysis suggested that this is achieved by (i) increasing the transcript and protein levels of mitochondrial phosphoenolpyruvate carboxykinase (PEPCK-M), (ii) shunting tyrosine into the tricarboxylic acid (TCA) cycle to increase fumarate and oxaloacetate which will be converted into PEP by PEPCK-M, and (iii) blocking all the pathways that use PEP downstream gluconeogenesis (i.e., de novo serine synthesis pathway (SSP), glyceroneogenesis and gluconeogenesis). While sequestering host PEP may be critical for this bacterium because it cannot actively carry out glycolysis to produce PEP, excess of this metabolite may be toxic for A. phagocytophilum . The present work provides a more comprehensive view of the major amino acid metabolic pathways involved in the response to pathogen infection in ticks, and provides the basis for further studies to develop novel strategies for the control of granulocytic anaplasmosis.

Alginate-polyester comacromer based hydrogels as physiochemically and biologically favorable entities for cardiac tissue engineering.

PubMed

Thankam, Finosh G; Muthu, Jayabalan

2015-11-01

The physiochemical and biological responses of tissue engineering hydrogels are crucial in determining their desired performance. A hybrid comacromer was synthesized by copolymerizing alginate and poly(mannitol fumarate-co-sebacate) (pFMSA). Three bimodal hydrogels pFMSA-AA, pFMSA-MA and pFMSA-NMBA were synthesized by crosslinking with Ca(2+) and vinyl monomers acrylic acid (AA), methacrylic acid (MA) and N,N'-methylene bisacrylamide (NMBA), respectively. Though all the hydrogels were cytocompatible and exhibited a normal cell cycle profile, pFMSA-AA exhibited superior physiochemical properties viz non-freezable water content (58.34%) and water absorption per unit mass (0.97 g water/g gel) and pore length (19.92±3.91 μm) in comparing with other two hydrogels. The increased non-freezable water content and water absorption of pFMSA-AA hydrogels greatly influenced its biological performance, which was evident from long-term viability assay and cell cycle proliferation. The physiochemical and biological favorability of pFMSA-AA hydrogels signifies its suitability for cardiac tissue engineering. Copyright © 2015 Elsevier Inc. All rights reserved.

Tracking the degradation of fresh orange juice and discrimination of orange varieties: an example of NMR in coordination with chemometrics analyses.

PubMed

de Oliveira, Clayton R; Carneiro, Renato L; Ferreira, Antonio G

2014-12-01

Brazil is currently the largest exporter of concentrated orange juice and, unlike the other exporter countries, the domestic consumption is mainly based on the fresh orange juice. The quality control by evaluating the major chemical constituents under the influence of the most important factors, such as temperature and storage time of the product, is very important in this context. Therefore, the objective of this study was to evaluate the influence of temperature and time on the degradation of fresh orange juice for 24h, by using (1)H NMR technique and chemometric tools for data mining. The storage conditions at 24h led to the production of the formic, fumaric and acetic acids; and an increase of succinic and lactic acids and ethanol, which were observed at low concentration at the initial time. Furthermore, analysis by PCA has successfully distinguished the juice of different species/varieties as well as the metabolites responsible for their separation. Copyright © 2014 Elsevier Ltd. All rights reserved.

Anaerobic and aerobic pathways for salvage of proximal tubules from hypoxia-induced mitochondrial injury

PubMed Central

WEINBERG, JOEL M.; VENKATACHALAM, MANJERI A.; ROESER, NANCY F.; SAIKUMAR, POTHANA; DONG, ZHENG; SENTER, RUTH A.; NISSIM, ITZHAK

2010-01-01

We have further examined the mechanisms for a severe mitochondrial energetic deficit, deenergization, and impaired respiration in complex I that develop in kidney proximal tubules during hypoxia-reoxygenation, and their prevention and reversal by supplementation with α-ketoglutarate (α-KG) + aspartate. The abnormalities preceded the mitochondrial permeability transition and cytochrome c loss. Anaerobic metabolism of α-KG + aspartate generated ATP and maintained mitochondrial membrane potential. Other citric-acid cycle intermediates that can promote anaerobic metabolism (malate and fumarate) were also effective singly or in combination with α-KG. Succinate, the end product of these anaerobic pathways that can bypass complex I, was not protective when provided only during hypoxia. However, during reoxygenation, succinate also rescued the tubules, and its benefit, like that of α-KG + malate, persisted after the extra substrate was withdrawn. Thus proximal tubules can be salvaged from hypoxia-reoxygenation mitochondrial injury by both anaerobic metabolism of citric-acid cycle intermediates and aerobic metabolism of succinate. These results bear on the understanding of a fundamental mode of mitochondrial dysfunction during tubule injury and on strategies to prevent and reverse it. PMID:11053054

Synthesis of Unsaturated Polyester Resins from Various Bio-Derived Platform Molecules.

PubMed

Farmer, Thomas J; Castle, Rachael L; Clark, James H; Macquarrie, Duncan J

2015-07-02

Utilisation of bio-derived platform molecules in polymer synthesis has advantages which are, broadly, twofold; to digress from crude oil dependence of the polymer industry and secondly to reduce the environmental impact of the polymer synthesis through the inherent functionality of the bio-derived platform molecules. Bulk polymerisation of bio-derived unsaturated di-acids has been employed to produce unsaturated polyester (UPEs) which have been analysed by GPC, TGA, DSC and NMR spectroscopy, advancing on the analysis previously reported. UPEs from the diesters of itaconic, succinic, and fumaric acids were successfully synthesised with various diols and polyols to afford resins of MN 480-477,000 and Tg of -30.1 to -16.6 °C with solubilities differing based on starting monomers. This range of properties allows for many applications and importantly due to the surviving Michael acceptor moieties, solubility and cross-linking can be specifically tailored, post polymerisation, to the desired function. An improved synthesis of itaconate and succinate co-polymers, via the initial formation of an itaconate bis-diol, is also demonstrated for the first time, resulting in significantly improved itaconate incorporation.

Growth of a Strictly Anaerobic Bacterium on Furfural (2-Furaldehyde)

PubMed Central

Brune, Gerhard; Schoberth, Siegfried M.; Sahm, Hermann

1983-01-01

A strictly anaerobic bacterium was isolated from a continuous fermentor culture which converted the organic constituents of sulfite evaporator condensate to methane and carbon dioxide. Furfural is one of the major components of this condensate. This furfural isolate could degrade furfural as the sole source of carbon and energy in a defined mineral-vitamin-sulfate medium. Acetic acid was the major fermentation product. This organism could also use ethanol, lactate, pyruvate, or fumarate and contained cytochrome c3 and desulfoviridin. Except for furfural degradation, the characteristics of the furfural isolate were remarkably similar to those of the sulfate reducer Desulfovibrio gigas. The furfural isolate has been tentatively identified as Desulfovibrio sp. strain F-1. Images PMID:16346423

S3 Guideline for the treatment of psoriasis vulgaris, update - Short version part 1 - Systemic treatment.

PubMed

Nast, Alexander; Amelunxen, Lasse; Augustin, Matthias; Boehncke, Wolf-Henning; Dressler, Corinna; Gaskins, Matthew; Härle, Peter; Hoffstadt, Bernd; Klaus, Joachim; Koza, Joachim; Mrowietz, Ulrich; Ockenfels, Hans-Michael; Philipp, Sandra; Reich, Kristian; Rosenbach, Thomas; Rzany, Berthold; Schlaeger, Martin; Schmid-Ott, Gerhard; Sebastian, Michael; von Kiedrowski, Ralph; Weberschock, Tobias

2018-05-01

The German guideline for the treatment of psoriasis vulgaris was updated using GRADE methodology. The guideline is based on a systematic literature review completed on December 1, 2016, and on a formal consensus and approval process. The first section of this short version of the guideline covers systemic treatment options considered relevant by the expert panel and approved in Germany at the time of the consensus conference (acitretin, adalimumab, apremilast, cyclosporine, etanercept, fumaric acid esters, infliximab, methotrexate, secukinumab and ustekinumab). Detailed information is provided on the management and monitoring of the included treatment options. © 2018 The Authors | Journal compilation © Blackwell Verlag GmbH, Berlin.

Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.

PubMed

Selak, Mary A; Armour, Sean M; MacKenzie, Elaine D; Boulahbel, Houda; Watson, David G; Mansfield, Kyle D; Pan, Yi; Simon, M Celeste; Thompson, Craig B; Gottlieb, Eyal

2005-01-01

Several mitochondrial proteins are tumor suppressors. These include succinate dehydrogenase (SDH) and fumarate hydratase, both enzymes of the tricarboxylic acid (TCA) cycle. However, to date, the mechanisms by which defects in the TCA cycle contribute to tumor formation have not been elucidated. Here we describe a mitochondrion-to-cytosol signaling pathway that links mitochondrial dysfunction to oncogenic events: succinate, which accumulates as a result of SDH inhibition, inhibits HIF-alpha prolyl hydroxylases in the cytosol, leading to stabilization and activation of HIF-1alpha. These results suggest a mechanistic link between SDH mutations and HIF-1alpha induction, providing an explanation for the highly vascular tumors that develop in the absence of VHL mutations.

Correlation between degradation pathway and toxicity of acetaminophen and its by-products by using the electro-Fenton process in aqueous media.

PubMed

Le, Thi Xuan Huong; Nguyen, Thi Van; Amadou Yacouba, Zoulkifli; Zoungrana, Laetitia; Avril, Florent; Nguyen, Duy Linh; Petit, Eddy; Mendret, Julie; Bonniol, Valerie; Bechelany, Mikhael; Lacour, Stella; Lesage, Geoffroy; Cretin, Marc

2017-04-01

The evolution of the degradation by-products of an acetaminophen (ACE) solution was monitored by HPLC-UV/MS and IC in parallel with its ecotoxicity (Vibrio fischeri 81.9%, Microtox ® screening tests) during electro-Fenton (EF) oxidation performed on carbon felt. The aromatic compounds 2-hydroxy-4-(N-acetyl) aminophenol, 1,4-benzoquinone, benzaldehyde and benzoic acid were identified as toxic sub-products during the first stage of the electrochemical treatment, whereas aliphatic short-chain carboxylic acids (oxalic, maleic, oxamic, formic, acetic and fumaric acids) and inorganic ions (ammonium and nitrate) were well identified as non-toxic terminal sub-products. Electrogenerated hydroxyl radicals then converted the eco-toxic and bio-refractory property of initial ACE molecule (500 mL, 1 mM) and subsequent aromatic sub-products into non-toxic compounds after 2 h of EF treatment. The toxicity of every intermediate produced during the mineralization of ACE was quantified, and a relationship was established between the degradation pathway of ACE and the global toxicity evolution of the solution. After 8 h of treatment, a total organic carbon removal of 86.9% could be reached for 0.1 mM ACE at applied current of 500 mA with 0.2 mM of Fe 2+ used as catalyst. Copyright © 2016 Elsevier Ltd. All rights reserved.

Effect of different carboxylic acids in cyclodextrin functionalization of cellulose nanocrystals for prolonged release of carvacrol.

PubMed

Castro, D O; Tabary, N; Martel, B; Gandini, A; Belgacem, N; Bras, J

2016-12-01

Current investigations deal with new surface functionalization strategy of nanocrystalline cellulose-based substrates to impart active molecule release properties. In this study, cellulose nanocrystals (CNC) were surface-functionalized with β-cyclodextrin (β-CD) using succinic acid (SA) and fumaric acid (FA) as bridging agents. The main objective of this surface modification performed only in aqueous media was to obtain new active materials able to release antibacterial molecules over a prolonged period of time. The reactions were conducted by immersing the CNC film into a solution composed of β-CD, SA and FA, leading to CNC grafting. The materials were characterized by infrared spectroscopy (FT-IR), Quartz crystal microbalance-dissipation (QCM-D), AFM and phenolphthalein (PhP) was used to determine the efficiency of CNC grafting with β-CD. The results indicated that β-CD was successfully attached to the CNC backbone through the formation of ester bonds. Furthermore, carvacrol was entrapped by the attached β-CD and a prolonged release was confirmed. In particular, CNC grafted to β-CD in the presence of FA was selected as the best solution. The antibacterial activity and the controlled release were studied for this sample. Considerably longer bacterial activity against B. subtilis was observed for CNC grafted to β-CD compared to CNC and CNC-FA, confirming the promising impact of the present strategy. Copyright © 2016 Elsevier B.V. All rights reserved.

Gateways to clinical trials.

PubMed

Bayes, M; Rabasseda, X; Prous, J R

2006-01-01

Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs:(R)-Flurbiprofen, 90Yttrium-DOTA-huJ591; ABT-510, ACP-103, Ad5-FGF4, adalimumab, ademetionine, AG-7352, alemtuzumab, Amb a 1 ISS-DNA, anakinra, apaziquone, aprepitant, aripiprazole, atazanavir sulfate; BAL-8557, bevacizumab, BMS-188797, bortezomib, bosentan, brivudine; Calcipotriol/betamethasone dipropionate, cannabidiol, caspofungin acetate, catumaxomab, CERE-120, cetuximab, ciclesonide, cilomilast, cizolirtine citrate, Cypher, cystemustine; Dalbavancin, darifenacin hydrobromide, dasatinib, deferasirox, denosumab, desmoteplase, dihydrexidine, dimethyl fumarate, dutasteride, DW-166HC; Eculizumab, enfuvirtide, entecavir, epratuzumab, erlotinib hydrochloride, escitalopram oxalate, eszopiclone, etoricoxib, everolimus; Fallypride, febuxostat, fenretinide, fesoterodine, fingolimod hydrochloride; Gabapentin enacarbil, gefitinib; hMaxi-K, human papillomavirus vaccine, HYAL-CT1101; Imatinib mesylate, indiplon, inolimomab, ISAtx-247; J591; Lacosamide, landiolol, lasofoxifene tartrate, lestaurtinib, lidocaine/prilocaine, linezolid, lixivaptan, lonafarnib, lopinavir, lopinavir/ritonavir, lumiracoxib; Natalizumab, nesiritide; OC-108, omalizumab, onercept, OSC; Palifermin, palonosetron hydrochloride, parathyroid hormone (human recombinant), parecoxib sodium, PD-MAGE-3 vaccine, PEG-filgrastim, peginterferon alfa-2a, peginterferon alfa-2b, pegsunercept, pelitinib, pitavastatin calcium, plerixafor hydrochloride, posaconazole, prasterone sulfate, pregabalin; Ramelteon, ranelic acid distrontium salt, rasburicase, rosuvastatin calcium, rotigotine, RSD-1235, rufinamide, rupatadine fumarate; Sarizotan hydrochloride, SHL-749, sirolimus-eluting stent, solifenacin succinate, sunitinib malate; Tadalafil, talampanel, tasidotin hydrochloride, Taxus, tegaserod maleate, telavancin hydrochloride, tenofovir disoproxil fumarate, tiotropium bromide, tocilizumab, tositumomab, treprostinil sodium, tridolgosir hydrochloride, TTS-CD3; Ularitide; Valdecoxib, Val-Tyr sardine peptidase, vardenafil hydrochloride hydrate, voriconazole; Yttrium (90Y) edotreotide, Yttrium 90 (90Y) ibritumomab tiuxetan; Zileuton, zucapsaicin.

Potentiometric determination of ketotifen fumarate in pharmaceutical preparations and urine using carbon paste and PVC membrane selective electrodes.

PubMed

Frag, Eman Y Z; Mohamed, Gehad G; Khalil, Mohamed M; Hwehy, Mohammad M A

2011-01-01

This study compares between unmodified carbon paste (CPE; the paste has no ion pair) and polyvinyl chloride (PVC) membrane selective electrodes that were used in potentiometric determination of ketotifen fumarate (KTF), where sodium tetraphenylborate (NaTPB) was used as titrant. The performance characteristics of these sensors were evaluated according to IUPAC recommendations which reveal a fast, stable, and linear response for KTF over the concentration range of 10(-7) to 10(-2) mol L(-1). The electrodes show Nernstian slope value of 52.51 ± 0.20 and 51.51 ± 0.25 mV decade(-1) for CPE and PVC membrane electrodes at 30°C, respectively. The potential is nearly stable over the pH range 3.0-6.0 and 2.0-7.0 for CPE and PVC membrane electrodes, respectively. Selectivity coefficient values towards different inorganic cations, sugars, and amino acids reflect high selectivity of the prepared electrodes. The electrodes responses at different temperatures were also studied, and long operational lifetime of 12 and 5 weeks for CPE and PVC membrane electrodes, respectively, were found. These are used for determination of ketotifen fumarate using potentiometric titration, calibration, and standard addition methods in pure samples, its pharmaceutical preparations (Zaditen tablets), and biological fluid (urine). The direct potentiometric determination of KTF using the proposed sensors gave recoveries % of 98.97 ± 0.53 and 98.62 ± 0.74 with RSD 1.42 and 0.63% for CPE and PVC membrane selective electrodes, respectively. Validation of the method shows suitability of the proposed sensors for use in quality control assessment of KTF. The obtained results were in a good agreement with those obtained using the reported spectrophotometric method.

Potentiometric Determination of Ketotifen Fumarate in Pharmaceutical Preparations and Urine Using Carbon Paste and PVC Membrane Selective Electrodes

PubMed Central

Frag, Eman Y. Z.; Mohamed, Gehad G.; Khalil, Mohamed M.; Hwehy, Mohammad M. A.

2011-01-01

This study compares between unmodified carbon paste (CPE; the paste has no ion pair) and polyvinyl chloride (PVC) membrane selective electrodes that were used in potentiometric determination of ketotifen fumarate (KTF), where sodium tetraphenylborate (NaTPB) was used as titrant. The performance characteristics of these sensors were evaluated according to IUPAC recommendations which reveal a fast, stable, and linear response for KTF over the concentration range of 10−7 to 10−2 mol L−1. The electrodes show Nernstian slope value of 52.51 ± 0.20 and 51.51 ± 0.25 mV decade−1 for CPE and PVC membrane electrodes at 30°C, respectively. The potential is nearly stable over the pH range 3.0–6.0 and 2.0–7.0 for CPE and PVC membrane electrodes, respectively. Selectivity coefficient values towards different inorganic cations, sugars, and amino acids reflect high selectivity of the prepared electrodes. The electrodes responses at different temperatures were also studied, and long operational lifetime of 12 and 5 weeks for CPE and PVC membrane electrodes, respectively, were found. These are used for determination of ketotifen fumarate using potentiometric titration, calibration, and standard addition methods in pure samples, its pharmaceutical preparations (Zaditen tablets), and biological fluid (urine). The direct potentiometric determination of KTF using the proposed sensors gave recoveries % of 98.97 ± 0.53 and 98.62 ± 0.74 with RSD 1.42 and 0.63% for CPE and PVC membrane selective electrodes, respectively. Validation of the method shows suitability of the proposed sensors for use in quality control assessment of KTF. The obtained results were in a good agreement with those obtained using the reported spectrophotometric method. PMID:22013443

Dimethyl Fumarate Selectively Reduces Memory T Cells and Shifts the Balance between Th1/Th17 and Th2 in Multiple Sclerosis Patients.

PubMed

Wu, Qi; Wang, Qin; Mao, Guangmei; Dowling, Catherine A; Lundy, Steven K; Mao-Draayer, Yang

2017-04-15

Dimethyl fumarate (DMF; trade name Tecfidera) is an oral formulation of the fumaric acid ester that is Food and Drug Administration approved for treatment of relapsing-remitting multiple sclerosis. To better understand the therapeutic effects of Tecfidera and its rare side effect of progressive multifocal leukoencephalopathy, we conducted cross-sectional and longitudinal studies by immunophenotyping cells from peripheral blood (particularly T lymphocytes) derived from untreated and 4-6 and 18-26 mo Tecfidera-treated stable relapsing-remitting multiple sclerosis patients using multiparametric flow cytometry. The absolute numbers of CD4 and CD8 T cells were significantly decreased and the CD4/CD8 ratio was increased with DMF treatment. The proportions of both effector memory T cells and central memory T cells were reduced, whereas naive T cells increased in treated patients. T cell activation was reduced with DMF treatment, especially among effector memory T cells and effector memory RA T cells. Th subsets Th1 (CXCR3 + ), Th17 (CCR6 + ), and particularly those expressing both CXCR3 and CD161 were reduced most significantly, whereas the anti-inflammatory Th2 subset (CCR3 + ) was increased after DMF treatment. A corresponding increase in IL-4 and decrease in IFN-γ and IL-17-expressing CD4 + T cells were observed in DMF-treated patients. DMF in vitro treatment also led to increased T cell apoptosis and decreased activation, proliferation, reactive oxygen species, and CCR7 expression. Our results suggest that DMF acts on specific memory and effector T cell subsets by limiting their survival, proliferation, activation, and cytokine production. Monitoring these subsets could help to evaluate the efficacy and safety of DMF treatment. Copyright © 2017 by The American Association of Immunologists, Inc.

Gateways to clinical trials.

PubMed

Bayés, M; Rabasseda, X; Prous, J R

2005-04-01

Gateways to Clinical Trials is a guide to the most recent clinical trials in current literature and congresses. The data in the following tables has been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity. prous.com. This issue focuses on the following selection of drugs: ABX-IL-8, Acclaim, adalimumab, AGI-1067, alagebrium chloride, alemtuzumab, Alequel, Androgel, anti-IL-12 MAb, AOD-9604, aripiprazole, atomoxetine hydrochloride; Biphasic insulin aspart, bosentan, botulinum toxin type B, bovine lactoferrin, brivudine; Cantuzumab mertansine, CB-1954, CDB-4124, CEA-TRICOM, choriogonadotropin alfa, cilansetron, CpG-10101, CpG-7909, CTL-102, CTL-102/CB-1954; DAC:GRF, darbepoetin alfa, davanat-1, decitabine, del-1 Genemedicine, dexanabinol, dextofisopam, dnaJP1, dronedarone hydrochloride, dutasteride; Ecogramostim, eletriptan, emtricitabine, EPI-hNE-4, eplerenone, eplivanserin fumarate, erlotinib hydrochloride, ertapenem sodium, escitalopram oxalate, esomeprazole magnesium, etoricoxib, ezetimibe; Falecalcitriol, fingolimod hydrochloride; Gepirone hydrochloride; HBV-ISS, HSV-2 theracine, human insulin; Imatinib mesylate, Indiplon, insulin glargine, ISAtx-247; L612 HuMAb, levodopa/carbidopa/entacapone, lidocaine/prilocaine, LL-2113AD, lucinactant, LY-156735; Meclinertant, metelimumab, morphine hydrochloride, morphine-6-glucuronide; Natalizumab, nimotuzumab, NX-1207, NYVAC-HIV C; Omalizumab, onercept, osanetant; PABA, palosuran sulfate, parathyroid hormone (human recombinant), parecoxib sodium, PBI-1402, PCK-3145, peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, pemetrexed disodium, pimecrolimus, PINC, pregabalin; Ramelteon, rasagiline mesilate, rasburicase, rimonabant hydrochloride, RO-0098557, rofecoxib, rosiglitazone maleate/metformin hydrochloride; Safinamide mesilate, SHL-749, sitaxsentan sodium, sparfosic acid, SprayGel, squalamine, St. John's Wort extract, synthetic human secretin; Taxus, telavancin hydrochloride, telithromycin, temoporfin, tenofovir disoproxil fumarate, tenofovir disoproxil fumarate/emtricitabine, teriparatide, testosterone gel, TG-1024, tirapazamine, travoprost, travoprost/timolol; Valdecoxib, valganciclovir hydrochloride, voriconazole; Ximelagatran.

Development of laminated fiber-reinforced nanocomposites for bone regeneration

NASA Astrophysics Data System (ADS)

Xu, Weijie

There have been numerous efforts to develop synthetic and/or natural tissue engineering scaffolds that are suitable for bone regeneration applications to replace autograft and allograft bones. Current biomaterials as a scaffold for bone regeneration are limited by the extent of degradation concurrent with bone formation, mechanical strength, and the extent of osteogenic differentiation of marrow stromal cells migrating from the surrounding tissues. In this project, a novel laminated nanocomposite scaffold is fabricated, consisting of poly (L-lactide ethylene oxide fumarate) (PLEOF) hydrogel reinforced with poly (L-lactic acid) (PLLA) electrospun nanofibers and hydroxyapatite (HA) nanoparticles. PLEOF is a novel in situ crosslinkable macromer synthesized from biocompatible building units which can be functionalized with bioactive peptides like the cell-adhesive Arg--Gly--Asp (RGD) amino acid sequence. The hydrophilicity and degradation rate of the macromer can be tailored to a particular application by controlling the ratio of PEG to PLA blocks in the macromer and the unsaturated fumarate units can be used for in-situ crosslinking. The PLLA nanofibers were electrospun from high molecular weight PLLA. The laminated nanocomposites were fabricated by dry-hand lay up technique followed by compression molding and thermal crosslinking. The laminated nanocomposites were evaluated with respect to degradation, water uptake, mechanical strength, and the extent of osteogenic differentiation of bone marrow stromal (BMS) cells. Laminates with or without HA nanoparticles showed modulus values much higher than that of trabecular bone (50-100 MPa). The effect of laminated nanocomposites on osteogenic differentiation of BMS cells was determined in terms of cell number, ALPase activity and calcium content. Our results demonstrate that grafting RGD peptide and HA nanoparticles to a PLEOF hydrogel reinforced with PLLA nanofibers synergistically enhance osteogenic differentiation of BMS cells. In conclusion, the laminated nanocomposite with controllable degradation characteristics and robust mechanical properties is attractive as a synthetic bone-mimetic matrix for skeletal tissue regeneration.

Gateways to clinical trials.

PubMed

Bayes, M; Rabasseda, X; Prous, J R

2006-03-01

Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: 131I-labetuzumab; Abacavir sulfate, abatacept, adalimumab, ademetionine, adjuvanted influenza vaccine, alefacept, alemtuzumab, amlodipine, amphotericin B, anakinra, aripiprazole, aspirin, axitinib; Betamethasone dipropionate, bevacizumab, biphasic insulin aspart, bortezomib, bosentan, botulinum toxin type B, BQ-123; Calcium folinate, canertinib dihydrochloride, carboplatin, carmustine, cetirizine hydrochloride, cetuximab, cholecalciferol, ciclesonide, ciclosporin, cinacalcet hydrochloride, cisplatin, clarithromycin, clofazimine, cold-adapted influenza vaccine trivalent, CpG-7909; Darbepoetin alfa, darifenacin hydrobromide, DB-289, desloratadine, Dexamet, dicycloverine hydrochloride, dimethyl fumarate, docetaxel, dolastatin 10, drospirenone, drospirenone/estradiol, duloxetine hydrochloride; Ecogramostim, edotecarin, efaproxiral sodium, enalapril maleate, epoetin beta, epoprostenol sodium, epratuzumab, erlotinib hydrochloride, escitalopram oxalate, estradiol, etanercept; Fluconazole, fludarabine phosphate, fluorouracil; Gefitinib, gemcitabine, Ghrelin (human), glibenclamide, glimepiride, GTI-2040; Haloperidol, human insulin, hydrocortisone probutate; Imatinib mesylate, indisulam, influenza vaccine, inhaled insulin, insulin aspart, insulin glulisine, insulin lispro, irinotecan, ispronicline; Lamivudine, lamivudine/zidovudine/abacavir sulfate, lapatinib, letrozole, levocetirizine, lomustine, lonafarnib, lumiracoxib;Magnesium sulfate, MD-1100, melphalan, metformin hydrochloride, methotrexate, metoclopramide hydrochloride, mitiglinide calcium hydrate, monophosphoryl lipid A, montelukast sodium, motexafin gadolinium, mycophenolate mofetil, mycophenolic acid sodium salt; Nitisinone; Omalizumab, omapatrilat, ONYX-015, oxaliplatin; Paclitaxel, paclitaxel nanoparticles, panitumumab, parathyroid hormone (human recombinant), peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, pertuzumab, phosphatidylcholine-rich phospholipid mixture, pimecrolimus, pioglitazone hydrochloride, pramlintide acetate, prasterone; QR-333; Ranelic acid distrontium salt, ranolazine, rasagiline mesilate, RFB4(dsFv)-PE38, ribavirin, rifabutin, risperidone, rituximab, rofecoxib, rosiglitazone maleate, rosiglitazone maleate/metformin hydrochloride, rotavirus vaccine; S-236, salmeterol xinafoate, sarizotan hydrochloride, sildenafil, sildenafil citrate, sunitinib malate; Tadalafil, tegaserod maleate, temozolomide, tenofovir disoproxil fumarate, teriparatide, tiotropium bromide, tipifarnib, trabectedin, treprostinil sodium; Vandetanib, vardenafil hydrochloride hydrate, vatalanib succinate, vinflunine, virosome influenza vaccine, voriconazole; Zidovudine. (c) 2006 Prous Science. All rights reserved.

Escherichia coli strains engineered for homofermentative production of D-lactic acid from glycerol.

PubMed

Mazumdar, Suman; Clomburg, James M; Gonzalez, Ramon

2010-07-01

Given its availability and low price, glycerol has become an ideal feedstock for the production of fuels and chemicals. We recently reported the pathways mediating the metabolism of glycerol in Escherichia coli under anaerobic and microaerobic conditions. In this work, we engineer E. coli for the efficient conversion of glycerol to d-lactic acid (d-lactate), a negligible product of glycerol metabolism in wild-type strains. A homofermentative route for d-lactate production was engineered by overexpressing pathways involved in the conversion of glycerol to this product and blocking those leading to the synthesis of competing by-products. The former included the overexpression of the enzymes involved in the conversion of glycerol to glycolytic intermediates (GlpK-GlpD and GldA-DHAK pathways) and the synthesis of d-lactate from pyruvate (d-lactate dehydrogenase). On the other hand, the synthesis of succinate, acetate, and ethanol was minimized through two strategies: (i) inactivation of pyruvate-formate lyase (DeltapflB) and fumarate reductase (DeltafrdA) (strain LA01) and (ii) inactivation of fumarate reductase (DeltafrdA), phosphate acetyltransferase (Deltapta), and alcohol/acetaldehyde dehydrogenase (DeltaadhE) (strain LA02). A mutation that blocked the aerobic d-lactate dehydrogenase (Deltadld) also was introduced in both LA01 and LA02 to prevent the utilization of d-lactate. The most efficient strain (LA02Deltadld, with GlpK-GlpD overexpressed) produced 32 g/liter of d-lactate from 40 g/liter of glycerol at a yield of 85% of the theoretical maximum and with a chiral purity higher than 99.9%. This strain exhibited maximum volumetric and specific productivities for d-lactate production of 1.5 g/liter/h and 1.25 g/g cell mass/h, respectively. The engineered homolactic route generates 1 to 2 mol of ATP per mol of d-lactate and is redox balanced, thus representing a viable metabolic pathway.

The sulfate-reducing bacterium Desulfovibrio desulfuricans ND132 as a model for understanding bacterial mercury methylation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gilmour, C C; Elias, Dwayne A; Kucken, A M

2010-01-01

We propose the use of Desulfovibrio sp. ND132 as a model species for understanding the genetics and biochemistry of microbial Hg methylation. ND132 is a dissimilatory sulfate-reducing bacterium (DSRB) that exhibits exceptionally high rates of Hg methylation in culture, but is otherwise a characteristically typical Desulfovibrio strain. The full genome sequence of ND132 will be available soon. ND132 is very similar to other DSRB that are sequenced but do not methylate Hg, allowing comparison for potential methylation genes. Here, we describe the physiological characteristics of the strain, examine its MeHg production capability, and place the strain within the phylogeny ofmore » the Desulfovibrionales using 16S rRNA. We also examine Hg toxicity and the inducibility of MeHg production amongst the DSRB by comparing ND132 to non-methylating DSRB. The optimal growth medium for Hg methylation is pyruvate/fumarate, which supports strong respiratory growth without sulfide production. At moderate Hg concentrations (10 ng/ml), and using TiNTA as a reductant, ND132 methylates about 30% of added HgCl2 during batch culture growth on 40 mM pyruvate/fumarate. Under constant culture conditions, MeHg production is an exponential function of Hg concentration, probably reflecting Hg partitioning between aqueous and solid phases. To help understand how Hg is taken up by this organism, we examined the influence of a variety of small thiol-bearing ligands, as well as select amino acids, on methylation by D. desulfuricans ND132. All thiol bearing ligands tested affected methylation in similar ways, suggesting that Hg uptake by ND132 is not associated with uptake of a specific amino acid. To identify enzymes for the methylation activity, a genetic approach is being pursued. Conjugation from E. coli donors works well that allows the generation of a transposon library of random ND132 mutants. These mutants will be screened for affects on mercury methylation.« less

Anaerobic 1-alkene metabolism by the alkane- and alkene-degrading sulfate reducer Desulfatibacillum aliphaticivorans strain CV2803T.

PubMed

Grossi, Vincent; Cravo-Laureau, Cristiana; Méou, Alain; Raphel, Danielle; Garzino, Frédéric; Hirschler-Réa, Agnès

2007-12-01

The alkane- and alkene-degrading, marine sulfate-reducing bacterium Desulfatibacillum aliphaticivorans strain CV2803(T), known to oxidize n-alkanes anaerobically by fumarate addition at C-2, was investigated for its 1-alkene metabolism. The total cellular fatty acids of this strain were predominantly C-(even number) (C-even) when it was grown on C-even 1-alkenes and predominantly C-(odd number) (C-odd) when it was grown on C-odd 1-alkenes. Detailed analyses of those fatty acids by gas chromatography-mass spectrometry after 6- to 10-week incubations allowed the identification of saturated 2- and 4-ethyl-, 2- and 4-methyl-, and monounsaturated 4-methyl-branched fatty acids with chain lengths that correlated with those of the 1-alkene. The growth of D. aliphaticivorans on (per)deuterated 1-alkenes provided direct evidence of the anaerobic transformation of these alkenes into the corresponding 1-alcohols and into linear as well as 10- and 4-methyl-branched fatty acids. Experiments performed with [(13)C]bicarbonate indicated that the initial activation of 1-alkene by the addition of inorganic carbon does not occur. These results demonstrate that D. aliphaticivorans metabolizes 1-alkene by the oxidation of the double bond at C-1 and by the subterminal addition of organic carbon at both ends of the molecule [C-2 and C-(omega-1)]. The detection of ethyl-branched fatty acids from unlabeled 1-alkenes further suggests that carbon addition also occurs at C-3. Alkylsuccinates were not observed as potential initial intermediates in alkene metabolism. Based on our observations, the first pathways for anaerobic 1-alkene metabolism in an anaerobic bacterium are proposed. Those pathways indicate that diverse initial reactions of 1-alkene activation can occur simultaneously in the same strain of sulfate-reducing bacterium.

Anaerobic 1-Alkene Metabolism by the Alkane- and Alkene-Degrading Sulfate Reducer Desulfatibacillum aliphaticivorans Strain CV2803T▿

PubMed Central

Grossi, Vincent; Cravo-Laureau, Cristiana; Méou, Alain; Raphel, Danielle; Garzino, Frédéric; Hirschler-Réa, Agnès

2007-01-01

The alkane- and alkene-degrading, marine sulfate-reducing bacterium Desulfatibacillum aliphaticivorans strain CV2803T, known to oxidize n-alkanes anaerobically by fumarate addition at C-2, was investigated for its 1-alkene metabolism. The total cellular fatty acids of this strain were predominantly C-(even number) (C-even) when it was grown on C-even 1-alkenes and predominantly C-(odd number) (C-odd) when it was grown on C-odd 1-alkenes. Detailed analyses of those fatty acids by gas chromatography-mass spectrometry after 6- to 10-week incubations allowed the identification of saturated 2- and 4-ethyl-, 2- and 4-methyl-, and monounsaturated 4-methyl-branched fatty acids with chain lengths that correlated with those of the 1-alkene. The growth of D. aliphaticivorans on (per)deuterated 1-alkenes provided direct evidence of the anaerobic transformation of these alkenes into the corresponding 1-alcohols and into linear as well as 10- and 4-methyl-branched fatty acids. Experiments performed with [13C]bicarbonate indicated that the initial activation of 1-alkene by the addition of inorganic carbon does not occur. These results demonstrate that D. aliphaticivorans metabolizes 1-alkene by the oxidation of the double bond at C-1 and by the subterminal addition of organic carbon at both ends of the molecule [C-2 and C-(ω-1)]. The detection of ethyl-branched fatty acids from unlabeled 1-alkenes further suggests that carbon addition also occurs at C-3. Alkylsuccinates were not observed as potential initial intermediates in alkene metabolism. Based on our observations, the first pathways for anaerobic 1-alkene metabolism in an anaerobic bacterium are proposed. Those pathways indicate that diverse initial reactions of 1-alkene activation can occur simultaneously in the same strain of sulfate-reducing bacterium. PMID:17965214

Argininosuccinate lyase deficiency-argininosuccinic aciduria and beyond.

PubMed

Erez, Ayelet; Nagamani, Sandesh C Sreenath; Lee, Brendan

2011-02-15

The urea cycle consists of six consecutive enzymatic reactions that convert waste nitrogen into urea. Deficiencies of any of these enzymes of the cycle result in urea cycle disorders (UCD), a group of inborn errors of hepatic metabolism that often result in life threatening hyperammonemia. Argininosuccinate lyase (ASL) is a cytosolic enzyme which catalyzes the fourth reaction in the cycle and the first degradative step, that is, the breakdown of argininosuccinic acid to arginine and fumarate. Deficiency of ASL results in an accumulation of argininosuccinic acid in tissues, and excretion of argininosuccinic acid in urine leading to the condition argininosuccinic aciduria (ASA). ASA is an autosomal recessive disorder and is the second most common UCD. In addition to the accumulation of argininosuccinic acid, ASL deficiency results in decreased synthesis of arginine, a feature common to all UCDs except argininemia. Arginine is not only the precursor for the synthesis of urea and ornithine as part of the urea cycle but it is also the substrate for the synthesis of nitric oxide, polyamines, proline, glutamate, creatine, and agmatine. Hence, while ASL is the only enzyme in the body able to generate arginine, at least four enzymes use arginine as substrate: arginine decarboxylase, arginase, nitric oxide synthetase (NOS) and arginine/glycine aminotransferase. In the liver, the main function of ASL is ureagenesis, and hence, there is no net synthesis of arginine. In contrast, in most other tissues, its role is to generate arginine that is designated for the specific cell's needs. While patients with ASA share the acute clinical phenotype of hyperammonemia, encephalopathy, and respiratory alkalosis common to other UCD, they also present with unique chronic complications most probably caused by a combination of tissue specific deficiency of arginine and/or elevation of argininosuccinic acid. This review article summarizes the clinical characterization, biochemical, enzymatic, and molecular features of this disorder. Current treatment, prenatal diagnosis, diagnosis through the newborn screening as well as hypothesis driven future treatment modalities are discussed. Copyright © 2011 Wiley-Liss, Inc.

Catabolism of α-Ketoglutarate by a sucA Mutant of Bradyrhizobium japonicum: Evidence for an Alternative Tricarboxylic Acid Cycle

PubMed Central

Green, Laura S.; Li, Youzhong; Emerich, David W.; Bergersen, Fraser J.; Day, David A.

