Science.gov

Sample records for acid functionalized gold

  1. Poly(amino acid) functionalized maghemite and gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Perego, Davide; Masciocchi, Norberto; Guagliardi, Antonietta; Domínguez-Vera, José Manuel; Gálvez, Natividad

    2013-02-01

    Bimodal MRI/OI imaging probes are of great interest in nanomedicine. Although many organic polymers have been studied thoroughly for in vivo applications, reports on the use of poly(amino acid)s as coating polymers are scarce. In this paper, poly-(d-glutamic acid, d-lysine) (PGL) has been used for coating maghemite and gold nanoparticles. An advantage of this flexible and biocompatible polymer is that, once anchored to the nanoparticle surface, dangling lysine amino groups are available for the incorporation of new functionalities. As an example, Alexa Fluor derivatives have been attached to PGL-coated maghemite nanoparticles to obtain magnetic/fluorescent materials. These dual-property materials could be used as bimodal MRI/OI probes for in vivo imaging.

  2. Synthesis of functionalized fluorescent gold nanoclusters for acid phosphatase sensing

    NASA Astrophysics Data System (ADS)

    Sun, Jian; Yang, Fan; Yang, Xiurong

    2015-10-01

    A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by introducing an alkaline aqueous solution of MUA into the GSH-Au+ complexes or AuNC@GSH solution. Subsequently, a reliable AuNC@GSH/MUA-based real-time assay of acid phosphatase (ACP) is established for the first time, inspired by the selective coordination of Fe3+ with surface ligands of AuNCs, the higher binding affinity between the pyrophosphate ion (PPi) and Fe3+, and the hydrolysis of PPi into orthophosphate by ACP. Our fluorescent chemosensor can also be applied to assay ACP in a real biological sample and, furthermore, to screen the inhibitor of ACP. This report paves a new avenue for synthesizing AuNCs based on either the bottom-up reduction or top-down etching method, establishing real-time fluorescence assays for ACP by means of PPi as the substrate, and further exploring the sensing applications of fluorescent AuNCs.A novel and convenient one-pot but two-step synthesis of fluorescent gold nanoclusters, incorporating glutathione (GSH) and 11-mercaptoundecanoic acid (MUA) as the functionalized ligands (i.e. AuNCs@GSH/MUA), is demonstrated. Herein, the mixing of HAuCl4 and GSH in aqueous solution results in the immediate formation of non-fluorescent GSH-Au+ complexes, and then a class of ~2.6 nm GSH-coated AuNCs (AuNCs@GSH) with mild orange-yellow fluorescence after several days. Interestingly, the intense orange-red emitting ~1.7 nm AuNCs@GSH/MUA can be synthesized within seconds by

  3. Lipoic Acid Gold Nanoparticles Functionalized with Organic Compounds as Bioactive Materials

    PubMed Central

    Turcu, Ioana; Zarafu, Irina; Popa, Marcela; Chifiriuc, Mariana Carmen; Bleotu, Coralia; Culita, Daniela; Ghica, Corneliu; Ionita, Petre

    2017-01-01

    Water soluble gold nanoparticles protected by lipoic acid were obtained and further functionalized by standard coupling reaction with 1-naphtylamine, 4-aminoantipyrine, and 4′-aminobenzo-15-crown-5 ether. Derivatives of lipoic acid with 1-naphtylamine, 4-aminoantipyrine, and 4′-aminobenzo-15-crown-5 ether were also obtained and characterized. All these were tested for their antimicrobial activity, as well as for their influence on mammalian cell viability and cellular cycle. In all cases a decreased antimicrobial activity of the obtained bioactive nanoparticles was observed as compared with the organic compounds, proving that a possible inactivation of the bioactive groups could occur during functionalization. However, both the gold nanoparticles as well as the functionalized bioactive nanosystems proved to be biocompatible at concentrations lower than 50 µg/mL, as revealed by the cellular viability and cell cycle assay, demonstrating their potential for the development of novel antimicrobial agents. PMID:28336877

  4. Phenylboronic acid functionalized gold nanoparticles for highly sensitive detection of Staphylococcus aureus

    NASA Astrophysics Data System (ADS)

    Wang, Jine; Gao, Jingqing; Liu, Dianjun; Han, Dongxue; Wang, Zhenxin

    2012-01-01

    Herein, we report a phenylboronic acid functionalized gold nanoparticle (GNP)-based colorimetric assay for rapid detection of Staphylococcus aureus (S. aureus) with high sensitivity. In this approach, GNPs can bind to S. aureus by the reaction of phenylboronic acid with the cis-diol configuration in glycans on the bacterial surface, providing a colorimetric readout of the binding event. Using this strategy, we have been able to quantify S. aureus at a concentration of 50 cells per mL (three times the standard deviation divided by the slope of the working curve) in aqueous solution.Herein, we report a phenylboronic acid functionalized gold nanoparticle (GNP)-based colorimetric assay for rapid detection of Staphylococcus aureus (S. aureus) with high sensitivity. In this approach, GNPs can bind to S. aureus by the reaction of phenylboronic acid with the cis-diol configuration in glycans on the bacterial surface, providing a colorimetric readout of the binding event. Using this strategy, we have been able to quantify S. aureus at a concentration of 50 cells per mL (three times the standard deviation divided by the slope of the working curve) in aqueous solution. Electronic supplementary information (ESI) available: Details of experimental method and additional figures are available. See DOI: 10.1039/c2nr11657j

  5. Plasmonics-Based Detection of Virus Using Sialic Acid Functionalized Gold Nanoparticles.

    PubMed

    Lee, Changwon; Wang, Peng; Gaston, Marsha A; Weiss, Alison A; Zhang, Peng

    2017-01-01

    Biosensor for the detection of virus was developed by utilizing plasmonic peak shift phenomenon of the gold nanoparticles and viral infection mechanism of hemagglutinin on virus and sialic acid on animal cells. The plasmonic peak of the colloidal gold nanoparticles changes with the aggregation of the particles due to the plasmonic interaction between nearby particles and the color of the colloidal nanoparticle solution changes from wine red to purple. Sialic acid reduced and stabilized colloidal gold nanoparticle aggregation is induced by the addition of viral particles in the solution due to the hemagglutinin-sialic acid interaction. In this work, sialic acid reduced and stabilized gold nanoparticles (d = 20.1 ± 1.8 nm) were synthesized by a simple one-pot, green method without chemically modifying sialic acid. The gold nanoparticles showed target-specific aggregation with viral particles via hemagglutinin-sialic acid binding. A linear correlation was observed between the change in optical density and dilution of chemically inactivated influenza B virus species. The detection limit of the virus dilution (hemagglutinination assay titer, 512) was shown to be 0.156 vol% and the upper limit of the linearity can be extended with the use of more sialic acid-gold nanoparticles.

  6. One-step synthesis of boronic acid functionalized gold nanoclusters for photoluminescence sensing of dopamine

    NASA Astrophysics Data System (ADS)

    Chen, Huide; Liu, Chunxiu; Xia, Yunsheng

    2017-03-01

    This study is the first to report one-step synthesis of boronic acid functionalized gold nanoclusters (AuNCs) using mixed ligands of 4-mercaptophenylboronic acid (MPBA) and glutathione. Furthermore, the emission color of the products can be fancily tuned from green to near-infrared by simply changing the proportion of the two stabilizers. In basic media, dopamine (DA) molecules themselves polymerize each other and form polydopamine with large amounts of cis-diol groups, which then react with boronic acid groups on the AuNC’s surface based on the formation of boronate esters. As a result, the photoluminescence of the AuNCs is well quenched by the electron transfer effect. Accordingly, DA molecules are assayed from 0.5 to 9 μM, and the detection limit is as low as 0.1 μM. The as-prepared AuNCs exhibit high selectivity; the existing biomolecules including various amino acids, ascorbic acid, uric acid, glucose, etc, do not interfere with the assay. The proposed method is successfully applied to the assay of DA in human serum, indicating its practical potential.

  7. Tannic acid functionalized graphene hydrogel for entrapping gold nanoparticles with high catalytic performance toward dye reduction.

    PubMed

    Luo, Jing; Zhang, Nan; Lai, Jianping; Liu, Ren; Liu, Xiaoya

    2015-12-30

    In this work, a simple, cost-effective, and environmental-friendly strategy was developed to synthesize gold nanoparticles (Au NPs) decorated graphene hydrogel with the use of tannic acid. This facile route involved the reduction of graphene oxide (GO) in the presence of tannic acid to form tannic acid functionalized graphene hydrogel, followed by loading and in situ reduction of AuCl4(-) ions in the graphene hydrogel network benefiting from the abundant phenol groups of tannic acid. Tannic acid (TA), a typical plant polyphenol widely present in woods, not only reduced GO and induced the self-assembly of reduced graphene oxide into graphene hydrogel, but also served as the reducing agent and stabilizer for the synthesis and immobilization of Au NPs, avoiding extra chemical reagent and any stabilizer. The obtained Au NPs decorated graphene hydrogel (Au@TA-GH) was fully characterized and exhibited much higher catalytic activities than the unsupported and other polymer-supported Au NPs toward the reduction of methylene blue (MB). In addition, the high catalytic activity of Au@TA-GH could withhold in different pH solution conditions. Another distinct advantage of Au@TA-GH as catalysts is that it can be easily recovered and reused for five cycles.

  8. Peptide coupling between amino acids and the carboxylic acid of a functionalized chlorido-gold(I)-phosphane.

    PubMed

    Kriechbaum, Margit; List, Manuela; Himmelsbach, Markus; Redhammer, Günther J; Monkowius, Uwe

    2014-10-06

    We have developed a protocol for the direct coupling between methyl ester protected amino acids and the chlorido-gold(I)-phosphane (p-HOOC(C6H4)PPh2)AuCl. By applying the EDC·HCl/NHS strategy (EDC·HCl = N-ethyl-N'-(3-(dimethylamino)propyl)carbodiimide hydrochloride, NHS = N-hydroxysuccinimide), the methyl esters of l-phenylalanine, glycine, l-leucine, l-alanine, and l-methionine are coupled with the carboxylic acid of the gold complex in moderate to good yields (62-88%). All amino acid tagged gold complexes were characterized by (1)H and (13)C NMR spectroscopy and high-resolution mass spectrometry. As corroborated by measurement of the angle of optical rotation, no racemization occurred during the reaction. The molecular structure of the leucine derivative was determined by single-crystal X-ray diffraction. In the course of developing an efficient coupling protocol, the acyl chlorides (p-Cl(O)C(C6H4)PPh2)AuX (X = Cl, Br) were also prepared and characterized.

  9. Highly sensitive colorimetric detection of lead using maleic acid functionalized gold nanoparticles.

    PubMed

    Ratnarathorn, Nalin; Chailapakul, Orawon; Dungchai, Wijitar

    2015-01-01

    Highly sensitive colorimetric detection for Pb(2+) has been developed using maleic acid (MA) functionalized GNP. The -COOH on MA was used to modify GNP surface whereas the other -COOH functional group have strong affinity to coordination behavior of Pb(2+) allowing the selective formation more than other ions. MA-GNPs solution changed from red to blue color after the addition of Pb(2+) due to nanoparticle aggregation. The different optical absorption and discriminate of particle size between the MA-GNPs solution with and without Pb(2+) were characterized by UV-visible spectroscopy and transmission electron microscopy (TEM), respectively. The color intensity as a function of Pb(2+) concentration gave a linear response in the range of 0.0-10.0 µg L(-1) (R(2)=0.990). The detection limit was found at 0.5 µg L(-1) by naked eye and can be completed the analysis within 15 min. The MA-GNPs aggregated with Pb(2+) showed high selectivity when was compared to other metal ions (As(3+), Ca(2+), Cd(2+), Co(2+), Cu(2+), Fe(3+), Hg(2+), Mg(2+), Mn(2+), Ni(2+), Pb(2+) and Zn(2+)) and anions (Cl(-), NO3(-) and SO4(2-)). Our proposed method was also applied for the determination of Pb(2+) in real drinking water samples from 5 sources. The result of real water samples were not statistically significant different from the standard methods at the 95% confidence level (pair t-test method). Moreover, we evaluated our proposed method for the determination of trace Pb(2+) concentration in real breast milk samples. The recoveries were acceptable and ranged from 101 to 104% for spiked Pb(2+) in real breast milk samples. Thus, MA-GNP colorimetric sensing provides a simple, rapid, sensitive, easy-to-use, inexpensive and low detection limit for the monitoring of Pb(2+).

  10. Functionalization of gold nanoparticles as antidiabetic nanomaterial

    NASA Astrophysics Data System (ADS)

    Venkatachalam, M.; Govindaraju, K.; Mohamed Sadiq, A.; Tamilselvan, S.; Ganesh Kumar, V.; Singaravelu, G.

    2013-12-01

    In the present investigation, functionalization of gold nanoparticles synthesized using propanoic acid 2-(3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl) (PAT) an active biocomponent isolated from Cassia auriculata is studied in detail. On reaction of PAT with aqueous HAuCl4, rapid formation of stable gold nanoparticles was achieved. Formation of gold nanoparticles was confirmed by UV-vis spectroscopy, XRD, GC-MS, FTIR, TEM and SEM with EDAX. Gold nanoparticles mostly were monodisperse, spherical in shape and ranged in size 12-41 nm. Gold nanoparticles synthesised using PAT was administered to alloxan (150 mg/kg body weight) induced diabetic male albino rats at different doses (0.25, 0.5, 0.75 and 1.0 mg/kg body weight) for 28 days. Plasma glucose level, cholesterol and triglyceride were significantly (p < 0.001) reduced in experimental animals treated with gold nanoparticles at dosage of 0.5 mg/kg body weight and plasma insulin increased significantly. The newly genre green gold nanoparticles exhibit remarkable protein tyrosine phosphatase 1B inhibitory activity.

  11. Functionalization of gold nanoparticles as antidiabetic nanomaterial.

    PubMed

    Venkatachalam, M; Govindaraju, K; Mohamed Sadiq, A; Tamilselvan, S; Ganesh Kumar, V; Singaravelu, G

    2013-12-01

    In the present investigation, functionalization of gold nanoparticles synthesized using propanoic acid 2-(3-acetoxy-4,4,14-trimethylandrost-8-en-17-yl) (PAT) an active biocomponent isolated from Cassia auriculata is studied in detail. On reaction of PAT with aqueous HAuCl4, rapid formation of stable gold nanoparticles was achieved. Formation of gold nanoparticles was confirmed by UV-vis spectroscopy, XRD, GC-MS,FTIR, TEM and SEM with EDAX. Gold nanoparticles mostly were monodisperse, spherical in shape and ranged in size 12-41 nm. Gold nanoparticles synthesised using PAT was administered to alloxan (150 mg/kg body weight) induced diabetic male albino rats at different doses (0.25, 0.5, 0.75 and 1.0mg/kg body weight) for 28 days. Plasma glucose level, cholesterol and triglyceride were significantly (p<0.001) reduced in experimental animals treated with gold nanoparticles at dosage of 0.5mg/kg body weight and plasma insulin increased significantly. The newly genre green gold nanoparticles exhibit remarkable protein tyrosine phosphatase 1B inhibitory activity.

  12. Colorimetric detection of Cr3+ using gold nanoparticles functionalized with 4-amino hippuric acid

    NASA Astrophysics Data System (ADS)

    Jin, Weiwei; Huang, Pengcheng; Chen, Yueji; Wu, Fangying; Wan, Yiqun

    2015-09-01

    A facile and effective technique for monitoring Cr3+ concentration based on 4-amino hippuric acid (PAH) decorated Au nanoparticles (PAH-AuNPs) is introduced. The modified AuNPs were easily aggregated in the presence of Cr3+, resulting in the color change from red to violet or blue, which is in response to the surface plasmon absorption of dispersed or aggregated nanoparticles. Under the optimized conditions, a good linear relationship (correlation coefficient r = 0.998) was obtained between the ratio of the absorbance at 635 nm to that at 520 nm ( A 635 nm/ A 520 nm), and the concentration of Cr3+ was over the range of 5.0-120 µM with detection limit of 1.17 µM. This method exhibited excellent selectivity for Cr3+ over other tested heavy metal ions. Furthermore, there was no significant difference for the parameters of calibration equation between the presence and absence of ethylenediamine tetraacetic acid (EDTA), which suggests that the method can be applied in various real samples owing to the strong masking ability of EDTA. The assay was used to detect the concentrations of Cr3+ in liquid milk, milk power, and lake water samples with recoveries ranging from 93.5 to 114 %, indicating that the method could be used for extensive practical application.

  13. Intracellular surface-enhanced Raman scattering probe based on gold nanorods functionalized with mercaptohexadecanoic acid with reduced cytotoxicity.

    PubMed

    Liu, Min; Wang, Zhuyuan; Zong, Shenfei; Zhang, Ruohu; Yang, Jing; Cui, Yiping

    2012-01-01

    A surface-enhanced Raman scattering (SERS) probe for intracellular detection was demonstrated by utilizing gold nanorods (GNRs) coated with p-aminothiophenol as the Raman reporters. In this probe, to reduce the cytotoxicity of GNRs, cetyltrimethylammonium bromide (CTAB) molecules adsorbed on the surfaces of GNRs as ligands were replaced by mercaptohexadecanoic acid via a "round-trip" phase change method. Such a ligand exchange can reduce the toxicity of the probe compared to the original CTAB-stabilized GNRs, which were confirmed by both 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay and bright field view of HeLa cells. Meanwhile, the transmission electron microscopy images indicated that there is no significant morphologic change of GNRs before and after the ligand exchange. Moreover, its SERS performance was adequately retained after the incorporation of the probe into living HeLa cells. This new type of SERS probe is expected to have great potential in intracellular imaging or sensing applications.

  14. 2,3-Pyridine dicarboxylic acid functionalized gold nanoparticles: Insight into experimental conditions for Cr(3+) sensing.

    PubMed

    Shaikh, Ruqaya; Memon, Najma; Solangi, Amber R; Shaikh, Huma I; Agheem, Muhammad Hassan; Ali, Syed Abid; Shah, Muhammad Raza; Kandhro, Aftab

    2017-02-15

    Selectivity of gold nanoparticles (AuNPs) depends upon surface functionality; small changes in structure or concentration bring significant changes in the behavior of AuNPs. In this study, citrate-capped AuNPs were functionalized with ortho-dicarboxylate substituted pyridine (2,3-PDCA) and detailed studies on experimental conditions were carried out to check the stability of AuNPs and response for Cr(3+). Stability of PDCA-AuNPs was found sensitive to the pH, ionic strength of buffer and its type. Capping behavior of PDCA on C-AuNPs was examined by FTIR spectroscopy. Surface morphology and size of synthesized AuNPs were confirmed by AFM, XRD, and DLS techniques where particles were found 11nm in size, monodisperse and spherical in shape. Interaction of stabilized AuNPs was tested with various metal ions; where Cr(3+) induced the changes in localized surface plasmon band (LSPR) of PDCA-AuNPs which leads to a color change from wine red to violet blue. The phenomenon is explained as cooperative effect of citrate and pyridine nitrogen on surface of AuNPs in contrary to meta-dicarboxylate substituted pyridine derivatives. Further, under optimized and controlled conditions Cr(3+) shows linear response with decrease in absorbance at LSPR intensity of AuNPs (518nm). Moreover, to demonstrate the applicability of method, Cr(3+) was determined in the presence of Cr (VI) which shows 96% recovery.

  15. 2,3-Pyridine dicarboxylic acid functionalized gold nanoparticles: Insight into experimental conditions for Cr3 + sensing

    NASA Astrophysics Data System (ADS)

    Shaikh, Ruqaya; Memon, Najma; Solangi, Amber R.; Shaikh, Huma I.; Agheem, Muhammad Hassan; Ali, Syed Abid; Shah, Muhammad Raza; Kandhro, Aftab

    2017-02-01

    Selectivity of gold nanoparticles (AuNPs) depends upon surface functionality; small changes in structure or concentration bring significant changes in the behavior of AuNPs. In this study, citrate-capped AuNPs were functionalized with ortho-dicarboxylate substituted pyridine (2,3-PDCA) and detailed studies on experimental conditions were carried out to check the stability of AuNPs and response for Cr3 +. Stability of PDCA-AuNPs was found sensitive to the pH, ionic strength of buffer and its type. Capping behavior of PDCA on C-AuNPs was examined by FTIR spectroscopy. Surface morphology and size of synthesized AuNPs were confirmed by AFM, XRD, and DLS techniques where particles were found 11 nm in size, monodisperse and spherical in shape. Interaction of stabilized AuNPs was tested with various metal ions; where Cr3 + induced the changes in localized surface plasmon band (LSPR) of PDCA-AuNPs which leads to a color change from wine red to violet blue. The phenomenon is explained as cooperative effect of citrate and pyridine nitrogen on surface of AuNPs in contrary to meta-dicarboxylate substituted pyridine derivatives. Further, under optimized and controlled conditions Cr3 + shows linear response with decrease in absorbance at LSPR intensity of AuNPs (518 nm). Moreover, to demonstrate the applicability of method, Cr3 + was determined in the presence of Cr (VI) which shows 96% recovery.

  16. Nucleic Acid-directed Self-assembly of Multifunctional Gold Nanoparticle Imaging Agents1

    PubMed Central

    Zhang, Ziyan; Liu, Yongjian; Jarreau, Chad; Welch, Michael J.; Taylor, John-Stephen A.

    2013-01-01

    Gold nanoparticles have attracted much interest as a platform for development of multifunctional imaging and therapeutic agents. Multifunctionalized gold nanoparticles are generally constructed by covalent assembly of a gold core with thiolated ligands. In this study, we have assembled multifunctionalized gold nanoparticles in one step by nucleic acid hybridization of ODN (oligodeoxynucleotide)-derivatized gold nanoparticles with a library of pre-functionalized complementary PNAs (peptide nucleic acids). The PNAs were functionalized by conjugation with DOTA (1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid) for chelating 64Cu for PET imaging, PEG (polyethylene glycol) for conferring stealth properties, and Cy5 for fluorescent imaging. The resulting nanoparticles showed good stability both in vitro and in vivo showing biodistribution behavior in a mouse that would be expected for a PEGylated gold nanoparticle rather than that for the radiolabelled PNA used in its assembly. PMID:24058728

  17. Functionalized Gold Nanoparticles and Their Biomedical Applications

    PubMed Central

    Tiwari, Pooja M.; Vig, Komal; Dennis, Vida A.; Singh, Shree R.

    2011-01-01

    Metal nanoparticles are being extensively used in various biomedical applications due to their small size to volume ratio and extensive thermal stability. Gold nanoparticles (GNPs) are an obvious choice due to their amenability of synthesis and functionalization, less toxicity and ease of detection. The present review focuses on various methods of functionalization of GNPs and their applications in biomedical research. Functionalization facilitates targeted delivery of these nanoparticles to various cell types, bioimaging, gene delivery, drug delivery and other therapeutic and diagnostic applications. This review is an amalgamation of recent advances in the field of functionalization of gold nanoparticles and their potential applications in the field of medicine and biology.

  18. Synthesis of gold nanoparticles using various amino acids.

    PubMed

    Maruyama, Tatsuo; Fujimoto, Yuhei; Maekawa, Tetsuya

    2015-06-01

    Gold nanoparticles (4-7nm) were synthesized from tetraauric acid using various amino acids as reducing and capping agents. The gold nanoparticles were produced from the incubation of a AuCl4(-) solution with an amino acid at 80°C for 20min. Among the twenty amino acids tested, several amino acids produced gold nanoparticles. The color of the nanoparticle solutions varied with the amino acids used for the reduction. We adopted l-histidine as a reducing agent and investigated the effects of the synthesis conditions on the gold nanoparticles. The His and AuCl4(-) concentrations affected the size of the gold nanoparticles and their aggregates. The pH of the reaction solution also affected the reaction yields and the shape of the gold nanoparticles.

  19. Tetrazine Click Chemistry for the Modification of 1-Hydroxy-1,1-methylenebisphosphonic Acids: Towards Bio-orthogonal Functionalization of Gold Nanoparticles.

    PubMed

    Aufaure, Romain; Hardouin, Julie; Millot, Nadine; Motte, Laurence; Lalatonne, Yoann; Guénin, Erwann

    2016-11-02

    Inverse electron demand Diels-Alder (iEDDA) was evaluated for the functionalization of gold nanoparticles. The reaction was first modelled with the free coating molecule 1-hydroxy-1,1-methylenebisphosphonate bearing an alkene functionality (HMBPene). A model tetrazine 3,6-dipyridin-2-yl-1,2,4,5-tetrazine (pyTz) was used, kinetic of the reaction was calculated and coupling products were analysed by NMR and HRMS. The reaction was then transposed at the nanoparticle surface. Gold nanoparticles bearing an alkene functionality were obtained using a one-pot methodology with HMBPene and the tetrazine click chemistry was evaluated at their surface using pyTz. The successful coupling was assessed by XPS measurements. This click-methodology was extended to the conjugation of a NIR probe at the NP surface.

  20. Dendritic functionalization of monolayer-protected gold nanoparticles

    SciTech Connect

    Cutler, Erin C.; Lundin, Erik; Garabato, B. Davis; Choi, Daeock; Shon, Young-Seok . E-mail: young.shon@wku.edu

    2007-06-05

    This paper describes the facile synthesis of nanoparticle-cored dendrimers (NCDs) and nanoparticle megamers from monolayer-protected gold clusters using either single or multi-step reactions. First, 11-mercaptoundecanoic acid/hexanethiolate-protected gold clusters were synthesized using the Schiffrin reaction followed by the ligand place-exchange reaction. A convergent approach for the synthesis of nanoparticle-cored dendrimers uses a single step reaction that is an ester coupling reaction of hydroxy-functionalized dendrons with carboxylic acid-functionalized gold clusters. A divergent approach, which is based on multi-step reactions, employs the repetition of an amide coupling reaction and a Michael addition reaction to build polyamidoamine dendritic architectures around a nanoparticle core. Nanoparticle megamers, which are large dendrimer-induced nanoparticle aggregates with an average diameter of more than 300 nm, were prepared by the amide coupling reaction between polyamiodoamine [G-2] dendrimers and carboxylic acid-functionalized gold clusters. {sup 1}H NMR spectroscopy, FT-IR spectroscopy, thermogravimetric analysis (TGA), and transmission electron microscopy (TEM) were used for the characterization of these hybrid nanoparticles.

  1. Benchmarking Density Functionals for Chemical Bonds of Gold.

    PubMed

    Kepp, Kasper P

    2017-03-09

    Gold plays a major role in nanochemistry, catalysis, and electrochemistry. Accordingly, hundreds of studies apply density functionals to study chemical bonding with gold, yet there is no systematic attempt to assess the accuracy of these methods applied to gold. This paper reports a benchmark against 51 experimental bond enthalpies of AuX systems and seven additional polyatomic and cationic molecules. Twelve density functionals were tested, covering meta functionals, hybrids with variable HF exchange, double-hybrid, dispersion-corrected, and nonhybrid GGA functionals. The defined benchmark data set probes all types of bonding to gold from very electronegative halides that force Au(+) electronic structure, via covalently bonded systems, hard and soft Lewis acids and bases that either work against or complement the softness of gold, the Au2 molecule probing gold's bond with itself, and weak bonds between gold and noble gases. Zero-point vibrational corrections are relatively small for Au-X bonds, ∼ 11-12 kJ/mol except for Au-H bonds. Dispersion typically provides ∼5 kJ/mol of the total bond enthalpy but grows with system size and is 10 kJ/mol for AuXe and AuKr. HF exchange and LYP correlation produce weaker bonds to gold. Most functionals provide similar trend accuracy, though somewhat lower for M06 and M06L, but very different numerical accuracy. Notably, PBE and TPSS functionals with dispersion display the smallest numerical errors and very small mean signed errors (0-6 kJ/mol), i.e. no bias toward over- or under-binding. Errors are evenly distributed versus atomic number, suggesting that relativistic effects are treated fairly; the mean absolute error is almost halved from B3LYP (45 kJ/mol) to TPSS and PBE (23 kJ/mol, including difficult cases); 23 kJ/mol is quite respectable considering the diverse bonds to gold and the complication of relativistic effects. Thus, studies that use DFT with effective core potentials for gold chemistry, with no alternative due

  2. Gold-catalyzed naphthalene functionalization

    PubMed Central

    Rivilla, Iván

    2011-01-01

    Summary The complexes IPrMCl (IPr = 1,3-bis(diisopropylphenyl)imidazol-2-ylidene, M = Cu, 1a; M = Au, 1b), in the presence of one equiv of NaBAr'4 (Ar' = 3,5-bis(trifluoromethyl)phenyl), catalyze the transfer of carbene groups: C(R)CO2Et (R = H, Me) from N2C(R)CO2Et to afford products that depend on the nature of the metal center. The copper-based catalyst yields exclusively a cycloheptatriene derivative from the Buchner reaction, whereas the gold analog affords a mixture of products derived either from the formal insertion of the carbene unit into the aromatic C–H bond or from its addition to a double bond. In addition, no byproducts derived from carbene coupling were observed. PMID:21647320

  3. Hybridization-modulated ion fluxes through peptide-nucleic-acid- functionalized gold nanotubes. A new approach to quantitative label-free DNA analysis.

    PubMed

    Jágerszki, Gyula; Gyurcsányi, Róbert E; Höfler, Lajos; Pretsch, Ernö

    2007-06-01

    The inner walls of gold nanotubes, prepared by template synthesis in the nanopores of polycarbonate track etch membranes, have been chemically modified with peptide nucleic acid (PNA) and used for label-free quantification of complementary DNA sequences. Selective binding of DNA to the PNA-modified nanotubes is shown to decrease the flux of optically detected anionic markers through the nanotubes in a concentration-dependent manner. The strong dependence of the biorecognition-modulated ion transport through the nanopores on the ionic strength suggests a dominantly electrostatic exclusion mechanism of the ion flux decrease as a result of DNA binding to the PNA-modified nanopores.

  4. Functionalized gold nanorods for molecular optoacoustic imaging

    NASA Astrophysics Data System (ADS)

    Eghtedari, Mohammad; Oraevsky, Alexander; Conjusteau, Andre; Copland, John A.; Kotov, Nicholas A.; Motamedi, Massoud

    2007-02-01

    The development of gold nanoparticles for molecular optoacoustic imaging is a very promising area of research and development. Enhancement of optoacoustic imaging for molecular detection of tumors requires the engineering of nanoparticles with geometrical and molecular features that can enhance selective targeting of malignant cells while optimizing the sensitivity of optoacoustic detection. In this article, cylindrical gold nanoparticles (i.e. gold nanorods) were fabricated with a plasmon resonance frequency in the near infra-red region of the spectrum, where deep irradiation of tissue is possible using an Alexandrite laser. Gold nanorods (Au-NRs) were functionalized by covalent attachment of Poly(ethylene glycol) to enhance their biocompatibility. These particles were further functionalized with the aim of targeting breast cancer cells using monoclonal antibodies that binds to Her2/neu receptors, which are over expressed on the surface of breast cancer cells. A custom Laser Optoacoustic Imaging System (LOIS) was designed and employed to image nanoparticle-targeted cancer cells in a phantom and PEGylated Au-NRs that were injected subcutaneously into a nude mouse. The results of our experiments show that functionalized Au-NRs with a plasmon resonance frequency at near infra-red region of the spectrum can be detected and imaged in vivo using laser optoacoustic imaging system.

  5. Tryptophan-functionalized gold nanoparticles for deep UV imaging of microbial cells.

    PubMed

    Pajović, Jelena D; Dojčilović, Radovan; Božanić, Dušan K; Kaščáková, Slavka; Réfrégiers, Matthieu; Dimitrijević-Branković, Suzana; Vodnik, Vesna V; Milosavljević, Aleksandar R; Piscopiello, Emanuela; Luyt, Adriaan S; Djoković, Vladimir

    2015-11-01

    Biocompatible fluorescent nanostructures were prepared by a functionalization of gold nanoparticles with the amino acid tryptophan. The gold-tryptophan bioconjugates were investigated by TEM and HRTEM and various spectroscopy methods (XPS, FTIR, UV-vis and photoluminescence). It was found that the gold nanoparticles, initially 8 nm in diameter, aggregate in the presence of the amino acid. From the XPS and FTIR spectroscopy results, it was concluded that the tryptophan gold interactions mainly take place via indole and carboxyl groups. Although the indole group is involved in the interaction with the gold surfaces, the tryptophan-gold hybrids showed strong fluorescence due to the presence of multilayers of tryptophan. Deep ultra violet (DUV) imaging performed at the SOLEIL synchrotron showed that it is possible to detect these hybrid nanostructures within Escherichia coli cells.

  6. Hyaluronic acid co-functionalized gold nanoparticle complex for the targeted delivery of metformin in the treatment of liver cancer (HepG2 cells).

    PubMed

    Kumar, C Senthil; Raja, M D; Sundar, D Sathish; Gover Antoniraj, M; Ruckmani, K

    2015-09-05

    In this study, green synthesis of gold nanoparticles (AuNPs) was achieved using the extract of eggplant as a reducing agent. Hyaluronic acid (HA) serves as a capping and targeting agent. Metformin (MET) was successfully loaded on HA capped AuNPs (H-AuNPs) and this formulation binds easily on the surface of the liver cancer cells. The synthesized nanoparticles were characterized by UV-Vis spectrophotometer, HR-TEM, particle size analyser and zeta potential measurement. Toxicity studies of H-AuNPs in zebra fish confirmed the in vivo safety of the AuNPs. The in vitro cytotoxicity results showed that the amount of MET-H-AuNPs enough to achieve 50% inhibition (IC50) was much lower than free MET. Flow cytometry analysis showed the significant reduction in G2/M phase after treatment with MET-H-AuNPs, and molecular level apoptosis were studied using western blotting. The novelty of this study is the successful synthesis of AuNPs with a higher MET loading and this formulation exhibited better targeted delivery as well as increased regression activity than free MET in HepG2 cells.

  7. Preparation and bactericide activity of gallic acid stabilized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Moreno-Álvarez, S. A.; Martínez-Castañón, G. A.; Niño-Martínez, N.; Reyes-Macías, J. F.; Patiño-Marín, N.; Loyola-Rodríguez, J. P.; Ruiz, Facundo

    2010-10-01

    In this work, gold nanoparticles with three different sizes (13.7, 39.4, and 76.7 nm) were prepared using a simple aqueous method with gallic acid as the reducing and stabilizing agent, the different sizes were obtained varying some experimental parameters as the pH of the reaction and the amount of the gallic acid. The prepared nanoparticles were characterized using X-ray diffraction, transmission electron microscopy, dynamic light scattering, and UV-Vis spectroscopy. Samples were identified as elemental gold and present spherical morphology, a narrow size distribution and good stabilization according to TEM and DLS results. The antibacterial activity of this gallic acid stabilized gold nanoparticles against S. mutans (the etiologic agent of dental caries) was assessed using a microdilution method obtaining a minimum inhibitory concentration of 12.31, 12.31, and 49.25 μg/mL for 13.7, 39.4, and 76.7 nm gold nanoparticles, respectively. The antibacterial assay showed that gold nanoparticles prepared in this work present a bactericide activity by a synergistic action with gallic acid. The MIC found for this nanoparticles are much lower than those reported for mixtures of gold nanoparticles and antibiotics.

  8. Viral detection using DNA functionalized gold filaments†

    PubMed Central

    Perez, Jonas W.; Haselton, Frederick R.

    2010-01-01

    Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5′ [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3′ covalently attached to a 5 cm length of a 100 μm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 μm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 μL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was ~200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting. PMID:20448919

  9. The electrokinetic characterization of gold nanoparticles, functionalized with cationic functional groups, and its' interaction with DNA.

    PubMed

    Lazarus, Geraldine Genevive; Revaprasadu, Neerish; López-Viota, Julián; Singh, Moganavelli

    2014-09-01

    Gold nanoparticles have attracted strong biomedical interest for drug delivery due to their low toxic nature, surface plasmon resonance and capability of increasing the stability of the payload. However, gene transfection represents another important biological application. Considering that cellular barriers keep enclosed their secret to deliver genes using nanoparticles, an important step can be achieved by studying the functionalization of nanoparticles with DNA. In the present contribution the synthesis of nanoparticles consisting of a gold core coated with one or more layers of amino acid (l-lysine), and cationic polyelectrolytes (poly-ethyleneimine and poly-l-lysine) is reported. All nanoparticles were subjected to dynamic light scattering, electrophoretic mobility measurements, UV-vis optical spectrophotometry analysis and transmission electron microscopy imaging. In addition, the adsorption of DNA plasmid (pSGS) with linear and supercoiled configurations was studied for those gold nanoparticles under the most suitable surface modifications. Preliminary results showed that the gold nanoparticles functionalized with poly-ethyleneimine and poly-l-lysine, respectively, and bound to linear DNA configurations, present in absolute value a higher electrophoretic mobility irrespective of the pH of the media, compared to the supercoiled and nicked configuration. The findings from this study suggest that poly-ethyleneimine and poly-l-lysine functionalized gold nanoparticles are biocompatible and may be promising in the chemical design and future optimization of nanostructures for biomedical applications such as gene and drug delivery.

  10. Functionalization and Characterization of Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Techane, Sirnegeda D.

    2011-12-01

    Surface characterization of gold nanoparticles (AuNPs) is necessary to obtain a thorough understanding of the AuNP properties and ultimately realize their full potential in applications. The work described in this dissertation strives to the structure and composition of AuNPs using highly surface sensitive techniques such as X-ray photoelectron spectroscopy (XPS) and time-of-flight secondary ion mass spectrometry (ToF-SIMS) in addition to the more widely used characterization techniques such as transmission electron microscopy (TEM), fourier transform infrared spectroscopy (FTIR) and UV-VIS spectroscopy. Self-assembled monolayers (SAMs) of alkanethiols were used to modify AuNPs surfaces to create positively and negatively charged surfaces. Functionalization with carboxylic acid terminated alkanethiol SAMs (COON-SAMs) was first optimized to produce clean and stable negatively charged AuNPs. Using 14nm and 40nm diameter AuNPs in combination with C11 and C16 chain length COOH-SAMs, it was found that addition of NH4OH during functionalization coupled with dialysis purification produced AuNPs that did not aggregate and did not have unbound thiols. Effects of AuNP size and COOH-SAM chain lengths were studied using 14, 25 and 40nm average diameter AuNPs functionalized with C6, C8, C11 and C16 COOH-SAMs. Flat Au surfaces were also functionalized with the COOH-SAMs for comparison. It was shown that the 14nm AuNPs with C16 COOH-SAMs were the most stable and had crystalline-like, well-ordered SAM structures. The SAMs on the 40nm AuNPs had similar surface chemistry as the SAMs on the flat Au surfaces. The effective photoelectron take-off angle of the C16 COOH-SAM decreased when the size of the AuNP increased. It was also shown that when using Kratos AxisUltra DLD XPS instrument in the hybrid mode, it was important to consider effects of both the hybrid mode and the AuNPs curvature when calculating overlayer thickness of the SAMs on AuNPs. Using the Kratos in the electrostatic

  11. Assembly of functional gold nanoparticle on silica microsphere.

    PubMed

    Wang, Hsuan-Lan; Lee, Fu-Cheng; Tang, Tse-Yu; Zhou, Chenguang; Tsai, De-Hao

    2016-05-01

    We demonstrate a controlled synthesis of silica microsphere with the surface-decorated functional gold nanoparticles. Surface of silica microsphere was modified by 3-aminopropypltriethoxysilane and 3-aminopropyldimethylethoxysilane to generate a positive electric field, by which the gold nanoparticles with the negative charges (unconjugated, thiolated polyethylene glycol functionalized with the traceable packing density and conformation) were able to be attracted to the silica microsphere. Results show that both the molecular conjugation on gold nanoparticle and the uniformity in the amino-silanization of silica microsphere influenced the loading and the homogeneity of gold nanoparticles on silica microsphere. The 3-aminopropyldimethylethoxysilane-functionalized silica microsphere provided an uniform field to attract gold nanoparticles. Increasing the ethanol content in aminosilane solution significantly improved the homogeneity and the loading of gold nanoparticles on the surface of silica microsphere. For the gold nanoparticle, increasing the molecular mass of polyethylene glycol yielded a greater homogeneity but a lower loading on silica microsphere. Bovine serum albumin induced the desorption of gold nanoparticles from silica microsphere, where the extent of desorption was suppressed by the presence of high-molecular mass polyethylene glycol on gold nanoparticles. This work provides the fundamental understanding for the synthesis of gold nanoparticle-silica microsphere constructs useful to the applications in chemo-radioactive therapeutics.

  12. Amoxicillin functionalized gold nanoparticles reverts MRSA resistance.

    PubMed

    Kalita, Sanjeeb; Kandimalla, Raghuram; Sharma, Kaustav Kalyan; Kataki, Amal Chandra; Deka, Manab; Kotoky, Jibon

    2016-04-01

    In this study, we have described the biosynthesis of biocompatible gold nanoparticles (GNPs) from aqueous extract of the aerial parts of a pteridophyte, "Adiantum philippense" by microwave irradiation and its surface functionalization with broad spectrum beta lactam antibiotic, amoxicillin (Amox). The functionalization of amoxicillin on GNPs (GNP-Amox) was carried out via electrostatic interaction of protonated amino group and thioether moiety mediated attractive forces. The synthesized GNPs and GNP-Amox were physicochemically characterized. UV-Vis spectroscopy, Zeta potential, XRD, FTIR and SERS (surface enhanced raman spectra) results confirmed the loading of Amox into GNPs. Loading of Amox to GNPs reduce amoxicillin cytotoxicity, whereas GNPs were found to be nontoxic to mouse fibroblast cell line (L929) as evident from MTT and acridine orange/ethidium bromide (AO/EtBr) live/dead cell assays. The GNP-Amox conjugates demonstrated enhanced broad-spectrum bactericidal activity against both Gram-positive and Gram-negative bacteria. Furthermore, in-vitro and in-vivo assays of GNP-Amox revealed potent anti-MRSA activity and improved the survival rate. This indicates the subversion of antibiotic resistance mechanism by overcoming the effect of high levels of β-lactamase produced by methicillin resistant Staphylococcus aureus (MRSA). Taken together, this study demonstrates the positive attributes from GNP-Amox conjugates as a promising antibacterial therapeutic agent against MRSA as well as other pathogens.

  13. Straightforward and robust synthesis of monodisperse surface-functionalized gold nanoclusters

    PubMed Central

    Varela-Aramburu, Silvia; Wirth, Richard; Lai, Chian-Hui; Orts-Gil, Guillermo

    2016-01-01

    Summary Gold nanoclusters are small (1–3 nm) nanoparticles with a high surface area that are useful for biomedical studies and drug delivery. The synthesis of small, surface-functionalized gold nanoclusters is greatly dependent on the reaction conditions. Here, we describe a straightforward, efficient and robust room temperature one-pot synthesis of 2 nm gold nanoclusters using thioglucose as a reducing and stabilizing agent, which was discovered by serendipity. The resultant monodisperse gold nanoclusters are more stable than those generated using some other common methods. The carboxylic acid contained in the stabilizing agent on the cluster surface serves as anchor for nanocluster functionalization. Alternatively, the addition of thiols serves to functionalize the nanoclusters. The resulting non-cytotoxic nanoclusters are taken up by cells and constitute a tuneable platform for biomedical applications including drug delivery. PMID:27826501

  14. SDS bubbles functionalized with Gold nanoparticles and SERS applications

    NASA Astrophysics Data System (ADS)

    Navarro-Badilla, A.; Hurtado, R. Britto; Cortez-Valadez, M.; Perez-Rodriguez, A.; Flores-Acosta, M.; Maldonado-Arce, A.

    2017-03-01

    We present a method of incorporation of gold nanoparticles in SDS (sodium dodecyl sulfate) bubbles with a low polydispersity index (monodispersed nanoparticles). Both the bubbles and nanoparticles maintained their structural and morphologic properties after functionalization. The bubbles present a radio of 0.38 mm with a standard deviation of±0.018 mm. The gold nanoparticles were obtained with sucrose as the catalytic agent and ascorbic acid as the reducing agent. The nanoparticles display several geometric morphologies as well as sizes inferior to 50 nm, as observed in the images obtained with Transmission Electron Microscopy (TEM). The optical properties were studied by optical absorption spectroscopy. The absorption band linked to the surface plasmon resonance (SPR) is located at 550 nm before and after the functionalization of the bubbles. Moreover, microscopic bubbles with a diameter smaller than 1 μm with the ability to stabilize nanoparticles in their surface were found in isolated regions of the sample. Additionally, the Surface Enhancement Raman Spectroscopy (SERS) properties of the colloid were analyzed with common drugs.

  15. Functionalized Gold Nanorods for Tumor Imaging and Targeted Therapy

    PubMed Central

    Gui, Chen; Cui, Da-xiang

    2012-01-01

    Gold nanorods, as an emerging noble metal nanomaterial with unique properties, have become the new exciting focus of theoretical and experimental studies in the past few years. The structure and function of gold nanorods, especially their biocompatibility, optical property, and photothermal effects, have been attracting more and more attention. Gold nanorods exhibit great potential in applications such as tumor molecular imaging and photothermal therapy. In this article, we review some of the main advances made over the past few years in the application of gold nanorods in surface functionalization, molecular imaging, and photothermal therapy. We also explore other prospective applications and discuss the corresponding concepts, issues, approaches, and challenges, with the aim of stimulating broader interest in gold nanorod-based nanotechnology and improving its practical application. PMID:23691482

  16. Preparation of surfactant-stabilized gold nanoparticle-peptide nucleic acid conjugates

    NASA Astrophysics Data System (ADS)

    Duy, Janice; Connell, Laurie B.; Eck, Wolfgang; Collins, Scott D.; Smith, Rosemary L.

    2010-09-01

    A simple, two-step method of producing stable and functional peptide nucleic acid (PNA)-conjugated gold nanoparticles using a surfactant stabilization step is presented. PNA are DNA analogs with superior chemical stability and target discrimination, but their use in metallic nanoparticle systems has been limited by the difficulty of producing stable colloids of nanoparticle-PNA conjugates. In this work, the nonionic surfactant Tween 20 (polyoxyethylene (20) sorbitan monolaurate) was used to sterically shield gold surfaces prior to the addition of thiolated PNA, producing conjugates which remain dispersed in solution and retain the ability to hybridize to complementary nucleic acid sequences. The conjugates were characterized using transmission electron microscopy, dynamic light scattering, and UV-visible absorbance spectroscopy. PNA attachment to gold nanoparticles was confirmed with an enzyme-linked immunoassay, while the ability of nanoparticle-bound PNA to hybridize to its complement was demonstrated using labeled DNA.

  17. Functionalized Gold Nanoparticles: Synthesis, Properties and Applications--A Review.

    PubMed

    Alex, Saji; Tiwari, Ashutosh

    2015-03-01

    The past few decades have witnessed significant advances in the development of functionalized gold nanoparticles for applications in various fields such as chemistry, biology, pharmacy and physics. Although it has been more than 150 years since they were first synthesized, extensive research has recently been undertaken to improve or modify gold nanoparticles, thereby opening up opportunities to enhance and optimize their potential and breadth of their applicability. Recently developed methods have allowed a precise control of gold nanoparticle size and the modification of gold nanoparticles with suitable protecting and functionalizing agents, facilitate their applications in different areas such as chemical and biological sensing, imaging and biomedical applications. This review focuses on the recent developments in various methods for the size and shape controlled synthesis of gold nanoparticles, understanding of different properties of gold nanoparticles and their applications in various fields. Particular attention is given to the chemical and biological sensing applications of gold nanoparticles and on the advances in the controlled ordering of gold nanoparticles for creating nanostructures for diverse applications.

  18. The Oxidation of Cysteine, Cysteinesulfinic Acid and Cysteic Acid on a Polycrystalline Gold Electrode

    DTIC Science & Technology

    1993-04-15

    The mechanism of cysteine, cysteinesulfinic acid and cysteic acid electrooxidation in perchloric acid solutions has been studied using cyclic ... voltammetry . All compounds investigated have been found to be chemisorbed on a polycrystalline gold electrode and oxidized with four, two or one electron

  19. Oligonucleotide-Functionalized Anisotropic Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Jones, Matthew Robert

    In this thesis, we describe the properties of oligonucleotide-functionalized gold colloids under the unique set of conditions where the particles are geometrically anisotropic and have nanometer-scale dimensions. While nearly two decades of previous work elucidated numerous unexpected and emergent phenomena arising from the combination of inorganic nanoparticles with surface-bound DNA strands, virtually nothing was known about how these properties are altered when the shape of the nanoparticle core is chosen to be non-spherical. In particular, we are interested in understanding, and ultimately controlling, the ways in which these DNA-conjugated anisotropic nanostructures interact when their attraction is governed by programmable DNA hybridization events. Chapter 1 introduces the field of DNA-based materials assembly by discussing how nanoscale building blocks which present rigid, directional interactions can be thought of as possessing artificial versions of the familiar chemical principles of "bonds" and "valency". In chapter 2 we explore the fundamental interparticle binding thermodynamics of DNA-functionalized spherical and anisotropic nanoparticles, which reveals enormous preferences for collective ligand interactions occurring between flat surfaces over those that occur between curved surfaces. Using these insights, chapter 3 demonstrates that when syntheses produce mixtures of different nanoparticle shapes, the tailorable nature of DNA-mediated interparticle association can be used to selectively crystallize and purify the desired anisotropic nanostructure products, leaving spherical impurity particles behind. Chapter 4 leverages the principle that the flat facets of anisotropic particles generate directional DNA-based hybridization interactions to assemble a variety of tailorable nanoparticle superlattices whose symmetry and dimensionality are a direct consequence of the shape of the nanoparticle building block used in their construction. Chapter 5 explores

  20. Dilute nitric or nitrous acid solution containing halide ions as effective media for pure gold dissolution.

    PubMed

    Hojo, Masashi; Yamamoto, Masahiko; Okamura, Kei

    2015-08-14

    The greatly enhanced oxidation ability of dilute aqueous nitric acid (0.10-2.0 mol L(-1)) containing bromide and iodide salts as well as chloride salts has been examined based on the dissolution kinetics of pure gold at 30-60 °C. It has been found that bromide salts are more effective than chloride salts in gaining the ability of dissolving gold in dilute aqueous nitric acid solution. At 60 °C, a piece of gold-wire (ca. 20 mg) is dissolved in 20 mL of as low as 0.10 mol L(-1) HNO3 solution containing 1.0-5.0 mol L(-1) NaBr and the dissolution rate constant, log(k/s(-1)), increases linearly (from -5.78 to -4.52) with the increasing NaBr concentration. The addition of organic solvents, such as acetonitrile and acetic acid, causes acceleration of gold dissolution in LiBr and NaBr solutions. With increasing MeCN contents, for instance, the log(k/s(-1)) value of 0.10 mol L(-1) HNO3 solution containing 2.0 mol L(-1) NaBr increases linearly from -5.30 to -4.61 at 30% (v/v) MeCN. The bromide salts affect the gold dissolution rate constant in the order of KBr < NaBr < LiBr < CaBr2. With increasing NaI concentration (0.20-3.0 mol L(-1)), some acceleration in log(k/s(-1)) of 0.50 or 1.0 mol L(-1) HNO3 solution has been observed; however, the slope of acceleration as the function of NaI concentration is much smaller than that of NaCl or NaBr. The gold dissolution ability has been examined also for nitrous acid containing chloride and bromide ions at 35 °C. The NaNO2 solution containing twice or more amounts of HX (X = Cl, Br) gives the maximum efficiency for gold dissolution, according to the log(k/s(-1)) values of the mixed solutions of NaNO2 (0.10-2.0 mol L(-1)) and HX of various concentrations. The influence of oxidation by dilute nitric and nitrous acids on the gold dissolution is discussed from the standpoint of the redox potentials in "modified" aqueous solutions and not of the changes in the activity coefficients of ions.