2000-01-01

A complete tricarboxylic acid (TCA) cycle is generally considered necessary for energy production from the dicarboxylic acid substrates malate, succinate, and fumarate. However, a Bradyrhizobium japonicum sucA mutant that is missing α-ketoglutarate dehydrogenase is able to grow on malate as its sole source of carbon. This mutant also fixes nitrogen in symbiosis with soybean, where dicarboxylic acids are its principal carbon substrate. Using a flow chamber system to make direct measurements of oxygen consumption and ammonium excretion, we confirmed that bacteroids formed by the sucA mutant displayed wild-type rates of respiration and nitrogen fixation. Despite the absence of α-ketoglutarate dehydrogenase activity, whole cells of the mutant were able to decarboxylate α-[U-14C]ketoglutarate and [U-14C]glutamate at rates similar to those of wild-type B. japonicum, indicating that there was an alternative route for α-ketoglutarate catabolism. Because cell extracts from B. japonicum decarboxylated [U-14C]glutamate very slowly, the γ-aminobutyrate shunt is unlikely to be the pathway responsible for α-ketoglutarate catabolism in the mutant. In contrast, cell extracts from both the wild type and mutant showed a coenzyme A (CoA)-independent α-ketoglutarate decarboxylation activity. This activity was independent of pyridine nucleotides and was stimulated by thiamine PPi. Thin-layer chromatography showed that the product of α-ketoglutarate decarboxylation was succinic semialdehyde. The CoA-independent α-ketoglutarate decarboxylase, along with succinate semialdehyde dehydrogenase, may form an alternative pathway for α-ketoglutarate catabolism, and this pathway may enhance TCA cycle function during symbiotic nitrogen fixation. PMID:10781553

The metabolite profiling of coastal coccolithophorid species Pleurochrysis carterae (Haptophyta)

NASA Astrophysics Data System (ADS)

Zhou, Chengxu; Luo, Jie; Ye, Yangfang; Yan, Xiaojun; Liu, Baoning; Wen, Xin

2016-07-01

Pleurochrysis carterae is a calcified coccolithophorid species that usually blooms in the coastal area and causes aquaculture losses. The cellular calcification, blooming and many other critical species specific eco-physiological processes are closely related to various metabolic pathways. The purpose of this study is to apply the unbiased and non-destructive method of nuclear magnetic resonance (NMR) to detect the unknown holistic metabolite of P. carterae. The results show that NMR spectroscopic method is practical in the analysis of metabolites of phytoplankton. The metabolome of P. carterae was dominated by 26 metabolites involved in a number of different primary and secondary metabolic pathways. Organic acids and their derivatives, amino acids, sugars, nucleic aides were mainly detected. The abundant metabolites are that closely related to the process of cellular osmotic adjustment, which possibly reflect the active ability of P. carterae to adapt to the versatile coastal niche. DMSP (dimethylsulphoniopropionate) was the most dominant metabolite in P. carterae, up to 2.065±0.278 mg/g lyophilized cells, followed by glutamate and lactose, the contents were 0.349±0.035 and 0.301±0.073 mg/g lyophilized cells respectively. Other metabolites that had the content ranged between 0.1-0.2 mg/g lyophilized cells were alanine, isethionate and arabinose. Amino acid (valine, phenylalanine, isoleucine, tyrosine), organic acid salts (lactate, succinate), scyllitol and uracil had content ranged from 0.01 to below 0.1 mg/g lyophilized cells. Trigonelline, fumarate and formate were detected in very low content (only thousandths of 1 mg per gram of lyophilized cells or below). Our results of the holistic metabolites of P. carterae are the basic references for the further studies when multiple problems will be addressed to this notorious blooming calcifying species.

Investigation of the chemomarkers correlated with flower colour in different organs of Catharanthus roseus using NMR-based metabolomics.

PubMed

Pan, Qifang; Dai, Yuntao; Nuringtyas, Tri Rini; Mustafa, Natali Rianika; Schulte, Anna Elisabeth; Verpoorte, Robert; Choi, Young Hae

2014-01-01

Flower colour is a complex phenomenon that involves a wide range of secondary metabolites of flowers, for example phenolics and carotenoids as well as co-pigments. Biosynthesis of these metabolites, though, occurs through complicated pathways in many other plant organs. The analysis of the metabolic profile of leaves, stems and roots, for example, therefore may allow the identification of chemomarkers related to the final expression of flower colour. To investigate the metabolic profile of leaves, stems, roots and flowers of Catharanthus roseus and the possible correlation with four flower colours (orange, pink, purple and red). (1) H-NMR and multivariate data analysis were used to characterise the metabolites in the organs. The results showed that flower colour is characterised by a special pattern of metabolites such as anthocyanins, flavonoids, organic acids and sugars. The leaves, stems and roots also exhibit differences in their metabolic profiles according to the flower colour. Plants with orange flowers featured a relatively high level of kaempferol analogues in all organs except roots. Red-flowered plants showed a high level of malic acid, fumaric acid and asparagine in both flowers and leaves, and purple and pink flowering plants exhibited high levels of sucrose, glucose and 2,3-dihydroxy benzoic acid. High concentrations of quercetin analogues were detected in flowers and leaves of purple-flowered plants. There is a correlation between the metabolites specifically associated to the expression of different flower colours and the metabolite profile of other plant organs and it is therefore possible to predict the flower colours by detecting specific metabolites in leaves, stems or roots. This may have interesting application in the plant breeding industry. Copyright © 2013 John Wiley & Sons, Ltd.

Fluorescent pseudomonads occurring in Macrotermes subhyalinus mound structures decrease Cd toxicity and improve its accumulation in sorghum plants.

PubMed

Duponnois, R; Kisa, M; Assigbetse, K; Prin, Y; Thioulouse, J; Issartel, M; Moulin, P; Lepage, M

2006-11-01

Cd-tolerant bacterial strains of fluorescent pseudomonads, mostly belonging to Pseudomonas monteillii, were isolated from termite mound soil (Macrotermes subhyalinus, a litter-forager and fungus-growing termite), in a Sudanese shrubby savanna, Burkina Faso. Such large mounds appeared as sites of great bacterial diversity and could be considered as hot spots of metal-tolerant fluorescent pseudomonads. Microbial isolates were inoculated to Sorghum plants (S. bicolor) in glasshouse experiments with soil amended with CdCl(2) (560 mg Cd kg(-1) soil). Microbial functional diversity was assessed at the end of the experiment by measurement of in situ patterns of catabolic potentials. All the bacteria isolates significantly improved the shoot and total biomass of sorghum plants compared to the control. Results concerning root biomass were not significant with some strains. Arbuscular mycorrhiza (AM) was greatly reduced by CdCl(2) amendment, and fluorescent pseudomonad inoculation significantly increased AM colonisation in the contaminated soil. The bacterial inoculation significantly improved Cd uptake by sorghum plants. Measurement of catabolic potentials on 16 substrates showed that the microbial communities were different according to the soil amendment. Soils samples inoculated with pseudomonad strains presented a higher use of ketoglutaric and hydroxybutiric acids, as opposed to fumaric acid in soil samples not inoculated. It is suggested that fluorescent pseudomonads could act indirectly in such metabolic processes by involving a lower rate of degradation of citric acid, in line with the effect of small organic acid on phytoextraction of heavy metals from soil. This is a first contribution to bioremediation of metal-contaminated sites with soil-to-plant transfer, using termite built structures. Further data are required on the efficiency of the bacterial strains isolated and on the processes involved.

Effects of gamma irradiation on physicochemical properties, antioxidant and microbial activities of sour cherry juice

NASA Astrophysics Data System (ADS)

Arjeh, Edris; Barzegar, Mohsen; Ali Sahari, Mohammad

2015-09-01

Recently, due to the beneficial effects of bioactive compounds, demand for minimally processed fruits and fruit juices has increased rapidly in the world. In this study, sour cherry juice (SCJ) was exposed to gamma irradiation at 0.0, 0.5, 1.5, 3.0, 4.5, and 6.0 kGy and then stored at 4 °C for 60 days. Total soluble solids (TSS), total acidity (TA), color, total phenolic content (TPC), total monomeric anthocyanin content (TMC), antioxidant activity, organic acid profile, and microbial analysis were evaluated at regular intervals during the storage. Results indicated that irradiation did not have any significant effect on TSS, while level of TA increased significantly at the dose of 6 kGy (p<0.05). Furthermore, irradiation treatment and storage time led to a significant increase in L* and b* values and a decrease in a* values. Total monomeric anthocyanin content of the irradiated SCJ was lower than that of the non-irradiated one (24% at 3.0 kGy) and also changed toward a more negative direction during the storage (63% at 3.0 kGy for 60 days). There was a significant decrease in the antioxidant activity (DPPH radical scavenging and FRAP assay) in both irradiated and stored SCJs. After irradiation (0-6 kGy), the results showed that the concentration of malic and oxalic acid significantly increased; but, the concentration of ascorbic, citric, fumaric, and succinic acids significantly decreased. Gamma irradiation with doses of ≥3 kGy resulted in overall reduction in microbial loads. Based on the results obtained from the changes of physicochemical properties, antioxidant activity, and microbial analysis, irradiation of SCJ at doses of higher than 3.0 kGy is not recommended.

The antidiabetic drug metformin decreases mitochondrial respiration and tricarboxylic acid cycle activity in cultured primary rat astrocytes.

PubMed

Hohnholt, Michaela C; Blumrich, Eva-Maria; Waagepetersen, Helle S; Dringen, Ralf

2017-11-01

Metformin is an antidiabetic drug that is used daily by millions of patients worldwide. Metformin is able to cross the blood-brain barrier and has recently been shown to increase glucose consumption and lactate release in cultured astrocytes. However, potential effects of metformin on mitochondrial tricarboxylic acid (TCA) cycle metabolism in astrocytes are unknown. We investigated this by mapping 13 C labeling in TCA cycle intermediates and corresponding amino acids after incubation of primary rat astrocytes with [U- 13 C]glucose. The presence of metformin did not compromise the viability of cultured astrocytes during 4 hr of incubation, but almost doubled cellular glucose consumption and lactate release. Compared with control cells, the presence of metformin dramatically lowered the molecular 13 C carbon labeling (MCL) of the cellular TCA cycle intermediates citrate, α-ketoglutarate, succinate, fumarate, and malate, as well as the MCL of the TCA cycle intermediate-derived amino acids glutamate, glutamine, and aspartate. In addition to the total molecular 13 C labeling, analysis of the individual isotopomers of TCA cycle intermediates confirmed a severe decline in labeling and a significant lowering in TCA cycling ratio in metformin-treated astrocytes. Finally, the oxygen consumption of mitochondria isolated from metformin-treated astrocytes was drastically reduced in the presence of complex I substrates, but not of complex II substrates. These data demonstrate that exposure to metformin strongly impairs complex I-mediated mitochondrial respiration in astrocytes, which is likely to cause the observed decrease in labeling of mitochondrial TCA cycle intermediates and the stimulation of glycolytic lactate production. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Reductive Dehalogenation of Trichloroacetic Acid by Trichlorobacter thiogenes gen. nov., sp. nov.

PubMed Central

De Wever, Helene; Cole, James R.; Fettig, Michael R.; Hogan, Deborah A.; Tiedje, James M.

2000-01-01

A bacterium able to grow via reductive dechlorination of trichloroacetate was isolated from anaerobic soil enrichments. The isolate, designated strain K1, is a member of the δ proteobacteria and is related to other known sulfur and ferric iron reducers. In anaerobic mineral media supplemented with acetate and trichloroacetate, its doubling time was 6 h. Alternative electron donor and acceptors were acetoin and sulfur or fumarate, respectively. Trichloroacetate dehalogenation activity was constitutively present, and the dechlorination product was dichloroacetate and chloride. Trichloroacetate conversion seemed to be coupled to a novel sulfur-sulfide redox cycle, which shuttled electrons from acetate oxidation to trichloroacetate reduction. In view of its unique physiological characteristics, the name Trichlorobacter thiogenes is suggested for strain K1. PMID:10831402

Cochlear Homocysteine Metabolism at the Crossroad of Nutrition and Sensorineural Hearing Loss.

PubMed

Partearroyo, Teresa; Vallecillo, Néstor; Pajares, María A; Varela-Moreiras, Gregorio; Varela-Nieto, Isabel

2017-01-01

Hearing loss (HL) is one of the most common causes of disability, affecting 360 million people according to the World Health Organization (WHO). HL is most frequently of sensorineural origin, being caused by the irreversible loss of hair cells and/or spiral ganglion neurons. The etiology of sensorineural HL (SNHL) is multifactorial, with genetic and environmental factors such as noise, ototoxic substances and aging playing a role. The nutritional status is central in aging disability, but the interplay between nutrition and SNHL has only recently gained attention. Dietary supplementation could therefore constitute the first step for the prevention and potential repair of hearing damage before it reaches irreversibility. In this context, different epidemiological studies have shown correlations among the nutritional condition, increased total plasma homocysteine (tHcy) and SNHL. Several human genetic rare diseases are also associated with homocysteine (Hcy) metabolism and SNHL confirming this potential link. Accordingly, rodent experimental models have provided the molecular basis to understand the observed effects. Thus, increased tHcy levels and vitamin deficiencies, such as folic acid (FA), have been linked with SNHL, whereas long-term dietary supplementation with omega-3 fatty acids improved Hcy metabolism, cell survival and hearing acuity. Furthermore, pharmacological supplementations with the anti-oxidant fumaric acid that targets Hcy metabolism also improved SNHL. Overall these results strongly suggest that cochlear Hcy metabolism is a key player in the onset and progression of SNHL, opening the way for the design of prospective nutritional therapies.

Cochlear Homocysteine Metabolism at the Crossroad of Nutrition and Sensorineural Hearing Loss

PubMed Central

Partearroyo, Teresa; Vallecillo, Néstor; Pajares, María A.; Varela-Moreiras, Gregorio; Varela-Nieto, Isabel

2017-01-01

Hearing loss (HL) is one of the most common causes of disability, affecting 360 million people according to the World Health Organization (WHO). HL is most frequently of sensorineural origin, being caused by the irreversible loss of hair cells and/or spiral ganglion neurons. The etiology of sensorineural HL (SNHL) is multifactorial, with genetic and environmental factors such as noise, ototoxic substances and aging playing a role. The nutritional status is central in aging disability, but the interplay between nutrition and SNHL has only recently gained attention. Dietary supplementation could therefore constitute the first step for the prevention and potential repair of hearing damage before it reaches irreversibility. In this context, different epidemiological studies have shown correlations among the nutritional condition, increased total plasma homocysteine (tHcy) and SNHL. Several human genetic rare diseases are also associated with homocysteine (Hcy) metabolism and SNHL confirming this potential link. Accordingly, rodent experimental models have provided the molecular basis to understand the observed effects. Thus, increased tHcy levels and vitamin deficiencies, such as folic acid (FA), have been linked with SNHL, whereas long-term dietary supplementation with omega-3 fatty acids improved Hcy metabolism, cell survival and hearing acuity. Furthermore, pharmacological supplementations with the anti-oxidant fumaric acid that targets Hcy metabolism also improved SNHL. Overall these results strongly suggest that cochlear Hcy metabolism is a key player in the onset and progression of SNHL, opening the way for the design of prospective nutritional therapies. PMID:28487633

Variation in antibiotic-induced microbial recolonization impacts on the host metabolic phenotypes of rats.

PubMed

Swann, Jonathan R; Tuohy, Kieran M; Lindfors, Peter; Brown, Duncan T; Gibson, Glenn R; Wilson, Ian D; Sidaway, James; Nicholson, Jeremy K; Holmes, Elaine

2011-08-05

The interaction between the gut microbiota and their mammalian host is known to have far-reaching consequences with respect to metabolism and health. We investigated the effects of eight days of oral antibiotic exposure (penicillin and streptomycin sulfate) on gut microbial composition and host metabolic phenotype in male Han-Wistar rats (n = 6) compared to matched controls. Early recolonization was assessed in a third group exposed to antibiotics for four days followed by four days recovery (n = 6). Fluorescence in situ hybridization analysis of the intestinal contents collected at eight days showed a significant reduction in all bacterial groups measured (control, 10(10.7) cells/g feces; antibiotic-treated, 10(8.4)). Bacterial suppression reduced the excretion of mammalian-microbial urinary cometabolites including hippurate, phenylpropionic acid, phenylacetylglycine and indoxyl-sulfate whereas taurine, glycine, citrate, 2-oxoglutarate, and fumarate excretion was elevated. While total bacterial counts remained notably lower in the recolonized animals (10(9.1) cells/g faeces) compared to the controls, two cage-dependent subgroups emerged with Lactobacillus/Enterococcus probe counts dominant in one subgroup. This dichotomous profile manifested in the metabolic phenotypes with subgroup differences in tricarboxylic acid cycle metabolites and indoxyl-sulfate excretion. Fecal short chain fatty acids were diminished in all treated animals. Antibiotic treatment induced a profound effect on the microbiome structure, which was reflected in the metabotype. Moreover, the recolonization process was sensitive to the microenvironment, which may impact on understanding downstream consequences of antibiotic consumption in human populations.

Path of carbon flow during NO/sub 3//sup -/-induced photosynthetic suppression in N-limited Selenastrum minutum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elrifi, I.R.; Turpin, D.H.

Nitrate addition to nitrate-limited cultures of Selenastrum minutum Naeg. Collins (Chlorophyta) resulted in a 70% suppression of photosynthetic carbon fixation. In /sup 14/CO/sub 2/ pulse/chase experiments nitrate resupply increased radiolabel incorporation into amino and organic acids and decreased radiolabel incorporation into insoluble material. Nitrate resupply increased the concentration of phosphoenolpyruvate and increased the radiolabeling of phosphoenolpyruvate, pyruvate and tricarboxylic acid cycle intermediates, notably citrate, fumarate, and malate. Furthermore, nitrate also increased the pool sizes and radiolabeling of most amino acids, with alanine, aspartate, glutamate, and glutamine showing the largest changes. Nitrate resupply increased the proportion of radiolabel in the C-4more » position of malate and increased the ratios of radiolabel in aspartate to phosphoenolpyruvate and in pyruvate to phosphoenolpyruvate, indicative of increased phosphoenolpyruvate carboxylase and pyruvate kinase activities. Analysis of these data showed that the rate of carbon flow through glutamate (10.6 ..mu..moles glutamate per milligram chlorophyll per hour) and the rate of net glutamate production (7.9 ..mu..moles glutamate per milligram chlorophyll per hour) were both greater than the maximum rate of carbon export from the Calvin cycle which could be maintained during steady state photosynthesis. These results are consistent with the hypothesis that nitrogen resupply to nitrogen-limited microalgae results in a transient suppression of photosynthetic carbon fixation due, in part, to the severity of competition for carbon skeletons between the Calvin cycle and nitrogen assimilation.« less

The Path of Carbon Flow during NO3−-Induced Photosynthetic Suppression in N-Limited Selenastrum minutum1

PubMed Central

Elrifi, Ivor R.; Turpin, David H.

1987-01-01

Nitrate addition to nitrate-limited cultures of Selenastrum minutum Naeg. Collins (Chlorophyta) resulted in a 70% suppression of photosynthetic carbon fixation. In 14CO2 pulse/chase experiments nitrate resupply increased radiolabel incorporation into amino and organic acids and decreased radiolabel incorporation into insoluble material. Nitrate resupply increased the concentration of phosphoenolpyruvate and increased the radiolabeling of phosphoenolpyruvate, pyruvate and tricarboxylic acid cycle intermediates, notably citrate, fumarate, and malate. Furthermore, nitrate also increased the pool sizes and radiolabeling of most amino acids, with alanine, aspartate, glutamate, and glutamine showing the largest changes. Nitrate resupply increased the proportion of radiolabel in the C-4 position of malate and increased the ratios of radiolabel in aspartate to phosphoenolpyruvate and in pyruvate to phosphoenolpyruvate, indicative of increased phosphoenolpyruvate carboxylase and pyruvate kinase activities. Analysis of these data showed that the rate of carbon flow through glutamate (10.6 μmoles glutamate per milligram chlorophyll per hour) and the rate of net glutamate production (7.9 μmoles glutamate per milligram chlorophyll per hour) were both greater than the maximum rate of carbon export from the Calvin cycle which could be maintained during steady state photosynthesis. These results are consistent with the hypothesis that nitrogen resupply to nitrogen-limited microalgae results in a transient suppression of photosynthetic carbon fixation due, in part, to the severity of competition for carbon skeletons between the Calvin cycle and nitrogen assimilation (IR Elrifi, DH Turpin 1986 Plant Physiol 81: 273-279). PMID:16665223

The Path of Carbon Flow during NO(3)-Induced Photosynthetic Suppression in N-Limited Selenastrum minutum.

PubMed

Elrifi, I R; Turpin, D H

1987-01-01

Nitrate addition to nitrate-limited cultures of Selenastrum minutum Naeg. Collins (Chlorophyta) resulted in a 70% suppression of photosynthetic carbon fixation. In (14)CO(2) pulse/chase experiments nitrate resupply increased radiolabel incorporation into amino and organic acids and decreased radiolabel incorporation into insoluble material. Nitrate resupply increased the concentration of phosphoenolpyruvate and increased the radiolabeling of phosphoenolpyruvate, pyruvate and tricarboxylic acid cycle intermediates, notably citrate, fumarate, and malate. Furthermore, nitrate also increased the pool sizes and radiolabeling of most amino acids, with alanine, aspartate, glutamate, and glutamine showing the largest changes. Nitrate resupply increased the proportion of radiolabel in the C-4 position of malate and increased the ratios of radiolabel in aspartate to phosphoenolpyruvate and in pyruvate to phosphoenolpyruvate, indicative of increased phosphoenolpyruvate carboxylase and pyruvate kinase activities. Analysis of these data showed that the rate of carbon flow through glutamate (10.6 mumoles glutamate per milligram chlorophyll per hour) and the rate of net glutamate production (7.9 mumoles glutamate per milligram chlorophyll per hour) were both greater than the maximum rate of carbon export from the Calvin cycle which could be maintained during steady state photosynthesis. These results are consistent with the hypothesis that nitrogen resupply to nitrogen-limited microalgae results in a transient suppression of photosynthetic carbon fixation due, in part, to the severity of competition for carbon skeletons between the Calvin cycle and nitrogen assimilation (IR Elrifi, DH Turpin 1986 Plant Physiol 81: 273-279).

Single-step purification and characterization of recombinant aspartase of Aeromonas media NFB-5.

PubMed

Singh, Ram Sarup; Yadav, Mukesh

2012-07-01

Aspartase (L-aspartate ammonia-lyase; EC 4.3.1.1) catalyzes the reversible amination of fumaric acid to produce L-aspartic acid. Aspartase coding gene (aspA) of Aeromonas media NFB-5 was cloned, sequenced, and expressed with His tag using pET-21b⁺ expression vector in Escherichia coli BL21. Higher expression was obtained with IPTG (1.5 mM) induction for 5 h at 37 °C in LB medium supplemented with 0.3% K₂HPO₄ and 0.3% KH₂PO₄. Recombinant His tagged aspartase was purified using Ni-NTA affinity chromatography and characterized for various biochemical and kinetic parameters. The purified aspartase showed optimal activity at pH 8.5 and 8.0 in the presence and absence of magnesium ions, respectively. The optimum temperature was determined to be 35 °C. The enzyme showed apparent K(m) and V(max) values for L-aspartate as 2.01 mM and 114 U/mg, respectively. The enzyme was stable in pH range of 6.5-9.5 and temperature up to 45 °C. Divalent metal ion requirement of enzyme was efficiently fulfilled by Mg²⁺, Mn²⁺, and Ca²⁺ ions. The cloned gene (aspA) product showed molecular weight of approximately 51 kDa by SDS-PAGE, which is in agreement with the molecular weight calculated from putative amino acid sequence. This is the first report on expression and characterization of recombinant aspartase from A. media.

Quality of tomato slices disinfected with ozonated water.

PubMed

Aguayo, Encarna; Escalona, Víctor; Silveira, Ana Cecilia; Artés, Francisco

2014-04-01

Fresh-cut industry needs novel disinfectant to replace the use of chlorine. Ozone is one of the most powerful oxidizing agents and is applied in gaseous or aqueous form for sanitation purposes. However, the strong oxidative effect could affect the nutritional and sensorial quality, in particular, when time of washing is extended. For that reason, the overall impact of ozonated water (0.4 mg/L) dipping applied during 1, 3 and 5 min compared to control washed in water during 5 min was studied in tomato slices stored during 14 days at 5 . According to the results, ozonated water treatment of 3 min achieved the best firmness retention, microbial quality (mesophilic, psychrotrophic and yeas load) and reduced the consumption of fructose and glucose. The use of ozonated water did not affect the total acidity, pH, total solid soluble, organic acid as ascorbic, fumaric or succinic acid and the sensorial parameters, which were only affected by storage time. However, the poor appearance, aroma and overall quality obtained in all treatments prevented shelf life of 14 days and the quality at acceptable levels was established in 10 days at 5 . It is recommended to wash tomato slices with 0.4 mg/L ozonated water for 3 min only. Extending treatment duration did not improve the microbiological quality, possibly due to the extra time permitting the ozone to react with other components of the fruit tissue, undermining the antimicrobial benefits.

The Research and Application of Sustainable Long-release Carbon Material with Agricultural Waste

NASA Astrophysics Data System (ADS)

Wen, Z.

2017-12-01

(1) The element analysis shown that ten kinds of agricultural wastes containing a certain amount of C, N, H elements, the highest content of C element, and t value ranges from 36.02% 36.02%, and the variation of C, N, H elements content in difference materials was not significant. The TOC concentration of sugar cane was up to 38.66 mg·g-1, and quality ratio was 39‰, significantly lower than C elements content. The released TOC quality of the rest materials were 2.36 2.36 mg·g-1, and the order from high to low were the soybean straw, rice straw, corn straw, rice husk, poplar branches, wheat straw, reeds, corn cob and wood chips respectively. The long-term leaching experiment of selected Optimized agricultural waste showed that the TOC content in leaching solution rise rapidly to peak value and was stable afterwards, with the concentration of 4.59 19.46 mg·g-1. The TOC releasing amount order was same with the short-term leaching experiment. (2) The releasing of nitrate nitrogen in ten kinds of agricultural waste was low (< 0.08mg·g-1), among which corn straw was up to 0.12mg·g-1, and the rest were all below 0.04mg·g-1 without accumulation. Most of the ammonia nitrogen concentration in leachate was lower than 0.3mg·g-1. The kjeldahl nitrogen in the corn straw, soybean straw, rice straw, reed, rice husk, and sugar cane leachate (0.81 1.65mg·g-1) were higher than that of poplar branches, corn cob and wood chips (< 0.30mg·g-1). The organic composition analysis of above carbon source shown that organic acid in leachate was mainly formic acid, acetic acid, oxalic acid, fumaric acid and other small molecule organic acids, and sugars was mainly cellobiose, glucose, fructose and xylose. Substance concentration was higher in sugar cane leachate, and the small molecular organic acid concentration was higher in the corn straw, rice husk and wheat straw leachate. Above all, it can be concluded that the sugar cane, corn straw, rice husk, wheat straw, corn cob, wood were ideal carbon source material in ten kinds of agricultural.

3D printing of new biobased unsaturated polyesters by microstereo-thermallithography.

PubMed

Gonçalves, Filipa A M M; Costa, Cátia S M F; Fabela, Inês G P; Farinha, Dina; Faneca, Henrique; Simões, Pedro N; Serra, Arménio C; Bártolo, Paulo J; Coelho, Jorge F J

2014-09-01

New micro three-dimensional (3D) scaffolds using biobased unsaturated polyesters (UPs) were prepared by microstereo-thermal-lithography (μSTLG). This advanced processing technique offers indubitable advantages over traditional printing methods. The accuracy and roughness of the 3D structures were evaluated by scanning electron microscopy and infinite focus microscopy, revealing a suitable roughness for cell attachment. UPs were synthesized by bulk polycondensation between biobased aliphatic diacids (succinic, adipic and sebacic acid) and two different glycols (propylene glycol and diethylene glycol) using fumaric acid as the source of double bonds. The chemical structures of the new oligomers were confirmed by proton nuclear magnetic resonance spectra, attenuated total reflectance Fourier transform infrared spectroscopy and matrix assisted laser desorption/ionization-time of flight mass spectrometry. The thermal and mechanical properties of the UPs were evaluated to determine the influence of the diacid/glycol ratio and the type of diacid in the polyester's properties. In addition an extensive thermal characterization of the polyesters is reported. The data presented in this work opens the possibility for the use of biobased polyesters in additive manufacturing technologies as a route to prepare biodegradable tailor made scaffolds that have potential applications in a tissue engineering area.

Investigation of Deteriorated Dissolution of Amorphous Itraconazole: Description of Incompatibility with Magnesium Stearate and Possible Solutions.

PubMed

Démuth, B; Galata, D L; Szabó, E; Nagy, B; Farkas, A; Balogh, A; Hirsch, E; Pataki, H; Rapi, Z; Bezúr, L; Vigh, T; Verreck, G; Szalay, Z; Demeter, Á; Marosi, G; Nagy, Z K

2017-11-06

Disadvantageous crystallization phenomenon of amorphous itraconazole (ITR) occurring in the course of dissolution process was investigated in this work. A perfectly amorphous form (solid dispersion) of the drug was generated by the electroblowing method (with vinylpyrrolidone-vinyl acetate copolymer), and the obtained fibers were formulated into tablets. Incomplete dissolution of the tablets was noticed under the circumstances of the standard dissolution test, after which a precipitated material could be filtered. The filtrate consisted of ITR and stearic acid since no magnesium content was detectable in it. In parallel with dissolution, ITR forms an insoluble associate, stabilized by hydrogen bonding, with stearic acid deriving from magnesium stearate. This is why dissolution curves do not have the plateaus at 100%. Two ways are viable to tackle this issue: change the lubricant (with sodium stearyl fumarate >95% dissolution can be accomplished) or alter the polymer in the solid dispersion to a type being able to form hydrogen bonds with ITR (e.g., hydroxypropyl methylcellulose). This work draws attention to one possible phenomenon that can lead to a deterioration of originally good dissolution of an amorphous solid dispersion.

Solubility of carbamazepine co-crystals in ethanolic solution

NASA Astrophysics Data System (ADS)

Ramle, Noor Ashila; Rahim, Syarifah Abd; Anuar, Nornizar; El-Hadad, Omar

2017-08-01

The study aimed to determine the solubility of carbamazepine (CBZ) co-crystals formed from co-crystal formers (CCFs) of nicotinamide (NIC), saccharin (SAC), succinic acid (SUC) and fumaric acid (FUM) at various temperatures (25-50°C). High Performance Liquid Chromatography (HPLC) was used to determine the solubility and the X-Ray Powder Diffraction was used to characterize the crystals. The solubility of CBZ-NIC and CBZ-FUM co-crystals were found to be higher than the solubility of the CBZ for the range of studied temperatures. However, opposite findings was obtained for CBZ-SUC co-crystal as its solubility is lower than the solubility of CBZ. Different trend was found for CBZ-SAC co-crystal in which for temperature lower than 40°C, the solubility of CBZ crystal is higher than the CBZ-SAC co-crystal. The solubility of CBZ-SAC co-crystal is higher than the solubility of CBZ at a temperature above 40°C. CBZ co-crystals with NIC and FUM have shown to increase the solubility of CBZ by solubility ratio of 1.95 and 1.24 respectively. However, the CBZ co-crystal with SAC was found to have similar solubility value as the CBZ.

3-Nitropropionic Acid is a Suicide Inhibitor of MitochondrialRespiration that, Upon Oxidation by Complex II, Forms a Covalent AdductWith a Catalytic Base Arginine in the Active Site of the Enzyme

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Li-shar; Sun, Gang; Cobessi, David

We report three new structures of mitochondrial respiratory Complex II (succinate ubiquinone oxidoreductase, E.C. 1.3.5.1) at up to 2.1 {angstrom} resolution, with various inhibitors. The structures define the conformation of the bound inhibitors and suggest the residues involved in substrate binding and catalysis at the dicarboxylate site. In particular they support the role of Arg297 as a general base catalyst accepting a proton in the dehydrogenation of succinate. The dicarboxylate ligand in oxaloacetate-containing crystals appears to be the same as that reported for Shewanella flavocytochrome c treated with fumarate. The plant and fungal toxin 3-nitropropionic acid, an irreversible inactivator ofmore » succinate dehydrogenase, forms a covalent adduct with the side chain of Arg297. The modification eliminates a trypsin cleavage site in the flavoprotein, and tandem mass spectroscopic analysis of the new fragment shows the mass of Arg 297 to be increased by 83 Da and to have potential of losing 44 Da, consistent with decarboxylation, during fragmentation.« less

Feed additives decrease survival of delta coronavirus in nursery pig diets.

PubMed

Cottingim, Katie M; Verma, Harsha; Urriola, Pedro E; Sampedro, Fernando; Shurson, Gerald C; Goyal, Sagar M

2017-01-01

Feed contaminated with feces from infected pigs is believed to be a potential route of transmission of porcine delta coronavirus (PDCoV). The objective of this study was to determine if the addition of commercial feed additives (e.i., acids, salt and sugar) to swine feed can be an effective strategy to inactive PDCoV. Six commercial feed acids (UltraAcid P, Activate DA, KEMGEST, Acid Booster, Luprosil, and Amasil), salt, and sugar were evaluated. The acids were added at the recommended concentrations to 5 g aliquots of complete feed, which were also inoculated with 1 mL of PDCoV and incubated for 0, 7, 14, 21, 28, and 35 days. In another experiment, double the recommended concentrations of these additives were also added to the feed samples and incubated for 0, 1, 3, 7, and 10 days. All samples were stored at room temperature (~25 °C) followed by removal of aliquots at 0, 7, 14, 21, 28, and 35 days. Any surviving virus was eluted in a buffer solution and then titrated in swine testicular cells. Feed samples without any additive were used as controls. Both Weibull and log-linear kinetic models were used to analyze virus survival curves. The presence of a tail in the virus inactivation curves indicated deviations from the linear behavior and hence, the Weibull model was chosen for characterizing the inactivation responses due to the better fit. At recommended concentrations, delta values (days to decrease virus concentration by 1 log) ranged from 0.62-1.72 days, but there were no differences on virus survival among feed samples with or without additives at the manufacturers recommended concentrations. Doubling the concentration of the additives reduced the delta value to ≤ 0.28 days ( P  < 0.05) for all the additives except for Amasil (delta values of 0.86 vs. 4.95 days). Feed additives that contained phosphoric acid, citric acid, or fumaric acid were the most effective in reducing virus survival, although none of the additives completely inactivated the virus by 10- days post-inoculation. Commercial feed additives (acidifiers and salt) may be utilized as a strategy to decrease risk of PDCoV in feed, specially, commercial feed acidifiers at double the recommended concentrations reduced PDCoV survival in complete feed during storage at room temperature. However, none of these additives completely inactivated the virus.

Molecular distribution, seasonal variation, chemical transformation and sources of dicarboxylic acids and related compounds in atmospheric aerosols at remote marine Gosan site, Jeju Island

NASA Astrophysics Data System (ADS)

Kundu, S.; Kawamura, K.; Lee, M.

2009-12-01

: A homologous series of C2-C12 α, ω-dicarboxylic acids, ω-oxocarboxylic acids (C2-C9), pyruvic acid and α-dicarbonyls (C2-C3) were detected in atmospheric aerosols collected between April 2003 and April 2004 from remote marine Gosan site (33°29‧ N, 126°16‧ E) located in Jeju Island, South Korea. They were determined using a GC-FID and GC/MS. Total diacid concentration ranged from 130 to 1911 ng m-3 (av. 642 ng m-3), whereas total oxoacid concentration ranged from 7 to 155 ng m-3 (av. 43 ng m-3), and pyruvic acid and α-dicarbonyls ranged from 0.5 to 15 ng m-3 (av. 5 ng m-3) and 2-108 ng m-3 (av. 17.3 ng m-3), respectively. Oxalic (C2) acid was the most abundant in all seasons followed by malonic (C3) or succinic (C4) acid, and phthalic (Ph) acid. The concentration of diacids decreased with an increase in carbon number except for azelaic (C9) acid, which was more abundant than suberic (C8) acid. Glyoxylic acid was predominant ω-oxoacid contributing to 92% of total ω-oxoacid. Total diacids, oxoacids and dicarbonyls showed maximum concentrations in spring and occasionally in winter, while minimum concentrations were observed in summer. Air mass trajectory analysis suggests that either spring or winter maxima can be explained by strong continental outflow associated with cold front passages, while summer minima are associated with warm southerly flows, which transport clean marine air from low latitudes to Jeju Island. The comparison between total diacid concentration level of this study and other study results of urban and remote sites of East Asia reveals that Gosan site is more heavily influenced by the continental outflow from China. The seasonal variation of malonic/succinic (C3/C4), malic/succinic (hC4/C4), fumaric/maleic (F/M), oxalic/pyruvic (C2/Py) and oxalic/Glyoxal (C2/Gly) ratios showed maxima in summer due to an enhanced photo-production and degradation of diacids and related compounds. Throughout all seasons C3/C4 ratio at Gosan site, located between Chinese cities and Chichi-jima Island in Japan was observed higher than those in Chinese cities and lower than that of the Chichi-jima Island, pointing to the formation of diacid during long range transport. The lowest values of adipic/azelaic (C6/C9) and phthalic/azelaic (Ph/C9) were observed as a result of the overwhelming biogenic emission of the precursors (e.g., unsaturated fatty acids) of azelaic acid in summer.In this study, we will also discuss the sources and transport pathways of diacids and related compounds resolved using a hybrid receptor model, potential source contribution function (PSCF) and model results will be compared with available in-situ observations in East Asia.

Cascade oxime formation, cyclization to a nitrone, and intermolecular dipolar cycloaddition.

PubMed

Furnival, Rachel C; Saruengkhanphasit, Rungroj; Holberry, Heather E; Shewring, Jonathan R; Guerrand, Hélène D S; Adams, Harry; Coldham, Iain

2016-11-22

Simple haloaldehydes, including enolisable aldehydes, were found to be suitable for the formation of cyclic products by cascade (domino) condensation, cyclisation, dipolar cycloaddition chemistry. This multi-component reaction approach to heterocyclic compounds was explored by using hydroxylamine, a selection of aldehydes, and a selection of activated dipolarophiles. Initial condensation gives intermediate oximes that undergo cyclisation with displacement of halide to give intermediate nitrones; these nitrones undergo in situ intermolecular dipolar cycloaddition reactions to give isoxazolidines. The cycloadducts from using dimethyl fumarate were treated with zinc/acetic acid to give lactam products and this provides an easy way to prepare pyrrolizinones, indolizinones, and pyrrolo[2,1-a]isoquinolinones. The chemistry is illustrated with a very short synthesis of the pyrrolizidine alkaloid macronecine and a formal synthesis of petasinecine.

Pearson Syndrome: A Retrospective Cohort Study from the Marrow Failure Study Group of A.I.E.O.P. (Associazione Italiana Emato-Oncologia Pediatrica).

PubMed

Farruggia, Piero; Di Cataldo, Andrea; Pinto, Rita M; Palmisani, Elena; Macaluso, Alessandra; Valvo, Laura Lo; Cantarini, Maria E; Tornesello, Assunta; Corti, Paola; Fioredda, Francesca; Varotto, Stefania; Martire, Baldo; Moroni, Isabella; Puccio, Giuseppe; Russo, Giovanna; Dufour, Carlo; Pillon, Marta

2016-01-01

Pearson syndrome (PS) is a very rare and often fatal multisystemic mitochondrial disorder involving the liver, kidney, pancreas, and hematopoietic and central nervous system. It is characterized principally by a transfusion-dependent anemia that usually improves over time, a tendency to develop severe infections, and a high mortality rate. We describe a group of 11 PS patients diagnosed in Italy in the period 1993-2014. The analysis of this reasonably sized cohort of patients contributes to the clinical profile of the disease and highlights a rough incidence of 1 case/million newborns. Furthermore, it seems that some biochemical parameters like increased serum alanine and urinary fumaric acid can help to address an early diagnosis.

Effect of different iron compounds on rheological and technological parameters as well as bioaccessibility of minerals in whole wheat bread.

PubMed

Rebellato, Ana Paula; Bussi, Jéssica; Silva, Joyce Grazielle Siqueira; Greiner, Ralf; Steel, Caroline Joy; Pallone, Juliana Azevedo Lima

2017-04-01

This study aimed at investigating the effect of iron compounds used in whole wheat flour (WWF) fortification, both on rheological properties of the dough and on bread technological quality. Furthermore, bioaccessibility of iron (Fe), zinc (Zn) and calcium (Ca) in the final breads was determined. Rheological properties (mainly dough development time, stability, mixing tolerance index, resistance to extension and ratio number) of the dough and the technological quality of bread (mainly oven spring and cut opening) were altered. However, producing roll breads fortified with different iron compounds was still possible. NaFeEDTA (ferric sodium ethylene diamine tetra acetic acid) proved to be the most effective iron compound in the fortification of WWF, since it presented the highest levels of solubility (44.80%) and dialysability (46.14%), followed by microencapsulated ferrous fumarate (FFm). On the other hand, the microencapsulated ferrous sulfate (FSm) and reduced iron presented the lowest solubility (5.40 and 18.30%, respectively) and dialysability (33.12 and 31.79%, respectively). Zn dialysis was positively influenced by NaFeEDTA, FSm, and ferrous fumarate. As for Ca, dialysis was positively influenced by FSm and negatively influenced by FFm. The data indicated that there is a competitive interaction for the absorption of these minerals in whole wheat roll breads, but all studied minerals can be considered bioaccessible. Copyright © 2017 Elsevier Ltd. All rights reserved.

Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

PubMed

Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

2018-05-24

Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

Desulfovibrio zosterae sp. nov., a new sulfate reducer isolated from surface-sterilized roots of the seagrass Zostera marina.

PubMed

Nielsen, J T; Liesack, W; Finster, K

1999-04-01

A sulfate-reducing bacterium, designated strain lacT, was isolated from surface-sterilized roots of the benthic macrophyte Zostera marina. Cells were motile by means of a single polar flagellum. Strain lacT utilized lactate, pyruvate, malate, ethanol, L-alanine, fumarate, choline and fructose with sulfate as electron acceptor. In addition, fumarate, pyruvate and fructose were also degraded without an external electron acceptor. Sulfate could be substituted with thiosulfate, sulfite and elemental sulfur. Optimal growth was observed between 32.5 and 34.5 degrees C, at an NaCl concentration of 0.2 M and in a pH range between 6.8 and 7.3. The G + C content of the DNA was 42.7 +/- 0.2 mol%. Desulfoviridin and catalase were present. Strain lacT contained c-type cytochromes. Comparative 16S rRNA gene sequence analysis and the fatty acid pattern grouped this isolate into the genus Desulfovibrio. However, strain lacT differs from all other described Desulfovibrio species on the bases of its 16S rRNA gene sequence, the G + C content, its cellular lipid pattern and the utilization pattern of substrates. These characteristics establish strain lacT (= DSM 11974T) as a novel species of the genus Desulfovibrio, for which the name Desulfovibrio zosterae sp. nov. is proposed.