  1. Peptide-functionalized iron oxide magnetic nanoparticle for gold mining

    NASA Astrophysics Data System (ADS)

    Shen, Wei-Zheng; Cetinel, Sibel; Sharma, Kumakshi; Borujeny, Elham Rafie; Montemagno, Carlo

    2017-02-01

    Here, we present our work on preparing a novel nanomaterial composed of inorganic binding peptides and magnetic nanoparticles for inorganic mining. Two previously selected and well-characterized gold-binding peptides from cell surface display, AuBP1 and AuBP2, were exploited. This nanomaterial (AuBP-MNP) was designed to fulfill the following two significant functions: the surface conjugated gold-binding peptide will recognize and selectively bind to gold, while the magnetic nano-sized core will respond and migrate according to the applied external magnetic field. This will allow the smart nanomaterial to mine an individual material (gold) from a pool of mixture, without excessive solvent extraction, filtration, and concentration steps. The working efficiency of AuBP-MNP was determined by showing a dramatic reduction of gold nanoparticle colloid concentration, monitored by spectroscopy. The binding kinetics of AuBP-MNP onto the gold surface was determined using surface plasmon resonance (SPR) spectroscopy, which exhibits around 100 times higher binding kinetics than peptides alone. The binding capacity of AuBP-MNP was demonstrated by a bench-top mining test with gold microparticles.

  2. Self-Assembled Monolayers of Dithiophosphinic Acids on Gold

    NASA Astrophysics Data System (ADS)

    San Juan, Ronan Roca

    This dissertation reports the synthesis of derivatives of dithiophosphinic acids (R1R2DTPAs), and the formation and characterization of DTPA SAMs on gold to build a knowledge base on their nature of binding, organization of the alkyl chains and electrochemical barrier properties. The binding of DTPA molecules on gold depends on the morphology of the gold film: They bind in a mixed monodentate and bidentate modes on standard as-deposited (As-Dep) gold, while they fully chelate on smoother template-stripped (TS) gold. Chapter 2 focuses on van der Waals interactions of various alkyl chain lengths of symmetrical R2DTPA SAMs, which increase with increasing chain lengths similar to those of the analogous n-alkanethiol SAMs, but with alkyl chains that are generally less dense than those of n-alkanethiol SAMs. Chapter 3 addresses why the DTPA compounds do not chelate on the standard As-Dep gold by comparing (C16)2DTPA SAM to (C16 )2DDP SAM. Here, side chain crystallinity stabilizes DTPA SAM structure at the expense of chelation of the DTPA molecules, which leads to a mixture of bidentate and monodentate DTPA molecules, whereas the increased flexibility of the chains in DDP due to the oxygen atoms retains chelation of the DDP molecules. Chapter 4 focuses on the SAMs formed from RlongRshort DTPAs, which shows that the length of the short chain spacer affects SAM packing density and thickness. The SAMs of these molecules also show homogeneous mixing of Rlong and Rshort chains. Chapter 5 investigates PhRDTPA SAMs in preparation for molecular junction studies. The chelation of PhRDTPA molecules on TS gold allows the PhRDTPAs to act as molecular alligator clips. The length of the alkyl chains controls the density of the phenyl group and they fill in the voids between adsorbates to prevent electrical shorting. Finally, Chapter 6 incorporates OH tail group(s) to control the wettability of DTPA SAMs. The presence of OH groups in DTPAs forms hydrophilic SAMs. The symmetrical OH

  3. DNA-functionalized gold nanoparticles in macromolecularly crowded polymer solutions.

    PubMed

    Shin, Jeehae; Zhang, Xu; Liu, Juewen

    2012-11-15

    DNA-functionalized gold nanoparticles (AuNPs) are one of the most commonly used reagents in nanobiotechnology. They are important not only for practical applications in analytical chemistry and drug delivery, but also for fundamental understanding of nanoscience. For biological samples such as blood serum or for intracellular applications, the effects of crowded cellular proteins and nucleic acids need to be considered. The thermodynamic effect of crowding is to induce nanoparticle aggregation. But before such aggregation can take place, there might also be a depletion repulsive barrier. Polyethylene glycol (PEG) is one of the most frequently used polymers to mimic the crowded cellular environment. We show herein that while DNA-functionalized AuNPs are very stable in buffer (e.g., no PEG) and citrate-capped AuNPs are very stable in PEG, DNA-functionalized AuNPs are unstable in PEG and are easily aggregated. Although such aggregation in PEG is mediated by DNA, no sharp melting transition typical for DNA-linked AuNPs is observed. We attribute this broad melting to depletion force instead of DNA base pairing. The effects of PEG molecular weight, concentration and temperature have been studied in detail and we also find an interesting PEG phase separation and AuNP partition into the water-rich phase at high temperature.

  4. Functionalized gold nanoparticles manifested as potent carriers for nucleolar targeting

    NASA Astrophysics Data System (ADS)

    Shahbazi, Reza; Ozcicek, Ilyas; Ozturk, Gurkan; Ulubayram, Kezban

    2017-01-01

    It is generally known that gold nanoparticles are localised in the cytoplasm and, if synthesised in small sizes or functionalized with specific proteins, they enter the cell nucleus. However, there is no report emphasising the importance of surface functionalization in their accumulation in the nucleolus. Here, for the first time in the literature, it is proposed that functionalization of gold nanoparticles with a thin layer of polyethyleneimine (PEI) spearheads them to the nucleolus of hard-to-transfect post-mitotic dorsal root ganglion neurones in a size-independent manner. As a potential for theranostic applications, it was found that functionalization with a thin layer of PEI affected the emission signal intensity of gold nanoparticles so that the cellular biodistribution of nanoparticles was visualised clearly under both confocal and two-photon microscopes.

  5. Relativistic effects on acidities and basicities of Brønsted acids and bases containing gold.

    PubMed

    Koppel, Ilmar A; Burk, Peeter; Kasemets, Kalev; Koppel, Ivar

    2013-11-07

    It is usually believed that relativistic effects as described by the Dirac-Schrödinger equation (relative to the classical or time-independent Schrödinger equation) are of little importance in chemistry. A closer look, however, reveals that some important and widely known properties (e.g., gold is yellow, mercury is liquid at room temperature) stem from relativistic effects. So far the influence of relativistic effects on the acid-base properties has been mostly ignored. Here we show that at least for compounds of gold such omission is completely erroneous and would lead to too high basicity and too low acidity values with errors in the range of 25-55 kcal mol(-1) (or 20 to 44 powers of ten in pK(a) units) in the gas-phase. These findings have important implications for the design of new superstrong acids and bases, and for the understanding of gold-catalysed reactions.

  6. Chemically functionalized gold nanoparticles: Synthesis, characterization, and applications

    NASA Astrophysics Data System (ADS)

    Daniel, Weston Lewis

    This thesis focuses on the development and application of gold nanoparticle based detection systems and biomimetic structures. Each class of modified nanoparticle has properties that are defined by its chemical moieties that interface with solution and the gold nanoparticle core. In Chapter 2, a comparison of the biomolecular composition and binding properties of various preparations of antibody oligonucleotide gold nanoparticle conjugates is presented. These constructs differed significantly in terms of their structure and binding properties. Chapter 3 reports the use of electroless gold deposition as a light scattering signal enhancer in a multiplexed, microarray-based scanometric immunoassay using the gold nanoparticle probes evaluated in Chapter 2. The use of gold development results in greater signal enhancement than the typical silver development, and multiple rounds of metal development were found to increase the resulting signal compared to one development. Chapter 4 describes an amplified scanometric detection method for human telomerase activity. Gold nanoparticles functionalized with specific oligonucleotide sequences can efficiently capture telomerase enzymes and subsequently be elongated. Both the elongated and unmodified oligonucleotide sequences are simultaneously measured. At low telomerase concentrations, elongated strands cannot be detected, but the unmodified sequences, which come from the same probe particles, can be detected because their concentration is higher, providing a novel form of amplification. Chapter 5 reports the development of a novel colorimetric nitrite and nitrate ion assay based upon gold nanoparticle probes functionalized with Griess reaction reagents. This assay takes advantage of the distance-dependent plasmonic properties of the gold nanoparticles and the ability of nitrite ion to facilitate the cross coupling of novel nanoparticle probes. The assay works on the concept of a kinetic end point and can be triggered at the EPA

  7. Influence of gold nanoparticles on platelets functional activity in vitro

    NASA Astrophysics Data System (ADS)

    Akchurin, Garif G.; Akchurin, George G.; Ivanov, Alexey N.; Kirichuk, Vyacheslav F.; Terentyuk, George S.; Khlebtsov, Boris N.; Khlebtsov, Nikolay G.

    2008-02-01

    Now in the leading biomedical centers of the world approved new technology of laser photothermal destruction of cancer cells using plasmon gold nanoparticles. Investigations of influence of gold nanoparticles on white rat platelets aggregative activity in vitro have been made. Platelet aggregation was investigated in platelet rich plasma (PRP) with help of laser analyzer 230 LA <>, Russia). Aggregation inductor was ADP solution in terminal concentration 2.5 micromole (<>, Russia). Gold nanoshells soluted in salt solution were used for experiments. Samples of PRP were incubated with 50 or 100 μl gold nanoshells solution in 5 minute, after that we made definition ADP induced platelet aggregation. We found out increase platelet function activity after incubation with nanoparticles solution which shown in maximum ADP-induced aggregation degree increase. Increase platelet function activity during intravenous nanoshells injection can be cause of thrombosis on patients. That's why before clinical application of cancer cell destruction based on laser photothermal used with plasmon gold nanoparticles careful investigations of thrombosis process and detail analyze of physiological blood parameters are very necessary.

  8. Gold

    USGS Publications Warehouse

    Kirkemo, Harold; Newman, William L.; Ashley, Roger P.

    1998-01-01

    Through the ages, men and women have cherished gold, and many have had a compelling desire to amass great quantities of it -- so compelling a desire, in fact, that the frantic need to seek and hoard gold has been aptly named "gold fever." Gold was among the first metals to be mined because it commonly occurs in its native form -- that is, not combined with other elements -- because it is beautiful and imperishable, and because exquisite objects can be made from it.

  9. Functionalized gold nanorod solution via reverse micelle based polyacrylate coating.

    PubMed

    Basiruddin, S K; Saha, Arindam; Pradhan, Narayan; Jana, Nikhil R

    2010-05-18

    Functionalization of gold nanorods is a key issue for their biomedical application, and currently it is performed via either electrostatic interaction or thiol based strategy. We have developed a polyacrylate based coating chemistry for gold nanorods that can be used in deriving a variety of functional nanorods with high colloidal stability. The coating processes can introduce primary amines, fluorescein, or poly(ethylene glycol) (PEG) on the nanorod surface in one step process. While fluorescein incorporation can produce fluorescent nanorods, primary amine groups can be used for further functionalization. Various functional nanorods have been successfully synthesized from these coated nanorods and used in different applications. Glucose and biotin functionalized nanorods are used for protein detection, and oleyl functionalized nanorods with fluorescein incorporated in the polymer shell are used for fluorescence based cell labeling.

  10. Synthesis and Functionalization of Gold Nanoparticles Using Chemically Modified ssDNA

    NASA Astrophysics Data System (ADS)

    Calabrese, P. G.

    In the first part of this thesis, methods for functionalizing spherical gold nanoparticles with nucleic acid binding ligands (aptamers) that target the VEGF receptor complex were developed. In order to provide a multiplexed labeling strategy for imaging the VEGF receptor complex in electron microscopy, gold nanoparticles of distinct sizes were conjugated to modified ssDNA aptamers that target the VEGF-A cytokine, the VEGFR-2 RTK receptor and a membrane associated co-receptor, Nrp-1. The modified ssDNA gold nanoparticle conjugates were applied to a human lung carcinoma cell line (A549) which has been shown to express each of these proteins and used as a model system for VEGF signaling. Binding constants for the modified aptamers were also determined using a fluorescence polarization anisotropy assay to determine KD and KOFF for the aptamers with their respective proteins. In the latter part of this thesis, a modied ssDNA SELEX protocol was also developed in order to evolve imidazole modied ssDNA sequences that assemble gold nanoparticles from Au3+ precursor ions in aqueous solution. Active sequences bound to nanoparticles were partitioned from inactive sequences based on density via ultracentrifugation through a discontinuous sucrose gradient. Colloidal gold solutions produced by the evolved pool had a distinct absorbance spectra and produced nanoparticles with a narrower distribution of sizes compared to colloidal gold solutions produced by the starting randomized pool of imidazole modified ssDNA. Sequencing data from the evolved pool shows that conserved 5 and 6 nt motifs were shared amongst many of the isolates, which indicates that these motifs could serve as chelation sites for gold atoms or help stabilize colloidal gold solutions in a base specific manner.

  11. Antithrombotic functions of small molecule-capped gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Tian, Yue; Zhao, Yuyun; Zheng, Wenfu; Zhang, Wei; Jiang, Xingyu

    2014-07-01

    Here we report the antithrombotic functions of pyrimidinethiol-capped gold nanoparticles (Au_DAPT NPs). They can prolong coagulation parameters when injected intravenously in normal mice. Applied in two typical thrombosis models, mice tail thrombosis and pulmonary thromboembolism, gold NPs can inhibit both thrombosis and improve the survival rates of mice tremendously, without increasing the bleeding risk. The anticoagulant mechanisms include inhibiting the platelet aggregation as well as interfering with thrombin and fibrin generation.Here we report the antithrombotic functions of pyrimidinethiol-capped gold nanoparticles (Au_DAPT NPs). They can prolong coagulation parameters when injected intravenously in normal mice. Applied in two typical thrombosis models, mice tail thrombosis and pulmonary thromboembolism, gold NPs can inhibit both thrombosis and improve the survival rates of mice tremendously, without increasing the bleeding risk. The anticoagulant mechanisms include inhibiting the platelet aggregation as well as interfering with thrombin and fibrin generation. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr01937g

  12. Artifacts resembling budding bacteria produced in placer-gold amalgams by nitric acid leaching

    USGS Publications Warehouse

    Watterson, J.R.

    1994-01-01

    Microscopic filiform morphologies in gold which are indistinguishable from forms originally interpreted as bacterial in origin were produced in the laboratory by treating amalgams made from natural and artificial gold with hot nitric acid. Textures ranging from cobblestone to deeply crenulated to nodular filiform were produced in the laboratory from all tested natural and artificial gold amalgams; analogous textures widespread in Alaskan placer gold may have a similar inorganic origin. These results indicate that morphology alone cannot be considered adequate evidence of microbial involvement in gold formation. -Author

  13. Artifacts resembling budding bacteria produced in placer-gold amalgams by nitric acid leaching

    USGS Publications Warehouse

    Watterson, J.R.

    1994-01-01

    Microscopic filiform morphologies in gold which are indistinguishable from forms originally interpreted as bacterial in origin were produced in the laboratory by treating amalgams made from natural and artificial gold with hot nitric acid. Textures ranging from cobblestone to deeply crenulated to nodular filiform were produced in the laboratory from all tested natural and artificial gold amalgams; analogous textures widespread in Alaskan placer gold may have a similar inorganic origin. These results indicate that morphology alone cannot be considered adequate evidence of microbial involvement in gold formation.

  14. Sensitive immunodetection through impedance measurements onto gold functionalized electrodes.

    PubMed

    Ameur, S; Martelet, C; Jaffrezic-Renault, N; Chovelon, J M

    2000-01-01

    This article deals with a direct electrochemical method of detecting antigens using new methods of functionalization of gold electrodes. Based on the reacting ability of gold with sulfhydryl groups, three protocols for the fixation of antibodies have been explored. They are based on either the self-assembling properties of functional thiols bearing long alkyl chains or the possibility of a direct coupling of antibody moieties. Coverage rates as high as 97% can be reached. The analysis of the electrochemical impedance behavior of such layers can lead to a sensitive method for the direct detection of the antibody/antigen interaction. The addition of a redox couple in the tested solution, acting as an amplifier, allowed detection limits for the antigens as low as a few picograms/milliliter to be reached.

  15. Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.

    PubMed

    Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M

    2012-03-27

    In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages.

  16. Method of making gold thiolate and photochemically functionalized microcantilevers

    DOEpatents

    Boiadjiev, Vassil I [Knoxville, TN; Brown, Gilbert M [Knoxville, TN; Pinnaduwage, Lal A [Knoxville, TN; Thundat, Thomas G [Knoxville, TN; Bonnesen, Peter V [Knoxville, TN; Goretzki, Gudrun [Nottingham, GB

    2009-08-25

    Highly sensitive sensor platforms for the detection of specific reagents, such as chromate, gasoline and biological species, using microcantilevers and other microelectromechanical systems (MEMS) whose surfaces have been modified with photochemically attached organic monolayers, such as self-assembled monolayers (SAM), or gold-thiol surface linkage are taught. The microcantilever sensors use photochemical hydrosilylation to modify silicon surfaces and gold-thiol chemistry to modify metallic surfaces thereby enabling individual microcantilevers in multicantilever array chips to be modified separately. Terminal vinyl substituted hydrocarbons with a variety of molecular recognition sites can be attached to the surface of silicon via the photochemical hydrosilylation process. By focusing the activating UV light sequentially on selected silicon or silicon nitride hydrogen terminated surfaces and soaking or spotting selected metallic surfaces with organic thiols, sulfides, or disulfides, the microcantilevers are functionalized. The device and photochemical method are intended to be integrated into systems for detecting specific agents including chromate groundwater contamination, gasoline, and biological species.

  17. Radiotracer study of the adsorption of organic compounds on gold. adsorption of chloroacetic and phenylacetic acid, and the effects of cadmium, copper, and silver adatoms on it

    SciTech Connect

    Horani, G.; Andreev, V.N.; Vazarinov, V.E.

    1986-04-01

    This paper studies the adsorption of monochloroacetic and phenylacetic acid (MA and PA, respectively) by the radiotracer technique on gold-plated gold electrodes in acidic solutions. The authors also study the effect of cadmium, copper, and silver adatoms on these processes. The adsorption of MA was measured as a function of potential of the electrode. Data from these measurements are presented. Data show that cadmium, copper, and silver ions present in the solution have no effect on the adsorption of PA at potentials where they are not adsorbed on the gold surface. It is confirmed that the radiotracer technique will be as effective in adsorption studies on the gold-plated gold electrode as it was in the case of the platinized platinum electrode.

  18. Spectrophotometric determination of gold(iii) with p-dimethylaminobenzilidenerhodanine in hydrochloric acid-ethanol medium.

    PubMed

    Borissova, R

    The reaction between gold(III) and p-dimethylaminobenzilidenerhodanine in hydrochloric acid medium containing 20% v/v ethanol has been studied spectrophotometrically. It has been established that the process is very complicated: gold(III) is reduced to gold(I) which reacts with unchanged reagent. The value of the equilibrium constant is 2.56 +/- 0.45. Conditions are proposed for the determination of 2-8 mug of gold in 25 ml, with a standard deviation of 0.04 mug 25 ml .

  19. Adsorption Study of Cysteine, N-Acetylcysteamine, Cysteinesulfinic Acid and Cysteic Acid on a Polycrystalline Gold Electrode

    DTIC Science & Technology

    1993-04-15

    effectively increases packing density of cysteine at the electrode surface. Films of N- acetyl - cysteamine are more hydrophobic than those of cysteine ... Cysteine , N-acetylcysteamine, CysteinesulImic Acid and Cysteic Acid on a Polycrystalline Gold Electrode by W. Ronald Fawcett, Milan Fedurco, Zuzana...200 words) Capacity against potential data for the adsorption of cysteine and Other organosulfur Compounds on polyc~rysraline gold are reported

  20. Trace cancer biomarker quantification using polystyrene-functionalized gold nanorods

    PubMed Central

    Wu, Jian; Li, Wei; Hajisalem, Ghazal; Lukach, Ariella; Kumacheva, Eugenia; Hof, Fraser; Gordon, Reuven

    2014-01-01

    We demonstrate the application of polystyrene-functionalized gold nanorods (AuNRs) as a platform for surface enhanced Raman scattering (SERS) quantification of the exogenous cancer biomarker Acetyl Amantadine (AcAm). We utilize the hydrophobicity of the polystyrene attached to the AuNR surface to capture the hydrophobic AcAm from solution, followed by drying and detection using SERS. We achieve a detection limit of 16 ng/mL using this platform. This result shows clinical potential for low-cost early cancer detection. PMID:25574423

  1. Effect of gold sodium thiomalate on murine lymphocyte functions.

    PubMed Central

    Jennings, J J; Macrae, S; Gorczynski, R M

    1979-01-01

    The in vitro effects of gold sodium thiomalate (GTM) on various murine splenic lymphocytic functions were tested. The presence of GTM in cultures of splenic cells suppressed anti-hapten responses to both thymus-independent and thymus-dependent antigens. GTM also suppressed the in vitro generation of cytotoxic effector cells as well as the mitogenic response to both T cell and B cell mitogens. This suppression could not be reversed by the addition of irradiated spleen cells. Spleen cells exposed to GTM for 4 hr prior to culture also exhibited similarly suppressed functions, although their functional capacity could be fully restored by the addition of irradiated spleen cells. These results show that GTM inhibits both humoral and cellular immune mechanisms and appears to act primarily at the accessory (macrophage) cell level, with perhaps a secondary effect on T lymphocytes. PMID:113153

  2. Label-free amino acid detection based on nanocomposites of graphene oxide hybridized with gold nanoparticles.

    PubMed

    Zhang, Qian; Zhang, Diming; Lu, Yanli; Xu, Gang; Yao, Yao; Li, Shuang; Liu, Qingjun

    2016-03-15

    Nanocomposites of graphene oxide and gold nanoparticles (GO/GNPs) were synthesized for label-free detections of amino acids. Interactions between the composites and amino acids were investigated by both naked-eye observation and optical absorption spectroscopy. The GO/GNPs composites displayed apparent color changes and absorption spectra changes in presences of amino acids including glutamate, aspartate, and cysteine. The interaction mechanisms of the composites and amino acids were discussed and explored with sulfhydryl groups and non-α-carboxylic groups on the amino acids. Sensing properties of the composites were tested, while pure gold particles were used as the control. The results suggested that the GO/GNPs composites had better linearity and stability in dose-dependent responses to the amino acids than those of the particles, especially in detections for acidic amino acids. Therefore, the nanocomposites platform can provide a convenient and efficient approach for label-free optical detections of important molecules such as amino acids.

  3. Electrospun carbon nanotubes-gold nanoparticles embedded nanowebs: prosperous multi-functional nanomaterials

    NASA Astrophysics Data System (ADS)

    Kim, Tae-Gyung; Ragupathy, Dhanusuraman; Iyengar Gopalan, Anantha; Lee, Kwang-Pill

    2010-04-01

    Electrospinning was employed to prepare new multi-functional nanowebs. Cyclodextrin based inclusion complex (CD-IC) was used to disperse multiwalled carbon nanotubes (MWNT) within electrospun polyvinylidene fluoride nanofibrous membranes (PVdF-NFM). Subsequently, MWNT(CD-IC)/PVdF-NFM was loaded with gold (Au) particles. The morphology, structure and thermal properties of Au/MWNT(CD-IC)/PVdF-NFM were investigated by transmission electron microscopy, field emission scanning electron microscopy, FT-IR spectroscopy, x-ray diffraction spectroscopy and differential scanning calorimetry. The new Au/MWNT(CD-IC)/PVdF-NFM is electroactive and shows excellent electrocatalytic activity towards oxidation of ascorbic acid.

  4. Electrospun carbon nanotubes-gold nanoparticles embedded nanowebs: prosperous multi-functional nanomaterials.

    PubMed

    Kim, Tae-Gyung; Ragupathy, Dhanusuraman; Gopalan, Anantha Iyengar; Lee, Kwang-Pill

    2010-04-02

    Electrospinning was employed to prepare new multi-functional nanowebs. Cyclodextrin based inclusion complex (CD-IC) was used to disperse multiwalled carbon nanotubes (MWNT) within electrospun polyvinylidene fluoride nanofibrous membranes (PVdF-NFM). Subsequently, MWNT(CD-IC)/PVdF-NFM was loaded with gold (Au) particles. The morphology, structure and thermal properties of Au/MWNT(CD-IC)/PVdF-NFM were investigated by transmission electron microscopy, field emission scanning electron microscopy, FT-IR spectroscopy, x-ray diffraction spectroscopy and differential scanning calorimetry. The new Au/MWNT(CD-IC)/PVdF-NFM is electroactive and shows excellent electrocatalytic activity towards oxidation of ascorbic acid.

  5. Efficient nucleic acid delivery to murine regulatory T cells by gold nanoparticle conjugates

    PubMed Central

    Gamrad, Lisa; Rehbock, Christoph; Westendorf, Astrid M.; Buer, Jan; Barcikowski, Stephan; Hansen, Wiebke

    2016-01-01

    Immune responses have to be tightly controlled to guarantee maintenance of immunological tolerance and efficient clearance of pathogens and tumorigenic cells without induction of unspecific side effects. CD4+ CD25+ regulatory T cells (Tregs) play an important role in these processes due to their immunosuppressive function. Genetic modification of Tregs would be helpful to understand which molecules and pathways are involved in their function, but currently available methods are limited by time, costs or efficacy. Here, we made use of biofunctionalized gold nanoparticles as non-viral carriers to transport genetic information into murine Tregs. Confocal microscopy and transmission electron microscopy revealed an efficient uptake of the bioconjugates by Tregs. Most importantly, coupling eGFP-siRNA to those particles resulted in a dose and time dependent reduction of up to 50% of eGFP expression in Tregs isolated from Foxp3eGFP reporter mice. Thus, gold particles represent a suitable carrier for efficient import of nucleic acids into murine CD4+ CD25+ Tregs, superior to electroporation. PMID:27381215

  6. Gold-functionalized magnetic nanoparticles restrict growth of Pseudomonas aeruginosa.

    PubMed

    Niemirowicz, Katarzyna; Swiecicka, Izabela; Wilczewska, Agnieszka Z; Misztalewska, Iwona; Kalska-Szostko, Beata; Bienias, Kamil; Bucki, Robert; Car, Halina

    2014-01-01

    Superparamagnetic iron oxide nanoparticles (SPIONs) and their derivatives (aminosilane and gold-coated) have been widely investigated in numerous medical applications, including their potential to act as antibacterial drug carriers that may penetrate into bacteria cells and biofilm mass. Pseudomonas aeruginosa is a frequent cause of infection in hospitalized patients, and significant numbers of currently isolated clinical strains are resistant to standard antibiotic therapy. Here we describe the impact of three types of SPIONs on the growth of P. aeruginosa during long-term bacterial culture. Their size, structure, and physicochemical properties were determined using transmission electron microscopy, X-ray diffraction analysis, and Fourier transform infrared spectroscopy. We observed significant inhibition of P. aeruginosa growth in bacterial cultures continued over 96 hours in the presence of gold-functionalized nanoparticles (Fe₃O₄@Au). At the 48-hour time point, growth of P. aeruginosa, as assessed by the number of colonies grown from treated samples, showed the highest inhibition (decreased by 40%). These data provide strong evidence that Fe₃O₄@Au can dramatically reduce growth of P. aeruginosa and provide a platform for further study of the antibacterial activity of this nanomaterial.

  7. SERS detection of uranyl using functionalized gold nanostars promoted by nanoparticle shape and size.

    PubMed

    Lu, Grace; Forbes, Tori Z; Haes, Amanda J

    2016-08-15

    The radius of curvature of gold (Au) nanostar tips but not the overall particle dimensions can be used for understanding the large and quantitative surface-enhanced Raman scattering (SERS) signal of the uranyl (UO2)(2+) moiety. The engineered roughness of the Au nanostar architecture and the distance between the gold surface and uranyl cations are promoted using carboxylic acid terminated alkanethiols containing 2, 5, and 10 methylene groups. By systematically varying the self-assembled monolayer (SAM) thickness with these molecules, the localized surface plasmon resonance (LSPR) spectral properties are used to quantify the SAM layer thickness and to promote uranyl coordination to the Au nanostars in neutral aqueous solutions. Successful uranyl detection is demonstrated for all three functionalized Au nanostar samples as indicated by enhanced signals and red-shifts in the symmetric U(vi)-O stretch. Quantitative uranyl detection is achieved by evaluating the integrated area of these bands in the uranyl fingerprint window. By varying the concentration of uranyl, similar free energies of adsorption are observed for the three carboxylic acid terminated functionalized Au nanostar samples indicating similar coordination to uranyl, but the SERS signals scale inversely with the alkanethiol layer thickness. This distance dependence follows previously established models assuming that roughness features associated with the radius of curvature of the tips are considered. These results indicate that SERS signals using functionalized Au nanostar substrates can provide quantitative detection of small molecules and that the tip architecture plays an important role in understanding the resulting SERS intensities.

  8. One pot, rapid and efficient synthesis of water dispersible gold nanoparticles using alpha-amino acids

    NASA Astrophysics Data System (ADS)

    Wangoo, Nishima; Kaur, Sarabjit; Bajaj, Manish; Jain, D. V. S.; Sharma, Rohit K.

    2014-10-01

    A detailed study on the synthesis of spherical and monodispersed gold nanoparticles (AuNPs) using all of the 20 naturally occurring α-amino acids has been reported. The synthesized nanoparticles have been further characterized using various techniques such as absorbance spectroscopy, transmission electron microscopy, dynamic light scattering and nuclear magnetic resonance. Size control of the nanoparticles has been achieved by varying the ratio of the gold ion to the amino acid. These monodispersed water soluble AuNPs synthesized using non-toxic, naturally occurring α-amino acids as reducing and capping/stabilizing agents serve as a remarkable example of green chemistry.

  9. A homogeneous hemin/G-quadruplex DNAzyme based turn-on chemiluminescence aptasensor for interferon-gamma detection via in-situ assembly of luminol functionalized gold nanoparticles, deoxyribonucleic acid, interferon-gamma and hemin.

    PubMed

    Jiang, Jie; He, Yi; Yu, Xiuxia; Zhao, Jinyang; Cui, Hua

    2013-08-12

    A homogeneous hemin/G-quadruplex DNAzyme (HGDNAzyme) based turn-on chemiluminescence aptasensor for interferon-gamma (IFN-γ) detection is developed, via dynamic in-situ assembly of luminol functionalized gold nanoparticles (lum-AuNPs), DNA, IFN-γ and hemin. The G-quadruplex oligomer of the HGDNAzyme was split into two halves, which was connected with the complementary sequence of P1 (IFN-γ-binding aptamer) to form the oligonucleotide P2. P2 hybridized with IFN-γ-binding aptamer and meanwhile assembled onto lum-AuNPs through biotin-streptavidin specific interaction. When IFN-γ was recognized by aptamer, P2 was released into the solution. The two lateral portions of P2 combined with hemin to yield the catalytic hemin/G-quadruplex DNAzyme, which amplified the luminol oxidation for a turn-on chemiluminescence signaling. Based on this strategy, the homogeneous aptasensor enables the facile detection of IFN-γ in a range of 0.5-100 nM. Moreover, the aptasensor showed high sensitivity (0.4 nM) and satisfactory specificity, pointing to great potential applications in clinical analysis.

  10. Mechanistic Insights into the Catalytic Oxidation of Carboxylic Acids on Au/TiO2: Partial Oxidation of Propionic and Butyric Acid to Gold Ketenylidene through Unsaturated Acids

    DOE PAGES

    McEntee, Monica; Tang, Wenjie; Neurock, Matthew; ...

    2014-12-12

    Here, the partial oxidation of model C2–C4 (acetic, propionic, and butyric) carboxylic acids on Au/TiO2 catalysts consisting of Au particles ~3 nm in size was investigated using transmission infrared spectroscopy and density functional theory. All three acids readily undergo oxidative dehydrogenation on Au/TiO2. Propionic and butyric acid dehydrogenate at the C2–C3 positions, whereas acetic acid dehydrogenates at the C1–C2 position. The resulting acrylate and crotonate intermediates are subsequently oxidized to form β-keto acids that decarboxylate. All three acids form a gold ketenylidene intermediate, Au2C=C=O, along the way to their full oxidation to form CO2. Infrared measurements of Au2C=C=O formation asmore » a function of time provides a surface spectroscopic probe of the kinetics for the activation and oxidative dehydrogenation of the alkyl groups in the carboxylate intermediates that form.« less

  11. Fabrication and functionalization of PCB gold electrodes suitable for DNA-based electrochemical sensing.

    PubMed

    Salvo, P; Henry, O Y F; Dhaenens, K; Acero Sanchez, J L; Gielen, A; Werne Solnestam, B; Lundeberg, J; O'Sullivan, C K; Vanfleteren, J

    2014-01-01

    The request of high specificity and selectivity sensors suitable for mass production is a constant demand in medical research. For applications in point-of-care diagnostics and therapy, there is a high demand for low cost and rapid sensing platforms. This paper describes the fabrication and functionalization of gold electrodes arrays for the detection of deoxyribonucleic acid (DNA) in printed circuit board (PCB) technology. The process can be implemented to produce efficiently a large number of biosensors. We report an electrolytic plating procedure to fabricate low-density gold microarrays on PCB suitable for electrochemical DNA detection in research fields such as cancer diagnostics or pharmacogenetics, where biosensors are usually targeted to detect a small number of genes. PCB technology allows producing high precision, fast and low cost microelectrodes. The surface of the microarray is functionalized with self-assembled monolayers of mercaptoundodecanoic acid or thiolated DNA. The PCB microarray is tested by cyclic voltammetry in presence of 5 mM of the redox probe K3Fe(CN6) in 0.1 M KCl. The voltammograms prove the correct immobilization of both the alkanethiol systems. The sensor is tested for detecting relevant markers for breast cancer. Results for 5 nM of the target TACSTD1 against the complementary TACSTD1 and non-complementary GRP, MYC, SCGB2A1, SCGB2A2, TOP2A probes show a remarkable detection limit of 0.05 nM and a high specificity.

  12. The dynamics of complex formation between amylose brushes on gold and fatty acids by QCM-D.

    PubMed

    Cao, Zheng; Tsoufis, Theodoros; Svaldo-Lanero, Tiziana; Duwez, Anne-Sophie; Rudolf, Petra; Loos, Katja

    2013-10-14

    Amylose brushes were synthesized by enzymatic polymerization with glucose-1-phosphate as monomer and rabbit muscle phosphorylase b as catalyst on gold-covered surfaces of a quartz crystal microbalance. Fourier transform infrared (FT-IR) spectra confirmed the presence of the characteristic absorption peaks of amylose between 3100 cm(-1) and 3500 cm(-1). The thickness of the amylose brushes-measured by Spectroscopic Ellipsometry--can be tailored from 4 to 20 nm, depending on the reaction time. The contour length of the stretched amylose chains on gold surfaces has been evaluated by single molecule force spectroscopy, and a total chain length of about 20 nm for 16.2 nm thick amylose brushes was estimated. X-ray photoelectron spectroscopy (XPS) was employed to characterize the amylose brushes before and after the adsorption of fatty acids. The dynamics of inclusion complex formation between amylose brushes and two fatty acids (octanoic acid and myristic acid) with different chain length was investigated as a function of time using a quartz crystal microbalance with dissipation monitoring (QCM-D) immersed in the liquid phase. QCM-D signals including the frequency and dissipation shifts elucidated the effects of the fatty acid concentration, the solvent types, the chain length of the fatty acids and the thickness of the amylose brushes on the dynamics of fatty acid molecule adsorption on the amylose brush-modified sensor surfaces.

  13. Induced pH-dependent shift by local surface plasmon resonance in functionalized gold nanorods

    PubMed Central

    2013-01-01

    Localized surface plasmon resonance (LSPR) spectroscopy of metallic nanoparticles is a powerful tool for chemical and biological sensing experiments. In this study, we observed LSPR shifts of 11-mercaptoundecanoic acid modified gold nanorods (GNR-MUA) for the pH range of 6.41 to 8.88. We proposed a mechanism involving changes of the dipole moment after protonation/deprotonation carboxylic groups of 11-mercaptoundecanoic acid (MUA) which plays an important role by modulating LSPR around the functionalized GNR. Such a stable and easily prepared GNR-MUA has potential to become one of the most efficient and promising pH nanosensors to study intra- or extra-cellular pH in a wide range of chemical or biological systems. PMID:23432999

  14. Fatty acids and lymphocyte functions.

    PubMed

    Calder, P C; Yaqoob, P; Thies, F; Wallace, F A; Miles, E A

    2002-01-01

    The immune system acts to protect the host against pathogenic invaders. However, components of the immune system can become dysregulated such that their activities are directed against host tissues, so causing damage. Lymphocytes are involved in both the beneficial and detrimental effects of the immune system. Both the level of fat and the types of fatty acid present in the diet can affect lymphocyte functions. The fatty acid composition of lymphocytes, and other immune cells, is altered according to the fatty acid composition of the diet and this alters the capacity of those cells to produce eicosanoids, such as prostaglandin E2, which are involved in immunoregulation. A high fat diet can impair lymphocyte function. Cell culture and animal feeding studies indicate that oleic, linoleic, conjugated linoleic, gamma-linolenic, dihomo-gamma-linolenic, arachidonic, alpha-linolenic, eicosapentaenoic and docosahexaenoic acids can all influence lymphocyte proliferation, the production of cytokines by lymphocytes, and natural killer cell activity. High intakes of some of these fatty acids are necessary to induce these effects. Among these fatty acids the long chain n-3 fatty acids, especially eicosapentaenoic acid, appear to be the most potent when included in the human diet. Although not all studies agree, it appears that fish oil, which contains eicosapentaenoic acid, down regulates the T-helper 1-type response which is associated with chronic inflammatory disease. There is evidence for beneficial effects of fish oil in such diseases; this evidence is strongest for rheumatoid arthritis. Since n-3 fatty acids also antagonise the production of inflammatory eicosanoid mediators from arachidonic acid, there is potential for benefit in asthma and related diseases. Recent evidence indicates that fish oil may be of benefit in some asthmatics but not others.

  15. Structure and function evolution of thiolate monolayers on gold

    SciTech Connect

    Edwards, Grant Alvin

    2006-01-01

    The use of n-alkanethiolate self-assembled monolayers on gold has blossomed in the past few years. These systems have functioned as models for common interfaces. Thiolate monolayers are ideal because they are easily modified before or after deposition. The works contained within this dissertation include interfacial characterization (infrared reflection absorption spectroscopy, ellipsometry, contact angle, scanning probe microscopy, and heterogeneous electron-transfer kinetics) and various modeling scenarios. The results of these characterizations present ground-breaking insights into the structure, function, and reproducible preparation of these monolayers. Surprisingly, three interfacial properties (electron-transfer, contact angle, and ellipsometry) were discovered to depend directly on the odd-even character of the monolayer components. Molecular modeling was utilized to investigate adlayer orientation, and suggests that these effects are adlayer structure specific. Finally, the electric force microscopy and theoretical modeling investigations of monolayer samples are presented, which show that the film dielectric constant, thickness, and dipole moment directly affect image contrast. In addition, the prospects for utilization of this emerging technique are outlined.

  16. Structure and Function Evolution of Thiolate Monolayers on Gold

    SciTech Connect

    Edwards, Grant Alvin

    2006-01-01

    The use of n-alkanethiolate self-assembled monolayers on gold has blossomed in the past few years. These systems have functioned as models for common interfaces. Thiolate monolayers are ideal because they are easily modified before or after deposition. The works contained within this dissertation include interfacial characterization (inbred reflection absorption spectroscopy, ellipsometry, contact angle, scanning probe microscopy, and heterogeneous electron-transfer kinetics) and various modeling scenarios. The results of these characterizations present ground-breaking insights into the structure, function, and reproducible preparation of these monolayers. Surprisingly, three interfacial properties (electron-transfer, contact angle, and ellipsometry) were discovered to depend directly on the odd-even character of the monolayer components. Molecular modeling was utilized to investigate adlayer orientation, and suggests that these effects are adlayer structure specific. Finally, the electric force microscopy and theoretical modeling investigations of monolayer samples are presented, which show that the film dielectric constant, thickness, and dipole moment directly affect image contrast. In addition, the prospects for utilization of this emerging technique are outlined.

  17. Charge transport through dicarboxylic-acid-terminated alkanes bound to graphene-gold nanogap electrodes

    NASA Astrophysics Data System (ADS)

    Liu, Longlong; Zhang, Qian; Tao, Shuhui; Zhao, Cezhou; Almutib, Eman; Al-Galiby, Qusiy; Bailey, Steven W. D.; Grace, Iain; Lambert, Colin J.; Du, Jun; Yang, Li

    2016-07-01

    Graphene-based electrodes are attractive for single-molecule electronics due to their high stability and conductivity and reduced screening compared with metals. In this paper, we use the STM-based matrix isolation I(s) method to measure the performance of graphene in single-molecule junctions with one graphene electrode and one gold electrode. By measuring the length dependence of the electrical conductance of dicarboxylic-acid-terminated alkanes, we find that the transport is consistent with phase-coherent tunneling, but with an attenuation factor of βN = 0.69 per methyl unit, which is lower than the value measured for Au-molecule-Au junctions. Comparison with density-functional-theory calculations of electron transport through graphene-molecule-Au junctions and Au-molecule-Au junctions reveals that this difference is due to the difference in Fermi energies of the two types of junction, relative to the frontier orbitals of the molecules. For most molecules, their electrical conductance in graphene-molecule-Au junctions is higher than that in Au-molecule-Au junctions, which suggests that graphene offers superior electrode performance, when utilizing carboxylic acid anchor groups.Graphene-based electrodes are attractive for single-molecule electronics due to their high stability and conductivity and reduced screening compared with metals. In this paper, we use the STM-based matrix isolation I(s) method to measure the performance of graphene in single-molecule junctions with one graphene electrode and one gold electrode. By measuring the length dependence of the electrical conductance of dicarboxylic-acid-terminated alkanes, we find that the transport is consistent with phase-coherent tunneling, but with an attenuation factor of βN = 0.69 per methyl unit, which is lower than the value measured for Au-molecule-Au junctions. Comparison with density-functional-theory calculations of electron transport through graphene-molecule-Au junctions and Au

  18. Functional nucleic acid probes and uses thereof

    DOEpatents

    Nilsen-Hamilton, Marit

    2006-10-03

    The present invention provides functional nucleic acid probes, and methods of using functional nucleic acid probes, for binding a target to carry out a desired function. The probes have at least one functional nucleic acid, at least one regulating nucleic acid, and at least one attenuator. The functional nucleic acid is maintained in an inactive state by the attenuator and activated by the regulating nucleic acid only in the presence of a regulating nucleic acid target. In its activated state the functional nucleic acid can bind to its target to carry out a desired function, such as generating a signal, cleaving a nucleic acid, or catalyzing a reaction.

  19. Interactions of hybrid gold-tannic acid nanoparticles with human serum albumin.

    PubMed

    Sekowski, Szymon; Tomaszewska, Emilia; Soliwoda, Katarzyna; Celichowski, Grzegorz; Grobelny, Jaroslaw

    2017-01-01

    Nanoparticles present a wide spectrum of chemical, biological, and physical properties which result in their usage in many branches of science. We present an investigation of the interaction between human serum albumin and hybrid gold-tannic acid nanoparticles synthesized via a chemical reduction method. The results obtained demonstrate that tannic acid can be a very effective reducing and stabilizing agent and allows monodisperse hybrid gold nanomaterial to be obtained. The synthesized hybrid gold-tannic acid nanoparticles strongly interact with human serum albumin by formation of protein-corona complexes. The strength of the interaction with albumin depends on the number of tannic acid molecules on the surface of the nanoparticles and the presence of citric acid. Nanoparticles of large size and rich in tannic acid react more strongly with the protein [K SV = (8.00 ± 0.2) × 10(5) M(-1)] compared with smaller ones [K SV = (6.83 ± 0.5) × 10(4) M(-1)] containing citric acid and low concentration of tannic acid.

  20. Role of 5-aminolevulinic acid-conjugated gold nanoparticles for photodynamic therapy of cancer

    NASA Astrophysics Data System (ADS)

    Zhang, Zhenxi; Wang, Sijia; Xu, Hao; Wang, Bo; Yao, Cuiping

    2015-05-01

    There are three possible mechanisms for 5-aminolevulinic acid (5-ALA) conjugated gold nanoparticles (GNPs) through electrostatic bonding for photodynamic therapy (PDT) of cancer: GNPs delivery function, singlet oxygen generation (SOG) by GNPs irradiated by light, and surface resonance enhancement (SRE) of SOG. Figuring out the exact mechanism is important for further clinical treatment. 5-ALA-GNPs and human chronic myeloid leukemia K562 cells were used to study delivery function and SOG by GNPs. The SRE of SOG enabled by GNPs was explored by protoporphyrin IX (PpIX)-GNPs conjugate through electrostatic bonding. Cell experiments show that the GNPs can improve the efficiency of PDT, which is due to the vehicle effect of GNPs. PpIX-GNPs conjugate experiments demonstrated that SOG can be improved about 2.5 times over PpIX alone. The experiments and theoretical results show that the local field enhancement (LFE) via localized surface plasmon resonance (LSPR) of GNPs is the major role; the LFE was dependent on the irradiation wavelength and the GNP's size. The LFE increased with an increase of the GNP size (2R ≤50 nm). However, the LSPR function of the GNPs was not found in cell experiments. Our study shows that in 5-ALA-conjugated GNPs PDT, the delivery function of GNPs is the major role.

  1. Ultrafast laser functionalized rare phased gold-silicon/silicon oxide nanostructured hybrid biomaterials.

    PubMed

    Premnath, P; Tan, B; Venkatakrishnan, K

    2015-12-01

    We introduce a hybrid nanostructured biomaterial that is a combination of rare phases of immiscible gold and silicon oxide, functionalized via ultrafast laser synthesis. For the first time, we show cancer controlling properties of rare phases of gold silicides, which include Au7Si, Au5Si, Au0.7Si2.3 and Au8Si2. Conventionally, pure forms of gold and silicon/silicon oxide are extensively employed in targeted therapy and drug delivery systems due to their unique properties. While silicon and silicon oxide nanoparticles have shown biocompatibility, gold nanoparticles show conflicting results based on their size and material properties. Several studies have shown that gold and silicon combinations produce cell controlling properties, however, these studies were not able to produce a homogenous combination of gold and silicon, owing to its immiscibility. A homogenous combination of gold and silicon may potentially enable properties that have not previously been reported. We describe rare phased gold-silicon oxide nanostructured hybrid biomaterials and its unique cancer controlling properties, owing to material properties, concentration, size and density. The gold-silicon oxide nanostructured hybrid is composed of individual gold-silicon oxide nanoparticles in various concentrations of gold and silicon, some nanoparticles possess a gold-core and silicon-shell like structure. The individual nanoparticles are bonded together forming a three dimensional nanostructured hybrid. The interaction of the nanostructured hybrids with cervical cancer cells showed a 96% reduction in 24h. This engineered nanostructured hybrid biomaterial presents significant potential due to the combination of immiscible gold and silicon oxide in varying phases and can potentially satiate the current vacuum in cancer therapy.

  2. Spectroscopic studies of nucleic acid additions during seed-mediated growth of gold nanoparticles

    PubMed Central

    Tapp, Maeling; Sullivan, Rick; Dennis, Patrick; Naik, Rajesh R.

    2015-01-01

    The effect of adding nucleic acids to gold seeds during the growth stage of either nanospheres or nanorods was investigated using UV-Vis spectroscopy to reveal any oligonucleotide base or structure-specific effects on nanoparticle growth kinetics or plasmonic signatures. Spectral data indicate that the presence of DNA duplexes during seed ageing drastically accelerated nanosphere growth while the addition of single-stranded polyadenine at any point during seed ageing induces nanosphere aggregation. For seeds added to a gold nanorod growth solution, single-stranded polythymine induces a modest blue-shift in the longitudinal peak wavelength. Moreover, a particular sequence comprised of 50% thymine bases was found to induce a faster, more dramatic blue-shift in the longitudinal peak wavelength compared to any of the homopolymer incubation cases. Monomeric forms of the nucleic acids, however, do not yield discernable spectral differences in any of the gold suspensions studied. PMID:25960601

  3. Colorimetric sensor array based on gold nanoparticles and amino acids for identification of toxic metal ions in water.

    PubMed

    Sener, Gulsu; Uzun, Lokman; Denizli, Adil

    2014-01-01

    A facile colorimetric sensor array for detection of multiple toxic heavy metal ions (Hg(2+), Cd(2+), Fe(3+), Pb(2+), Al(3+), Cu(2+), and Cr(3+)) in water is demonstrated using 11-mercaptoundecanoic acid (MUA)-capped gold nanoparticles (AuNPs) and five amino acids (lysine, cysteine, histidine, tyrosine, and arginine). The presence of amino acids (which have functional groups that can form complexes with metal ions and MUA) regulates the aggregation of MUA-capped particles; it can either enhance or diminish the particle aggregation. The combinatorial colorimetric response of all channels of the sensor array (i.e., color change in each of AuNP and amino acid couples) enables naked-eye discrimination of all of the metal ions tested in this study with excellent selectivity.

  4. Interactions and Attachment Pathways between Functionalized Gold Nanorods.

    PubMed

    Tan, Shu Fen; Anand, Utkarsh; Mirsaidov, Utkur

    2017-01-31

    Nanoparticle (NP) self-assembly has been recognized as an important technological process for forming ordered nanostructures. However, the detailed dynamics of the assembly processes remain poorly understood. Using in situ liquid cell transmission electron microscopy, we describe the assembly modes of gold (Au) nanorods (NRs) in solution mediated by hydrogen bonding between NR-bound cysteamine linker molecules. Our observations reveal that by tuning the linker concentration, two different NR assembly modes can be achieved. These assembly modes proceed via the (1) end-to-end and (2) side-to-side attachment of NRs at low and high linker concentrations in solution, respectively. In addition, our time-resolved observations reveal that the side-to-side NR assemblies can occur through two different pathways: (i) prealigned attachment, where two Au NRs prealign to be parallel prior to assembly, and (ii) postattachment alignment, where two Au NRs first undergo end-to-end attachment and pivot around the attachment point to form the side-to-side assembly. We attributed the observed assembly modes to the distribution of linkers on the NR surfaces and the electrostatic interactions between the NRs. The intermediate steps in the assembly reported here reveal how the shape and surface functionalities of NPs drive their self-assembly, which is important for the rational design of hierarchical nanostructures.

  5. Significance of the amide functionality on DOPA-based monolayers on gold.

    PubMed

    Rībena, Dina; Alekseev, Alexander; van Asselen, Otto; Mannie, Gilbère J A; Hendrix, Marco M R M; van der Ven, Leendert G J; Sommerdijk, Nico A J M; de With, Gijsbertus

    2012-12-11

    The adhesive proteins secreted by marine mussels contain an unusual amino acid, 3,4-dihydroxyphenylalanine (DOPA), that is responsible for the cohesive and adhesive strength of this natural glue and gives mussels the ability to attach themselves to rocks, metals, and plastics. Here we report a detailed structural and spectroscopic investigation of the interface between N-stearoyldopamine and a single-crystalline Au(111) model surface and an amide-absent molecule, 4-stearylcatechol, also on Au(111), with the aim of understanding the role of the amide functionality in the packing, orientation, and fundamental interaction between the substrate and the monolayer formed from an aqueous environment by the Langmuir-Blodgett technique. The organization of monolayers on gold was observed directly and studied in detail by X-ray photoelectron spectroscopy (XPS), contact angle measurements (CA), surface-enhanced Raman spectroscopy (SERS), infrared reflection-absorption spectroscopy (IRRAS), and atomic force microscopy (AFM). Our study shows that within the monolayer the catecholic oxygen atoms are coordinated to the gold surface, having a more perpendicular orientation with respect to the aromatic ring and the apparently tilted alkyl chains, whereas the amide functionality stabilizes the monolayer that is formed.

  6. High surface area Au-SBA-15 and Au-MCM-41 materials synthesis: tryptophan amino acid mediated confinement of gold nanostructures within the mesoporous silica pore walls.

    PubMed

    Selvakannan, Pr; Mantri, Kshudiram; Tardio, James; Bhargava, Suresh K

    2013-03-15

    Advantages of confining the gold nanostructures formation within the mesoporous silica pore walls during its silica condensation and consequent improvement in the textural properties such as specific surface area, pore volume, pore diameter have been demonstrated, while retaining gold nanostructures within the silica walls. This has been achieved by tryptophan mediated confinement of gold nanoparticles formation within the condensing silica framework, to obtain Au-SBA-15 (SSA 1247 m(2)/g, V(t)~1.37 cm(3)/g) and Au-MCM-41 (SSA 1287 m(2)/g, V(t)~1.1 cm(3)/g), mesoporous silica materials having the combination of very high surface area from the porous support as well as gold nanoparticles infiltrated silica walls. Choice of tryptophan for this purpose is that it has an indole group, which was known to reduce gold ions to form gold nanoparticles and its amine and carboxylic acid groups, catalyze the hydrolysis of silica precursors in a wide range of pH. These properties have been utilized in restricting the gold nanostructures formation inside the condensing silica phase without affecting the self assembly between the silica precursors and the triblock copolymer (for SBA-15) or cetyltrimethylammonium bromide template (for MCM-41). The polytryptophan and the gold nanostructures, which were encapsulated within the silica framework and upon removal of the template by calcination resulting in the formation mesoporous materials wherein the silica walls become microporous due to the removal of occluded polytryptophan and the resulting microchannels contain very small gold nanostructures. Hence, the resulting materials have very high surface area, high pore volume and narrow pore size distribution as compared to their parent SBA-15, MCM-41 and SBA-15, MCM-41 post functionalized with gold nanoparticles inside the pores.

  7. ELECTROCHEMICALLY DEPOSITED POLYMER-COATED GOLD ELECTRODES SELECTIVE FOR 2,4-DICHLOROPHENOXYACETIC ACID

    EPA Science Inventory

    Electropolymerized membranes on gold electrodes doped with 2,4-dichlorophenoxyacetic acid (2,4-D) were prepared from a solution containing resorcinol, o-phenylenediamine and 2,4-D. Fourier Transform Infrared (FTIR) spectroscopy was used to evaluate the incorporation and interact...

  8. Ultrasensitive electrochemiluminescence immunosensor based on luminol functionalized gold nanoparticle labeling.

    PubMed

    Tian, Dayong; Duan, Chunfeng; Wang, Wei; Cui, Hua

    2010-06-15

    An ultrasensitive electrochemiluminescence (ECL) immunosensor based on luminol functionalized gold nanoparticle (AuNP) labeling was developed using human immunoglobulin G (hIgG) as a model analyte. The primary antibody biotin-conjugated goat-anti-human IgG was first immobilized on a streptavidin coated AuNP modified electrode, then the antigen (human IgG) and the luminol functionalized AuNP-labeled second antibody were conjugated successively to form a sandwich-type immunocomplex, i.e. immunosensor. ECL was carried out with a double-step potential in carbonate buffer solution containing 1.0 mmol/L H(2)O(2). Since thousand of luminol molecules were coated on the surface of AuNPs to realize labeling of multiple molecules with CL activity at a single antibody and the amplification of AuNPs and biotin-streptavidin system was utilized, luminol ECL signal could be enhanced greatly, finally resulting in extremely high sensitivity. The ECL method shows a detection limit of 1.0 pg/mL (S/N=3) for hIgG, which is superior to all previously reported methods for the determination of hIgG. Moreover, the proposed method is also simple, stable, specific, and time-saving, avoiding the complicated stripping procedure during CL detection and the uncontrollable synthesis of irregular nanoparticles compared with other chemiluminescence immunoassay based on AuNP labeling. Additionally, the labeling procedure is also superior to that of other reported multilabeling strategies, such as Ru complex-encapsulated polymer microspheres, and most of Ru complex-encapsulated liposomes in simplicity, stability, labeling property and practical applicability. Finally, the proposed method has been successfully applied to the detection of hIgG in human serums.

  9. Reversible Covalent and Supramolecular Functionalization of Water-Soluble Gold(I) Complexes.

    PubMed

    Kemper, Benedict; von Gröning, Maximilian; Lewe, Vanessa; Spitzer, Daniel; Otremba, Tobias; Stergiou, Natascha; Schollmeyer, Dieter; Schmitt, Edgar; Ravoo, Bart Jan; Besenius, Pol

    2017-02-09

    The ligation of gold(I) metalloamphiphiles with biomolecules is reported, using water-soluble Au(I) -N-alkynyl substituted maleimide complexes. For this purpose, two different polar ligands were applied: 1) a neutral, dendritic tetraethylene glycol-functionalized phosphane and 2) a charged, sulfonated N-heterocyclic carbene (NHC). The retro Diels-Alder reaction of a furan-protected maleimide gold(I) complex, followed by cycloaddition with a diene-functionalized biotin under mild conditions leads to a novel gold(I) metalloamphiphile. The strong streptavidin-biotin binding affinity in buffered aqueous solution of the resulting biotin alkynyl gold(I) phosphane conjugate remains intact. The cytotoxicity of the biotinylated gold(I) complex against a T47D human breast cancer cell line is higher than for cisplatin.

  10. Binding Preferences of Amino Acids for Gold Nanoparticles: A Molecular Simulation Study.

    PubMed

    Shao, Qing; Hall, Carol K

    2016-08-09

    A better understanding of the binding preference of amino acids for gold nanoparticles of different diameters could aid in the design of peptides that bind specifically to nanoparticles of a given diameter. Here we identify the binding preference of 19 natural amino acids for three gold nanoparticles with diameters of 1.0, 2.0, and 4.0 nm, and investigate the mechanisms that govern these preferences. We calculate potentials of mean force between 36 entities (19 amino acids and 17 side chains) and the three gold nanoparticles in explicit water using well-tempered metadynamics simulations. Comparing these potentials of mean force determines the amino acids' nanoparticle binding preferences and if these preferences are controlled by the backbone, the side chain, or both. Twelve amino acids prefer to bind to the 4.0 nm gold nanoparticle, and seven prefer to bind to the 2.0 nm one. We also use atomistic molecular dynamics simulations to investigate how water molecules near the nanoparticle influence the binding of the amino acids. The solvation shells of the larger nanoparticles have higher water densities than those of the smaller nanoparticles while the orientation distributions of the water molecules in the shells of all three nanoparticles are similar. The nanoparticle preferences of the amino acids depend on whether their binding free energy is determined mainly by their ability to replace or to reorient water molecules in the nanoparticle solvation shell. The amino acids whose binding free energy depends mainly on the replacement of water molecules are likely to prefer to bind to the largest nanoparticle and tend to have relatively simple side chain structures. Those whose binding free energy depends mainly on their ability to reorient water molecules prefer a smaller nanoparticle and tend to have more complex side chain structures.

  11. Facile one-pot synthesis of gold nanoparticles using tannic acid and its application in catalysis

    NASA Astrophysics Data System (ADS)

    Aswathy Aromal, S.; Philip, Daizy

    2012-04-01

    The paper reports a simple and efficient method for the synthesis of stable, nearly spherical gold nanoparticles using tannic acid as both the reducing and stabilizing agent. The nanoparticles are characterized by UV-visible spectroscopy, transmission electron microscopy (TEM), EDX and X-ray diffraction (XRD) analysis. The influence of tannic acid on the control of size and shape of gold nanoparticles is reported. Upon an increase in the concentration of tannic acid, there is a shift in the shape of nanoparticles as evidenced by the change in bandwidth and peak position of the surface plasmon resonance (SPR) band. Also, it is found that tannic acid ceases to act as a reducing agent beyond the limit of 10 mL (6×10-3 M) for 30 mL of HAuCl4 (1.3×10-3 M). On increasing the quantity of tannic acid, nucleation is favored in the initial stages and thereafter growth supersedes nucleation. The stable colloids obtained by this method are found to consist of nanoparticles with average size 8 and 12 nm. The crystallinity of the sample with fcc phase is observed from TEM, SAED and XRD pattern. Involvement of carboxylic acid group in capping of gold nanoparticles is evident from the FTIR spectrum. The application of the synthesized nanoparticles as catalyst in the reduction of 4-Nitrophenol to 4-Aminophenol is also reported.

  12. Nonlocal nonlinear refractive index of gold nanoparticles synthesized by ascorbic acid reduction: comparison of fitting models.

    PubMed

    Balbuena Ortega, A; Arroyo Carrasco, M L; Méndez Otero, M M; Gayou, V L; Delgado Macuil, R; Martínez Gutiérrez, H; Iturbe Castillo, M D

    2014-12-12

    In this paper, the nonlinear refractive index of colloidal gold nanoparticles under continuous wave illumination is investigated with the z-scan technique. Gold nanoparticles were synthesized using ascorbic acid as reductant, phosphates as stabilizer and cetyltrimethylammonium chloride (CTAC) as surfactant agent. The nanoparticle size was controlled with the CTAC concentration. Experiments changing incident power and sample concentration were done. The experimental z-scan results were fitted with three models: thermal lens, aberrant thermal lens and the nonlocal model. It is shown that the nonlocal model reproduces with exceptionally good agreement; the obtained experimental behaviour.

  13. Nonlocal nonlinear refractive index of gold nanoparticles synthesized by ascorbic acid reduction: comparison of fitting models

    PubMed Central

    Balbuena Ortega, A.; Arroyo Carrasco, M.L.; Méndez Otero, M.M.; Gayou, V.L.; Delgado Macuil, R.; Martínez Gutiérrez, H.; Iturbe Castillo, M.D.

    2014-01-01

    In this paper, the nonlinear refractive index of colloidal gold nanoparticles under continuous wave illumination is investigated with the z-scan technique. Gold nanoparticles were synthesized using ascorbic acid as reductant, phosphates as stabilizer and cetyltrimethylammonium chloride (CTAC) as surfactant agent. The nanoparticle size was controlled with the CTAC concentration. Experiments changing incident power and sample concentration were done. The experimental z-scan results were fitted with three models: thermal lens, aberrant thermal lens and the nonlocal model. It is shown that the nonlocal model reproduces with exceptionally good agreement; the obtained experimental behaviour. PMID:25705090

  14. Density functional study of hydrogen binding on gold and silver-gold clusters.

    PubMed

    Zhao, Shuang; Ren, YunLi; Ren, YunLai; Wang, JianJi; Yin, WeiPing

    2010-04-15

    A theoretical study was carried out on the binding of hydrogen on small bimetallic Ag(m)Au(n) (m + n < or = 5) and pure Au(n) (n < or = 5) clusters with neutral, negative, and positive charge state. It is found that the composition and charge state of clusters have strong influence on the most favorable binding site. The adiabatic ionization potentials, electron affinities, and hydrogen binding energies of cluster hydrides increase with the Au content increasing for the given cluster size. The cationic silver-gold cluster hydrides prefer ejection of Au-containing products whereas the anionic silver-gold cluster hydrides prefer ejection of Ag-containing products. The magnitude of metal-H frequency in combination with the metal-H bond length indicates that, with the same type of the binding site, the Au-H interaction is stronger than the Ag-H interaction.

  15. Amorphous/nanocrystalline silicon biosensor for the specific identification of unamplified nucleic acid sequences using gold nanoparticle probes

    NASA Astrophysics Data System (ADS)

    Martins, Rodrigo; Baptista, Pedro; Raniero, Leandro; Doria, Gonçalo; Silva, Leonardo; Franco, Ricardo; Fortunato, Elvira

    2007-01-01

    Amorphous/nanocrystalline silicon pi 'ii'n devices fabricated on micromachined glass substrates are integrated with oligonucleotide-derivatized gold nanoparticles for a colorimetric detection method. The method enables the specific detection and quantification of unamplified nucleic acid sequences (DNA and RNA) without the need to functionalize the glass surface, allowing for resolution of single nucleotide differences between DNA and RNA sequences—single nucleotide polymorphism and mutation detection. The detector's substrate is glass and the sample is directly applied on the back side of the biosensor, ensuring a direct optical coupling of the assays with a concomitant maximum photon capture and the possibility to reuse the sensor.

  16. Facile Synthesis of Gd-Functionalized Gold Nanoclusters as Potential MRI/CT Contrast Agents

    PubMed Central

    Le, Wenjun; Cui, Shaobin; Chen, Xin; Zhu, Huanhuan; Chen, Bingdi; Cui, Zheng

    2016-01-01

    Multi-modal imaging plays a key role in the earlier detection of disease. In this work, a facile bioinspired method was developed to synthesize Gd-functionalized gold nanoclusters (Gd-Au NCs). The Gd-Au NCs exhibit a uniform size, with an average size of 5.6 nm in dynamic light scattering (DLS), which is a bit bigger than gold clusters (3.74 nm, DLS), while the fluorescent properties of Gd-Au NCs are almost the same as that of Au NCs. Moreover, the Gd-Au NCs exhibit a high longitudinal relaxivity value (r1) of 22.111 s−1 per mM of Gd in phosphate-buffered saline (PBS), which is six times higher than that of commercial Magnevist (A complex of gadolinium with a chelating agent, diethylenetriamine penta-acetic acid, Gd-DTPA, r1 = 3.56 mM−1·s−1). Besides, as evaluated by nano single photon emission computed tomography (SPECT) and computed tomography (CT) the Gd-Au NCs have a potential application as CT contrast agents because of the Au element. Finally, the Gd-Au NCs show little cytotoxicity, even when the Au concentration is up to 250 μM. Thus, the Gd-Au NCs can act as multi-modal imaging contrast agents.

  17. Selective oxidation of glycerol under acidic conditions using gold catalysts

    SciTech Connect

    Villa, Alberto; Veith, Gabriel M; Prati, Laura

    2010-01-01

    H-mordenite-supported PtAu nanoparticles are highly active and selective in the oxidation of glycerol under acidic conditions, which allows the direct preparation of free acids (see picture). The high selectivity for C{sub 3} compounds results from the negligible formation of H{sub 2}O{sub 2}, in contrast to PtAu nanoparticles supported on activated carbon.

  18. Electrochemical investigations of 3-(3-thienyl) acrylic acid protected nanoclusters and planar gold surfaces.

    PubMed

    Nirmal, R G; Kavitha, A L; Berchmans, Sheela; Yegnaraman, V

    2007-06-01

    Formation of self assembled monolayers on gold surface by thiols and disulphides is a well known phenomenon and extensive research work has been carried out in this area with envisaged applications in the area of sensors, molecular electronics, lithography, device fabrication using bottom-up approach, etc. Recently, it has been established that thiophene molecules can self assemble on gold surface due to Au-S interactions. 3-(3-thienyl) acrylic acid, a bifunctional ligand is used in this work to form self-assembled monolayers on planar gold surfaces (two dimensional assemblies) and to prepare monolayer protected gold nano clusters (three-dimensional assemblies). The electron transfer blocking properties of the two-dimensional monolayers were evaluated by using standard redox probes like ferrocyanide anions and Ruthenium hexamine cations. The functionalisation of the two-dimensional and three-dimensional assemblies has been carried out with ferrocene carboxylic acid and the functionalised monolayers were characterized by Cyclic voltammetry. The formation of thienyl acrylic acid protected nanoclusters has been verified by TEM and surface plasmon resonance absorption. It has been observed that when thiophene based ligands are used as stabilizers for the formation of metal nanoparticles, they tend to aggregate as a result of pi-pi interactions between adjacent thiophene ligands. In this case it is found that aggregation is prevented. The substituent at the thiophene ring hinders pi-pi interactions. The quantised nature of electrochemical charging of these nanoparticles has been demonstrated by differential pulse voltammetry (DPV), which exhibit peak like features (coulomb's staircase). This work also explores the possibility of using 3-(3-thienyl) acrylic acid as building blocks or spacers on planar and colloidal gold surfaces for potential applications in the field of sensors and devices.

  19. Surface functionalization by gold nanoparticles and its prospects for application in conductometric metal oxide gas sensors

    NASA Astrophysics Data System (ADS)

    Korotcenkov, G.; Brinzari, V.; Cho, B. K.

    2017-03-01

    Approaches to surface functionalizing by gold nanoparticles of metal oxides aimed for gas sensors applications are discussed in this paper. It is demonstrated that surface modification by gold nanoparticles is accompanied by improvement of sensor performance. However, analysis of obtained results has shown that the achievement of strong improvement of gas sensor parameters is not a trivial task. For its reduction, it is necessary to ensure several specific conditions related to the size and density of gold clusters on the surface of metal oxide crystallites, the state of gold in the cluster, and to the properties of the metal oxide support used. It is also demonstrated that additional studies are required before conductometric gas sensors modified by gold nanoclusters will appear in gas-sensor market.

  20. Assessment of nanofiltration and reverse osmosis potentialities to recover metals, sulfuric acid, and recycled water from acid gold mining effluent.

    PubMed

    Ricci, Bárbara C; Ferreira, Carolina D; Marques, Larissa S; Martins, Sofia S; Amaral, Míriam C S

    This work assessed the potential of nanofiltration (NF) and reverse osmosis (RO) to treat acid streams contaminated with metals, such as effluent from the pressure oxidation process (POX) used in refractory gold ore processing. NF and RO were evaluated in terms of rejections of sulfuric acid and metals. Regarding NF, high sulfuric acid permeation (∼100%), was observed, while metals were retained with high efficiencies (∼90%), whereas RO led to high acid rejections (<88%) when conducted in pH values higher than 1. Thus, sequential use of NF and RO was proved to be a promising treatment for sulfuric acid solutions contaminated by metals, such as POX effluent. In this context, a purified acid stream could be recovered in NF permeate, which could be further concentrated in RO. Recovered acid stream could be reused in the gold ore processing or commercialized. A metal-enriched stream could be also recovered in NF retentate and transferred to a subsequent metal recovery stage. In addition, considering the high acid rejection obtained through the proposed system, RO permeate could be used as recycling water.

  1. Functional and Selective Bacterial Interfaces Using Cross-Scaffold Gold Binding Peptides

    NASA Astrophysics Data System (ADS)

    Adams, Bryn L.; Hurley, Margaret M.; Jahnke, Justin P.; Stratis-Cullum, Dimitra N.

    2015-11-01

    We investigated the functional and selective activity of three phage-derived gold-binding peptides on the Escherichia coli ( E. coli) bacterial cell surface display scaffold (eCPX) for the first time. Gold-binding peptides, p3-Au12 (LKAHLPPSRLPS), p8#9 (VSGSSPDS), and Midas-2 (TGTSVLIATPYV), were compared side-by-side through experiment and simulation. All exhibited strong binding to an evaporated gold film, with approximately a 4-log difference in binding between each peptide and the control sample. The increased affinity for gold was also confirmed by direct visualization of samples using Scanning Electron Microscopy (SEM). Peptide dynamics in solution were performed to analyze innate structure, and all three were found to have a high degree of flexibility. Preferential binding to gold over silicon for all three peptides was demonstrated, with up to four orders of magnitude selectivity exhibited by p3-Au12. The selectivity was also clearly evident through SEM analysis of the boundary between the gold film and silicon substrate. Functional activity of bound E. coli cells was further demonstrated by stimulating filamentation and all three peptides were characterized as prolific relative to control samples. This work shows great promise towards functional and active bacterial-hybrid gold surfaces and the potential to enable the next generation living material interfaces.

  2. Targeting and molecular imaging of HepG2 cells using surface-functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Rathinaraj, Pierson; Lee, Kyubae; Choi, Yuri; Park, Soo-Young; Kwon, Oh Hyeong; Kang, Inn-Kyu

    2015-07-01

    Mercaptosuccinic acid (M)-conjugated gold nanoparticles (GM) were prepared and characterized by transmission electron microscope and dynamic light scattering. M was used to improve the monodispersity and non-specific intracellular uptake of nanoparticles. Lactobionic acid (L) was subsequently conjugated to the GM to target preferentially HepG2 cells (liver cancer cells) that express asialoglycoprotein receptors (ASGPR) on their membrane surfaces and facilitate the transit of nanoparticles across the cell membrane. The mean size of lactobionic acid-conjugated gold nanoparticle (GL) was approximately 10 ± 0.2 nm. Finally, the Atto 680 dye (A6) was coupled to the nanoparticles to visualize their internalization into HepG2 cells. The interaction of surface-modified gold nanoparticles with HepG2 cells was studied after culturing cells in media containing the GM or L-conjugated GM (GL).

  3. Phenolic acid induced growth of gold nanoshells precursor composites and their application in antioxidant capacity assay.

    PubMed

    Ma, Xiaoyuan; Qian, Weiping

    2010-11-15

    In the present work, the gold nanoshells (GNSs) precursor composites were preadsorbed onto the surface of ITO substrates. With the treatment of modified electrodes immersed in the gold nanoparticles (GNPs) growth solution containing different phenolic acids, the GNSs precursor composites were enlarged to varying degrees. Phenolic acids with one or more phenolic hydroxyl groups served as reductants for the growth of GNPs. The enlargement conditions varied with the different reducing capacity of phenolic acids, exhibiting specific morphologies differ from the complete GNSs. Consequently, the UV-vis-NIR spectra and cyclic voltammetry curves for the phenolic acid-treated ITO electrode were gradually changed. Results showed that the higher reducing capacity for phenolic acid to reduce AuCl(4)(-) to Au(0) resulted in the intensified localized surface plasmon resonance features and reduced cathodic currents. The spectral wavelength peaks red shifted hundreds of nanometers across the visible region. Moreover, the antioxidant capacity of phenolic acids correlates well with their reducing activity, both of which reflect their tendency to donate electrons. Thus, the optical and electrochemical results could be used to evaluate the antioxidant capacity of phenolic acids by utilizing GNSs precursor composites as nanoprobes. The method is simple, rapid and could be used in visual analysis to a certain extent.

  4. Caffeic acid: potential applications in nanotechnology as a green reducing agent for sustainable synthesis of gold nanoparticles.

    PubMed

    Seo, Yu Seon; Cha, Song-Hyun; Yoon, Hye-Ran; Kang, Young-Hwa; Park, Youmie

    2015-04-01

    The sustainable synthesis of gold nanoparticles from gold ions was conducted with caffeic acid as a green reducing agent. The formation of gold nanoparticles was confirmed by spectroscopic and microscopic methods. Spherical nanoparticles with an average diameter of 29.99 ± 7.43 nm were observed in high- resolution transmission electron microscopy and atomic force microscopy images. The newly prepared gold nanoparticles exhibited catalytic activity toward the reduction of 4-nitrophenol to 4-aminophenol in the presence of sodium borohydride. This system enables the preparation of green catalysts using plant natural products as reducing agents, which fulfills the growing need for sustainability initiatives.

  5. Functionalization of Multi-Walled Carbon Nanotubes with Cysteamine for the Construction of Cnt/gold Nanoparticle Hybrid Nanostructures

    NASA Astrophysics Data System (ADS)

    Kumar, Nanjundan Ashok; Kim, Sung Hun; Kim, Jong Su; Kim, Jong Tae; Jeong, Yeon Tae

    Combining hybrid nanostructures of metal nanoparticles (NPs) and carbon nanotubes could afford a novel strategy to prepare promising nanomaterials for the highly sensitive sensors and imaging science applications. Conventional acid oxidation process was used to obtain carboxylic acid bound multi-walled carbon nanotubes (MWNTs) which was further acylated with thionyl chloride to give acyl chloride functionalized MWNTs. Thiol functionalized MWNTs were synthesized by amidation reaction of the acylated MWNTs with cysteamine. Further, gold nanoparticles (GNPs) were successfully fabricated on the tube walls to yield the CNT/Au hybrid. Fourier transform infrared spectroscopy and energy dispersive X-ray studies were used to characterize the surface chemical functionalities and composition of MWNTs, respectively. Evidence for the attachment of GNPs to thiol functionalized MWNTs was obtained from ultraviolet-visible absorption spectra. In addition, TEM images provided a vivid image of uniform decoration of GNPs on the nanotube sidewalls.

  6. Study of nucleic acid-gold nanorod interactions and detecting nucleic acid hybridization using gold nanorod solutions in the presence of sodium citrate.

    PubMed

    Kanjanawarut, Roejarek; Su, Xiaodi

    2010-09-01

    In this study, the authors report that sodium citrate can aggregate hexadecyl-trimethyl-ammonium ion(+)-coated gold nanorods (AuNRs), and nucleic acids of different charge and structure properties, i.e., single-stranded DNA (ssDNA), double-stranded DNA (dsDNA), single-stranded peptide nucleic acid (PNA), and PNA-DNA complex, can bind to the AuNRs and therefore retard the sodium citrate-induced aggregation to different extents. The discovery that hybridized dsDNA (and the PNA-DNA complex) has a more pronounced protection effect than ssDNA (and PNA) allows the authors to develop a homogeneous phase AuNRs-based UV-visible (UV-vis) spectral assay for detecting specific sequences of oligonucleotides (20 mer) with a single-base-mismatch selectivity and a limit of detection of 5 nM. This assay involves no tedious bioconjugation and on-particle hybridization. The simple "set and test" format allows for a highly efficient hybridization in a homogeneous phase and a rapid display of the results in less than a minute. By measuring the degree of reduction in AuNR aggregation in the presence of different nucleic acid samples, one can assess how different nucleic acids interact with the AuNRs to complement the knowledge of spherical gold nanoparticles. Besides UV-vis characterization, transmission electron microscopy and zeta potential measurements were conduced to provide visual evidence of the particle aggregation and to support the discussion of the assay principle.

  7. Surface Crystallographic Dependence of Voltammetric Oxidation of Polyhydric Alcohols and Related Systems at Monocrystalline Gold-Acidic Aqueous Interfaces

    DTIC Science & Technology

    1992-02-01

    reactants formic acid and oxalic acid . Linear sweep voltammetric data were gathered for these reactions on seven gold crystallographic orientations: Au...quoted versus the saturated calomel electrode (SCE), and all measurements were performed at room temperature, 23±I°C. RESULTS Formic Acid and Oxalic Acid Following...voltammetric electrooxidation of oxalic acid under similar conditions. A representative set of anodic voltam- mograms obtained for 45 mM oxalic acid in 0.1 M

  8. Hematite spindles with optical functionalities: growth of gold nanoshells and assembly of gold nanorods.

    PubMed

    Spuch-Calvar, Miguel; Pérez-Juste, Jorge; Liz-Marzán, Luis M

    2007-06-01

    The layer-by-layer (LBL) assembly method, combined with the seeded growth technique, have been used to deposit gold shells on the surface of hematite (alpha-Fe(2)O(3)) spindles. While the LBL method yields dense coatings of preformed Au nanoparticles, when AuCl(-)(4) ions are further reduced by a mild reducing agent, thicker, rough nanostructured shells can be grown. The deposition process was monitored by TEM and UV-visible spectroscopy, demonstrating a gradual change in the optical features of the colloids as the surface is more densely covered. The particles so-prepared can find useful applications in cancer therapy and as SERS substrates. Additionally, we show that Au nanorods can be assembled on hematite spindles, providing a flexible way to tune the optical properties of the resulting composite colloids.

  9. Natural polysaccharide functionalized gold nanoparticles as biocompatible drug delivery carrier.

    PubMed

    Pooja, Deep; Panyaram, Sravani; Kulhari, Hitesh; Reddy, Bharathi; Rachamalla, Shyam S; Sistla, Ramakrishna

    2015-09-01

    Biocompatibility is one of the major concerns with inorganic nanoparticles for their applications as drug delivery system. Natural compounds such as sugars, hydrocolloids and plant extracts have shown potential for the green synthesis of biocompatible gold nanoparticles. In this study, we report the synthesis of gum karaya (GK) stabilized gold nanoparticles (GKNP) and the application of prepared nanoparticles in the delivery of anticancer drugs. GKNP were characterized using different analytical techniques. GKNP exhibited high biocompatibility during cell survival study against CHO normal ovary cells and A549 human non-small cell lung cancer cells and during hemolytic toxicity studies. Gemcitabine hydrochloride (GEM), an anticancer drug, was loaded on the surface of nanoparticles with 19.2% drug loading efficiency. GEM loaded nanoparticles (GEM-GNP) showed better inhibition of growth of cancer cells in anti-proliferation and clonogenic assays than native GEM. This effect was correlated with higher reactive oxygen species generation by GEM-GNP in A549 cells than native GEM. In summary, GK has significant potential in the synthesis of biocompatible gold nanoparticles that could be used as prospective drug delivery carrier for anticancer drugs.

  10. Surface oxidation of gold nanoparticles supported on a glassy carbon electrode in sulphuric acid medium: contrasts with the behaviour of 'macro' gold.

    PubMed

    Wang, Ying; Laborda, Eduardo; Crossley, Alison; Compton, Richard G

    2013-03-07

    Consecutive electro-oxidation and reduction cycling of gold macroelectrodes in sulphuric acid medium is a widely-used cleaning and calibration procedure. In this paper this method is applied to electrodeposited nanoparticles revealing significant differences in the electro-oxidation process and the cleaning effectiveness. This suggests a higher density of surface defects on the nanoparticles.

  11. Toward spatial control of gold nanorod surface functionalization

    NASA Astrophysics Data System (ADS)

    Eller, Jonathan R.

    Gold nanorods (GNRs) show much promise for applications in biological, optoelectronic and energy applications. The resonant generation of a localized surface plasmon resonance (LSPR) at the GNR surface results in interesting optical properties and unique interactions with molecules. Combined with their biocompatibility, ease of synthesis and facile surface functionalization, these anisotropic metal particles are excellent scaffolds for the study of the interactions between nanoscale surfaces and their chemical/biological environments. Regardless of the application, however, GNR utility will not be fully realized until the chemical nature of the surface is understood and controlled. GNRs can enhance various photophysical properties of molecules. In the case of two-photon absorption (TPA), cross-section enhancements have been shown to increase with strong distance-dependence. Here, a dual approach for the conjugation of a TPA chromophore to GNRs is presented, relying on layer-by- layer (LbL) polymer wrapping and direct thiol coating of the same parent chromophore structure. Together, these approaches allow for estimated chromophore-particle distances from <1nm to more than 15 nm. Composites were confirmed using conventional nanoparticle characterization methods. Imaging of GNR polymer shells indicated anisotropic composite structures, as confirmed by both conventional and cryo-TEM. Optical characterizations were performed using two-photon excited fluorescence and Z-scan techniques, to probe the TPA enhancement. The intrinsic nonlinear optical properties of GNRs is shown to contribute strongly to these measurements, suggesting the utility of these materials for bi-modal imaging platforms. GNR properties, like their shape, are anisotropic. The LSPR-induced near- fields are heterogeneously distributed on the nanorod surface, with the tips being much "hotter" than the sides. To understand and utilize fully the spatially- dependent interactions of GNRs with their

  12. Elucidating the influence of gold nanoparticles on the binding of salvianolic acid B and rosmarinic acid to bovine serum albumin.

    PubMed

    Peng, Xin; Qi, Wei; Huang, Renliang; Su, Rongxin; He, Zhimin

    2015-01-01

    Salvianolic acid B and rosmarinic acid are two main water-soluble active ingredients from Salvia miltiorrhiza with important pharmacological activities and clinical applications. The interactions between salvianolic acid B (or rosmarinic acid) and bovine serum albumin (BSA) in the presence and absence of gold nanoparticles (Au NPs) with three different sizes were investigated by using biophysical methods for the first time. Experimental results proved that two components quenched the fluorescence of BSA mainly through a static mechanism irrespective of the absence or presence of Au NPs. The presence of Au NPs decreased the binding constants of salvianolic acid B with BSA from 27.82% to 10.08%, while Au NPs increased the affinities of rosmarinic acid for BSA from 0.4% to 14.32%. The conformational change of BSA in the presence of Au NPs (caused by a noncompetitive binding between Au NPs and drugs at different albumin sites) induced changeable affinity and binding distance between drugs and BSA compared with no Au NPs. The competitive experiments revealed that the site I (subdomain IIA) of BSA was the primary binding site for salvianolic acid B and rosmarinic acid. Additionally, two compounds may induce conformational and micro-environmental changes of BSA. The results would provide valuable binding information between salvianolic acid B (or rosmarinic acid) and BSA, and also indicated that the Au NPs could alter the interaction mechanism and binding capability of drugs to BSA, which might be beneficial to understanding the pharmacokinetics and biological activities of the two drugs.

  13. Mono- and bi-functional arenethiols as surfactants for gold nanoparticles: synthesis and characterization

    NASA Astrophysics Data System (ADS)

    Vitale, Floriana; Fratoddi, Ilaria; Battocchio, Chiara; Piscopiello, Emanuela; Tapfer, Leander; Russo, Maria Vittoria; Polzonetti, Giovanni; Giannini, Cinzia

    2011-12-01

    Stable gold nanoparticles stabilized by different mono and bi-functional arenethiols, namely, benzylthiol and 1,4-benzenedimethanethiol, have been prepared by using a modified Brust's two-phase synthesis. The size, shape, and crystalline structure of the gold nanoparticles have been determined by high-resolution electron microscopy and full-pattern X-ray powder diffraction analyses. Nanocrystals diameters have been tuned in the range 2 ÷ 9 nm by a proper variation of Au/S molar ratio. The chemical composition of gold nanoparticles and their interaction with thiols have been investigated by X-ray photoelectron spectroscopy. In particular, the formation of networks has been observed with interconnected gold nanoparticles containing 1,4-benzenedimethanethiol as ligand.

  14. Design, development and characterization of multi-functionalized gold nanoparticles for biodetection and targeted boron delivery in BNCT applications.

    PubMed

    Mandal, Subhra; Bakeine, Gerald J; Krol, Silke; Ferrari, Cinzia; Clerici, Anna M; Zonta, Cecilia; Cansolino, Laura; Ballarini, Francesca; Bortolussi, Silva; Stella, Subrina; Protti, Nicoletta; Bruschi, Piero; Altieri, Saverio

    2011-12-01

    The aim of this study is to optimize targeted boron delivery to cancer cells and its tracking down to the cellular level. To this end, we describe the design and synthesis of novel nanovectors that double as targeted boron delivery agents and fluorescent imaging probes. Gold nanoparticles were coated with multilayers of polyelectrolytes functionalized with the fluorescent dye (FITC), boronophenylalanine and folic acid. In vitro confocal fluorescence microscopy demonstrated significant uptake of the nanoparticles in cancer cells that are known to overexpress folate receptors.

  15. Bidirectional reflectance distribution function of gold-plated sandpaper.

    PubMed

    Stuhlinger, T W; Dereniak, E L; Bartell, F O

    1981-08-01

    Gold-plated sandpaper was investigated for use as a Lambertian standard reference reflector for the IR spectrum. Various grit sizes from 3 to 400 microm and material types (i.e., silicon carbide and aluminum oxide) were studied. The different gold-plated sandpaper grit sizes were measured in the same way using three laser wavelengths (0.6328, 3.39, and 10.6 microm) at five angles of incidence of the source (0, 10, 20, 30, and 60 degrees ). All the scattering measurements were performed in the plane of incidence. The best choices of sandpaper grit sizes were 9-microm A1(2)O(3) for 0.6328- and 3.39-microm radiation and 600 grit by Armak Co. for 10.6-microm radiation. These choices were compared with other commonly used reflectors such as magnesium oxide, halon, sintered bronze, and flowers of sulfur. An attempt was made to correlate surface roughness (size of grit) to the degree of approximation to a good Lambertian reflector, but it was found that grit size is not as important as the filling factor, or density of particles, over a given area. It was found that fairly good approximations to Lambertian behavior result when the angle of incidence is small but not when the angle of incidence is as large as 60 degrees .

  16. Amplified electrochemical detection of nucleic acid hybridization via selective preconcentration of unmodified gold nanoparticles.

    PubMed

    Li, Yuan; Tian, Rui; Zheng, Xingwang; Huang, Rongfu

    2016-08-31

    The common drawback of optical methods for rapid detection of nucleic acid by exploiting the differential affinity of single-/double-stranded nucleic acids for unmodified gold nanoparticles (AuNPs) is its relatively low sensitivity. In this article, on the basis of selective preconcentration of AuNPs unprotected by single-stranded DNA (ssDNA) binding, a novel electrochemical strategy for nucleic acid sequence identification assay has been developed. Through detecting the redox signal mediated by AuNPs on 1, 6-hexanedithiol blocked gold electrode, the proposed method is able to ensure substantial signal amplification and a low background current. This strategy is demonstrated for quantitative analysis of the target microRNA (let-7a) in human breast adenocarcinoma cells, and a detection limit of 16 fM is readily achieved with desirable specificity and sensitivity. These results indicate that the selective preconcentration of AuNPs for electrochemical signal readout can offer a promising platform for the detection of specific nucleic acid sequence.

  17. PDMS microchip coated with polydopamine/gold nanoparticles hybrid for efficient electrophoresis separation of amino acids.

    PubMed

    Liang, Ru-Ping; Meng, Xiang-Ying; Liu, Chun-Ming; Qiu, Jian-Ding

    2011-11-01

    In this paper, a novel, simple, economical and environmentally friendly method based on in situ chemically induced synthesis strategy was designed and developed for the modification of a poly(dimethylsiloxane) (PDMS) microchip channel with polydopamine/gold nanoparticles (PDA/Au NPs) to create a hydrophilic and biofouling resistant surface. Dopamine as a reductant and a monomer, and HAuCl(4) as an oxidant to trigger dopamine polymerization and the source of metallic nanoparticles, were filled into the PDMS microchannel to yield in situ a well-distributed and robust PDA/Au NP coating. Au NPs were highly and uniformly dispersed in/on the PDA matrix with a narrow size distribution, as verified by scanning electron microscopy and UV-vis spectra. Compared with the native PDMS microchannel, the modified surfaces exhibited much better wettability, high stability and suppressed electroosmotic mobility, and less nonspecific adsorption towards biomolecules. The water contact angle and EOF of PDA/Au NP-coated PDMS microchip were measured to be 13° and 4.17×10(-4) cm(2)/V s, compared to those of 111° and 5.33×10(-4) cm(2)/V s from the native one, respectively. Fast and efficient separations of five amino acids such as arginine, proline, histidine, valine and threonine suggested greatly improved electrophoretic performance of the PDA/Au NP-functionalized PDMS microchips. This one-step procedure offers an effective approach for a biomimetic surface design on microfluidic chips, which is promising in high-throughput and complex biological analysis.

  18. Is It Real Gold?

    ERIC Educational Resources Information Center

    Harris, Harold H.

    1999-01-01

    Features acid tests for determining whether jewelry is "real" gold or simply gold-plated. Describes the carat system of denoting gold content and explains how alloys are used to create various shades of gold jewelry. Addresses the question of whether gold jewelry can turn a wearer's skin green by considering various oxidation reactions.…

  19. Colorimetric As (V) detection based on S-layer functionalized gold nanoparticles.

    PubMed

    Lakatos, Mathias; Matys, Sabine; Raff, Johannes; Pompe, Wolfgang

    2015-11-01

    Herein, we present simple and rapid colorimetric and UV/VIS spectroscopic methods for detecting anionic arsenic (V) complexes in aqueous media. The methods exploit the aggregation of S-layer-functionalized spherical gold nanoparticles of sizes between 20 and 50 nm in the presence of arsenic species. The gold nanoparticles were functionalized with oligomers of the S-layer protein of Lysinibacillus sphaericus JG-A12. The aggregation of the nanoparticles results in a color change from burgundy-red for widely dispersed nanoparticles to blue for aggregated nanoparticles. A detailed signal analysis was achieved by measuring the shift of the particle plasmon resonance signal with UV/VIS spectroscopy. To further improve signal sensitivity, the influence of larger nanoparticles was tested. In the case of 50 nm gold nanoparticles, a concentration of the anionic arsenic (V) complex lower than 24 ppb was detectable.

  20. Bioactive enzyme-metal composites: the entrapment of acid phosphatase within gold and silver.

    PubMed

    Ben-Knaz, Racheli; Avnir, David

    2009-03-01

    This paper is concerned with the entrapment of an enzyme within an aggregated metallic matrix and the development of a bioactive enzyme-metal composite. Whereas the use of organic polymers and metal oxides for the preparation of enzymatically active materials is well developed, the third principle enzyme-material combination, namely protein-metal bulk, has not yet been reported. A new methodology for the entrapment of organic molecules and polymers within metals has been employed for the preparation of bioactive acid phosphatase@gold and acid phosphatase@silver, according to which room temperature reduction of the metal cation is carried out in the presence of the enzyme to be entrapped. Protectability of the entrapped enzyme against harsh conditions is shown: the acidic enzyme is kept alive under basic conditions.

  1. Polyglycerolsulfate Functionalized Gold Nanorods as Optoacoustic Signal Nanoamplifiers for In Vivo Bioimaging of Rheumatoid Arthritis

    PubMed Central

    Vonnemann, Jonathan; Beziere, Nicolas; Böttcher, Christoph; Riese, Sebastian B.; Kuehne, Christian; Dernedde, Jens; Licha, Kai; von Schacky, Claudio; Kosanke, Yvonne; Kimm, Melanie; Meier, Reinhard; Ntziachristos, Vasilis; Haag, Rainer

    2014-01-01

    We have synthesized a targeted imaging agent for rheumatoid arthritis based on polysulfated gold nanorods. The CTAB layer on gold nanorods was first replaced with PEG-thiol and then with dendritic polyglycerolsulfate at elevated temperature, which resulted in significantly reduced cytotoxicity compared to polyanionic gold nanorods functionalized by non-covalent approaches. In addition to classical characterization methods, we have established a facile UV-VIS based BaCl2 agglomeration assay to confirm a quantitative removal of unbound ligand. With the help of a competitive surface plasmon resonance-based L-selectin binding assay and a leukocyte adhesion-based flow cell assay, we have demonstrated the high inflammation targeting potential of the synthesized gold nanorods in vitro. In combination with the surface plasmon resonance band of AuNRs at 780 nm, these findings permitted the imaging of inflammation in an in vivo mouse model for rheumatoid arthritis with high contrast using multispectral optoacoustic tomography. The study offers a robust method for otherwise difficult to obtain covalently functionalized polyanionic gold nanorods, which are suitable for biological applications as well as a low-cost, actively targeted, and high contrast imaging agent for the diagnosis of rheumatoid arthritis. This paves the way for further research in other inflammation associated pathologies, in particular, when photothermal therapy can be applied. PMID:24723984

  2. The adsorption of gold, palladium and platinum from acidic chloride solutions on mesoporous carbons.

    DOE PAGES

    Zalupski, Peter R.; McDowell, Rocklan; Dutech, Guy

    2014-08-05

    Studies on the adsorption characteristics of gold, palladium and platinum on mesoporous carbon (CMK-3) and sulfur-impregnated mesoporous carbon (CMK-3/S) evaluated the benefits/drawbacks of the presence of a layer of elemental sulfur inside mesoporous carbon structures. Adsorption isotherms collected for Au(III), Pd(II) and Pt(IV) on those materials suggest that sulfur does enhance the adsorption of those metal ions in mildly acidic environment (pH 3). The isotherms collected in 1 M HCl show that the benefit of sulfur disappears due to the competing influence of large concentration of hydrogen ions on the ion-exchanging mechanism of metal ions sorption on mesoporous carbon surfaces.more » The collected acid dependencies illustrate similar adsorption characteristics for CMK-3 and CMK-3/S in 1-5 M HCl concentration range. Sorption of metal ions from diluted aqueous acidic mixtures of actual leached electronic waste demonstrated the feasibility of recovery of gold from such liquors.« less

  3. The adsorption of gold, palladium and platinum from acidic chloride solutions on mesoporous carbons.

    SciTech Connect

    Zalupski, Peter R.; McDowell, Rocklan; Dutech, Guy

    2014-08-05

    Studies on the adsorption characteristics of gold, palladium and platinum on mesoporous carbon (CMK-3) and sulfur-impregnated mesoporous carbon (CMK-3/S) evaluated the benefits/drawbacks of the presence of a layer of elemental sulfur inside mesoporous carbon structures. Adsorption isotherms collected for Au(III), Pd(II) and Pt(IV) on those materials suggest that sulfur does enhance the adsorption of those metal ions in mildly acidic environment (pH 3). The isotherms collected in 1 M HCl show that the benefit of sulfur disappears due to the competing influence of large concentration of hydrogen ions on the ion-exchanging mechanism of metal ions sorption on mesoporous carbon surfaces. The collected acid dependencies illustrate similar adsorption characteristics for CMK-3 and CMK-3/S in 1-5 M HCl concentration range. Sorption of metal ions from diluted aqueous acidic mixtures of actual leached electronic waste demonstrated the feasibility of recovery of gold from such liquors.

  4. Gold Nanoparticles Enhance the Anticancer Activity of Gallic Acid against Cholangiocarcinoma Cell Lines.

    PubMed

    Rattanata, Narintorn; Daduang, Sakda; Wongwattanakul, Molin; Leelayuwat, Chanvit; Limpaiboon, Temduang; Lekphrom, Ratsami; Sandee, Alisa; Boonsiri, Patcharee; Chio-Srichan, Sirinart; Daduang, Jureerut

    2015-01-01

    Gold nanoparticles (GNPs) were conjugated with gallic acid (GA) at various concentrations between 30 and 150 μM and characterized using transmission electron microscopy (TEM) and UV-Vis spectroscopy (UV-VIS). The anticancer activities of the gallic acid-stabilized gold nanoparticles against well-differentiated (M213) and moderately differentiated (M214) adenocarcinomas were then determined using a neutral red assay. The GA mechanism of action was evaluated using Fourier transform infrared (FTIR) microspectroscopy. Distinctive features of the FTIR spectra between the control and GA-treated cells were confirmed by principal component analysis (PCA). The surface plasmon resonance spectra of the GNPs had a maximum absorption at 520 nm, whereas GNPs-GA shifted the maximum absorption values. In an in vitro study, the complexed GNPs-GA had an increased ability to inhibit the proliferation of cancer cells that was statistically significant (P<0.0001) in both M213 and M214 cells compared to GA alone, indicating that the anticancer activity of GA can be improved by conjugation with GNPs. Moreover, PCA revealed that exposure of the tested cells to GA resulted in significant changes in their cell membrane lipids and fatty acids, which may enhance the efficacy of this anticancer activity regarding apoptosis pathways.