A Validated Stability Indicating RP-HPLC Method for the Determination of Emtricitabine, Tenofovir Disoproxil Fumarate, Elvitegravir and Cobicistat in Pharmaceutical Dosage Form

PubMed Central

Runja, Chinnalalaiah; Ravi Kumar, Pigili; Avanapu, Srinivasa Rao

2016-01-01

A new simple, rapid stability indicating assay method has been developed and validated for the determination of emtricitabine, tenofovir disoproxil fumarate, elvitegravir and cobicistat using reverse-phase high-performance liquid chromatography in their pharmaceutical dosage form. The chromatographic separation was performed on an ODS column (250 × 4.6 mm, 5 µm) using mobile phase A (potassium dihydrogen orthophosphate, pH adjusted to 2.5) and mobile phase B (acetonitrile) in the ratio of 55:45% v/v at a flow rate of 1 mL/min. The analytes were detected at 250 nm. The method was found to be linear in the concentration range of 2–12 µg/mL for EMT, 3–18 µg/mL for TNDF, 1.5–9 µg/mL for ELV and COB, with the coefficient value (R2) of >0.9990. The accuracy was measured via recovery studies and found to be acceptable, and the percentage recoveries were found in the range of 99.93–100.08 ± 0.5%. Forced degradation studies were also conducted, and the drugs were subjected to various stress conditions such as acid hydrolysis, base hydrolysis, oxidative, photolytic and thermal degradation. The proposed method was successfully validated and applied for the quantitative estimation of these drugs in both bulk and tablet dosage forms. PMID:26865655

Metabolic engineering of Aspergillus oryzae for efficient production of l-malate directly from corn starch.

PubMed

Liu, Jingjing; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian; Liu, Long

2017-11-20

l-Malate, an important chemical building block, has been widely applied in the food, pharmaceutical, and bio-based materials industries. In previous work, we engineered Aspergillus oryzae by rewiring the reductive tricarboxylic acid pathway to produce l-malate from glucose. To decrease the production cost, here, we further engineered A. oryzae to efficiently produce l-malate directly from corn starch with simultaneous liquefaction-saccharification and fermentation. First, a promoter PN5 was constructed by quintuple tandem of the 97-bp fragment containing the cis-element of the glucoamylase gene promoter (PglaA), and with the promoter PN5, the transcriptional level of glaA gene increased by 25-45%. Then, by co-overexpression of glaA, a-amylase (amyB) and a-glucosidase (agdA) genes with the promoter PN5, the l-malate titer increased from 55.5g/L to 72.0g/L with 100g/L corn starch in shake flask. In addition, to reduce the concentration of byproducts succinate and fumarate, a fumarase from Saccharomyces cerevisiae, which facilitated the transformation of fumarate to l-malate, was overexpressed. As a result, the concentration of succinate and fumarate decreased from 12.6 and 1.29g/L to 7.8 and 0.59g/L, and the l-malate titer increased from 72.0g/L to 78.5g/L. Finally, we found that the addition of glucose at the initial fermentation stage facilitated the cell growth and l-malate synthesis, and the l-malate titer further increased to 82.3g/L by co-fermentation of 30g/L glucose and 70g/L corn starch, with a productivity of 1.18g/L/h and a yield of 0.82g/g total carbon sources. Copyright © 2017 Elsevier B.V. All rights reserved.

Desulfobulbus mediterraneus sp. nov., a sulfate-reducing bacterium growing on mono- and disaccharides.

PubMed

Sass, Andrea; Rütters, Heike; Cypionka, Heribert; Sass, Henrik

2002-06-01

A new sulfate-reducing bacterium, strain 86FS1, was isolated from a deep-sea sediment in the western Mediterranean Sea with sodium lactate as electron and carbon source. Cells were ovoid, gram-negative and motile. Strain 86FS1 contained b- and c-type cytochromes. The organism was able to utilize propionate, pyruvate, lactate, succinate, fumarate, malate, alanine, primary alcohols (C(2)-C(5)), and mono- and disaccharides (glucose, fructose, galactose, ribose, sucrose, cellobiose, lactose) as electron donors for the reduction of sulfate, sulfite or thiosulfate. The major products of carbon metabolism were acetate and CO(2), with exception of n-butanol and n-pentanol, which were oxidized only to the corresponding fatty acids. The growth yield with sulfate and glucose or lactate was 8.3 and 15 g dry mass, respectively, per mol sulfate. The temperature limits for growth were 10 degrees C and 30 degrees C with an optimum at 25 degrees C. Growth was observed at salinities ranging from 10 to 70 g NaCl l(-1). Sulfide concentrations above 4 mmol l(-1) inhibited growth. The fatty acid pattern of strain 86FS1 resembled that of Desulfobulbus propionicus with n-14:0, n-16:1omega7, n-16:1 omega5, n-17:1 omega6 and n-18:1 omega7 as dominant fatty acids. On the basis of its phylogenetic position and its phenotypic properties, strain 86FS1 affiliates with the genus Desulfobulbus and is described as a new species, Desulfobulbus mediterraneus sp. nov.

Application of total-reflection X-ray fluorescence spectrometry and high-performance liquid chromatography for the chemical characterization of xylem saps of nickel contaminated cucumber plants

NASA Astrophysics Data System (ADS)

Mihucz, Victor G.; Tatár, Eniko; Varga, Anita; Záray, Gyula; Cseh, Edit

2001-11-01

Total-reflection X-ray fluorescence (TXRF) spectrometry, reversed-phase (RP) and size-exclusion (SE) high-performance liquid chromatography (HPLC) methods were applied for the characterization of low-volume xylem sap of control and nickel contaminated cucumber plants growing in hydroponics containing urea as the sole nitrogen source. In these saps collected for 1 h, Ca, K, Fe, Mn, Ni, Zn, as well as malic, citric and fumaric acids were determined. The SEC measurements showed that macromolecules were not detectable in the samples. Nickel contamination had minimum impact on the organic acid transport, however, the transport of Zn, K and Fe was reduced by 50, 22 and 11%, respectively. This observation supports the results of our earlier experiments when nitrate ions were used as the sole nitrogen form. At the same time, the fresh root weight and the volume of the collected xylem sap increased by 36 and 85%, respectively. Therefore, nickel addition seemed to decrease the urea toxicity of the plants. By pooling the eluting fractions of the SEC column, which were 10-fold concentrated by freeze-drying, the series of the resulted samples were analyzed by the TXRF spectrometry and RP-HPLC. The three organic acids could be identified in only one of the fractions, which contained Fe and, in the case of the contaminated plants, Ni in detectable concentration. However, considerable parts of these two elements and Mn, as well as practically the total amounts of Cu may be transported by unidentified organic compounds in the xylem.

Aminobacterium thunnarium sp. nov., a mesophilic, amino acid-degrading bacterium isolated from an anaerobic sludge digester, pertaining to the phylum Synergistetes.

PubMed

Hamdi, Olfa; Ben Hania, Wajdi; Postec, Anne; Bouallagui, Hassib; Hamdi, Moktar; Bonin, Patricia; Ollivier, Bernard; Fardeau, Marie-Laure

2015-02-01

A new Gram-staining-positive, non-sporulating, mesophilic, amino acid-degrading anaerobic bacterium, designated strain OTA 102(T), was isolated from an anaerobic sequencing batch reactor treating wastewater from cooking tuna. The cells were curved rods (0.6-2.5×0.5 µm) and occurred singly or in pairs. The strain was motile by means of one lateral flagellum. Strain OTA 102(T) grew at temperatures between 30 and 45 °C (optimum 40 °C), between pH 6.0 and 8.4 (optimum pH 7.2) and NaCl concentrations between 1 and 5 % (optimum 2 %, w/v). Strain OTA 102(T) required yeast extract for growth. Serine, threonine, glycine, cysteine, citrate, fumarate, α-ketoglutarate and pyruvate were fermented. When co-cultured with Methanobacterium formicicum as the hydrogen scavenger, strain OTA 102(T) oxidized alanine, valine, leucine, isoleucine, aspartate, tyrosine, methionine, histidine and asparagine. The genomic DNA G+C content of strain OTA 102(T) was 41.7 mol%. The main fatty acid was iso-C15 : 0. Phylogenetic analysis of the 16S rRNA gene sequence indicated that strain OTA 102(T) was related to Aminobacterium colombiense and Aminobacterium mobile (95.5 and 95.2 % similarity, respectively), of the phylum Synergistetes. On the basis of phylogenetic, genetic and physiological characteristics, strain OTA 102(T) is proposed to represent a novel species of the genus Aminobacterium, Aminobacterium thunnarium sp. nov. The type strain is OTA 102(T) ( = DSM 27500(T) = JCM 19320(T)). © 2015 IUMS.

Optimization of cell-based assays to quantify the anti-inflammatory/allergic potential of test substances in 96-well format.

PubMed

Chandrasekaran, C V; Edwin Jothie, R; Kapoor, Preeti; Gupta, Anumita; Agarwal, Amit

2011-06-01

There is an insistent need for robust, reliable, and optimized assays for screening novel drugs targeting the inflammatory/allergic markers. The present study describes about the optimization of eight cell-based assays utilizing mammalian cell lines in 96-well format for quantifying anti-inflammatory/allergic drug candidates. We estimated the inhibitory response of reference compounds: 1400 W dihydrochloride on LPS-induced NO release, celecoxib on LPS-induced PGE(2) production and dexamethasone on LPS-induced pro-inflammatory cytokines IL-1 beta, IL-6, and TNF-alpha production by J774A.1 murine macrophages. Response of acetylsalicylic acid and celecoxib was studied on A23187-induced TXB(2) production; captopril on A23187-stimulated LTB(4) production by HL-60 cells. Effect of ketotifen fumarate was evaluated on A23187-elicited histamine release by RBL-2H3 cells. Each experiment was repeated twice to assess the reproducibility and suitability of the assays by determining appropriate statistical tools viz. %CV, S/B and Z' factor. 1400 W dihydrochloride was capable of inhibiting LPS-induced NO levels (IC(50) = 10.7 μM). Dexamethasone attenuated LPS-induced IL-1 beta (IC(50) = 70 nM), IL-6 (IC(50) = 58 nM) and TNF-alpha (IC(50) = 44 nM) release, whereas celecoxib, a specific COX-2 inhibitor showed marked reduction in LPS-induced PGE(2) (IC(50) = 23 nM) production. Captopril (IC(50) = 48 μM) and ketotifen fumarate (IC(50) = 36.4 μM) demonstrated potent inhibitory effect against A23187-stimulated LTB(4) and histamine levels, respectively. Both acetylsalicylic acid (IC(50) = 5.5 μM) and celecoxib (IC(50) = 7.9 nM) exhibited concentration-dependent decrease in TXB(2) production. Results for all the cell assays from two experiments showed a Z' factor varying from 0.30 to 0.99; the S/B ratio ranged from 2.39 to 24.92; %CV ranged between 1.52 and 20.14. The results proclaim that these cell-based assays can act as ideal tools for screening new anti-inflammatory/anti-allergic compounds.

Phytochemical Constituents, ChEs and Urease Inhibitions, Antiproliferative and Antioxidant Properties of Elaeagnus umbellata Thunb.

PubMed

Ozen, Tevfik; Yenigun, Semiha; Altun, Muhammed; Demirtas, Ibrahim

2017-01-01

Due to the common ethnopharmacological used or scientifically examined biochemical properties, Elaeagnaceae family, Elaeagnus umbellate (Thunb.) (EU, Guz yemisi) was worth investigating. In this investigation, we revealed antioxidant, antiproliferative and enzyme inhibition activities of the water, methanol, ethanol, acetone, ethyl acetate and hexane extracts of EU as well as the contents of their phenolic, flavonoid, anthocyanin, ascorbic acid, lycopene and β- carotene. The antioxidant activity was screened by total antioxidant (phosphomolybdenum), inhibition of linoleic acid peroxidation, reducing power, 2-deoxyribose degradation assay, H2O2 scavenging and metal chelating activities of the samples were tested in vitro. Additionally, the scavenging activities of the extracts were determined against 1,1-diphenyl-2-picrylhydrazyl (DPPH˙), 2,2-azino-bis(3-ethylbenzothiazloine-6-sulfonicacid (ABTS˙+), superoxide anion and peroxide radicals. The samples were determined for their inhibitory activities against urease, acetylcholinesterase (AChE) and butyrylcholinesterase (BuChE). In vitro, antiproliferative activities of six different extracts were tested using the xCELLigence system against HeLa and HT29 cell lines. The antioxidant activities of the extracts were found higher than standard antioxidants. The water extracts of fruit and leaf showed the best antioxidant activity. In inhibition assays of urease, AChE and BuChE, all extracts exhibited remarkable inhibition potential. Ethyl acetate extracts, especially, showed better inhibition capacity. It was found that the antioxidant activities of the extracts presented consistently with their chemical contents. The antiproliferative activities of leaf extracts were more effective than the fruit extracts. The chromatographic methods were applied to the different solvents to analyses phenolic secondery metabolites. It was found that fumaric acid, 4- hydroxybenzoic acid, rutin and quercetin-3-β-D-glucoside, neohesperidin, hesperidin determined to have higher contents all the extracts. EU can be suggested as a potential natural source of antioxidants appropriate for utilization in nutritional/pharmaceutical fields. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Impact of an energy-conserving strategy on succinate production under weak acidic and anaerobic conditions in Enterobacter aerogenes.

PubMed

Tajima, Yoshinori; Yamamoto, Yoko; Fukui, Keita; Nishio, Yousuke; Hashiguchi, Kenichi; Usuda, Yoshihiro; Sode, Koji

2015-06-11

Succinate is an important C4 building block chemical, and its production via fermentative processes in bacteria has many practical applications in the biotechnology field. One of the major goals of optimizing the bacterium-based succinate production process is to lower the culture pH from the current neutral conditions, as this would reduce total production costs. In our previous studies, we selected Enterobacter aerogenes, a rapid glucose assimilator at pH 5.0, in order to construct a metabolically engineered strain that could produce succinate under weakly acidic conditions. This engineered strain produced succinate from glucose with a 72.7% (g/g) yield at pH 5.7, with a volumetric productivity of 0.23 g/L/h. Although this demonstrates proof-of-concept that bacterium-based succinate fermentation can be improved under weakly acidic conditions, several parameters still required further optimization. In this study, we genetically modified an E. aerogenes strain previously developed in our laboratory in order to increase the production of ATP during succinate synthesis, as we inferred that this would positively impact succinate biosynthesis. This led to the development of the ES08ΔptsG strain, which contains the following modifications: chromosomally expressed Actinobacillus succinogenes phosphoenolpyruvate carboxykinase, enhanced fumarate reductase, inactivated pyruvate formate lyase, pyruvate oxidase, and glucose-phosphotransferase permease (enzyme IIBC(Glc)). This strain produced 55.4 g/L succinate from glucose, with 1.8 g/L acetate as the major byproduct at pH 5.7 and anaerobic conditions. The succinate yield and volumetric productivity of this strain were 86.8% and 0.92 g/L/h, respectively. Focusing on increasing net ATP production during succinate synthesis leads to increased succinate yield and volumetric productivity in E. aerogenes. We propose that the metabolically engineered E. aerogenes ES08ΔptsG strain, which effectively produces succinate under weakly acidic and anaerobic conditions, has potential utility for economical succinate production.

Emission characteristics of carboxylates in PM2.5 from incense burning with the effect of light on acetate

NASA Astrophysics Data System (ADS)

Kuo, Su-Ching; Tsai, Ying I.; Sopajaree, Khajornsak

2016-08-01

Incense burning produces potentially harmful particulate matter. In this study we investigated the emissions of PM2.5 and gaseous acetic acid from four brands of traditional incense; Liao and Shang Lao Shan (SLS), sold in Taiwan, and Thai Yellow (Thai Y) and Thai Black (Thai B), sold in Thailand. Additionally, photochemical reactions of PM2.5 carboxylates emitted from incense burning were studied via a simulated light experiment. The average PM2.5 mass emission factor of each incense type was inversely correlated with the ash production of that incense. The Thailand incense carboxylate emissions were markedly higher than the Taiwan incense. Acetate accounted for 87.46% of total carboxylate emissions, with acetate emitted from the Thailand incense 1.26 times higher than from the Taiwan incense. Phthalate was detected in the PM2.5, indicating the presence of plasticizer. Concentrations of PM2.5 acetate, formate, pyruvate, glutarate, succinate, fumarate and tartarate were reduced in simulated light (51.5%-97.1% of those under dark), indicating that these seven types of carboxylate are easily photodegradable. In contrast, malonate, maleate, oxalate and phthalate concentrations in light were 1.17-1.84 times higher than in darkness, indicating photochemical reactions contribute to the formation of these species. The formation of the low-molecular weight dicarboxylates oxalate and malonate was most noticeable. Acetic acid, highly irritating to the respiratory system and skin, was present at high levels for all four incense types, as shown by the gaseous acetic acid/PM2.5 acetate ratios of 1.03-3.61. Burning incense indoors can generate high concentrations of PM2.5 acetate that increases the risks of respiratory and contact irritation, particularly when burning the Thailand incense. Moreover, burning incense in poorly ventilated, dimly lit indoor areas (e.g., temples and homes) can markedly increase the risk of irritation because the gaseous acetic acid is not degraded as it would be in light.

[Isolation, identification and fermentation optimization of Bacillus tequilensis PanD37 producing L-aspartate α- decarboxylase].

PubMed

Feng, Zhibin; Zhang, Juan; Chen, Guozhong; Cha, Yaping; Liu, Jinjie; Ge, Yihe; Cheng, Shiwei; Yu, Botao

2016-01-04

We screened bacteria producing L-aspartate α-decarboxylase from grapery soil and optimized the fermentation conditions. L-aspartate α-decarboxylase producing bacteria were screened by color-changing circle and liquid secondary screening culture media. Combination of morphological, physiological and biochemical characteristics and 16S rRNA sequence analysis were used to identify the bacteria. Fermentation conditions were optimized by single factor test and orthogonal experiment. Strain PanD37 showed high L-aspartate α-decarboxylase producing property and was identified as Bacillus tequilensis. The optimum fermentation conditions of PanD37 were liquid volume of 50 mL in 500 mL flask, 220 r/min at 35 °C, inoculation amount of 5% for 28 h with a medium of 22.5 g/L sucrose, 7.5 g/L fumaric acid, 20 g/L peptone, 6 g/L L-aspartic acid, 2 g/L Triton X-100, at initial pH of 7.0. Under the optimal fermentation conditions, the highest L-aspartate α-decarboxylase activity reached 44.57 U/mL, which was 2.57 folds higher than that obtained before optimization. Strain PanD37 was identified as Bacillus tequilensiswhich was capable of highly producing L-aspartate α-decarboxylase under the optimal fermentation conditions.

TPhP exposure disturbs carbohydrate metabolism, lipid metabolism, and the DNA damage repair system in zebrafish liver

NASA Astrophysics Data System (ADS)

Du, Zhongkun; Zhang, Yan; Wang, Guowei; Peng, Jianbiao; Wang, Zunyao; Gao, Shixiang

2016-02-01

Triphenyl phosphate is a high production volume organophosphate flame retardant that has been detected in multiple environmental media at increasing concentrations. The environmental and health risks of triphenyl phosphate have drawn attention because of the multiplex toxicity of this chemical compound. However, few studies have paid close attention to the impacts of triphenyl phosphate on liver metabolism. We investigated hepatic histopathological, metabolomic and transcriptomic responses of zebrafish after exposure to 0.050 mg/L and 0.300 mg/L triphenyl phosphate for 7 days. Metabolomic analysis revealed significant changes in the contents of glucose, UDP-glucose, lactate, succinate, fumarate, choline, acetylcarnitine, and several fatty acids. Transcriptomic analysis revealed that related pathways, such as the glycosphingolipid biosynthesis, PPAR signaling pathway and fatty acid elongation, were significantly affected. These results suggest that triphenyl phosphate exposure markedly disturbs hepatic carbohydrate and lipid metabolism in zebrafish. Moreover, DNA replication, the cell cycle, and non-homologous end-joining and base excision repair were strongly affected, thus indicating that triphenyl phosphate hinders the DNA damage repair system in zebrafish liver cells. The present study provides a systematic analysis of the triphenyl phosphate-induced toxic effects in zebrafish liver and demonstrates that low concentrations of triphenyl phosphate affect normal metabolism and cell cycle.

TPhP exposure disturbs carbohydrate metabolism, lipid metabolism, and the DNA damage repair system in zebrafish liver

PubMed Central

Du, Zhongkun; Zhang, Yan; Wang, Guowei; Peng, Jianbiao; Wang, Zunyao; Gao, Shixiang

2016-01-01

Triphenyl phosphate is a high production volume organophosphate flame retardant that has been detected in multiple environmental media at increasing concentrations. The environmental and health risks of triphenyl phosphate have drawn attention because of the multiplex toxicity of this chemical compound. However, few studies have paid close attention to the impacts of triphenyl phosphate on liver metabolism. We investigated hepatic histopathological, metabolomic and transcriptomic responses of zebrafish after exposure to 0.050 mg/L and 0.300 mg/L triphenyl phosphate for 7 days. Metabolomic analysis revealed significant changes in the contents of glucose, UDP-glucose, lactate, succinate, fumarate, choline, acetylcarnitine, and several fatty acids. Transcriptomic analysis revealed that related pathways, such as the glycosphingolipid biosynthesis, PPAR signaling pathway and fatty acid elongation, were significantly affected. These results suggest that triphenyl phosphate exposure markedly disturbs hepatic carbohydrate and lipid metabolism in zebrafish. Moreover, DNA replication, the cell cycle, and non-homologous end-joining and base excision repair were strongly affected, thus indicating that triphenyl phosphate hinders the DNA damage repair system in zebrafish liver cells. The present study provides a systematic analysis of the triphenyl phosphate-induced toxic effects in zebrafish liver and demonstrates that low concentrations of triphenyl phosphate affect normal metabolism and cell cycle. PMID:26898711

Dancing with chemical formulae of antivirals: a personal account.

PubMed

De Clercq, Erik

2013-09-15

A chemical structure is a joy forever, and this is how I perceived the chemical structures of a number of antiviral compounds with which I have been personally acquainted over the past 3 decades: (1) amino acid esters of acyclovir (i.e. valaciclovir); (2) 5-substituted 2'-deoxyuridines (i.e. brivudin); (3) 2',3'-dideoxynucleoside analogues (i.e. stavudine); (4) acyclic nucleoside phosphonates (ANPs) (i.e. cidofovir, adefovir); (5) tenofovir disoproxil fumarate (TDF) and drug combinations therewith; (6) tenofovir alafenamide (TAF, GS-7340), a new phosphonoamidate prodrug of tenofovir; (7) pro-prodrugs of PMEG (i.e. GS-9191 and GS-9219); (8) new ANPs: O-DAPy and 5-aza-C phosphonates; (9) non-nucleoside reverse transcriptase inhibitors (NNRTIs): HEPT and TIBO derivatives; and (10) bicyclam derivatives (i.e. AMD3100). Copyright © 2013 Elsevier Inc. All rights reserved.

¹H NMR and multivariate data analysis of the relationship between the age and quality of duck meat.

PubMed

Liu, Chunli; Pan, Daodong; Ye, Yangfang; Cao, Jinxuan

2013-11-15

To contribute to a better understanding of the factors affecting meat quality, we investigated the influence of age on the chemical composition of duck meat. Aging probably affects the quality of meat through changes in metabolism. Therefore, we studied the metabolic composition of duck meat using (1)H nuclear magnetic resonance (NMR) spectroscopy. Comprehensive multivariate data analysis showed significant differences between extracts from ducks that had been aged for four different time periods. Although lactate and anserine increased with age, fumarate, betaine, taurine, inosine and alkyl-substituted free amino acids decreased. These results contribute to a better understanding of changes in duck meat metabolism as meat ages, which could be used to help assess the quality of duck meat as a food. Copyright © 2013 Elsevier Ltd. All rights reserved.

Role of S…O non-bonded interaction in controlling supramolecular assemblies in a new series of 2-aminobenzothiazole based organic salts/ co-crystals

NASA Astrophysics Data System (ADS)

Yadav, Priyanka; Patel, Vatsa; Ballabh, Amar

2018-07-01

A new series of 2-aminobenzothiazole based organic salts were synthesized with mono- / di-carboxylic acid and characterized with various physico-chemical methods. One of the synthesized salt 2-aminobenzothiazolium-hydrogen fumarate (BTzA4) was found to be capable of gelling water with minimum gelator concentration (MGC) around 1.25 wt% (w/v). The single crystal structures of gelator (BTzA4) and non-gelators were analyzed for the presence of various supramolecular synthons especially the rarely occurring non-bonded S…O interactions and their role in controlling the overall hydrogen bonded network in these series of salts/ cocrystals. Charge assisted hydrogen bonded network was found to be governing the weak non-bonded S…O supramolecular synthons in the present study.

21 CFR 172.826 - Sodium stearyl fumarate.

Code of Federal Regulations, 2011 CFR

2011-04-01

... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Sodium stearyl fumarate. 172.826 Section 172.826... CONSUMPTION Multipurpose Additives § 172.826 Sodium stearyl fumarate. Sodium stearyl fumarate may be safely... sodium stearyl fumarate calculated on the anhydrous basis, and not more than 0.25 percent sodium stearyl...

21 CFR 172.826 - Sodium stearyl fumarate.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Sodium stearyl fumarate. 172.826 Section 172.826... CONSUMPTION Multipurpose Additives § 172.826 Sodium stearyl fumarate. Sodium stearyl fumarate may be safely... sodium stearyl fumarate calculated on the anhydrous basis, and not more than 0.25 percent sodium stearyl...

21 CFR 172.826 - Sodium stearyl fumarate.

Code of Federal Regulations, 2014 CFR

2014-04-01

... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Sodium stearyl fumarate. 172.826 Section 172.826... Sodium stearyl fumarate. Sodium stearyl fumarate may be safely used in food in accordance with the following conditions: (a) It contains not less than 99 percent sodium stearyl fumarate calculated on the...

21 CFR 172.826 - Sodium stearyl fumarate.

Code of Federal Regulations, 2013 CFR

2013-04-01

... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Sodium stearyl fumarate. 172.826 Section 172.826... CONSUMPTION Multipurpose Additives § 172.826 Sodium stearyl fumarate. Sodium stearyl fumarate may be safely... sodium stearyl fumarate calculated on the anhydrous basis, and not more than 0.25 percent sodium stearyl...

The Succinated Proteome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Merkley, Eric D.; Metz, Thomas O.; Smith, Richard D.

Succination is a chemical modification of cysteine in protein by the Krebs cycle intermediate, fumarate, yielding S-(2-succino)cysteine (2SC). Intracellular fumarate concentration and succination of proteins are increased by hyperpolarization of the inner mitochondrial membrane, in concert with mitochondrial, endoplasmic reticulum (ER) and oxidative stress in adipocytes grown in high glucose medium and in adipose tissue in obesity and diabetes. Increased succination of proteins is also detected in the kidney of a fumarase conditional knock-out mouse which develops renal tumors. Keap1, the gatekeeper of the antioxidant response, was identified as a major succinated protein in renal cancer cells, suggesting that succinationmore » may play a role in activation of the antioxidant response. A wide range of proteins is subject to succination, including enzymes, adipokines, cytoskeletal proteins and ER chaperones with functional cysteine residues. There is also significant overlap between succinated and glutathionylated proteins, and with proteins containing cysteine residues that are readily oxidized to the sulfenic (cysteic) acid. Succination of adipocyte proteins is inhibited by uncouplers, which discharge the mitochondrial membrane potential (Δψm) and by ER stress inhibitors. 2SC serves as a biomarker of mitochondrial stress or dysfunction in chronic diseases, such as obesity, diabetes and cancer, and recent studies suggest that succination is a mechanistic link between mitochondrial dysfunction, oxidative and ER stress, and cellular progression toward apoptosis. In this article, we review the history of the succinated proteome and the challenges associated with measuring this non-enzymatic post-translational modification of proteins by proteomics approaches.« less

Organic reactions catalyzed by methylrhenium trioxide: Reactions of ethyl diazoacetate and organic azides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Z.; Espenson, J.H.

1996-10-16

Methylrhenium trioxide (CH{sub 3}ReO{sub 3} or MTO) catalyzes several classes of reactions of ethyl diazoacetate, EDA. It is the first high valent oxo complex for carbene transfer. Under mild conditions and in the absence of other substrates, EDA was converted to a 9:1 mixture of diethyl maleate and diethyl fumarate. In the presence of alcohols, {alpha}-alkoxy ethyl acetates were obtained in good yield. The yields dropped for the larger and more branched alcohols, the balance of material being diethyl maleate and fumarate. An electron-donating group in the para position of phenols favors the formation of {alpha}-phenoxy ethyl acetates. The usemore » of EDA to form {alpha}-thio ethyl acetates and N-substituted glycine ethyl esters, on the other hand, is hardly affected by the size or structure of the parent thiol or amine, with all of these reactions proceeding in high yield. MTO-catalyzed cycloaddition reactions occur between EDA and aromatic imines, olefins, and carbonyl compounds. Three-membered ring products are formed: aziridines, cyclopropanes, and epoxides, respectively. The reactions favor the formation of trans products, and provide a convenient route for the preparation of aziridines. Intermediate carbenoid and nitrenoid species have been proposed. In the presence of an oxygen source such as an epoxide, ethyl diazoacetate and azibenzil are converted to an oxalic acid monoethyl ester and to benzil; at the same time the epoxide was converted to an olefin. 75 refs., 1 fig., 7 tabs.« less

Evolutionary Divergences in Root Exudate Composition among Ecologically-Contrasting Helianthus Species

PubMed Central

Bowsher, Alan W.; Ali, Rifhat; Harding, Scott A.; Tsai, Chung-Jui; Donovan, Lisa A.

2016-01-01

Plant roots exude numerous metabolites into the soil that influence nutrient availability. Although root exudate composition is hypothesized to be under selection in low fertility soils, few studies have tested this hypothesis in a phylogenetic framework. In this study, we examined root exudates of three pairs of Helianthus species chosen as phylogenetically-independent contrasts with respect to native soil nutrient availability. Under controlled environmental conditions, seedlings were grown to the three-leaf-pair stage, then transferred to either high or low nutrient treatments. After five days of nutrient treatments, we used gas chromatography-mass spectrometry for analysis of root exudates, and detected 37 metabolites across species. When compared in the high nutrient treatment, species native to low nutrient soils exhibited overall higher exudation than their sister species native to high nutrient soils in all three species pairs, providing support for repeated evolutionary shifts in response to native soil fertility. Species native to low nutrient soils and those native to high nutrient soils responded similarly to low nutrient treatments with increased exudation of organic acids (fumaric, citric, malic acids) and glucose, potentially as a mechanism to enhance nutrition acquisition. However, species native to low nutrient soils also responded to low nutrient treatments with a larger decrease in exudation of amino acids than species native to high nutrient soils in all three species pairs. This indicates that species native to low nutrient soils have evolved a unique sensitivity to changes in nutrient availability for some, but not all, root exudates. Overall, these repeated evolutionary divergences between species native to low nutrient soils and those native to high nutrient soils provide evidence for the adaptive value of root exudation, and its plasticity, in contrasting soil environments. PMID:26824236

Metagenomic analysis of rumen microbial population in dairy heifers fed a high grain diet supplemented with dicarboxylic acids or polyphenols.

PubMed

De Nardi, Roberta; Marchesini, Giorgio; Li, Shucong; Khafipour, Ehsan; Plaizier, Kees J C; Gianesella, Matteo; Ricci, Rebecca; Andrighetto, Igino; Segato, Severino

2016-02-19

The aim of this study was to investigate the effects of two feed supplements on rumen bacterial communities of heifers fed a high grain diet. Six Holstein-Friesian heifers received one of the following dietary treatments according to a Latin square design: no supplement (control, C), 60 g/day of fumarate-malate (organic acid, O) and 100 g/day of polyphenol-essential oil (P). Rumen fluid was analyzed to assess the microbial population using Illumina sequencing and quantitative real time PCR. The P treatment had the highest number of observed species (P < 0.10), Chao1 index (P < 0.05), abundance based coverage estimated (ACE) (P < 0.05), and Fisher's alpha diversity (P < 0.10). The O treatment had intermediate values between C and P treatments with the exception of the Chao1 index. The PCoA with unweighted Unifrac distance showed a separation among dietary treatments (P = 0.09), above all between the C and P (P = 0.05). The O and P treatments showed a significant increase of the family Christenenellaceae and a decline of Prevotella brevis compared to C. Additionally, the P treatment enhanced the abundance of many taxa belonging to Bacteroidetes, Firmicutes and Tenericutes phyla due to a potential antimicrobial activity of flavonoids that increased competition among bacteria. Organic acid and polyphenols significantly modified rumen bacterial populations during high-grain feeding in dairy heifers. In particular the polyphenol treatment increased the richness and diversity of rumen microbiota, which are usually high in conditions of physiological rumen pH and rumen function.

Periconceptional iron supplementation does not reduce anemia or improve iron status among pregnant women in rural Bangladesh.

PubMed

Khambalia, Amina Z; O'Connor, Deborah L; Macarthur, Colin; Dupuis, Annie; Zlotkin, Stanley H

2009-11-01

There is a growing interest in periconceptional iron supplementation in developing countries by researchers and policy makers; however, there are no randomized controlled trials that examine the effectiveness of this strategy in decreasing anemia during pregnancy. The aim was to determine whether periconceptional iron supplementation reduces anemia during pregnancy. A randomized, double-blind, controlled trial was conducted in rural Bangladesh. Married, nulliparous women were randomly assigned to receive daily iron and folic acid (IFA; 60 mg ferrous fumarate and 400 microg folic acid) (n = 134) or folic acid (FA; 400 microg) (n = 138) in the form of a powdered supplement added to food. Women were followed until pregnancy or the end of 9 mo. Primary outcomes included hemoglobin, plasma ferritin, and plasma transferrin receptor concentrations. Among 88 pregnant women, periconceptional IFA in comparison with FA did not affect anemia or iron status at 15 wk gestation. However, each 1% increase in adherence was associated with a 10-g/L increase in change in hemoglobin from baseline (P = 0.03), and those who initiated supplementation at a mean (+/-SD) time of 72.9 +/- 57.8 d before conception showed a 7.3-g/L increase in change in hemoglobin from baseline compared with those who initiated supplementation at 26.3 +/- 12.3 d after conception (P = 0.01). Among 146 nonpregnant women, IFA decreased anemia (odds ratio: 0.19; 95% CI: 0.04, 0.95) and improved iron stores (P = 0.001) more than did FA. Good adherence and initiation of supplementation before conception are needed to reduce anemia during early pregnancy. This trial was registered at www.clinicaltrials.gov as NCT00953134.

Optimization of cyanophycin production in recombinant strains of Pseudomonas putida and Ralstonia eutropha employing elementary mode analysis and statistical experimental design.

PubMed

Diniz, Simone Cardoso; Voss, Ingo; Steinbüchel, Alexander

2006-03-05

Elementary mode analysis was applied to simulate conditions for cyanophycin (CGP) biosynthesis and to optimize its production in bacteria. The conclusions from these simulations were confirmed by experiments with recombinant strains of the wild types and polyhydroxyalkanoate (PHA)-negative mutants of Ralstonia eutropha and Pseudomonas putida expressing CGP synthetase genes (cphA) of Synechocystis sp. strain PCC6308 or Anabaena sp. strain PCC7120. In particular, the effects of suitable precursor substrates and of oxygen supply as well as of the capability to accumulate PHA in addition to CGP biosynthesis were investigated. Since CGP consists of the amino acids aspartate and arginine, the tricarboxylic acid cycle (TCC), which provides intermediates for biosynthesis of these amino acids, seems to be important. Excretion of intermediates of the TCC upon cultivation at restricted oxygen supply and conversion of fumarate mainly to malate and to only little succinate in the absence of oxygen indicated that TCC intermediates for arginine and aspartate biosynthesis were provided by the oxidative or reductive parts of the TCC, respectively. The following important conclusions were made from the experiments and the simulations: (i) external arginine additionally supplied to the medium, (ii) oxygen limitation, and (iii) absence of PHA accumulation exerted positive effects on CGP accumulation. These conclusions were utilized to obtain CGP contents in the cells of as high as 17.9% (w x w(-1)) during cultivation of the investigated bacteria at the 30-L scale using mineral salts medium. Such high CGP contents were previously not obtained with these bacteria at a 30-L scale, even if complex media were used.

The Carcinogenic Liver Fluke, Clonorchis sinensis: New Assembly, Reannotation and Analysis of the Genome and Characterization of Tissue Transcriptomes

PubMed Central

Wang, Xiaoyun; Liu, Hailiang; Chen, Yangyi; Guo, Lei; Luo, Fang; Sun, Jiufeng; Mao, Qiang; Liang, Pei; Xie, Zhizhi; Zhou, Chenhui; Tian, Yanli; Lv, Xiaoli; Huang, Lisi; Zhou, Juanjuan; Hu, Yue; Li, Ran; Zhang, Fan; Lei, Huali; Li, Wenfang; Hu, Xuchu; Liang, Chi; Xu, Jin; Li, Xuerong; Yu, Xinbing

2013-01-01

Clonorchis sinensis (C. sinensis), an important food-borne parasite that inhabits the intrahepatic bile duct and causes clonorchiasis, is of interest to both the public health field and the scientific research community. To learn more about the migration, parasitism and pathogenesis of C. sinensis at the molecular level, the present study developed an upgraded genomic assembly and annotation by sequencing paired-end and mate-paired libraries. We also performed transcriptome sequence analyses on multiple C. sinensis tissues (sucker, muscle, ovary and testis). Genes encoding molecules involved in responses to stimuli and muscle-related development were abundantly expressed in the oral sucker. Compared with other species, genes encoding molecules that facilitate the recognition and transport of cholesterol were observed in high copy numbers in the genome and were highly expressed in the oral sucker. Genes encoding transporters for fatty acids, glucose, amino acids and oxygen were also highly expressed, along with other molecules involved in metabolizing these substrates. All genes involved in energy metabolism pathways, including the β-oxidation of fatty acids, the citrate cycle, oxidative phosphorylation, and fumarate reduction, were expressed in the adults. Finally, we also provide valuable insights into the mechanism underlying the process of pathogenesis by characterizing the secretome of C. sinensis. The characterization and elaborate analysis of the upgraded genome and the tissue transcriptomes not only form a detailed and fundamental C. sinensis resource but also provide novel insights into the physiology and pathogenesis of C. sinensis. We anticipate that this work will aid the development of innovative strategies for the prevention and control of clonorchiasis. PMID:23382950

Fagus sylvatica L. provenances maintain different leaf metabolic profiles and functional response

NASA Astrophysics Data System (ADS)

Aranda, Ismael; Sánchez-Gómez, David; de Miguel, Marina; Mancha, Jose Antonio; Guevara, María Angeles; Cadahía, Estrella; Fernández de Simón, María Brígida

2017-07-01

Most temperate forest tree species will suffer important environmental changes as result of the climate change. Adaptiveness to local conditions could change at different sites in the future. In this context, the study of intra-specific variability is important to clarify the singularity of different local populations. Phenotypic differentiation between three beech provenances covering a wide latitudinal range (Spain/ES, Germany/DE and Sweden/SE), was studied in a greenhouse experiment. Non-target leaf metabolite profiles and ecophysiological response was analyzed in well-watered and water stressed seedlings. There was a provenance-specific pattern in the relative concentrations of some leaf metabolites regardless watering treatment. The DE and SE from the center and north of the distribution area of the species showed a clear differentiation from the ES provenance in the relative concentration of some metabolites. Thus the ES provenance from the south maintained larger relative concentration of some organic and amino acids (e.g. fumaric and succinic acids or valine and isoleucine), and in some secondary metabolites (e.g. kaempferol, caffeic and ferulic acids). The ecophysiological response to mild water stress was similar among the three provenances as a consequence of the moderate water stress applied to seedlings, although leaf N isotope composition (δ15N) and leaf C:N ratio were higher and lower respectively in DE than in the other two provenances. This would suggest potential differences in the capacity to uptake and post-process nitrogen according to provenance. An important focus of the study was to address for the first time inter-provenance leaf metabolic diversity in beech from a non-targeted metabolic profiling approach that allowed differentiation of the three studied provenances.