  5. Nonenzymatic amperometric sensor for ascorbic acid based on hollow gold/ruthenium nanoshells.

    PubMed

    Jo, Ara; Kang, Minkyung; Cha, Areum; Jang, Hye Su; Shim, Jun Ho; Lee, Nam-Suk; Kim, Myung Hwa; Lee, Youngmi; Lee, Chongmok

    2014-03-28

    We report a new nonenzymatic amperometric detection of ascorbic acid (AA) using a glassy carbon (GC) disk electrode modified with hollow gold/ruthenium (hAu-Ru) nanoshells, which exhibited decent sensing characteristics. The hAu-Ru nanoshells were prepared by the incorporation of Ru on hollow gold (hAu) nanoshells from Co nanoparticle templates, which enabled AA selectivity against glucose without aid of enzyme or membrane. The structure and electrocatalytic activities of the hAu-Ru catalysts were characterized by spectroscopic and electrochemical techniques. The hAu-Ru loaded on GC electrode (hAu-Ru/GC) showed sensitivity of 426 μA mM(-1) cm(-2) (normalized to the GC disk area) for the linear dynamic range of <5 μM to 2 mM AA at physiological pH. The response time and detection limit were 1.6 s and 2.2 μM, respectively. Furthermore, the hAu-Ru/GC electrode displayed remarkable selectivity for ascorbic acid over all potential biological interferents, including glucose, uric acid (UA), dopamine (DA), 4-acetamidophenol (AP), and nicotinamide adenine dinucleotide (NADH), which could be especially good for biological sensing.

  6. A paper based microfluidic device for easy detection of uric acid using positively charged gold nanoparticles.

    PubMed

    Kumar, Anand; Hens, Abhiram; Arun, Ravi Kumar; Chatterjee, Monosree; Mahato, Kuldeep; Layek, Keya; Chanda, Nripen

    2015-03-21

    A paper based microfluidic device is fabricated that can rapidly detect very low concentrations of uric acid (UA) using 3,5,3',5'-tetramethyl benzidine (TMB), H2O2 and positively charged gold nanoparticles ((+)AuNPs). In the presence of (+)AuNPs, H2O2 reacts with TMB to produce a bluish-green colour which becomes colourless on reaction with UA. This colorimetric method can detect as low as 8.1 ppm of UA within <20 minutes on white filter paper. This technique provides an alternative way for UA detection.

  7. Gold Electrodes Modified with Self-Assembled Monolayers for Measuring L-Ascorbic Acid: An Undergraduate Analytical Chemistry Laboratory Experiment

    ERIC Educational Resources Information Center

    Ito, Takashi; Perera, D. M. Neluni T.; Nagasaka, Shinobu

    2008-01-01

    This article describes an undergraduate electrochemistry laboratory experiment in which the students measure the L-ascorbic acid content of a real sample. Gold electrodes modified with self-assembled monolayers (SAMs) of thioctic acid and cysteamine are prepared to study the effects of surface modification on the electrode reaction of L-ascorbic…

  8. Elucidating the Influence of Gold Nanoparticles on the Binding of Salvianolic Acid B and Rosmarinic Acid to Bovine Serum Albumin

    PubMed Central

    Peng, Xin; Qi, Wei; Huang, Renliang; Su, Rongxin; He, Zhimin

    2015-01-01

    Salvianolic acid B and rosmarinic acid are two main water-soluble active ingredients from Salvia miltiorrhiza with important pharmacological activities and clinical applications. The interactions between salvianolic acid B (or rosmarinic acid) and bovine serum albumin (BSA) in the presence and absence of gold nanoparticles (Au NPs) with three different sizes were investigated by using biophysical methods for the first time. Experimental results proved that two components quenched the fluorescence of BSA mainly through a static mechanism irrespective of the absence or presence of Au NPs. The presence of Au NPs decreased the binding constants of salvianolic acid B with BSA from 27.82% to 10.08%, while Au NPs increased the affinities of rosmarinic acid for BSA from 0.4% to 14.32%. The conformational change of BSA in the presence of Au NPs (caused by a noncompetitive binding between Au NPs and drugs at different albumin sites) induced changeable affinity and binding distance between drugs and BSA compared with no Au NPs. The competitive experiments revealed that the site I (subdomain IIA) of BSA was the primary binding site for salvianolic acid B and rosmarinic acid. Additionally, two compounds may induce conformational and micro-environmental changes of BSA. The results would provide valuable binding information between salvianolic acid B (or rosmarinic acid) and BSA, and also indicated that the Au NPs could alter the interaction mechanism and binding capability of drugs to BSA, which might be beneficial to understanding the pharmacokinetics and biological activities of the two drugs. PMID:25861047

  9. Green synthesis of gold and silver nanoparticles using gallic acid: catalytic activity and conversion yield toward the 4-nitrophenol reduction reaction

    NASA Astrophysics Data System (ADS)

    Park, Jisu; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-06-01

    In the present report, gallic acid was used as both a reducing and stabilizing agent to synthesize gold and silver nanoparticles. The synthesized gold and silver nanoparticles exhibited characteristic surface plasmon resonance bands at 536 and 392 nm, respectively. Nanoparticles that were approximately spherical in shape were observed in high-resolution transmission electron microscopy and atomic force microscopy images. The hydrodynamic radius was determined to be 54.4 nm for gold nanoparticles and 33.7 nm for silver nanoparticles in aqueous medium. X-ray diffraction analyses confirmed that the synthesized nanoparticles possessed a face-centered cubic structure. FT-IR spectra demonstrated that the carboxylic acid functional groups of gallic acid contributed to the electrostatic binding onto the surface of the nanoparticles. Zeta potential values of -41.98 mV for the gold nanoparticles and -53.47 mV for the silver nanoparticles indicated that the synthesized nanoparticles possess excellent stability. On-the-shelf stability for 4 weeks also confirmed that the synthesized nanoparticles were quite stable without significant changes in their UV-visible spectra. The synthesized nanoparticles exhibited catalytic activity toward the reduction reaction of 4-nitrophenol to 4-aminophenol in the presence of sodium borohydride. The rate constant of the silver nanoparticles was higher than that of the gold nanoparticles in the catalytic reaction. Furthermore, the conversion yield (%) of 4-nitrophenol to 4-aminophenol was determined using reversed-phase high-performance liquid chromatography with UV detection at 254 nm. The silver nanoparticles exhibited an excellent conversion yield (96.7-99.9 %), suggesting that the synthesized silver nanoparticles are highly efficient catalysts for the 4-nitrophenol reduction reaction.

  10. Interaction of gold nanoparticles with free radicals and their role in enhancing the scavenging activity of ascorbic acid.

    PubMed

    Razzaq, Humaira; Saira, Farhat; Yaqub, Azra; Qureshi, Rumana; Mumtaz, Misbah; Saleemi, Samia

    2016-08-01

    The present study investigates the interaction of citrate stabilized gold nanoparticles (12±1.5nm) (GNPs) with free radicals; 1,1-diphenyl-2-picrylhydrazyl (DPPH) stable and electrochemically generated superoxide, O2(-). Different experiments were designed to understand the interaction between GNPs and DPPH by employing cyclic voltammetry, UV-vis spectroscopy and computational chemistry using 6-311G basis set. The increase in heterogeneous rate constant, ksh, of DPPH upon addition of GNPs pointed towards possible complex formation, DPPH-GNPs which were further explained by a model assuming surface adsorption of DPPH on GNPs. Further, the model was validated by studying interaction of GNPs with a biologically important free radical, O2(-). Exciting result in terms of disappearance of anodic peak after GNPs addition confirmed that gold nanoparticles interacted with stable as well as unstable free radicals. Also, the stoichiometry of the most stable complex GNP-DPPH was determined from UV-vis spectroscopy by applying Job's method. The GNP-DPPH complex was found to be active with 46.0% reduction of the IC50 value of standard antioxidant, ascorbic acid (AA), indicating its role in enhancing antioxidant activity. Hence, this study presents a simple and potential approach to enhance the efficiency of natural antioxidants without modifying their structure, or involving the complex functionalization of GNPs with antioxidants.

  11. In situ deposition of gold nanoparticles on polydopamine functionalized silica nanosphere for ultrasensitive nonenzymatic electrochemical immunoassay.

    PubMed

    Lai, Guosong; Zhang, Haili; Yong, Jiawey; Yu, Aimin

    2013-09-15

    A novel gold nanoprobe was prepared for the signal tracing of ultrasensitive nonenzymatic electrochemical immunoassay at a carbon nanotubes (CNTs)-based disposable immunosensor. The gold nanoprobe was prepared via in situ deposition of gold nanoparticles (Au NPs) on the polydopamine functionalized silica nanosphere followed by the labeling of signal antibodies. The immunosensor was prepared through the covalent immobilization of capturing antibodies on the CNTs modified screen-printed carbon electrode. After a sandwich-type immunoreaction on the immunosensor surface, the gold nanoprobes were captured onto the electrode surface to form immunocomplex. The multiple Au NPs on the attached nanoprobe composites were then measured by electrochemical stripping analysis to obtain signal response. This method provided a simple and controllable way to prepare a novel gold nanoprobe which greatly amplified the signal response of every single immuno-recognition event. The modification of electrode surface with CNTs also facilitated the stripping current enhancement of Au NPs resulting in the ultrahigh sensitivity of this immunoassay method. Using human IgG as a model analyte, the proposed method showed a wide linear range over three orders of magnitude with the detection limit down to 6.9pg/mL. Besides, this method showed excellent analytical performance with low cost, good portability, and acceptable reproducibility, stability and accuracy, thus providing great potentials for clinical applications.

  12. Surface-enhanced Raman spectroscopy on laser-engineered ruthenium dye-functionalized nanoporous gold

    NASA Astrophysics Data System (ADS)

    Schade, Lina; Franzka, Steffen; Biener, Monika; Biener, Jürgen; Hartmann, Nils

    2016-06-01

    Photothermal processing of nanoporous gold with a microfocused continuous-wave laser at λ = 532 nm provides a facile means in order engineer the pore and ligament size of nanoporous gold. In this report we take advantage of this approach in order to investigate the size-dependence of enhancement effects in surface-enhanced Raman spectroscopy (SERS). Surface structures with laterally varying pore sizes from 25 nm to ≥200 nm are characterized using scanning electron microscopy and then functionalized with N719, a commercial ruthenium complex, which is widely used in dye-sensitized solar cells. Raman spectroscopy reveals the characteristic spectral features of N719. Peak intensities strongly depend on the pore size. Highest intensities are observed on the native support, i.e. on nanoporous gold with pore sizes around 25 nm. These results demonstrate the particular perspectives of laser-fabricated nanoporous gold structures in fundamental SERS studies. In particular, it is emphasized that laser-engineered porous gold substrates represent a very well defined platform in order to study size-dependent effects with high reproducibility and precision and resolve conflicting results in previous studies.

  13. Influence of green and gold kiwifruit on indices of large bowel function in healthy rats.

    PubMed

    Paturi, Gunaranjan; Butts, Christine A; Bentley-Hewitt, Kerry L; Ansell, Juliet

    2014-08-01

    The effects of kiwifruit on large bowel health were investigated in healthy rats. Four-week old Sprague-Dawley rats were given diets containing 10% homogenized green kiwifruit, gold kiwifruit or 10% glucose solution (control) over 4 or 6 wk. Green kiwifruit increased the fecal output compared to control. Growth of certain bacterial species in cecum was influenced by both green and gold kiwifruit. A significant increase in cecal Lachnospiraceae in rats fed the green kiwifruit diet was observed at week 4. At week 6, green and gold kiwifruit diets assisted in improving colonic barrier function by upregulating the expression of mucin (MUC)-2, MUC3, Toll-like receptor (TLR)-4 or trefoil factor-3 genes. Gold kiwifruit consumption increased the colonic goblet cells per crypt at week 6. Significant negative correlations between E. coli and β-defensin 1 and TLR4 expression were observed. Consuming green and gold kiwifruit for 6 wk significantly altered the biomarkers of large bowel health; indicating that regularly consuming kiwifruit helps attain optimal digestive health.

  14. Targeted Enlargement of Aptamer Functionalized Gold Nanoparticles for Quantitative Protein Analysis

    PubMed Central

    Li, Feng; Li, Jingjing; Tang, Yanan; Wang, Chuan; Li, Xing-Fang; Le, X. Chris

    2016-01-01

    The ability to selectively amplify the detection signals for targets over interferences is crucial when analyzing proteins in a complicated sample matrix. Here, we describe a targeted enlargement strategy that can amplify the light-scattering signal from aptamer-functionalized gold nanoparticles (Apt-AuNP) with high specificity for quantitative protein analysis. This strategy is achieved by labeling target proteins with competitively protected Apt-AuNP probes and enlarging the probes with gold enhancement. This competitive protection strategy could effectively eliminate nonspecific protein adsorptions from a sample matrix, leading to a highly specific labeling of the target protein. As a result, the subsequent amplification of the light-scattering signal by gold enhancement only occurs in the presence of the target protein. This strategy was successfully demonstrated by analyzing human α-thrombin in human serum samples in a Western blot format. PMID:28248252

  15. Colorimetric detection of biological hydrogen sulfide using fluorosurfactant functionalized gold nanorods.

    PubMed

    Zhang, Xuan; Zhou, Wenjuan; Yuan, Zhiqin; Lu, Chao

    2015-11-07

    As a well-known environmental pollutant but also an important gaseous transmitter, the specific detection of hydrogen sulfide (H2S) is significant in biological systems. In this study, fluorosurfactant functionalized gold nanorods (FSN-AuNRs) have been proposed to act as selective colorimetric nanoprobes for H2S. With the combination of strong gold-S interactions and small FSN bilayer interstices, FSN-AuNRs demonstrate favorable selectivity and sensitivity toward H2S over other anions and small biological molecules. The practical application of the present method in biological H2S detection was validated with human and mouse serum samples. Moreover, the proposed nanoprobe can also be used for evaluating the activity of H2S synthetase.

  16. ACID EVAPORATION OF ULTIMA GOLD TM AB LIQUID SCINTILLATION COCKTAIL RESIDUE

    SciTech Connect

    Kyser, E.; Fondeur, F.; Crump, S.

    2011-12-21

    Prior analyses of samples from the F/H Lab solutions showed the presence of diisopropylnapthalene (DIN), a major component of Ultima Gold{trademark} AB liquid scintillation cocktail (LSC). These solutions are processed through H-Canyon Tank 10.5 and ultimately through the 17.8E evaporator. Similar solutions originated in SRNL streams sent to the same H Canyon tanks. This study examined whether the presence of these organics poses a process-significant hazard for the evaporator. Evaporation and calorimetry testing of surrogate samples containing 2000 ppm of Ultima Gold{trademark} AB LSC in 8 M nitric acid have been completed. These experiments showed that although reactions between nitric acid and the organic components do occur, they do not appear to pose a significant hazard for runaway reactions or generation of energetic compounds in canyon evaporators. The amount of off-gas generated was relatively modest and appeared to be well within the venting capacity of the H-Canyon evaporators. A significant fraction of the organic components likely survives the evaporation process primarily as non-volatile components that are not expected to represent any new process concerns during downstream operations such as neutralization. Laboratory Waste solutions containing minor amounts of DIN can be safely received, stored, transferred, and processed through the canyon waste evaporator.

  17. Citric acid-coated gold nanoparticles for visual colorimetric recognition of pesticide dimethoate

    NASA Astrophysics Data System (ADS)

    Dar, Aqib Iqbal; Walia, Shanka; Acharya, Amitabha

    2016-08-01

    A colorimetric chemo-sensor based on citric acid-coated gold NPs (C-GNP) showed a linear increase in fluorescence intensity with increasing concentration of pesticide dimethoate (DM). The limit of detection was found to be between 8.25± 0.3 and 20 ± 9.5 ppm. The increase in fluorescence intensity was suggested to have originated from the soft-soft interaction between C-GNPs and DM via sulfur group which is absent in pesticide dicofol (DF). Similar studies with citric acid-coated silver NPs (C-SNPs) did not result any change in the fluorescence intensity. The microscopic studies suggested aggregation of C-GNPs in the presence of DM but not in case of DF.

  18. Gold-functionalized DNAzyme Nanosensors to Quantify Heavy Metal Gradients

    NASA Astrophysics Data System (ADS)

    Adriaens, P.; Vannela, R.

    2005-12-01

    species (e.g. Hg2+ and As5+) These specific and sensitive nanosensors will be embedded on gold particle arrays for enhanced signal amplification, rendering them amenable to detect metal concentration gradients in situ.

  19. Surface analysis of gold nanoparticles functionalized with thiol-modified glucose SAMs for biosensor applications.

    NASA Astrophysics Data System (ADS)

    Spampinato, Valentina; Parracino, Mariaantonietta; La Spina, Rita; Rossi, Francois; Ceccone, Giacomo

    2016-02-01

    In this work, Time of Flight Secondary Ion Mass Spectrometry (ToF-SIMS), Principal Component Analysis (PCA) and X-ray Photoelectron Spectroscopy (XPS) have been used to characterize the surface chemistry of gold substrates before and after functionalization with thiol-modified glucose self-assembled monolayers and subsequent biochemical specific recognition of maltose binding protein (MBP). The results indicate that the surface functionalization is achieved both on flat and nanoparticles gold substrates thus showing the potential of the developed system as biodetection platform. Moreover, the method presented here has been found to be a sound and valid approach to characterize the surface chemistry of nanoparticles functionalized with large molecules. Both techniques were proved to be very useful tools for monitoring all the functionalization steps, including the investigation of the biological behaviour of the glucose-modified particles in presence of the maltose binding protein.

  20. Surface Analysis of Gold Nanoparticles Functionalized with Thiol-Modified Glucose SAMs for Biosensor Applications

    PubMed Central

    Spampinato, Valentina; Parracino, Maria Antonietta; La Spina, Rita; Rossi, Francois; Ceccone, Giacomo

    2016-01-01

    In this work, Time of Flight Secondary Ion Mass Spectrometry (ToF-SIMS), Principal Component Analysis (PCA) and X-ray Photoelectron Spectroscopy (XPS) have been used to characterize the surface chemistry of gold substrates before and after functionalization with thiol-modified glucose self-assembled monolayers and subsequent biochemical specific recognition of maltose binding protein (MBP). The results indicate that the surface functionalization is achieved both on flat and nanoparticles gold substrates thus showing the potential of the developed system as biodetection platform. Moreover, the method presented here has been found to be a sound and valid approach to characterize the surface chemistry of nanoparticles functionalized with large molecules. Both techniques were proved to be very useful tools for monitoring all the functionalization steps, including the investigation of the biological behavior of the glucose-modified particles in the presence of the maltose binding protein. PMID:26973830

  1. Catalytic reduction of 4-nitrophenol with gold nanoparticles synthesized by caffeic acid.

    PubMed

    Seo, Yu Seon; Ahn, Eun-Young; Park, Jisu; Kim, Tae Yoon; Hong, Jee Eun; Kim, Kyeongsoon; Park, Yohan; Park, Youmie

    2017-12-01

    In this study, various concentrations of caffeic acid (CA) were used to synthesize gold nanoparticles (CA-AuNPs) in order to evaluate their catalytic activity in the 4-nitrophenol reduction reaction. To facilitate catalytic activity, caffeic acid was removed by centrifugation after synthesizing CA-AuNPs. The catalytic activity of CA-AuNPs was compared with that of centrifuged CA-AuNPs (cf-CA-AuNPs). Notably, cf-CA-AuNPs exhibited up to 6.41-fold higher catalytic activity compared with CA-AuNPs. The catalytic activity was dependent on the caffeic acid concentration, and the lowest concentration (0.08 mM) produced CA-AuNPs with the highest catalytic activity. The catalytic activities of both CA-AuNPs and cf-CA-AuNPs decreased with increasing caffeic acid concentration. Furthermore, a conversion yield of 4-nitrophenol to 4-aminophenol in the reaction mixture was determined to be 99.8% using reverse-phase high-performance liquid chromatography. The product, 4-aminophenol, was purified from the reaction mixture, and its structure was confirmed by (1)H-NMR. It can be concluded that the removal of the reducing agent, caffeic acid in the present study, significantly enhanced the catalytic activity of CA-AuNPs in the 4-nitrophenol reduction reaction.

  2. Catalytic reduction of 4-nitrophenol with gold nanoparticles synthesized by caffeic acid

    NASA Astrophysics Data System (ADS)

    Seo, Yu Seon; Ahn, Eun-Young; Park, Jisu; Kim, Tae Yoon; Hong, Jee Eun; Kim, Kyeongsoon; Park, Yohan; Park, Youmie

    2017-01-01

    In this study, various concentrations of caffeic acid (CA) were used to synthesize gold nanoparticles (CA-AuNPs) in order to evaluate their catalytic activity in the 4-nitrophenol reduction reaction. To facilitate catalytic activity, caffeic acid was removed by centrifugation after synthesizing CA-AuNPs. The catalytic activity of CA-AuNPs was compared with that of centrifuged CA-AuNPs ( cf-CA-AuNPs). Notably, cf-CA-AuNPs exhibited up to 6.41-fold higher catalytic activity compared with CA-AuNPs. The catalytic activity was dependent on the caffeic acid concentration, and the lowest concentration (0.08 mM) produced CA-AuNPs with the highest catalytic activity. The catalytic activities of both CA-AuNPs and cf-CA-AuNPs decreased with increasing caffeic acid concentration. Furthermore, a conversion yield of 4-nitrophenol to 4-aminophenol in the reaction mixture was determined to be 99.8% using reverse-phase high-performance liquid chromatography. The product, 4-aminophenol, was purified from the reaction mixture, and its structure was confirmed by 1H-NMR. It can be concluded that the removal of the reducing agent, caffeic acid in the present study, significantly enhanced the catalytic activity of CA-AuNPs in the 4-nitrophenol reduction reaction.

  3. Quantitative analysis of PEG-functionalized colloidal gold nanoparticles using charged aerosol detection.

    PubMed

    Smith, Mackensie C; Crist, Rachael M; Clogston, Jeffrey D; McNeil, Scott E

    2015-05-01

    Surface characteristics of a nanoparticle, such as functionalization with polyethylene glycol (PEG), are critical to understand and achieve optimal biocompatibility. Routine physicochemical characterization such as UV-vis spectroscopy (for gold nanoparticles), dynamic light scattering, and zeta potential are commonly used to assess the presence of PEG. However, these techniques are merely qualitative and are not sensitive enough to distinguish differences in PEG quantity, density, or presentation. As an alternative, two methods are described here which allow for quantitative measurement of PEG on PEGylated gold nanoparticles. The first, a displacement method, utilizes dithiothreitol to displace PEG from the gold surface. The dithiothreitol-coated gold nanoparticles are separated from the mixture via centrifugation, and the excess dithiothreitol and dissociated PEG are separated through reversed-phase high-performance liquid chromatography (RP-HPLC). The second, a dissolution method, utilizes potassium cyanide to dissolve the gold nanoparticles and liberate PEG. Excess CN(-), Au(CN)2 (-), and free PEG are separated using RP-HPLC. In both techniques, the free PEG can be quantified against a standard curve using charged aerosol detection. The displacement and dissolution methods are validated here using 2-, 5-, 10-, and 20-kDa PEGylated 30-nm colloidal gold nanoparticles. Further value in these techniques is demonstrated not only by quantitating the total PEG fraction but also by being able to be adapted to quantitate the free unbound PEG and the bound PEG fractions. This is an important distinction, as differences in the bound and unbound PEG fractions can affect biocompatibility, which would not be detected in techniques that only quantitate the total PEG fraction.

  4. UV-Visible Spectroscopy Detection of Iron(III) Ion on Modified Gold Nanoparticles With a Hydroxamic Acid

    NASA Astrophysics Data System (ADS)

    Karami, C.; Alizadeh, A.; Taher, M. A.; Hamidi, Z.; Bahrami, B.

    2016-09-01

    The present work describes the preparation of gold nanoparticles (AuNPs) functionalized with hydroxamic acid and the use of them in UV-visible spectroscopy detection of iron(III) ions. The prepared AuNPs were thoroughly characterized by using UV-visible spectroscopy, TEM, and 1H NMR techniques. The newly synthesized hydroxamic acid-AuNPs are brown in color due to the intense surface plasmon absorption band centered at 527 nm. In the presence of Fe(III), the surface plasmon absorption band is centered at 540 nm. However, the sensitivity of hydroxamic acid-AuNPs towards other metal ions such as Mg(II), Ca(II), Ag(I), Cu(II), Mn(II), Cr(II), Ni(II), Co(II),Fe(II), Hg(II), and Pb(II) can be negligible. This highly selective sensor allows a direct quantitative assay of Fe(III) with a UVvisible spectroscopy detection limited to 45.8 nM.

  5. EGF Functionalized Polymer-Coated Gold Nanoparticles Promote EGF Photostability and EGFR Internalization for Photothermal Therapy

    PubMed Central

    Silva, Catarina Oliveira; Petersen, Steffen B.; Reis, Catarina Pinto; Rijo, Patrícia; Molpeceres, Jesús; Fernandes, Ana Sofia; Gonçalves, Odete; Gomes, Andreia C.; Correia, Isabel; Vorum, Henrik; Neves-Petersen, Maria Teresa

    2016-01-01

    The application of functionalized nanocarriers on photothermal therapy for cancer ablation has wide interest. The success of this application depends on the therapeutic efficiency and biocompatibility of the system, but also on the stability and biorecognition of the conjugated protein. This study aims at investigating the hypothesis that EGF functionalized polymer-coated gold nanoparticles promote EGF photostability and EGFR internalization, making these conjugated particles suitable for photothermal therapy. The conjugated gold nanoparticles (100–200 nm) showed a plasmon absorption band located within the near-infrared range (650–900 nm), optimal for photothermal therapy applications. The effects of temperature, of polymer-coated gold nanoparticles and of UVB light (295nm) on the fluorescence properties of EGF have been investigated with steady-state and time-resolved fluorescence spectroscopy. The fluorescence properties of EGF, including the formation of Trp and Tyr photoproducts, is modulated by temperature and by the intensity of the excitation light. The presence of polymeric-coated gold nanoparticles reduced or even avoided the formation of Trp and Tyr photoproducts when EGF is exposed to UVB light, protecting this way the structure and function of EGF. Cytotoxicity studies of conjugated nanoparticles carried out in normal-like human keratinocytes showed small, concentration dependent decreases in cell viability (0–25%). Moreover, conjugated nanoparticles could activate and induce the internalization of overexpressed Epidermal Growth Factor Receptor in human lung carcinoma cells. In conclusion, the gold nanoparticles conjugated with Epidermal Growth Factor and coated with biopolymers developed in this work, show a potential application for near infrared photothermal therapy, which may efficiently destroy solid tumours, reducing the damage of the healthy tissue. PMID:27788212

  6. Rational design of gold nanoparticles functionalized with carboranes for application in Boron Neutron Capture Therapy.

    PubMed

    Ciani, Laura; Bortolussi, Silva; Postuma, Ian; Cansolino, Laura; Ferrari, Cinzia; Panza, Luigi; Altieri, Saverio; Ristori, Sandra

    2013-12-31

    In this paper we propose a bottom-up approach to obtain new boron carriers built with ortho-carborane functionalized gold nanoparticles (GNPs) for applications in Boron Neutron Capture Therapy. The interaction between carboranes and the gold surface was assured by one or two SH-groups directly linked to the boron atoms of the B10C2 cage. This allowed obtaining stable, nontoxic systems, though optimal biological performance was hampered by low solubility in aqueous media. To improve cell uptake, the hydrophilic character of carborane functionalized GNPs was enhanced by further coverage with an appropriately tailored diblock copolymer (PEO-b-PCL). This polymer also contained pendant carboranes to provide anchoring to the pre-functionalized GNPs. In vitro tests, carried out on osteosarcoma cells, showed that the final vectors possessed excellent biocompatibility joint to the capacity of concentrating boron atoms in the target, which is encouraging evidenced to pursue applications in vivo.

  7. Nanoporous-Gold-Based Electrode Morphology Libraries for Investigating Structure-Property Relationships in Nucleic Acid Based Electrochemical Biosensors.

    PubMed

    Matharu, Zimple; Daggumati, Pallavi; Wang, Ling; Dorofeeva, Tatiana S; Li, Zidong; Seker, Erkin

    2017-01-31

    Nanoporous gold (np-Au) electrode coatings significantly enhance the performance of electrochemical nucleic acid biosensors because of their three-dimensional nanoscale network, high electrical conductivity, facile surface functionalization, and biocompatibility. Contrary to planar electrodes, the np-Au electrodes also exhibit sensitive detection in the presence of common biofouling media due to their porous structure. However, the pore size of the nanomatrix plays a critical role in dictating the extent of biomolecular capture and transport. Small pores perform better in the case of target detection in complex samples by filtering out the large nonspecific proteins. On the other hand, larger pores increase the accessibility of target nucleic acids in the nanoporous structure, enhancing the detection limits of the sensor at the expense of more interference from biofouling molecules. Here, we report a microfabricated np-Au multiple electrode array that displays a range of electrode morphologies on the same chip for identifying feature sizes that reduce the nonspecific adsorption of proteins but facilitate the permeation of target DNA molecules into the pores. We demonstrate the utility of the electrode morphology library in studying DNA functionalization and target detection in complex biological media with a special emphasis on revealing ranges of electrode morphologies that mutually enhance the limit of detection and biofouling resilience. We expect this technique to assist in the development of high-performance biosensors for point-of-care diagnostics and facilitate studies on the electrode structure-property relationships in potential applications ranging from neural electrodes to catalysts.

  8. Gold-Catalyzed Highly Regioselective Oxidation of C-C Triple Bonds Without Acid Additives: Propargyl Moieties as Masked α,β-Unsaturated Carbonyls

    PubMed Central

    Lu, Biao; Li, Chaoqun; Zhang, Liming

    2010-01-01

    Gold-catalyzed intermolecular oxidations of internal alkynes have been achieved with high regioselectivities using 8-alkylqinoline N-oxides as oxidants and in the absence of acid additives. Synthetically versatile α,β-unsaturated carbonyls are obtained in good to excellent yields and with excellent E-selectivities. A range of functional groups such as THP, MOMO, N3, OTBS, and N-Boc are tolerated. This reaction allows to mask α,β-unsaturated carbonyls as propargyl moieties, thus offering a practical solution to issues of functional group compatibility with α,β-unsaturated carbonyls, likely encountered in syntheses of complex structures. PMID:20853846

  9. Selective oxidation of cyclohexene through gold functionalized silica monolith microreactors

    NASA Astrophysics Data System (ADS)

    Alotaibi, Mohammed T.; Taylor, Martin J.; Liu, Dan; Beaumont, Simon K.; Kyriakou, Georgios

    2016-04-01

    Two simple, reproducible methods of preparing evenly distributed Au nanoparticle containing mesoporous silica monoliths are investigated. These Au nanoparticle containing monoliths are subsequently investigated as flow reactors for the selective oxidation of cyclohexene. In the first strategy, the silica monolith was directly impregnated with Au nanoparticles during the formation of the monolith. The second approach was to pre-functionalize the monolith with thiol groups tethered within the silica mesostructure. These can act as evenly distributed anchors for the Au nanoparticles to be incorporated by flowing a Au nanoparticle solution through the thiol functionalized monolith. Both methods led to successfully achieving even distribution of Au nanoparticles along the length of the monolith as demonstrated by ICP-OES. However, the impregnation method led to strong agglomeration of the Au nanoparticles during subsequent heating steps while the thiol anchoring procedure maintained the nanoparticles in the range of 6.8 ± 1.4 nm. Both Au nanoparticle containing monoliths as well as samples with no Au incorporated were tested for the selective oxidation of cyclohexene under constant flow at 30 °C. The Au free materials were found to be catalytically inactive with Au being the minimum necessary requirement for the reaction to proceed. The impregnated Au-containing monolith was found to be less active than the thiol functionalized Au-containing material, attributable to the low metal surface area of the Au nanoparticles. The reaction on the thiol functionalized Au-containing monolith was found to depend strongly on the type of oxidant used: tert-butyl hydroperoxide (TBHP) was more active than H2O2, likely due to the thiol induced hydrophobicity in the monolith.

  10. Effect of halide and acid additives on the direct synthesis of hydrogen peroxide using supported gold-palladium catalysts.

    PubMed

    Ntainjua N, Edwin; Piccinini, Marco; Pritchard, James C; Edwards, Jennifer K; Carley, Albert F; Moulijn, Jacob A; Hutchings, Graham J

    2009-01-01

    The effect of halide and acid addition on the direct synthesis of hydrogen peroxide is studied for magnesium oxide- and carbon-supported bimetallic gold-palladium catalysts. The addition of acids decreases the hydrogenation/decomposition of hydrogen peroxide, and the effect is particularly pronounced for the magnesium oxide-supported catalysts whilst for carbon-supported catalysts the pH requires close control to optimize hydrogen peroxide synthesis. The addition of bromide leads to a marked decrease in the hydrogenation/decomposition of hydrogen peroxide with either catalyst. These effects are discussed in terms of the structure of the gold-palladium alloy nanoparticles and the isoelectric point of the support. We conclude that with the highly active carbon-supported gold-palladium catalysts these additives are not required and that therefore this system presents the potential for the direct synthesis of hydrogen peroxide to be operated using green process technology.

  11. Lung function decline rates according to GOLD group in patients with chronic obstructive pulmonary disease

    PubMed Central

    Kim, Joohae; Yoon, Ho Il; Oh, Yeon-Mok; Lim, Seong Yong; Lee, Ji-Hyun; Kim, Tae-Hyung; Lee, Sang Yeub; Lee, Jin Hwa; Lee, Sang-Do; Lee, Chang-Hoon

    2015-01-01

    Background Since the Global Initiative for Chronic Obstructive Lung Disease (GOLD) groups A–D were introduced, the lung function changes according to group have been evaluated rarely. Objective We investigated the rate of decline in annual lung function in patients categorized according to the 2014 GOLD guidelines. Methods Patients with COPD included in the Korean Obstructive Lung Disease (KOLD) prospective study, who underwent yearly postbronchodilator spirometry at least three times, were included. The main outcome was the annual decline in postbronchodilator forced expiratory volume in 1 second (FEV1), which was analyzed by random-slope and random-intercept mixed linear regression. Results A total 175 participants were included. No significant postbronchodilator FEV1 decline was observed between the groups (−34.4±7.9 [group A]; −26.2±9.4 [group B]; −22.7±16.0 [group C]; and −24.0±8.7 mL/year [group D]) (P=0.79). The group with less symptoms (−32.3±7.2 vs −25.0±6.5 mL/year) (P=0.44) and the low risk group (−31.0±6.1 vs −23.6±7.7 mL/year) (P=0.44) at baseline showed a more rapid decline in the postbronchodilator FEV1, but the trends were not statistically significant. However, GOLD stages classified by FEV1 were significantly related to the annual lung function decline. Conclusion There was no significant difference in lung function decline rates according to the GOLD groups. Prior classification using postbronchodilator FEV1 predicts decline in lung function better than does the new classification. PMID:26379432

  12. Electrochemical Biosensor: Multistep functionalization of thiolated ssDNA on gold-coated microcantilever

    NASA Astrophysics Data System (ADS)

    Dulanto Carbajal, Jorge

    Bio-chemical sensors are an emerging and vibrant area of research. The use of micromechanical cantilevers is relatively new as biomechanical recognition detectors. Reactions on a gold coated and chemically functionalized surface produce a mechanical deflection of the cantilever which is used as the input signal of the detector. Within the area of biosensors, DNA-sensors have a wide range of applications such as DNA hybridization detectors, DNA mismatch sequence detectors and protein detectors. We designed and built a microcantilever sensor system which allows for control and characterization of surface conditions. This includes controlled functionalization which can be a dominant factor in signal generation and reproducibility in these systems. Additionally, we developed a multistep functionalization protocol which consists of a sequence of short incubations and characterizations of thiolated ssDNA on a gold-coated cantilever. Multistep functionalization is a new protocol that is used to control the ssDNA surface density on a gold-coated cantilever. Repeatable responses and feasible biosensors are obtained using this protocol.

  13. Synthesis and evaluation of glycopolymeric decorated gold nanoparticles functionalized with gold-triphenyl phosphine as anti-cancer agents.

    PubMed

    Adokoh, Christian K; Quan, Stephen; Hitt, Mary; Darkwa, James; Kumar, Piyush; Narain, Ravin

    2014-10-13

    In this study, statistical glyco-dithiocarbamate (DTC) copolymers were synthesized by reversible addition-fragmentation chain transfer polymerization (RAFT) and subsequently used to prepare glyconanoparticles and conjugated glyconanoparticles with the anticancer drug, gold(I) triphenylphosphine. These glyconanoparticles and the corresponding conjugates were then tested for their in vitro cytotoxicity in both normal and cancer cell lines using Neutral Red assay. The glyconanoparticles and their Au(I)PPh3 conjugates were all active against MCF7 and HepG2 cells, but galactose-functionalized glyconanoparticles {P(GMA-EDAdtc(AuPPh3)-st-LAEMA)AuNP} were found to be the most cytotoxic to HepG2 cells (IC50 ∼ 4.13 ± 0.73 μg/mL). The p(GMA-EDAdtc(AuPPh3)-st-LAEMA)AuNP was found to be a 4-fold more potent antitumor agent in HepG2 cells, and the overexpressed asialoglycoprotein (ASGPR) receptors revealed to play an important role in the cytotoxicity, presumably by the enhanced uptake. In addition, the glyconanoparticles Au(I) conjugates are found to be significantly more toxic as compared to the standard chemotherapeutic reagents such as cisplatin and cytarabine.

  14. Mechanistic Insights into the Catalytic Oxidation of Carboxylic Acids on Au/TiO2: Partial Oxidation of Propionic and Butyric Acid to Gold Ketenylidene through Unsaturated Acids

    SciTech Connect

    McEntee, Monica; Tang, Wenjie; Neurock, Matthew; Yates, Jr., John T.

    2014-12-12

    Here, the partial oxidation of model C2–C4 (acetic, propionic, and butyric) carboxylic acids on Au/TiO2 catalysts consisting of Au particles ~3 nm in size was investigated using transmission infrared spectroscopy and density functional theory. All three acids readily undergo oxidative dehydrogenation on Au/TiO2. Propionic and butyric acid dehydrogenate at the C2–C3 positions, whereas acetic acid dehydrogenates at the C1–C2 position. The resulting acrylate and crotonate intermediates are subsequently oxidized to form β-keto acids that decarboxylate. All three acids form a gold ketenylidene intermediate, Au2C=C=O, along the way to their full oxidation to form CO2. Infrared measurements of Au2C=C=O formation as a function of time provides a surface spectroscopic probe of the kinetics for the activation and oxidative dehydrogenation of the alkyl groups in the carboxylate intermediates that form.

  15. Analysis of the Evolution of Tannic Acid Stabilized Gold Nanoparticles Using Mie Theory

    PubMed Central

    Chabane Sari, Sidi Mohammed; Hakem, Ilhem Faiza

    2014-01-01

    Spherical gold nanoparticles (GNPs) have been synthesized in aqueous solutions using sodium citrate (SC) and tannic acid (TA) as reducing and stabilizing agents. Upon addition of TA and compared to the GNP TA-free aqueous solutions, a reduction of the GNPs size and consequently a dramatic change of their optical properties have been observed and quantitatively analyzed using Mie theory. An increase in the concentration of TA reveals a modification of the colloidal solution refractive index that is evidenced by the shift in the peak position of the localized surface plasmon resonance (LSPR) band. The variations of the peak absorbance with the TA concentration are examined in the low and high concentration regimes. PMID:25525433

  16. Enzymatically catalytic deposition of gold nanoparticles by glucose oxidase-functionalized gold nanoprobe for ultrasensitive electrochemical immunoassay.

    PubMed

    Cheng, Hui; Lai, Guosong; Fu, Li; Zhang, Haili; Yu, Aimin

    2015-09-15

    A novel ultrasensitive immunoassay method was developed by combination of the enzymatically catalytic gold deposition with the prepared gold nanoprobe and the gold stripping analysis at an electrochemical chip based immunosensor. The immunosensor was constructed through covalently immobilizing capture antibody at a carbon nanotube (CNT) modified screen-printed carbon electrode. The gold nanoprobe was prepared by loading signal antibody and high-content glucose oxidase (GOD) on the nanocarrier of gold nanorod (Au NR). After sandwich immunoreaction, the GOD-Au NR nanoprobe could be quantitatively captured onto the immunosensor surface and then induce the deposition of gold nanoparticles (Au NPs) via the enzymatically catalytic reaction. Based on the electrochemical stripping analysis of the Au NR nanocarriers and the enzymatically produced Au NPs, sensitive electrochemical signal was obtained for the immunoassay. Both the GOD-induced deposition of Au NPs by the nanoprobe and the sensitive electrochemical stripping analysis on the CNTs based sensing surface greatly amplified the signal response, leading to the ultrahigh sensitivity of this method. Using carcinoembryonic antigen as a model analyte, excellent analytical performance including a wide linear range from 0.01 to 100 ng/mL and a detection limit down to 4.2 pg/mL was obtained. In addition, this immunosensor showed high specificity and satisfactory reproducibility, stability and reliability. The relatively positive detection potential excluded the conventional interference from dissolved oxygen. Thus this electrochemical chip based immunosensing method provided great potentials for practical applications.

  17. Gold nanoparticles having dipicolinic acid imprinted nanoshell for Bacillus cereus spores recognition

    NASA Astrophysics Data System (ADS)

    Gültekin, Aytaç; Ersöz, Arzu; Hür, Deniz; Sarıözlü, Nalan Yılmaz; Denizli, Adil; Say, Rıdvan

    2009-10-01

    Taking into account the recognition element for sensors linked to molecular imprinted polymers (MIPs), a proliferation of interest has been witnessed by those who are interested in this subject. Indeed, MIP nanoparticles are theme which recently has come to light in the literature. In this study, we have proposed a novel thiol ligand-capping method with polymerizable methacryloylamidocysteine (MAC) attached to gold nanoparticles, reminiscent of a self-assembled monolayer. Furthermore, a surface shell by synthetic host polymers based on molecular imprinting method for recognition has been reconstructed. In this method, methacryloyl iminodiacetic acid-chrome (MAIDA-Cr(III)) has been used as a new metal-chelating monomer via metal coordination-chelation interactions and dipicolinic acid (DPA) which is the main participant of Bacillus cereus spores has been used as a template. Nanoshell sensors with templates produce a cavity that is selective for DPA. The DPA can simultaneously chelate to Cr(III) metal ion and fit into the shape-selective cavity. Thus, the interaction between Cr(III) ion and free coordination spheres has an effect on the binding ability of the gold nanoparticles nanosensor. The interactions between DPA and MIP particles were studied observing fluorescence measurements. DPA addition caused significant decreases in fluorescence intensity because they induced photoluminescence emission from Au nanoparticles through the specific binding to the recognition sites of the crosslinked nanoshell polymer matrix. The binding affinity of the DPA imprinted nanoparticles has been explored by using the Langmuir and Scatchard methods and the analysis of the quenching results has been performed in terms of the Stern-Volmer equation.

  18. The amplification effect of functionalized gold nanoparticles on the binding of anticancer drug dacarbazine to DNA and DNA bases

    NASA Astrophysics Data System (ADS)

    Shen, Qin; Wang, Xuemei; Fu, Degang

    2008-11-01

    The promising application of functionalized gold nanoparticles to amplify the performance of biosensors and relevant biomolecular recognition processes has been explored in this paper. Our observations illustrate the apparent enhancement effect of the gold nanoparticles on the electrochemical response of the anticancer drug dacarbazine (DTIC) binding to DNA and DNA bases, indicating that these functionalized gold nanoparticles could readily facilitate the specific interactions between DTIC and DNA/DNA bases. This raises the potential valuable applications of these biocompatible nanoparticles in the promising biosensors and biomedical engineering.

  19. Acid-functionalized nanoparticles for biomass hydrolysis

    NASA Astrophysics Data System (ADS)

    Pena Duque, Leidy Eugenia

    Cellulosic ethanol is a renewable source of energy. Lignocellulosic biomass is a complex material composed mainly of cellulose, hemicellulose, and lignin. Biomass pretreatment is a required step to make sugar polymers liable to hydrolysis. Mineral acids are commonly used for biomass pretreatment. Using acid catalysts that can be recovered and reused could make the process economically more attractive. The overall goal of this dissertation is the development of a recyclable nanocatalyst for the hydrolysis of biomass sugars. Cobalt iron oxide nanoparticles (CoFe2O4) were synthesized to provide a magnetic core that could be separated from reaction using a magnetic field and modified to carry acid functional groups. X-ray diffraction (XRD) confirmed the crystal structure was that of cobalt spinel ferrite. CoFe2O4 were covered with silica which served as linker for the acid functions. Silica-coated nanoparticles were functionalized with three different acid functions: perfluoropropyl-sulfonic acid, carboxylic acid, and propyl-sulfonic acid. Transmission electron microscope (TEM) images were analyzed to obtain particle size distributions of the nanoparticles. Total carbon, nitrogen, and sulfur were quantified using an elemental analyzer. Fourier transform infra-red spectra confirmed the presence of sulfonic and carboxylic acid functions and ion-exchange titrations accounted for the total amount of catalytic acid sites per nanoparticle mass. These nanoparticles were evaluated for their performance to hydrolyze the beta-1,4 glycosidic bond of the cellobiose molecule. Propyl-sulfonic (PS) and perfluoropropyl-sulfonic (PFS) acid functionalized nanoparticles catalyzed the hydrolysis of cellobiose significantly better than the control. PS and PFS were also evaluated for their capacity to solubilize wheat straw hemicelluloses and performed better than the control. Although PFS nanoparticles were stronger acid catalysts, the acid functions leached out of the nanoparticle during

  20. Colorimetric DNA detection of transgenic plants using gold nanoparticles functionalized with L-shaped DNA probes

    NASA Astrophysics Data System (ADS)

    Nourisaeid, Elham; Mousavi, Amir; Arpanaei, Ayyoob

    2016-01-01

    In this study, a DNA colorimetric detection system based on gold nanoparticles functionalized with L-shaped DNA probes was prepared and evaluated. We investigated the hybridization efficiency of the L-shaped probes and studied the effect of nanoparticle size and the L-shaped DNA probe length on the performance of the as-prepared system. Probes were attached to the surface of gold nanoparticles using an adenine sequence. An optimal sequence of 35S rRNA gene promoter from the cauliflower mosaic virus, which is frequently used in the development of transgenic plants, and the two complementary ends of this gene were employed as model target strands and probe molecules, respectively. The spectrophotometric properties of the as-prepared systems indicated that the large NPs show better changes in the absorption spectrum and consequently present a better performance. The results of this study revealed that the probe/Au-NPs prepared using a vertical spacer containing 5 thymine oligonucleotides exhibited a stronger spectrophotometric response in comparison to that of larger probes. These results in general indicate the suitable performance of the L-shaped DNA probe-functionalized Au-NPs, and in particular emphasize the important role of the gold nanoparticle size and length of the DNA probes in enhancing the performance of such a system.

  1. Size control in the synthesis of 1-6 nm gold nanoparticles using folic acid-chitosan conjugate as a stabilizer

    NASA Astrophysics Data System (ADS)

    Liu, Lili; Zhang, Xianwen; Chaudhuri, Jharna

    2014-09-01

    We report a simple and practical method for the preparation of folic acid (FA)-chitosan functionalized gold nanoparticles (AuNPs) with a very small size (1-6 nm). Sodium borohydride was used as a reducing agent. The size of the AuNPs was controlled by adjusting the mass fraction of FA-chitosan conjugate to Au. The AuNPs were characterized using UV-vis spectroscopy and transmission electron microscopy (TEM). The results indicated that the size distribution of AuNPs decreased ranging from 6 nm to 1 nm with increasing the fraction of FA-chitosan conjugate in the reaction systems.

  2. Functional analysis of rat acidic calponin.

    PubMed

    Fujii, Toshihiro; Yabe, Sachiko; Nakamura, Kouta; Koizumi, Youichi

    2002-05-01

    Recombinant acidic calponin, a member of the calponin family, interacted with F-actin, but not with microtubules, desmin filaments, tropomyosin, calmodulin, S100 and phosphatidylserine (PS) vesicles with significant affinity. The bindings of acidic calponin to F-actin occurred in a concentration-dependent manner and were saturated at a molar ratio of about 1 acidic calponin to 1-2 actin molecules. The apparent Kd value of acidic calponin to F-actin was calculated to be 1.6 x 10(5) M(-1). Chemical cross-linking experiments indicated that a 1:1 molar covalent complex of acidic calponin and actin monomer was produced as in the case of basic calponinactin binding. No significant morphologic change of F-actin was observed by the addition of acidic calponin. Acidic calponin had little effect on actomyosin Mg2+-ATPase activity unlike basic calponin. Basic calponin partially competed with acidic calponin for binding to F-actin. Domain mapping with V8 protease revealed that acidic calponin binding site resided within the C-terminal 16 kDa fragment of actin, where the binding of basic calponin also occurs. However, both calponins showed reversal effects on fluorescence intensity of pyrene-labeled F-actin. Fragments of acidic calponin with 30 and 22 kDa, lacking the C-terminal acidic tail, were bound to F-actin. Interestingly, both the fragments became bound to PS vesicles, but not to other components. Circular dichroism studies showed that limited digestion of acidic calponin resulted in about 30% decrease of alpha-helix and beta contents. The present results suggest that acidic calponin is functionally distinct from basic calponin and expresses a novel characteristic after removal of the acidic tail region.

  3. Interaction of gold nanoparticles mediated by captopril and S-nitrosocaptopril: the effect of manganese ions in mild acid medium.