Toxicological effects on earthworms (Eisenia fetida) exposed to sub-lethal concentrations of BDE-47 and BDE-209 from a metabolic point.

PubMed

Liang, Ruoyu; Chen, Juan; Shi, Yajuan; Lu, Yonglong; Sarvajayakesavalu, Suriyanarayanan; Xu, Xiangbo; Zheng, Xiaoqi; Khan, Kifayatullah; Su, Chao

2018-05-15

Earthworms improve the soil fertility and they are also sensitive to soil contaminants. Earthworms (Eisenia fetida), standard reference species, were usually chosen to culture and handle for toxicity tests. Metabolic responses in earthworms exposed to 2, 2', 4, 4'-tetrabromodiphenyl ether (BDE-47) and decabromodiphenyl ether (BDE-209) were inhibitory and interfered with basal metabolism. In this study, 1 H-NMR based metabolomics was used to identify sensitive biomarkers and explore metabolic responses of earthworms under sub-lethal BDE-47 and BDE-209 concentrations for 14 days. The results revealed that lactate was accumulated in earthworms exposed to BDE-47 and BDE-209. Glutamate increased significantly when the concentration of BDE-47 and BDE-209 reached 10 mg/kg. The BDE-47 exposure above 50 mg/kg concentration decreased the content of fumarate significantly, which was noticed different from that of BDE-209. Whereas, the BDE-207 or BDE-209 exposure increased the protein degradation into amino acids in vivo. The increased betaine content indicated that earthworms may maintain the cell osmotic pressure and protected enzyme activity by metabolic regulation. Moreover, the BDE-47 and BDE-209 exposure at 10 mg/kg changed most of the metabolites significantly, indicating that the metabolic responses were more sensitive than growth inhibition and gene expression. The metabolomics results revealed the toxic modes of BDE-47 and BDE-209 act on the osmoregulation, energy metabolism, nerve activities, tricarboxylic acid cycle and amino acids metabolism. Furthermore, our results highlighted that the 1 H-NMR based metabolomics is a strong tool for identifying sensitive biomarkers and eco-toxicological assessment. Copyright © 2018 Elsevier Ltd. All rights reserved.

Metabolic Surgery Profoundly Influences Gut Microbial-Host Metabolic Crosstalk

PubMed Central

Li, Jia V.; Ashrafian, Hutan; Bueter, Marco; Kinross, James; Sands, Caroline; le Roux, Carel W; Bloom, Stephen R.; Darzi, Ara; Athanasiou, Thanos; Marchesi, Julian R.; Nicholson, Jeremy K.; Holmes, Elaine

2013-01-01

Background and Aims Bariatric surgery is increasingly performed worldwide to treat morbid obesity and is also known as metabolic surgery to reflect its beneficial metabolic effects especially with respect to improvement in type 2 diabetes. Understanding surgical weight loss mechanisms and metabolic modulation is required to enhance patient benefits and operative outcomes. Methods We apply a parallel and statistically integrated metagenomic and metabonomic approach to characterize Roux-en-Y gastric bypass (RYGB) effects in a rat model. Results We show substantial shifts of the main gut phyla towards higher levels of Proteobacteria (52-fold) specifically Enterobacter hormaechei. We also find low levels of Firmicutes (4.5-fold) and Bacteroidetes (2-fold) in comparison to sham-operated rats. Faecal extraction studies reveal a decrease in faecal bile acids and a shift from protein degradation to putrefaction through decreased faecal tyrosine with concomitant increases in faecal putrescine and diamnoethane. We find decreased urinary amines and cresols and demonstrate indices of modulated energy metabolism post-RYGB including decreased urinary succinate, 2-oxoglutarate, citrate and fumarate. These changes could also indicate renal tubular acidosis, which associates with increased flux of mitochondrial tricarboxylic acid cycle intermediates. A surgically-induced effect on the gut-brain-liver metabolic axis is inferred by increased neurotropic compounds; faecal γ-aminobutyric acid (GABA) and glutamate. Conclusion This profound co-dependence of mammalian and microbial metabolism, which is systematically altered following RYGB surgery, suggests that RYGB exerts local and global metabolic activities. The effect of RYGB surgery on the host metabolic-microbial crosstalk augments our understanding of the metabolic phenotype of bariatric procedures and can facilitate enhanced treatments for obesity-related diseases. PMID:21572120

Evolutionary Divergences in Root Exudate Composition among Ecologically-Contrasting Helianthus Species.

PubMed

Bowsher, Alan W; Ali, Rifhat; Harding, Scott A; Tsai, Chung-Jui; Donovan, Lisa A

2016-01-01

Plant roots exude numerous metabolites into the soil that influence nutrient availability. Although root exudate composition is hypothesized to be under selection in low fertility soils, few studies have tested this hypothesis in a phylogenetic framework. In this study, we examined root exudates of three pairs of Helianthus species chosen as phylogenetically-independent contrasts with respect to native soil nutrient availability. Under controlled environmental conditions, seedlings were grown to the three-leaf-pair stage, then transferred to either high or low nutrient treatments. After five days of nutrient treatments, we used gas chromatography-mass spectrometry for analysis of root exudates, and detected 37 metabolites across species. When compared in the high nutrient treatment, species native to low nutrient soils exhibited overall higher exudation than their sister species native to high nutrient soils in all three species pairs, providing support for repeated evolutionary shifts in response to native soil fertility. Species native to low nutrient soils and those native to high nutrient soils responded similarly to low nutrient treatments with increased exudation of organic acids (fumaric, citric, malic acids) and glucose, potentially as a mechanism to enhance nutrition acquisition. However, species native to low nutrient soils also responded to low nutrient treatments with a larger decrease in exudation of amino acids than species native to high nutrient soils in all three species pairs. This indicates that species native to low nutrient soils have evolved a unique sensitivity to changes in nutrient availability for some, but not all, root exudates. Overall, these repeated evolutionary divergences between species native to low nutrient soils and those native to high nutrient soils provide evidence for the adaptive value of root exudation, and its plasticity, in contrasting soil environments.

Preparation, Characterization and Evaluation of Quetiapine Fumarate Solid Lipid Nanoparticles to Improve the Oral Bioavailability

PubMed Central

Narala, Arjun; Veerabrahma, Kishan

2013-01-01

Quetiapine fumarate is an antipsychotic drug with poor oral bioavailability (9%) due to first-pass metabolism. Present work is an attempt to improve oral bioavailability of quetiapine fumarate by incorporating in solid lipid nanoparticles (SLN). Six quetiapine fumarate SLN formulations were developed using three different lipids by hot homogenisation followed by ultrasonication. The drug excipient compatibility was studied by differential scanning calorimetry (DSC). Stable quetiapine fumarate SLNs having a mean particle size of 200–250 nm with entrapment efficiency varying in between 80% and 92% were developed. The physical stability of optimized formulation F3 was checked at room temperature for 2 months. Comparative bioavailability studies were conducted in male Wistar rats after oral administration of quetiapine fumarate suspension and SLN formulation. The relative bioavailability of quetiapine fumarate from optimized SLN preparation was increased by 3.71 times when compared with the reference quetiapine fumarate suspension. The obtained results are indicative of SLNs as potential lipid carriers for improving the bioavailability of quetiapine fumarate by minimizing first-pass metabolism. PMID:26555970

Single-agent tenofovir versus combination emtricitabine plus tenofovir for pre-exposure prophylaxis for HIV-1 acquisition: an update of data from a randomised, double-blind, phase 3 trial.

PubMed

Baeten, Jared M; Donnell, Deborah; Mugo, Nelly R; Ndase, Patrick; Thomas, Katherine K; Campbell, James D; Wangisi, Jonathan; Tappero, Jordan W; Bukusi, Elizabeth A; Cohen, Craig R; Katabira, Elly; Ronald, Allan; Tumwesigye, Elioda; Were, Edwin; Fife, Kenneth H; Kiarie, James; Farquhar, Carey; John-Stewart, Grace; Kidoguchi, Lara; Coombs, Robert W; Hendrix, Craig; Marzinke, Mark A; Frenkel, Lisa; Haberer, Jessica E; Bangsberg, David; Celum, Connie

2014-11-01

Antiretroviral pre-exposure prophylaxis (PrEP), with daily oral tenofovir disoproxil fumarate or tenofovir disoproxil fumarate in combination with emtricitabine, has been shown to be efficacious for HIV-1 prevention. Although the use of more than one antiretroviral agent is essential for effective HIV-1 treatment, more than one agent might not be required for effective prophylaxis. We assessed the efficacy of single-agent tenofovir disoproxil fumarate relative to combination emtricitabine plus tenofovir disoproxil fumarate as PrEP. We did a randomised, double-blind, placebo-controlled three-group phase 3 trial of daily oral tenofovir disoproxil fumarate and emtricitabine plus tenofovir disoproxil fumarate PrEP in HIV-1 uninfected individuals in heterosexual HIV-1 serodiscordant couples from Kenya and Uganda. After an interim review, the trial's placebo group was discontinued and thereafter the active groups were continued, and participants initially randomly assigned to placebo were offered rerandomisation in a 1:1 ratio to tenofovir disoproxil fumarate or emtricitabine plus tenofovir disoproxil fumarate as PrEP. The primary endpoints were HIV-1 seroconversion and safety. This trial is registered with ClinicalTrials.gov, number NCT00557245. 4410 (99·6%) of 4427 couples received tenofovir disoproxil fumarate or emtricitabine plus tenofovir disoproxil fumarate and were followed up for HIV-1 acquisition. Of 52 incident HIV-1 infections, 31 occurred in individuals assigned tenofovir disoproxil fumarate (incidence 0·71 cases per 100 person-years) and 21 were in those assigned emtricitabine plus tenofovir disoproxil fumarate (0·48 cases per 100 person-years); HIV-1 incidence in the placebo group until discontinuation was two cases per 100 person-years. HIV-1 prevention efficacy with emtricitabine plus tenofovir disoproxil fumarate was not significantly different from that of tenofovir disoproxil fumarate alone (hazard ratio [HR] 0·67, 95% CI 0·39-1·17; p=0·16). Detection of tenofovir in plasma samples, compared with no detection and as measured in seroconverters and a subset of non-seroconverters, was associated with an 85% relative risk reduction in HIV-1 acquisition for the tenofovir disoproxil fumarate group (HR 0·15, 95% CI 0·06-0·37; p<0·0001) and 93% for the emtricitabine plus tenofovir disoproxil fumarate group (0·07, 0·02-0·23; p<0·0001). No significant differences were noted in the frequency of deaths, serious adverse events, or serum creatinine and phosphorus abnormalities between the two groups. These results do not rule out the potential for a slight difference in HIV-1 protection with tenofovir disoproxil fumarate compared with emtricitabine plus tenofovir disoproxil fumarate, but show that once-daily oral tenofovir disoproxil fumarate or emtricitabine plus tenofovir disoproxil fumarate regimens both provide high protection against HIV-1 acquisition in heterosexual men and women. Bill & Melinda Gates Foundation and US National Institutes of Health. Copyright © 2014 Elsevier Ltd. All rights reserved.

Research on the degradation mechanism of pyridine in drinking water by dielectric barrier discharge.

PubMed

Li, Yang; Yi, Rongjie; Yi, Chengwu; Zhou, Biyun; Wang, Huijuan

2017-03-01

Pyridine, an important chemical raw material, is widely used in industry, for example in textiles, leather, printing, dyeing, etc. In this research, a dielectric barrier discharge (DBD) system was developed to remove pyridine, as a representative type of nitrogen heterocyclic compound in drinking water. First, the influence of the active species inhibitors tertiary butanol alcohol (TBA), HCO 3 - , and CO 3 2- on the degradation rate of pyridine was investigated to verify the existence of active species produced by the strong ionization discharge in the system. The intermediate and final products generated in the degradation process of pyridine were confirmed and analyzed through a series of analytical techniques, including liquid chromatography-mass spectrometry (LC-MS), high performance liquid chromatography (HPLC), ion chromatography (IC), total organic carbon (TOC) analysis, ultraviolet (UV) spectroscopy, etc. The results showed that the degradation of pyridine was mainly due to the strong oxidizing power of ozone and hydroxyl radical produced by the DBD system. Several intermediate products including 3-hydroxyl pyridine, fumaric acid, 2, 3-dihydroxypyridine, and oxalic acid were detected. Nitrogen was removed from the pyridine molecule to form nitrate. Through analysis of the degradation mechanism of pyridine, the oxidation pathway was deduced. The study provided a theoretical and experimental basis for the application of DBD strong ionization discharge in treatment of nitrogen heterocyclic compounds in drinking water. Copyright © 2016. Published by Elsevier B.V.

Metabolic characterization of cultured mammalian cells by mass balance analysis, tracer labeling experiments and computer-aided simulations.

PubMed

Okahashi, Nobuyuki; Kohno, Susumu; Kitajima, Shunsuke; Matsuda, Fumio; Takahashi, Chiaki; Shimizu, Hiroshi

2015-12-01

Studying metabolic directions and flow rates in cultured mammalian cells can provide key information for understanding metabolic function in the fields of cancer research, drug discovery, stem cell biology, and antibody production. In this work, metabolic engineering methodologies including medium component analysis, (13)C-labeling experiments, and computer-aided simulation analysis were applied to characterize the metabolic phenotype of soft tissue sarcoma cells derived from p53-null mice. Cells were cultured in medium containing [1-(13)C] glutamine to assess the level of reductive glutamine metabolism via the reverse reaction of isocitrate dehydrogenase (IDH). The specific uptake and production rates of glucose, organic acids, and the 20 amino acids were determined by time-course analysis of cultured media. Gas chromatography-mass spectrometry analysis of the (13)C-labeling of citrate, succinate, fumarate, malate, and aspartate confirmed an isotopically steady state of the cultured cells. After removing the effect of naturally occurring isotopes, the direction of the IDH reaction was determined by computer-aided analysis. The results validated that metabolic engineering methodologies are applicable to soft tissue sarcoma cells derived from p53-null mice, and also demonstrated that reductive glutamine metabolism is active in p53-null soft tissue sarcoma cells under normoxia. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Gateways to clinical trials.

PubMed

Bayés, M; Rabasseda, X; Prous, J R

2005-12-01

Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity. prous.com. This issue focuses on the following selection of drugs: 131I-chTNT; Abatacept, adalimumab, alemtuzumab, APC-8015, aprepitant, atazanavir sulfate, atomoxetine hydrochloride, azimilide hydrochloride; Bevacizumab, bortezomib, bosentan, buserelin; Caspofungin acetate, CC-4047, ChAGCD3, ciclesonide, clopidogrel, curcumin, Cypher; Dabigatran etexilate, dapoxetine hydrochloride, darbepoetin alfa, darusentan, denosumab, DMXB-Anabaseine, drospirenone, drospirenone/estradiol, duloxetine hydrochloride, dutasteride; Edodekin alfa, efaproxiral sodium, elaidic acid-cytarabine, erlotinib hydrochloride, ertapenem sodium, escitalopram oxalate, eszopiclone, etonogestrel/testosterone decanoate, exenatide; Fulvestrant; Gefitinib, glycine, GVS-111; Homoharringtonine; ICC-1132, imatinib mesylate, iodine (I131) tositumomab, i.v. gamma-globulin; Levetiracetam, levocetirizine, lintuzumab, liposomal nystatin, lumiracoxib, lurtotecan; Manitimus, mapatumumab, melatonin, micafungin sodium, mycophenolic acid sodium salt; Oblimersen sodium, OGX-011, olmesartan medoxomil, omalizumab, omapatrilat, oral insulin; Parathyroid hormone (human recombinant), pasireotide, peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, phVEGF-A165, pimecrolimus, pitavastatin calcium, plerixafor hydrochloride, posaconazole, pramlintide acetate, prasterone, pregabalin, PT-141; Quercetin; Ranolazine, rosuvastatin calcium, rubitecan, rupatadine fumarate; Sardomozide, sunitinib malate; Tadalafil, talactoferrin alfa, tegaserod maleate, telithromycin, testosterone transdermal patch, TH-9507, tigecycline, tiotropium bromide, tipifarnib, tocilizumab, treprostinil sodium; Valdecoxib, vandetanib, vardenafil hydrochloride hydrate, voriconazole. Copyright 2005 Prous Science. All rights reserved.

A comprehensive analysis of myocardial substrate preference emphasizes the need for a synchronized fluxomic/metabolomic research design.

PubMed

Ragavan, Mukundan; Kirpich, Alexander; Fu, Xiaorong; Burgess, Shawn C; McIntyre, Lauren M; Merritt, Matthew E

2017-06-01

The heart oxidizes fatty acids, carbohydrates, and ketone bodies inside the tricarboxylic acid (TCA) cycle to generate the reducing equivalents needed for ATP production. Competition between these substrates makes it difficult to estimate the extent of pyruvate oxidation. Previously, hyperpolarized pyruvate detected propionate-mediated activation of carbohydrate oxidation, even in the presence of acetate. In this report, the optimal concentration of propionate for the activation of glucose oxidation was measured in mouse hearts perfused in Langendorff mode. This study was performed with a more physiologically relevant perfusate than the previous work. Increasing concentrations of propionate did not cause adverse effects on myocardial metabolism, as evidenced by unchanged O 2 consumption, TCA cycle flux, and developed pressures. Propionate at 1 mM was sufficient to achieve significant increases in pyruvate dehydrogenase flux (3×), and anaplerosis (6×), as measured by isotopomer analysis. These results further demonstrate the potential of propionate as an aid for the correct estimation of total carbohydrate oxidative capacity in the heart. However, liquid chromotography/mass spectroscopy-based metabolomics detected large changes (~30-fold) in malate and fumarate pool sizes. This observation leads to a key observation regarding mass balance in the TCA cycle; flux through a portion of the cycle can be drastically elevated without changing the O 2 consumption. Copyright © 2017 the American Physiological Society.

Metabolomic Analysis of Key Central Carbon Metabolism Carboxylic Acids as Their 3-Nitrophenylhydrazones by UPLC/ESI-MS

PubMed Central

Han, Jun; Gagnon, Susannah; Eckle, Tobias; Borchers, Christoph H.

2014-01-01

Multiple hydroxy-, keto-, di-, and tri-carboxylic acids are among the cellular metabolites of central carbon metabolism (CCM). Sensitive and reliable analysis of these carboxylates is important for many biological and cell engineering studies. In this work, we examined 3-nitrophenylhydrazine as a derivatizing reagent and optimized the reaction conditions for the measurement of ten CCM related carboxylic compounds, including glycolate, lactate, malate, fumarate, succinate, citrate, isocitrate, pyruvate, oxaloacetate, and α-ketoglutarate as their 3-nitrophenylhydrazones using LC/MS with electrospray ionization. With the derivatization protocol which we have developed, and using negative-ion multiple reaction monitoring on a triple-quadrupole instrument, all of the carboxylates showed good linearity within a dynamic range of ca. 200 to more than 2000. The on-column limits of detection and quantitation were from high femtomoles to low picomoles. The analytical accuracies for eight of the ten analytes were determined to be between 89.5 to 114.8% (CV≤7.4%, n=6). Using a quadrupole time-of-flight instrument, the isotopic distribution patterns of these carboxylates, extracted from a 13C-labeled mouse heart, were successfully determined by UPLC/MS with full-mass detection, indicating the possible utility of this analytical method for metabolic flux analysis. In summary, this work demonstrates an efficient chemical derivatization LC/MS method for metabolomic analysis of these key CCM intermediates in a biological matrix. PMID:23580203

Seasonal evaluation of disinfection by-products throughout two full-scale drinking water treatment plants.

PubMed

Zhong, Xin; Cui, Chongwei; Yu, Shuili

2017-07-01

Carbonyl compounds can occur alpha-hydrogens or beta-diketones substitution reactions with disinfectants contributed to halogenated by-products formation. The objective of this research was to study the occurrence and fate of carbonyl compounds as ozonation by-products at two full-scale drinking water treatment plants (DWTPs) using different disinfectants for one year. The quality of the raw water used in both plants was varied according to the season. The higher carbonyl compounds concentrations were found in raw water in spring. Up to 15 (as the sum of both DWTPs) of the 24 carbonyl compounds selected for this work were found after disinfection. The dominant carbonyl compounds were formaldehyde, glyoxal, methyl-glyoxal, fumaric, benzoic, protocatechuic and 3-hydroxybenzoic acid at both DWTPs. In the following steps in each treatment plant, the concentration patterns of these carbonyl compounds differed depending on the type of disinfectant applied. Benzaldehyde was the only aromatic aldehyde detected after oxidation with ozone in spring. As compared with DWTP 1, five new carbonyl compounds were formed (crotonaldehyde, benzaldehyde, formic, oxalic and malonic acid) disinfection by ozone, and the levels of the carbonyl compounds increased. In addition, pre-ozonation (PO) and main ozonation (OZ) increased the levels of carbonyl compounds, however coagulation/flocculation (CF), sand filtration (SF) and granular activated carbon filtration (GAC) decreased the levels of carbonyl compounds. Copyright © 2017 Elsevier Ltd. All rights reserved.

Genome of ‘Ca. Desulfovibrio trichonymphae', an H2-oxidizing bacterium in a tripartite symbiotic system within a protist cell in the termite gut

PubMed Central

Kuwahara, Hirokazu; Yuki, Masahiro; Izawa, Kazuki; Ohkuma, Moriya; Hongoh, Yuichi

2017-01-01

The cellulolytic protist Trichonympha agilis in the termite gut permanently hosts two symbiotic bacteria, ‘Candidatus Endomicrobium trichonymphae' and ‘Candidatus Desulfovibrio trichonymphae'. The former is an intracellular symbiont, and the latter is almost intracellular but still connected to the outside via a small pore. The complete genome of ‘Ca. Endomicrobium trichonymphae' has previously been reported, and we here present the complete genome of ‘Ca. Desulfovibrio trichonymphae'. The genome is small (1 410 056 bp), has many pseudogenes, and retains biosynthetic pathways for various amino acids and cofactors, which are partially complementary to those of ‘Ca. Endomicrobium trichonymphae'. An amino acid permease gene has apparently been transferred between the ancestors of these two symbionts; a lateral gene transfer has affected their metabolic capacity. Notably, ‘Ca. Desulfovibrio trichonymphae' retains the complex system to oxidize hydrogen by sulfate and/or fumarate, while genes for utilizing other substrates common in desulfovibrios are pseudogenized or missing. Thus, ‘Ca. Desulfovibrio trichonymphae' is specialized to consume hydrogen that may otherwise inhibit fermentation processes in both T. agilis and ‘Ca. Endomicrobium trichonymphae'. The small pore may be necessary to take up sulfate. This study depicts a genome-based model of a multipartite symbiotic system within a cellulolytic protist cell in the termite gut. PMID:27801909

Peptide and protein delivery using new drug delivery systems.

PubMed

Jain, Ashish; Jain, Aviral; Gulbake, Arvind; Shilpi, Satish; Hurkat, Pooja; Jain, Sanjay K

2013-01-01

Pharmaceutical and biotechnological research sorts protein drug delivery systems by importance based on their various therapeutic applications. The effective and potent action of the proteins/peptides makes them the drugs of choice for the treatment of numerous diseases. Major research issues in protein delivery include the stabilization of proteins in delivery devices and the design of appropriate target-specific protein carriers. Many efforts have been made for effective delivery of proteins/peptidal drugs through various routes of administrations for successful therapeutic effects. Nanoparticles made of biodegradable polymers such as poly lactic acid, polycaprolactone, poly(lactic-co-glycolic acid), the poly(fumaric-co-sebacic) anhydride chitosan, and modified chitosan, as well as solid lipids, have shown great potential in the delivery of proteins/peptidal drugs. Moreover, scientists also have used liposomes, PEGylated liposomes, niosomes, and aquasomes, among others, for peptidal drug delivery. They also have developed hydrogels and transdermal drug delivery systems for peptidal drug delivery. A receptor-mediated delivery system is another attractive strategy to overcome the limitation in drug absorption that enables the transcytosis of the protein across the epithelial barrier. Modification such as PEGnology is applied to various proteins and peptides of the desired protein and peptides also increases the circulating life, solubility and stability, pharmacokinetic properties, and antigenicity of protein. This review focuses on various approaches for effective protein/peptidal drug delivery, with special emphasis on insulin delivery.

Preparation and physicochemical characterization of acyclovir cocrystals with improved dissolution properties.

PubMed

Bruni, Giovanna; Maietta, Mariarosa; Maggi, Lauretta; Mustarelli, Piercarlo; Ferrara, Chiara; Berbenni, Vittorio; Milanese, Chiara; Girella, Alessandro; Marini, Amedeo

2013-11-01

Acyclovir is a well-known antiviral agent. It can be administered in very high doses (from 200 to 1000 mg even three-four times daily). It has absorption problems mainly due to its poor solubility in water (about 0.2 g/100 mL at 25°C) and its oral bioavailability is approximately 15%-20% with a half-life of about 3 h. To improve acyclovir solubility and/or its dissolution properties, two cocrystals of this drug were successfully produced with glutaric acid (AGA1:1) and fumaric acid (AFA1:1) as conformers, using a cogrinding method. Their effective formation was investigated by a broad range of techniques: thermal analysis, Fourier transform infrared spectroscopy, X-ray powder diffraction, solid state nuclear magnetic resonance, and scanning electron microscopy coupled with energy dispersive X-ray spectrometry. The water solubility of the AGA1:1 cocrystal was not improved in comparison to acyclovir, while AFA1:1 showed a slight increased solubility at equilibrium. The main difference was detected in terms of intrinsic dissolution rates (IDR). The IDR of the new phases were much faster compared with acyclovir, particularly at neutral pH. AFA1:1 showed the most rapid dissolution behavior in water; within 10 min, the drug was released completely, while just 60% of acyclovir was dissolved in 1 h. © 2013 Wiley Periodicals, Inc. and the American Pharmacists Association.

Sequence and Genetic Characterization of etrA, an fnr Analog that Regulates Anaerobic Respiration in Shewanella putrefaciens MR-1

NASA Technical Reports Server (NTRS)

Saffarini, Daad A.; Nelson, Kenneth H.

1993-01-01

An electron transport regulatory gene, etrA, has been isolated and characterized from the obligate respiratory bacterium Shewanella putrefaciens MR-l. The deduced amino acid sequence of etrA (EtrA) shows a high degree of identity to both the Fnr of Escherichia coli (73.6%) and the analogous protein (ANR) of Pseudomonas aeruginosa (50.8%). The four active cysteine residues of Fnr are conserved in EtrA, and the amino acid sequence of the DNA-binding domains of the two proteins are identical. Further, S.putrefaciens etrA is able to complement an fnr mutant of E.coli. In contrast to fnr, there is no recognizable Fnr box upstream of the etrA sequence. Gene replacement etr.A mutants of MR-1 were deficient in growth on nitrite, thiosulfate, sulfite, trimethylamine-N-oxide, dimethyl sulfoxide, Fe(III), and fumarate, suggesting that EtrA is involved in the regulation of the corresponding reductase genes. However, the mutants were all positive for reduction of and growth on nitrate and Mn(IV), indicating that EtrA is not involved in the regulation of these two systems. Southern blots of S.putrefaciens DNA with use of etrA as a probe revealed the expected etrA bands and a second set of hybridization signals whose genetic and functional properties remain to be determined.

Environmental metabolomics reveal geographic variation in aerobic metabolism and metabolic substrates in Mongolian gerbils (Meriones unguiculatus).

PubMed

Shi, Yao-Long; Chi, Qing-Sheng; Liu, Wei; Fu, He-Ping; Wang, De-Hua

2015-06-01

Mongolian gerbils (Meriones unguiculatus) have a large-scale distribution in northern China. Geographic physiological variations which related to energy and water metabolism are critical to animals' local adaptation and distribution. However, the underlying biochemical mechanism of such variation and its role in adaptation remains largely unknown. We used GC-MS metabolomics approach to investigate the biochemical adaptation of Mongolian gerbils from xeric (desert), transition (desert steppe) and mesic (typical steppe) environments. Gerbils in desert population had lower resting metabolic rate (RMR) and total evaporative water loss (TEWL) than mesic population. Serum metabolomics revealed that concentrations of five tricarboxylic acid cycle intermediates (citrate, cis-aconitate, α-ketoglutarate, fumarate and malate) were lower in desert population than mesic population. Gastrocnemius metabolomics and citrate synthase activity analysis showed a lower concentration of citrate and lower citrate synthase activity in desert population. These findings suggest that desert dwelling gerbils decrease RMR and TEWL via down-regulation of aerobic respiration. Gastrocnemius metabolomics also revealed that there were higher concentrations of glucose and glycolytic intermediates, but lower concentrations of lipids, amino acids and urea in desert population than mesic population. This geographic variation in metabolic substrates may enhance metabolic water production per oxygen molecule for desert population while constraining aerobic respiration to reduce RMR and TEWL. Copyright © 2015 Elsevier Inc. All rights reserved.

Probing the metabolic network in bloodstream-form Trypanosoma brucei using untargeted metabolomics with stable isotope labelled glucose.

PubMed

Creek, Darren J; Mazet, Muriel; Achcar, Fiona; Anderson, Jana; Kim, Dong-Hyun; Kamour, Ruwida; Morand, Pauline; Millerioux, Yoann; Biran, Marc; Kerkhoven, Eduard J; Chokkathukalam, Achuthanunni; Weidt, Stefan K; Burgess, Karl E V; Breitling, Rainer; Watson, David G; Bringaud, Frédéric; Barrett, Michael P

2015-03-01

Metabolomics coupled with heavy-atom isotope-labelled glucose has been used to probe the metabolic pathways active in cultured bloodstream form trypomastigotes of Trypanosoma brucei, a parasite responsible for human African trypanosomiasis. Glucose enters many branches of metabolism beyond glycolysis, which has been widely held to be the sole route of glucose metabolism. Whilst pyruvate is the major end-product of glucose catabolism, its transamination product, alanine, is also produced in significant quantities. The oxidative branch of the pentose phosphate pathway is operative, although the non-oxidative branch is not. Ribose 5-phosphate generated through this pathway distributes widely into nucleotide synthesis and other branches of metabolism. Acetate, derived from glucose, is found associated with a range of acetylated amino acids and, to a lesser extent, fatty acids; while labelled glycerol is found in many glycerophospholipids. Glucose also enters inositol and several sugar nucleotides that serve as precursors to macromolecule biosynthesis. Although a Krebs cycle is not operative, malate, fumarate and succinate, primarily labelled in three carbons, were present, indicating an origin from phosphoenolpyruvate via oxaloacetate. Interestingly, the enzyme responsible for conversion of phosphoenolpyruvate to oxaloacetate, phosphoenolpyruvate carboxykinase, was shown to be essential to the bloodstream form trypanosomes, as demonstrated by the lethal phenotype induced by RNAi-mediated downregulation of its expression. In addition, glucose derivatives enter pyrimidine biosynthesis via oxaloacetate as a precursor to aspartate and orotate.

DMF, but not other fumarates, inhibits NF-κB activity in vitro in an Nrf2-independent manner.

PubMed

Gillard, Geoffrey O; Collette, Brian; Anderson, John; Chao, Jianhua; Scannevin, Robert H; Huss, David J; Fontenot, Jason D

2015-06-15

Fumarate-containing pharmaceuticals are potent therapeutic agents that influence multiple cellular pathways. Despite proven clinical efficacy, there is a significant lack of data that directly defines the molecular mechanisms of action of related, yet distinct fumarate compounds. We systematically compared the impact of dimethyl fumarate (DMF), monomethyl fumarate (MMF) and a mixture of monoethyl fumarate salts (Ca(++), Mg(++), Zn(++); MEF) on defined cellular responses. We demonstrate that DMF inhibited NF-κB-driven cytokine production and nuclear translocation of p65 and p52 in an Nrf2-independent manner. Equivalent doses of MMF and MEF did not affect NF-κB signaling. These results highlight a key difference in the biological impact of related, yet distinct fumarate compounds. Copyright © 2015. Published by Elsevier B.V.

Low Risk of Proximal Tubular Dysfunction Associated With Emtricitabine-Tenofovir Disoproxil Fumarate Preexposure Prophylaxis in Men and Women

PubMed Central

Mugwanya, Kenneth; Baeten, Jared; Celum, Connie; Donnell, Deborah; Nickolas, Thomas; Mugo, Nelly; Branch, Andrea; Tappero, Jordan; Kiarie, James; Ronald, Allan; Yin, Michael; Wyatt, Christina

2016-01-01

Objective. Tenofovir disoproxil fumarate (TDF) is associated with proximal tubular dysfunction (tubulopathy) when used in the treatment of human immunodeficiency virus (HIV) infection. We evaluated whether TDF causes tubulopathy when used as HIV preexposure prophylaxis (PrEP) and whether tubulopathy predicts clinically relevant decline (≥25%) in the estimated glomerular filtration rate (eGFR). Methods. A subgroup analysis of the Partners PrEP Study, a randomized, placebo-controlled trial of daily oral TDF, alone or with emtricitabine (FTC), in HIV-uninfected African men and women (Clinicaltrials.gov NCT00557245). Tubulopathy was assessed in concurrently obtained urine and serum samples at the 24-month or last on-treatment visit, predefined as ≥2 of the following: tubular proteinuria, euglycemic glycosuria, increased urinary phosphate, and uric acid excretion. Results. Of 1549 persons studied (776 receiving FTC-TDF, 773 receiving placebo), 64% were male, and the median age was 37 years. Over a median 24 months of study-drug exposure, the frequency of tubulopathy was 1.7% for FTC-TDF versus 1.3% for placebo (odds ratio, 1.30; 95% confidence interval, .52–3.33; P = .68); Tubulopathy occurred in 2 of 52 persons (3.8%) with versus 3 of 208 (1.4%) without ≥25% eGFR decline (adjusted odds ratio, 1.39; .10–14.0; P > .99). Conclusions. Daily oral FTC-TDF PrEP was not significantly associated with tubulopathy over the course of 24 months, nor did tubulopathy predict clinically relevant eGFR decline. PMID:27029778

Dimethyl fumarate reduces the risk of mycotoxins via improving intestinal barrier and microbiota

PubMed Central

Ma, Ning; Wu, Yi; Xie, Fei; Du, Kexin; Wang, Yuan; Shi, Linxin; Ji, Linbao; Liu, Tianyi; Ma, Xi

2017-01-01

The effects of dimethyl fumarate (DMF) on mycotoxins and animal growth performance are well documented. However, its mechanism of anti-mildew effects is still unknown. The current study investigated how DMF detoxified the mycotoxin and improved the growth performance using BALB/c mice model, especially its effects on intestinal barrier function and gut micro-ecology. Our study also compared with the ultraviolet radiation (UR) treatment, a traditional anti-mildew control (TC). The results indicated that the DMF treatment had a lower contents of mycotoxin, better growth performance and improved mucosal morphology (P < 0.05), accompanied with the decreased intestinal permeability and the tighter gut barrier. Moreover, the efficiency of DMF was better than TC (P < 0.05). 16S rRNA gene sequence analysis revealed that the richness and diversity of bacteria was increased in DMF treatment. The most abundant OTUs belonged to Firmicutes and Bacteroidetes, and their changes in DMF were more moderate than the TC group, suggesting a more stable micro-ecology and the positive impact of DMF on the biodiversity of intestine. Specifically, the increased abundance of bacteria producing short-chain fatty acids (SCFAs), such as Gemella, Roseburia, Bacillus and Bacteroides in DMF group and prebiotics such as Lactobacillus in TC group, suggested a more healthier microbial composition and distribution. These findings supported that DMF had significant effects on animal's growth performance and intestinal barrier function by modulating the pathway of nutrient absorption and increasing the diversity and balance of gut microbes, which also illuminate that DMF is more efficient than traditional anti-mildew method. PMID:28574825

Gateways to clinical trials.

PubMed

Tomillero, A; Moral, M A

2010-01-01

(-)-Epigallocatechin gallate, Abafungin, ACE-031, Adapalene/benzoyl peroxide, AE-37, Aflibercept, AGS-003, Albiglutide, Alemtuzumab, Aliskiren fumarate, ALT-801, AN-2728, Anacetrapib, API, Aprepitant, ARQ-197, Ascorbic acid, Atazanavir sulfate, ATN-224, AVI-4658, Azacitidine, Azelnidipine; Belinostat, Bevacizumab, BI-2536, Biphasic insulin aspart, Bortezomib, Bovine lactoferrin, Bryostatin 1, Budesonide/formoterol fumarate; cAC10, Canfosfamide hydrochloride, Cediranib, Clofarabine, Cocaine conjugate vaccine; Darbepoetin alfa, Dasatinib, Denosumab, Disomotide, Doripenem, Dovitinib Lactate, Dronedarone hydrochloride, Drospirenone/estradiol, Dutasteride; Ecogramostim, Entinostat, Enzastaurin hydrochloride, Erlotinib hydrochloride, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; Fampridine, Fenretinide LXS, FFR-factor VIIa, Fingolimod hydrochloride, Frovatriptan; Gefitinib, Gimatecan, GP-2/GM-CSF; Iloperidone, Imatinib mesylate, Indibulin, Ipilimumab, Ivabradine hydrochloride; Lactobacillus rhamnosus, Lapatinib ditosylate, LC-07, Lenalidomide, Linifanib, Liposomal doxorubicin, Liposomal vincristine, Litenimod, Lutein; M-118, MDX-1401, MEDI-528, Midostaurin, Miglustat, MK-0657; Natalizumab, Nesiritide, NGR-TNF, Niacin/simvastatin; Obatoclax mesylate, Olaparib, Omacetaxine mepesuccinate; Paclitaxel nanoparticles, Paclitaxel-eluting stent, Palonosetron hydrochloride, Pazopanib hydrochloride, Pegfilgrastim, Pemetrexed disodium, PER.C-flu, Perifosine, PF-02341066, Pimecrolimus, Pitrakinra, Plerixafor hydrochloride, Posaconazole; Rasburicase, Recombinant human relaxin H2, ReoT3D, Retaspimycin hydrochloride, Riferminogene pecaplasmid, Rindopepimut, Romiplostim, Ronacaleret hydrochloride, Rosuvastatin calcium, Rotigotine; Sagopilone, sALP-FcD10, SAR-245409, SCH-697243, Selumetinib, Sirolimus-eluting stent, SIR-Spheres, Sitagliptin phosphate monohydrate, Sitaxentan sodium, Sorafenib, Sunitinib malate; Tadalafil, Tandutinib, Tasimelteon, Temsirolimus, Teriparatide, Tiotropium bromide, TIV, Trabectedin, Tremelimumab, TRU-016; Vadimezan, Val8-GLP-1(7-37)OH, Vandetanib, Vernakalant hydrochloride, Voreloxin, Voriconazole, Vorinostat, Yttrium 90 (90Y) ibritumomab tiuxetan; Zeaxanthin, Ziprasidone hydrochloride, Zosuquidar trihydrochloride. Copyright 2010 Prous Science, S.A.U. or its licensors. All rights reserved.

Metabolic Linkage and Correlations to Storage Capacity in Erythrocytes from Glucose 6-Phosphate Dehydrogenase-Deficient Donors.

PubMed

Reisz, Julie A; Tzounakas, Vassilis L; Nemkov, Travis; Voulgaridou, Artemis I; Papassideri, Issidora S; Kriebardis, Anastasios G; D'Alessandro, Angelo; Antonelou, Marianna H

2017-01-01

In glucose 6-phosphate dehydrogenase (G6PD) deficiency, decreased NADPH regeneration in the pentose phosphate pathway and subnormal levels of reduced glutathione result in insufficient antioxidant defense, increased susceptibility of red blood cells (RBCs) to oxidative stress, and acute hemolysis following exposure to pro-oxidant drugs and infections. Despite the fact that redox disequilibrium is a prominent feature of RBC storage lesion, it has been reported that the G6PD-deficient RBCs store well, at least in respect to energy metabolism, but their overall metabolic phenotypes and molecular linkages to the storability profile are scarcely investigated. We performed UHPLC-MS metabolomics analyses of weekly sampled RBC concentrates from G6PD sufficient and deficient donors, stored in citrate phosphate dextrose/saline adenine glucose mannitol from day 0 to storage day 42, followed by statistical and bioinformatics integration of the data. Other than previously reported alterations in glycolysis, metabolomics analyses revealed bioactive lipids, free fatty acids, bile acids, amino acids, and purines as top variables discriminating RBC concentrates for G6PD-deficient donors. Two-way ANOVA showed significant changes in the storage-dependent variation in fumarate, one-carbon, and sulfur metabolism, glutathione homeostasis, and antioxidant defense (including urate) components in G6PD-deficient vs. sufficient donors. The levels of free fatty acids and their oxidized derivatives, as well as those of membrane-associated plasticizers were significantly lower in G6PD-deficient units in comparison to controls. By using the strongest correlations between in vivo and ex vivo metabolic and physiological parameters, consecutively present throughout the storage period, several interactomes were produced that revealed an interesting interplay between redox, energy, and hemolysis variables, which may be further associated with donor-specific differences in the post-transfusion performance of G6PD-deficient RBCs. The metabolic phenotypes of G6PD-deficient donors recapitulate the basic storage lesion profile that leads to loss of metabolic linkage and rewiring. Donor-related issues affect the storability of RBCs even in the narrow context of this donor subgroup in a way likely relevant to transfusion medicine.

Nickel Availability in Soil as Influenced by Liming and Its Role in Soybean Nitrogen Metabolism

PubMed Central

de Macedo, Fernando G.; Bresolin, Joana D.; Santos, Elcio F.; Furlan, Felipe; Lopes da Silva, Wilson T.; Polacco, Joe C.; Lavres, José

2016-01-01

Nickel (Ni) availability in soil varies as a function of pH. Plants require Ni in small quantities for normal development, especially in legumes due its role in nitrogen (N) metabolism. This study investigated the effect of soil base saturation, and Ni amendments on Ni uptake, N accumulation in the leaves and grains, as well as to evaluate organic acids changes in soybean. In addition, two N assimilation enzymes were assayed: nitrate reductase (NR) and Ni-dependent urease. Soybean plants inoculated with Bradyrhizobium japonicum were cultivated in soil-filled pots under two base-cation saturation (BCS) ratios (50 and 70%) and five Ni rates – 0.0; 0.1; 0.5; 1.0; and 10.0 mg dm-3 Ni. At flowering (R1 developmental stage), plants for each condition were evaluated for organic acids (oxalic, malonic, succinic, malic, tartaric, fumaric, oxaloacetic, citric and lactic) levels as well as the activities of urease and NR. At the end of the growth period (R7 developmental stage – grain maturity), grain N and Ni accumulations were determined. The available soil-Ni in rhizosphere extracted by DTPA increased with Ni rates, notably in BCS50. The highest concentrations of organic acid and N occurred in BCS70 and 0.5 mg dm-3 of Ni. There were no significant differences for urease activity taken on plants grown at BSC50 for Ni rates, except for the control treatment, while plants cultivated at soil BCS70 increased the urease activity up to 0.5 mg dm-3 of Ni. In addition, the highest values for urease activities were reached from the 0.5 mg dm-3 of Ni rate for both BCS treatments. The NR activity was not affected by any treatment indicating good biological nitrogen fixation (BNF) for all plants. The reddish color of the nodules increased with Ni rates in both BCS50 and 70, also confirms the good BNF due to Ni availability. The optimal development of soybean occurs in BCS70, but requires an extra Ni supply for the production of organic acids and for increased N-shoot and grain accumulation. PMID:27660633

Microbial reduction of Fe(III) in acidic sediments: isolation of Acidiphilium cryptum JF-5 capable of coupling the reduction of Fe(III) to the oxidation of glucose.

PubMed

Küsel, K; Dorsch, T; Acker, G; Stackebrandt, E

1999-08-01

To evaluate the microbial populations involved in the reduction of Fe(III) in an acidic, iron-rich sediment, the anaerobic flow of supplemental carbon and reductant was evaluated in sediment microcosms at the in situ temperature of 12 degrees C. Supplemental glucose and cellobiose stimulated the formation of Fe(II); 42 and 21% of the reducing equivalents that were theoretically obtained from glucose and cellobiose, respectively, were recovered in Fe(II). Likewise, supplemental H(2) was consumed by acidic sediments and yielded additional amounts of Fe(II) in a ratio of approximately 1:2. In contrast, supplemental lactate did not stimulate the formation of Fe(II). Supplemental acetate was not consumed and inhibited the formation of Fe(II). Most-probable-number estimates demonstrated that glucose-utilizing acidophilic Fe(III)-reducing bacteria approximated to 1% of the total direct counts of 4', 6-diamidino-2-phenylindole-stained bacteria. From the highest growth-positive dilution of the most-probable-number series at pH 2. 3 supplemented with glucose, an isolate, JF-5, that could dissimilate Fe(III) was obtained. JF-5 was an acidophilic, gram-negative, facultative anaerobe that completely oxidized the following substrates via the dissimilation of Fe(III): glucose, fructose, xylose, ethanol, glycerol, malate, glutamate, fumarate, citrate, succinate, and H(2). Growth and the reduction of Fe(III) did not occur in the presence of acetate. Cells of JF-5 grown under Fe(III)-reducing conditions formed blebs, i.e., protrusions that were still in contact with the cytoplasmic membrane. Analysis of the 16S rRNA gene sequence of JF-5 demonstrated that it was closely related to an Australian isolate of Acidiphilium cryptum (99.6% sequence similarity), an organism not previously shown to couple the complete oxidation of sugars to the reduction of Fe(III). These collective results indicate that the in situ reduction of Fe(III) in acidic sediments can be mediated by heterotrophic Acidiphilium species that are capable of coupling the reduction of Fe(III) to the complete oxidation of a large variety of substrates including glucose and H(2).

PA-1, a Versatile Anaerobe Obtained in Pure Culture, Catabolizes Benzenoids and Other Compounds in Syntrophy with Hydrogenotrophs, and P-2 plus Wolinella sp. Degrades Benzenoids

PubMed Central

Barik, Sudhakar; Brulla, W. J.; Bryant, M. P.

1985-01-01

Methanogenic enrichments catabolizing 13 mM phenylacetate or 4 mM phenol were established at 37°C, using a 10% inoculum from a municipal anaerobic digester. By using agar roll tubes of the basal medium plus 0.1% yeast extract-25 mM fumarate, a hydrogenotrophic lawn of Wolinella succinogenes and phenol or phenylacetate, strains P-2 and PA-1, respectively, were isolated in coculture with W. succinogenes. With the lawn deleted, PA-1 was isolated in pure culture. Strain P-2 is apparently a new species of anaerobic, motile, gram-negative, spindle-shaped, small rod that as yet has been grown only in coculture with W. succinogenes. It used phenol, hydrocinnamate, benzoate, and phenylacetate as energy sources. Product recovery by the coculture, per mole of phenol and 4.4 mol of fumarate used, included 2.03, 0.12, 0.08, and 3.23 mol, respectively, of acetate, propionate, butyrate, and succinate. Carbon recovery was 75% and H recovery was 80%, although CO2 and a few other possible products were not determined. That P-2 is an obligate proton-reducing acetogen and possible pathways for its degradation of phenol are discussed. Strain PA-1 is apparently a new species of anaerobic, motile, relatively small, gram-negative rod. It utilized compounds such as phenylacetate, hydrocinnamate, benzoate, phenol, resorcinol, gallate, 4-aminophenol, 2-aminobenzoate, pyruvate, Casamino Acids, and aspartate as energy sources in coculture with W. succinogenes. Per mole of phenylacetate and 1.44 mol of fumarate used, 1.04, 0.53, and 0.78 mol of acetate, propionate, and succinate, respectively, were recovered from the coculture. Only about 50% of the carbon and H were recovered. In coculture with Methanospirillum hungatei, 0.96 mol of acetate and 0.25 mol of methane were recovered per mol of pyruvate used; 0.90 mol of acetate and 0.33 mol of methane, per mol of fumarate used; 0.93 mol of acetate and 0.54 mol of methane, per mol of aspartate used; and 1.71 mol of acetate and 0.57 mol of methane, per mol of glucose used. Carbon and H recoveries, assuming CO2 and ammonia were produced in stoichiometric amounts, were 97 and 98% for pyruvate, 72.5 and 82% for fumarate, 96.5 and 98% for aspartate, and 61.8 and 76% for glucose. No explanation such as contamination could be found for the fact that the coculture PA-1 plus Wolinella sp. did not use glucose; after growth with M. hungatei on pyruvate, however, the latter coculture used glucose. The PA-1 pure culture produced 0.86 mol of propionate per mol of succinate used during growth. PA-1 produced a small amount of H2. Strain PA-1 is the most versatile anaerobic bacterium yet known that catabolizes monobenzenoids in the absence of electron acceptors such as sulfate or nitrate. PMID:16346852

Fumarate decreases edema volume and improves functional outcome after experimental stroke.

PubMed

Clausen, Bettina Hjelm; Lundberg, Louise; Yli-Karjanmaa, Minna; Martin, Nellie Anne; Svensson, Martina; Alfsen, Maria Zeiler; Flæng, Simon Bertram; Lyngsø, Kristina; Boza-Serrano, Antonio; Nielsen, Helle H; Hansen, Pernille B; Finsen, Bente; Deierborg, Tomas; Illes, Zsolt; Lambertsen, Kate Lykke

2017-09-01

Oxidative stress and inflammation exacerbate tissue damage in the brain after ischemic stroke. Dimethyl-fumarate (DMF) and its metabolite monomethyl-fumarate (MMF) are known to stimulate anti-oxidant pathways and modulate inflammatory responses. Considering these dual effects of fumarates, we examined the effect of MMF treatment after ischemic stroke in mice. Permanent middle cerebral artery occlusion (pMCAO) was performed using adult, male C57BL/6 mice. Thirty minutes after pMCAO, 20mg/kg MMF was administered intravenously. Outcomes were evaluated 6, 24 and 48h after pMCAO. First, we examined whether a bolus of MMF was capable of changing expression of kelch-like erythroid cell-derived protein with CNC homology-associated protein 1 (Keap1) and nuclear factor erythroid 2-related factor (Nrf)2 in the infarcted brain. Next, we studied the effect of MMF on functional recovery. To explore mechanisms potentially influencing functional changes, we examined infarct volumes, edema formation, the expression of heat shock protein (Hsp)72, hydroxycarboxylic acid receptor 2 (Hcar2), and inducible nitric oxide synthase (iNOS) in the infarcted brain using real-time PCR and Western blotting. Concentrations of a panel of pro- and anti-inflammatory cytokines (IFNγ, IL-1β, IL-2, IL-4, IL-5, IL-6, IL-10, IL-12p70, TNF) were examined in both the infarcted brain tissue and plasma samples 6, 24 and 48h after pMCAO using multiplex electrochemoluminiscence analysis. Administration of MMF increased the protein level of Nrf2 6h after pMCAO, and improved functional outcome at 24 and 48h after pMCAO. MMF treatment did not influence infarct size, however reduced edema volume at both 24 and 48h after pMCAO. MMF treatment resulted in increased Hsp72 expression in the brain 6h after pMCAO. Hcar2 mRNA levels increased significantly 24h after pMCAO, but were not different between saline- and MMF-treated mice. MMF treatment also increased the level of the anti-inflammatory cytokine IL-10 in the brain and plasma 6h after pMCAO, and additionally reduced the level of the pro-inflammatory cytokine IL-12p70 in the brain at 24 and 48h after pMCAO. A single intravenous bolus of MMF improved sensory-motor function after ischemic stroke, reduced edema formation, and increased the levels of the neuroprotective protein Hsp72 in the brain. The early increase in IL-10 and reduction in IL-12p70 in the brain combined with changes in systemic cytokine levels may also contribute to the functional recovery after pMCAO. Copyright © 2017. Published by Elsevier Inc.

Isolation and growth characteristics of an EDTA-degrading member of the alpha-subclass of Proteobacteria.

PubMed

Weilenmann, Hans-Ueli; Engeli, Barbara; Bucheli-Witschel, Margarete; Egli, Thomas

2004-10-01

A Gram-negative, ethylenediaminetetraacetic acid (EDTA)-degrading bacterium (deposited at the German Culture Collection as strain DSM 9103) utilising EDTA as the only source of carbon, energy and nitrogen was isolated from a mixed EDTA-degrading population that was originally enriched in a column system from a mixture of activated sludge and soil. Chemotaxonomic analysis of quinones, polar lipids and fatty acids allowed allocation of the isolate to the alpha-subclass of Proteobacteria. 16S rDNA sequencing and phylogenetic analysis revealed highest similarity to the Mesorhizobium genus followed by the Aminobacter genus. However, the EDTA-degrading strain apparently forms a new branch within the Phyllobacteriaceae/Mesorhizobia family. Growth of the strain was rather slow not only on EDTA (micro(max) = 0.05 h(-1)) but also on other substrates. Classical substrate utilisation testing in batch culture suggested a quite restricted carbon source spectrum with only lactate, glutamate, and complexing agents chemically related to EDTA (nitrilotriacetate, iminodiacetate and ethylenediaminedisuccinate) supporting growth. However, when EDTA-limited continuous cultures of strain DSM 9103 were pulsed with fumarate, succinate, glucose or acetate, these substrates were assimilated immediately. Apparently, the strain can use a broader spectrum than indicated by traditional substrate testing techniques. The EDTA species CaEDTA and MgEDTA served as growth substrates of the strain because in the mineral medium employed EDTA was predicted to be mainly present in the form of these two complexes. The bacterium was not able to degrade Fe3+-complexed EDTA.

Relatedness of medically important strains of Saccharomyces cerevisiae as revealed by phylogenetics and metabolomics.

PubMed

MacKenzie, Donald A; Defernez, Marianne; Dunn, Warwick B; Brown, Marie; Fuller, Linda J; de Herrera, Santiago R M Seco; Günther, Andreas; James, Steve A; Eagles, John; Philo, Mark; Goodacre, Royston; Roberts, Ian N

2008-07-01

Ten medically important Saccharomyces strains, comprising six clinical isolates of Saccharomyces cerevisiae and four probiotic strains of Saccharomyces boulardii, were characterized at the genetic and metabolic level and compared with non-medical, commercial yeast strains used in baking and wine-making. Strains were compared by genetic fingerprinting using amplified fragment length polymorphism (AFLP) analysis, by ribosomal DNA ITS1 sequencing and by metabolic footprinting using both direct injection mass spectrometry (DIMS) and gas chromatography-time of flight-mass spectrometry (GC-ToF-MS). Overall, the clinical isolates fell into different groupings when compared with the non-medical strains, with good but not perfect correlation amongst strains at both the genetic and metabolic levels. Probiotic strains of S. boulardii that are used therapeutically to treat human gastro-intestinal tract disorders showed tight clustering both genetically and metabolically. Metabolomics was found to be of value both as a taxonomic tool and as a means to investigate anomalous links between genotype and phenotype. Key discriminatory metabolites were identified when comparing the three main groups of clinical, probiotic and non-medical strains and included molecules such as trehalose, myo-inositol, lactic acid, fumaric acid and glycerol 3-phosphate. This study confirmed the link between a subset of clinical isolates and baking or probiotic strains but also highlighted that in general the clinical strains were more diverse at both the genomic and metabolic levels. Copyright 2008 John Wiley & Sons, Ltd.

Pre-analytical method for NMR-based grape metabolic fingerprinting and chemometrics.

PubMed

Ali, Kashif; Maltese, Federica; Fortes, Ana Margarida; Pais, Maria Salomé; Verpoorte, Robert; Choi, Young Hae

2011-10-10

Although metabolomics aims at profiling all the metabolites in organisms, data quality is quite dependent on the pre-analytical methods employed. In order to evaluate current methods, different pre-analytical methods were compared and used for the metabolic profiling of grapevine as a model plant. Five grape cultivars from Portugal in combination with chemometrics were analyzed in this study. A common extraction method with deuterated water and methanol was found effective in the case of amino acids, organic acids, and sugars. For secondary metabolites like phenolics, solid phase extraction with C-18 cartridges showed good results. Principal component analysis, in combination with NMR spectroscopy, was applied and showed clear distinction among the cultivars. Primary metabolites such as choline, sucrose, and leucine were found discriminating for 'Alvarinho', while elevated levels of alanine, valine, and acetate were found in 'Arinto' (white varieties). Among the red cultivars, higher signals for citrate and GABA in 'Touriga Nacional', succinate and fumarate in 'Aragonês', and malate, ascorbate, fructose and glucose in 'Trincadeira', were observed. Based on the phenolic profile, 'Arinto' was found with higher levels of phenolics as compared to 'Alvarinho'. 'Trincadeira' showed lowest phenolics content while higher levels of flavonoids and phenylpropanoids were found in 'Aragonês' and 'Touriga Nacional', respectively. It is shown that the metabolite composition of the extract is highly affected by the extraction procedure and this consideration has to be taken in account for metabolomics studies. Copyright © 2011 Elsevier B.V. All rights reserved.

Gateways to clinical trials.

PubMed

Tomillero, A; Moral, M A

2009-03-01

ABT-869, Acadesine, Acetylsalicylic acid/omeprazole, Adefovir, Adefovir dipivoxil, AEG-35156, Agatolimod sodium, Albiglutide, Alemtuzumab, Alipogene tiparvovec, Alogliptin benzoate, AMG-386, Amrubicin hydrochloride, Apremilast, Aripiprazole, Asoprisnil, Atorvastatin/fenofibrate, AVN-944, Axitinib; Belinostat, Bevacizumab, BHT-3021, BI-2536, Biapenem, Bilastine, Biphasic insulin aspart, Blinatumomab, Bortezomib, Bosentan; Catumaxomab, CD-NP, Cediranib, Certolizumab pegol, Cetuximab, Choline fenofibrate, Ciclesonide, CK-1827452,Clevudine, Clofarabine, CSL-360, CYT-997; Dapagliflozin, Darinaparsin, Denosumab, Densiron 68, Desloratadine, Dulanermin; Edoxaban tosilate, Emtricitabine, Entecavir, Erlotinib hydrochloride, Everolimus, Exenatide, Ezetimibe, Ezetimibe/simvastatin; Fidaxomicintiacumiv, Fulvestrant; G-207, GCR-8015, Gefitinib, Ghrelin (human), Glufosfamide; HPV16L1E7CVLP; Ibutamoren mesilate, Imatinib mesylate, Insulin detemir, Insulin glargine, Iodine (I131) tositumomab, Istaroxime, ITMN-191, Ixabepilone; JZP-4, Lenalidomide; Levetiracetam, Linaclotide acetate, Liposomal cytarabine/daunorubicin, Liposomal doxorubicin, Liraglutide, LY-518674; Milatuzumab, MMR-V, Motesanib diphosphate, Mycophenolic acid sodium salt; Niacin/simvastatin; Obatoclax mesylate, Odanacatib; Paclitaxel nanoparticles, Paclitaxel-eluting stent, Pazufloxacin, PBT-2, Pegfilgrastim, Peginterferon alfa-2a, Peginterferon alfa-2b, Peginterferon alfa-2b/ribavirin, Pemetrexed disodium, Perampanel, PfCP2.9, Pitavastatin calcium, Poly I:CLC, Pomalidomide, Pralatrexate, Pramlintide acetate, Prucalopride; rhGAD65, Roflumilast; RTS,S/AS02D; SCH-530348, Semagacestat, Sirolimus-eluting coronary stent, Sirolimus-Eluting Stent, SIR-Spheres, Sivelestat sodium hydrate, Sorafenib, Sunitinib malate; Tadalafil, Tafluprost, Tanespimycin, Teduglutide, Telaprevir, Telbivudine, Tenofovir disoproxil fumarate, Tiotropium bromide, TMC-435350, Tositumomab/iodine (I131) tositumomab, Travoprost/timolol, Triciribine phosphate; Vandetanib, VIA-2291, Vinflunine, Vorinostat; XL-019; Yttrium 90 (90Y) ibritumomab tiuxetan. Copyright 2009 Prous Science, S.A.U. or its licensors. All rights reserved.

Succinyl-CoA:(R)-Benzylsuccinate CoA-Transferase: an Enzyme of the Anaerobic Toluene Catabolic Pathway in Denitrifying Bacteria†

PubMed Central

Leutwein, Christina; Heider, Johann

2001-01-01

Anaerobic microbial toluene catabolism is initiated by addition of fumarate to the methyl group of toluene, yielding (R)-benzylsuccinate as first intermediate, which is further metabolized via β-oxidation to benzoyl-coenzyme A (CoA) and succinyl-CoA. A specific succinyl-CoA:(R)-benzylsuccinate CoA-transferase activating (R)-benzylsuccinate to the CoA-thioester was purified and characterized from Thauera aromatica. The enzyme is fully reversible and forms exclusively the 2-(R)-benzylsuccinyl-CoA isomer. Only some close chemical analogs of the substrates are accepted by the enzyme: succinate was partially replaced by maleate or methylsuccinate, and (R)-benzylsuccinate was replaced by methylsuccinate, benzylmalonate, or phenylsuccinate. In contrast to all other known CoA-transferases, the enzyme consists of two subunits of similar amino acid sequences and similar sizes (44 and 45 kDa) in an α2β2 conformation. Identity of the subunits with the products of the previously identified toluene-induced bbsEF genes was confirmed by determination of the exact masses via electrospray-mass spectrometry. The deduced amino acid sequences resemble those of only two other characterized CoA-transferases, oxalyl-CoA:formate CoA-transferase and (E)-cinnamoyl-CoA:(R)-phenyllactate CoA-transferase, which represent a new family of CoA-transferases. As suggested by kinetic analysis, the reaction mechanism of enzymes of this family apparently involves formation of a ternary complex between the enzyme and the two substrates. PMID:11418570

Characterization of HIV-1 Resistance to Tenofovir Alafenamide In Vitro

PubMed Central

Johnson, Audun; Miller, Michael D.; Callebaut, Christian

2015-01-01

Tenofovir alafenamide (TAF) is an investigational prodrug of the HIV-1 nucleotide reverse transcriptase (RT) inhibitor (NtRTI) tenofovir (TFV), with improved potency and drug delivery properties over the current prodrug, tenofovir disoproxil fumarate (TDF). TAF is currently in phase 3 clinical studies for the treatment of HIV-1 infection, in combination with other antiretroviral agents. Phase 1 and 2 studies have shown that TAF was associated with increased peripheral blood mononuclear cell (PBMC) drug loading and increased suppression of HIV-1 replication compared to treatment with TDF. In this study, selection of in vitro resistance to both TAF and the parent compound, TFV, led to the emergence of HIV-1 with the K65R amino acid substitution in RT with 6.5-fold-reduced susceptibility to TAF. Although TAF is more potent than TFV in vitro, the antiviral susceptibilities to TAF and TFV of a large panel of nucleoside/nucleotide RT inhibitor (NRTI)-resistant mutants were highly correlated (R2 = 0.97), indicating that the two compounds have virtually the same resistance profile when assessed as fold change from the wild type. TAF showed full antiviral activity in PBMCs against primary HIV-1 isolates with protease inhibitor, nonnucleoside RT inhibitor (NNRTI), or integrase strand transfer inhibitor resistance but reduced activity against isolates with extensive NRTI resistance amino acid substitutions. However, the increased cell loading of TFV with TAF versus TDF observed in vivo suggests that TAF may retain activity against TDF-resistant mutant viruses. PMID:26149983

A second dihydroorotate dehydrogenase (Type A) of the human pathogen Enterococcus faecalis: expression, purification, and steady-state kinetic mechanism.

PubMed

Marcinkeviciene, J; Jiang, W; Locke, G; Kopcho, L M; Rogers, M J; Copeland, R A

2000-05-01

We report the identification, expression, and characterization of a second Dihydroorotate dehydrogenase (DHODase A) from the human pathogen Enterococcus faecalis. The enzyme consists of a polypeptide chain of 322 amino acids that shares 68% identity with the cognate type A enzyme from the bacterium Lactococcus lactis. E. faecalis DHODase A catalyzed the oxidation of l-dihydroorotate while reducing a number of substrates, including fumarate, coenzyme Q(0), and menadione. The steady-state kinetic mechanism has been determined with menadione as an oxidizing substrate at pH 7.5. Initial velocity and product inhibition data suggest that the enzyme follows a two-site nonclassical ping-pong kinetic mechanism. The absorbance of the active site FMN cofactor is quenched in a concentration-dependent manner by titration with orotate and barbituric acid, two competitive inhibitors with respect to dihydroorotate. In contrast, titration of the enzyme with menadione had no effect on FMN absorbance, consistent with nonoverlapping binding sites for dihyroorotate and menadione, as suggested from the kinetic mechanism. The reductive half-reaction has been shown to be only partially rate limiting, and an attempt to evaluate the slow step in the overall reaction has been made by simulating orotate production under steady-state conditions. Our data indicate that the oxidative half-reaction is a rate-limiting segment, while orotate, most likely, retains significant affinity for the reduced enzyme, as suggested by the product inhibition pattern. Copyright 2000 Academic Press.

Potential of ion chromatography coupled to isotope ratio mass spectrometry via a liquid interface for beverages authentication.

PubMed

Guyon, Francois; Gaillard, Laetitia; Brault, Audrey; Gaultier, Nicolas; Salagoïty, Marie-Hélène; Médina, Bernard

2013-12-27

New tools for the determination of characteristic parameters for food authentication are requested to prevent food adulteration from which health concerns, unfair competition could follow. A new coupling in the area of compound-specific carbon 13 isotope ratio (δ(13)C) analysis was developed to simultaneously quantify δ(13)C values of sugars and organic acids. The coupling of ion chromatography (IC) together with isotope ratio mass spectrometry (IRMS) can be achieved using a liquid interface allowing a chemical oxidation (co) of organic matter. Synthetic solutions containing 1 polyol (glycerol), 3 carbohydrates (sucrose, glucose and fructose) and 12 organic acids (gluconic, lactic, malic, tartaric, oxalic, fumaric, citric and isocitric) were used to optimize chromatographic conditions (concentration gradient and 3 types of column) and the studied isotopic range (-32.28 to -10.65‰) corresponds to the values found in food products. Optimum chromatographic conditions are found using an IonPac AS15, an elution flow rate of 0.3mLmin(-1) and a linear concentration gradient from 2 to 76mM (rate 21mMmin(-1)). Comparison between δ(13)C value individually obtained for each compound with the coupling IRMS and elemental analyzer, EA-IRMS, and the ones measured on the mixture of compounds by IC-co-IRMS does not reveal any isotope fractionation. Thus, under these experimental conditions, IC-co-IRMS results are accurate and reproducible. This new coupling was tested on two food matrices, an orange juice and a sweet wine. Some optimization is necessary as the concentration range between sugars and organic acids is too large: an increase in the filament intensity of the IRMS is necessary to simultaneously detect the two compound families. These first attempts confirm the good results obtained on synthetic solutions and the strong potential of the coupling IC-co-IRMS in food authentication area. Copyright © 2013 Elsevier B.V. All rights reserved.

Gateways to clinical trials.

PubMed

Bayes, M; Rabasseda, X; Prous, J R

2005-10-01

Gateways to Clinical Trials is a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: (-)-Epigallocatechin gallate, (Z)-4-hydroxytamoxifen; Ad.muIFN-beta AD-237, adalimumab, adefovir dipivoxil, agalsidase alfa, alemtuzumab, almotriptan, ALVAC vCP1452, alvimopan hydrate, ambrisentan, anakinra, anti-IFN-gamma MAb; Bimatoprost, BMS-188797, BMS-214662, bortezomib, bosentan, bovine lactoferrin; Caffeine, canertinib dihydrochloride, canfosfamide hydrochloride, cannabidiol, caspofungin acetate, cetuximab, cH36, ChimeriVax-JE, ciclesonide, cilansetron, cinacalcet hydrochloride, clopidogrel, CpG-7909, Cypher; Daptomycin, darbepoetin alfa, darifenacin hydrobromide, decitabine, denufosol tetrasodium, Dexamet, diindolemethane, drotrecogin alfa (activated), duloxetine hydrochloride, DX-9065a; E-7010, edaravone, efalizumab, eicosapentaenoic acid/docosahexaenoic acid, elacridar, eletriptan, emtricitabine, epratuzumab, erlotinib hydrochloride, ertapenem sodium, eszopiclone, everolimus, ezetimibe; Fludarabine, fondaparinux sodium; gamma-Hydroxybutyrate sodium, gavestinel sodium, gefitinib, granisetron-Biochronomer; Human Albumin, human insulin; Imatinib mesylate, indiplon, interleukin-2 XL, isatoribine, ISS-1018, i.v. gamma-globulin, ivabradine hydrochloride, ixabepilone; Lanthanum carbonate, L-arginine hydrochloride, liposomal doxorubicin, LY-450139; Magnesium sulfate, melatonin, motexafin gadolinium, mycophenolic acid sodium salt; Natalizumab, nesiritide, niacin/lovastatin; OGX-011, olmesartan medoxomil, omalizumab, ospemifene; PACAP38, panitumumab, parathyroid hormone (human recombinant), parecoxib sodium, patupilone, pegfilgrastim, peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, pemetrexed disodium, pimecrolimus, pirfenidone, posaconazole, prasterone, pregabalin; R-112, ramelteon, ranolazine, rasagiline mesilate, rebimastat, roflumilast, rosuvastatin calcium, rotigotine hydrochloride, rupatadine fumarate; S-3013, S-3304, semustine, sitaxsentan sodium, St. John's Wort extract; Tadalafil, tamoxifen, Taxus, Tc-99m-EDDA-HYNIC-TOC, TH-9507, tiotropium bromide, tipifarnib, tocilizumab, tolvaptan, torcetrapib, TR-14035, tramadol hydrochloride/acetaminophen, treprostinil diethanolamine, troglitazone, troxacitabine; Valdecoxib, valganciclovir hydrochloride, vandetanib, vardenafil hydrochloride hydrate, VAS-991, veglin, vinflunine, voriconazole; White sweet potato extract; Ximelagatran. (c) 2005 Prous Science. All rights reserved.

Phenotypic and Genotypic Features of a Salmonella Heidelberg Strain Isolated in Broilers in Brazil and Their Possible Association to Antibiotics and Short-Chain Organic Acids Resistance and Susceptibility

PubMed Central

Santin, Elizabeth; Hayashi, Ricardo Mitsuo; Wammes, Jessica Caroline; Gonzalez-Esquerra, Ricardo; Carazzolle, Marcelo Falsarella; Freire, Caio César de Melo; Monzani, Paulo Sérgio; da Cunha, Anderson Ferreira

2017-01-01

Salmonella enterica serovar Heidelberg is a human pathogen also found in broilers. A strain (UFPR1) has been associated with field reports of resistance to short-chain organic acids (SCOA) in broilers in the South of Brazil, but was susceptible to a Bacillus subtilis-based probiotic added in feed in a related study. This work aimed to (i) report clinical symptoms caused by SH UFPR1 in broilers, (ii) study its susceptibility to some antibiotics in vitro, and (iii) SCOA in vivo; and (iv) relate these phenotypic observations with its genome characteristics. Two in vivo trials used 1-day-old chicks housed for 21 days in 8 sterilized isolated negative pressure rooms with 4 battery cages of 12 birds each. Birds were challenged or not with 107 CFU/bird of SH UFPR1 orally and exposed or not to SCOA in a 2 × 2 factorial design. Zootechnical parameters were unaffected (P > 0.05), no clinical signs were observed, and few cecal and hepatic histologic and immune-related alterations were seen, in birds challenged with SH. Formic and propionic acids added together in drinking water, fumaric and benzoic acid in feed (Trial 1), and coated calcium butyrate in feed (Trial 2) did not reduce the SH isolation frequencies seen in cecum and liver in broilers after SH challenge (P > 0.05). SH UFPR1 was susceptible to amikacin, amoxicillin + clavulanate, ceftiofur, cephalexin, doxycycline and oxytetracycline; and mildly susceptible to ampicillin + sulbactam, cephalothin, ciprofloxacin, enrofloxacin, and gentamycin in an in vitro minimum inhibitory concentration model using Mueller–Hinton agar. The whole genome of SH UFPR1 was sequenced and consisted of a circular chromosome, spanning 4,760,321 bp with 52.18% of GC-content encoding 84 tRNA, 22 rRNA, and 4,427 protein-coding genes. The comparison between SH UFPR1 genome and a multidrug-resistant SL476 strain revealed 11 missing genomic fragments and 5 insertions related to bgt, bgr, and rpoS genes. The deleted genes codify proteins associated with cell cycle regulation, virulence, drug resistance, cellular adhesion, and salt efflux which collectively reveal key aspects of the evolution and adaptation of SH strains such as organic acids resistance and antibiotic sensitivity and provide information relevant to the control of SH in poultry. PMID:29164140

Synthesis of improved polyester resins

NASA Technical Reports Server (NTRS)

Mcleod, A. H.; Delano, C. B.

1979-01-01

Eighteen aromatic unsaturated polyester prepolymers prepared by a modified interfacial condensation technique were investigated for their solubility in vinyl monomers and ability to provide high char yield forming unsaturated polyester resins. The best resin system contained a polyester prepolymer of phthalic, fumaric and diphenic acids reacted with 2,7-naphthalene diol and 9,9-bis(4-hydroxyphenyl)fluorene. This prepolymer is very soluble in styrene, divinyl benzene, triallyl cyanurate, diallyl isophthalate and methylvinylpyridine. It provided anaerobic char yields as high as 41 percent at 800 C. The combination of good solubility and char yield represents a significant improvement over state-of-the-art unsaturated polyester resins. The majority of the other prepolymers had only low or no solubility in vinyl monomers. Graphite composites from this prepolymer with styrene were investigated. The cause for the observed low shear strengths of the composites was not determined, however 12-week aging of the composites at 82 C showed that essentially no changes in the composites had occurred.

Production, purification and detergent exchange of isotopically labeled Bacillussubtilis cytochrome b₅₅₈ (SdhC).

PubMed

Baureder, Michael; Hederstedt, Lars

2011-11-01

Cytochrome b₅₅₈ of the gram-positive bacterium Bacillussubtilis is the membrane anchor subunit of the succinate:quinone oxidoreductase of the citric acid cycle. The cytochrome consists of the SdhC polypeptide (202 residues) and two protoheme IX groups that function in transmembrane electron transfer to menaquinone. The general structure of the cytochrome is known from extensive experimental studies and by comparison to Wolinellasuccinogenes fumarate reductase for which the X-ray crystal structure has been determined. Solution state NMR can potentially be used to identify the quinone binding site(s) and study, e.g. redox-linked, dynamics of cytochrome b₅₅₈. In this work we present an efficient procedure for the isolation of preparative amounts of isotopically labeled B. subtilis cytochrome b₅₅₈ produced in Escherichia coli. We have also evaluated several detergents suitable for NMR for their effectiveness in maintaining the cytochrome solubilized and intact for days at room temperature. Copyright © 2011 Elsevier Inc. All rights reserved.

Desulfuromonas thiophila sp. nov., a new obligately sulfur-reducing bacterium from anoxic freshwater sediment.

PubMed

Finster, K; Coates, J D; Liesack, W; Pfennig, N

1997-07-01

A mesophilic, acetate-oxidizing, sulfur-reducing bacterium, strain NZ27T, was isolated from anoxic mud from a freshwater sulfur spring. The cells were ovoid, motile, and gram negative. In addition to acetate, the strain oxidized pyruvate, succinate, and fumarate. Sulfur flower could be replaced by polysulfide as an electron acceptor. Ferric nitrilotriacetic acid was reduced in the presence of pyruvate; however, this reduction did not sustain growth. These phenotypic characteristics suggested that strain NZ27T is affiliated with the genus Desulfuromonas. A phylogenetic analysis based on the results of comparative 16S ribosomal DNA sequencing confirmed that strain NZ27T belongs to the Desulfuromonas cluster in the recently proposed family "Geobacteracea" in the delta subgroup of the Proteobacteria. In addition, the results of DNA-DNA hybridization studies confirmed that strain NZ27T represents a novel species. Desulfuromonas thiophila, a name tentatively used in previous publication, is the name proposed for strain NZ27T in this paper.

Desulfuromonas thiophila sp. nov., a new obligately sulfur-reducing bacterium from anoxic freshwater sediment

USGS Publications Warehouse

Finster, K.; Coates, J.D.; Liesack, W.; Pfennig, N.

1997-01-01

A mesophilic, acetate-oxidizing, sulfur-reducing bacterium, strain NZ27(T), was isolated from anoxic mud from a freshwater sulfur spring. The cells were ovoid, motile, and gram negative. In addition to acetate, the strain oxidized pyruvate, succinate, and fumarate. Sulfur flower could be replaced by polysulfide as an electron acceptor. Ferric nitrilotriacetic acid was reduced in the presence of pyruvate; however, this reduction did not sustain growth. These phenotypic characteristics suggested that strain NZ27(T) is affiliated with the genus Desulfuromonas. A phylogenetic analysis based on the results of comparative 16S ribosomal DNA sequencing confirmed that strain NZ27(T) belongs to the Desulfuromonas cluster in the recently proposed family 'Geobacteraceae' in the delta subgroup of the Proteobacteria. In addition, the results of DNA-DNA hybridization studies confirmed that strain NZ27(T) represents a novel species. Desulfuromonas thiophila, a name tentatively used in previous publications, is the name proposed for strain NZ27(T) in this paper.

Metabolomics Approach to Investigate Estrogen Receptor-Dependent and Independent Effects of o,p'-DDT in the Uterus and Brain of Immature Mice.

PubMed

Wang, Dezhen; Zhu, Wentao; Wang, Yao; Yan, Jin; Teng, Miaomiao; Miao, Jiyan; Zhou, Zhiqiang

2017-05-10

Previous studies have demonstrated the endocrine disruption of o,p'-DDT. In this study, we used a 1 H NMR based metabolomics approach to investigate the estrogenic effects of o,p'-DDT (300 mg/kg) on the uterus and brain after 3 days of oral gavage administration, and ethynylestradiol (EE, 100 μg/kg) was used as a positive control. A supervised statistical analysis (PLS-DA) indicated that o,p'-DDT exerted both estrogenic receptor-(ER)-dependent and independent effects on the uterus but mainly ER-independent effects on the brain at metabolome levels, which was verified by coexposing with the antiestrogenic ICI 182,780. Four changed metabolites-glycine, choline, fumarate, and phenylalanine-were identified as ER-independent alterations in the uterus, while more metabolites, including γ-aminobutyrate, N-acetyl aspartate, and some amino acids, were disturbed based on the ER-independent mechanism in the brain. Together with biological end points, metabolomics is a promising approach to study potential estrogenic chemicals.

Metabolism of propionate by sheep liver. Interrelations of propionate and glutamate in aged mitochondria

PubMed Central

Smith, R. M.; Osborne-White, W. S.; Russell, G. R.

1965-01-01

1. Low concentrations of l-glutamate were slowly and quantitatively converted into aspartate by aged sheep-liver mitochondria with the loss of C-1 of the glutamate. 2. When propionate was present in addition the rate of conversion of glutamate into aspartate was increased slightly, and the presence of glutamate caused a marked stimulation in the rate at which propionate was metabolized. 3. The stimulatory effect of `sparker' amounts of l-glutamate on propionate metabolism was matched by the effects of α-oxoglutarate, pyruvate, citrate and isocitrate, but not by succinate, fumarate, malate or oxaloacetate. Succinate was stimulatory at higher concentrations, whereas oxaloacetate was inhibitory. 4. When propionate was incubated with l-[1-14C]glutamate in the presence of a large excess of unlabelled carbon dioxide, some labelling of dicarboxylic acids and aspartate occurred, but this was much less than would have been expected from an obligatory transcarboxylation from C-1 of α-oxoglutarate to propionyl-CoA. 5. Possible mechanisms of these effects are discussed. PMID:14340093

Reactive transport model for bioremediation of nitrate using fumarate in groundwater system: verification and field application

NASA Astrophysics Data System (ADS)

Lee, S.; Yeo, I. W.; Yeum, Y.; Kim, Y.

2016-12-01

Previous studies showed that groundwater of rural areas in Korea is often contaminated with nitrate highly exceeding the drinking water standard of 10 mg/L (NO3-N), which poses a major threat in human and livestock health. In-situ bioremediation method has been developed to reduce high nitrate-nitrogen concentration in groundwater using slowly released encapsulated carbon source. Collaborative research of this study revealed that fumarate was found to be a very effective carbon source in terms of cost and nitrate reduction against formate, propionate, and lactate. For reactive transport modeling of the bioremediation of nitrate using fumarate, the BTEX module of RT3D incorporated in GMS, a commercial groundwater modeling software developed by AQUAVEO, was adopted, where BTEX was replaced with fumarate as a carbon source. Column tests were carried out to determine transport and reaction parameters for numerical modeling such as dispersity and first order degradation rate of nitrate by fumarate. The calibration of the numerical model against column tests strongly indicated that nitrate, known to be not reactive in groundwater system, appeared to be retarded due to sorption by fumarate. The calibrated model was tested for field-scale application to the composting facility in Gimje, Korea. The numerical results showed that the model could simulate the nitrate reduction by fumarate in field scale groundwater system. The reactive transport model for nitrate can be used as a tool for optimum design of in-situ nitrate bioremediation system, such as released depth and amount of fumarate and the spacing of wells that encapsulated fumarate is released through.

Low Risk of Proximal Tubular Dysfunction Associated With Emtricitabine-Tenofovir Disoproxil Fumarate Preexposure Prophylaxis in Men and Women.