    PubMed

    Iglesias, Emilia; Prado-Gotor, Rafael

    2015-01-07

    We report herein results regarding reactivity and assembly of citrate-capped gold nanoparticles (AuNPs) mediated by captopril (cap) and S-nitrosocaptopril (NOcap), two angiotensin converting enzyme inhibitors and antihypertensive agents. The results were compared with that of cysteine (Cys), a thiol-containing amino acid found in plasma. The interparticle interactions were characterized by monitoring the evolution of the surface plasmon resonance band using the spectrophotometric method. The original gold nanoparticles were efficiently modified by small amounts of Mn(+2) ions, which are adsorbed onto the surface of 15.4 nm citrate-capped gold nanoparticles, giving rise to manganese-gold nanoparticles (Mn-AuNPs) that, in mild acid medium, have proved to be highly sensitive and a rapid colorimetric detection method for thiols. Depending on the concentration of the Mn(+2) ions the aggregation of AuNPs can be rapidly induced. The kinetics of the assembly process has been studied. Good first-order kinetics has been observed, with the exception of captopril-mediated nanoparticle aggregation at low concentration of either cap or acid. The rate of Cys-mediated assembly of gold nanoparticles in aqueous 10 mM acetic acid is more than 20-times faster than pure AuNPs and concentrations of Cys as low as 34 nM can be detected in less than 40 min under conditions of stable Mn-AuNPs. Similar effects were observed with cap or NOcap. The assembly-disassembly reversibility is shown with cap and NOcap and depends highly on pH.

  4. Thermal-driven attachment of gold nanoparticles prepared with ascorbic acid onto indium tin oxide surfaces

    NASA Astrophysics Data System (ADS)

    Aziz, Md. Abdul; Oyama, Munetaka

    2013-05-01

    Thermal-driven attachment of gold nanoparticles (AuNPs), of which size was less than 50 nm, onto the surfaces of indium tin oxide (ITO) is reported as a new phenomenon. This was permitted by preparing AuNPs via the reduction of hydrogen tetrachloroaurate (HAuCl4) with ascorbic acid (AA). While the AuNPs prepared via the AA reduction sparsely attached on the surface of ITO even at room temperature, a heat-up treatment at ca. 75 °C caused denser attachment of AuNPs on ITO surfaces. The attached density and the homogeneity after the thermal treatment were better than those of AuNP/ITO prepared using 3-aminopropyl-trimethoxysilane linker molecules. The denser attachment was observed similarly both by the immersion of ITO samples after the preparations of AuNPs by AA and by the in situ preparation of AuNPs with AA together with ITO samples. Thus, it is considered that the thermal-driven attachment of AuNPs would occur after the formation of AuNPs in the aqueous solutions, not via the growth of AuNPs on ITO surfaces. The preparation of AuNPs with AA would be a key for the thermal-driven attachment because the same attachments were not observed for AuNPs prepared with citrate ions or commercially available tannic acid-capped AuNPs.

  5. Highly improved synthesis of gold nanobipyramids by tuning the concentration of hydrochloric acid

    NASA Astrophysics Data System (ADS)

    Qi, Ying; Zhu, Jian; Li, Jianjun; Zhao, Junwu

    2016-07-01

    Fabrication of gold nanobipyramids (Au BPs) has attracted great attention because they exhibit more advantageous plasmonic properties. In this study, Au BPs were synthesized by the well-known seeded growth in the presence of hydrochloric acid (HCl). The effects of the ingredients, including HCl, silver nitrate (AgNO3), l-Ascorbic acid (AA), and seeds on the structure and yield of the Au BPs were systemically investigated. The results showed that the abundant HCl could improve the yield of Au BPs and decrease the longitudinal surface plasmon resonance wavelength. Under the circumstance of higher concentration of AA and AgNO3, more byproducts were resulted. In addition, the effect of HCl under different ratios of seed solution to AA has also been studied. The results showed that the yield was less sensitive to HCl when the amount of seed solution was small. If substantial AA was added to the system, then abundant HCl should be introduced correspondingly to improve the yield of Au BPs.

  6. Gallic acid conjugated with gold nanoparticles: antibacterial activity and mechanism of action on foodborne pathogens

    PubMed Central

    Rattanata, Narintorn; Klaynongsruang, Sompong; Leelayuwat, Chanvit; Limpaiboon, Temduang; Lulitanond, Aroonlug; Boonsiri, Patcharee; Chio-Srichan, Sirinart; Soontaranon, Siriwat; Rugmai, Supagorn; Daduang, Jureerut

    2016-01-01

    Foodborne pathogens, including Plesiomonas shigelloides and Shigella flexneri B, are the major cause of diarrheal endemics worldwide. Antibiotic drug resistance is increasing. Therefore, bioactive compounds with antibacterial activity, such as gallic acid (GA), are needed. Gold nanoparticles (AuNPs) are used as drug delivery agents. This study aimed to conjugate and characterize AuNP–GA and to evaluate the antibacterial activity. AuNP was conjugated with GA, and the core–shell structures were characterized by small-angle X-ray scattering and transmission electron microscopy. Antibacterial activity of AuNP–GA against P. shigelloides and S. flexneri B was evaluated by well diffusion method. AuNP–GA bactericidal mechanism was elucidated by Fourier transform infrared microspectroscopic analysis. The results of small-angle X-ray scattering showed that AuNP–GA conjugation was successful. Antibacterial activity of GA against both bacteria was improved by conjugation with AuNP because the minimum inhibitory concentration value of AuNP–GA was significantly decreased (P<0.0001) compared to that of GA. Fourier transform infrared analysis revealed that AuNP–GA resulted in alterations of lipids, proteins, and nucleic acids at the bacterial cell membrane. Our findings show that AuNP–GA has potential for further application in biomedical sciences. PMID:27555764

  7. Enhanced 5-aminolevulinic acid-gold nanoparticle conjugate-based photodynamic therapy using pulse laser

    NASA Astrophysics Data System (ADS)

    Xu, Hao; Yao, Cuiping; Wang, Jing; Chang, Zhennan; Zhang, Zhenxi

    2016-02-01

    The low bioavailability is a crucial limitation for the application of 5-aminolevulinic acid (ALA) in theranostics. In this research, 5-aminolevulinic acid and gold nanoparticle conjugates (ALA-GNPs) were synthesized to improve the bioavailability of ALA and to investigate the impact of ALA photodynamic therapy (ALA-PDT) in Hela cells. A 532 nm pulse laser and light-emitting diode (central wavelengths 502 nm) were jointly used as light sources in PDT research. The results show a 532 nm pulse laser can control ALA release from ALA-GNPs by adjusting the pulse laser dose. This laser control release may be attributed to the heat generation from GNPs under pulse laser irradiation, which indicates accurately adjusting the pulse laser dose to control the drug release in the cell interior can be considered as a new cellular surgery modality. Furthermore, the PDT results in Hela cells indicate the enhancement of ALA release by pulse laser before PDT can promote the efficacy of cell eradication in the light-emitting diode PDT (LED-PDT). This laser mediated drug release system can provide a new online therapy approach in PDT and it can be utilized in the optical monitor technologies based individual theranostics.

  8. Synthesis and characterizations of iso-luminol-functionalized, tadpole-shaped, gold nanomaterials.

    PubMed

    Li, Fang; Tian, Dayong; Cui, Hua

    2013-01-01

    Iso-luminol functionalized gold nanomaterials were synthesized in high yield by a simple seeding approach, using the chemiluminescent reagent iso-luminol as reductant in the presence of HAuCl(4), AgNO(3) and cetyltrimethylammonium bromide (CTAB). The morphology of as-prepared gold nanoparticles was characterized by transmission electron microscopy and UV-vis spectroscopy, showing that gold nanotadpoles (AuNTps) were obtained. Subsequent experiments revealed that the amounts of seed colloids and AgNO(3) and the concentrations of iso-luminol and CTAB in the growth solution play critical roles in the formation of well-shaped AuNTps. The surface state of AuNTps was characterized by UV-vis spectroscopy and fluorescence spectroscopy, indicating that iso-luminol and its oxidation product, 4-aminophthalate, coexisted on the surface of AuNTps. The CL behaviour was studied by static injection CL experiments, demonstrating that AuNTps were of CL activity. Finally, the growth mechanism of AuNTps was also discussed.

  9. Monitoring the Photocleaving Dynamics of Colloidal MicroRNA-Functionalized Gold Nanoparticles Using Second Harmonic Generation.

    PubMed

    Kumal, Raju R; Landry, Corey R; Abu-Laban, Mohammad; Hayes, Daniel J; Haber, Louis H

    2015-09-15

    Photoactivated drug delivery systems using gold nanoparticles provide the promise of spatiotemporal control of delivery that is crucial for applications ranging from regenerative medicine to cancer therapy. In this study, we use second harmonic generation (SHG) spectroscopy to monitor the light-activated controlled release of oligonucleotides from the surface of colloidal gold nanoparticles. MicroRNA is functionalized to spherical gold nanoparticles using a nitrobenzyl linker that undergoes photocleaving upon ultraviolet irradiation. The SHG signal generated from the colloidal nanoparticle sample is shown to be a sensitive probe for monitoring the photocleaving dynamics in real time. The photocleaving irradiation wavelength is scanned to show maximum efficiency on resonance at 365 nm, and the kinetics are investigated at varying irradiation powers to demonstrate that the nitrobenzyl photocleaving is a one-photon process. Additional characterization methods including electrophoretic mobility measurements, extinction spectroscopy, and fluorimetry are used to verify the SHG results, leading to a better understanding of the photocleaving dynamics for this model oligonucleotide therapeutic delivery system.

  10. Application of Chiral Ionic Liquid-Modified Gold Nanoparticles in the Chiral Recognition of Amino Acid Enantiomers.

    PubMed

    Huang, Lu; Chen, Yi-Ting; Li, Yan-Xia; Yu, Li-Shuang

    2016-07-14

    Two chiral ionic liquids (ILs), namely 1-ethyl-3-methylimidazole l-tartrate (EMIML-Tar) and 1-ethyl-3-methylimidazole l-lactate (EMIML-Lac), were used to modify gold nanoparticles (AuNPs) for chiral recognition of amino acid enantiomers. Transmission electron microscopy, infrared spectroscopy, ultraviolet-visible spectroscopy, and capillary electrophoresis were used for the characterization of chiral IL-modified AuNPs. Meanwhile, the performance of l-tartaric acid and l-lactic acid as modifiers was investigated to make a comparison. The chiral recognition mechanism is further discussed.

  11. Mixed DNA/Oligo(ethylene glycol) Functionalized Gold Surface Improve DNA Hybridization in Complex Media

    SciTech Connect

    Lee,C.; Gamble, L.; Grainger, D.; Castner, D.

    2006-01-01

    Reliable, direct 'sample-to-answer' capture of nucleic acid targets from complex media would greatly improve existing capabilities of DNA microarrays and biosensors. This goal has proven elusive for many current nucleic acid detection technologies attempting to produce assay results directly from complex real-world samples, including food, tissue, and environmental materials. In this study, we have investigated mixed self-assembled thiolated single-strand DNA (ssDNA) monolayers containing a short thiolated oligo(ethylene glycol) (OEG) surface diluent on gold surfaces to improve the specific capture of DNA targets from complex media. Both surface composition and orientation of these mixed DNA monolayers were characterized with x-ray photoelectron spectroscopy (XPS) and near-edge x-ray absorption fine structure (NEXAFS). XPS results from sequentially adsorbed ssDNA/OEG monolayers on gold indicate that thiolated OEG diluent molecules first incorporate into the thiolated ssDNA monolayer and, upon longer OEG exposures, competitively displace adsorbed ssDNA molecules from the gold surface. NEXAFS polarization dependence results (followed by monitoring the N 1s{yields}{pi}* transition) indicate that adsorbed thiolated ssDNA nucleotide base-ring structures in the mixed ssDNA monolayers are oriented more parallel to the gold surface compared to DNA bases in pure ssDNA monolayers. This supports ssDNA oligomer reorientation towards a more upright position upon OEG mixed adlayer incorporation. DNA target hybridization on mixed ssDNA probe/OEG monolayers was monitored by surface plasmon resonance (SPR). Improvements in specific target capture for these ssDNA probe surfaces due to incorporation of the OEG diluent were demonstrated using two model biosensing assays, DNA target capture from complete bovine serum and from salmon genomic DNA mixtures. SPR results demonstrate that OEG incorporation into the ssDNA adlayer improves surface resistance to both nonspecific DNA and protein

  12. Nanostructures of functionalized gold nanoparticles prepared by particle lithography with organosilanes.

    PubMed

    Lusker, Kathie L; Li, Jie-Ren; Garno, Jayne C

    2011-11-01

    Periodic arrays of organosilane nanostructures were prepared with particle lithography to define sites for selective adsorption of functionalized gold nanoparticles. Essentially, the approach for nanoparticle lithography consists of procedures with two masks. First, latex mesospheres were used as a surface mask for deposition of an organosilane vapor, to produce an array of holes within a covalently bonded, organic thin film. The latex particles were readily removed with solvent rinses to expose discrete patterns of nanosized holes of uncovered substrate. The nanostructured film of organosilanes was then used as a surface mask for a second patterning step, with immersion in a solution of functionalized nanoparticles. Patterned substrates were fully submerged in a solution of surface-active gold nanoparticles coated with 3-mercaptopropyltrimethoxysilane. Regularly shaped, nanoscopic areas of bare substrate produced by removal of the latex mask provided sites to bind silanol-terminated gold nanoparticles, and the methyl-terminated areas of the organosilane film served as an effective resist, preventing nonspecific adsorption on masked areas. Characterizations with atomic force microscopy demonstrate the steps for lithography with organosilanes and functionalized nanoparticles. Patterning was accomplished for both silicon and glass substrates, to generate nanostructures with periodicities of 200-300 nm that match the diameters of the latex mesospheres of the surface masks. Nanoparticles were shown to bind selectively to uncovered, exposed areas of the substrate and did not attach to the methyl-terminal groups of the organosilane mask. Billions of well-defined nanostructures of nanoparticles can be generated using this high-throughput approach of particle lithography, with exquisite control of surface density and periodicity at the nanoscale.

  13. Cell-specific optoporation with near-infrared ultrafast laser and functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Bergeron, Eric; Boutopoulos, Christos; Martel, Rosalie; Torres, Alexandre; Rodriguez, Camille; Niskanen, Jukka; Lebrun, Jean-Jacques; Winnik, Françoise M.; Sapieha, Przemyslaw; Meunier, Michel

    2015-10-01

    Selective targeting of diseased cells can increase therapeutic efficacy and limit off-target adverse effects. We developed a new tool to selectively perforate living cells with functionalized gold nanoparticles (AuNPs) and near-infrared (NIR) femtosecond (fs) laser. The receptor CD44 strongly expressed by cancer stem cells was used as a model for selective targeting. Citrate-capped AuNPs (100 nm in diameter) functionalized with 0.01 orthopyridyl-disulfide-poly(ethylene glycol) (5 kDa)-N-hydroxysuccinimide (OPSS-PEG-NHS) conjugated to monoclonal antibodies per nm2 and 5 μM HS-PEG (5 kDa) were colloidally stable in cell culture medium containing serum proteins. These AuNPs attached mostly as single particles 115 times more to targeted CD44+ MDA-MB-231 and CD44+ ARPE-19 cells than to non-targeted CD44- 661W cells. Optimally functionalized AuNPs enhanced the fs laser (800 nm, 80-100 mJ cm-2 at 250 Hz or 60-80 mJ cm-2 at 500 Hz) to selectively perforate targeted cells without affecting surrounding non-targeted cells in co-culture. This novel highly versatile treatment paradigm can be adapted to target and perforate other cell populations by adapting to desired biomarkers. Since living biological tissues absorb energy very weakly in the NIR range, the developed non-invasive tool may provide a safe, cost-effective clinically relevant approach to ablate pathologically deregulated cells and limit complications associated with surgical interventions.Selective targeting of diseased cells can increase therapeutic efficacy and limit off-target adverse effects. We developed a new tool to selectively perforate living cells with functionalized gold nanoparticles (AuNPs) and near-infrared (NIR) femtosecond (fs) laser. The receptor CD44 strongly expressed by cancer stem cells was used as a model for selective targeting. Citrate-capped AuNPs (100 nm in diameter) functionalized with 0.01 orthopyridyl-disulfide-poly(ethylene glycol) (5 kDa)-N-hydroxysuccinimide (OPSS

  14. From facets to facets: how does work function vary over a gold nanocluster?

    NASA Astrophysics Data System (ADS)

    Gao, Lingyuan; Souto, Jaime; Chelikowsky, James; Demkov, Alex

    Owing to their potential applications in catalysis, gold nanoclusters are a focus of intense research. The work function Φ, which can be measured using photoemission spectroscopy is a key parameter used to characterize the catalytic performance of the cluster. Φ is determined by the difference between the electrostatic potential just outside the metal surface and the Fermi energy of the cluster. We use a relativistic version of the real space first-principles code PARSEC to compute the work function of gold nanoclusters with dimensions on the order of a nanometer, which is similar in size to those used in experiment. We illustrate how the work function depends on the surface orientation of the nanocluster facets and compare our results with available experimental data We acknowledge supports from SciDAC program, Department of Energy, Office of Science, Advanced Scientific Computing Research and Basic Energy Sciences grant DE-SC0008877 for work on algorithms. Two of us (JRC and JS-C) acknowledge support for the work on nanostructures from grant from the U.S. Department of Energy: DE-FG02-06ER46286.

  15. Phase properties of carbon-supported platinum-gold nanoparticles for formic acid eletro-oxidation

    NASA Astrophysics Data System (ADS)

    Liao, Mengyin; Xiong, Jihai; Fan, Min; Shi, Jinming; Luo, Chenglong; Zhong, Chuan-Jian; Chen, Bing H.

    2015-10-01

    The design of active and robust bimetallic nanocatalysts requires the control of the nanoscale alloying, phase-segregation and the correlation between nanoscale phase-segregation and catalytic properties. To enhance the performance and durability of formic acid oxidation reaction in fuel-cell applications, we prepared a platinum-gold (PtAu) nanocatalyst with controlled morphology and composition. The catalyst is further treated by calcination under controlled temperature and atmosphere. The morphology of the bimetallic nanoparticles is determined by transmission electron microscopy. The nanoscale phase properties and surface composition are carried out by X-ray diffraction and X-ray photoelectron spectroscopy. Cyclic voltammetry measurements demonstrated that the catalytic activity is highly dependent on the nanoscale evolution of alloying and phase segregation. The mass activity of as-prepared Pt50Au50/C with 600 °C treatment temperature is about 11 times higher than that of commercial Pt/C. Stability tests showed no obvious loss of activity after 500 potential cycles. The high activity and stability are attributed to lattice contraction effect as a result of the high thermal treatment condition. Our findings demonstrate the importance of phase segregation at the nanoscale in harnessing the true electrocatalytic potential of bimetallic nanoparticles.

  16. Direct electrodeposition of gold nanotube arrays of rough and porous wall by cyclic voltammetry and its applications of simultaneous determination of ascorbic acid and uric acid.

    PubMed

    Yang, Guangming; Li, Ling; Jiang, Jinhe; Yang, Yunhui

    2012-08-01

    Gold nanotube arrays of rough and porous wall has been synthesized by direct electrodeposition with cyclic voltammetry utilizing anodic aluminum oxide template (AAO) and polycarbonate membrane (PC) during short time (only 3 min and 2 min, respectively). The mechanism of the direct electrodeposition of gold nanotube arrays by cyclic voltammetry (CV) has been discussed. The morphological characterizations of the gold nanotube arrays have been investigated by scanning electron microscopy (SEM). A simultaneous determination of ascorbic acid (AA) and uric acid (UA) by differential pulse voltammetry (DPV) was constructed by attaching gold nanotube arrays (using AAO) onto the surface of a glassy carbon electrode (GCE). The electrochemical behavior of AA and UA at this modified electrode has been studied by CV and differential pulse voltammetry (DPV). The sensor offers an excellent response for AA and UA and the linear response range for AA and UA were 1.02×10(-7)-5.23×10(-4) mol L(-1) and 1.43×10(-7)-4.64×10(-4) mol L(-1), the detection limits were 1.12×10(-8) mol L(-1) and 2.24×10(-8) mol L(-1), respectively. This sensor shows good regeneration, stability and selectivity and has been used for the determination of AA and UA in real human urine and serum samples with satisfied results.

  17. Surface enhanced Raman scattering of amino acids assisted by gold nanoparticles and Gd(3+) ions.

    PubMed

    López-Neira, Juan Pablo; Galicia-Hernández, José Mario; Reyes-Coronado, Alejandro; Pérez, Elías; Castillo-Rivera, Francisco

    2015-05-07

    The surface enhanced raman scattering (SERS) signal from the l-tyrosine (tyr) molecule adsorbed on gold nanoparticles (Au-tyr) is compared with the SERS signal assisted by the presence of gadolinium ions (Gd(3+)) coordinated with the Au-tyr system. An enhancement factor of the SERS signal in the presence of Gd(3+) ions was ∼5 times higher than that produced by l-tyrosine adsorbed on gold nanoparticles. The enhancement of the SERS signal can be attributed to a corresponding increase in the local electric field due to the presence of Gd(3+) ions in the vicinity of a gold dimer configuration. This scenario was confirmed by solving numerically Maxwell equations, showing an increase of 1 order of magnitude in the local electric scattered field when the Gd(3+) ion is located in between a gold dimer compared with naked gold nanoparticles.

  18. Integrating Retinoic Acid Signaling with Brain Function

    ERIC Educational Resources Information Center

    Luo, Tuanlian; Wagner, Elisabeth; Drager, Ursula C.

    2009-01-01

    The vitamin A derivative retinoic acid (RA) regulates the transcription of about a 6th of the human genome. Compelling evidence indicates a role of RA in cognitive activities, but its integration with the molecular mechanisms of higher brain functions is not known. Here we describe the properties of RA signaling in the mouse, which point to…

  19. Single step synthesis of gold-amino acid composite, with the evidence of the catalytic hydrogen atom transfer (HAT) reaction, for the electrochemical recognition of Serotonin

    NASA Astrophysics Data System (ADS)

    Choudhary, Meenakshi; Siwal, Samarjeet; Nandi, Debkumar; Mallick, Kaushik

    2016-03-01

    A composite architecture of amino acid and gold nanoparticles has been synthesized using a generic route of 'in-situ polymerization and composite formation (IPCF)' [1,2]. The formation mechanism of the composite has been supported by a model hydrogen atom (H•≡H++e-) transfer (HAT) type of reaction which belongs to the proton coupled electron transfer (PCET) mechanism. The 'gold-amino acid composite' was used as a catalyst for the electrochemical recognition of Serotonin.

  20. Study of the Agglomeration of 5 to 25nm Gold Nanoparticles as a Function of Viscosity and Ionic Concentration

    NASA Astrophysics Data System (ADS)

    Stefankiewicz, Adam; Dobbins, Tabbetha

    2013-03-01

    Gold nanoparticles (AuNPs) attached to carcinoma cells and treated with light irradiation are able to convert the light into heat energy, thus killing those cells. In order to get the particles to the affected area, they may be entered into the circulatory system where the environment is highly viscous and comprised of high salt concentrations. This study examines the aggregation behavior of gold nanoparticles under those conditions. Surface charge creates coulombic repulsion between particles. Likewise, highly viscous solutions will prevent aggregation by limiting the rate of transport of gold through the solution. This study examines the aggregation behavior of gold nanopartilces as a function of viscosity (varied using polyethylene glycol). The study also examines the role of excess ions in the solution (varied using 5-Bromo-4-chloro-3-indolyl phosphate disodium salt). The aggregation phenomena was explored using dynamic light scattering for particle size analysis. Early results are presented here.

  1. In vivo studies of silk based gold nano-composite conduits for functional peripheral nerve regeneration.

    PubMed

    Das, Suradip; Sharma, Manav; Saharia, Dhiren; Sarma, Kushal Konwar; Sarma, Monalisa Goswami; Borthakur, Bibhuti Bhusan; Bora, Utpal

    2015-09-01

    We report a novel silk-gold nanocomposite based nerve conduit successfully tested in a neurotmesis grade sciatic nerve injury model in rats over a period of eighteen months. The conduit was fabricated by adsorbing gold nanoparticles onto silk fibres and transforming them into a nanocomposite sheet by electrospinning which is finally given a tubular structure by rolling on a stainless steel mandrel of chosen diameter. The conduits were found to promote adhesion and proliferation of Schwann cells in vitro and did not elicit any toxic or immunogenic responses in vivo. We also report for the first time, the monitoring of muscular regeneration post nerve conduit implantation by recording motor unit potentials (MUPs) through needle electromyogram. Pre-seeding the conduits with Schwann cells enhanced myelination of the regenerated tissue. Histo-morphometric and electrophysiological studies proved that the nanocomposite based conduits pre-seeded with Schwann cells performed best in terms of structural and functional regeneration of severed sciatic nerves. The near normal values of nerve conduction velocity (50 m/sec), compound muscle action potential (29.7 mV) and motor unit potential (133 μV) exhibited by the animals implanted with Schwann cell loaded nerve conduits in the present study are superior to those observed in previous reports with synthetic materials as well as collagen based nerve conduits. Animals in this group were also able to perform complex locomotory activities like stretching and jumping with excellent sciatic function index (SFI) and led a normal life.

  2. Elucidation of structural and functional properties of albumin bound to gold nanoparticles.

    PubMed

    Mariam, Jessy; Sivakami, S; Dongre, P M

    2017-02-01

    Nanoparticle-albumin complexes are being designed for targeted drug delivery and imaging. However, the changes in the functional properties of albumin due to adsorption on nanoparticles remain elusive. Thus, the objective of this work was to elucidate the structural and functional properties of human and bovine serum albumin bound to negatively charged gold nanoparticles (GNPs). Fluorescence data demonstrated static quenching of albumin by GNP with the quenching of buried as well as surface tryptophan in BSA. The binding process was enthalpy and entropy-driven in HSA and BSA, respectively. At lower concentrations of GNP there was a higher affinity for tryptophan, whereas at higher concentrations both tryptophan and tyrosine participated in the interaction. Synchronous fluorescence spectra revealed that the microenvironment of tryptophan in HSA turned more hydrophilic upon exposure to GNP. The α-helical content of albumin was unaltered by GNP. Approximately 37 and 23% reduction in specific activity of HSA and BSA was observed due to GNP binding. In presence of warfarin and ibuprofen the binding constants of albumin-GNP complexes were altered. A very interesting observation not reported so far is the retained antioxidant activity of albumin in presence of GNP i.e. we believe that GNPs did not bind to the free sulfhydryl groups of albumin. However enhanced levels of copper binding were observed. We have also highlighted the differential response in albumin due to gold and silver nanoparticles which could be attributed to differences in the charge of the nanoparticle.

  3. Aptamer-conjugated gold functionalized graphene oxide nanocomposites for human α-thrombin specific recognition.

    PubMed

    Deng, Nan; Jiang, Bo; Chen, Yuanbo; Liang, Zhen; Zhang, Lihua; Liang, Yu; Yang, Kaiguang; Zhang, Yukui

    2016-01-04

    The specific recognition toward target proteins from complex biological samples has great potential in clinical diagnostics and therapeutics, receiving more and more attention. Herein, we achieved the specific detection of human α-thrombin from human serum by aptamer-conjugated gold functionalized graphene oxide nanocomposites (denoted as Apt/Au/PEI/GO nanocomposites). Gold functionalized graphene oxide nanocomposites were synthesized by in situ growth of Au nanoparticles on graphene oxide surface using polyethylenimine as reducing and stabilizing reagents, and then it was used as support for aptamer immobilization through forming an Au-S bonding. The obtained Apt/Au/PEI/GO nanocomposites inherited not only the large surface area which made the immobilizing amount of aptamer up to 36.1 nmol/mg, but also the excellent hydrophilicity which showed remarkable selectivity for human α-thrombin specific recognition, even with the interference of 3000 fold human serum proteins. Furthermore, with its superior properties, Apt/Au/PEI/GO nanocomposites showed advantages of high capture efficiency (>86%) and excellent recognition repeatability. Finally, the Apt/Au/PEI/GO nanocomposites were successfully applied for human α-thrombin specific recognition in human serum, verifying its great potential in clinical applications.

  4. Self-assembly of DNA functionalized gold nanoparticles at the liquid-vapor interface

    DOE PAGES

    Zhang, Honghu; Wang, Wenjie; Hagen, Noah; ...

    2016-05-30

    Here, surface sensitive synchrotron X-ray scattering and spectroscopy are used to monitor and characterize the spontaneous formation of 2D Gibbs monolayers of thiolated single-stranded DNA-functionalized gold nanoparticles (ssDNAAuNPs) at the vapor–solution interface by manipulating salt concentrations. Grazing incidence small-angle X-ray scattering and X-ray refl ectivity show that the noncomplementary ssDNA-AuNPs dispersed in aqueous solution spontaneously accumulate at the vapor–liquid interface in the form of a single layer by increasing MgCl2 or CaCl2 concentrations. Furthermore, the monoparticle layer undergoes a transformation from short- to long-range (hexagonal) order above a threshold salt-concentration. Using various salts at similar ionic strength to those ofmore » MgCl2 or CaCl2 such as, NaCl or LaCl3, it is found that surface adsorbed NPs lack any order. X-ray fluorescence near total reflection of the same samples provides direct evidence of interfacial gold and more importantly a significant surface enrichment of the cations. Quantitative analysis reveals that divalent cations screen the charge of ssDNA, and that the hydrophobic hexyl-thiol group, commonly used to functionalize the ssDNA (for capping the AuNPs), is likely the driving force for the accumulation of the NPs at the interface.« less

  5. Self-assembly of DNA functionalized gold nanoparticles at the liquid-vapor interface

    SciTech Connect

    Zhang, Honghu; Wang, Wenjie; Hagen, Noah; Kuzmenko, Ivan; Akinc, Mufit; Travesset, Alex; Mallapragada, Surya; Vaknin, David

    2016-05-30

    Here, surface sensitive synchrotron X-ray scattering and spectroscopy are used to monitor and characterize the spontaneous formation of 2D Gibbs monolayers of thiolated single-stranded DNA-functionalized gold nanoparticles (ssDNAAuNPs) at the vapor–solution interface by manipulating salt concentrations. Grazing incidence small-angle X-ray scattering and X-ray refl ectivity show that the noncomplementary ssDNA-AuNPs dispersed in aqueous solution spontaneously accumulate at the vapor–liquid interface in the form of a single layer by increasing MgCl2 or CaCl2 concentrations. Furthermore, the monoparticle layer undergoes a transformation from short- to long-range (hexagonal) order above a threshold salt-concentration. Using various salts at similar ionic strength to those of MgCl2 or CaCl2 such as, NaCl or LaCl3, it is found that surface adsorbed NPs lack any order. X-ray fluorescence near total reflection of the same samples provides direct evidence of interfacial gold and more importantly a significant surface enrichment of the cations. Quantitative analysis reveals that divalent cations screen the charge of ssDNA, and that the hydrophobic hexyl-thiol group, commonly used to functionalize the ssDNA (for capping the AuNPs), is likely the driving force for the accumulation of the NPs at the interface.

  6. Dielectric Function for Gold in Plasmonics Applications: Size Dependence of Plasmon Resonance Frequencies and Damping Rates for Nanospheres.

    PubMed

    Derkachova, Anastasiya; Kolwas, Krystyna; Demchenko, Iraida

    Realistic representation of the frequency dependence of dielectric function of noble metals has a significant impact on the accuracy of description of their optical properties and farther applications in plasmonics, nanoscience, and nanotechnology. Drude-type models successfully used in describing material properties of silver, for gold are known to be not perfect above the threshold energy at 1.8 eV. We give the improved, simple dielectric function for gold which accounts for the frequency dependence of the interband transitions over 1.8 eV and, in addition, for the finite size effects in gold nanoparticles. On that basis, we provide the improved characterization of the spectral performance of gold nanoparticles. Furthermore, we give the direct size dependence of the resonance frequencies and total damping rates of localized surface plasmons of gold nanoparticles (retardation effects are taken into full account) in diverse dielectric environments. The results are compared to the data obtained experimentally for gold monodisperse colloidal nanospheres, as well with the experimental results of other authors.

  7. On-plate-selective enrichment of glycopeptides using boronic acid-modified gold nanoparticles for direct MALDI-QIT-TOF MS analysis.

    PubMed

    Tang, Jia; Liu, Yingchao; Qi, Dawei; Yao, Guoping; Deng, Chunhui; Zhang, Xiangmin

    2009-11-01

    In this study, an on-plate-selective enrichment method is developed for fast and efficient glycopeptide investigation. Gold nanoparticles were first spotted and sintered on a stainless-steel plate, then modified with 4-mercaptophenylboronic acid to provide porous substrate with large specific surface and dual functions. These spots were used to selectively capture glycopeptides from peptide mixtures and the captured target peptides could be analyzed by MALDI-MS simply by deposition of 2,5-dihydroxybenzoic acid matrix. Horseradish peroxidase was employed as a standard glycoprotein to investigate the enrichment efficiency. In this way, the enrichment, washing and detection steps can all be fulfilled on a single MALDI target plate. The relatively small sample amount needed, low detection limit and rapid selective enrichment have made this on-plate strategy promising for online enrichment of glycopeptides, which could be applied in high-throughput proteome research.

  8. Specific ionic effect for simple and rapid colorimetric sensing assays of amino acids using gold nanoparticles modified with task-specific ionic liquid.

    PubMed

    Wu, Datong; Cai, Pengfei; Tao, Zhihao; Pan, Yuanjiang

    2016-01-01

    In this study, a novel task-specific ionic liquid functionalized gold nanoparticle (TSIL-GNP) was successfully prepared and applied in the recognition of amino acids. Particularly, the surface of GNP was modified with the ionic liquid containing carbamido and ester group via thiol, which was characterized by Fourier transform infrared spectroscopy (FTIR) and transmission electron microscopy (TEM). The stability of this material in aqueous solution improves apparently and can remain unchanged for more than three months. The effect of pH was also discussed in this study. Attractive ionic interaction would effectively weaken intensity of the covalent coupling between the metal ion and the functional groups of amino acids. Thus, TSIL-GNP was successfully applied to recognizing serine, aspartic acid, lysine, arginine, and histidine in the presence of Cu(2+) through distinctive color changes. Suspension would be generated once a spot of cysteine was added into the GNPs solution. Results indicated that it had a good linear relationship between extinction coefficients and concentration of amino acids in a wide range of 10(-3)-10(-6) M. Moreover, the proposed strategy was successfully used to analyze the histidine in urinary samples. In brief, TSIL-GNP is a suitable substrate for discrimination of five amino acids in a rapid and simple way without sophisticated instruments.

  9. Structure function attributes of gold nanoparticle vaccine association: effect of particle size and association temperature.

    PubMed

    Barhate, Ganesh A; Gaikwad, Sushama M; Jadhav, Suresh S; Pokharkar, Varsha B

    2014-08-25

    Many biotherapeutic applications of gold nanoparticles make use of conjugated or adsorbed protein moieties. Physical parameters of association such as particle size, morphology, surface chemistry and temperature influences the protein-nanoparticle association and thereby their interaction with the biological environment. In present study, effect of size of chitosan reduced gold nanoparticles (CsAuNPs) and association temperature on structure and function of tetanus toxoid (TT) vaccine has been investigated. CsAuNPs were synthesized in the sizes of 20±3, 40±5 and 80±7 nm followed by loading of TT. Binding process of CsAuNPs with TT was investigated at their predetermined micro molar concentrations. Upon binding of TT onto CsAuNPs, particle surface was characterized using X-ray photoelectron spectroscopy. CD spectroscopic evaluation of TT bound 20 nm CsAuNPs led to 75% reduction in secondary structure of TT and thereby compromised immune function. Binding of TT with 40 and 80 nm sized CsAuNPs did not cause significant modifications in secondary structure or function of TT. Thermodynamic studies using temperature dependent fluorescence spectroscopy revealed an increase in association constants with the temperature. Based on thermodynamic data three phases in CsAuNPs and TT association process were traced. Samples from these distinct phases were also investigated for immunological recognition. Ex-vivo interaction of TT-CsAuNPs with TT positive and negative sera followed by relative change in particle size and zeta potential was studied. The findings here suggests prominent role of particle size and association temperature on adsorbed TT structure and function. Such studies may help in engineering functional nanotherapeutics.

  10. ALD Functionalized Nanoporous Gold: Thermal Stability, Mechanical Properties, and Catalytic Activity

    SciTech Connect

    Biener, M M; Biener, J; Wichmann, A; Wittstock, A; Baumann, T F; Baeumer, M; Hamza, A V

    2011-03-24

    Nanoporous metals have many technologically promising applications but their tendency to coarsen limits their long-term stability and excludes high temperature applications. Here, we demonstrate that atomic layer deposition (ALD) can be used to stabilize and functionalize nanoporous metals. Specifically, we studied the effect of nanometer-thick alumina and titania ALD films on thermal stability, mechanical properties, and catalytic activity of nanoporous gold (np-Au). Our results demonstrate that even only one-nm-thick oxide films can stabilize the nanoscale morphology of np-Au up to 1000 C, while simultaneously making the material stronger and stiffer. The catalytic activity of np-Au can be drastically increased by TiO{sub 2} ALD coatings. Our results open the door to high temperature sensor, actuator, and catalysis applications and functionalized electrodes for energy storage and harvesting applications.

  11. Ultrathin gold nanowire-functionalized carbon nanotubes for hybrid molecular sensing.

    PubMed

    Cui, Huizhong; Hong, Chenglin; Ying, Andrew; Yang, Xinmai; Ren, Shenqiang

    2013-09-24

    Carbon nanotubes (CNTs) have shown great potential as sensing component in the electrochemical field effect transistor and optical sensors, because of their extraordinary one-dimensional electronic structure, thermal conductivity, and tunable and stable near-infrared emission. However, the insolubility of CNTs due to strong van der Waals interactions limits their use in the field of nanotechnology. In this study, we demonstrate that noncovalent ultrathin gold nanowires functionalized multiwalled carbon nanotube (GNW-CNT) hybrid sensing agents show highly efficient and selective immune molecular sensing in electrochemical and near-infrared photoacoustic imaging methods. A detection limit of 0.01 ng/mL for the alpha-fetoprotein (AFP) antigen with high selectivity is shown. The extraordinary optical absorption, thermal, and electric conductivity of hybrid GNW-CNTs presented in this study could be an effective tactic to integrate imaging, sensing, and treatment functionalities.

  12. Solubility of gold nanoparticles as a function of ligand shell and alkane solvent.

    PubMed

    Lohman, Brandon C; Powell, Jeffrey A; Cingarapu, Sreeram; Aakeroy, Christer B; Chakrabarti, Amit; Klabunde, Kenneth J; Law, Bruce M; Sorensen, Christopher M

    2012-05-14

    The solubility of ca. 5.0 nm gold nanoparticles was studied systematically as a function of ligand shell and solvent. The ligands were octane-, decane-, dodecane- and hexadecanethiols; the solvents were the n-alkanes from hexane to hexadecane and toluene. Supernatant concentrations in equilibrium with precipitated superclusters of nanoparticles were measured at room temperature (23 °C) with UV-Vis spectrophotometry. The solubility of nanoparticles ligated with decane- and dodecanethiol was greatest in n-decane and n-dodecane, respectively. In contrast, the solubility of nanoparticles ligated with octane- and hexadecanethiol showed decreasing solubility with increasing solvent chain length. In addition the solubility of the octanethiol ligated system showed a nonmonotonic solvent carbon number functionality with even numbered solvents being better solvents than neighboring odd numbered solvents.

  13. Adsorption of small molecules on helical gold nanorods: a relativistic density functional study.

    PubMed

    Liu, Xiao-Jing; Hamilton, Ian

    2014-10-15

    We study the adsorption of a variety of small molecules on helical gold nanorods using relativistic density functional theory. We focus on Au40 which consists of a central linear strand of five gold atoms with seven helical strands of five gold atoms on a coaxial tube. All molecules preferentially adsorb at a single low-coordinated gold atom on the coaxial tube at an end of Au40. In most cases, there is significant charge transfer (CT) between Au40 and the adsorbate, for CO and NO2, there is CT from the Au40 to adsorbate while for all other molecules there is CT from the adsorbate to Au40. Thus, Au40-adsorbate can be described as a donor-accepter complex and we use charge decomposition analysis to better understand the adsorption process. We determine the adsorption energy order to be C5H5N >NO2  > CO > NH3  > CH2=CH2  > CH2=CH-CHO > NO > HC≡CH > H2S > SO2  > HCN > CH3OH > H2C=O > O2  > H2O > CH4  > N2. We find that the Au-C, Au-N, Au-S, and Au-O bonds are surprisingly strong, with clear implications for reactivity enhancement of the adsorbate. The Au-H bond is relatively weak but, for interactions via an H atom that is bonded to a carbon atom (e.g., CH4), we find that there is large charge polarization of the Au-H-C moiety and partial activation of the inert C-H bond. Although the Au-S and Au-O bonds are generally weaker than the Au-C and Au-N bonds, we find that adsorption of H2S or H2O causes greater distortion of Au40 in the binding region. However, the degree of distortion is small and the helical structure is retained, demonstrating the stability of the helical Au40 nanorod under perturbations.

  14. Mass spectrometry signal amplification for ultrasensitive glycoprotein detection using gold nanoparticle as mass tag combined with boronic acid based isolation strategy.

    PubMed

    Liu, Minbo; Zhang, Lijuan; Xu, Yawei; Yang, Pengyuan; Lu, Haojie

    2013-07-25

    We describe a novel method for rapid and ultrasensitive detection of intact glycoproteins without enzymatic pretreatment which was commonly used in proteomic research. This method is based on using gold nanoparticle (AuNP) as signal tag in laser desorption/ionization mass spectrometry (LDI-MS) analysis combined with boronic acid assisted isolation strategy. Briefly speaking, target glycoproteins were firstly isolated from sample solution with boronic acid functionalized magnetic microparticles, and then the surface modified gold nanoparticles were added to covalently bind to the glycoproteins. After that, these AuNP tagged glycoproteins were eluted from magnetic microparticles and applied to LDI-MS analysis. The mass signal of AuNP rather than that of glycoprotein was detected and recorded in this strategy. Through data processing of different standard glycoproteins, we have demonstrated that the signal of AuNP could be used to quantitatively represent glycoprotein. This method allows femtomolar detection of intact glycoproteins. We believe that the successful validation of this method on three different kinds of glycoproteins suggests the potential use for tracking trace amount of target glycoproteins in real biological samples in the near future.

  15. Colloidal Synthesis of Gold Semishells

    PubMed Central

    Rodríguez-Fernández, Denis; Pérez-Juste, Jorge; Pastoriza-Santos, Isabel; Liz-Marzán, Luis M

    2012-01-01

    This work describes a novel and scalable colloid chemistry strategy to fabricate gold semishells based on the selective growth of gold on Janus silica particles (500 nm in diameter) partly functionalized with amino groups. The modulation of the geometry of the Janus silica particles allows us to tune the final morphology of the gold semishells. This method also provides a route to fabricating hollow gold semishells through etching of the silica cores with hydrofluoric acid. The optical properties were characterized by visible near-infrared (vis-NIR) spectroscopy and compared with simulations performed using the boundary element method (BEM). These revealed that the main optical features are located beyond the NIR region because of the large core size. PMID:24551496

  16. Highly sensitive SERS detection and quantification of sialic acid on single cell using photonic-crystal fiber with gold nanoparticles.

    PubMed

    Gong, Tianxun; Cui, Ying; Goh, Douglas; Voon, Kong Kien; Shum, Perry Ping; Humbert, Georges; Auguste, Jean-Louis; Dinh, Xuan-Quyen; Yong, Ken-Tye; Olivo, Malini

    2015-02-15

    An ultrasensitive surface enhanced Raman spectroscopy (SERS) based sensing platform was developed to detect the mean sialic acid level on the surface of single cell with sensitivity as low as 2 fmol. This platform adopted the use of an interference-free Raman tag, 4-(dihydroxyborophenyl) acetylene (DBA), which selectively binds to sialic acid on the cell membrane. By loading the side channel of a photonic crystal fiber with a mixture of gold nanoparticles and DBA-tagged HeLa cell, and subsequently propagating laser light through the central solid core, strong SERS signal was obtained. This SERS technique achieved accurate detection and quantification of concentration of sialic acid on a single cell, surpassing previously reported methods that required more than 10(5) cells. Moreover, this platform can be developed into a clinical diagnostic tool to potentially analyze sialic acid-related diseases such as tumor malignancy and metastasis in real-time.

  17. Molecularly resolved images of peptide-functionalized gold surfaces by scanning tunneling microscopy.

    PubMed

    Raigoza, Annette F; Webb, Lauren J

    2012-11-28

    Peptide-terminated monolayers were formed through a Huisgen cycloaddition reaction between an α-helical peptide containing two propargylglycine unnatural functional groups 20 Å apart and an alkanethiol self-assembled monolayer (SAM) on a gold surface containing 25% surface density of reactive azide terminal groups. The azide- and peptide-terminated surfaces were imaged by scanning tunneling microscopy (STM) using a low tunneling current of 10 pA. On the peptide-terminated surface, oblong features ~30 Å long and ~20 Å wide were observed and attributed to individual surface-bound α-helical peptides oriented parallel to the gold surface. These features covered an area of the surface corresponding to a density of 0.11 ± 0.01 peptides nm(-2), compared with a theoretical density of ~0.14 peptides nm(-2) for a fully reacted surface. Finally, no evidence of peptide aggregation was observed on either short (<10 nm) or long (~100 nm) length scales.

  18. Molecular Dynamics Studies of Self-Assembling Biomolecules and DNA-functionalized Gold Nanoparticles

    NASA Astrophysics Data System (ADS)

    Cho, Vince Y.

    This thesis is organized as following. In Chapter 2, we use fully atomistic MD simulations to study the conformation of DNA molecules that link gold nanoparticles to form nanoparticle superlattice crystals. In Chapter 3, we study the self-assembly of peptide amphiphiles (PAs) into a cylindrical micelle fiber by using CGMD simulations. Compared to fully atomistic MD simulations, CGMD simulations prove to be computationally cost-efficient and reasonably accurate for exploring self-assembly, and are used in all subsequent chapters. In Chapter 4, we apply CGMD methods to study the self-assembly of small molecule-DNA hybrid (SMDH) building blocks into well-defined cage-like dimers, and reveal the role of kinetics and thermodynamics in this process. In Chapter 5, we extend the CGMD model for this system and find that the assembly of SMDHs can be fine-tuned by changing parameters. In Chapter 6, we explore superlattice crystal structures of DNA-functionalized gold nanoparticles (DNA-AuNP) with the CGMD model and compare the hybridization.

  19. Paper-supported nanostructured ultrathin gold film electrodes - Characterization and functionalization

    NASA Astrophysics Data System (ADS)

    Ihalainen, Petri; Määttänen, Anni; Pesonen, Markus; Sjöberg, Pia; Sarfraz, Jawad; Österbacka, Ronald; Peltonen, Jouko

    2015-02-01

    Ultrathin gold films (UTGFs) were fabricated on a nanostructured latex-coated paper substrate by physical vapour deposition (PVD) with the aim to provide low-cost and flexible conductive electrodes in paper-based electronics. Morphological, electric and optical properties of UTGFs were dependent on the deposited film thickness. In addition, UTGFs were functionalized with insulating and hydrophobic 1-octadecanethiol self-assembled monolayer and inkjet-printed conductive and hydrophilic poly(3,4-ethylenedioxythiophene)-poly(styrenesulfonate) (PEDOT-PSS) layer and their electrochemical properties were examined. Results showed that sufficient mechanical stability and adhesion of UTGFs deposited on latex-coated paper was achieved without the need on any additional adhesive layers, enabling a more robust fabrication process of the electrodes. UTGF electrodes tolerated extensive bending without adverse effects and conductivity comparable to the bulk gold was obtained already with the film thickness of 6 nm. Although not been fabricated with the high-throughput method like printing, a very low material consumption (∼12 μg/cm2) together with a high conductivity (resistivity < 3 × 10-6 Ω cm) makes the UTGFs electrodes potential candidates low-cost components in flexible electronics. In addition, the excellent stability of the UTGF electrodes in electrochemical experiments enables their application in the development of paper-based electrochemical platforms, e.g. for biosensing purposes.

  20. Highly sensitive free radical detection by nitrone-functionalized gold nanoparticles.

    PubMed

    Du, Libo; Huang, Saipeng; Zhuang, Qianfen; Jia, Hongying; Rockenbauer, Antal; Liu, Yangping; Liu, Ke Jian; Liu, Yang

    2014-01-01

    The detection of free radicals and related species has attracted significant attention in recent years because of their critical roles in physiological and pathological processes. Among the methods for the detection of free radicals, electron spin resonance (ESR) coupled with the use of the spin trapping technique has been an effective approach for characterization and quantification of these species due to its high specificity. However, its application in biological systems, especially in in vivo systems, has been greatly limited partially due to the low reaction rate between the currently available spin traps with biological radicals. To overcome this drawback, we herein report the first example of nitrone functionalized gold nanoparticles (Au@EMPO) as highly efficient spin traps in which the thiolated EMPO (2-(ethoxycarbonyl)-2-methyl-3,4-dihydro-2H-pyrrole 1-oxide) derivative was self-assembled on gold nanoparticles. Kinetic studies showed that Au@EMPO has a 137-fold higher reaction rate constant with ˙OH than PBN (N-tert-butyl-α-phenylnitrone). Owing to the high rate of trapping ˙OH by Au@EMPO as well as the high stability of the resulting spin adduct (t½ ∼ 56 min), Au@EMPO affords 124-fold higher sensitivity for ˙OH than EMPO. Thus, this new nanospin trap shows great potential in trapping the important radicals such as ˙OH in various biological systems and provides a novel strategy to design spin traps with much improved properties.

  1. Modulating the physicochemical and structural properties of gold-functionalized protein nanotubes through thiol surface modification.

    PubMed

    Carreño-Fuentes, Liliana; Plascencia-Villa, Germán; Palomares, Laura A; Moya, Sergio E; Ramírez, Octavio T

    2014-12-16

    Biomolecules are advantageous scaffolds for the synthesis and ordering of metallic nanoparticles. Rotavirus VP6 nanotubes possess intrinsic affinity to metal ions, a property that has been exploited to synthesize gold nanoparticles over them. The resulting nanobiomaterials have unique properties useful for novel applications. However, the formed nanobiomaterials lack of colloidal stability and flocculate, limiting their functionality. Here we demonstrate that it is possible to synthesize thiol-protected gold nanoparticles over VP6 nanotubes, which resulted in soluble nanobiomaterials. With this strategy, it was possible to modulate the size, colloidal stability, and surface plasmon resonance of the synthesized nanoparticles by controlling the content of the thiolated ligands. Two types of water-soluble ligands were tested, a small linear ligand, sodium 3-mercapto-1-propanesulfonate (MPS), and a bulky ligand, 5-mercaptopentyl β-D-glucopyranoside (GlcC5SH). The synthesized nanobiomaterials had a higher stability in suspension, as determined by Z-potential measurements. To the extent of our knowledge, this is the first time that a rational strategy is developed to modulate the particular properties of metal nanoparticles in situ synthesized over a protein bioscaffold through thiol coating, achieving a high spatial and structural organization of nanoparticles in a single integrative hybrid structure.

  2. Plasmonic-based colorimetric and spectroscopic discrimination of acetic and butyric acids produced by different types of Escherichia coli through the different assembly structures formation of gold nanoparticles.

    PubMed

    La, Ju A; Lim, Sora; Park, Hyo Jeong; Heo, Min-Ji; Sang, Byoung-In; Oh, Min-Kyu; Cho, Eun Chul

    2016-08-24

    We present a plasmonic-based strategy for the colourimetric and spectroscopic differentiation of various organic acids produced by bacteria. The strategy is based on our discovery that particular concentrations of dl-lactic, acetic, and butyric acids induce different assembly structures, colours, and optical spectra of gold nanoparticles. We selected wild-type (K-12 W3110) and genetically-engineered (JHL61) Escherichia coli (E. coli) that are known to primarily produce acetic and butyric acid, respectively. Different assembly structures and optical properties of gold nanoparticles were observed when different organic acids, obtained after the removal of acid-producing bacteria, were mixed with gold nanoparticles. Moreover, at moderate cell concentrations of K-12 W3110 E. coli, which produce sufficient amounts of acetic acid to induce the assembly of gold nanoparticles, a direct estimate of the number of bacteria was possible based on time-course colour change observations of gold nanoparticle aqueous suspensions. The plasmonic-based colourimetric and spectroscopic methods described here may enable onsite testing for the identification of organic acids produced by bacteria and the estimation of bacterial numbers, which have applications in health and environmental sciences.

  3. Novel route synthesis of porous and solid gold nanoparticles for investigating their comparative performance as contrast agent in computed tomography scan and effect on liver and kidney function

    PubMed Central

    Aziz, Farooq; Ihsan, Ayesha; Nazir, Aalia; Ahmad, Ishaq; Bajwa, Sadia Zafar; Rehman, Asma; Diallo, Abdoulaye; Khan, Waheed S

    2017-01-01

    Gold nanoparticles (GNPs) with dimension in the range of 1–100 nm have a prominent role in a number of biomedical applications like imaging, drug delivery, and cancer therapy owing to their unique optical features and biocompatibility. In this work, we report a novel technique for the synthesis of two types of GNPs namely porous gold nanoparticles (PGNPs) and solid gold nanoparticles (SGNPs). PGNPs of size 35 nm were fabricated by reduction of gold (III) solution with lecithin followed by addition of L-ascorbic acid and tri-sodium citrate, whereas SGNPs with a dimension of 28 nm were prepared by reflux method using lecithin as a single reducing agent. Comparative studies using PGNPs (λmax 560 nm) and SGNPs (λmax 548 nm) were conducted for evaluating their use as a contrast agent. These studies reveled that in direct computed tomography scan, PGNPs exhibited brighter contrast (45 HU) than SGNPs (26 HU). To investigate the effect of PGNPs and SGNPs on the liver and kidney profile, male rabbits were intravenously injected with an equal dose of 1 mg/kg weight of PGNPs and SGNPs. The effect on biochemical parameters was evaluated 72 hours after intravenous (IV) injection including liver function profile, renal (kidney) function biomarker, random blood glucose value, and cholesterol level. During one comparison of contrast in CT scan, PGNPs showed significantly enhanced contrast in whole-rabbit and organ CT scan as compared to SGNPs 6 hours after injection. Our findings suggested that the novel PGNPs enhance CT scan image with higher efficacy as compared to SGNPs. The results showed that IV administration of synthesized PGNPs increases the levels of aspartate aminotransferase (AST), alkaline phosphate (ALP), serum creatinine, and blood glucose, whereas that of SGNPs increases the levels of AST, ALP, and blood glucose. PMID:28280325

  4. Gold nanoclusters as switch-off fluorescent probe for detection of uric acid based on the inner filter effect of hydrogen peroxide-mediated enlargement of gold nanoparticles.

    PubMed

    Liu, Yanyan; Li, Hongchang; Guo, Bin; Wei, Lijuan; Chen, Bo; Zhang, Youyu

    2017-05-15

    Herein we report a novel switch-off fluorescent probe for highly selective determination of uric acid (UA) based on the inner filter effect (IFE), by using poly-(vinylpyrrolidone)-protected gold nanoparticles (PVP-AuNPs) and chondroitin sulfate-stabilized gold nanoclusters (CS-AuNCs) as the IFE absorber/fluorophore pair. In this IFE-based fluorometric assay, the newly designed CS-AuNCs were explored as an original fluorophore and the hydrogen peroxide (H2O2) -driven formed PVP-AuNPs can be a powerful absorber to influence the excitation of the fluorophore, due to the complementary overlap between the absorption band of PVP-AuNPs and the emission band of CS-AuNCs. Under the optimized conditions, the extent of the signal quenching depends linearly on the H2O2 concentration in the range of 1-100μM (R(2) =0.995) with a detection limit down to 0.3μM. Based on the H2O2-dependent fluorescence IFE principle, we further developed a new assay strategy to enable selective sensing of UA by using a specific uricase-catalyzed UA oxidation as the in situ H2O2 generator. The proposed uricase-linked IFE-based assay exhibited excellent analytical performance for measuring UA over the concentration ranging from 5 to 100μM (R(2)=0.991), and can be successfully applied to detection of UA as low as 1.7μM (3σ) in diluted human serum samples.

  5. Effect of gold nanoparticle conjugation on the activity and stability of functional proteins.

    PubMed

    Bailes, Julian; Gazi, Sara; Ivanova, Rositsa; Soloviev, Mikhail

    2012-01-01

    Immobilization of functional proteins such as enzymes on solid surfaces produces a variety of effects ranging from the reversal and strong inhibition to the enhancement of protein stability and function. Such effects are protein-dependent and are affected by the physical and chemical properties of the surfaces. Functional consequences of protein immobilization on the surface of gold nanoparticles (AuNPs) are protein-dependent and require thorough investigation using suitable functional tests. However, traditional approaches to making control samples, i.e., immobilized protein vs. protein in solution in absence of any nanoparticles do not provide sufficiently identical reaction conditions and complicate interpretation of the results. This report provides advice and methods for preparing AuNP-conjugated preparations generally suitable for studying the effects of immobilization on the activity and stability of different functional proteins. We use bovine catalase to illustrate our approach, but the methods are easily adaptable to any other enzyme or protein. The AuNP-immobilized enzyme showed increased stability at elevated temperatures compared to the same enzyme in solution.

  6. Diamondoid-functionalized gold nanogaps as sensors for natural, mutated, and epigenetically modified DNA nucleotides.

    PubMed

    Sivaraman, Ganesh; Amorim, Rodrigo G; Scheicher, Ralph H; Fyta, Maria

    2016-05-21

    Modified tiny hydrogen-terminated diamond structures, known as diamondoids, show a high efficiency in sensing DNA molecules. These diamond cages, as recently proposed, could offer functionalization possibilities for gold junction electrodes. In this investigation, we report on diamondoid-functionalized electrodes, showing that such a device would have a high potential in sensing and sequencing DNA. The smallest diamondoid including an amine modification was chosen for the functionalization. Here, we report on the quantum tunneling signals across diamondoid-functionalized Au(111) electrodes. Our work is based on quantum-transport calculations and predicts the expected signals arising from different DNA units within the break junctions. Different gating voltages are proposed in order to tune the sensitivity of the functionalized electrodes with respect to specific nucleotides. The relation of this sensitivity to the coupling or decoupling of the electrodes is discussed. Our results also shed light on the sensing capability of such a device in distinguishing the DNA nucleotides, in their natural and mutated forms.

  7. Detection and differentiation of influenza viruses with glycan-functionalized gold nanoparticles.

    PubMed

    Zheng, Longtang; Wei, Jinhua; Lv, Xun; Bi, Yuhai; Wu, Peixing; Zhang, Zhenxing; Wang, Pengfei; Liu, Ruichen; Jiang, Jingwen; Cong, Haolong; Liang, Jingnan; Chen, Wenwen; Cao, Hongzhi; Liu, Wenjun; Gao, George F; Du, Yuguang; Jiang, Xingyu; Li, Xuebing

    2017-05-15

    Accurate diagnosis of influenza viruses is difficult and generally requires a complex process because of viral diversity and rapid mutability. In this study, we report a simple and rapid strategy for the detection and differentiation of influenza viruses using glycan-functionalized gold nanoparticles (gGNPs). This method is based on the aggregation of gGNP probes on the viral surface, which is mediated by the specific binding of the virus to the glycans. Using a set of gGNPs bearing different glycan structures, fourteen influenza virus strains, including the major subtypes currently circulating in human and avian populations, were readily differentiated from each other and from a human respiratory syncytial virus in a single-step colorimetric procedure. The results presented here demonstrate the potential of this gGNP-based system in the development of convenient and portable sensors for the clinical diagnosis and surveillance of influenza viruses.

  8. Functionalized carbon dots as sensors for gold nanoparticles in spiked samples: formation of nanohybrids.

    PubMed

    Cayuela, Angelina; Soriano, M Laura; Carrión, M Carmen; Valcárcel, Miguel

    2014-04-11

    This paper reports the synthesis, passivation and functionalization of luminescent carbon dots (CDs) possessing surface thiol ending groups. A simple procedure involving amidation of passivated carbon dots (p-CDs) with cysteamine boosts their photoluminescent properties and enables their use as easily controlled fluorescent nanosensors for determining citrate-gold nanoparticles (AuNPs). The mechanism behind the quenching phenomenon was established from fluorescence measurements at high temperatures and lifetime tests, and found to involve static quenching leading to the formation of CD-AuNP nanohybrids. A method for determining AuNPs in complex matrices was developed and validated by application to spiked drinking water and mussel tissues. The limits of detection and quantitation for AuNPs thus obtained were 0.20 and 0.66 nmol L(-1), respectively.

  9. A colorimetric sensor for determination of cysteine by carboxymethyl cellulose-functionalized gold nanoparticles.

    PubMed

    Wei, Xiaoyi; Qi, Li; Tan, Junjun; Liu, Ruigang; Wang, Fuyi

    2010-06-25

    A simple and sensitive colorimetric method for cysteine detection was established based on the carboxymethyl cellulose-functionalized gold nanoparticles (CMC-AuNPs). The nanoparticles were directly synthesized with sodium carboxymethyl cellulose by a simple approach, which would protect particles against salt-induced aggregation. Then the CMC-AuNPs solution exhibited a high colorimetric selectivity to cysteine. The assay results indicated that the introduction of cysteine could induce the aggregation of the colloidal solutions at the presence of sodium chloride, displaying changes in color and in UV-vis absorption spectra. Thus an exceptionally simple, rapid method for detecting cysteine was obtained at the linear range of 10.0-100.0 microM with the relative coefficient of 0.997. The proposed method possessed the advantages of simplicity and sensitivity, and was applied to real urine sample detection. The results were satisfying and the proposed method was especially appropriate for detection of cysteine in biological samples.

  10. Electrostatic Assembly of Functional and Macromolecular Ferricinium Chloride-Stabilized Gold Nanoparticles.

    PubMed

    Ciganda, Roberto; Gu, Haibin; Hernandez, Ricardo; Escobar, Ane; Martínez, Angel; Yates, Luis; Moya, Sergio; Ruiz, Jaime; Astruc, Didier

    2017-03-06

    Substituted ferrocenes with various stereoelectronic effects including a ferrocene-terminated dendrimer in ether reduce aqueous HAuCl4 to gold nanoparticles (AuNPs) by interfacial electron transfer. The dependence on the stirring speed plays a crucial role, and the stereoelectronic influences on the reaction rates are dramatic. With a ferrocene-containing polymer, the reaction is conducted using an homogeneous THF/water medium, also forming AuNPs. Fully stable functional, dendritic and polymeric ferricinium chloride-stabilized AuNPs are obtained with core sizes between 13 and 35 nm, an optimal size range for potential biomedical applications. Finally the ferricinium coating of the Au nanoparticles is replaced by a more electron-rich ferricinium derivative by exergonic redox reaction with the corresponding ferrocene derivative.

  11. Modulation of enzyme-substrate selectivity using tetraethylene glycol functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Jordan, Brian J.; Hong, Rui; Han, Gang; Rana, Subinoy; Rotello, Vincent M.

    2009-10-01

    Tetraethylene glycol (TEG) functionalized gold nanoparticles with 2 nm core diameters (AuTEG) enhance α-chymotrypsin (ChT) enzyme activity in a substrate-selective fashion. We explored the hydrolysis of four different substrates and observed a marked increase in activity with the most hydrophobic substrate N-succinyl-alanine-alanine-proline-phenylalanine- p-nitroanilide (TP), while the other substrates remain virtually unaffected by the AuTEG 'crowding effect' in solution. The enhancement in catalysis is indicated by an increase in Kcat/Km as obtained from Lineweaver-Burk analysis and we hypothesize it to arise from a macromolecular crowding effect analogous to that observed with high molecular weight poly(ethylene glycol) (PEG) polymers.

  12. Functionalized gold nanoparticles for topical delivery of methotrexate for the possible treatment of psoriasis.

    PubMed

    Bessar, Hagar; Venditti, Iole; Benassi, Luisa; Vaschieri, Cristina; Azzoni, Paola; Pellacani, Giovanni; Magnoni, Cristina; Botti, Elisabetta; Casagrande, Viviana; Federici, Massimo; Costanzo, Antonio; Fontana, Laura; Testa, Giovanna; Mostafa, Fawzia Farag; Ibrahim, Samia Ali; Russo, Maria Vittoria; Fratoddi, Ilaria

    2016-05-01

    Gold nanoparticles (AuNPs) represent an effective choice for topical drug delivery systems thanks to their small size, general non-toxicity, ease of functionalization and high surface to volume ratio. Even if systemic, methotrexate still plays an important role in psoriasis treatment: its topical use shows insufficient percutaneus penetration owing to limited passive diffusion, high molecular weight and dissociation at physiological pH. The aim of our study was to design a new drug delivery nanocarrier for Methotrexate and to improve its solubility, stability and biodistribution. AuNPs were on purpose prepared with a hydrophilic stabilizing layer, in order to improve the colloidal stability in water. Water-soluble gold nanoparticles functionalized by sodium 3-mercapto-1-propansulfonate (Au-3MPS) were prepared and loaded with methotrexate (MTX). The loading efficiency of MTX on Au-3MPS was assessed in the range 70-80%, with a fast release (80% in one hour). The release was studied up to 24h reaching the value of 95%. The Au-3MPS@MTX conjugate was fully characterized by spectroscopic techniques (UV-vis, FTIR) and DLS. Preliminary toxicity tests in the presence of keratinocytes monolayers allowed to assess that the used Au-3MPS are not toxic. The conjugate was then topically used on C57BL/6 mouse normal skin in order to trace the absorption behavior. STEM images clearly revealed the distribution of gold nanoparticles inside the cells. In vitro studies showed that Methotrexate conjugated with Au-3MPS is much more efficient than Methotrexate alone. Moreover, DL50, based on MTT analysis, is 20 folds reduced at 48 h, by the presence of nanoparticles conjugation. UV-vis spectra for in vivo tracing of the conjugate on bare mouse skin after 24h of application, show increased delivery of Methotrexate in the epidermis and dermis using Au-3MPS@MTX conjugate, compared to MTX alone. Moreover we observed absence of the Au-3MPS in the dermis and in the epidermis, suggesting that

  13. High-sensitive surface plasmon resonance microRNA biosensor based on streptavidin functionalized gold nanorods-assisted signal amplification.

    PubMed

    Hao, Kaihong; He, Yu; Lu, Huiting; Pu, Shaotao; Zhang, Yingnan; Dong, Haifeng; Zhang, Xueji

    2017-02-15

    Herein, a facile and sensitive microRNA (miRNA) biosensor was designed by using interfacial biotinylated thiolated DNA molecular beacon (MB) as probe and streptavidin functionalized gold nanorods (Stre-GNRs) as tag for the enhanced surface plasmon resonance (SPR) signal. The MB probe with two terminals labeled with biotin and thiol groups, respectively, was modified on the gold film via thiol-gold interaction. Upon hybridization with the target, the biotinylated group became accessible to the Stre-GNRs. The introduction of the Stre-GNRs tag to the gold film produced strong SPR signal for detection. Our work has illustrated that the plasmonic field extension generated from the gold film to GNRs and the mass increase due to the GNRs have led to drastic sensitivity enhancement. Under optimal conditions, this proposed approach allowed detection of miRNA with the limit of detection (LOD) down to 0.045 pM. The results have shown that the MB probe functionalized sensing film, together with streptavidin-conjugated GNRs, was readily served as a plasmonic coupling partner that can be used as a powerful ultrasensitive sandwich assay for miRNA detection, and GNRs were readily served as promising amplification labels in SPR sensing technology.

  14. Biomimetic synthesis of highly biocompatible gold nanoparticles with amino acid-dithiocarbamate as a precursor for SERS imaging

    NASA Astrophysics Data System (ADS)

    Li, Li; Liu, Jianbo; Yang, Xiaohai; Huang, Jin; He, Dinggeng; Guo, Xi; Wan, Lan; He, Xiaoxiao; Wang, Kemin

    2016-03-01

    Amino acid-dithiocarbamate (amino acid-DTC) was developed as both the reductant and ligand stabilizer for biomimetic synthesis of gold nanoparticles (AuNPs), which served as an excellent surface-enhanced Raman scattering (SERS) contrast nanoprobe for cell imaging. Glycine (Gly), glutamic acid (Glu), and histidine (His) with different isoelectric points were chosen as representative amino acid candidates to synthesize corresponding amino acid-DTC compounds through mixing with carbon disulfide (CS2), respectively. The pyrogenic decomposition of amino acid-DTC initiated the reduction synthesis of AuNPs, and the strong coordinating dithiocarbamate group of amino acid-DTC served as a stabilizer that grafted onto the surface of the AuNPs, which rendered the as-prepared nanoparticles a negative surface charge and high colloidal stability. MTT cell viability assay demonstrated that the biomimetic AuNPs possessed neglectful toxicity to the human hepatoma cell, which guaranteed them good biocompatibility for biomedical application. Meanwhile, the biomimetic AuNPs showed a strong SERS effect with an enhancement factor of 9.8 × 105 for the sensing of Rhodamine 6G, and two distinct Raman peaks located at 1363 and 1509 cm-1 could be clearly observed in the cell-imaging experiments. Therefore, biomimetic AuNPs can be explored as an excellent SERS contrast nanoprobe for biomedical imaging, and the amino acid-DTC mediated synthesis of the AuNPs has a great potential in bio-engineering and biomedical imaging applications.

  15. The unexpected effect of PEGylated gold nanoparticles on the primary function of erythrocytes

    NASA Astrophysics Data System (ADS)

    He, Zeng; Liu, Jiaxin; Du, Libo

    2014-07-01

    Polyethylene glycol-functionalized gold nanoparticles (PEGylated AuNPs) have been widely used as nanocarriers for the delivery of various drugs. However, little attention has been paid to whether the PEGylated AuNPs could affect the primary function of human erythrocytes, which is the main cellular component in the blood. In the current study, we show that both the deformability and oxygen-delivering ability of erythrocytes are decreased when treated with PEGyalted AuNPs of various sizes, which can be attributed to the interaction between PEGylated AuNPs and erythrocyte membranes. It is observed that the PEGylated AuNPs could also induce the aggregation of band-3 and the ATP decrease of erythrocytes. In addition, the PEGylated AuNPs can accelerate the loss of CD47 on erythrocyte membranes, possibly enhancing the senescent process of erythrocytes and the following clearance by SIRPα-expressing leukocytes in bloodstream. The results suggested that PEGylated AuNPs have the potential to affect the primary function of human erythrocytes, which should be considered when using them as drug carriers.Polyethylene glycol-functionalized gold nanoparticles (PEGylated AuNPs) have been widely used as nanocarriers for the delivery of various drugs. However, little attention has been paid to whether the PEGylated AuNPs could affect the primary function of human erythrocytes, which is the main cellular component in the blood. In the current study, we show that both the deformability and oxygen-delivering ability of erythrocytes are decreased when treated with PEGyalted AuNPs of various sizes, which can be attributed to the interaction between PEGylated AuNPs and erythrocyte membranes. It is observed that the PEGylated AuNPs could also induce the aggregation of band-3 and the ATP decrease of erythrocytes. In addition, the PEGylated AuNPs can accelerate the loss of CD47 on erythrocyte membranes, possibly enhancing the senescent process of erythrocytes and the following clearance by

  16. Detection of saccharides with a fluorescent sensing device based on a gold film modified with 4-mercaptophenylboronic acid monolayer

    NASA Astrophysics Data System (ADS)

    Chen, Shu-Jen; Chang, Jui-Feng; Cheng, Nai-Jen; Yih, Jeng-Nan; Chiu, Kuo-Chi

    2013-09-01

    An extremely sensitive fluorescent sensor based on a phenylboronic acid monolayer was developed for detecting saccharide molecules. The fluorescent sensor was prepared by assembling a monolayer of 4-mercaptophenylboronic acid (4-MPBA) onto a gold-coated compact disk. The change in the fluorescence of the 4-MPBA monolayer was extremely obvious in basic methanolic buffer containing monosaccharides down to the picomolar level. The fluorescence spectra demonstrated that the 4-MPBA monolayer was sensitive to monosaccharides and disaccharides, and the affinity of the monolayer toward saccharides was in the order of glucose < fructose < mannose < galactose < maltose > lactose > sucrose. Additionally, the fluorescence intensity of 4-MPBA monolayer was restorable after cleaning with weak acid, indicating that the reported fluorescent sensor with the detection limit of glucose down to the picomolar level is reusable for sensing saccharides.

  17. Double-functionalized gold nanoparticles with split aptamer for the detection of adenosine triphosphate.

    PubMed

    Cheng, Sheng; Zheng, Bin; Wang, Mozhen; Lam, Michael Hon-Wah; Ge, Xuewu

    2013-10-15

    A newly designed functionalization type for gold nanoparticles (AuNP) with split aptamer has been developed for the detection of adenosine triphosphate (ATP). The ATP aptamer was split into two parts with their 5' prime or 3' prime modified with thiol. Both the 5' SH and 3' SH modified strands for each split aptamer fragment were functionalized onto the same AuNP to construct double-functionalized AuNP-DNA conjugates. Thus, the split aptamer can be reassembled into intact folded structure in the presence of ATP molecule with two potential assembly types, which induces the assembly of AuNP-DNA conjugates. In this double-functionalized system, the traditional assembly type might facilitate another assembly type, which was found to give much higher LSPR change in the presence of ATP than the traditional assembly type, and improve the sensitivity for ATP detection. Time courses of the assemble processes with different assembly types, Mg(2+) concentrations, and aptamer fragments densities on AuNP were followed using the absorption ratio at 650 nm and 520 nm. ATP response with this newly designed system was investigated using absorption spectra and dynamic light scattering method.

  18. Glutathione immunosensing platform based on total internal reflection ellipsometry enhanced by functionalized gold nanoparticles.

    PubMed

    García-Marín, Antonio; Abad, José M; Ruiz, Eduardo; Lorenzo, Encarnación; Piqueras, Juan; Pau, José L

    2014-05-20

    An immunosensor to detect small molecules, such as glutathione (GSH), has been developed by combination of ellipsometry and Kretschmann surface plasmon resonance (SPR). The Au thin film used for surface plasmon polariton (SPP) excitation is functionalized with anti-GSH to specifically bind GSH. At low concentrations, the small refractive index changes caused by the low molecular weight of GSH induced only negligible shifts in the plasmon resonant energy during GSH binding. To improve sensitivity, gold nanoparticles (AuNPs) are functionalized with glutathione acting as amplifiers of the antigen-antibody interaction. Changes induced by the AuNP adsorption are monitored using Ψ and Δ ellipsometric functions. After performing competitive assays using solutions containing different concentrations of free GSH and a constant amount of functionalized AuNPs, it was concluded that the resonant energy linearly shifts as the relative concentration of free GSH increases. A detection limit for free GSH in the nanomolar range is found, demonstrating the effectiveness of AuNPs to enhance the sensitivity to immunoreactions in total internal reflection ellipsometry.

  19. Pose prediction and virtual screening performance of GOLD scoring functions in a standardized test

    NASA Astrophysics Data System (ADS)

    Liebeschuetz, John W.; Cole, Jason C.; Korb, Oliver

    2012-06-01

    The performance of all four GOLD scoring functions has been evaluated for pose prediction and virtual screening under the standardized conditions of the comparative docking and scoring experiment reported in this Edition. Excellent pose prediction and good virtual screening performance was demonstrated using unmodified protein models and default parameter settings. The best performing scoring function for both pose prediction and virtual screening was demonstrated to be the recently introduced scoring function ChemPLP. We conclude that existing docking programs already perform close to optimally in the cognate pose prediction experiments currently carried out and that more stringent pose prediction tests should be used in the future. These should employ cross-docking sets. Evaluation of virtual screening performance remains problematic and much remains to be done to improve the usefulness of publically available active and decoy sets for virtual screening. Finally we suggest that, for certain target/scoring function combinations, good enrichment may sometimes be a consequence of 2D property recognition rather than a modelling of the correct 3D interactions.

  20. Gold nanoparticles functionalized with therapeutic and targeted peptides for cancer treatment.

    PubMed

    Kumar, Anil; Ma, Huili; Zhang, Xu; Huang, Keyang; Jin, Shubin; Liu, Juan; Wei, Tuo; Cao, Weipeng; Zou, Guozhang; Liang, Xing-Jie

    2012-02-01

    Functionalization of nanostructures such as gold nanoparticles (AuNPs) with different biological molecules has many applications in biomedical imaging, clinical diagnosis and therapy. Researchers mostly employed AuNPs larger than 10 nm for different biological and medicinal applications in previous studies. Herein, we synthesized a novel small (2 nm) AuNPs, which were functionalized with the therapeutic peptide, PMI (p12), and a targeted peptide, CRGDK for selective binding to neuropilin-1(Nrp-1) receptors which overexpressed on the cancer cells and regulated the process of membrane receptor-mediated internalization. It was found that CRGDK peptides increased intracellular uptake of AuNPs compared to other surface conjugations quantified by ICP-MS. Interestingly, CRGDK functionalized AuNPs resulted in maximal binding interaction between the CRGDK peptide and targeted Nrp-1 receptor overexpressed on MDA-MB-321 cell surface, which improved the delivery of therapeutic P12 peptide inside targeted cells. Au@p12 + CRGDK nanoparticles indicated with highly effective cancer treatment by increasing p53 expression upregulated with intracellular enhanced p12 therapeutic peptide. These results have implications to design and functionalize different molecules onto AuNPs surfaces to make hybrid model system for selective target binding as well as therapeutic effects for cancer treatment.

  1. Phytosynthesis of gold nanoparticles using Mappia foetida leaves extract and their conjugation with folic acid for delivery of doxorubicin to cancer cells.

    PubMed

    Yallappa, S; Manjanna, J; Dhananjaya, B L; Vishwanatha, U; Ravishankar, B; Gururaj, H

    2015-09-01

    Mappia foetida leaves extract is used as bioreductant for the synthesis of gold nanoparticles and their application in the efficient delivery of doxorubicin to human cancer cells is reported here. The formation of gold nanoparticles is evident from their characteristic optical absorption at ~560 nm. X-ray diffraction pattern of gold nanoparticles confirmed their fcc structure. Fourier transform infrared spectroscopy shows the bioactive molecules from plant extract capped on the surface of gold nanoparticles and conjugation of doxorubicin along with activated folic acid as navigational molecules for targeted drug delivery. Such a conjugation of gold nanoparticles is characterized by their weight loss, ~35-40 %, due to thermal degradation of plant biomass and conjugated drug along with receptor, as observed in thermogravimetric analysis. The spherical shaped gold nanoparticles (Φ 10-20 nm) are observed by field emission scanning electron microscopy and transmission electron microscopy images and the expected elemental composition by energy dispersive X-ray spectroscopy. Gold nanoparticles conjugated with activated folic acid and doxorubicin complex is found to be toxic for human cancer cells viz., MDA-MB-231, HeLa, SiHa and Hep-G2. Furthermore, the amount of drug released was maximum at pH 5.3 (an ambient condition for intravenous cancer drugs) followed by pH 7.2 and pH 6.8.

  2. Luminol functionalized gold nanoparticles as colorimetric and chemiluminescent probes for visual, label free, highly sensitive and selective detection of minocycline

    NASA Astrophysics Data System (ADS)

    He, Yi; Peng, Rufang

    2014-11-01

    In this work, luminol functionalized gold nanoparticles (LuAuNPs) were used as colorimetric and chemiluminescent probes for visual, label free, sensitive and selective detection of minocycline (MC). The LuAuNPs were prepared by simple one-pot reduction of HAuCl4 with luminol, which exhibited a good chemiluminescence (CL) activity owing to the presence of luminol molecules on their surface and surface plasmon resonance absorption. In the absence of MC, the color of LuAuNPs was wine red and their size was relatively small (˜25 nm), which could react with silver nitrate, producing a strong CL emission. Upon the addition of MC at acidic buffer solutions, the electrostatic interaction between positively charged MC and negatively charged LuAuNPs caused the aggregation of LuAuNPs, generating a purple or blue color. Simultaneously, the aggregated LuAuNPs did not effectively react with silver nitrate, producing a weak CL emission. The signal change was linearly dependent on the logarithm of MC concentration in the range from 30 ng to 1.0 μg for colorimetric detection and from 10 ng to 1.0 μg for CL detection. With colorimetry, a detection limit of 22 ng was achieved, while the detection limit for CL detection modality was 9.7 ng.

  3. Luminol functionalized gold nanoparticles as colorimetric and chemiluminescent probes for visual, label free, highly sensitive and selective detection of minocycline.

    PubMed

    He, Yi; Peng, Rufang

    2014-11-14

    In this work, luminol functionalized gold nanoparticles (LuAuNPs) were used as colorimetric and chemiluminescent probes for visual, label free, sensitive and selective detection of minocycline (MC). The LuAuNPs were prepared by simple one-pot reduction of HAuCl₄ with luminol, which exhibited a good chemiluminescence (CL) activity owing to the presence of luminol molecules on their surface and surface plasmon resonance absorption. In the absence of MC, the color of LuAuNPs was wine red and their size was relatively small (∼25 nm), which could react with silver nitrate, producing a strong CL emission. Upon the addition of MC at acidic buffer solutions, the electrostatic interaction between positively charged MC and negatively charged LuAuNPs caused the aggregation of LuAuNPs, generating a purple or blue color. Simultaneously, the aggregated LuAuNPs did not effectively react with silver nitrate, producing a weak CL emission. The signal change was linearly dependent on the logarithm of MC concentration in the range from 30 ng to 1.0 μg for colorimetric detection and from 10 ng to 1.0 μg for CL detection. With colorimetry, a detection limit of 22 ng was achieved, while the detection limit for CL detection modality was 9.7 ng.

  4. Circulating tumor cell identification by functionalized silver-gold nanorods with multicolor, super-enhanced SERS and photothermal resonances

    NASA Astrophysics Data System (ADS)

    Nima, Zeid A.; Mahmood, Meena; Xu, Yang; Mustafa, Thikra; Watanabe, Fumiya; Nedosekin, Dmitry A.; Juratli, Mazen A.; Fahmi, Tariq; Galanzha, Ekaterina I.; Nolan, John P.; Basnakian, Alexei G.; Zharov, Vladimir P.; Biris, Alexandru S.

    2014-05-01

    Nanotechnology has been extensively explored for cancer diagnostics. However, the specificity of current methods to identify simultaneously several cancer biomarkers is limited due to color overlapping of bio-conjugated nanoparticles. Here, we present a technique to increase both the molecular and spectral specificity of cancer diagnosis by using tunable silver-gold nanorods with narrow surface-enhanced Raman scattering (SERS) and high photothermal contrast. The silver-gold nanorods were functionalized with four Raman-active molecules and four antibodies specific to breast cancer markers and with leukocyte-specific CD45 marker. More than two orders of magnitude of SERS signal enhancement was observed from these hybrid nanosystems compared to conventional gold nanorods. Using an antibody rainbow cocktail, we demonstrated highly specific detection of single breast cancer cells in unprocessed human blood. By integrating multiplex targeting, multicolor coding, and multimodal detection, our approach has the potential to improve multispectral imaging of individual tumor cells in complex biological environments.

  5. Circulating tumor cell identification by functionalized silver-gold nanorods with multicolor, super-enhanced SERS and photothermal resonances.

    PubMed

    Nima, Zeid A; Mahmood, Meena; Xu, Yang; Mustafa, Thikra; Watanabe, Fumiya; Nedosekin, Dmitry A; Juratli, Mazen A; Fahmi, Tariq; Galanzha, Ekaterina I; Nolan, John P; Basnakian, Alexei G; Zharov, Vladimir P; Biris, Alexandru S

    2014-05-09

    Nanotechnology has been extensively explored for cancer diagnostics. However, the specificity of current methods to identify simultaneously several cancer biomarkers is limited due to color overlapping of bio-conjugated nanoparticles. Here, we present a technique to increase both the molecular and spectral specificity of cancer diagnosis by using tunable silver-gold nanorods with narrow surface-enhanced Raman scattering (SERS) and high photothermal contrast. The silver-gold nanorods were functionalized with four Raman-active molecules and four antibodies specific to breast cancer markers and with leukocyte-specific CD45 marker. More than two orders of magnitude of SERS signal enhancement was observed from these hybrid nanosystems compared to conventional gold nanorods. Using an antibody rainbow cocktail, we demonstrated highly specific detection of single breast cancer cells in unprocessed human blood. By integrating multiplex targeting, multicolor coding, and multimodal detection, our approach has the potential to improve multispectral imaging of individual tumor cells in complex biological environments.

  6. Intraspinal Delivery of Polyethylene Glycol-coated Gold Nanoparticles Promotes Functional Recovery After Spinal Cord Injury

    PubMed Central

    Papastefanaki, Florentia; Jakovcevski, Igor; Poulia, Nafsika; Djogo, Nevena; Schulz, Florian; Martinovic, Tamara; Ciric, Darko; Loers, Gabrielle; Vossmeyer, Tobias; Weller, Horst; Schachner, Melitta; Matsas, Rebecca

    2015-01-01

    Failure of the mammalian central nervous system (CNS) to regenerate effectively after injury leads to mostly irreversible functional impairment. Gold nanoparticles (AuNPs) are promising candidates for drug delivery in combination with tissue-compatible reagents, such as polyethylene glycol (PEG). PEG administration in CNS injury models has received interest for potential therapy, but toxicity and low bioavailability prevents clinical application. Here we show that intraspinal delivery of PEG-functionalized 40-nm-AuNPs at early stages after mouse spinal cord injury is beneficial for recovery. Positive outcome of hind limb motor function was accompanied by attenuated inflammatory response, enhanced motor neuron survival, and increased myelination of spared or regrown/sprouted axons. No adverse effects, such as body weight loss, ill health, or increased mortality were observed. We propose that PEG-AuNPs represent a favorable drug-delivery platform with therapeutic potential that could be further enhanced if PEG-AuNPs are used as carriers of regeneration-promoting molecules. PMID:25807288

  7. Density functional theory approach to gold-ligand interactions: Separating true effects from artifacts

    SciTech Connect

    Koppen, Jessica V.; Szczęśniak, Małgorzata M.; Hapka, Michał; Modrzejewski, Marcin; Chałasiński, Grzegorz

    2014-06-28

    Donor-acceptor interactions are notoriously difficult and unpredictable for conventional density functional theory (DFT) methodologies. This work presents a reliable computational treatment of gold-ligand interactions of the donor-acceptor type within DFT. These interactions require a proper account of the ionization potential of the electron donor and electron affinity of the electron acceptor. This is accomplished in the Generalized Kohn Sham framework that allows one to relate these properties to the frontier orbitals in DFT via the tuning of range-separated functionals. A donor and an acceptor typically require different tuning schemes. This poses a problem when the binding energies are calculated using the supermolecular method. A two-parameter tuning for the monomer properties ensures that a common functional, optimal for both the donor and the acceptor, is found. A reliable DFT approach for these interactions also takes into account the dispersion contribution. The approach is validated using the water dimer and the (HAuPH{sub 3}){sub 2} aurophilic complex. Binding energies are computed for Au{sub 4} interacting with the following ligands: SCN{sup −}, benzenethiol, benzenethiolate anion, pyridine, and trimethylphosphine. The results agree for the right reasons with coupled-cluster reference values.

  8. Thiol-reactive amphiphilic block copolymer for coating gold nanoparticles with neutral and functionable surfaces.

    PubMed

    Chen, Hongwei; Zou, Hao; Paholak, Hayley J; Ito, Masayuki; Qian, Wei; Che, Yong; Sun, Duxin

    2014-04-21

    Nanoparticles designed for biomedical applications are often coated with polymers containing reactive functional groups, such as -COOH and -NH2, to conjugate targeting ligands or drugs. However, introducing highly charged surfaces promotes binding of the nanoparticles to biomolecules in biological systems through ionic interactions, causing the nanoparticles to aggregate in biological environments and consequently undergo strong non-specific binding to off-target cells and tissues. Developing a unique polymer with neutral surfaces that can be further functionalized directly would be critical to develop suitable nanomaterials for nanomedicine. Here, we report a thiol-reactive amphiphilic block copolymer poly(ethylene oxide)-block-poly(pyridyldisulfide ethylmeth acrylate) (PEO-b-PPDSM) for coating gold nanoparticles (AuNPs). The resultant polymer-coated AuNPs have almost neutral surfaces with slightly negative zeta potentials from -10 to 0 mV over a wide pH range from 2 to 12. Although the zeta potential is close to zero we show that the PEO-b-PPDSM copolymer-coated AuNPs have both good stability in various physiological conditions and reduced non-specific adsorption of proteins/biomolecules. Because of the multiple pyridyldisulfide groups on the PPDSM block, these individually dispersed nanocomplexes with an overall hydrodynamic size around 43.8 nm can be directly functionalized via disulfide-thiol exchange chemistry.

  9. A universal strategy for visual chiral recognition of α-amino acids with L-tartaric acid-capped gold nanoparticles as colorimetric probes.

    PubMed

    Song, Guoxin; Zhou, Fulin; Xu, Chunli; Li, Baoxin

    2016-02-21

    The ability to recognize and quantify the chirality of alpha-amino acids constitutes the basis of many critical areas for specific targeting in drug development and metabolite probing. It is still challenging to conveniently distinguish the enantiomer of amino acids largely due to the lack of a universal and simple strategy. In this work, we report a strategy for the visual recognition of α-amino acids. It is based on the chirality of L-tartaric acid-capped gold nanoparticles (L-TA-capped AuNPs, ca. 13 nm in diameter). All of 19 right-handed α-amino acids can induce a red-to-blue color change of L-TA-capped AuNP solution, whereas all of the left-handed amino acids (except cysteine) cannot. The chiral recognition can be achieved by the naked eye and a simple spectrophotometer. This method does not require complicated chiral modification, and excels through its low-cost, good availability of materials and its simplicity. Another notable feature of this method is its high generality, and this method can discriminate almost all native α-amino acid enantiomers. This versatile method could be potentially used for high-throughput chiral recognition of amino acids.

  10. Microfluidic immunosensor based on mesoporous silica platform and CMK-3/poly-acrylamide-co-methacrylate of dihydrolipoic acid modified gold electrode for cancer biomarker detection.

    PubMed

    Regiart, Matías; Fernández-Baldo, Martin A; Villarroel-Rocha, Jhonny; Messina, Germán A; Bertolino, Franco A; Sapag, Karim; Timperman, Aaron T; Raba, Julio

    2017-04-22

    We report a hybrid glass-poly (dimethylsiloxane) microfluidic immunosensor for epidermal growth factor receptor (EGFR) determination, based on the covalent immobilization of anti-EGFR antibody (anti-EGFR) on amino-functionalized mesoporous silica (AMS) retained in the central channel of a microfluidic device. The synthetized AMS was characterized by N2 adsorption-desorption isotherm, scanning electron microscopy (SEM), energy dispersive spectrometry (EDS) and infrared spectroscopy. The cancer biomarker was quantified in human serum samples by a direct sandwich immunoassay measuring through a horseradish peroxidase-conjugated anti-EGFR. The enzymatic product was detected at -100 mV by amperometry on a sputtering gold electrode, modified with an ordered mesoporous carbon (CMK-3) in a matrix of poly-acrylamide-co-methacrylate of dihydrolipoic acid (poly(AC-co-MDHLA)) through in situ copolymerization. CMK-3/poly(AC-co-MDHLA)/gold was characterized by cyclic voltammetry, EDS and SEM. The measured current was directly proportional to the level of EGFR in human serum samples. The linear range was from 0.01 ng mL(-1) to 50 ng mL(-1). The detection limit was 3.03 pg mL(-1), and the within- and between-assay coefficients of variation were below 5.20%. The microfluidic immunosensor is a very promising device for the diagnosis of several kinds of epithelial origin carcinomas.

  11. Fischer carbene mediated covalent grafting of a peptide nucleic acid on gold surfaces and IR optical detection of DNA hybridization with a transition metalcarbonyl label

    NASA Astrophysics Data System (ADS)

    Srivastava, Pratima; Ghasemi, Mahsa; Ray, Namrata; Sarkar, Amitabha; Kocabova, Jana; Lachmanova, Stepanka; Hromadova, Magdalena; Boujday, Souhir; Cauteruccio, Silvia; Thakare, Pramod; Licandro, Emanuela; Fosse, Céline; Salmain, Michèle

    2016-11-01

    Amine-reactive surfaces comprising N-hydroxysuccinimide ester groups as well as much more unusual Fischer alkoxymetallocarbene groups were generated on gold-coated surfaces via self-assembled monolayers of carboxy- and azido-terminated thiolates, respectively. These functions were further used to immobilize homothymine peptide nucleic acid (PNA) decamer in a covalent fashion involving the primary amine located at its N-terminus. These stepwise processes were monitored by polarization modulation reflection - absorption infrared spectroscopy (PM-RAIRS) that gave useful information on the molecular composition of the organic layers. PNA grafting and hybridization with complementary DNA strand were successfully transduced by quartz crystal microbalance (QCM) measurements. Unfortunately, attempts to transduce the hybridization optically by IR in a label-free fashion were inconclusive. Therefore we undertook to introduce an IR reporter group, namely a transition metalcarbonyl (TMC) entity at the 5‧ terminus of complementary DNA. Evidence for the formation of PNA-DNA heteroduplex was brought by the presence of ν(Ctbnd O) bands in the 2000 cm-1 region of the IR spectrum of the gold surface owing to the metalcarbonyl label.

  12. Multimetallic complexes and functionalized gold nanoparticles based on a combination of d- and f-elements.

    PubMed

    Sung, Simon; Holmes, Holly; Wainwright, Luke; Toscani, Anita; Stasiuk, Graeme J; White, Andrew J P; Bell, Jimmy D; Wilton-Ely, James D E T

    2014-02-17

    The new DO3A-derived dithiocarbamate ligand, DO3A-(t)Bu-CS2K, is formed by treatment of the ammonium salt [DO3A-(t)Bu]HBr with K2CO3 and carbon disulfide. DO3A-(t)Bu-CS2K reacts with the ruthenium complexes cis-[RuCl2(dppm)2] and [Ru(CH═CHC6H4Me-4)Cl(CO)(BTD)(PPh3)2] (BTD = 2,1,3-benzothiadiazole) to yield [Ru(S2C-DO3A-(t)Bu)(dppm)2](+) and [Ru(CH═CHC6H4Me-4)(S2C-DO3A-(t)Bu)(CO)(PPh3)2], respectively. Similarly, the group 10 metal complexes [Pd(C,N-C6H4CH2NMe2)Cl]2 and [PtCl2(PPh3)2] form the dithiocarbamate compounds, [Pd(C,N-C6H4CH2NMe2)(S2C-DO3A-(t)Bu)] and [Pt(S2C-DO3A-(t)Bu)(PPh3)2](+), under the same conditions. The linear gold complexes [Au(S2C-DO3A-(t)Bu)(PR3)] are formed by reaction of [AuCl(PR3)] (R = Ph, Cy) with DO3A-(t)Bu-CS2K. However, on reaction with [AuCl(tht)] (tht = tetrahydrothiophene), the homoleptic digold complex [Au(S2C-DO3A-(t)Bu)]2 is formed. Further homoleptic examples, [M(S2C-DO3A-(t)Bu)2] (M = Ni, Cu) and [Co(S2C-DO3A-(t)Bu)3], are formed from treatment of NiCl2·6H2O, Cu(OAc)2, or Co(OAc)2, respectively, with DO3A-(t)Bu-CS2K. The molecular structure of [Ni(S2C-DO3A-(t)Bu)2] was determined crystallographically. The tert-butyl ester protecting groups of [M(S2C-DO3A-(t)Bu)2] (M = Ni, Cu) and [Co(S2C-DO3A-(t)Bu)3] are cleaved by trifluoroacetic acid to afford the carboxylic acid products, [M(S2C-DO3A)2] (M = Ni, Cu) and [Co(S2C-DO3A)3]. Complexation with Gd(III) salts yields trimetallic [M(S2C-DO3A-Gd)2] (M = Ni, Cu) and tetrametallic [Co(S2C-DO3A-Gd)3], with r(1) values of 11.5 (Co) and 11.0 (Cu) mM(-1) s(-1) per Gd center. DO3A-(t)Bu-CS2K can also be used to prepare gold nanoparticles, Au@S2C-DO3A-(t)Bu, by displacement of the surface units from citrate-stabilized nanoparticles. This material can be transformed into the carboxylic acid derivative Au@S2C-DO3A by treatment with trifluoroacetic acid. Complexation with Gd(OTf)3 or GdCl3 affords Au@S2C-DO3A-Gd with an r(1) value of 4.7 mM(-1) s(-1) per chelate and 1500 mM(-1) s(-1) per

  13. Porous Gold Nanoparticle-Decorated Nanoreactors Prepared from Smartly Designed Functional Polystyrene-block-Poly(d,l-Lactide) Diblock Copolymers: Toward Efficient Systems for Catalytic Cascade Reaction Processes.

    PubMed

    Poupart, Romain; Benlahoues, Antoine; Le Droumaguet, Benjamin; Grande, Daniel

    2017-03-15

    Original porous catalytic supports can be engineered via an effective and straightforward synthetic route to polystyrene-block-poly(d,l-lactide) diblock copolymer precursors displaying an acid-cleavable acetal junction between both blocks. To this purpose, we synthesized an acetal-containing heterodifunctional initiator, thus enabling to combine two different polymerization methods, i.e., first atom transfer radical polymerization (ATRP) of styrene, and then ring-opening polymerization (ROP) of d,l-lactide. Thanks to the labile nature of the acetal junction, oriented porous frameworks could be obtained upon trifluoroacetic acid-mediated cleavage of the latter, after orientation of the block copolymer nanodomains by solvent vapor annealing. The resulting porous materials bearing a reactive aldehyde function at the pore surface allowed for further chemical modification via reductive amination with amino-containing compounds, such as tetraethylenepentamine, thus leading to amine-functionalized porous polystyrene. In situ generated gold nanoparticles could then be immobilized within such functionalized porous nanoreactors, and these hybrid materials could find interesting applications in heterogeneous supported catalysis. In this regard, model catalytic reactions, including C-C homocoupling of benzeneboronic acid derivatives, hydride-mediated reduction of nitroaromatic compounds, and especially unprecedented "one-pot" cascade reactions consisting of the latter consecutive reactions from 3-nitrobenzeneboronic acid, were successfully monitored by different chromatographic and spectroscopic techniques.

  14. Synthesis and characterization of functional multicomponent nanosized gallium chelated gold crystals.

    PubMed

    Zambre, Ajit; Silva, Francisco; Upendran, Anandhi; Afrasiabi, Zahra; Xin, Yan; Paulo, António; Kannan, Raghuraman

    2014-03-28

    In this communication, we describe a novel synthetic method for fabricating multicomponent gold nanoparticles containing both gallium ions and biomolecules on the surface. Detailed compositional analysis, using STEM-HAADF and EELS spectroscopy, confirmed the crystalline nature of gold and chelation of gallium ions. The presence of the biomolecule was validated using conventional ELISA.