PubMed

Mugwanya, Kenneth; Baeten, Jared; Celum, Connie; Donnell, Deborah; Nickolas, Thomas; Mugo, Nelly; Branch, Andrea; Tappero, Jordan; Kiarie, James; Ronald, Allan; Yin, Michael; Wyatt, Christina

2016-10-01

Tenofovir disoproxil fumarate (TDF) is associated with proximal tubular dysfunction (tubulopathy) when used in the treatment of human immunodeficiency virus (HIV) infection. We evaluated whether TDF causes tubulopathy when used as HIV preexposure prophylaxis (PrEP) and whether tubulopathy predicts clinically relevant decline (≥25%) in the estimated glomerular filtration rate (eGFR). A subgroup analysis of the Partners PrEP Study, a randomized, placebo-controlled trial of daily oral TDF, alone or with emtricitabine (FTC), in HIV-uninfected African men and women (Clinicaltrials.gov NCT00557245). Tubulopathy was assessed in concurrently obtained urine and serum samples at the 24-month or last on-treatment visit, predefined as ≥2 of the following: tubular proteinuria, euglycemic glycosuria, increased urinary phosphate, and uric acid excretion. Of 1549 persons studied (776 receiving FTC-TDF, 773 receiving placebo), 64% were male, and the median age was 37 years. Over a median 24 months of study-drug exposure, the frequency of tubulopathy was 1.7% for FTC-TDF versus 1.3% for placebo (odds ratio, 1.30; 95% confidence interval, .52-3.33; P = .68); Tubulopathy occurred in 2 of 52 persons (3.8%) with versus 3 of 208 (1.4%) without ≥25% eGFR decline (adjusted odds ratio, 1.39; .10-14.0; P > .99). Daily oral FTC-TDF PrEP was not significantly associated with tubulopathy over the course of 24 months, nor did tubulopathy predict clinically relevant eGFR decline. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Establishment and development of ruminal hydrogenotrophs in methanogen-free lambs.

PubMed

Fonty, Gérard; Joblin, Keith; Chavarot, Michel; Roux, Remy; Naylor, Graham; Michallon, Fabien

2007-10-01

The aim of this work was to determine whether reductive acetogenesis can provide an alternative to methanogenesis in the rumen. Gnotobiotic lambs were inoculated with a functional rumen microbiota lacking methanogens and reared to maturity on a fibrous diet. Lambs with a methanogen-free rumen grew well, and the feed intake and ruminal volatile fatty acid concentrations for lambs lacking ruminal methanogens were lower but not markedly dissimilar from those for conventional lambs reared on the same diet. A high population density (10(7) to 10(8) cells g(-1)) of ruminal acetogens slowly developed in methanogen-free lambs. Sulfate- and fumarate-reducing bacteria were present, but their population densities were highly variable. In methanogen-free lambs, the hydrogen capture from fermentation was low (28 to 46%) in comparison with that in lambs containing ruminal methanogens (>90%). Reductive acetogenesis was not a significant part of ruminal fermentation in conventional lambs but contributed 21 to 25% to the fermentation in methanogen-free meroxenic animals. Ruminal H(2) utilization was lower in lambs lacking ruminal methanogens, but when a methanogen-free lamb was inoculated with a methanogen, the ruminal H(2) utilization was similar to that in conventional lambs. H(2) utilization in lambs containing a normal ruminal microflora was age dependent and increased with the animal age. The animal age effect was less marked in lambs lacking ruminal methanogens. Addition of fumarate to rumen contents from methanogen-free lambs increased H(2) utilization. These findings provide the first evidence from animal studies that reductive acetogens can sustain a functional rumen and replace methanogens as a sink for H(2) in the rumen.

Aniline Is an Inducer, and Not a Precursor, for Indole Derivatives in Rubrivivax benzoatilyticus JA2

PubMed Central

Mohammed, Mujahid; Ch, Sasikala; Ch, Ramana V.

2014-01-01

Rubrivivax benzoatilyticus JA2 and other anoxygenic photosynthetic bacteria produce indole derivatives when exposed to aniline, a xenobiotic compound. Though this phenomenon has been reported previously, the role of aniline in the production of indoles is still a biochemical riddle. The present study aims at understanding the specific role of aniline (as precursor or stimulator) in the production of indoles and elucidating the biochemical pathway of indoles in aniline-exposed cells by using stable isotope approaches. Metabolic profiling revealed tryptophan accumulation only in aniline exposed cells along with indole 3-acetic acid (IAA) and indole 3-aldehyde (IAld), the two major catabolites of tryptophan. Deuterium labelled aniline feeding studies revealed that aniline is not a precursor of indoles in strain JA2. Further, production of indoles only in aniline-exposed cells suggests that aniline is an indoles stimulator. In addition, production of indoles depended on the presence of a carbon source, and production enhanced when carbon sources were added to the culture. Isotope labelled fumarate feeding identified, fumarate as the precursor of indole, indicating de novo synthesis of indoles. Glyphosate (shikimate pathway inhibitor) inhibited the indoles production, accumulation of tryptophan, IAA and IAld indicating that indoles synthesis in strain JA2 occurs via the de novo shikimate pathway. The up-regulation of anthranilate synthase gene and induction of anthranilate synthase activity correlated well with tryptophan production in strain JA2. Induction of tryptophan aminotransferase and tryptophan 2-monooxygenase activities corroborated well with IAA levels, suggesting that tryptophan catabolism occurs simultaneously in aniline exposed cells. Our study demonstrates that aniline (stress) stimulates tryptophan/indoles synthesis via the shikimate pathway by possibly modulating the metabolic pathway. PMID:24533057

Aniline is an inducer, and not a precursor, for indole derivatives in Rubrivivax benzoatilyticus JA2.

PubMed

Mujahid, Mohammed; Sasikala, Ch; Ramana, Ch V

2014-01-01

Rubrivivax benzoatilyticus JA2 and other anoxygenic photosynthetic bacteria produce indole derivatives when exposed to aniline, a xenobiotic compound. Though this phenomenon has been reported previously, the role of aniline in the production of indoles is still a biochemical riddle. The present study aims at understanding the specific role of aniline (as precursor or stimulator) in the production of indoles and elucidating the biochemical pathway of indoles in aniline-exposed cells by using stable isotope approaches. Metabolic profiling revealed tryptophan accumulation only in aniline exposed cells along with indole 3-acetic acid (IAA) and indole 3-aldehyde (IAld), the two major catabolites of tryptophan. Deuterium labelled aniline feeding studies revealed that aniline is not a precursor of indoles in strain JA2. Further, production of indoles only in aniline-exposed cells suggests that aniline is an indoles stimulator. In addition, production of indoles depended on the presence of a carbon source, and production enhanced when carbon sources were added to the culture. Isotope labelled fumarate feeding identified, fumarate as the precursor of indole, indicating de novo synthesis of indoles. Glyphosate (shikimate pathway inhibitor) inhibited the indoles production, accumulation of tryptophan, IAA and IAld indicating that indoles synthesis in strain JA2 occurs via the de novo shikimate pathway. The up-regulation of anthranilate synthase gene and induction of anthranilate synthase activity correlated well with tryptophan production in strain JA2. Induction of tryptophan aminotransferase and tryptophan 2-monooxygenase activities corroborated well with IAA levels, suggesting that tryptophan catabolism occurs simultaneously in aniline exposed cells. Our study demonstrates that aniline (stress) stimulates tryptophan/indoles synthesis via the shikimate pathway by possibly modulating the metabolic pathway.

Isolation and characterization of the stage-specific cytochrome b small subunit (CybS) of Ascaris suum complex II from the aerobic respiratory chain of larval mitochondria.

PubMed

Amino, Hisako; Osanai, Arihiro; Miyadera, Hiroko; Shinjyo, Noriko; Tomitsuka, Eriko; Taka, Hikari; Mineki, Reiko; Murayama, Kimie; Takamiya, Shinzaburo; Aoki, Takashi; Miyoshi, Hideto; Sakamoto, Kimitoshi; Kojima, Somei; Kita, Kiyoshi

2003-05-01

We recently reported that Ascaris suum mitochondria express stage-specific isoforms of complex II: the flavoprotein subunit and the small subunit of cytochrome b (CybS) of the larval complex II differ from those of adult enzyme, while two complex IIs share a common iron-sulfur cluster subunit (Ip). In the present study, A. suum larval complex II was highly purified to characterize the larval cytochrome b subunits in more detail. Peptide mass fingerprinting and N-terminal amino acid sequencing showed that the larval and adult cytochrome b (CybL) proteins are identical. In contrast, cDNA sequences revealed that the small subunit of larval cytochrome b (CybS(L)) is distinct from the adult CybS (CybS(A)). Furthermore, Northern analysis and immunoblotting showed stage-specific expression of CybS(L) and CybS(A) in larval and adult mitochondria, respectively. Enzymatic assays revealed that the ratio of rhodoquinol-fumarate reductase (RQFR) to succinate-ubiquinone reductase (SQR) activities and the K(m) values for quinones are almost identical for the adult and larval complex IIs, but that the fumarate reductase (FRD) activity is higher for the adult form than for the larval form. These results indicate that the adult and larval A. suum complex IIs have different properties than the complex II of the mammalian host and that the larval complex II is able to function as a RQFR. Such RQFR activity of the larval complex II would be essential for rapid adaptation to the dramatic change of oxygen availability during infection of the host.

Sulfurospirillum arcachonense sp. nov., a new microaerophilic sulfur-reducing bacterium.

PubMed

Finster, K; Liesack, W; Tindall, B J

1997-10-01

The isolation of a new motile, gram-negative, heterotrophic, sulfur-reducing, microaerophilic, vibrioid bacterium, strain F1F6, from oxidized marine surface sediment (Arcachon Bay, French Atlantic coast) is described. Hydrogen (with acetate as the carbon source), formate (with acetate as the carbon source), pyruvate, lactate, alpha-ketoglutarate, glutarate, glutamate, and yeast extract supported growth with elemental sulfur under anaerobic conditions. Apart from H2 and formate, the oxidation of the substrates was incomplete. Microaerophilic growth was supported with hydrogen (acetate as the carbon source), formate (acetate as the carbon source), acetate, propionate, pyruvate, lactate, alpha-ketoglutarate, glutamate, yeast extract, fumarate, succinate, malate, citrate, and alanine. The isolate grew fermentatively with fumarate, succinate being the only organic product. Elemental sulfur and oxygen were the only electron acceptors used. Vitamins or amino acids were not required. The isolate was oxidase, catalase, and urease positive. Comparative 16S rDNA sequence analysis revealed a tight cluster consisting of the validly described species Sulfurospirillum deleyianum and the strains SES-3 and CCUG 13942 as the closest relatives of strain F1F6 (level of sequence similarity, 91.7 to 92.4%). Together with strain F1F6, these organisms form a novel lineage within the epsilon subclass of proteobacteria clearly separated from the described species of the genera Arcobacter, Campylobacter, Wolinella, and Helicobacter. Due to the phenotypic characteristics shared by strain F1F6 and S. deleyianum and considering their phylogenetic relationship, we propose the inclusion of strain F1F6 in the genus Sulfurospirillum, namely, as S. arcachonense sp. nov. Based on the results of this study, an emended description of the genus Sulfurospirillum is given.

Isolation and characterization of Sulfurospirillum carboxydovorans sp. nov., a new microaerophilic carbon monoxide oxidizing epsilon Proteobacterium.

PubMed

Jensen, Anders; Finster, Kai

2005-05-01

A new microaerophilic, Gram-negative, motile, 2-3 microm long and 0.3 microm wide, vibrioid to spirillum-shaped, CO oxidizing bacterium, designated strain MV, isolated from marine sediment (The North Sea) is described. Strain MV was able to couple the oxidation of CO to the reduction of elemental sulphur, DMSO and thiosulphate. Growth occurred with up to 100% (v/v) CO in the headspace. Acetate was needed as carbon source. No growth on CO was observed with nitrate and selenate as electron acceptor. Sulphite, elemental sulphur, DMSO, thiosulphate, nitrate, nitrite, perchloroethylene, arsenate and selenate were used as electron acceptors with pyruvate as energy and carbon source. Microaerophilic growth was observed. In non-agitated cultures growth occurred at atmospheric oxygen concentrations in the headspace. Hydrogen (with acetate as carbon source), formate (with acetate as carbon source), pyruvate, lactate, succinate, fumarate, malate alpha-ketoglutaric acid, aspartate and yeast extract (1% (w/v)) supported growth with nitrate as electron acceptor. Fumarate and malate were fermented. Vitamins were not required for growth. The strain was cytochrome C oxidase and catalase positive. The DNA mol G+C content was 30.5%. 16S rRNA gene sequence comparison showed that strain MV grouped within the genus Sulfurospirillum with Sulfurospirillum arcachonense (sequence similarity 98.3%) as closest relative. The relative DNA-DNA relatedness between strain MV and S. arcachonense was 33.1%. Based on a detailed phenotypic and phylogenetic analysis, inclusion of strain MV in the genus Sulfurospirillum as a well separated new species is proposed. As species name we propose Sulfurospirillum carboxydovorans. The type strain is strain MV (ATCC BAA-937 = DSM 16295, GenBank accession number: AY740528).

Changes in renal function associated with oral emtricitabine/tenofovir disoproxil fumarate use for HIV pre-exposure prophylaxis

PubMed Central

Solomon, Marc M.; Lama, Javier R.; Glidden, David V.; Mulligan, Kathleen; McMahan, Vanessa; Liu, Albert Y.; Guanira, Juan Vicente; Veloso, Valdilea G.; Mayer, Kenneth H.; Chariyalertsak, Suwat; Schechter, Mauro; Bekker, Linda-Gail; Kallás, Esper Georges; Burns, David N.; Grant, Robert M.

2014-01-01

Objective: Tenofovir disoproxil fumarate (TDF) pre-exposure prophylaxis decreases sexual acquisition of HIV infection. We sought to evaluate the renal safety of TDF in HIV-uninfected persons. Design and methods: The Iniciativa Profilaxis Pre-Exposición (iPrEx) study randomly assigned 2499 HIV-seronegative men and transgender women who have sex with men (MSM) to receive oral daily TDF coformulated with emtricitabine (FTC/TDF) or placebo. Serum creatinine and phosphorus during randomized treatment and after discontinuation were measured, and creatinine clearance (CrCl) was estimated by the Cockcroft–Gault equation. Indicators of proximal renal tubulopathy (fractional excretion of phosphorus and uric acid, urine protein, and glucose) were measured in a substudy. Results: There was a small but statistically significant decrease in CrCl from baseline in the active arm, compared to placebo, which was first observed at week 4 (mean change: −2.4 vs. −1.1 ml/min; P = 0.02), persisted through the last on-treatment visit (mean change: +0.3 vs. +1.8 ml/min; P = 0.02), and resolved after stopping pre-exposure prophylaxis (mean change: −0.1 vs. 0.0 ml/min; P = 0.83). The effect was confirmed when stratifying by drug detection. The effect of FTC/TDF on CrCl did not vary by race, age, or history of hypertension. There was no difference in serum phosphate trends between the treatment arms. In the substudy, two participants receiving placebo had indicators of tubulopathy. Conclusions: In HIV-seronegative MSM, randomization to FTC/TDF was associated with a very mild nonprogressive decrease in CrCl that was reversible and managed with routine serum creatinine monitoring. PMID:24499951

Changes in renal function associated with oral emtricitabine/tenofovir disoproxil fumarate use for HIV pre-exposure prophylaxis.

PubMed

Solomon, Marc M; Lama, Javier R; Glidden, David V; Mulligan, Kathleen; McMahan, Vanessa; Liu, Albert Y; Guanira, Juan Vicente; Veloso, Valdilea G; Mayer, Kenneth H; Chariyalertsak, Suwat; Schechter, Mauro; Bekker, Linda-Gail; Kallás, Esper Georges; Burns, David N; Grant, Robert M

2014-03-27

Tenofovir disoproxil fumarate (TDF) pre-exposure prophylaxis decreases sexual acquisition of HIV infection. We sought to evaluate the renal safety of TDF in HIV-uninfected persons. The Iniciativa Profilaxis Pre-Exposición (iPrEx) study randomly assigned 2499 HIV-seronegative men and transgender women who have sex with men (MSM) to receive oral daily TDF coformulated with emtricitabine (FTC/TDF) or placebo. Serum creatinine and phosphorus during randomized treatment and after discontinuation were measured, and creatinine clearance (CrCl) was estimated by the Cockcroft-Gault equation. Indicators of proximal renal tubulopathy (fractional excretion of phosphorus and uric acid, urine protein, and glucose) were measured in a substudy. There was a small but statistically significant decrease in CrCl from baseline in the active arm, compared to placebo, which was first observed at week 4 (mean change: -2.4 vs. -1.1 ml/min; P=0.02), persisted through the last on-treatment visit (mean change: +0.3 vs. +1.8 ml/min; P=0.02), and resolved after stopping pre-exposure prophylaxis (mean change: -0.1 vs. 0.0 ml/min; P=0.83). The effect was confirmed when stratifying by drug detection. The effect of FTC/TDF on CrCl did not vary by race, age, or history of hypertension. There was no difference in serum phosphate trends between the treatment arms. In the substudy, two participants receiving placebo had indicators of tubulopathy. In HIV-seronegative MSM, randomization to FTC/TDF was associated with a very mild nonprogressive decrease in CrCl that was reversible and managed with routine serum creatinine monitoring.

Management Strategies to Facilitate Optimal Outcomes for Patients Treated with Delayed-release Dimethyl Fumarate.

PubMed

Mayer, Lori; Fink, Mary Kay; Sammarco, Carrie; Laing, Lisa

2018-04-01

Delayed-release dimethyl fumarate is an oral disease-modifying therapy that has demonstrated significant efficacy in adults with relapsing-remitting multiple sclerosis. Incidences of flushing and gastrointestinal adverse events are common in the first month after delayed-release dimethyl fumarate initiation. Our objective was to propose mitigation strategies for adverse events related to initiation of delayed-release dimethyl fumarate in the treatment of patients with multiple sclerosis. Studies of individually developed mitigation strategies and chart reviews were evaluated. Those results, as well as mitigation protocols developed at multiple sclerosis care centers, are summarized. Key steps to optimize the effectiveness of delayed-release dimethyl fumarate treatment include education prior to and at the time of delayed-release dimethyl fumarate initiation, initiation dose protocol gradually increasing to maintenance dose, dietary suggestions for co-administration with food, gastrointestinal symptom management with over-the-counter medications, flushing symptom management with aspirin, and temporary dose reduction. Using the available evidence from clinical trials and evaluations of post-marketing studies, these strategies to manage gastrointestinal and flushing symptoms can be effective and helpful to the patient when initiating delayed-release dimethyl fumarate.

Utilization of Electrically Reduced Neutral Red by Actinobacillus succinogenes: Physiological Function of Neutral Red in Membrane-Driven Fumarate Reduction and Energy Conservation

PubMed Central

Park, D. H.; Zeikus, J. G.

1999-01-01

Neutral red (NR) functioned as an electronophore or electron channel enabling either cells or membranes purified from Actinobacillus succinogenes to drive electron transfer and proton translocation by coupling fumarate reduction to succinate production. Electrically reduced NR, unlike methyl or benzyl viologen, bound to cell membranes, was not toxic, and chemically reduced NAD. The cell membrane of A. succinogenes contained high levels of benzyl viologen-linked hydrogenase (12.2 U), fumarate reductase (13.1 U), and diaphorase (109.7 U) activities. Fumarate reductase (24.5 U) displayed the highest activity with NR as the electron carrier, whereas hydrogenase (1.1 U) and diaphorase (0.8 U) did not. Proton translocation by whole cells was dependent on either electrically reduced NR or H2 as the electron donor and on the fumarate concentration. During the growth of Actinobacillus on glucose plus electrically reduced NR in an electrochemical bioreactor system versus on glucose alone, electrically reduced NR enhanced glucose consumption, growth, and succinate production by about 20% while it decreased acetate production by about 50%. The rate of fumarate reduction to succinate by purified membranes was twofold higher with electrically reduced NR than with hydrogen as the electron donor. The addition of 2-(n-heptyl)-4-hydroxyquinoline N-oxide to whole cells or purified membranes inhibited succinate production from H2 plus fumarate but not from electrically reduced NR plus fumarate. Thus, NR appears to replace the function of menaquinone in the fumarate reductase complex, and it enables A. succinogenes to utilize electricity as a significant source of metabolic reducing power. PMID:10198002

Sporosalibacterium faouarense gen. nov., sp. nov., a moderately halophilic bacterium isolated from oil-contaminated soil.

PubMed

Rezgui, Raja; Ben Ali Gam, Zouhaier; Ben Hamed, Said; Fardeau, Marie-Laure; Cayol, Jean-Luc; Maaroufi, Abderrazak; Labat, Marc

2011-01-01

A novel strictly anaerobic, moderately halophilic and mesophilic bacterium, designated strain SOL3f37(T), was isolated from a hydrocarbon-polluted soil surrounding a deep petroleum environment located in south Tunisia. Cells of strain SOL3f37(T) stained Gram-positive and were motile, straight and spore-forming. Strain SOL3f37(T) had a typical Gram-positive-type cell-wall structure, unlike the thick, multilayered cell wall of its closest relative Clostridiisalibacter paucivorans. The major fatty acids were iso-C(15 : 0) (41 %), iso-C(14 : 0) 3-OH and/or iso-C(15 : 0) dimethyl acetal (21.6 %), iso-C(13 : 0) (4.4 %), anteiso-C(15 : 0) (3.9 %) and iso-C(15 : 1) (2.8 %). Strain SOL3f37(T) grew between 20 and 48 °C (optimum 40 °C) and at pH 6.2-8.1 (optimum pH 6.9). Strain SOL3f37(T) required at least 0.5 NaCl l(-1) and grew in the presence of NaCl concentrations up to 150 g l(-1) (optimum 40 g l(-1)). Yeast extract (2 g l(-1)) was required for degradation of pyruvate, fumarate, fructose, glucose and mannitol. Also, strain SOL3f37(T) grew heterotrophically on yeast extract, peptone and bio-Trypticase, but was unable to grow on Casamino acids. Sulfate, thiosulfate, sulfite, elemental sulfur, fumarate, nitrate and nitrite were not reduced. The DNA G+C content was 30.7 mol%. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain SOL3f37(T) was a member of the family Clostridiaceae in the order Clostridiales; strain SOL3f37(T) was related to members of various genera of the family Clostridiaceae. It exhibited highest 16S rRNA gene sequence similarity (93.4 %) with Clostridiisalibacter paucivorans 37HS60(T), 91.8 % with Thermohalobacter berrensis CTT3(T) and 91.7 % with Caloranaerobacter azorensis MV1087(T). On the basis of genotypic, phenotypic and phylogenetic data, it is suggested that strain SOL3f37(T) represents a novel species in a new genus. The name Sporosalibacterium faouarense gen. nov., sp. nov. is proposed, with SOL3f37(T) (=DSM 21485(T) =JCM 15487(T)) as the type strain of Sporosalibacterium faouarense.

21 CFR 520.2455 - Tiamulin.

Code of Federal Regulations, 2011 CFR

2011-04-01

...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...

21 CFR 520.2455 - Tiamulin.

Code of Federal Regulations, 2014 CFR

2014-04-01

...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...

21 CFR 520.2455 - Tiamulin.

Code of Federal Regulations, 2012 CFR

2012-04-01

...) Each gram of soluble powder contains 450 milligrams (mg) tiamulin hydrogen fumarate. (2) Each milliliter (mL) of solution contains 125 mg (12.5 percent) tiamulin hydrogen fumarate. (3) Each mL of solution contains 123 mg (12.3 percent) tiamulin hydrogen fumarate. (b) Sponsors. See sponsor numbers in...

Gateways to clinical trials.

PubMed

Bayés, M; Rabasseda, X; Prous, J R

2006-10-01

Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issues focuses on the following selection of drugs: (-)-Epigallocatechin gallate, (-)-gossypol, 2-deoxyglucose, 3,4-DAP, 7-monohydroxyethylrutoside; Ad5CMV-p53, adalimumab, adefovir dipivoxil, ADH-1, alemtuzumab, aliskiren fumarate, alvocidib hydrochloride, aminolevulinic acid hydrochloride, aminolevulinic acid methyl ester, amrubicin hydrochloride, AN-152, anakinra, anecortave acetate, antiasthma herbal medicine intervention, AP-12009, AP-23573, apaziquone, aprinocarsen sodium, AR-C126532, AR-H065522, aripiprazole, armodafinil, arzoxifene hydrochloride, atazanavir sulfate, atilmotin, atomoxetine hydrochloride, atorvastatin, avanafil, azimilide hydrochloride; Bevacizumab, biphasic insulin aspart, BMS-214662, BN-83495, bortezomib, bosentan, botulinum toxin type B; Caspofungin acetate, cetuximab, chrysin, ciclesonide, clevudine, clofarabine, clopidogrel, CNF-1010, CNTO-328, CP-751871, CX-717, Cypher; Dapoxetine hydrochloride, darifenacin hydrobromide, dasatinib, deferasirox, dextofisopam, dextromethorphan/quinidine sulfate, diclofenac, dronedarone hydrochloride, drotrecogin alfa (activated), duloxetine hydrochloride, dutasteride; Edaravone, efaproxiral sodium, emtricitabine, entecavir, eplerenone, epratuzumab, erlotinib hydrochloride, escitalopram oxalate, etoricoxib, ezetimibe, ezetimibe/simvastatin; Finrozole, fipamezole hydrochloride, fondaparinux sodium, fulvestrant; Gabapentin enacarbil, gaboxadol, gefitinib, gestodene, ghrelin (human); Human insulin, human papillomavirus vaccine; Imatinib mesylate, immunoglobulin intravenous (human), indiplon, insulin detemir, insulin glargine, insulin glulisine, intranasal insulin, istradefylline, i.v. gamma-globulin, ivabradine hydrochloride, ixabepilone; LA-419, lacosamide, landiolol, lanthanum carbonate, lidocaine/prilocaine, liposomal cisplatin, lutropin alfa; Matuzumab, MBP(82-98), mecasermin, MGCD-0103, MMR-V, morphine hydrochloride, mycophenolic acid sodium salt; Natalizumab, NCX-4016, neridronic acid, nesiritide, nilotinib, NSC-330507; O6-benzylguanine, olanzapine/fluoxetine hydrochloride, omalizumab; Panitumumab, parathyroid hormone (human recombinant), parecoxib sodium, PEG-filgrastim, peginterferon alfa-2a, peginterferon alfa-2b, pegvisomant, pemetrexed disodium, perospirone hydrochloride, pexelizumab, phorbol 12-myristate 13-acetate, pneumococcal 7-valent conjugate vaccine, posaconazole, pramiconazole, prasugrel, pregabalin, prilocaine; rAAV-GAD65, raclopride, rasagiline mesilate, retapamulin, rosuvastatin calcium, rotigotine, rufinamide; SarCNU, SB-743921, SHL-749, sirolimus-eluting stent, sitaxsentan sodium, sorafenib; TachoSil, tadalafil, talampanel, Taxus, tegaserod maleate, telithromycin, telmisartan/hydrochlorothiazide, temsirolimus, tenatoprazole, teriflunomide, tetrathiomolybdate, ticilimumab, timcodar dimesilate, tipifarnib, tirapazamine, TPI, tramiprosate, trifluridine/TPI, trimethoprim; Ularitide, Urocortin 2; Valdecoxib, valganciclovir hydrochloride, valproate magnesium, valspodar, vardenafil hydrochloride hydrate, vitespen, vofopitant hydrochloride, volociximab, vorinostat; Yttrium 90 (90Y) ibritumomab tiuxetan; Ziprasidone hydrochloride, zotarolimus, zotarolimus-eluting stent.

Metabolite Profiling of adh1 Mutant Response to Cold Stress in Arabidopsis

PubMed Central

Song, Yuan; Liu, Lijun; Wei, Yunzhu; Li, Gaopeng; Yue, Xiule; An, Lizhe

2017-01-01

As a result of global warming, vegetation suffers from repeated freeze-thaw cycles caused by more frequent short-term low temperatures induced by hail, snow, or night frost. Therefore, short-term freezing stress of plants should be investigated particularly in light of the current climatic conditions. Alcohol dehydrogenase (ADH) plays a central role in the metabolism of alcohols and aldehydes and it is a key enzyme in anaerobic fermentation. ADH1 responds to plant growth and environmental stress; however, the function of ADH1 in the response to short-term freezing stress remains unknown. Using real-time quantitative fluorescence PCR, the expression level of ADH1 was analyzed at low temperature (4°C). The lethal temperature was calculated based on the electrolyte leakage tests for both ADH1 deletion mutants (adh1) and wild type (WT) plants. To further investigate the relationship between ADH1 and cold tolerance in plants, low-Mr polar metabolite analyses of Arabidopsis adh1 and WT were performed at cold temperatures using gas chromatography-mass spectrometry. This investigation focused on freezing treatments (cold acclimation group: −6°C for 2 h with prior 4°C for 7 d, cold shock group: −6°C for 2 h without cold acclimation) and recovery (23°C for 24 h) with respect to seedling growth at optimum temperature. The experimental results revealed a significant increase in ADH1 expression during low temperature treatment (4°C) and at a higher lethal temperature in adh1 compared to that in the WT. Retention time indices and specific mass fragments were used to monitor 263 variables and annotate 78 identified metabolites. From these analyses, differences in the degree of metabolite accumulation between adh1 and WT were detected, including soluble sugars (e.g., sucrose) and amino acids (e.g., asparagine). In addition, the correlation-based network analysis highlighted some metabolites, e.g., melibiose, fumaric acid, succinic acid, glycolic acid, and xylose, which enhanced connectedness in adh1 network under cold chock. When considered collectively, the results showed that adh1 possessed a metabolic response to freezing stress and ADH1 played an important role in the cold stress response of a plant. These results expands our understanding of the short-term freeze response of ADH1 in plants. PMID:28123394

21 CFR 520.82a - Aminopropazine fumarate tablets.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate tablets. 520.82a Section 520.82a Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES... Aminopropazine fumarate tablets. (a) Specifications. The drug is in tablet form. Each tablet contains...

The decreased growth performance and impaired immune function and structural integrity by dietary iron deficiency or excess are associated with TOR, NF-κB, p38MAPK, Nrf2 and MLCK signaling in head kidney, spleen and skin of grass carp (Ctenopharyngodon idella).

PubMed

Guo, Yan-Lin; Jiang, Wei-Dan; Wu, Pei; Liu, Yang; Zhou, Xiao-Qiu; Kuang, Sheng-Yao; Tang, Ling; Tang, Wu-Neng; Zhang, Yong-An; Feng, Lin

2017-06-01

This study was conducted to investigate the effects of dietary iron on the growth, and immune function and structural integrity in head kidney, spleen and skin as well as the underlying signaling of young grass carp (Ctenopharyngodon idella). Total 630 grass carp (242.32 ± 0.58 g) were fed diets containing graded levels of iron at 12.15 (basal diet), 35.38, 63.47, 86.43, 111.09, 136.37 mg/kg (diets 2-6 were added with ferrous fumarate) and 73.50 mg/kg (diet 7 was added with ferrous sulfate) diet for 60 days. Then, a challenge test was conducted by infection of Aeromonas hydrophila for 14 days. The results firstly showed that compared with optimal iron level, iron deficiency decreased lysozyme (LZ) and acid phosphatase (ACP) activities, complement 3 (C3), C4 and immunoglobulin M (IgM) contents and down-regulated the mRNA levels of antibacterial peptides, anti-inflammatory cytokines, inhibitor of κBα (IκBα), target of rapamycin (TOR) and ribosomal protein S6 kinase 1 (S6K1), whereas up-regulated the mRNA levels of pro-inflammatory cytokines, nuclear factor kappa B (NF-κB) p65, IκB kinases β (IKKβ) and eIF4E-binding protein (4E-BP) in head kidney and spleen of young grass carp (P < 0.05), indicating that iron deficiency impaired immune function in head kidney and spleen of fish. Secondly, iron deficiency down-regulated the mRNA levels of B-cell lymphoma-2 (Bcl-2), myeloid cell leukemia 1 (Mcl-1), and inhibitor of apoptosis protein (IAP), and decreased activities and mRNA levels of antioxidant enzymes, down-regulated the mRNA levels of NF-E2-related factor 2 (Nrf2) and tight junction complexes, and up-regulated mRNA levels of cysteinyl aspartic acid-protease (caspase) -2, -3, -7, -8, -9, apoptotic protease activating factor-1 (Apaf-1), Bcl-2 associated X protein (Bax), Fas ligand (FasL), p38 mitogen-activated protein kinase (p38MAPK), Kelch-like ECH-associating protein (Keap) 1a, Keap1b, claudin-12 and myosin light chain kinase (MLCK), and increased malondialdehyde (MDA), protein carbonyl (PC) and reactive oxygen species (ROS) contents in head kidney and spleen of young grass carp (P < 0.05), indicating that iron deficiency impaired structural integrity in head kidney and spleen of fish. Thirdly, iron deficiency increased skin hemorrhage and lesion morbidity, and impaired immune function and structural integrity in skin of fish. Fourthly, iron excess decreased growth and impaired the immune function and structural integrity in head kidney, spleen and skin of fish. Besides, in young grass carp, based on PWG and ability against skin hemorrhage and lesion, the efficacy of ferrous fumarate relative to ferrous sulfate was 140.32% and 126.48%, respectively, and the iron requirements based on PWG, ability against skin hemorrhage and lesion, ACP activities and MDA contents in head kidney and spleen were estimated to be 75.65, 87.03, 79.74, 78.93, 83.17 and 82.14 mg/kg diet (based on ferrous fumarate), respectively. Copyright © 2017 Elsevier Ltd. All rights reserved.

21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

Code of Federal Regulations, 2012 CFR

2012-04-01

... 21 Food and Drugs 6 2012-04-01 2012-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each tablet... sulfate equivalent to 50 milligrams of neomycin base. (b) Sponsor. See No. 000061 in § 510.600(c) of this...

Dielectric Properties of Iron- and Sodium-Fumarate

NASA Astrophysics Data System (ADS)

Skuban, Sonja J.; Džomić, Tanja; Kapor, Agneš

2007-04-01

The behaviour of dielectric parameters such as relative dielectric constant (ɛ'), relative loss factor (V'') and ac conductivity of well known pharmaceutical materials Fe(II)-fumarate and sodium-fumarate have been studied as a function of temperature (range 303 K to 483 K) and frequency (range 0.1 Hz to 100 kHz).

Alkaliphilus crotonatoxidans sp. nov., a strictly anaerobic, crotonate-dismutating bacterium isolated from a methanogenic environment.

PubMed

Cao, Xianhua; Liu, Xiaoli; Dong, Xiuzhu

2003-07-01

Two bacterial strains were isolated from methanogenic butyrate-oxidizing mixed cultures. The cells were straight to slightly curved, gram-positive rods that were motile by means of multiple flagella and formed endospores. Growth was observed in the temperature range 15-45 degrees C (optimum 37 degrees C) and pH range 5.5-9.0 (optimum pH 7.5). The novel isolates were strictly anaerobic chemo-organotrophs capable of utilizing yeast extract, peptone, tryptone and a variety of sugars and organic acids, but not glucose. None of the accessory electron acceptors tested (elemental sulfur, thiosulfate or fumarate) improved growth, except crotonate, which was dismutated to butyrate and acetate. The G + C content of the DNA of one of the isolates, strain B11-2T, was 30.6 mol%. Phylogenetic analysis based on 16S rDNA sequence similarity between strain B11-2T and some other strictly anaerobic, spore-forming bacteria indicated that the novel isolates represented a species in cluster XI within the low-GC gram-positive bacteria, being most closely related to Alkaliphilus transvaalensis JCM 10712T. DNA-DNA relatedness between strain B11-2T and A. transvaalensis JCM 10712T was 21%. On the basis of physiological and molecular properties, and cellular fatty acid and cell wall compositions, the novel isolates are proposed to represent a novel species of the genus Alkaliphilus, for which the name Alkaliphilus crotonatoxidans is proposed (type strain B11-2T=AS 1.2897T=JCM 11672T).

Thermostable and highly specific L-aspartate oxidase from Thermococcus litoralis DSM 5473: cloning, overexpression, and enzymological properties.

PubMed

Washio, Tsubasa; Oikawa, Tadao

2018-01-01

We successfully expressed the L-aspartate oxidase homolog gene (accession no: OCC_06611) of Thermococcus litoralis DSM 5473 in the soluble fraction of Escherichia coli BL21 (DE3) using a pET21b vector with 6X His tag at its C-terminus. The gene product (Tl-LASPO) showed L-aspartate oxidase activity in the presence of FAD in vitro, and this report is the first that details an L-aspartate oxidase derived from a Thermococcus species. The homologs of Tl-LASPO existed mainly in archaea, especially in the genus of Thermococcus, Pyrococcus, Sulfolobus, and Halobacteria. The quaternary structure of Tl-LASPO was homotrimeric with a subunit molecular mass of 52 kDa. The enzyme activity of Tl-LASPO increased with temperature up to 70 °C. Tl-LASPO was active from pH 6.0 to 9.0, and its highest activity was at pH 8.0. Tl-LASPO was stable at 80 °C for 1 h. The highest k cat /K m value was observed in assays at 70 °C. Tl-LASPO was highly specific for L-aspartic acid. Tl-LASPO utilized fumaric acid, 2,6-dichlorophenolindophenol, and ferricyanide in addition to FAD as a cofactor under anaerobic conditions. The absorption spectrum of holo-Tl-LASPO exhibited maxima at 380 and 450 nm. The FAD dissociation constant, K d , of the FAD-Tl-LASPO complex was determined to be 5.9 × 10 -9 M.

Mineralization of aniline using hydroxyl/sulfate radical-based technology in a waterfall reactor.

PubMed

Durán, A; Monteagudo, J M; San Martín, I; Amunategui, F J; Patterson, D A

2017-11-01

The aim of this work is to study the applicability of a UV/H 2 O 2 process intensified with persulfate (PS) as a source of SO 4 - radicals to efficiently mineralize a synthetic effluent containing aniline in a glass reactor arranged in a cascade configuration. pH conditions were studied and the concentration of PS was optimized. The synergism for aniline mineralization between the UV/H 2 O 2 process and the combined UV/H 2 O 2 /PS process was quantified in 10.1%. Aniline degradation reached 100% under the UV/H2O2/PS process after 20 min. Its mineralization is favored under acidic conditions and with the presence of persulfate (optimal conditions: 49% in 90 min; pH = 4; [PS] = 250 ppm). On the contrary, the worst conditions were found at pH = 11, since hydrogen peroxide decomposes and carbonates were formed increasing the scavenging effect. The different mechanisms involved (formulated from intermediates identified by mass spectrometry) confirm these results. Aniline was found to follow a degradation pathway where phenol is the main intermediate. The presence of sulfate radicals increases phenol degradation rate leading to a higher mineralization extent. Benzoquinone was identified as the main aromatic oxidation product of phenol, whereas succinic, 4-oxo-pentanoic, fumaric and oxalic acids were detected as aliphatic oxidation products for both UV/H2O2 and UV/H2O2/PS oxidation processes. Copyright © 2017 Elsevier Ltd. All rights reserved.

Metabolomics approach to reduce the Crabtree effect in continuous culture of Saccharomyces cerevisiae.

PubMed

Imura, Makoto; Iwakiri, Ryo; Bamba, Takeshi; Fukusaki, Eiichiro

2018-04-20

The budding yeast Saccharomyces cerevisiae is an important microorganism for fermentation and the food industry. However, during production, S. cerevisiae commonly uses the ethanol fermentation pathway for glucose utilization if excess sugar is present, even in the presence of sufficient oxygen levels. This aerobic ethanol fermentation, referred to as "the Crabtree effect" is one of the most significant reasons for low cell yield. To weaken the Crabtree effect in fed-batch and continuous culture, sugar flow should be limited. In addition, in continuous culture, the dilution rate must be reduced to avoid washing out cells. However, under such conditions, production speed might be sacrificed. It is difficult to solve this problem with the tradeoff between cell yield and production speed by using conventional tactics. However, a metabolomics approach may be an effective way to search for clues regarding metabolic modulation. Therefore, the purpose of this study was to reduce ethanol production in continuous culture of S. cerevisiae at a higher dilution rate through a metabolomics approach. We used a metabolomics analysis to identify metabolites that were drastically increased or decreased in continuous culture when the dilution rate shifted from biomass formation to ethanol fermentation. The individual addition of two of the selected metabolites, fumaric acid and malic acid, reduced ethanol production at a higher dilution rate. This result demonstrates the potential for using metabolomics approaches to identify metabolites that reduce ethanol production in continuous culture at high dilution rates. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Palaeococcus pacificus sp. nov., an archaeon from deep-sea hydrothermal sediment.