  15. A Novel Controlled Release Immunosensor based on Benzimidazole Functionalized SiO2 and Cyclodextrin Functionalized Gold

    PubMed Central

    Ma, Hongmin; Wang, Yaoguang; Wu, Dan; Zhang, Yong; Gao, Jian; Ren, Xiang; Du, Bin; Wei, Qin

    2016-01-01

    A novel controlled release system-based sandwich-type immunosensor is fabricated to detect squamous cell carcinoma antigen (SCCA). The 1-methyl-1H-benzimidazole functionalized mesoporous SiO2 (MBI-MS) is used to load methylene blue (MB). β-cyclodextrin functionalized gold (CD-Au) is introduced as the gatekeeper for encapsulating MB and capturing the adamantly functional detection antibody (ADA-Ab2). And pH stimulus serves as the trigger system to control the MB release. After the load of MB, the CD-Au blocks the pores of the MBI-MS by the host-guest interaction in the neutral condition. However, when the pH is below 7.0, CD-Au is separated from the surface of MBI-MS owing to the protonation of the aromatic amines. The encapsulated MB is released from the pores of MBI-MS and detected by square wave voltammetry. The controlled release immunosensor shows a relatively wide linear range from 0.001 to 20 ng·mL−1 with a low detection limit of 0.25 pg·mL−1. The immunosensor also shows good reproducibility and selectivity, which endows it broad application prospect in clinical research. PMID:26791418

  16. Binding and Uptake into Human Hepatocellular Carcinoma Cells of Peptide-Functionalized Gold Nanoparticles

    PubMed Central

    2016-01-01

    One of the most daunting challenges of nanomedicine is the finding of appropriate targeting agents to deliver suitable payloads precisely to cells affected by malignancies. Even more complex is the ability to ensure that the nanosystems enter those cells. Here, we use 2 nm (metal core) gold nanoparticles to target human hepatocellular carcinoma (HepG2) cells stably transfected with the SERPINB3 (SB3) protein. The nanoparticles were coated with a 85:15 mixture of thiols featuring, respectively, a phosphoryl choline (to ensure water solubility and biocompatibility) and a 28-mer peptide corresponding to the amino acid sequence 21–47 of the hepatitis B virus-PreS1 protein (PreS1(21–47)). Conjugation of the peptide was performed via the maleimide–thiol reaction in methanol, allowing the use of a limited amount of the targeting molecule. This is an efficient procedure also in the perspective of selecting libraries of new targeting agents. The rationale behind the selection of the peptide is that SB3, which is undetectable in normal hepatocytes, is overexpressed in hepatocellular carcinoma and in hepatoblastoma and has been proposed as a target of the hepatitis B virus (HBV). For the latter, the key recognition element is the PreS1(21–47) peptide, which is a fragment of one of the proteins composing the viral envelope. The ability of the conjugated nanoparticles to bind the target protein SB3, expressed in liver cancer cells, was investigated by surface plasmon resonance analysis and in vitro via cellular uptake analysis followed by atomic absorption analysis of digested samples. The results showed that the PreS1(21–47) peptide is a suitable targeting agent for cells overexpressing the SB3 protein. Even more important is the evidence that the gold nanoparticles are internalized by the cells. The comparison between the surface plasmon resonance analysis and the cellular uptake studies suggests that the presentation of the protein on the cell surface is critical

  17. Functionalization of gold nanoparticles and CdS quantum dots with cell penetrating peptides

    NASA Astrophysics Data System (ADS)

    Berry, Catherine C.; de la Fuente, Jesus M.

    2009-02-01

    During the last decade, there has been great deal of interest in the self-assembly fabrication of hybrid materials from inorganic nanoparticles and biomolecules. Nanoparticles are similar in size range to many common biomolecules, thus, nanoparticles appear to be natural companions in hybrid systems. At present, it is straightforward to control and modify properties of nanostructures to better suit their integration with biological systems; for example, controlling their size, modifying their surface layer for enhanced aqueous solubility, biocompatibility, or biorecognition. A particularly desirable target for therapeutic uses is the cell nucleus, because the genetic information is there. We review in this article the synthesis developed by our research group of water-soluble gold nanoparticles and CdS nanocrystals functionalized with a Tat protein-derived peptide sequence by straightforward and economical methodologies. The particles were subsequently tested in vitro with a human fibroblast cell line using optical and transmission electron microscopy to determine the biocompatibility of these nanoparticles and whether the functionalization with the cell penetrating peptide allowed particles to transfer across the cell membrane and locate into the nucleus.

  18. Simple Method of Synthesizing Nickel-Nitrilotriacetic Acid Gold Nanoparticles with a Narrow Size Distribution for Protein Labeling

    NASA Astrophysics Data System (ADS)

    Kitai, Toshiyuki; Watanabe, Yuta; Toyoshima, Yoko Y.; Kobayashi, Takuya; Murayama, Takashi; Sakaue, Hiroyuki; Suzuki, Hitoshi; Takahagi, Takayuki

    2011-09-01

    We developed a simple method to synthesize nickel-nitrilotriacetic acid gold nanoparticles (Ni-NTA Au NPs) with a narrow size distribution for site-specific labeling in protein complexes. Au NPs were synthesized by the reduction of HAuCl4 using trisodium citrate and tannin acid. Then, the nanoparticle surfaces were modified with NTA and subsequent complexation with Ni2+. The mean diameter of the synthesized Ni-NTA Au NPs was 4.3 nm, and the coefficient of variation was 9%. The specific binding of the Ni-NTA Au NPs to polyhistidine-tagged (His-tagged) proteins was determined by transmission electron microscopy using kinesin and the p62 subunit of dynactin. Consequently, our method is useful for analyzing the substructures of protein complexes.

  19. Plasmonic Enhancement of Dye Sensitized Solar Cells via a Tailored Size-Distribution of Chemically Functionalized Gold Nanoparticles

    PubMed Central

    Andrei, Codrin; Lestini, Elena; Crosbie, Stephen; de Frein, Caoimhe; O'Reilly, Thomas; Zerulla, Dominic

    2014-01-01

    A substantial and stable increase of the current density Jsc of ruthenium (Ru) dye sensitized solar cells (DSC) of up to 16.18% and of the power efficiency of up to 25.5% is demonstrated in this article via plasmonic enhancement. The key aspect of this work is the use of a tailored bimodal size distribution of functionalized gold nanoparticles (AuNPs) that have been chemically immobilized onto the mesoporous titanium dioxide (TiO2) layer via short, stable dithiodibutyric acid linkers. The size distribution of the AuNPs is a result of theoretical calculations that aimed at the perfection of the absorption characteristics of the complete solar cell system over a wide range of wavelengths. The functionalization of the AuNPs serves to bind them at a close but defined distance to TiO2-particles and additionally to chemically protect them against potential corrosion by the electrolyte. Simulations of near field (enhanced absorption) and far field (scattering) contributions have been used to tailor a complex AuNPs bimodal size distribution that had subsequently demonstrated experimentally a close to optimum improvement of the absorbance over a wide wavelength range (500–675 nm) and therefore an impressive DSC efficiency enhancement. Finally, the modified DSCs are exhibiting pronounced longevity and stable performance as confirmed via long time measurements. In summary, the presented systems show increased performance compared to non plasmonic enhanced cells with otherwise identical composition, and are demonstrating a previously unpublished longevity for iodide electrolyte/AuNPs combinations. PMID:25354362

  20. Plasmonic enhancement of dye sensitized solar cells via a tailored size-distribution of chemically functionalized gold nanoparticles.

    PubMed

    Andrei, Codrin; Lestini, Elena; Crosbie, Stephen; de Frein, Caoimhe; O'Reilly, Thomas; Zerulla, Dominic

    2014-01-01

    A substantial and stable increase of the current density Jsc of ruthenium (Ru) dye sensitized solar cells (DSC) of up to 16.18% and of the power efficiency of up to 25.5% is demonstrated in this article via plasmonic enhancement. The key aspect of this work is the use of a tailored bimodal size distribution of functionalized gold nanoparticles (AuNPs) that have been chemically immobilized onto the mesoporous titanium dioxide (TiO2) layer via short, stable dithiodibutyric acid linkers. The size distribution of the AuNPs is a result of theoretical calculations that aimed at the perfection of the absorption characteristics of the complete solar cell system over a wide range of wavelengths. The functionalization of the AuNPs serves to bind them at a close but defined distance to TiO2-particles and additionally to chemically protect them against potential corrosion by the electrolyte. Simulations of near field (enhanced absorption) and far field (scattering) contributions have been used to tailor a complex AuNPs bimodal size distribution that had subsequently demonstrated experimentally a close to optimum improvement of the absorbance over a wide wavelength range (500-675 nm) and therefore an impressive DSC efficiency enhancement. Finally, the modified DSCs are exhibiting pronounced longevity and stable performance as confirmed via long time measurements. In summary, the presented systems show increased performance compared to non plasmonic enhanced cells with otherwise identical composition, and are demonstrating a previously unpublished longevity for iodide electrolyte/AuNPs combinations.

  1. Detection of the nanomolar level of total Cr[(iii) and (vi)] by functionalized gold nanoparticles and a smartphone with the assistance of theoretical calculation models.

    PubMed

    Chen, Wenwen; Cao, Fengjing; Zheng, Wenshu; Tian, Yue; Xianyu, Yunlei; Xu, Peng; Zhang, Wei; Wang, Zhuo; Deng, Ke; Jiang, Xingyu

    2015-02-07

    We report a method for rapid, effective detection of both Cr(iii) and Cr(vi) (in the form of Cr(3+) and Cr2O7(2-), the main species of chromium in the natural environment) by making use of meso-2,3-dimercaptosuccinic acid (DMSA)-functionalized gold nanoparticles (Au NPs). The limit of detection (LOD) is 10 nM with the naked eye and the assay can be applied in detecting chromium in polluted soil from Yun-Nan Province in Southwest China. We use density functional theory to calculate the change of the Gibbs free energy (ΔG) of the interactions between the DMSA-Au NP system and various metal ions, which shows that DMSA-Au NPs have high specificity for both Cr(3+) and Cr2O7(2-).

  2. Amino acids: metabolism, functions, and nutrition.

    PubMed

    Wu, Guoyao

    2009-05-01

    Recent years have witnessed the discovery that amino acids (AA) are not only cell signaling molecules but are also regulators of gene expression and the protein phosphorylation cascade. Additionally, AA are key precursors for syntheses of hormones and low-molecular weight nitrogenous substances with each having enormous biological importance. Physiological concentrations of AA and their metabolites (e.g., nitric oxide, polyamines, glutathione, taurine, thyroid hormones, and serotonin) are required for the functions. However, elevated levels of AA and their products (e.g., ammonia, homocysteine, and asymmetric dimethylarginine) are pathogenic factors for neurological disorders, oxidative stress, and cardiovascular disease. Thus, an optimal balance among AA in the diet and circulation is crucial for whole body homeostasis. There is growing recognition that besides their role as building blocks of proteins and polypeptides, some AA regulate key metabolic pathways that are necessary for maintenance, growth, reproduction, and immunity. They are called functional AA, which include arginine, cysteine, glutamine, leucine, proline, and tryptophan. Dietary supplementation with one or a mixture of these AA may be beneficial for (1) ameliorating health problems at various stages of the life cycle (e.g., fetal growth restriction, neonatal morbidity and mortality, weaning-associated intestinal dysfunction and wasting syndrome, obesity, diabetes, cardiovascular disease, the metabolic syndrome, and infertility); (2) optimizing efficiency of metabolic transformations to enhance muscle growth, milk production, egg and meat quality and athletic performance, while preventing excess fat deposition and reducing adiposity. Thus, AA have important functions in both nutrition and health.

  3. Colorimetric detection of Ehrlichia canis via nucleic acid hybridization in gold nano-colloids.

    PubMed

    Muangchuen, Ajima; Chaumpluk, Piyasak; Suriyasomboon, Annop; Ekgasit, Sanong

    2014-08-08

    Canine monocytic ehrlichiosis (CME) is a major thick-bone disease of dog caused by Ehrlichia canis. Detection of this causal agent outside the laboratory using conventional methods is not effective enough. Thus an assay for E. canis detection based on the p30 outer membrane protein gene was developed. It was based on the p30 gene amplification using loop-mediated isothermal DNA amplification (LAMP). The primer set specific to six areas within the target gene were designed and tested for their sensitivity and specificity. Detection of DNA signals was based on modulation of gold nanoparticles' surface properties and performing DNA/DNA hybridization using an oligonucleotide probe. Presence of target DNA affected the gold colloid nanoparticles in terms of particle aggregation with a plasmonic color change of the gold colloids from ruby red to purple, visible by the naked eye. All the assay steps were completed within 90 min including DNA extraction without relying on standard laboratory facilities. This method was very specific to target bacteria. Its sensitivity with probe hybridization was sufficient to detect 50 copies of target DNA. This method should provide an alternative choice for point of care control and management of the disease.

  4. Biomimetic synthesis of highly biocompatible gold nanoparticles with amino acid-dithiocarbamate as a precursor for SERS imaging.

    PubMed

    Li, Li; Liu, Jianbo; Yang, Xiaohai; Huang, Jin; He, Dinggeng; Guo, Xi; Wan, Lan; He, Xiaoxiao; Wang, Kemin

    2016-03-11

    Amino acid-dithiocarbamate (amino acid-DTC) was developed as both the reductant and ligand stabilizer for biomimetic synthesis of gold nanoparticles (AuNPs), which served as an excellent surface-enhanced Raman scattering (SERS) contrast nanoprobe for cell imaging. Glycine (Gly), glutamic acid (Glu), and histidine (His) with different isoelectric points were chosen as representative amino acid candidates to synthesize corresponding amino acid-DTC compounds through mixing with carbon disulfide (CS2), respectively. The pyrogenic decomposition of amino acid-DTC initiated the reduction synthesis of AuNPs, and the strong coordinating dithiocarbamate group of amino acid-DTC served as a stabilizer that grafted onto the surface of the AuNPs, which rendered the as-prepared nanoparticles a negative surface charge and high colloidal stability. MTT cell viability assay demonstrated that the biomimetic AuNPs possessed neglectful toxicity to the human hepatoma cell, which guaranteed them good biocompatibility for biomedical application. Meanwhile, the biomimetic AuNPs showed a strong SERS effect with an enhancement factor of 9.8 × 10(5) for the sensing of Rhodamine 6G, and two distinct Raman peaks located at 1363 and 1509 cm(-1) could be clearly observed in the cell-imaging experiments. Therefore, biomimetic AuNPs can be explored as an excellent SERS contrast nanoprobe for biomedical imaging, and the amino acid-DTC mediated synthesis of the AuNPs has a great potential in bio-engineering and biomedical imaging applications.

  5. Lactose-Functionalized Gold Nanorods for Sensitive and Rapid Serological Diagnosis of Cancer.

    PubMed

    Zhao, Yuetao; Tong, Liping; Li, Yong; Pan, Haobo; Zhang, Wei; Guan, Min; Li, Weihao; Chen, Yixin; Li, Qing; Li, Zhongjun; Wang, Huaiyu; Yu, Xue-Feng; Chu, Paul K

    2016-03-09

    Timely and accurate diagnosis of cancer is crucial to cancer treatment. However, serological diagnosis of cancer still faces great challenge because the conventional methodology based on the enzyme-linked immune sorbent assay (ELISA) is costly, time-consuming, and complicated, involving multiple steps. Herein, lactose-functionalized gold nanorods (Lac-GNRs) are fabricated as efficient biosensors to detect cancerous conditions based on the unique surface plasmon resonance properties of GNRs and high specificity of lactose to the galectin-1 cancer biomarker. A trace concentration of galectin-1 as small as 10(-13) M can be detected by Lac-GNRs. The comparative study among BSA, galectin-3, and galectin-1 demonstrates the good specificity of Lac-GNRs to galectin-1 either in aqueous solutions or in the complex and heterogeneous serum specimens. Clinical tests show that the Lac-GNRs biosensors can readily distinguish the serums of cancer patients from those of healthy persons simply by using a microplate reader or even direct visual observation. The Lac-GNRs biosensing platform is highly efficient and easy to use and have great potential in rapid screening of cancer patients.

  6. Sequential strand displacement beacon for detection of DNA coverage on functionalized gold nanoparticles.

    PubMed

    Paliwoda, Rebecca E; Li, Feng; Reid, Michael S; Lin, Yanwen; Le, X Chris

    2014-06-17

    Functionalizing nanomaterials for diverse analytical, biomedical, and therapeutic applications requires determination of surface coverage (or density) of DNA on nanomaterials. We describe a sequential strand displacement beacon assay that is able to quantify specific DNA sequences conjugated or coconjugated onto gold nanoparticles (AuNPs). Unlike the conventional fluorescence assay that requires the target DNA to be fluorescently labeled, the sequential strand displacement beacon method is able to quantify multiple unlabeled DNA oligonucleotides using a single (universal) strand displacement beacon. This unique feature is achieved by introducing two short unlabeled DNA probes for each specific DNA sequence and by performing sequential DNA strand displacement reactions. Varying the relative amounts of the specific DNA sequences and spacing DNA sequences during their coconjugation onto AuNPs results in different densities of the specific DNA on AuNP, ranging from 90 to 230 DNA molecules per AuNP. Results obtained from our sequential strand displacement beacon assay are consistent with those obtained from the conventional fluorescence assays. However, labeling of DNA with some fluorescent dyes, e.g., tetramethylrhodamine, alters DNA density on AuNP. The strand displacement strategy overcomes this problem by obviating direct labeling of the target DNA. This method has broad potential to facilitate more efficient design and characterization of novel multifunctional materials for diverse applications.

  7. Coating fabrics with gold nanorods for colouring, UV-protection, and antibacterial functions

    NASA Astrophysics Data System (ADS)

    Zheng, Yidan; Xiao, Manda; Jiang, Shouxiang; Ding, Feng; Wang, Jianfang

    2012-12-01

    Gold nanorods exhibit rich colours owing to the nearly linear dependence of the longitudinal plasmon resonance wavelength on the length-to-diameter aspect ratio. This property of Au nanorods has been utilized in this work for dyeing fabrics. Au nanorods of different aspect ratios were deposited on both cotton and silk fabrics by immersing them in Au nanorod solutions. The coating of Au nanorods makes the fabrics exhibit a broad range of colours varying from brownish red through green to purplish red, which are essentially determined by the longitudinal plasmon wavelength of the deposited Au nanorods. The colorimetric values of the coated fabrics were carefully measured for examining the colouring effects. The nanorod-coated cotton fabrics were found to be commercially acceptable in washing fastness to laundering tests and colour fastness to dry cleaning tests. Moreover, the nanorod-coated cotton and silk fabrics show significant improvements on both UV-protection and antibacterial functions. Our study therefore points out a promising approach for the use of noble metal nanocrystals as dyeing materials for textile applications on the basis of their inherent localized plasmon resonance properties.

  8. Gold nanoparticle biodistribution: Cell, blood, and tissue interactions as a function of nanoparticle surface properties

    NASA Astrophysics Data System (ADS)

    Shah, Neha B.

    Intravenously injected gold nanoparticles (GNPs) hold a great promise for clinical diagnostic and therapeutic applications. A critical issue in their implementation is incomplete mechanistic understanding of their in vivo biodistribution. Two major limitations in optimizing the biodistribution of NPs are: (1) achieving the highest accumulation at the disease site, and (2) avoiding accumulation in healthy organs including liver and spleen. To overcome these limitations, the interactions of GNPs with biological system must be better understood. The research described in this dissertation sought to advance the field of GNP in vivo biodistribution by elucidating the effects of GNP surface properties such as surface charge, ligand, and polyethylene glycol (PEG) coverage. It was shown that the interactions of GNPs with cells and tissues were a function of their surface properties. A Confocal Raman Microscopy based technique was developed to study GNPs interactions with cells in vitro in fast, label-free, and non-invasive way. It was further shown that GNP surface properties strongly influence their blood circulation time in vivo. It was demonstrated that GNPs interact with circulating blood cells including platelets and monocytes, which may play a role in their clearance from blood stream. Most of the injected dose was shown to accumulate in liver and spleen; however, both organs displayed a different mechanism of uptake and distribution of GNPs. Long-term biodistribution studies further suggested that GNPs were still found in liver and spleen after 4 months, but GNPs showed clearance from liver overtime.

  9. Coating fabrics with gold nanorods for colouring, UV-protection, and antibacterial functions.

    PubMed

    Zheng, Yidan; Xiao, Manda; Jiang, Shouxiang; Ding, Feng; Wang, Jianfang

    2013-01-21

    Gold nanorods exhibit rich colours owing to the nearly linear dependence of the longitudinal plasmon resonance wavelength on the length-to-diameter aspect ratio. This property of Au nanorods has been utilized in this work for dyeing fabrics. Au nanorods of different aspect ratios were deposited on both cotton and silk fabrics by immersing them in Au nanorod solutions. The coating of Au nanorods makes the fabrics exhibit a broad range of colours varying from brownish red through green to purplish red, which are essentially determined by the longitudinal plasmon wavelength of the deposited Au nanorods. The colorimetric values of the coated fabrics were carefully measured for examining the colouring effects. The nanorod-coated cotton fabrics were found to be commercially acceptable in washing fastness to laundering tests and colour fastness to dry cleaning tests. Moreover, the nanorod-coated cotton and silk fabrics show significant improvements on both UV-protection and antibacterial functions. Our study therefore points out a promising approach for the use of noble metal nanocrystals as dyeing materials for textile applications on the basis of their inherent localized plasmon resonance properties.

  10. Gold nanoparticles assisted characterization of amine functionalized polystyrene multiwell plate and glass slide surfaces

    NASA Astrophysics Data System (ADS)

    Dharanivasan, Gunasekaran; Rajamuthuramalingam, Thangavelu; Michael Immanuel Jesse, Denison; Rajendiran, Nagappan; Kathiravan, Krishnan

    2015-01-01

    We demonstrated citrate-capped gold nanoparticles assisted characterization of amine functionalized polystyrene plate and glass slide surfaces through AuNPs staining method. The effect of AuNPs concentration on the characterization of amine modified surfaces was also studied with different concentration of AuNPs (ratios 1.0-0.0). 3-Aminopropylyl triethoxy silane has been used as amine group source for the surface modification. The interactions of AuNPs on modified and unmodified surfaces were investigated using atomic force microscopy and the dispersibility, and the aggregation of AuNPs was analyzed using UV-visible spectrophotometer. Water contact angle measurement and X-ray photoelectron spectroscopy (XPS) were used to further confirmation of amine modified surfaces. The aggregation of AuNPs in modified multiwell plate leads to the color change from red to purple and they are found to be adsorped on the modified surfaces. Aggregation and adsorption of AuNPs on the modified surfaces through the electrostatic interactions and the hydrogen bonds were revealed by XPS analysis. Remarkable results were found even in the very low concentration of AuNPs (ratio 0.2). This AuNPs staining method is simple, cost-effective, less time consuming, and required very low concentration of AuNPs. These results can be read out through the naked eye without the help of sophisticated equipments.

  11. Electrochemical Aptasensor for Myoglobin-Specific Recognition Based on Porphyrin Functionalized Graphene-Conjugated Gold Nanocomposites

    PubMed Central

    Zhang, Guojuan; Liu, Zhiguang; Wang, Li; Guo, Yujing

    2016-01-01

    In this work, a novel electrochemical aptasensor was developed for sensitive and selective detection of myoglobin based on meso-tetra (4-carboxyphenyl) porphyrin-functionalized graphene-conjugated gold nanoparticles (TCPP–Gr/AuNPs). Due to its good electric conductivity, large specific surface area, and excellent mechanical properties, TCPP–Gr/AuNPs can act as an enhanced material for the electrochemical detection of myoglobin. Meanwhile, it provides an effective matrix for immobilizing myoglobin-binding aptamer (MbBA). The electrochemical aptasensor has a sensitive response to myoglobin in a linear range from 2.0 × 10−11 M to 7.7 × 10−7 M with a detection limit of 6.7 × 10−12 M (S/N = 3). Furthermore, the method has the merits of high sensitivity, low price, and high specificity. Our work will supply new horizons for the diagnostic applications of graphene-based materials in biomedicine and biosensors. PMID:27801833

  12. Measuring error rates in genomic perturbation screens: gold standards for human functional genomics

    PubMed Central

    Hart, Traver; Brown, Kevin R; Sircoulomb, Fabrice; Rottapel, Robert; Moffat, Jason

    2014-01-01

    Technological advancement has opened the door to systematic genetics in mammalian cells. Genome-scale loss-of-function screens can assay fitness defects induced by partial gene knockdown, using RNA interference, or complete gene knockout, using new CRISPR techniques. These screens can reveal the basic blueprint required for cellular proliferation. Moreover, comparing healthy to cancerous tissue can uncover genes that are essential only in the tumor; these genes are targets for the development of specific anticancer therapies. Unfortunately, progress in this field has been hampered by off-target effects of perturbation reagents and poorly quantified error rates in large-scale screens. To improve the quality of information derived from these screens, and to provide a framework for understanding the capabilities and limitations of CRISPR technology, we derive gold-standard reference sets of essential and nonessential genes, and provide a Bayesian classifier of gene essentiality that outperforms current methods on both RNAi and CRISPR screens. Our results indicate that CRISPR technology is more sensitive than RNAi and that both techniques have nontrivial false discovery rates that can be mitigated by rigorous analytical methods. PMID:24987113

  13. Biocompatible gold nanorods: one-step surface functionalization, highly colloidal stability, and low cytotoxicity.

    PubMed

    Liu, Kang; Zheng, Yuanhui; Lu, Xun; Thai, Thibaut; Lee, Nanju Alice; Bach, Udo; Gooding, J Justin

    2015-05-05

    The conjugation of gold nanorods (AuNRs) with polyethylene glycol (PEG) is one of the most effective ways to reduce their cytotoxicity arising from the cetyltrimethylammonium bromide (CTAB) and silver ions used in their synthesis. However, typical PEGylation occurs only at the tips of the AuNRs, producing partially modified AuNRs. To address this issue, we have developed a novel, facile, one-step surface functionalization method that involves the use of Tween 20 to stabilize AuNRs, bis(p-sulfonatophenyl)phenylphosphine (BSPP) to activate the AuNR surface for the subsequent PEGylation, and NaCl to etch silver from the AuNRs. This method allows for the complete removal of the surface-bound CTAB and the most active surface silver from the AuNRs. The produced AuNRs showed far lower toxicity than other methods to PEGylate AuNRs, with no apparent toxicity when their concentration is lower than 5 μg/mL. Even at a high concentration of 80 μg/mL, their cell viability is still four times higher than that of the tip-modified AuNRs.

  14. Ultraviolet light and laser irradiation enhances the antibacterial activity of glucosamine-functionalized gold nanoparticles

    PubMed Central

    Govindaraju, Saravanan; Ramasamy, Mohankandhasamy; Baskaran, Rengarajan; Ahn, Sang Jung; Yun, Kyusik

    2015-01-01

    Here we report a novel method for the synthesis of glucosamine-functionalized gold nanoparticles (GlcN-AuNPs) using biocompatible and biodegradable glucosamine for antibacterial activity. GlcN-AuNPs were prepared using different concentrations of glucosamine. The synthesized AuNPs were characterized for surface plasmon resonance, surface morphology, fluorescence spectroscopy, and antibacterial activity. The minimum inhibitory concentrations (MICs) of the AuNPs, GlcN-AuNPs, and GlcN-AuNPs when irradiated by ultraviolet light and laser were investigated and compared with the MIC of standard kanamycin using Escherichia coli by the microdilution method. Laser-irradiated GlcN-AuNPs exhibited significant bactericidal activity against E. coli. Flow cytometry and fluorescence microscopic analysis supported the cell death mechanism in the presence of GlcN-AuNP-treated bacteria. Further, morphological changes in E. coli after laser treatment were investigated using atomic force microscopy and transmission electron microscopy. The overall results of this study suggest that the prepared nanoparticles have potential as a potent antibacterial agent for the treatment of a wide range of disease-causing bacteria. PMID:26345521

  15. Förster resonance energy transfer studies of luminescent gold nanoparticles functionalized with ruthenium(II) and rhenium(I) complexes: modulation via esterase hydrolysis.

    PubMed

    Leung, Frankie Chi-Ming; Tam, Anthony Yiu-Yan; Au, Vonika Ka-Man; Li, Mei-Jin; Yam, Vivian Wing-Wah

    2014-05-14

    A number of ruthenium(II) and rhenium(I) bipyridine complexes functionalized with lipoic acid moieties have been synthesized and characterized. Functionalization of gold nanoparticles with these chromophoric ruthenium(II) and rhenium(I) complexes has resulted in interesting supramolecular assemblies with Förster resonance energy transfer (FRET) properties that could be modulated via esterase hydrolysis. The luminescence of the metal complex chromophores was turned on upon cleavage of the ester bond linkage by esterase to reduce the efficiency of FRET quenching. The prepared nanoassembly conjugates have been characterized by transmission electron microscopy (TEM), energy-dispersive X-ray analysis (EDX), Fourier transform infrared spectroscopy (FTIR), dynamic light scattering (DLS), UV-visible spectroscopy, and emission spectroscopy. The quenching mechanism has also been studied by transient absorption and time-resolved emission decay measurements. The FRET efficiencies were found to vary with the nature of the chromophores and the length of the spacer between the donor (transition metal complexes) and the acceptor (gold nanoparticles).

  16. Facile formation of dendrimer-stabilized gold nanoparticles modified with diatrizoic acid for enhanced computed tomography imaging applications

    NASA Astrophysics Data System (ADS)

    Peng, Chen; Li, Kangan; Cao, Xueyan; Xiao, Tingting; Hou, Wenxiu; Zheng, Linfeng; Guo, Rui; Shen, Mingwu; Zhang, Guixiang; Shi, Xiangyang

    2012-10-01

    We report a facile approach to forming dendrimer-stabilized gold nanoparticles (Au DSNPs) through the use of amine-terminated fifth-generation poly(amidoamine) (PAMAM) dendrimers modified by diatrizoic acid (G5.NH2-DTA) as stabilizers for enhanced computed tomography (CT) imaging applications. In this study, by simply mixing G5.NH2-DTA dendrimers with gold salt in aqueous solution at room temperature, dendrimer-entrapped gold nanoparticles (Au DENPs) with a mean core size of 2.5 nm were able to be spontaneously formed. Followed by an acetylation reaction to neutralize the dendrimer remaining terminal amines, Au DSNPs with a mean size of 6 nm were formed. The formed DTA-containing [(Au0)50-G5.NHAc-DTA] DSNPs were characterized via different techniques. We show that the Au DSNPs are colloid stable in aqueous solution under different pH and temperature conditions. In vitro hemolytic assay, cytotoxicity assay, flow cytometry analysis, and cell morphology observation reveal that the formed Au DSNPs have good hemocompatibility and are non-cytotoxic at a concentration up to 3.0 μM. X-ray absorption coefficient measurements show that the DTA-containing Au DSNPs have enhanced attenuation intensity, much higher than that of [(Au0)50-G5.NHAc] DENPs without DTA or Omnipaque at the same molar concentration of the active element (Au or iodine). The formed DTA-containing Au DSNPs can be used for CT imaging of cancer cells in vitro as well as for blood pool CT imaging of mice in vivo with significantly improved signal enhancement. With the two radiodense elements of Au and iodine incorporated within one particle, the formed DTA-containing Au DSNPs may be applicable for CT imaging of various biological systems with enhanced X-ray attenuation property and detection sensitivity.We report a facile approach to forming dendrimer-stabilized gold nanoparticles (Au DSNPs) through the use of amine-terminated fifth-generation poly(amidoamine) (PAMAM) dendrimers modified by diatrizoic acid

  17. Graphene-multiwall carbon nanotube-gold nanocluster composites modified electrode for the simultaneous determination of ascorbic acid, dopamine, and uric acid.

    PubMed

    Liu, Xiaofang; Wei, Shaping; Chen, Shihong; Yuan, Dehua; Zhang, Wen

    2014-08-01

    In this paper, graphene-multiwall carbon nanotube-gold nanocluster (GP-MWCNT-AuNC) composites were synthesized and used as modifier to fabricate a sensor for simultaneous detection of ascorbic acid (AA), dopamine (DA), and uric acid (UA). The electrochemical behavior of the sensor was investigated by electrochemical impedance spectroscopy (EIS), cyclic voltammetry (CV) and differential pulse voltammetry (DPV) techniques. The combination of GP, MWCNTs, and AuNCs endowed the electrode with a large surface area, good catalytic activity, and high selectivity and sensitivity. The linear response range for simultaneous detection of AA, DA, and UA at the sensor were 120-1,701, 2-213, and 0.7-88.3 μM, correspondingly, and the detection limits were 40, 0.67, and 0.23 μM (S/N=3), respectively. The proposed method offers a promise for simple, rapid, selective, and cost-effective analysis of small biomolecules.

  18. Energetic stabilities of thiolated pyrimidines on gold nanoparticles investigated by Raman spectroscopy and density functional theory calculations.

    PubMed

    Ganbold, Erdene-Ochir; Yoon, Jinha; Cho, Kwang-Hwi; Joo, Sang-Woo

    2015-01-01

    The adsorption structures of 2-thiocytosine (2TC) on gold surfaces were examined by means of vibrational Raman spectroscopy and quantum mechanical density functional theory calculations. The 1H-thione-amino form was calculated to be most stable among the six examined tautomers. The three plausible binding geometries of sulfur, pyrimidine nitrogen, and amino group binding modes were calculated to estimate the binding energies of the 1H-thione-amino form with six gold cluster atoms. Thiouracils including 2-thiouracil (2TU), 4-thiouracil (4TU), and 6-methyl-2-thiouracil (6M2TU) were also studied to compare their relative binding energies on gold atoms. The intracellular localization of a DNA base analog of 2TC on gold nanoparticles (AuNPs) in HeLa cells was identified by means of surface-enhanced Raman scattering. AuNPs were modified with 2TC by self-assembly. Our dark-field microscopy and z-depth-dependent confocal Raman spectroscopy indicated that 2TC-assembled AuNPs could be found inside cancer cells. On the other hand, we did not observe noticeably strong Raman peaks in the cases of thiouracils including 2TU, 4TU, and 6M2TU. This may be due to the additional amino group of 2TC, which can lead to a stronger binding of adsorbates on AuNPs.

  19. Polydopamine-enabled surface functionalization of gold nanorods for cancer cell-targeted imaging and photothermal therapy

    PubMed Central

    Black, Kvar CL; Yi, Ji; Rivera, José G; Zelasko-Leon, Daria C; Messersmith, Phillip B

    2012-01-01

    Aim A novel biomimetic strategy was employed for presenting antibodies on gold nanorods (NRs) to target growth factor receptors on cancer cells for use in photothermal therapy. Materials & methods Polydopamine (PD) was polymerized onto gold NRs, and EGF receptor antibodies (anti-EGFR) were immobilized onto the layer. Cell-binding affinity and light-activated cell death of cancer cells incubated with anti-EGFR-PD-NRs were quantified by optical imaging. Results PD was deposited onto gold NRs, and antibodies were bound to PD-coated NRs. Anti-EGFR-PD-NRs were stable in media, and were specifically bound to EGFR-overexpressing cells. Illumination of cells targeted with anti-EGFR-PD-NRs enhanced cell death compared with nonirradiated controls and cells treated with antibody-free NRs. Conclusion PD facilitates the surface functionalization of gold NRs with biomolecules, allowing cell targeting and photothermal killing of cancer cells. PD can potentially coat a large variety of nanoparticles with targeting ligands as a strategy for biofunctionalization of diagnostic and therapeutic nanoparticles. PMID:22891865

  20. Acid-functionalized polyolefin materials and their use in acid-promoted chemical reactions

    DOEpatents

    Oyola, Yatsandra; Tian, Chengcheng; Bauer, John Christopher; Dai, Sheng

    2016-06-07

    An acid-functionalized polyolefin material that can be used as an acid catalyst in a wide range of acid-promoted chemical reactions, wherein the acid-functionalized polyolefin material includes a polyolefin backbone on which acid groups are appended. Also described is a method for the preparation of the acid catalyst in which a precursor polyolefin is subjected to ionizing radiation (e.g., electron beam irradiation) of sufficient power and the irradiated precursor polyolefin reacted with at least one vinyl monomer having an acid group thereon. Further described is a method for conducting an acid-promoted chemical reaction, wherein an acid-reactive organic precursor is contacted in liquid form with a solid heterogeneous acid catalyst comprising a polyolefin backbone of at least 1 micron in one dimension and having carboxylic acid groups and either sulfonic acid or phosphoric acid groups appended thereto.

  1. Current topics in the biotechnological production of essential amino acids, functional amino acids, and dipeptides.

    PubMed

    Mitsuhashi, Satoshi

    2014-04-01

    Amino acids play important roles in both human and animal nutrition and in the maintenance of health. Here, amino acids are classified into three groups: first, essential amino acids, which are essential to nutrition; second, functional amino acids, recently found to be important in the promotion of physiological functions; and third, dipeptides, which are used to resolve problematic features of specific free amino acids, such as their instability or insolubility. This review focusses on recent researches concerning the microbial production of essential amino acids (lysine and methionine), functional amino acids (histidine and ornithine), and a dipeptide (L-alanyl-L-glutamine).

  2. Bioinspired Gold Nanorod Functionalization Strategies for MUC1-Targeted Imaging and Photothermal Therapy

    NASA Astrophysics Data System (ADS)

    Zelasko-Leon, Daria Cecylia

    The majority of cancers diagnosed in 2016 are epithelial in origin, constituting 85% of all new cases and predicted to account for 78% of all cancer deaths this year. Given these statistics, improving patient outcomes by providing personalized, multimodal, and minimally invasive medical interventions is critically needed. Mucin 1 (MUC1), a transmembrane glycoprotein, extends over 100 nm from cell membranes and is a key marker promoting epithelial carcinogenesis. Due to its antenna-like manifestation, MUC1 is a unique yet underexplored candidate for targeted cancer therapy, with overexpression in >64% of epithelial cancers. To overcome the limitations of existing treatment strategies for epithelial cancer, this dissertation describes a novel platform for nanomedicine, highlighting bioinspired modifications of gold nanorod (AuNR) surfaces for diagnostic cancer imaging and photothermal therapy. An ongoing challenge in the field of nanomedicine is the need for simple and effective strategies for simple surface modification of nanoparticles to facilitate targeting and enhance efficacy. Here, biofunctionalization of AuNRs was achieved with polydopamine (PD) and tannic acid (TA), polyphenolic compounds found in the marine mussel and throughout the plant kingdom that exhibit promiscuous interfacial binding properties. AuNR stabilization was achieved via PD or TA coatings followed by secondary modification with the serum protein, bovine serum albumin (BSA), or glycoprotein-mimetic polymers. The resultant constructs demonstrated good biocompatibility, enabled diagnostic imaging, and facilitated MUC1-specific photothermal treatment of breast and oral cancer cells. The in vivo performance of BSA and PD modified AuNRs was evaluated in two orthotopic animal models of breast cancer. Clinically relevant hyperthermia and high response rates with MUC1-targeted formulations were found, with significant enhancement of progression-free survival and several complete tumor regressions

  3. Gold Functionalized Mesoporous Silica Nanoparticle Mediated Protein and DNA Codelivery to Plant Cells Via the Biolistic Method

    SciTech Connect

    Martin-Ortigosa, Susana; Valenstein, Justin S.; Lin, Victor S.-Y.; Trewyn, Brian G.; Wang, Kan

    2012-09-11

    The synthesis and characterization of a gold nanoparticle functionalized mesoporous silica nanoparticle (Au-MSN) platform for codelivery of proteins and plasmid DNA to plant tissues using a biolistic particle delivery system is reported. The in vitro uptake and release profiles of fluorescently labeled bovine serum albumin (BSA) and enhanced green fluorescent protein (eGFP) are investigated. As a proof-of-concept demonstration, Au-MSN with large average pore diameters (10 nm) are shown to deliver and subsequently release proteins and plasmid DNA to the same cell after passing through the plant cell wall upon bombardment. Release of fluorescent eGFP indicates the delivery of active, non-denatured proteins to plant cells. This advance represents the first example of biolistic-mediated codelivery of proteins and plasmid DNA to plant cells via gold-functionalized MSN and provides a powerful tool for both fundamental and applied research of plant sciences.

  4. Synthesis of functionalized gold nanoparticles capped with 3-mercapto-1-propansulfonate and 1-thioglucose mixed thiols and "in vitro" bioresponse.

    PubMed

    Porcaro, F; Battocchio, C; Antoccia, A; Fratoddi, I; Venditti, I; Fracassi, A; Luisetto, I; Russo, M V; Polzonetti, G

    2016-06-01

    The synthesis, characterization and assessment of biological behavior of innovative negatively charged functionalized gold nanoparticles is herein reported, for potential applications in the field of radiotherapy and drug delivery. Gold nanoparticles (AuNPs) functionalized with two capping agents, i.e., the 3-mercapto-1-propansulfonate (3-MPS) and 1-β-thio-D-glucose (TG), have been on purpose synthesized and fully characterized. Advanced characterization techniques including X-Ray Photoelectron Spectroscopy (XPS) were applied to probe the chemical structure of the synthesized nanomaterials. Z-potential and Dynamic Light Scattering measurements allowed assessing the nanodimension, dispersity, surface charge and stability of AuNPs. Transmission Electron Microscopy (TEM) and Flame Atomic Absorption Spectroscopy (FAAS) were applied to the "in vitro" HSG cell model, to investigate the nanoparticles-cells interaction and to evaluate the internalization efficiency, whereas short term cytotoxicity and long term cell killing were evaluated by means of MTT and SRB assays, respectively. In conclusion, in order to increase the amount of gold atoms inside the cell we have optimized the synthesis for a new kind of biocompatible and very stable negatively charged TG-functionalized nanoparticles, with diameters in a range that maximize the uptake in cells (i.e., ∼15nm). Such particles are very promising for radiotherapy and drug delivery application.

  5. Inhibition of several enzymes by gold compounds. II. beta-Glucuronidase, acid phosphatase and L-malate dehydrogenase by sodium thiomalatoraurate (I), sodium thiosulfatoaurate (I) and thioglucosoaurate (I).

    PubMed

    Lee, M T; Ahmed, T; Haddad, R; Friedman, M E

    1989-01-01

    Bovine liver beta-D-glucuronide glucuronohydrolase, EC 3.2.1.32), wheat germ acid phosphatase (orthophosphoric monoesterphosphohydrolase, EC 3.1.3.2) and bovine liver L-malate dehydrogenase (L-malate: NAD oxidoreductase, EC 1.1.1.37) were inhibited by a series of gold (I) complexes that have been used as anti-inflammatory drugs. Both sodium thiosulfatoaurate (I) (Na AuTs) and sodium thiomalatoraurate (NaAuTM) effectively inhibited all three enzymes, while thioglucosoaurate (I) (AuTG) only inhibited L-malate dehydrogenase. The equilibrium constants (K1) ranged from nearly 4000 microM for the NaAuTM-beta-glucuronidase interaction to 24 microM for the NaAuTS-beta-glucuronidase interaction. The rate of covalent bond formation (kp) ranged from 0.00032 min-1 for NaAuTM-beta-glucuronidase formation to 1.7 min-1 for AuTG-L-malate dehydrogenase formation. The equilibrium data shows that the gold (I) drugs bind by several orders lower than the gold (III) compounds, suggesting a significantly stronger interaction between the more highly charged gold ion and the enzyme. Yet the rate of covalent bond formation depends as much on the structure of the active site as upon the lability of the gold-ligand bond. It was also observed that the more effective the gold inhibition the more toxic the compound.

  6. Nanoporous gold on three-dimensional nickel foam: An efficient hybrid electrode for hydrogen peroxide electroreduction in acid media

    NASA Astrophysics Data System (ADS)

    Ke, Xi; Xu, Yantong; Yu, Changchun; Zhao, Jie; Cui, Guofeng; Higgins, Drew; Li, Qing; Wu, Gang

    2014-12-01

    A hybrid structure of nanoporous gold (NPG) on three-dimensional (3D) macroporous Ni foam has been synthesized by electrodeposition of Au-Sn alloy film followed by a facile chemical dealloying process under free corrosion conditions. Scanning electron microscopy (SEM) and X-ray diffraction (XRD) are used to characterize the morphology and structure of the NPG/Ni foam hybrids. It is shown that the Ni foam skeletons are uniformly wrapped by the NPG film which is composed of bicontinuous nanostructures consisting of interconnected ligaments and nanopores. Electroreduction of H2O2 on the NPG/Ni foam hybrid electrode in acid media is investigated by linear scan voltammetry, chronoamperometry and electrochemical impedance spectroscopy. It is found that such hierarchical porous electrode displays superior activity, durability and mass transport property for H2O2 electroreduction. These results demonstrate the potential of the NPG/Ni foam hybrid electrodes for the applications in fuel cell technology.

  7. Enhancement of electrogenerated chemiluminescence of luminol by ascorbic acid at gold nanoparticle/graphene modified glassy carbon electrode.

    PubMed

    Dong, Yongping; Gao, Tingting; Zhou, Ying; Chu, Xiangfeng; Wang, Chengming

    2015-01-05

    Gold nanoparticle/graphene (GNP/GR) nanocomposite was one-pot synthesized from water soluble graphene and HAuCl₄ by hydrothermal method and characterized by TEM, Raman spectroscopy, XRD, XPS, UV-vis spectroscopy, and electrochemical impedance spectroscopy (EIS). Electrogenerated chemiluminescence (ECL) of luminol was investigated at the GNP/GR modified glassy carbon electrode (GNP/GR/GCE) and the GNP modified glassy carbon electrode (GNP/GCE) in aqueous solution respectively. The results revealed that one strong anodic ECL peak could be observed at ∼0.8 V at two modified electrodes compared with that at the bare electrode. The intensity of the anodic ECL at the GNP/GR/GCE is weaker than that at the GNP/GCE, which should be due to the synergic effect of the enhancing effect of gold nanoparticles and the inhibiting effect of graphene on anodic luminol ECL. One strong cathodic ECL peak located at ∼-0.8 V could be observed at the GNP/GR/GCE but not at the GNP/GCE, which should be result from the adsorbed oxygen at the graphene film. In the presence of ascorbic acid, the anodic ECL at the GNP/GR/GCE was enhanced more than 8-times, which is more apparent than that at the GNP/GCE. Whereas, the cathodic ECL peak was seriously inhibited at the GNP/GR/GCE. The enhanced ECL intensity at the GNP/GR/GCE varied linearly with the logarithm of ascorbic acid concentration in the range of 1.0 × 10(-8) to 1.0 × 10(-6)mol L(-1) with a detection limit of 1.0 × 10(-9) mol L(-1). The possible ECL mechanism was also discussed.

  8. Enhancement of electrogenerated chemiluminescence of luminol by ascorbic acid at gold nanoparticle/graphene modified glassy carbon electrode

    NASA Astrophysics Data System (ADS)

    Dong, Yongping; Gao, Tingting; Zhou, Ying; Chu, Xiangfeng; Wang, Chengming

    2015-01-01

    Gold nanoparticle/graphene (GNP/GR) nanocomposite was one-pot synthesized from water soluble graphene and HAuCl4 by hydrothermal method and characterized by TEM, Raman spectroscopy, XRD, XPS, UV-vis spectroscopy, and electrochemical impedance spectroscopy (EIS). Electrogenerated chemiluminescence (ECL) of luminol was investigated at the GNP/GR modified glassy carbon electrode (GNP/GR/GCE) and the GNP modified glassy carbon electrode (GNP/GCE) in aqueous solution respectively. The results revealed that one strong anodic ECL peak could be observed at ∼0.8 V at two modified electrodes compared with that at the bare electrode. The intensity of the anodic ECL at the GNP/GR/GCE is weaker than that at the GNP/GCE, which should be due to the synergic effect of the enhancing effect of gold nanoparticles and the inhibiting effect of graphene on anodic luminol ECL. One strong cathodic ECL peak located at ∼-0.8 V could be observed at the GNP/GR/GCE but not at the GNP/GCE, which should be result from the adsorbed oxygen at the graphene film. In the presence of ascorbic acid, the anodic ECL at the GNP/GR/GCE was enhanced more than 8-times, which is more apparent than that at the GNP/GCE. Whereas, the cathodic ECL peak was seriously inhibited at the GNP/GR/GCE. The enhanced ECL intensity at the GNP/GR/GCE varied linearly with the logarithm of ascorbic acid concentration in the range of 1.0 × 10-8 to 1.0 × 10-6 mol L-1 with a detection limit of 1.0 × 10-9 mol L-1. The possible ECL mechanism was also discussed.

  9. Label-free detection of cardiac troponin-I using gold nanoparticles functionalized single-walled carbon nanotubes based chemiresistive biosensor

    NASA Astrophysics Data System (ADS)

    Rajesh, Sharma, Vikash; Puri, Nitin K.; Singh, Rajiv K.; Biradar, Ashok M.; Mulchanadani, Ashok

    2013-11-01

    We report a specific and ultrasensitive, label-free chemiresistive biosensor based on mercaptopropionic acid capped gold nanoparticles (GNP) functionalized single walled carbon nanotube (SWNT) hybrid for the detection of cardiac specific biomarker troponin-I (cTnI). GNPs were attached to SWNTs through a molecular linker 1-pyrenemethylamine. The highly specific cTnI antibody was covalently immobilized on GNPs through capping agent using carbodiimide coupling reaction. The cTnI interaction to its corresponding antibody was studied with respect to changes in conductance in SWNTs channel, and a detailed field-effect transistor characteristic was delineated. The device exhibited a linear response to cTnI from 0.01 to 10 ng ml-1.

  10. In vitro selection of functional nucleic acids

    NASA Technical Reports Server (NTRS)

    Wilson, D. S.; Szostak, J. W.