PubMed

Zeng, Xiang; Zhang, Xiaobo; Jiang, Lijing; Alain, Karine; Jebbar, Mohamed; Shao, Zongze

2013-06-01

A hyperthermophilic, anaerobic, piezophilic archaeon (strain DY20341(T)) was isolated from a sediment sample collected from an East Pacific Ocean hydrothermal field (1° 37' S 102° 45' W) at a depth of 2737 m. The cells were irregular cocci, 0.8-1.5 µm in diameter. Growth was observed between 50 and 90 °C (optimum 80 °C), pH 5.0 and 8.0 (optimum pH 7.0), 1% and 7% (w/v) sea salts (Sigma, optimum 3%), 1% and 4% (w/v) NaCl (optimum 3%) and 0.1 and 80 MPa (optimum 30 MPa). The minimum doubling time was 66 min at 30 MPa and 80 °C. The isolate was an obligate chemoorganoheterotroph, capable of utilizing complex organic compounds and organic acids including yeast extract, peptone, tryptone, casein, starch, Casamino acids, citrate, lactate, acetate, fumarate, propanoate and pyruvate for growth. It was strictly anaerobic and facultatively dependent on elemental sulfur or sulfate as electron acceptors, but did not reduce sulfite, thiosulfate, Fe(III) or nitrate. The presence of elemental sulfur enhanced growth. The G+C content of the genomic DNA was 43.6 ± 1 mol%. 16S rRNA gene sequence analysis revealed that the closest relative of the isolated organism was Palaeococcus ferrophilus DMJ(T) (95.7% 16S rRNA gene similarity). On the basis of its physiological properties and phylogenetic analyses, the isolate is considered to represent a novel species, for which the name Palaeococcus pacificus sp. nov. is proposed. The type strain is strain DY20341(T) (=JCM 17873(T)=DSM 24777(T)).

Effect of bicarbonate concentration on aerobic growth of campylobacter in a fumarate-pyruvate medium

USDA-ARS?s Scientific Manuscript database

The purpose of the present study was to examine the effect of sodium bicarbonate (NaHCO3) concentration on aerobic growth of Campylobacter in a fumarate-pyruvate medium. Fumarate-pyruvate broth medium was supplemented with 0.00 to 0.10% NaHCO3 and inoculated with Campylobacter coli 33559, Campyloba...

21 CFR 520.82b - Aminopropazine fumarate, neomycin sulfate tablets.

Code of Federal Regulations, 2010 CFR

2010-04-01

... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Aminopropazine fumarate, neomycin sulfate tablets... Aminopropazine fumarate, neomycin sulfate tablets. (a) Specifications. The drug is in tablet form. Each tablet... administered at a dosage level of one to two tablets per 10 pounds of body weight twice daily for 3 days.1 (3...

Study of Vitamins and Dietary Supplements Containing Ferrous Fumarate and Ferrous Sulfate Using Moessbauer Spectroscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshtrakh, M. I.; Novikov, E. G.; Semionkin, V. A.

2010-07-13

A study of several samples of vitamins and dietary supplements containing ferrous fumarate and ferrous sulfate was carried out using Moessbauer spectroscopy with a high velocity resolution. A presence of ferrous and ferric impurities was revealed. Small variations of Moessbauer hyperfine parameters were found for both ferrous fumarates and ferrous sulfates in the investigated medicines.

GiFRD encodes a protein involved in anaerobic growth in the arbuscular mycorrhizal fungus Glomus intraradices.

PubMed

Sędzielewska, Kinga A; Vetter, Katja; Bode, Rüdiger; Baronian, Keith; Watzke, Roland; Kunze, Gotthard

2012-04-01

Fumarate reductase is a protein involved in the maintenance of redox balance during oxygen deficiency. This enzyme irreversibly catalyzes the reduction of fumarate to succinate and requires flavin cofactors as electron donors. Two examples are the soluble mitochondrial and the cytosolic fumarate reductases of Saccharomyces cerevisiae encoded by the OSM1 and FRDS1 genes, respectively. This work reports the identification and characterization of the gene encoding cytosolic fumarate reductase enzyme in the arbuscular mycorrhizal fungus, Glomus intraradices and the establishment of its physiological role. Using a yeast expression system, we demonstrate that G. intraradices GiFRD encodes a protein that has fumarate reductase activity which can functionally substitute for the S. cerevisiae fumarate reductases. Additionally, we showed that GiFRD transformants are not affected by presence of salt in medium, indicating that the presence of this gene has no effect on yeast behavior under osmotic stress. The fact that GiFRD expression and enzymatic activity was present only in asymbiotic stage confirmed existence of at least one anaerobic metabolic pathway in this phase of fungus life cycle. This suggests that the AMF behave as facultative anaerobes in the asymbiotic stage. Copyright © 2012 Elsevier Inc. All rights reserved.

Fumarate-Mediated Persistence of Escherichia coli against Antibiotics

PubMed Central

Kim, Jun-Seob; Cho, Da-Hyeong; Heo, Paul; Jung, Suk-Chae; Park, Myungseo; Oh, Eun-Joong; Sung, Jaeyun; Kim, Pan-Jun; Lee, Suk-Chan; Lee, Dae-Hee; Lee, Sarah; Lee, Choong Hwan; Shin, Dongwoo

2016-01-01

Bacterial persisters are a small fraction of quiescent cells that survive in the presence of lethal concentrations of antibiotics. They can regrow to give rise to a new population that has the same vulnerability to the antibiotics as did the parental population. Although formation of bacterial persisters in the presence of various antibiotics has been documented, the molecular mechanisms by which these persisters tolerate the antibiotics are still controversial. We found that amplification of the fumarate reductase operon (FRD) in Escherichia coli led to a higher frequency of persister formation. The persister frequency of E. coli was increased when the cells contained elevated levels of intracellular fumarate. Genetic perturbations of the electron transport chain (ETC), a metabolite supplementation assay, and even the toxin-antitoxin-related hipA7 mutation indicated that surplus fumarate markedly elevated the E. coli persister frequency. An E. coli strain lacking succinate dehydrogenase (SDH), thereby showing a lower intracellular fumarate concentration, was killed ∼1,000-fold more effectively than the wild-type strain in the stationary phase. It appears that SDH and FRD represent a paired system that gives rise to and maintains E. coli persisters by producing and utilizing fumarate, respectively. PMID:26810657

Crystallographic studies of the binding of ligands to the dicarboxylate site of Complex II, and the identity of the ligand in the "oxaloacetate-inhibited" state.

PubMed

Huang, Li-Shar; Shen, John T; Wang, Andy C; Berry, Edward A

2006-01-01

Mitochondrial Complex II (succinate:ubiquinone oxidoreductase) is purified in a partially inactivated state, which can be activated by removal of tightly bound oxaloacetate (E.B. Kearney, et al., Biochem. Biophys. Res. Commun. 49 1115-1121). We crystallized Complex II in the presence of oxaloacetate or with the endogenous inhibitor bound. The structure showed a ligand essentially identical to the "malate-like intermediate" found in Shewanella Flavocytochrome c crystallized with fumarate (P. Taylor, et al., Nat. Struct. Biol. 6 1108-1112) Crystallization of Complex II in the presence of excess fumarate also gave the malate-like intermediate or a mixture of that and fumarate at the active site. In order to more conveniently monitor the occupation state of the dicarboxylate site, we are developing a library of UV/Vis spectral effects induced by binding different ligands to the site. Treatment with fumarate results in rapid development of the fumarate difference spectrum and then a very slow conversion into a species spectrally similar to the OAA-liganded complex. Complex II is known to be capable of oxidizing malate to the enol form of oxaloacetate (Y.O. Belikova, et al., Biochim. Biophys. Acta 936 1-9). The observations above suggest it may also be capable of interconverting fumarate and malate. It may be useful for understanding the mechanism and regulation of the enzyme to identify the malate-like intermediate and its pathway of formation from oxaloacetate or fumarate.

Pseudodesulfovibrio hydrargyri sp. nov., a mercury-methylating bacterium isolated from a brackish sediment.

PubMed

Ranchou-Peyruse, Magali; Goñi-Urriza, Marisol; Guignard, Marion; Goas, Marjorie; Ranchou-Peyruse, Anthony; Guyoneaud, Rémy

2018-05-01

The strain BerOc1 T was isolated from brackish sediments contaminated with hydrocarbons and heavy metals. This strain has been used as a model strain of sulfate-reducer to study the biomethylation of mercury. The cells are vibrio-shaped, motile and not sporulated. Phylogeny and physiological traits placed this strain within the genus Pseudodesulfovibrio. Optimal growth was obtained at 30 °C, 1.5 % NaCl and pH 6.0-7.4. The estimated G+C content of the genomic DNA was 62.6 mol%. BerOc1 T used lactate, pyruvate, fumarate, ethanol and hydrogen. Terminal electron acceptors used were sulfate, sulfite, thiosulfate and DMSO. Only pyruvate could be used without a terminal electron acceptor. The major fatty acids were C18 : 0, anteiso-C15 : 0, C16 : 0 and C18 : 1ω7. The name Pseudodesulfovibrio hydrargyri sp. nov. is proposed for the type strain BerOc1 T (DSM 10384 T =JCM 31820 T ).

Malate and Aspartate Increase L-Arginine and Nitric Oxide and Attenuate Hypertension.

PubMed

Hou, Entai; Sun, Na; Zhang, Fuchang; Zhao, Chenyang; Usa, Kristie; Liang, Mingyu; Tian, Zhongmin

2017-05-23

Fumarase catalyzes the interconversion of fumarate and L-malate in the tricarboxylic acid cycle. The Dahl salt-sensitive (SS) rat, a model of salt-sensitive hypertension, exhibits fumarase insufficiencies. To investigate the mechanism mediating the effect of fumarase-related metabolites on hypertension, we considered the pathway in which L-malate can be converted to oxaloacetate, aspartate, argininosuccinate, and L-arginine, the substrate of nitric oxide (NO) synthase. The levels of aspartate, citrulline, L-arginine, and NO were significantly decreased in the kidneys of SS rats compared to salt-insensitive consomic SS.13 BN rats. Knockdown of fumarase in human kidney cells and vascular endothelial cells resulted in decreased levels of malate, aspartate, L-arginine, and NO. Supplementation of aspartate or malate increased renal levels of L-arginine and NO and attenuated hypertension in SS rats. These findings reveal a multi-step metabolic pathway important for hypertension in which malate and aspartate may modulate blood pressure by altering levels of L-arginine and NO. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Synthesis and Characterization of Degradable Bioconjugated Hydrogels with Hyperbranched Multifunctional Crosslinkers

PubMed Central

Pedrón, Sara; Peinado, Carmen; Bosch, Paula; S.Anseth, Kristi

2010-01-01

Hyperbranched poly(ester amide) polymer (Hybrane™ S1200; Mn 1200 g/mol) was functionalized with maleic anhydride (MA) and propylene sulfide, to obtain multifunctional crosslinkers with fumaric and thiol-end groups, S1200MA and S1200SH, respectively. The degree of substitution of maleic acid groups (DS) was controlled by varying the molar ratio of MA to S1200 in the reaction mixture. Hydrogels were obtained by UV crosslinking of functionalized S1200 and poly(ethyleneglycol) diacrylate (PEGDA) in aqueous solutions. Compressive modulus increased with decreasing the S1200/PEG ratio and also depended on the DS of the multifunctional crosslinker (S1200). Also, heparin-based macromonomers together with functionalized hyperbranched polymers were used to construct novel functional hydrogels. The multivalent hyperbranched polymers allowed high crosslinking densities in heparin modified gels while introducing biodegradation sites. Both heparin presence and acrylate/thiol ratio have an impact on degradation profiles and morphologies. Hyperbranched crosslinked hydrogels showed no evidence of cell toxicity. Overall, the multifunctional crosslinkers afford hydrogels with promising properties that suggest that these may be suitable for tissue engineering applications. PMID:20561601

Preparation, Characterization and Performances of Powdered Polycarboxylate Superplasticizer with Bulk Polymerization.

PubMed

Liu, Xiao; Wang, Ziming; Zheng, Yunsheng; Cui, Suping; Lan, Mingzhang; Li, Huiqun; Zhu, Jie; Liang, Xu

2014-08-29

A polycarboxylate superplasticizer (PCE) was synthesized in a non-solvent system with bulk polymerization and then was pulverized into powdered form to achieve a rapid transportation and convenient preparation. PCE synthesized by using isopentenyl polyethylene glycol (TPEG) or isobutenyl polyethylene glycol (IPEG) as a macromonomer exhibited the best fluidities and retaining properties at 80 °C and 75 °C, respectively. Besides, azobisisobutyronitrile (AIBN) was suitable as an initiator, and the fumaric acid was suitable as the third monomer. The test results of ¹H nuclear magnetic resonance (¹H NMR) confirmed the occurrences of polymerization, and the measurement results of molecular weight and distribution showed that PCE molecular weight characteristics were in accordance with their fluidity properties in cement paste. The application performances in cement showed that PCEs with the best paste fluidity retentions had the longest final setting time and the shortest setting time interval, and the PCEs with good fluidity properties can obviously delay the hydration process and lower the hydration heat. Accordingly, this is a novel, energy-saving and economical method to prepare powdered PCE in the field of concrete admixtures.

Preparation, Characterization and Performances of Powdered Polycarboxylate Superplasticizer with Bulk Polymerization

PubMed Central

Liu, Xiao; Wang, Ziming; Zheng, Yunsheng; Cui, Suping; Lan, Mingzhang; Li, Huiqun; Zhu, Jie; Liang, Xu

2014-01-01

A polycarboxylate superplasticizer (PCE) was synthesized in a non-solvent system with bulk polymerization and then was pulverized into powdered form to achieve a rapid transportation and convenient preparation. PCE synthesized by using isopentenyl polyethylene glycol (TPEG) or isobutenyl polyethylene glycol (IPEG) as a macromonomer exhibited the best fluidities and retaining properties at 80 °C and 75 °C, respectively. Besides, azobisisobutyronitrile (AIBN) was suitable as an initiator, and the fumaric acid was suitable as the third monomer. The test results of 1H nuclear magnetic resonance (1H NMR) confirmed the occurrences of polymerization, and the measurement results of molecular weight and distribution showed that PCE molecular weight characteristics were in accordance with their fluidity properties in cement paste. The application performances in cement showed that PCEs with the best paste fluidity retentions had the longest final setting time and the shortest setting time interval, and the PCEs with good fluidity properties can obviously delay the hydration process and lower the hydration heat. Accordingly, this is a novel, energy-saving and economical method to prepare powdered PCE in the field of concrete admixtures. PMID:28788184

Desulfovibrio oceani subsp. oceani sp. nov., subsp. nov. and Desulfovibrio oceani subsp. galateae subsp. nov., novel sulfate-reducing bacteria isolated from the oxygen minimum zone off the coast of Peru.

PubMed

Finster, Kai W; Kjeldsen, Kasper U

2010-03-01

Two deltaproteobacterial sulfate reducers, designated strain I.8.1(T) and I.9.1(T), were isolated from the oxygen minimum zone water column off the coast of Peru at 400 and 500 m water depth. The strains were Gram-negative, vibrio-shaped and motile. Both strains were psychrotolerant, grew optimally at 20 degrees C at pH 7.0-8.0 and at 2.5-3.5% NaCl (w/v). The strains grew by utilizing hydrogen/acetate, C(3-4) fatty acids, amino acids and glycerol as electron acceptors for sulfate reduction. Fumarate, lactate and pyruvate supported fermentative growth. Sulfate, sulfite, thiosulfate and taurin supported growth as electron acceptors. Both strains were catalase-positive and highly oxygen-tolerant, surviving 24 days of exposure to atmospheric concentrations. MK6 was the only respiratory quinone. The most prominent cellular fatty acid was iso-17:1-omega9c (18%) for strain I.8.1(T) and iso-17:0-omega9c (14%) for strain I.9.1(T). The G+C contents of their genomic DNA were 45-46 mol%. Phylogenetic analysis of 16S rRNA and dsrAB gene sequences showed that both strains belong to the genus Desulfovibrio. Desulfovibrio acrylicus DSM 10141(T) and Desulfovibrio marinisediminis JCM 14577(T) represented their closest validly described relatives with pairwise 16S rRNA gene sequence identities of 98-99%. The level of DNA-DNA hybridization between strains I.8.1(T) and I.9.1(T) was 30-38%. The two strains shared 10-26% DNA-DNA relatedness with D. acrylicus. Based on a polyphasic investigation it is proposed that strains I.8.1(T) and I.9.1(T) represent a novel species for which the name Desulfovibrio oceani sp. nov. is proposed with the two subspecies D. oceani subsp. oceani (type strain, I.8.1(T) = DSM 21390(T) = JCM 15970(T)) and D. oceani subsp. galateae (type strain, I.9.1(T) = DSM 21391(T) = JCM 15971(T)).

Mitochondrial fumarate reductase as a target of chemotherapy: from parasites to cancer cells.

PubMed

Sakai, Chika; Tomitsuka, Eriko; Esumi, Hiroyasu; Harada, Shigeharu; Kita, Kiyoshi

2012-05-01

Recent research on respiratory chain of the parasitic helminth, Ascaris suum has shown that the mitochondrial NADH-fumarate reductase system (fumarate respiration), which is composed of complex I (NADH-rhodoquinone reductase), rhodoquinone and complex II (rhodoquinol-fumarate reductase) plays an important role in the anaerobic energy metabolism of adult parasites inhabiting hosts. The enzymes in these parasite-specific pathways are potential target for chemotherapy. We isolated a novel compound, nafuredin, from Aspergillus niger, which inhibits NADH-fumarate reductase in helminth mitochondria at nM order. It competes for the quinone-binding site in complex I and shows high selective toxicity to the helminth enzyme. Moreover, nafuredin exerts anthelmintic activity against Haemonchus contortus in in vivo trials with sheep indicating that mitochondrial complex I is a promising target for chemotherapy. In addition to complex I, complex II is a good target because its catalytic direction is reverse of succinate-ubiquionone reductase in the host complex II. Furthermore, we found atpenin and flutolanil strongly and specifically inhibit mitochondrial complex II. Interestingly, fumarate respiration was found not only in the parasites but also in some types of human cancer cells. Analysis of the mitochondria from the cancer cells identified an anthelminthic as a specific inhibitor of the fumarate respiration. Role of isoforms of human complex II in the hypoxic condition of cancer cells and fetal tissues is a challenge. This article is part of a Special Issue entitled Biochemistry of Mitochondria, Life and Intervention 2010. Copyright © 2011 Elsevier B.V. All rights reserved.

Analysis of mechanisms for memory enhancement using novel and potent 5-HT1A receptor ligands.

PubMed

Pittalà, Valeria; Siracusa, Maria A; Salerno, Loredana; Romeo, Giuseppe; Modica, Maria N; Madjid, Nather; Ogren, Sven Ove

2015-08-01

In light of the involvement of serotonergic 5-HT1A receptors in the mediation of the memory of aversive events, the potent and selective 5-HT1A receptor antagonists, MC18 fumarate and VP08/34 fumarate, were tested in the passive avoidance task (PA), a rodent model of instrumental conditioning. Either alone or in combination with the prototypical agonist 8-OH-DPAT, MC18 fumarate at doses (0.1, 0.3 and 1mg/kg given 15min prior to training) exerted a dose-dependent facilitation of PA memory retention. When administered 15min prior to 8-OH-DPAT (0.3 and 1mg/kg), MC18 fumarate at a dose of 0.3mg/kg, enhanced significantly the impairment of PA retention caused by 8-OH-DPAT (1mg/kg). However, VP08/34 fumarate given at the same doses exerted no statistically effect on PA retention memory. Furthermore, VP08/34 fumarate given 15min prior to 8-OH-DPAT (0.3 and 1mg/kg) only slightly enhanced the PA impairment induced by 8-OH-DPAT. In conclusion, the profile of MC18 fumarate is intriguing since it behaves in a manner which differs from both full receptor antagonists such as NAD-299 or partial receptor agonists. The results also illustrate the importance of subtle receptor interaction and probably ligand efficacy in determining the actions of two almost identical 5-HT1A receptor ligands in cognitive function such as instrumental learning. Copyright © 2015 Elsevier B.V. and ECNP. All rights reserved.

New HIF2α inhibitors: potential implications as therapeutics for advanced pheochromocytomas and paragangliomas.

PubMed

Toledo, Rodrigo Almeida

2017-09-01

Two recent independent studies published in Nature show robust responses of clear cell renal cell carcinoma (ccRCC) cell lines, preclinical ccRCC xenograft models and, remarkably, a patient with progressive ccRCC despite receiving multiple lines of treatment, to the long-awaited, recently developed inhibitors of hypoxia-inducible factor 2-alpha (HIF2α). This commentary published in Endocrine-Related Cancer is based on the recognition of similar molecular drivers in ccRCC and the endocrine neoplasias pheochromocytomas and paragangliomas (PPGLs), ultimately leading to stabilization of HIFs. HIF-stabilizing mutations have been detected in the von Hippel-Lindau (VHL) gene, as well as in other genes, such as succinate dehydrogenase (SDHx), fumarate hydratase (FH) and transcription elongation factor B subunit 1 (TCEB1), as well as the gene that encodes HIF2α itself: EPAS1 HIF2α Importantly, the recent discovery of EPAS1 mutations in PPGLs and the results of comprehensive in vitro and in vivo studies revealing their oncogenic roles characterized a hitherto unknown direct mechanism of HIF2α activation in human cancer. The now available therapeutic opportunity to successfully inhibit HIF2α pharmacologically with PT2385 and PT2399 will certainly spearhead a series of investigations in several types of cancers, including patients with SDHB -related metastatic PPGL for whom limited therapeutic options are currently available. Future studies will determine the efficacy of these promising drugs against the hotspot EPAS1 mutations affecting HIF2α amino acids 529-532 (in PPGLs) and amino acids 533-540 (in erythrocytosis type 4), as well as against HIF2α protein activated by VHL , SDHx and FH mutations in PPGL-derived chromatin cells. © 2017 Society for Endocrinology.

Insulin-releasing action of the novel antidiabetic agent BTS 67 582.

PubMed

McClenaghan, N H; Flatt, P R; Bailey, C J

1998-02-01

1. BTS 67582 (1,1-dimethyl-2-(2-morpholinophenyl)guanidine fumarate) is a novel antidiabetic agent with a short-acting insulin-releasing effect. This study examined its mode of action in the clonal B-cell line BRIN-BD11. 2. BTS 67582 increased insulin release from BRIN-BD11 cells in a concentration-dependent manner (10[-8] to 10[-4] M) at both non-stimulating (1.1 mM) and stimulating (16.7 mM) concentrations of glucose. 3. BTS 67582 (10[-4] M) potentiated the insulin-releasing effect of a depolarizing concentration of K+ (30 mM), whereas the K+ channel openers pinacidil (400 microM) and diazoxide (300 microM) inhibited BTS 67582-induced release. 4. Suppression of Ca+ channel activity with verapamil (20 microM) reduced the insulin-releasing effect of BTS 67582 (10[-4] M). 5. BTS 67582 (10[-4] M) potentiated insulin release induced by amino acids (10 mM), and enhanced the combined stimulant effects of glucose plus either the fatty acid palmitate (10 mM), or agents which raise intracellular cyclic AMP concentrations (25 microM forskolin and 1 mM isobutylmethylxanthine), or the cholinoceptor agonist carbachol (100 microM). 6. Inhibition of glucose-stimulated insulin release by adrenaline or noradrenaline (10 microM) was partially reversed by BTS 67582 (10[-4] M). 7. These data suggest that the insulin-releasing effect of BTS 67582 involves regulation of ATP-sensitive K+ channel activity and Ca2+ influx, and that the drug augments the stimulant effects of nutrient insulin secretagogues and agents which enhance adenylate cyclase and phospholipase C. BTS 67582 may also exert insulin-releasing effects independently of ATP-sensitive K+ channel activity.

Development and validation of an LC-MS/MS method for the quantification of tiamulin, trimethoprim, tylosin, sulfadiazine and sulfamethazine in medicated feed.

PubMed

Patyra, Ewelina; Nebot, Carolina; Gavilán, Rosa Elvira; Cepeda, Alberto; Kwiatek, Krzysztof

2018-05-01

A new multi-compound method for the analysis of veterinary drugs, namely tiamulin, trimethoprim, tylosin, sulfadiazine and sulfamethazine was developed and validated in medicated feeds. After extraction, the samples were centrifuged, diluted in Milli-Q water, filtered and analysed by high performance liquid chromatography coupled to tandem mass spectrometry. The separation of the analytes was performed on a biphenyl column with a gradient of 0.1% formic acid in acetonitrile and 0.1% formic acid in Milli-Q water. Quantitative validation was done in accordance with the guidelines laid down in European Commission Decision 2002/657/EC. Method performances were evaluated by the following parameters: linearity (R 2  < 0.99), precision (repeatability <14% and within-laboratory reproducibility <24%), recovery (73.58-115.21%), sensitivity, limit of detection (LOD), limit of quantification (LOQ), selectivity and expanded measurement uncertainty (k. = 2). The validated method was successfully applied to the 2 medicated feeds obtained from the interlaboratory studies and feed manufactures from Spain in August 2017. In these samples, tiamulin, tylosin and sulfamethazine were detected at the concentration levels declared by the manufacturers. The developed method can therefore be successfully used to routinely control the content and homogeneity of these antibacterial substances in medicated feed. Abbreviations AAFCO - Association of American Feed Control Officials; TYL - tylosin; TIAM - tiamulin fumarate; TRIM - trimethoprim; SDZ - sulfadiazine; SMZ - sulfamethazine; UV - ultraviolet detector; FLD - fluorescence detector; HPLC - high performance liquid chromatography; MS/MS - tandem mass spectrometry; LOD - limit of detection; LOQ - limit of quantification; CV - coefficient of variation; SD - standard deviation; U - uncertainty.

The Role of Glutamine Synthetase and Glutamate Dehydrogenase in Cerebral Ammonia Homeostasis

PubMed Central

Cooper, Arthur J. L.

2012-01-01

In the brain, glutamine synthetase (GS), which is located predominantly in astrocytes, is largely responsible for the removal of both blood-derived and metabolically generated ammonia. Thus, studies with [13N]ammonia have shown that about 25% of blood-derived ammonia is removed in a single pass through the rat brain and that this ammonia is incorporated primarily into glutamine (amide) in astrocytes. Major pathways for cerebral ammonia generation include the glutaminase reaction and the glutamate dehydrogenase (GDH) reaction. The equilibrium position of the GDH-catalyzed reaction in vitro favors reductive amination of α-ketoglutarate at pH 7.4. Nevertheless, only a small amount of label derived from [13N]ammonia in rat brain is incorporated into glutamate and the α-amine of glutamine in vivo. Most likely the cerebral GDH reaction is drawn normally in the direction of glutamate oxidation (ammonia production) by rapid removal of ammonia as glutamine. Linkage of glutamate/α-ketoglutarate-utilizing aminotransferases with the GDH reaction channels excess amino acid nitrogen toward ammonia for glutamine synthesis. At high ammonia levels and/or when GS is inhibited the GDH reaction coupled with glutamate/α-ketoglutarate-linked aminotransferases may, however, promote the flow of ammonia nitrogen toward synthesis of amino acids. Preliminary evidence suggests an important role for the purine nucleotide cycle (PNC) as an additional source of ammonia in neurons (Net reaction: L-Aspartate + GTP + H2O → Fumarate + GDP + Pi + NH3) and in the beat cycle of ependyma cilia. The link of the PNC to aminotransferases and GDH/GS and its role in cerebral nitrogen metabolism under both normal and pathological (e.g. hyperammonemic encephalopathy) conditions should be a productive area for future research. PMID:22618691

Anaerosalibacter bizertensis gen. nov., sp. nov., a halotolerant bacterium isolated from sludge.

PubMed

Rezgui, Raja; Maaroufi, Abderrazak; Fardeau, Marie-Laure; Ben Ali Gam, Zouhaier; Cayol, Jean-Luc; Ben Hamed, Saïd; Labat, Marc

2012-10-01

A strictly anaerobic, halotolerant and thermotolerant strain, designated C5BEL(T), was isolated in north Tunisia from storage tanks holding waste generated by the recycling of discarded motor oils. Cells of strain C5BEL(T) were Gram-stain-positive, motile by laterally inserted flagella, straight, and spore-forming. Their two major fatty acids were iso-C(15 : 0) and iso-C(15 : 0) dimethyl acetal. Growth was observed at temperatures of 25-55 °C (optimum, 40 °C) and at pH 6-9 (optimum, pH 7.5). The salinity range for growth was 0-100 g l(-1) NaCl (optimum, 5 g l(-1)). Yeast extract was required for growth. Strain C5BEL(T) was heterotrophic, able to use glucose, pyruvate, succinate, yeast extract, bio-trypticase and peptone, but unable to grow on Casamino acids. Sulfate, thiosulfate, sulfite, elemental sulfur, fumarate, nitrate and nitrite were not reduced. The DNA G+C content of strain C5BEL(T) was 31.1 mol%. 16S rRNA gene sequence analysis indicated that strain C5BEL(T) was a member of the family Clostridiaceae, class Clostridia, phylum Firmicutes and was most closely related to Sporanaerobacter acetigenes Lup33(T) ( = DSM 13106(T)) (92.4 % similarity). On the basis of 16S rRNA gene sequence comparisons and physiological characteristics, strain C5BEL(T) can be classified as a novel species in a new genus, for which the name Anaerosalibacter bizertensis gen. nov., sp. nov. is proposed. The type strain of the type species is C5BEL(T) ( = DSM 23801(T) = JCM 17239(T)).

Synthesis of Poly(Propylene Fumarate)

PubMed Central

Kasper, F. Kurtis; Tanahashi, Kazuhiro; Fisher, John P.; Mikos, Antonios G.

2010-01-01

This protocol describes the synthesis of 500 – 4000 Da poly(propylene fumarate) by a two-step reaction of diethyl fumarate and propylene glycol through a bis(hydroxypropyl) fumarate diester intermediate. Purified PPF can be covalently crosslinked to form degradable polymer networks, which have been widely explored for biomedical applications. The properties of crosslinked PPF networks depend upon the molecular properties of the constituent polymer, such as the molecular weight. The purity of the reactants and the exclusion of water from the reaction system are of utmost importance in the generation of high-molecular-weight PPF products. Additionally, the reaction time and temperature influence the molecular weight of the PPF product. The expected time required to complete this protocol is 3 d. PMID:19325548

A Na+-coupled C4-dicarboxylate transporter (Asuc_0304) and aerobic growth of Actinobacillus succinogenes on C4-dicarboxylates.

PubMed

Rhie, Mi Na; Yoon, Hyo Eun; Oh, Hye Yun; Zedler, Sandra; Unden, Gottfried; Kim, Ok Bin

2014-07-01

Actinobacillus succinogenes, which is known to produce large amounts of succinate during fermentation of hexoses, was able to grow on C4-dicarboxylates such as fumarate under aerobic and anaerobic conditions. Anaerobic growth on fumarate was stimulated by glycerol and the major product was succinate, indicating the involvement of fumarate respiration similar to succinate production from glucose. The aerobic growth on C4-dicarboxylates and the transport proteins involved were studied. Fumarate was oxidized to acetate. The genome of A. succinogenes encodes six proteins with similarity to secondary C4-dicarboxylate transporters, including transporters of the Dcu (C4-dicarboxylate uptake), DcuC (C4-dicarboxylate uptake C), DASS (divalent anion : sodium symporter) and TDT (tellurite resistance dicarboxylate transporter) family. From the cloned genes, Asuc_0304 of the DASS family protein was able to restore aerobic growth on C4-dicarboxylates in a C4-dicarboxylate-transport-negative Escherichia coli strain. The strain regained succinate or fumarate uptake, which was dependent on the electrochemical proton potential and the presence of Na(+). The transport had an optimum pH ~7, indicating transport of the dianionic C4-dicarboxylates. Transport competition experiments suggested substrate specificity for fumarate and succinate. The transport characteristics for C4-dicarboxylate uptake by cells of aerobically grown A. succinogenes were similar to those of Asuc_0304 expressed in E. coli, suggesting that Asuc_0304 has an important role in aerobic fumarate uptake in A. succinogenes. Asuc_0304 has sequence similarity to bacterial Na(+)-dicarboxylate cotransporters and contains the carboxylate-binding signature. Asuc_0304 was named SdcA (sodium-coupled C4-dicarboxylate transporter from A. succinogenes). © 2014 The Authors.

Osm1 facilitates the transfer of electrons from Erv1 to fumarate in the redox-regulated import pathway in the mitochondrial intermembrane space

PubMed Central

Neal, Sonya E.; Dabir, Deepa V.; Wijaya, Juwina; Boon, Cennyana; Koehler, Carla M.

2017-01-01

Prokaryotes have aerobic and anaerobic electron acceptors for oxidative folding of periplasmic proteins. The mitochondrial intermembrane space has an analogous pathway with the oxidoreductase Mia40 and sulfhydryl oxidase Erv1, termed the mitochondrial intermembrane space assembly (MIA) pathway. The aerobic electron acceptors include oxygen and cytochrome c, but an acceptor that can function under anaerobic conditions has not been identified. Here we show that the fumarate reductase Osm1, which facilitates electron transfer from fumarate to succinate, fills this gap as a new electron acceptor. In addition to microsomes, Osm1 localizes to the mitochondrial intermembrane space and assembles with Erv1 in a complex. In reconstitution studies with reduced Tim13, Mia40, and Erv1, the addition of Osm1 and fumarate completes the disulfide exchange pathway that results in Tim13 oxidation. From in vitro import assays, mitochondria lacking Osm1 display decreased import of MIA substrates, Cmc1 and Tim10. Comparative reconstitution assays support that the Osm1/fumarate couple accepts electrons with similar efficiency to cytochrome c and that the cell has strategies to coordinate expression of the terminal electron acceptors. Thus Osm1/fumarate is a new electron acceptor couple in the mitochondrial intermembrane space that seems to function in both aerobic and anaerobic conditions. PMID:28814504

Evaluation of the binding interaction between bovine serum albumin and dimethyl fumarate, an anti-inflammatory drug by multispectroscopic methods

NASA Astrophysics Data System (ADS)

Jattinagoudar, Laxmi; Meti, Manjunath; Nandibewoor, Sharanappa; Chimatadar, Shivamurti

2016-03-01

The information of the quenching reaction of bovine serum albumin with dimethyl fumarate is obtained by multi-spectroscopic methods. The number of binding sites, n and binding constants, KA were determined at different temperatures. The effect of increasing temperature on Stern-Volmer quenching constants (KD) indicates that a dynamic quenching mechanism is involved in the interaction. The analysis of thermodynamic quantities namely, ∆H° and ∆S° suggested hydrophobic forces playing a major role in the interaction between dimethyl fumarate and bovine serum albumin. The binding site of dimethyl fumarate on bovine serum albumin was determined by displacement studies, using the site probes viz., warfarin, ibuprofen and digitoxin. The determination of magnitude of the distance of approach for molecular interactions between dimethyl fumarate and bovine serum albumin is calculated according to the theory of Förster energy transfer. The CD, 3D fluorescence spectra, synchronous fluorescence measurements and FT-IR spectral results were indicative of the change in secondary structure of the protein. The influence of some of the metal ions on the binding interaction was also studied.

Identification, characterization, and high-performance liquid chromatography quantification of process-related impurities in vonoprazan fumarate.

PubMed

Liu, Lei; Cao, Na; Ma, Xingling; Xiong, Kaihe; Sun, Lili; Zou, Qiaogen

2016-04-01

High-performance liquid chromatography analysis of vonoprazan fumarate, a novel proton pump inhibitor drug revealed six impurities. These were identified by liquid chromatography with mass spectrometry. Further, the structures of the impurities were confirmed by synthesis followed by characterization by mass spectrometry, NMR spectroscopy, and infrared spectroscopy. On the basis of these data and knowledge of the synthetic scheme of vonoprazan fumarate, the previously unknown impurity was identified as 1-[5-(2-fluorophenyl)-1-(pyridin-3-ylsulfonyl)-1H-pyrrol-3-yl]-N-methyldimethylamine, which is a new compound. The possible mechanisms by which these impurities were formed were also discussed. A high-performance liquid chromatography method was optimized in order to separate, selectively detect, and quantify all process-related impurities of vonoprazan fumarate. The presented method has been validated in terms of linearity, limits of detection, and quantification, and response factors and, therefore, is highly suitable for routine analysis of vonoprazan fumarate related substances as well as stability studies. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Studies on biodegradable and crosslinkable poly(castor oil fumarate)/poly(propylene fumarate) composite adhesive as a potential injectable biomaterial.

PubMed

Mitha, M K; Jayabalan, M

2009-12-01

Biodegradable hydroxyl terminated-poly(castor oil fumarate) (HT-PCF) and poly(propylene fumarate) (HT-PPF) resins were synthesized as an injectable and in situ-cross linkable polyester resins for orthopedic applications. An injectable adhesive formulation containing this resin blend, N-vinyl pyrrolidone (NVP), hydroxy apatite, free radical initiator and accelerator was developed. The Composite adhesives containing the ratio of resin blend and NVP, 2.1:1.5, 2.1:1.2 and 2.1:1.0 set fast with tolerable exothermic temperature as a three dimensionally cross linked toughened material. Crosslink density and mechanical properties of the crosslinked composite increase with increase of NVP. The present crosslinked composite has hydrophilic character and cytocompatibility with L929 fibroblast cells.

Dimethyl Fumarate

MedlinePlus

... course of disease where symptoms flare up from time to time) of multiple sclerosis (MS; a condition in which ... day. Take dimethyl fumarate at around the same times every day. Follow the directions on your prescription ...

The synthesis and the spectroscopic, thermal, and structural properties of the M2[(fumarate)Ni(CN)4]·2(1,4-Dioxane) clathrate (M = Co, Ni, Cd and Hg)

NASA Astrophysics Data System (ADS)

Kartal, Zeki; Yavuz, Abdülkerim

2018-03-01

In this study, the clathrates of fumarate-tetracyanonickel-dioxane, given by the formula M2[(fumarate)Ni(CN)4]·2(1,4-Dioxane) (M = Co, Ni, Cd and Hg), have been obtained for the first time through chemical methods. These clathrates have been characterized by elemental, thermal, FT-IR, and FT-Raman spectroscopies. The parameters of structures of clathrates have been determined by X-ray powder diffraction. The thermal behaviors of these clathrates have been also investigated by thermo-gravimetric analysis (TGA), differential thermal analysis (DTA), and derivative thermal gravimetric analysis (DTG) in the range of 20-900 °C. X-ray powder diffraction data have been recorded at ambient temperature in the 2θ range 5-50°. The FT-IR and FT-Raman spectra of clathrates have been recorded in the region of 4000-400 cm-1 and 4000-100 cm-1, respectively. The results of the spectral and thermal analyses of the newly synthesized clathrates of fumarate-tetracyanonickel-dioxane suggest that these clathrates are new examples of the Hofmann-type dioxane clathrates. In our study, the Hofmann-type dioxane clathrates, which are formed by bounding electrons of oxygen-donor atoms of fumarate ion ligand molecule to transition metal atoms, consist of the corrugated |M-Ni(CN)4|∞ polymeric layers, which are held in parallel through the chain of (-M-fumarate-M-).

Cost effectiveness of fingolimod, teriflunomide, dimethyl fumarate and intramuscular interferon-β1a in relapsing-remitting multiple sclerosis.

PubMed

Zhang, Xinke; Hay, Joel W; Niu, Xiaoli

2015-01-01

The aim of the study was to compare the cost effectiveness of fingolimod, teriflunomide, dimethyl fumarate, and intramuscular (IM) interferon (IFN)-β(1a) as first-line therapies in the treatment of patients with relapsing-remitting multiple sclerosis (RRMS). A Markov model was developed to evaluate the cost effectiveness of disease-modifying drugs (DMDs) from a US societal perspective. The time horizon in the base case was 5 years. The primary outcome was incremental net monetary benefit (INMB), and the secondary outcome was incremental cost-effectiveness ratio (ICER). The base case INMB willingness-to-pay (WTP) threshold was assumed to be US$150,000 per quality-adjusted life year (QALY), and the costs were in 2012 US dollars. One-way sensitivity analyses and probabilistic sensitivity analysis were conducted to test the robustness of the model results. Dimethyl fumarate dominated all other therapies over the range of WTPs, from US$0 to US$180,000. Compared with IM IFN-β(1a), at a WTP of US$150,000, INMBs were estimated at US$36,567, US$49,780, and US$80,611 for fingolimod, teriflunomide, and dimethyl fumarate, respectively. The ICER of fingolimod versus teriflunomide was US$3,201,672. One-way sensitivity analyses demonstrated the model results were sensitive to the acquisition costs of DMDs and the time horizon, but in most scenarios, cost-effectiveness rankings remained stable. Probabilistic sensitivity analysis showed that for more than 90% of the simulations, dimethyl fumarate was the optimal therapy across all WTP values. The three oral therapies were favored in the cost-effectiveness analysis. Of the four DMDs, dimethyl fumarate was a dominant therapy to manage RRMS. Apart from dimethyl fumarate, teriflunomide was the most cost-effective therapy compared with IM IFN-β(1a), with an ICER of US$7,115.

Simple chemiluminescence determination of ketotifen using tris(1,10 phenanthroline)ruthenium(II)- Ce(IV) system.

PubMed

Mokhtari, Ali; Ghazaeian, Mehrgan; Maghsoudi, Mahdieh; Keyvanfard, Mohsen; Emami, Iraj

2015-11-01

A new method using chemiluminescence (CL) detection has been developed for the simple determination of ketotifen fumarate (KF). The method is based on the catalytic effect of KF in the CL reaction of tris(1,10 phenanthroline)ruthenium(II), Ru(phen)3 (2+), with Ce(IV) in sulfuric acid medium. The CL response was detected using a lab-made chemiluminometer. Effects of chemical variables were investigated and under optimum conditions, the CL intensity was proportional to the concentration of the drug over the range 0.34-34.00 µg mL(-1) KF. The limit of detection (S/N=3) was 0.09 µg mL(-1). Effects of common ingredients were investigated and the method was applied successfully for determining KF in pharmaceutical formulations and human plasma. The percent of relative standard deviation (n=11) at level of 3.4 µg mL(-1) of KF was 4.6% and the minimum sampling rate was 70 samples per hour. The possible CL mechanism is proposed based on the kinetic characteristic of the CL reaction, CL spectrum, UV-Vis and phosphorescence spectra. Copyright © 2015 John Wiley & Sons, Ltd.

Use of ion chromatography for monitoring microbial spoilage in the fruit juice industry.

PubMed

Trifirò, A; Saccani, G; Gherardi, S; Vicini, E; Spotti, E; Previdi, M P; Ndagijimana, M; Cavalli, S; Reschiotto, C

1997-05-16

Fruit juices and purees are defined as fermentable, but unfermented, products obtained by mechanical processing of fresh fruits. The presence of undesired metabolites derived from microbial growth can arise from the use of unsuitable fruit or from defects in the production line or subsequent contamination. This involves a loss in the overall quality that cannot be resolved by thermal treatment following the start of fermentation. With these considerations, together with microbiological control, the analysis of different metabolites, which can be considered as microbial growth markers, such as alcohols (i.e. ethanol, etc.), acids (i.e. acetic, fumaric, lactic, etc.) is fundamental in order to achieve a better evaluation of product quality. Enzymatic determination and other single-component analytical techniques are often used for the determination of these metabolites. When the microbial spoilage is not well known, this results in a long and cumbersome procedure. A versatile technique that is capable of determining many metabolites in one analysis could be helpful in improving routine quality control. For this purpose, an ion chromatographic technique, such as ion exclusion, for separation, and diode array spectrophotometry and conductivity, for detection, were evaluated. Both different industrial samples and inoculated samples were analyzed.

Non-invasive urinary metabolomic profiling discriminates prostate cancer from benign prostatic hyperplasia.

PubMed

Pérez-Rambla, Clara; Puchades-Carrasco, Leonor; García-Flores, María; Rubio-Briones, José; López-Guerrero, José Antonio; Pineda-Lucena, Antonio

2017-01-01

Prostate cancer (PCa) is one of the most common malignancies in men worldwide. Serum prostate specific antigen (PSA) level has been extensively used as a biomarker to detect PCa. However, PSA is not cancer-specific and various non-malignant conditions, including benign prostatic hyperplasia (BPH), can cause a rise in PSA blood levels, thus leading to many false positive results. In this study, we evaluated the potential of urinary metabolomic profiling for discriminating PCa from BPH. Urine samples from 64 PCa patients and 51 individuals diagnosed with BPH were analysed using 1 H nuclear magnetic resonance ( 1 H-NMR). Comparative analysis of urinary metabolomic profiles was carried out using multivariate and univariate statistical approaches. The urine metabolomic profile of PCa patients is characterised by increased concentrations of branched-chain amino acids (BCAA), glutamate and pseudouridine, and decreased concentrations of glycine, dimethylglycine, fumarate and 4-imidazole-acetate compared with individuals diagnosed with BPH. PCa patients have a specific urinary metabolomic profile. The results of our study underscore the clinical potential of metabolomic profiling to uncover metabolic changes that could be useful to discriminate PCa from BPH in a clinical context.

Phosphine-functionalized NHC Ni(ii) and Ni(0) complexes: synthesis, characterization and catalytic properties.

PubMed

Rull, S G; Rama, R J; Álvarez, E; Fructos, M R; Belderrain, T R; Nicasio, M C

2017-06-13

Two families of nickel complexes bearing chelating diphenylphosphine-functionalized NHC ligands [Ni II (ArNHCPPh 2 )(allyl)]Cl 1a (Ar = Mes); 1b, (Ar = 2,6-iPr 2 -C 6 H 3 ) and [Ni 0 (ArNHCPPh 2 )(alkene)] 2a (Ar = 2,6-iPr 2 -C 6 H 3 , alkene = styrene); 2b (Ar = 2,6-iPr 2 -C 6 H 3 , alkene = diethyl fumarate) have been prepared and fully characterized. VT-NMR experiments in solution reveal that the allyl derivatives 1a-b are stereochemically nonrigid. The solid-state structure of the Ni 0 derivative 2b is also reported. These complexes display interesting catalytic properties in various cross-coupling reactions. The precatalyst [Ni 0 (ArNHCPPh 2 )(styrene)] 2a was found to be the most active system. The bulkiness of the N-substituent on the imidazole ring and the low oxidation state of the metal center in 2a accounted for its enhanced catalytic performance. This system catalyzed effectively the coupling of (hetero)aryl chlorides with a range of nucleophiles including Grignard reagents, boronic acids, secondary amines and indoles.

Fluorescence sensing and photocatalytic properties of a 2D stable and biocompatible Zn(II)-based polymer

NASA Astrophysics Data System (ADS)

Wu, Jian; Li, Bao-Hong; Zhong, Hua-Rui; Qiu, Shuo-Wen; Liang, Yi-Wen; Zhuang, Xiao-Yi; Singh, Amita; Kumar, Abhinav

2018-04-01

A biocompatible metal-organic framework (MOF) [Zn2(TPL)(FA)(OH)(H2O)] (1) (TPL = theophylline and H2FA = fumaric acid) had been chosen which offers an ideal model for the development of fluorescencent chemosensor using simple synthetic protocol. The MOF 1 have been tested as a fluorescent chemosensor against nitro-aromatics (NACs) and it displayed high selectivity for 4-NT over other NACs as evident by the emission spectroscopy. The alleviation in fluorescence intensity of 1 in presence of different NACs have been explained with the help of theoretical calculations which suggested that there is occurrence of both electron and energy transfer processes, in addition to electrostatic interaction between 1 and NACs which may be responsible for the unprecedented selective alleviation in the fluorescence intensity. Also, 1 had been deployed as a photocatalyst for the degradation of methyl violet (MV) and Rhodamine B (Rh B) in aqueous solution under UV irradiation. The photocatalytic results indicated the 1 exhibit 85% photocatalytic efficiency against Rh B in 100 min, while its efficiency against MV was only 50% under the identical experimental conditions. The possible mechanism for the photocatalytic activity has been proposed using density of states (DOS) calculations.

Electron Donors Supporting Growth and Electroactivity of Geobacter sulfurreducens Anode Biofilms

PubMed Central

Speers, Allison M.

2012-01-01

Geobacter bacteria efficiently oxidize acetate into electricity in bioelectrochemical systems, yet the range of fermentation products that support the growth of anode biofilms and electricity production has not been thoroughly investigated. Here, we show that Geobacter sulfurreducens oxidized formate and lactate with electrodes and Fe(III) as terminal electron acceptors, though with reduced efficiency compared to acetate. The structure of the formate and lactate biofilms increased in roughness, and the substratum coverage decreased, to alleviate the metabolic constraints derived from the assimilation of carbon from the substrates. Low levels of acetate promoted formate carbon assimilation and biofilm growth and increased the system's performance to levels comparable to those with acetate only. Lactate carbon assimilation also limited biofilm growth and led to the partial oxidization of lactate to acetate. However, lactate was fully oxidized in the presence of fumarate, which redirected carbon fluxes into the tricarboxylic acid (TCA) cycle, and by acetate-grown biofilms. These results expand the known ranges of electron donors for Geobacter-driven fuel cells and identify microbial constraints that can be targeted to develop better-performing strains and increase the performance of bioelectrochemical systems. PMID:22101036

Relationships between digestive efficiency and metabolomic profiles of serum and intestinal contents in chickens.

PubMed

Beauclercq, Stéphane; Nadal-Desbarats, Lydie; Hennequet-Antier, Christelle; Gabriel, Irène; Tesseraud, Sophie; Calenge, Fanny; Le Bihan-Duval, Elisabeth; Mignon-Grasteau, Sandrine

2018-04-27

The increasing cost of conventional feedstuffs has bolstered interest in genetic selection for digestive efficiency (DE), a component of feed efficiency, assessed by apparent metabolisable energy corrected to zero nitrogen retention (AMEn). However, its measurement is time-consuming and constraining, and its relationship with metabolic efficiency poorly understood. To simplify selection for this trait, we searched for indirect metabolic biomarkers through an analysis of the serum metabolome using nuclear magnetic resonance ( 1 H NMR). A partial least squares (PLS) model including six amino acids and two derivatives from butyrate predicted 59% of AMEn variability. Moreover, to increase our knowledge of the molecular mechanisms controlling DE, we investigated 1 H NMR metabolomes of ileal, caecal, and serum contents by fitting canonical sparse PLS. This analysis revealed strong associations between metabolites and DE. Models based on the ileal, caecal, and serum metabolome respectively explained 77%, 78%, and 74% of the variability of AMEn and its constitutive components (utilisation of starch, lipids, and nitrogen). In our conditions, the metabolites presenting the strongest associations with AMEn were proline in the serum, fumarate in the ileum and glucose in caeca. This study shows that serum metabolomics offers new opportunities to predict chicken DE.

Screening for bioactivity of Mutinus elegans extracts

NASA Astrophysics Data System (ADS)

Gajendiran, A.; Cyriac, RE; Abraham, J.

2017-11-01

Mutinus elegans is a species of fungi that is commonly called as Elegant Stinkhorn. The aim of this study was to screen the crude extracts of the fungus for phytochemical analysis, antimicrobial activity, antioxidant assay and anticancer activity. Extraction of the fungal sample in Soxhlet apparatus was done with n-hexane and methanol as the solvent. Stock solutions of the crude methanol extract were prepared and used for microbiological assay. Thin layer chromatography was performed in order to determine the number of active components in n-hexane, and methanol solvent system for the fungus Mutinus elegans. Further, antioxidant assay was performed using DPPH radical scavenging assay. The fungal sample was then tested for cytotoxicity assay against MG63 osteosarcoma cell lines. The antimicrobial assay of Mutinus elegans extract exhibited activity against five pathogens. The zone of inhibition was measured with respect to standard antibiotics. Gas chromatography and Mass spectrometry (GC/MS analysis), revealed the presence of dibromo-tetradecan-1-ol-acetate, 2-myristynoyl-glycinamide, fumaric acid, and cyclohexylmethyldecyl ester compounds were presented in methanol and n-hexane extract of Mutinus elegans. The present study concludes the presence of bioactive compound in the extract which exhibited antimicrobial and antioxidant activity in Mutinus elegans.

Probing the Low-Barrier Hydrogen Bond in Hydrogen Maleate in the Gas Phase: A Photoelectron Spectroscopy and ab Initio Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woo, Hin-koon; Wang, Xue B.; Wang, Lai S.

2005-12-01

The strength of the low-barrier hydrogen bond in hydrogen maleate in the gas phase was investigated by low-temperature photoelectron spectroscopy and ab initio calculations. Photoelectron spectra of maleic and fumaric acid monoanions (cis-/trans-HO2CCHdCHCO2 -) were obtained at low temperatures and at 193 nm photon energy. Vibrational structure was observed for trans-HO2CCHdCHCO2 - due to the OCO bending modes; however, cis-HO2CCHdCHCO2 - yielded a broad and featureless spectrum. The electron binding energy of cis-HO2CCHdCHCO2 - is about 1 eV blue-shifted relative to trans-HO2CCHdCHCO2 - due to the formation of intramolecular hydrogen bond in the cis-isomer. Theoretical calculations (CCSD(T)/ aug-cc-pVTZ and B3LYP/aug-cc-pVTZ)more » were carried out to estimate the strength of the intramolecular hydrogen bond in cis-HO2CCHdCHCO2 -. Combining experimental and theoretical calculations yields an estimate of 21.5 ( 2.0 kcal/mol for the intramolecular hydrogen bond strength in hydrogen maleate.« less

Gateways to clinical trials.

PubMed

Bayes, M; Rabasseda, X; Prous, J R

2005-01-01

Gateways to Clinical Trials are a guide to the most recent clinical trials in current literature and congresses. The data in the following tables have been retrieved from the Clinical Trials Knowledge Area of Prous Science Integrity, the drug discovery and development portal, http://integrity.prous.com. This issue focuses on the following selection of drugs: (-)-Epigallocatechin gallate; ACP-103, Ad.Egr.TNF.11 D, adalimumab, AF-IL 12, AIDSVAX gp120 B/B, alefacept, alemtuzumab, a-Galactosylceramide, ALVAC vCP 1452, alvimopan hydrate, alvocidib hydrochloride, aminolevulinic acid hydrochloride, aminolevulinic acid methyl ester, anakinra, anidulafungin, antarelix, aprepitant, aripiprazole, arsenic sulfide, asoprisnil, atazanavir sulfate, atomoxetine hydrochloride; Bevacizumab, bimatoprost, BMS-184476, bortezomib, bosentan, botulinum toxin type B, BrachySil, brivudine; Caffeine, calcipotriol/betamethasone dipropionate, cannabidiol, capsaicin for injection, caspofungin acetate, CC-4047, cetuximab, CGP-36742, clofazimine, CpG-7909, Cypher; Darbepoetin alfa, dextromethorphan/quinidine sulfate, dimethylfumarate, dronabinol/cannabidiol, drotrecogin alfa (activated), duloxetine hydrochloride, dutasteride; Ecogramostim, efalizumab, eletriptan, emtricitabine, enfuvirtide, eplerenone, esomeprazole magnesium, estradiol acetate, eszopiclone, etoricoxib, exenatide, ezetimibe, ezetimibe/simvastatin; Fampridine, fondaparinux sodium, fosamprenavir calcium; Gefitinib, GPI-0100; hA 20, HTU-PA, human insulin, HuOKT 3 gamma 1(Ala 234-Ala 235), hyaluronic acid; Icatibant, imatinib mesylate, Indiplon, INKP-100, INKP-102, iodine (I131) tositumomab, istradefylline, IV gamma-globulin, ivabradine hydrochloride, ixabepilone; Lacosamide, landiolol, lanthanum carbonate, lasofoxifene tartrate, LB-80380, lenalidomide, lidocaine/tetracaine, linezolid, liposomal doxorubicin, liposomal vincristine sulfate, lopinavir, lopinavir/ritonavir, lumiracoxib, lurtotecan; Maribavir, morphine glucuronide, MVA-5 T 4; NBI-56418, NCX-4016, nesiritide, nicotine conjugate vaccine, NSC-330507; Oglufanide, omalizumab, oxipurinol; Palifermin, palonosetron hydrochloride, parecoxib sodium, PEG-filgrastim, peginterferon alfa-2a, peginterferon alfa-2b, peginterferon alfa-2b/ribavirin, PEGylated interferon alfacon-1, perospirone hydrochloride, pimecrolimus, pixantrone maleate, plerixafor hydrochloride, PowderJect lidocaine, pradefovir mesylate, prasterone, pregabalin, Prostvac VF, PT-141, PTC-124, pyridoxamine; QS-21, quercetin; R-126638, R-411, ralfinamide, rasagiline mesilate, rF-PSA, RG-2077, rhThrombin, rimonabant hydrochloride, rofecoxib, rosuvastatin calcium, rotigotine hydrochloride, rV-PSA; S-18886, S-303, seocalcitol, SGN-40, sitaxsentan sodium, SPP-301, St. John's Wort extract; Tadalafil, taxus, telithromycin, tenatoprazole, tenofovir disoproxil fumarate, testosterone MDTS, testosterone transdermal patch, tgAAC-09, TH-9507, thioacetazone, tipifarnib, TQ-1011, trabectedin, travoprost, trimethoprim; Valdecoxib, valganciclovir hydrochloride, valopicitabine, voriconazole; Xcellerated T cells. (c) 2005 Prous Science. All rights reserved.

Conversion of the sensor kinase DcuS of Escherichia coli of the DcuB/DcuS sensor complex to the C4 -dicarboxylate responsive form by the transporter DcuB.

PubMed

Wörner, Sebastian; Strecker, Alexander; Monzel, Christian; Zeltner, Matthias; Witan, Julian; Ebert-Jung, Andrea; Unden, Gottfried

2016-12-01

The sensor kinase DcuS of Escherichia coli co-operates under aerobic conditions with the C 4 -dicarboxylate transporter DctA to form the DctA/DcuS sensor complex. Under anaerobic conditions C 4 -dicarboxylate transport in fumarate respiration is catalyzed by C 4 -dicarboxylate/fumarate antiporter DcuB. (i) DcuB interacted with DcuS as demonstrated by a bacterial two-hybrid system (BACTH) and by co-chromatography of the solubilized membrane-proteins (mHPINE assay). (ii) In the DcuB/DcuS complex only DcuS served as the sensor since mutations in the substrate site of DcuS changed substrate specificity of sensing, and substrates maleate or 3-nitropropionate induced DcuS response without affecting the fumarate site of DcuB. (iii) The half-maximal concentration for induction of DcuS by fumarate (1 to 2 mM) and the corresponding K m for transport (50 µM) differ by a factor of 20 to 40. Therefore, the fumarate sites are different in transport and sensing. (iv) Increasing levels of DcuB converted DcuS from the permanent ON (DcuB deficient) state to the fumarate responsive form. Overall, the data show that DcuS and DcuB form a DcuB/DcuS complex representing the C 4 -dicarboxylate responsive form, and that the sensory site of the complex is located in DcuS whereas DcuB is required for converting DcuS to the sensory competent state. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

Osm1 facilitates the transfer of electrons from Erv1 to fumarate in the redox-regulated import pathway in the mitochondrial intermembrane space.

PubMed

Neal, Sonya E; Dabir, Deepa V; Wijaya, Juwina; Boon, Cennyana; Koehler, Carla M

2017-10-15

Prokaryotes have aerobic and anaerobic electron acceptors for oxidative folding of periplasmic proteins. The mitochondrial intermembrane space has an analogous pathway with the oxidoreductase Mia40 and sulfhydryl oxidase Erv1, termed the mitochondrial intermembrane space assembly (MIA) pathway. The aerobic electron acceptors include oxygen and cytochrome c , but an acceptor that can function under anaerobic conditions has not been identified. Here we show that the fumarate reductase Osm1, which facilitates electron transfer from fumarate to succinate, fills this gap as a new electron acceptor. In addition to microsomes, Osm1 localizes to the mitochondrial intermembrane space and assembles with Erv1 in a complex. In reconstitution studies with reduced Tim13, Mia40, and Erv1, the addition of Osm1 and fumarate completes the disulfide exchange pathway that results in Tim13 oxidation. From in vitro import assays, mitochondria lacking Osm1 display decreased import of MIA substrates, Cmc1 and Tim10. Comparative reconstitution assays support that the Osm1/fumarate couple accepts electrons with similar efficiency to cytochrome c and that the cell has strategies to coordinate expression of the terminal electron acceptors. Thus Osm1/fumarate is a new electron acceptor couple in the mitochondrial intermembrane space that seems to function in both aerobic and anaerobic conditions. © 2017 Neal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Pyruvate Formate-Lyase Is Essential for Fumarate-Independent Anaerobic Glycerol Utilization in the Enterococcus faecalis Strain W11

PubMed Central

Ikegami, Yuki

2014-01-01

Although anaerobic glycerol metabolism in Enterococcus faecalis requires exogenous fumarate for NADH oxidation, E. faecalis strain W11 can metabolize glycerol in the absence of oxygen without exogenous fumarate. In this study, metabolic end product analyses and reporter assays probing the expression of enzymes involved in pyruvate metabolism were performed to investigate this fumarate-independent anaerobic metabolism of glycerol in W11. Under aerobic conditions, the metabolic end products of W11 cultured with glycerol were similar to those of W11 cultured with glucose. However, when W11 was cultured anaerobically, most of the glucose was converted to l-lactate, but glycerol was converted to ethanol and formate. During anaerobic culture with glycerol, the expression of the l-lactate dehydrogenase and pyruvate dehydrogenase E1αβ genes in W11 was downregulated, whereas the expression of the pyruvate formate-lyase (Pfl) and aldehyde/alcohol dehydrogenase genes was upregulated. These changes in the expression levels caused the change in the composition of end products. A pflB gene disruptant (Δpfl mutant) of W11 could barely utilize glycerol under anaerobic conditions, but the growth of the Δpfl mutant cultured with either glucose or dihydroxyacetone (DHA) under anaerobic conditions was the same as that of W11. Glucose metabolism and DHA generates one NADH molecule per pyruvate molecule, whereas glycerol metabolism in the dehydrogenation pathway generates two NADH molecules per pyruvate molecule. These findings demonstrate that NADH generated from anaerobic glycerol metabolism in the absence of fumarate is oxidized through the Pfl-ethanol fermentation pathway. Thus, Pfl is essential to avoid the accumulation of excess NADH during fumarate-independent anaerobic glycerol metabolism. PMID:24769696

Catalytically important flavin linked through a phosphoester bond in a eukaryotic fumarate reductase.

PubMed

Serebryakova, Marina V; Bertsova, Yulia V; Sokolov, Svyatoslav S; Kolesnikov, Alexander A; Baykov, Alexander A; Bogachev, Alexander V

2018-06-01

One of the three domains of kinetoplastid NADH:fumarate oxidoreductase (FRD) is homologous to bacterial flavin transferase that catalyzes transfer of FMN residue from FAD to threonine in flavoproteins. Leptomonas pyrrhocoris FRD produced in yeast cells, which lack flavin transferase gene in their proteome, reduces fumarate in the presence of NADH and contains an FMN residue covalently linked to a Ser9 residue. The conserved flavinylation motif of FRD, D 3 (g/s)x(s/t)(s/g)AS 9 , is similar to the Dxx(s/t)gAT motif recognized by flavin transferase in prokaryotic proteins. Ser9 replacement abolished the flavinylation and fumarate reductase activity of FRD. These findings suggest that the flavinylation is important for the activity of FRD and that this post-translational modification is carried out by the own flavin transferase domain. Copyright © 2018 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.

Geometric Restraint Drives On- and Off-pathway Catalysis by the Escherichia coli Menaquinol:Fumarate Reductase*

PubMed Central

Tomasiak, Thomas M.; Archuleta, Tara L.; Andréll, Juni; Luna-Chávez, César; Davis, Tyler A.; Sarwar, Maruf; Ham, Amy J.; McDonald, W. Hayes; Yankovskaya, Victoria; Stern, Harry A.; Johnston, Jeffrey N.; Maklashina, Elena; Cecchini, Gary; Iverson, Tina M.

2011-01-01

Complex II superfamily members catalyze the kinetically difficult interconversion of succinate and fumarate. Due to the relative simplicity of complex II substrates and their similarity to other biologically abundant small molecules, substrate specificity presents a challenge in this system. In order to identify determinants for on-pathway catalysis, off-pathway catalysis, and enzyme inhibition, crystal structures of Escherichia coli menaquinol:fumarate reductase (QFR), a complex II superfamily member, were determined bound to the substrate, fumarate, and the inhibitors oxaloacetate, glutarate, and 3-nitropropionate. Optical difference spectroscopy and computational modeling support a model where QFR twists the dicarboxylate, activating it for catalysis. Orientation of the C2–C3 double bond of activated fumarate parallel to the C(4a)–N5 bond of FAD allows orbital overlap between the substrate and the cofactor, priming the substrate for nucleophilic attack. Off-pathway catalysis, such as the conversion of malate to oxaloacetate or the activation of the toxin 3-nitropropionate may occur when inhibitors bind with a similarly activated bond in the same position. Conversely, inhibitors that do not orient an activatable bond in this manner, such as glutarate and citrate, are excluded from catalysis and act as inhibitors of substrate binding. These results support a model where electronic interactions via geometric constraint and orbital steering underlie catalysis by QFR. PMID:21098488

Budesonide + formoterol fumarate dihydrate for the treatment of asthma.

PubMed

Wolthers, Ole D

2016-01-01

One of the most widely used fixed combinations in asthma management is dry powder budesonide+formoterol fumarate dihydrate which is commercially available as Symbicort Turbuhaler(®) (and generic products), Easyhaler Bufomix(®) and DuoRespSpiromax(®) inhaler. The aim of this paper was to review the fixed dry powder combination of inhaled budesonide+formoterol fumarate dihydrate for asthma treatment in adolescents and adults. A literature search using relevant search terms, reference lists for reviews and meta-analyses was performed. In symptomatic adolescent and adult patients with asthma maintenance and reliever therapy with a single-inhaler fixed combination of dry powder budesonide+formoterol fumarate dihydrate is an evidenced option. The combination treatment is convenient to patients. It reduces the number of exacerbations requiring treatment with oral corticosteroids. In some patients the strategy may also reduce the total intake of inhaled corticosteroids over time. Whether important outcome measures of asthma treatment, such as hospital admission and emergency room visit rates, may be reduced is less well documented since the published studies may have been influenced by publication bias. Non-pharmaceutical company-sponsored research evaluating such measures is needed. There is no evidence for the use of single inhaler fixed combinations of inhaled corticosteroids+long-acting β(2)-agonists in children (<12 years of age), and budesonide+formoterol fumarate dihydrate should not be prescribed to the age group.

Influence of the composition of the cellulolytic flora on the development of hydrogenotrophic microorganisms, hydrogen utilization, and methane production in the rumens of gnotobiotically reared lambs.

PubMed

Chaucheyras-Durand, Frédérique; Masséglia, Sébastien; Fonty, Gérard; Forano, Evelyne

2010-12-01

We investigated the influence of the composition of the fibrolytic microbial community on the development and activities of hydrogen-utilizing microorganisms in the rumens of gnotobiotically reared lambs. Two groups of lambs were reared. The first group was inoculated with Fibrobacter succinogenes, a non-H(2)-producing species, as the main cellulolytic organism, and the second group was inoculated with Ruminococcus albus, Ruminococcus flavefaciens, and anaerobic fungi that produce hydrogen. The development of hydrogenotrophic bacterial communities, i.e., acetogens, fumarate and sulfate reducers, was monitored in the absence of methanogens and after inoculation of methanogens. Hydrogen production and utilization and methane production were measured in rumen content samples incubated in vitro in the presence of exogenous hydrogen (supplemented with fumarate or not supplemented with fumarate) or in the presence of ground alfalfa hay as a degradable substrate. Our results show that methane production was clearly reduced when the dominant fibrolytic species was a non-H(2)-producing species, such as Fibrobacter succinogenes, without significantly impairing fiber degradation and fermentations in the rumen. The addition of fumarate to the rumen contents stimulated H(2) utilization only by the ruminal microbiota inoculated with F. succinogenes, suggesting that these communities could play an important role in fumarate reduction in vivo.

Geometric Restraint Drives On- and Off-pathway Catalysis by the Escherichia coli Menaquinol:Fumarate Reductase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomasiak, Thomas M.; Archuleta, Tara L.; Andréll, Juni

2012-01-05

Complex II superfamily members catalyze the kinetically difficult interconversion of succinate and fumarate. Due to the relative simplicity of complex II substrates and their similarity to other biologically abundant small molecules, substrate specificity presents a challenge in this system. In order to identify determinants for on-pathway catalysis, off-pathway catalysis, and enzyme inhibition, crystal structures of Escherichia coli menaquinol:fumarate reductase (QFR), a complex II superfamily member, were determined bound to the substrate, fumarate, and the inhibitors oxaloacetate, glutarate, and 3-nitropropionate. Optical difference spectroscopy and computational modeling support a model where QFR twists the dicarboxylate, activating it for catalysis. Orientation of themore » C2-C3 double bond of activated fumarate parallel to the C(4a)-N5 bond of FAD allows orbital overlap between the substrate and the cofactor, priming the substrate for nucleophilic attack. Off-pathway catalysis, such as the conversion of malate to oxaloacetate or the activation of the toxin 3-nitropropionate may occur when inhibitors bind with a similarly activated bond in the same position. Conversely, inhibitors that do not orient an activatable bond in this manner, such as glutarate and citrate, are excluded from catalysis and act as inhibitors of substrate binding. These results support a model where electronic interactions via geometric constraint and orbital steering underlie catalysis by QFR.« less

21 CFR 522.84 - Beta-aminopropionitrile fumarate.

Code of Federal Regulations, 2010 CFR

2010-04-01

... use in breeding animals since the effects on fertility, pregnancy, or fetal health have not been... 21 Food and Drugs 6 2010-04-01 2010-04-01 false Beta-aminopropionitrile fumarate. 522.84 Section 522.84 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED...

Incidence and mitigation of gastrointestinal events in patients with relapsing-remitting multiple sclerosis receiving delayed-release dimethyl fumarate: a German phase IV study (TOLERATE).

PubMed

Gold, Ralf; Schlegel, Eugen; Elias-Hamp, Birte; Albert, Christian; Schmidt, Stephan; Tackenberg, Björn; Xiao, James; Schaak, Tom; Salmen, Hans Christian

2018-01-01

Gastrointestinal (GI) events are common adverse events (AEs) associated with delayed-release dimethyl fumarate (DMF), an approved treatment for relapsing-remitting multiple sclerosis (RRMS). The objective of the TOLERATE study was to evaluate GI tolerability and GI mitigation via symptomatic therapies in patients initiating DMF in a real-world clinical setting in Germany. TOLERATE was a multicentre, open-label, single-arm study performed at 25 German sites. Endpoints were frequency, severity, duration (all primary) and mitigation of GI-related events (secondary). Patients were instructed to take DMF according to the prescribing information for up to 12 weeks and to document GI events and intake of GI-symptomatic therapy on numerical rating scales, using eDiaries. A total of 211 patients were included in the safety population (71% female; mean age 40 ± 11 years). Of these, 185 patients (87.7%) reported GI-related events, out of which nearly half received GI-symptomatic therapy (84/185; 45.4%). The most frequently reported GI events were upper abdominal pain, flatulence and nausea. GI-related events peaked during the first 3 weeks of therapy and rapidly decreased thereafter. The severity of GI events over 12 weeks according to the Modified Overall Gastrointestinal Symptom Scale were mild to moderate in the majority of patients reporting GI-related events and taking symptomatic GI medication (53.6%). Only 10% of all patients discontinued study treatment due to AEs in general, while 6.6% discontinued due to GI-related events. The severity of GI-related events decreased over time in patients who received symptomatic treatment with one or more medications (e.g. acid secretion blockers, antidiarrhoeals or antiemetics). Gastrointestinal events associated with delayed-release DMF were mainly mild to moderate in severity. Prevalence of GI events peaked during the first 3 weeks of therapy and rapidly faded thereafter. Although 44.9% of patients experiencing GI events used common GI symptomatic therapies, only 6.6% of patients discontinued DMF because of GI events, suggesting that GI events could be managed well with common symptomatic therapy.

Studies on promoting action in skin carcinogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saffiotti, U.; Shubik, P.

1963-01-01

A number of substances were tested for carcinogenic promoting activity in Swiss mice by applying them twice weekly to the clipped dorsal skin, beginning 1 wk after a single application of 9,10-dimethyl-1, 2-benzanthracene (DMBA; 1 to 1.5% in mineral oil). Tests with silver nitrate (10% aqueous), iodoacetic acid (0.9% in acetone, fumaric acid (1% in acetone), ethylphenylpropiolate (5% in acetone), trihydroxymethylanthraquinone. (Emodin; 0.5% in acetone), oleic alcohol, monostearin (5% in acetone) and sorbitan monolaurate were essentially negative; when a single application of croton oil (5% in mineral oil) was interspersed between the carcinogen and silver nitrate, 6/20 mice developed 14more » benign tumors and 1 carcinoma. N-Dodecane showed moderate promoting activity (26 tumors, with 2 carcinomas, in 12/30 mice). Tests of several petroleum fractions showed high initial promoting activity (404 tumors, with 31 carcinomas, in 36/50 mice), but the activity disappeared on storage; while there was no carcinogenic activity in mice, in New Zealand albino rabbits the petroleum fractions alone produced considerable numbers of tumors. One application of DMBA, however, did increase tumor incidence and shorten the latent period. The hexane-eluted fraction of a methanolic extract of croton seeds (which had little vesicant activity), had all the promoting activity of the original croton oil; this could be demonstrated with uethan (20 mg/day ip for 5 days) as the initiator as well as with DMBA. In conclusion, the authors distinguish sharply between the promoting activity of compounds such as croton oil, which lead mostly to benign tumors (many of which regress spontaneously), and the additive effects of carcinogenic substances which may have a stimulatory effect on the second stage of carcinogenesis; for this additive carcinogenic effect, they suggest the term developing action. Other studies on croton oil are also reviewed.« less

Unravelling the bioherbicide potential of Eucalyptus globulus Labill: Biochemistry and effects of its aqueous extract

PubMed Central

Reigosa, Manuel J.; Valentão, Patrícia; Andrade, Paula B.

2018-01-01

In the worldwide search for new strategies in sustainable weed management, the use of plant species able to produce and release phytotoxic compounds into the environment could be an effective alternative to synthetic herbicides. Eucalyptus globulus Labill. is known to be a source of biologically active compounds responsible for its phytotoxic and allelopathic properties. Our previous results demonstrated the bioherbicide potential of eucalyptus leaves incorporated into the soil as a green manure, probably through the release of phytotoxins into the soil solution. Thus, the aims of this study were to understand the phytotoxicity of the eucalyptus leaves aqueous extract applied in pre- and post-emergence, and to identify and quantify its potentially phytotoxic water-soluble compounds. The effects were tested on the germination and early growth of the model target species Lactuca sativa and Agrostis stolonifera, and on physiological parameters of L. sativa adult plants after watering or spraying application. Dose-response curves and ED50 and ED80 values for eucalyptus aqueous extracts revealed pre-emergence inhibitory effects on both target species, effects being comparable to the herbicide metolachlor. While spraying treatment reduced the aerial and root biomass and increased the dry weight/fresh weight ratio of lettuce adult plants, watering application reduced protein contents and chlorophyll concentrations with respect to control, reflecting different modes of action depending on the site of phytotoxin entry. Via HPLC analyses, a total of 8 phenolic compounds (chlorogenic, two ρ-coumaric derivatives, ellagic, hyperoside, rutin, quercitrin, and kaempferol 3-O-glucoside) and other 5 low weight organic acids (citric, malic, shikimic, succinic and fumaric acids) were obtained from aqueous extract, the latter being identified for the first time in E. globulus. Despite some phytotoxic effects were found on lettuce adult plants, the use of eucalyptus aqueous extract would be discarded in post-emergence, whereas it was promising as a pre-emergence bioherbicide. PMID:29438430

In vitro dissolution profile of two commercially available iron preparations.

PubMed

Patrício, José P H; Santos, Cristina; Cerdeira, Rui

2012-03-01

Current scientific evidence indicates that anemia in pregnancy, regardless of severity, is associated with an increased risk of maternal and fetal mortality. There is little published information about the bioavailability and bioequivalence of formulations containing both iron and folic acid. However, in vitro dissolution studies can provide important information on the likely relative bioavailability of various formulations. The objective of our study was to compare the in vitro dissolution of two similar commercially available formulations of iron- and folic acid-containing supplements, Folifer® (Bialport - Produtos Farmacêuticos, S.A., Portugal) and Ferroliver® (SM Pharma c.a., Venezuela), in order to determine the in vitro availability of their iron content. Folifer® and Ferroliver® were chosen because they contained similar amounts of elemental iron. The amount of iron released from each tablet was evaluated over a 4-hour period in three dissolution media replicating gastric or intestinal juices with pH values ranging from 1.5 to 6.9. The samples were then titrated with a solution of cerium ammonium sulfate in order to calculate the amount of iron released in each specific pH condition. The percentage of dissolved iron was calculated as a cumulative frequency, using the percentage of dissolved iron at all timepoints. The dissolution similarity between the two commercially available formulations was evaluated using the &U0192;(2) statistic formula. During a 4-hour dissolution test, Folifer® released 59.4 mg of iron compared with 48.5 mg released by Ferroliver®. The value obtained for the similarity factor, an indicator of likely bioequivalence, was 41. These data suggest that Folifer® releases more iron than Ferroliver®, and that the two formulations are not equivalent in vitro. The superior dissolution of ferrous sulfate with Folifer® compared with ferrous fumarate in Ferroliver® might be responsible for the observed difference.

Sulforaphane Ameliorates 3-Nitropropionic Acid-Induced Striatal Toxicity by Activating the Keap1-Nrf2-ARE Pathway and Inhibiting the MAPKs and NF-κB Pathways.

PubMed

Jang, Minhee; Cho, Ik-Hyun

2016-05-01

The potential neuroprotective value of sulforaphane (SFN) in Huntington's disease (HD) has not been established yet. We investigated whether SFN prevents and improves the neurological impairment and striatal cell death in a 3-nitropropionic acid (3-NP)-induced mouse model of HD. SFN (2.5 and 5.0 mg/kg/day, i.p.) was given daily 30 min before 3-NP treatment (pretreatment) and from onset/progression/peak points of the neurological scores. Pretreatment with SFN (5.0 mg/kg/day) produced the best neuroprotective effect with respect to the neurological scores and lethality among other conditions. The protective effects due to pretreatment with SFN were associated with the following: suppression of the formation of a lesion area, neuronal death, succinate dehydrogenase activity, apoptosis, microglial activation, and mRNA or protein expression of inflammatory mediators, including tumor necrosis factor-alpha, interleukin (IL)-1β, IL-6, inducible nitric oxide synthase, and cyclooxygenase-2 in the striatum after 3-NP treatment. Also, pretreatment with SFN activated the Kelch-like ECH-associated protein 1 (Keap1)-nuclear factor erythroid 2-related factor 2 (Nrf2)-antioxidant response element (ARE) pathway and inhibited the mitogen-activated protein kinases (MAPKs) and nuclear factor-kappa B (NF-κB) pathways in the striatum after 3-NP treatment. As expected, the pretreatment with activators (dimethyl fumarate and antioxidant response element inducer-3) of the Keap1-Nrf2-ARE pathway decreased the neurological impairment and lethality after 3-NP treatment. Our findings suggest that SFN may effectively attenuate 3-NP-induced striatal toxicity by activating the Keap1-Nrf2-ARE pathway and inhibiting the MAPKs and NF-κB pathways and that SFN has a wide therapeutic time-window for HD-like symptoms.

Collagen telopeptides (cross-linking sites) play a role in collagen gel lattice contraction

NASA Technical Reports Server (NTRS)

Woodley, D. T.; Yamauchi, M.; Wynn, K. C.; Mechanic, G.; Briggaman, R. A.

1991-01-01

Solubilized interstitial collagens will form a fibrillar, gel-like lattice when brought to physiologic conditions. In the presence of human dermal fibroblasts the collagen lattice will contract. The rate of contraction can be determined by computer-assisted planemetry. The mechanisms involved in contraction are as yet unknown. Using this system it was found that the rate of contraction was markedly decreased when collagen lacking telopeptides was substituted for native collagen. Histidinohydroxylysinonorleucine (HHL) is a major stable trifunctional collagen cross-link in mature skin that involves a carboxyl terminal, telopeptide site 16c, the sixteenth amino acid residue from the carboxy terminal of the telopeptide region of alpha 1 (I) in type I collagen. Little, if any, HHL was present in native, purified, reconstituted, soluble collagen fibrils from 1% acetic acid-extracted 2-year-old bovine skin. In contrast, HHL cross-links were present (0.22 moles of cross-link per mole of collagen) in lattices of the same collagen contracted by fibroblasts. However, rat tail tendon does not contain HHL cross-links, and collagen lattices made of rat tail tendon collagen are capable of contraction. This suggests that telopeptide sites, and not mature HHL cross-links per se, are essential for fibroblasts to contract collagen lattices. Beta-aminopropionitrile fumarate (BAPN), a potent lathyrogen that perturbs collagen cross-linking by inhibition of lysyl oxidase, also inhibited the rate of lattice cell contraction in lattices composed of native collagen. However, the concentrations of BAPN that were necessary to inhibit the contraction of collagen lattices also inhibited fibroblast growth suggestive of cellular toxicity. In accordance with other studies, we found no inhibition of the rate of lattice contraction when fibronectin-depleted serum was used. Electron microscopy of contracted gels revealed typical collagen fibers with a characteristic axial periodicity. The data provide evidence that collagen telopeptide sites play a role in collagen gel lattice contraction.