    1999-01-01

    In vitro selection allows rare functional RNA or DNA molecules to be isolated from pools of over 10(15) different sequences. This approach has been used to identify RNA and DNA ligands for numerous small molecules, and recent three-dimensional structure solutions have revealed the basis for ligand recognition in several cases. By selecting high-affinity and -specificity nucleic acid ligands for proteins, promising new therapeutic and diagnostic reagents have been identified. Selection experiments have also been carried out to identify ribozymes that catalyze a variety of chemical transformations, including RNA cleavage, ligation, and synthesis, as well as alkylation and acyl-transfer reactions and N-glycosidic and peptide bond formation. The existence of such RNA enzymes supports the notion that ribozymes could have directed a primitive metabolism before the evolution of protein synthesis. New in vitro protein selection techniques should allow for a direct comparison of the frequency of ligand binding and catalytic structures in pools of random sequence polynucleotides versus polypeptides.

  11. Poly(ethylene glycol)- and carboxylate-functionalized gold nanoparticles using polymer linkages: single-step synthesis, high stability, and plasmonic detection of proteins.

    PubMed

    Park, Garam; Seo, Daeha; Chung, Im Sik; Song, Hyunjoon

    2013-11-05

    Gold nanoparticles with suitable surface functionalities have been widely used as a versatile nanobioplatform. However, functionalized gold nanoparticles using thiol-terminated ligands have a tendency to aggregate, particularly in many enzymatic reaction buffers containing biological thiols, because of ligand exchange reactions. In the present study, we developed a one-step synthesis of poly(ethylene glycol) (PEG)ylated gold nanoparticles using poly(dimethylaminoethyl methacrylate) (PDMAEMA) in PEG as a polyol solvent. Because of the chelate effect of polymeric functionalities on the gold surface, the resulting PEGylated gold nanoparticles (Au@P-PEG) are very stable under the extreme conditions at which the thiol-monolayer-protected gold nanoparticles are easily coagulated. Using the solvent mixture of PEG and ethylene glycol (EG) and subsequent hydrolysis, gold nanoparticles bearing mixed functionalities of PEG and carboxylate are generated. The resulting particles exhibit selective adsorption of positively charged chymotrypsin (ChT) without nonselective adsorption of bovine serum albumin (BSA). The present nanoparticle system has many advantages, including high stability, simple one-step synthesis, biocompatibility, and excellent binding specificity; thus, this system can be used as a versatile platform for potential bio-related applications, such as separation, sensing, imaging, and assays.

  12. Functional inhibition of aquaporin-3 with a gold-based compound induces blockage of cell proliferation.

    PubMed

    Serna, Ana; Galán-Cobo, Ana; Rodrigues, Claudia; Sánchez-Gomar, Ismael; Toledo-Aral, Juan José; Moura, Teresa F; Casini, Angela; Soveral, Graça; Echevarría, Miriam

    2014-11-01

    AQP3 has been correlated with higher transport of glycerol, increment of ATP content, and larger proliferation capacity. Recently, we described the gold(III) complex Auphen as a very selective and potent inhibitor of AQP3's glycerol permeability (Pgly ). Here we evaluated Auphen effect on the proliferation of various mammalian cell lines differing in AQP3 expression level: no expression (PC12), moderate (NIH/3T3) or high (A431) endogenous expression, cells stably expressing AQP3 (PC12-AQP3), and human HEK293T cells transiently transfected (HEK-AQP3) for AQP3 expression. Proliferation was evaluated in the absence or presence of Auphen (5 μM) by counting number of viable cells and analyzing 5-bromo-2'-deoxyuridine (BrdU) incorporation. Auphen reduced ≈50% the proliferation in A431 and PC12-AQP3, ≈15% in HEK-AQP3 and had no effect in PC12-wt and NIH/3T3. Strong arrest in the S-G2/M phases of the cell cycle, supported by analysis of cyclins (A, B1, D1, E) levels, was observed in AQP3-expressing cells treated with Auphen. Flow-cytometry of propidium iodide incorporation and measurements of mitochondrial dehydrogenases activity confirmed absence of cytotoxic effect of the drug. Functional studies evidenced ≈50% inhibition of A431 Pgly by Auphen, showing that the compound's antiproliferative effect correlates with its ability to inhibit AQP3 Pgly . Role of Cys-40 on AQP3 permeability blockage by Auphen was confirmed by analyzing the mutated protein (AQP3-Ser-40). Accordingly, cells transfected with mutated AQP3 gained resistance to the antiproliferative effect of Auphen. These results highlight an Auphen inhibitory effect on proliferation of cells expressing AQP3 and suggest a targeted therapeutic effect on carcinomas with large AQP3 expression.

  13. DNAzyme-functionalized gold-palladium hybrid nanostructures for triple signal amplification of impedimetric immunosensor.

    PubMed

    Hou, Li; Gao, Zhuangqiang; Xu, Mingdi; Cao, Xia; Wu, Xiaoping; Chen, Guonan; Tang, Dianping

    2014-04-15

    A highly sensitive and selective impedimetric immunosensor with triple signal amplification was designed for ultrasensitive detection of prostate-specific antigen (PSA) by using anti-PSA antibody and DNAzyme-functionalized gold-palladium hybrid nanotags (Ab2-AuPd-DNA). The signal was amplified based on the Ab2-AuPd-DNA toward the catalytic precipitation of 4-choloro-1-naphthol (4-CN). DNAzyme (as a kind of peroxidase mimic) could catalyze the oxidation of 4-CN, whilst AuPd hybrid nanostructures could not only provide a large surface coverage for immobilization of biomolecules but also promote 4-CN oxidation to some extent. The produced insoluble benzo-4-chlorohexadienone via 4-CN was coated on the electrode surface, and hindered the electron transfer between the solution and the electrode, thereby increasing the Faradaic impedance of the base electrode. Three labeling strategies including Ab2-AuNP, Ab2-AuPd and Ab2-AuPd-DNA were investigated for determination of PSA, and improved analytical features were obtained with the Ab2-AuPd-DNA strategy. Under optimal conditions, the dynamic concentration range of the impedimetric immunosensor spanned from 1.0 pg mL(-1) to 50 ng mL(-1) PSA with a detection limit of 0.73 pg mL(-1). Intra- and inter-assay coefficients of variation were below 8.5% and 9.5%, respectively. Importantly, no significant differences at the 0.05 significance level were encountered in the analysis of 6 clinical serum specimens and 6 diluted standards between the impedimetric immunosensor and the commercialized electrochemiluminescent method for PSA detection.

  14. Investigate electrochemical immunosensor of cortisol based on gold nanoparticles/magnetic functionalized reduced graphene oxide.

    PubMed

    Sun, Bolu; Gou, Yuqiang; Ma, Yuling; Zheng, Xiaoping; Bai, Ruibin; Ahmed Abdelmoaty, Ahmed Attia; Hu, Fangdi

    2017-02-15

    A sensitively competitive electrochemical immunosensor for the detection of cortisol was successfully developed based on gold nanoparticles and magnetic functionalized reduced graphene oxide (AuNPs/MrGO). In order to construct the base of the immunosensor, the MrGO was initially fabricated by chemical cross-linking and used to modify the nafion pretreated glassy carbon electrode. Subsequently, the surface of electrode was modified by AuNPs via electrochemical deposition. A variety of cortisol (Cor) can be firmly loaded in the AuNPs/MrGO with large specific surface area and good bioactivity to construct the basic electrode (Cor/AuNPs/MrGO/Nafion@GCE), which was characterized by the cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS), respectively. Due to the cortisol on the surface of basic electrode and samples can competitively combine with the cortisol antibody labelled by horseradish peroxidase (HRP-Strept-Biotin-Ab). Finally, the detection signal of electrochemical immunosensor (HRP-Strept-Biotin-Ab-Cor/AuNPs/MrGO/Nafion@GCE) in the test liquid had negative correlations with the concentration of cortisol in samples. The AuNPs/MrGO with excellent electrical conductivity being applied, the electrochemical response of the immunosensor was immensely amplified. The immunosensor displayed excellent analytical performance for the detection of cortisol range from 0.1 to 1000ng/mL with a detection limit of 0.05ng/mL at 3σ. Moreover, compared the developed immunoassay with commercially available enzyme linked immunosorbent assay, the proposed method showed good precision, acceptable stability and reproducibility, indicating the immunosensor could be used for the sensitive, efficient and real-time detection of cortisol in real samples. Therefore, the present strategy provides a novel and convenient method for clinical determination of cortisol.

  15. Biosynthesis of gold and silver nanoparticles by natural precursor clove and their functionalization with amine group

    NASA Astrophysics Data System (ADS)

    Singh, Ashwani Kumar; Talat, Mahe; Singh, D. P.; Srivastava, O. N.

    2010-06-01

    We report a simple and cost effective way for synthesis of metallic nanoparticles (Au and Ag) using natural precursor clove. Au and Ag nanoparticles have been synthesized by reducing the aqueous solution of AuCl4 and AgNO3 with clove extract. One interesting aspect here is that reduction time is quite small (few minutes instead of hours as compared to other natural precursors). We synthesized gold and silver nanoparticles of different shape and size by varying the ratio of AuCl4 and AgNO3 with respect to clove extract, where the dominant component is eugenol. The evolution of Au and Ag nanoparticles from the reduction of different ratios of AuCl4 and AgNO3 with optimised concentration of the clove extract has been evaluated through monitoring of surface plasmon behaviour as a function of time. The reduction of AuCl4 and AgNO3 by eugenol is because of the inductive effect of methoxy and allyl groups which are present at ortho and para positions of proton releasing -OH group as two electrons are released from one molecule of eugenol. This is followed by the formation of resonating structure of the anionic form of eugenol. The presence of methoxy and allyl groups has been confirmed by FTIR. To the best of our knowledge, use of clove as reducing agent, the consequent very short time (minutes instead of hours and without any scavenger) and the elucidation of mechanism of reduction based on FTIR analysis has not been attempted earlier.

  16. Importance of nanoparticle size in colorimetric and SERS-based multimodal trace detection of Ni(II) ions with functional gold nanoparticles.

    PubMed

    Krpetić, Zeljka; Guerrini, Luca; Larmour, Iain A; Reglinski, John; Faulds, Karen; Graham, Duncan

    2012-03-12

    Colorimetric detection of analytes using gold nanoparticles along with surface-enhanced Raman spectroscopy (SERS) are areas of intense research activity since they both offer sensing of very low concentrations of target species. Multimodal detection promotes the simultaneous detection of a sample by a combination of different techniques; consequently, surface chemistry design in the development of multimodal nanosensors is important for rapid and sensitive evaluation of the analytes by diverse analytical methods. Herein it is shown that nanoparticle size plays an important role in the design of functional nanoparticles for colorimetric and SERS-based sensing applications, allowing controlled nanoparticle assembly and tunable sensor response. The design and preparation of robust nanoparticle systems and their assembly is reported for trace detection of Ni(II) ions as a model system in an aqueous solution. The combination of covalently attached nitrilotriacetic acid moieties along with the L-carnosine dipeptide on the nanoparticle surface represents a highly sensitive platform for rapid and selective detection of Ni(II) ions. This systematic study demonstrates that significantly lower detection limits can be achieved by finely tuning the assembly of gold nanoparticles of different core sizes. The results clearly demonstrate the feasibility and usefulness of a multimodal approach.

  17. The effect of gold nanoparticle structure on the conformation and function of adsorbed proteins

    NASA Astrophysics Data System (ADS)

    Gagner, Jennifer E.

    Many applications of nanobiomaterials rely on or are enhanced by specific, protein-mediated interactions with biological systems. These interactions can be engineered by chemically modifying the surface of the material to affect protein adsorption, or by altering the topography of the nanoscale surface. The attachment or adsorption of proteins onto materials can greatly affect the structure and subsequent function of those proteins, giving rise to unpredictable and potentially undesirable effects. Thus, it is essential to develop a detailed understanding of how nanostructured surface characteristics, such as atomic-scale topography, surface energy, and chemical structure may affect protein adsorption, structure, function, and stability. The presented work on gold nanoparticles (AuNP) in the forms of spheres (AuNS), rods (AuNR), cubes (AuNC) and octahedra (AuNO) will elucidate the effect of nanoparticle morphology on adsorbed model proteins lysozyme (Lyz) and α-chymotrypsin (ChT). It has been found that nanoparticle morphology does affect the structure of adsorbed proteins as well as the extent of the surface coverage; however, the final form of the nano-bio conjugate is protein specific. Lyz conjugates underwent loss of structure and rapid aggregation regardless of AuNP morphology; however, ChT conjugates exhibited no structure loss when immobilized on AuNS, and a significant, loading specific structure loss when adsorbed on AuNR. Further work will be presented on efforts to determine the role of crystal structure, surface energy, and ligand chemistry on adsorbed proteins. Wet chemical methods are used to synthesize AuNC with f100g facets and AuNO with f111g facets. Nanoparticles are characterized through electron microscopy, X-ray and electron diffraction, X-ray photoelectron spectroscopy and inductively coupled plasma mass spectroscopy. Protein conjugation and changes in protein structure are monitored through a variety of physical and spectroscopic techniques

  18. Density functional theory study of CO-induced segregation in gold-based alloys.

    PubMed

    Sansa, Myriam; Dhouib, Adnene; Guesmi, Hazar

    2014-08-14

    This paper reports a systematic study of the effect of CO gas on the chemical composition at the surface of gold-based alloys. Using DFT periodic calculations in presence of adsorbed CO the segregation behavior of group 9-10-11 transition metals (Ag, Cu, Pt, Pd, Ni, Ir, Rh, Co) substituted in semi-infinite gold surfaces is investigated. Although, CO is found to be more strongly adsorbed on (100) than on the (111) surface, the segregation of M impurities is found to be more pronounced on the (111) surface. The results reveal two competitive effects: the effect of M on CO and the effect of CO on M. Thus, on one hand, if M exists on the (100) gold facet, CO would be strongly adsorbed on it. But if M is initially located in the bulk, it would segregate to the (111) facet instead of the (100) in order to bind to CO.

  19. A New Porphyrin for the Preparation of Functionalized Water-Soluble Gold Nanoparticles with Low Intrinsic Toxicity

    PubMed Central

    Penon, Oriol; Patiño, Tania; Barrios, Lleonard; Nogués, Carme; Amabilino , David B; Wurst, Klaus; Pérez-García, Lluïsa

    2015-01-01

    A potential new photosensitizer based on a dissymmetric porphyrin derivative bearing a thiol group was synthesized. 5-[4-(11-Mercaptoundecyloxy)-phenyl-10,15,20-triphenylporphyrin (PR-SH) was used to functionalize gold nanoparticles in order to obtain a potential drug delivery system. Water-soluble multifunctional gold nanoparticles GNP-PR/PEG were prepared using the Brust–Schiffrin methodology, by immobilization of both a thiolated polyethylene glycol (PEG) and the porphyrin thiol compound (PR-SH). The nanoparticles were fully characterized by transmission electron microscopy and 1H nuclear magnetic resonance spectroscopy, UV/Vis absorption spectroscopy, and X-ray photoelectron spectroscopy. Furthermore, the ability of GNP-PR/PEGs to induce singlet oxygen production was analyzed to demonstrate the activity of the photosensitizer. Cytotoxicity experiments showed the nanoparticles are nontoxic. Finally, cellular uptake experiments demonstrated that the functionalized gold nanoparticles are internalized. Therefore, this colloid can be considered to be a novel nanosystem that could potentially be suitable as an intracellular drug delivery system of photosensitizers for photodynamic therapy. PMID:25969810

  20. Application of ultrafast gold luminescence to measuring the instrument response function for multispectral multiphoton fluorescence lifetime imaging

    NASA Astrophysics Data System (ADS)

    Talbot, Clifford B.; Patalay, Rakesh; Munro, Ian; Warren, Sean; Ratto, Fulvio; Matteini, Paolo; Pini, Roberto; Breunig, H. Georg; König, Karsten; Chu, Antony C.; Stamp, Gordon W.; Neil, Mark A. A.; French, Paul M. W.; Dunsby, Chris

    2011-07-01

    When performing multiphoton fluorescence lifetime imaging in multiple spectral emission channels, an instrument response function must be acquired in each channel if accurate measurements of complex fluorescence decays are to be performed. Although this can be achieved using the reference reconvolution technique, it is difficult to identify suitable fluorophores with a mono-exponential fluorescence decay across a broad emission spectrum. We present a solution to this problem by measuring the IRF using the ultrafast luminescence from gold nanorods. We show that ultrafast gold nanorod luminescence allows the IRF to be directly obtained in multiple spectral channels simultaneously across a wide spectral range. We validate this approach by presenting an analysis of multispectral autofluorescence FLIM data obtained from human skin ex vivo.

  1. Ultra-sensitive immunosensor for detection of hepatitis B surface antigen using multi-functionalized gold nanoparticles.

    PubMed

    Shourian, M; Ghourchian, H; Boutorabi, M

    2015-10-01

    The signal amplification for analytical purposes has considerable potential in detecting trace levels of analytes for clinical, security or environmental applications. In the present report a strategy based on a sandwich type immunoassay system was designed for the detection of hepatitis B surface antigen which exploits the specific affinity interaction between streptavidin and biotin recognition systems. The method involves the specific coupling of multi-functionalized gold nanoparticles (bearing biotin and luminol molecules) to the streptavidin modified by secondary antibody. The chemiluminescent signal is produced by the gold nanoparticles in the presence of HAuCl4 as catalyst and hydrogen peroxide as oxidant. The immunosensor was able to detect hepatitis B surface antigen in the linear concentration range from 1.7 to 1920 pg mL(-1) and the detection limit of 0.358 pg mL(-1), at signal/noise = 3.

  2. Laser thermal ablation of multidrug-resistant bacteria using functionalized gold nanoparticles

    PubMed Central

    Mocan, Lucian; Tabaran, Flaviu A; Mocan, Teodora; Pop, Teodora; Mosteanu, Ofelia; Agoston-Coldea, Lucia; Matea, Cristian T; Gonciar, Diana; Zdrehus, Claudiu; Iancu, Cornel

    2017-01-01

    The issue of multidrug resistance (MDR) has become an increasing threat to public health. One alternative strategy against MDR bacteria would be to construct therapeutic vectors capable of physically damaging these microorganisms. Gold nanoparticles hold great promise for the development of such therapeutic agents, since the nanoparticles exhibit impressive properties, of which the most important is the ability to convert light into heat. This property has scientific significance since is exploited to develop nano-photothermal vectors to destroy bacteria at a molecular level. The present paper summarizes the latest advancements in the field of nanotargeted laser hyperthermia of MDR bacteria mediated by gold nanoparticles. PMID:28356741

  3. Oligonucleotide-modified screen-printed gold electrodes for enzyme-amplified sensing of nucleic acids.

    PubMed

    Carpini, Guido; Lucarelli, Fausto; Marrazza, Giovanna; Mascini, Marco

    2004-09-15

    An electrochemical genosensor for the detection of specific sequences of DNA has been developed using disposable screen-printed gold electrodes. Screen-printed gold electrodes were firstly modified with a mixed monolayer of a 25-mer thiol-tethered DNA probe and a spacer thiol, 6-mercapto-1-hexanol (MCH). The DNA probe sequence was internal to the sequence of the 35S promoter, which sequence is inserted in the genome of GMOs regulating the transgene expression. An enzyme-amplified detection scheme, based on the coupling of a streptavidin-alkaline phosphatase conjugate and biotinylated target sequences was then applied. The enzyme catalysed the hydrolysis of the electroinactive alpha-naphthyl phosphate to alpha-naphthol; this product is electroactive and has been detected by means of differential pulse voltammetry. The assay was, firstly, characterised using synthetic oligonucleotides. Relevant parameters, such as the probe concentration and the immobilisation time, the use of the MCH and different enzymatic conjugates, were investigated and optimised. The genosensor response was found to be linearly related to the target concentration between 0 and 25 nmol/L; the detection limit was 0.25 nmol/L. The analytical procedure was then applied for the detection of the 35S promoter sequence, which was amplified from the pBI121 plasmid by polymerase chain reaction (PCR). Hybridisation conditions (i.e., hybridisation buffer and hybridisation time) were further optimised. The selectivity of the assay was confirmed using biotinylated non-complementary amplicons and PCR blanks. The results showed that the genosensor enabled sensitive (detection limit: 1 nmol/L) and specific detection of GMO-related sequences, thus providing a useful tool for the screening analysis of bioengineered food samples.

  4. Gold nanoparticles functionalized with a fragment of the neural cell adhesion molecule L1 stimulate L1-mediated functions

    NASA Astrophysics Data System (ADS)

    Schulz, Florian; Lutz, David; Rusche, Norman; Bastús, Neus G.; Stieben, Martin; Höltig, Michael; Grüner, Florian; Weller, Horst; Schachner, Melitta; Vossmeyer, Tobias; Loers, Gabriele

    2013-10-01

    The neural cell adhesion molecule L1 is involved in nervous system development and promotes regeneration in animal models of acute and chronic injury of the adult nervous system. To translate these conducive functions into therapeutic approaches, a 22-mer peptide that encompasses a minimal and functional L1 sequence of the third fibronectin type III domain of murine L1 was identified and conjugated to gold nanoparticles (AuNPs) to obtain constructs that interact homophilically with the extracellular domain of L1 and trigger the cognate beneficial L1-mediated functions. Covalent conjugation was achieved by reacting mixtures of two cysteine-terminated forms of this L1 peptide and thiolated poly(ethylene) glycol (PEG) ligands (~2.1 kDa) with citrate stabilized AuNPs of two different sizes (~14 and 40 nm in diameter). By varying the ratio of the L1 peptide-PEG mixtures, an optimized layer composition was achieved that resulted in the expected homophilic interaction of the AuNPs. These AuNPs were stable as tested over a time period of 30 days in artificial cerebrospinal fluid and interacted with the extracellular domain of L1 on neurons and Schwann cells, as could be shown by using cells from wild-type and L1-deficient mice. In vitro, the L1-derivatized particles promoted neurite outgrowth and survival of neurons from the central and peripheral nervous system and stimulated Schwann cell process formation and proliferation. These observations raise the hope that, in combination with other therapeutic approaches, L1 peptide-functionalized AuNPs may become a useful tool to ameliorate the deficits resulting from acute and chronic injuries of the mammalian nervous system.The neural cell adhesion molecule L1 is involved in nervous system development and promotes regeneration in animal models of acute and chronic injury of the adult nervous system. To translate these conducive functions into therapeutic approaches, a 22-mer peptide that encompasses a minimal and functional L1

  5. Room-temperature tunneling behavior of boron nitride nanotubes functionalized with gold quantum dots.

    PubMed

    Lee, Chee Huei; Qin, Shengyong; Savaikar, Madhusudan A; Wang, Jiesheng; Hao, Boyi; Zhang, Dongyan; Banyai, Douglas; Jaszczak, John A; Clark, Kendal W; Idrobo, Juan-Carlos; Li, An-Ping; Yap, Yoke Khin

    2013-09-06

    One-dimensional arrays of gold quantum dots (QDs) on insulating boron nitride nanotubes (BNNTs) can form conduction channels of tunneling field-effect transistors. We demonstrate that tunneling currents can be modulated at room temperature by tuning the lengths of QD-BNNTs and the gate potentials. Our discovery will inspire the creative use of nanostructured metals and insulators for future electronic devices.

  6. Multiple morphologies of gold-magnetite heterostructure nanoparticles are effectively functionalized with protein for cell targeting.

    PubMed

    Krystofiak, Evan S; Mattson, Eric C; Voyles, Paul M; Hirschmugl, Carol J; Albrecht, Ralph M; Gajdardziska-Josifovska, Marija; Oliver, Julie A

    2013-08-01

    Nanoparticles composed of a magnetic iron oxide core surrounded by a metal shell have utility in a broad range of biomedical applications. However, the presence of surface energy differences between the two components makes wetting of oxide with metal unfavorable, precluding a "core-shell" structure of an oxide core completely surrounded by a thin metal shell. Three-dimensional island growth followed by island coalescence into thick shells is favored over the two-dimensional layer-by-layer growth of a thin, continuous metal coating of a true core-shell. Aqueous synthesis of gold-coated magnetite nanoparticles with analysis by infrared, energy-dispersive X-ray, and electron energy loss spectroscopies; high-resolution transmission electron microscopy; selected area electron diffraction; and high-angle annular dark-field scanning transmission electron microscopy showed two distinct morphologies that are inconsistent with an idealized core-shell. The majority were isolated ~16-22-nm-diameter nanoparticles consisting of ~7-nm-diameter magnetite and a thick deposition of gold, most often discontinuous, with some potentially "sandwiched" morphologies. A minority were aggregates of agglomerated magnetite decorated with gold but displaying significant bare magnetite. Both populations were successfully conjugated to fibrinogen and targeted to surface-activated platelets, demonstrating that iron oxide-gold nanoparticles produced by aqueous synthesis do not require an ideal core-shell structure for biological activity in cell labeling and targeting applications.

  7. Detection of Glucose with Atomic Absorption Spectroscopy by Using Oligonucleotide Functionalized Gold Nanoparticle.

    PubMed

    Zhang, Hong; Yan, Honglian; Ling, Liansheng

    2016-06-01

    A novel method for the detection of glucose was established with atomic absorption spectroscopy by using the label of gold nanoparticle (AuNP). Silver-coated glass assembled with oligonucleotide 5'-SH-T12-AGA CAA GAG AGG-3' (Oligo 1) was acted as separation probe, oligonucleotide 5'-CAA CAG AGA ACG-T12-SH-3' modified gold nanoparticle (AuNP-Oligo 2) was acted as signal-reporting probe. Oligonucleotide 5'-CGT TCT CTG TTG CCT CTC TTG TCT-3' (Oligo 3) could hybridize with Oligo 1 on the surface of silver-coated glass and AuNP-Oligo 2, and free AuNP-Oligo 2 could be removed by rinsing with buffer. Hence the concentration of Oligo 3 was transformed into the concentration of gold element. In addition, Oligo 3 could be cleaved into DNA fragments by glucose, glucose oxidase and Fe(2+)-EDTA through Fenton reaction. Thereby the concentration of glucose could be transformed to the absorbance of gold element. Under the optimum conditions, the integrated absorbance decreased proportionally to the concentration of glucose over the range from 50.0 μM to 1.0 mM with a detection limit of 40.0 μM. Moreover, satisfactory result was obtained when the assay was used to determinate glucose in human serum.

  8. Functionalization of organically modified silica with gold nanoparticles in the presence of lignosulfonate.

    PubMed

    Konował, Emilia; Modrzejewska-Sikorska, Anna; Motylenko, Mykhailo; Klapiszewski, Łukasz; Wysokowski, Marcin; Bazhenov, Vasilii V; Rafaja, David; Ehrlich, Hermann; Milczarek, Grzegorz; Jesionowski, Teofil

    2016-04-01

    It is shown that lignosulfonate (LS) can be used as an effective reducing agent for gold ions and simultaneously as a stabilizing agent for gold nanoparticles (AuNPs). When organically modified silica is introduced to the reaction mixture, most of the AuNPs grow on the surface of the silica due to hydrophobic interactions between LS and organic layers covering the solid particles. It was also found that the structure of the organic layer is crucial for the effective deposition of gold nanoparticles onto silica spheres in terms of particle size and gold content in the final SiO2-LS-AuNPs composites. Due to the hydrophobicity of the modified silica it was necessary to carry out the modification in mixed organic/aqueous solvent. The polarity of the organic co-solvent was found to have an effect on the size of the deposited Au-NPs and their quantity. The physical appearance of the obtained hybrids was analyzed by colorimetry, and their structure and composition were evaluated using transmission electron microscopy (TEM). Additionally dispersive and thermal properties were examined by dynamic light scattering (DLS) and thermogravimetry (TG), respectively. The obtained multifunctional hybrid materials exhibits remarkable catalytic activity for the reduction of C.I. Basic Blue 9 (Methylene Blue) by borohydride.

  9. Functionalized gold nanoparticle supported sensory mechanisms applied in detection of chemical and biological threat agents: a review.

    PubMed

    Upadhyayula, Venkata K K

    2012-02-17

    There is a great necessity for development of novel sensory concepts supportive of smart sensing capabilities in defense and homeland security applications for detection of chemical and biological threat agents. A smart sensor is a detection device that can exhibit important features such as speed, sensitivity, selectivity, portability, and more importantly, simplicity in identifying a target analyte. Emerging nanomaterial based sensors, particularly those developed by utilizing functionalized gold nanoparticles (GNPs) as a sensing component potentially offer many desirable features needed for threat agent detection. The sensitiveness of physical properties expressed by GNPs, e.g. color, surface plasmon resonance, electrical conductivity and binding affinity are significantly enhanced when they are subjected to functionalization with an appropriate metal, organic or biomolecular functional groups. This sensitive nature of functionalized GNPs can be potentially exploited in the design of threat agent detection devices with smart sensing capabilities. In the presence of a target analyte (i.e., a chemical or biological threat agent) a change proportional to concentration of the analyte is observed, which can be measured either by colorimetric, fluorimetric, electrochemical or spectroscopic means. This article provides a review of how functionally modified gold colloids are applied in the detection of a broad range of threat agents, including radioactive substances, explosive compounds, chemical warfare agents, biotoxins, and biothreat pathogens through any of the four sensory means mentioned previously.

  10. Simulation and Modeling of Self-Assembled Monolayers of Carboxylic Acid Thiols on Flat and Nanoparticle Gold Surfaces

    SciTech Connect

    Techane, Sirnegeda D.; Baer, Donald R.; Castner, David G.

    2011-09-01

    Quantitative analysis of the 16-mercaptohexadecanoic acid self-assembled monolayer (C16 COOH-SAM) layer thickness on gold nanoparticles (AuNPs) was performed using simulation of electron spectra for surface analysis (SESSA) and x-ray photoelectron spectroscopy (XPS). XPS measurements of C16 COOH SAMs on flat gold surfaces were made at 9 different photoelectron take-off angles (5o to 85o in 5o increments), corrected using geometric weighting factors and then summed together to approximate spherical AuNPs. The SAM thickness and relative surface roughness (RSA) in SESSA were optimized to determine the best agreement between simulated and experimental surface composition. Based on the glancing angle results, it was found that inclusion of a hydrocarbon contamination layer on top the C16 COOH-SAM was necessary to improve the agreement between the SESSA and XPS results. For the 16 COOH-SAMs on flat Au surfaces, using a SAM thickness of 1.1Å/CH2 group, an RSA of 1.05 and a 1.5Å CH2-contamination overlayer (total film thickness = 21.5Å) for the SESSA calculations provided the best agreement with the experimental XPS data. After applying the appropriate geometric corrections and summing the SESSA flat surface compositions, the best fit results for the 16 COOH-SAM thickness and surface roughness on the AuNPs were determined to be 0.9Å/CH2 group and 1.06 RSA with a 1.5Å CH2-contamination overlayer (total film thickness = 18.5Å). The three angstrom difference in SAM thickness between the flat Au and AuNP surfaces suggests the alkyl chains of the SAM are slightly more tilted or disordered on the AuNP surfaces.

  11. Simulation and modeling of self-assembled monolayers of carboxylic acid thiols on flat and nanoparticle gold surfaces.

    PubMed

    Techane, Sirnegeda; Baer, Donald R; Castner, David G

    2011-09-01

    Quantitative analysis of the 16-mercaptohexadecanoic acid self-assembled monolayer (C16 COOH-SAM) layer thickness on gold nanoparticles (AuNPs) was performed using simulation of electron spectra for surface analysis (SESSA) software and X-ray photoelectron spectroscopy (XPS) experimental measurements. XPS measurements of C16 COOH-SAMs on flat gold surfaces were made at nine different photoelectron emission angles (5-85° in 10° increments), corrected using geometric weighting factors and then summed together to approximate spherical AuNPs. The SAM thickness and relative surface roughness (RSA) in SESSA were optimized to determine the best agreement between simulated and experimental surface composition. On the basis of the glancing-angle results, it was found that inclusion of a hydrocarbon-contamination layer on top the C16 COOH-SAM was necessary to improve the agreement between the SESSA and XPS results. For the 16 COOH-SAMs on flat Au surfaces, using a SAM thickness of 1.1 Å/CH(2) group, an RSA of 1.05, and a 1.5 Å CH(2)-contamination overlayer (total film thickness = 21.5 Å) for the SESSA calculations provided the best agreement with the experimental XPS data. After applying the appropriate geometric corrections and summing the SESSA flat-surface compositions, the best fit results for the 16 COOH-SAM thickness and surface roughness on the AuNPs indicated a slightly thinner overlayer with parameters of 0.9 Å/CH(2) group in the SAM, an RSA of 1.06 RSA, and a 1.5 Å CH(2)-contamination overlayer (total film thickness = 18.5 Å). The 3 Å difference in SAM thickness between the flat Au and AuNP surfaces suggests that the alkyl chains of the SAM are slightly more tilted or disordered on the AuNP surfaces.

  12. Optical Properties of Gold Nanoclusters Functionalized with a Small Organic Compound: Modeling by an Integrated Quantum-Classical Approach.

    PubMed

    Li, Xin; Carravetta, Vincenzo; Li, Cui; Monti, Susanna; Rinkevicius, Zilvinas; Ågren, Hans

    2016-07-12

    Motivated by the growing importance of organometallic nanostructured materials and nanoparticles as microscopic devices for diagnostic and sensing applications, and by the recent considerable development in the simulation of such materials, we here choose a prototype system - para-nitroaniline (pNA) on gold nanoparticles - to demonstrate effective strategies for designing metal nanoparticles with organic conjugates from fundamental principles. We investigated the motion, adsorption mode, and physical chemistry properties of gold-pNA particles, increasing in size, through classical molecular dynamics (MD) simulations in connection with quantum chemistry (QC) calculations. We apply the quantum mechanics-capacitance molecular mechanics method [Z. Rinkevicius et al. J. Chem. Theory Comput. 2014, 10, 989] for calculations of the properties of the conjugate nanoparticles, where time dependent density functional theory is used for the QM part and a capacitance-polarizability parametrization of the MM part, where induced dipoles and charges by metallic charge transfer are considered. Dispersion and short-range repulsion forces are included as well. The scheme is applied to one- and two-photon absorption of gold-pNA clusters increasing in size toward the nanometer scale. Charge imaging of the surface introduces red-shifts both because of altered excitation energy dependence and variation of the relative intensity of the inherent states making up for the total band profile. For the smaller nanoparticles the difference in the crystal facets are important for the spectral outcome which is also influenced by the surrounding MM environment.

  13. Gold Rush!

    ERIC Educational Resources Information Center

    Brahier, Daniel J.

    1997-01-01

    Describes a mathematical investigation of gold--how it is weighed, stored, used, and valued. For grades 3-4, children estimate the value of treasure chests filled with gold coins and explore the size and weight of gold bars. Children in grades 5-6 explore how gold is mined and used, and how the value of gold changes over time. (PVD)

  14. A novel sensor for determination of naproxen based on change in localized surface plasmon peak of functionalized gold nanoparticles.

    PubMed

    Khodaveisi, Javad; Shabani, Ali Mohammad Haji; Dadfarnia, Shayessteh; Saberi, Dariush

    2017-02-08

    A highly selective and sensitive colorimetric sensor for the determination of naproxen (NAP) based on the aggregation of the thiolated β-cyclodextrin (Tβ-CD) functionalized gold nanoparticles (Tβ-CD-Au NPs) in the presence of NAP and Zn(2+)is described. The hydrophobic end of NAP interacts with the immobilized Tβ-CD on the Au NPs and forms the complex of Tβ-CD:NAP while the Zn(2+) ions form a 1:2 complex of (NAP)2Zn with the carboxyl groups of NAP resulting in the aggregation of functionalized gold nanoparticles. As a result of aggregation, the localized surface plasmon resonance (LSPR) band of functionalized gold nanoparticles around 520nm decreases and a new red shifted band at 650nm appears which increases gradually as the function of NAP concentration. The calibration graph derived from the intensity ratios of absorbance at 650nm to 520nm was linear in the concentration range of 4-180μgL(-1)of NAP. At the optimum conditions, the limit of detection (LOD) and quantification (LOQ) were found to be 0.6 and 2.1μgL(-1), respectively and the relative standard deviation at 20μgL(-1)of NAP (n=5) was 2.5%. The selectivity and applicability of the method was verified through analyzes of the synthetic samples containing the major interference compounds reported in literature as well as tablets, wastewater and urine samples. The accuracy of the method was evaluated by recovery experiments and analysis of pharmaceutical tablets.

  15. Phosphorylcholine functionalized dendrimers for the formation of highly stable and reactive gold nanoparticles and their glucose conjugation for biosensing

    NASA Astrophysics Data System (ADS)

    Jia, Lan; Lv, Li-Ping; Xu, Jian-Ping; Ji, Jian

    2011-09-01

    Phosphorylcholine (PC)-functionalized poly(amido amine) (PAMAM) dendrimers were prepared and used as both reducing and stabilizing agents for synthesis of highly stable and reactive gold nanoparticles (Au NPs). Biomimetic PC-functionalized PAMAM dendrimers-stabilized gold nanoparticles (Au DSNPs) were formed by simply mixing the PC modified amine-terminated fifth-generation PAMAM dendrimers (G5-PC) with AuCl4 - ions by controlling the pH, no additional reducing agents or other stabilizers were needed. The obtained Au DSNPs were shown to be spherical, with particle diameters ranging from 5 to 12 nm, the sizes and growth kinetics of Au DSNPs could be tuned by changing the pH and the initial molar ratio of dendrimers to gold as indicated by transmission electron microscopy (TEM) and UV-Vis data. The prepared Au DSNPs showed excellent stability including: (1) stable at wide pH (7-13) values; (2) stable at high salt concentrations up to 2 M NaCl; (3) non-specific protein adsorption resistance. More importantly, surface functionalization could be performed by introducing desired functional groups onto the remained reactive amine groups. This was exemplified by the glucose conjugation. The glucose conjugated Au DSNPs showed bio-specific interaction with Concanavalin A (Con A), which induced aggregation of the Au NPs. Colorimetric detection of Con A based on the plasmon resonance of the glucose conjugated Au DSNPs was realized. A limit of detection (LOD) for Con A was 0.6 μM, based on a signal-to-noise ratio (S/N) of 3. These findings demonstrated that the PC modified Au DSNPs could potentially serve as a versatile nano-platform for the biomedical applications.

  16. Simultaneous optimization of monolayer formation factors, including temperature, to significantly improve nucleic acid hybridization efficiency on gold substrates.

    PubMed

    Pris, Andrew D; Ostrowski, Sara G; Garaas, Sarah D

    2010-04-20

    Past literature investigations have optimized various single factors used in the formation of thiolated, single stranded DNA (ss-DNA) monolayers on gold. In this study a more comprehensive approach is taken, where a design of experiment (DOE) is employed to simultaneously optimize all of the factors involved in construction of the capture monolayer used in a fluorescence-based hybridization assay. Statistical analysis of the fluorescent intensities resulting from the DOE provides empirical evidence for the importance and the optimal levels of traditional and novel factors included in this investigation. We report on the statistical importance of a novel factor, temperature of the system during monolayer formation of the capture molecule and lateral spacer molecule, and how proper usage of this temperature factor increased the hybridization signal 50%. An initial theory of how the physical factor of heat is mechanistically supplementing the function of the lateral spacer molecule is provided.

  17. Gold-catalyzed oxidative ring expansion of 2-alkynyl-1,2-dihydropyridines or -quinolines: highly efficient synthesis of functionalized azepine or benzazepine scaffolds.

    PubMed

    Chen, Ming; Chen, Yifeng; Sun, Ning; Zhao, Jidong; Liu, Yuanhong; Li, Yuxue

    2015-01-19

    A gold-catalyzed highly regio- and chemoselective oxidative ring expansion of 2-alkynyl-1,2-dihydropyridines and its analogues using pyridine-N-oxide as the oxidant has been developed. Ring expansion proceeds through exclusive 1,2-migration of a vinyl or phenyl group, whereas no 1,2-H and 1,2-N migration take place. The reaction provides an efficient and attractive route to various types of medium-sized azepine derivatives in generally high to excellent yields with a broad functional group tolerance. DFT studies indicate that the reaction proceeds through the formation of a cyclopropyl gold intermediate, and no gold carbene species is involved.

  18. Geophysical delineation of acidity and salinity in the Central Manitoba gold mine tailings pile, Manitoba, Canada

    NASA Astrophysics Data System (ADS)

    Tycholiz, C.; Ferguson, I. J.; Sherriff, B. L.; Cordeiro, M.; Sri Ranjan, R.; Pérez-Flores, M. A.

    2016-08-01

    Surface electrical and electromagnetic geophysical methods can map enhanced electrical conductivity caused by acid mine drainage in mine tailings piles. In this case study, we investigate quantitative relationships between geophysical responses and the electrical conductivity, acidity and salinity of tailing samples at the Central Manitoba Mine tailings in Manitoba, Canada. Previous electromagnetic surveys at the site identified zones of enhanced conductivity that were hypothesized to be caused by acid mine drainage. In the present study, high-resolution EM31 and DC-resistivity measurements were made on a profile through a zone of enhanced conductivity and laboratory measurements of salinity and pH were made on saturation paste extracts from an array of tailing samples collected from the upper 2 m of tailings along the profile. Observed spatial correlation of pH and pore-fluid salinity in the tailings samples confirms that the enhanced conductivity in the Central Manitoba Mine tailings is due to acid mine drainage. Contoured cross-sections of the data indicate that the acid mine drainage is concentrated near the base of the oxidized zone in the thicker parts of the tailings pile. The zone of increased acidity extends to the surface on sloping margins causing an increase in apparent conductivity in shallow penetrating geophysical responses. The quantitative relationship between measured pH and salinity shows that the conductivity increase associated with the acid mine drainage is due only in part to conduction by ions produced from dissociation of sulfuric acid. Comparison of the observations with fluid conductivity estimates based on statistical relationships of pH and ion concentrations in water samples from across the tailings pile shows that Ca2 + and Mg2 + ions also make significant contributions to the conductivity at all values of pH and Cu2 +, Al3 + and Fe3 + ions make additional contributions at low pH. Variability in the measured conductivity at constant

  19. Epithermal and plutonic gold mineralizations related to paleoproterozoic acid magmatism in the Tapajós Gold province, Amazonian craton, Brazil

    NASA Astrophysics Data System (ADS)

    Juliani, C.; Corrêa-Silva, R. H.; Monteiro, L. V.; Bettencourt, J. S.; dall Agnol, R.

    2003-04-01

    The Tapajós Gold Province (TGP) is part of the Tapajós-Parima geologic province, that includes ˜2.1 Ga volcano-sedimentary sequences (Jacareacanga Group) and the magmatic arcs of the Cuiú-Cuiú Complex (˜2.01 Ga), Creporizäo Intrusive Suite (1.97-1.95 Ga), Rio das Tropas Tonalite (˜1.90 Ga) and Parauari Intrusive Suite (˜1.88 Ga). Andesitic to rhyolitic volcanic and volcaniclastic rocks of the Iriri Group (1.88 Ga) overlie plutonic rocks and are cut by anorogenic Maloquinha Intrusive Suite (˜1.87 Ga). Paleoproterozoic fluvial to marine sequences (Buiuçú Formation), and several mafic intrusion events are also identified in the TGP. Paleoproterozoic gold mineralizations in the TGP are mainly classified as mesothermal orogenic lodes, intrusion-related gold systems, and epithermal and mesothermal lodes in shear zones. Recently, it was discovered a 1.869 Ga epithermal high-sulfidation (quartz-alunite) and low-sulfidation (adularia-sericite) gold and base metal mineralizations hosted in calc-alkaline volcanic and volcaniclastic rocks of the Iriri Group. In the high-sulfidation mineralization, hydrothermal breccias are strongly affected by high-temperature advanced argillic alteration, with alunite, natroalunite, woodhouseiite-svanbergite, andalusite, diaspore and enargite, besides argillic and propylitic hydrothermal alterations. Over the hydrothermal breccia pipe occurs a hematite-rich silica cap and in the deeper zones sericitic alteration is also present. The epithermal high- and low-sulfidation mineralizations are geneticaly linked to stocks of hydrothermalized granophyry, and rhyolitic and rhyodacitic porphyry dikes and are hosted by late ring composite volcanoes, related to evolution of nested ash-flow caldera complexes. The caldera genesis is atributed to emplacement of shalow late- to post-tectonic calc-alkaline batholits of the Parauari Intrusive Suite in back-arc rifts. The mesozonal relatively reduced Batalha Granite hosts gold mineralizations and

  20. The role of relativity in the optical response of gold within the time-dependent current-density-functional theory.

    PubMed

    Romaniello, P; de Boeij, P L

    2005-04-22

    We included relativistic effects in the formulation of the time-dependent current-density-functional theory for the calculation of linear response properties of metals [P. Romaniello and P. L. de Boeij, Phys. Rev. B (to be published)]. We treat the dominant scalar-relativistic effects using the zeroth-order regular approximation in the ground-state density-functional theory calculations, as well as in the time-dependent response calculations. The results for the dielectric function of gold calculated in the spectral range of 0-10 eV are compared with experimental data reported in literature and recent ellipsometric measurements. As well known, relativistic effects strongly influence the color of gold. We find that the onset of interband transitions is shifted from around 3.5 eV, obtained in a nonrelativistic calculation, to around 1.9 eV when relativity is included. With the inclusion of the scalar-relativistic effects there is an overall improvement of both real and imaginary parts of the dielectric function over the nonrelativistic ones. Nevertheless some important features in the absorption spectrum are not well reproduced, but can be explained in terms of spin-orbit coupling effects. The remaining deviations are attributed to the underestimation of the interband gap (5d-6sp band gap) in the local-density approximation and to the use of the adiabatic local-density approximation in the response calculation.

  1. Gold-Coated Fe3O4 Nanoroses with Five Unique Functions for Cancer Cell Targeting, Imaging and Therapy.

    PubMed

    Li, Chunmei; Chen, Tao; Ocsoy, Ismail; Zhu, Guizhi; Yasun, Emir; You, Mingxu; Wu, Cuichen; Zheng, Jing; Song, Erqun; Huang, Cheng Zhi; Tan, Weihong

    2014-03-26

    The development of nanomaterials that combine diagnostic and therapeutic functions within a single nanoplatform is extremely important for molecular medicine. Molecular imaging with simultaneous diagnosis and therapy will provide the multimodality needed for accurate diagnosis and targeted therapy. Here, we demonstrate gold-coated iron oxide (Fe3O4@Au) nanoroses with five distinct functions, which integrate aptamer-based targeting, magnetic resonance imaging (MRI), optical imaging, photothermal therapy and chemotherapy into one single probe. The inner Fe3O4 core functions as an MRI agent, while the photothermal effect is achieved through near-infrared absorption by the gold shell, causing a rapid rise in temperature and also resulting in a facilitated release of the anticancer drug doxorubicin carried by the nanoroses. Where the doxorubicin is released is monitored by its fluorescent. Aptamers immobilized on the surfaces of the nanoroses enable efficient and selective drug delivery, imaging and photothermal effect with high specificity. The five-function-embedded nanoroses show great advantages in multimodality.

  2. Gold and Hairpin DNA Functionalization of Upconversion Nanocrystals for Imaging and In Vivo Drug Delivery.

    PubMed

    Han, Sanyang; Samanta, Animesh; Xie, Xiaoji; Huang, Ling; Peng, Juanjuan; Park, Sung Jin; Teh, Daniel Boon Loong; Choi, Yongdoo; Chang, Young-Tae; All, Angelo Homayoun; Yang, Yanmei; Xing, Bengang; Liu, Xiaogang

    2017-03-10

    Although multifunctional upconversion imaging probes have recently attracted considerable interest in biomedical research, there are currently few methods for stabilizing these luminescent nanoprobes with oligonucleotides in biological systems. Herein, a method to robustly disperse upconversion nanoprobes in physiological buffers based on rational design and synthesis of nanoconjugates comprising hairpin-DNA-modified gold nanoparticles is presented. This approach imparts the upconversion nanoprobes with excellent biocompatibility and circumvents the problem of particle agglomeration. By combining single-band anti-Stokes near-infrared emission and the photothermal effect mediated by the coupling of gold to upconversion nanoparticles, a simple, versatile nanoparticulate system for simultaneous deep-tissue imaging and drug molecule release in vivo is demonstrated.

  3. Ursodeoxycholic acid attenuates colonic epithelial secretory function

    PubMed Central

    Kelly, Orlaith B; Mroz, Magdalena S; Ward, Joseph B J; Colliva, Carolina; Scharl, Michael; Pellicciari, Roberto; Gilmer, John F; Fallon, Padraic G; Hofmann, Alan F; Roda, Aldo; Murray, Frank E; Keely, Stephen J

    2013-01-01

    Dihydroxy bile acids, such as chenodeoxycholic acid (CDCA), are well known to promote colonic fluid and electrolyte secretion, thereby causing diarrhoea associated with bile acid malabsorption. However, CDCA is rapidly metabolised by colonic bacteria to ursodeoxycholic acid (UDCA), the effects of which on epithelial transport are poorly characterised. Here, we investigated the role of UDCA in the regulation of colonic epithelial secretion. Cl− secretion was measured across voltage-clamped monolayers of T84 cells and muscle-stripped sections of mouse or human colon. Cell surface biotinylation was used to assess abundance/surface expression of transport proteins. Acute (15 min) treatment of T84 cells with bilateral UDCA attenuated Cl− secretory responses to the Ca2+ and cAMP-dependent secretagogues carbachol (CCh) and forskolin (FSK) to 14.0 ± 3.8 and 40.2 ± 7.4% of controls, respectively (n= 18, P < 0.001). Investigation of the molecular targets involved revealed that UDCA acts by inhibiting Na+/K+-ATPase activity and basolateral K+ channel currents, without altering their cell surface expression. In contrast, intraperitoneal administration of UDCA (25 mg kg−1) to mice enhanced agonist-induced colonic secretory responses, an effect we hypothesised to be due to bacterial metabolism of UDCA to lithocholic acid (LCA). Accordingly, LCA (50–200 μm) enhanced agonist-induced secretory responses in vitro and a metabolically stable UDCA analogue, 6α-methyl-UDCA, exerted anti-secretory actions in vitro and in vivo. In conclusion, UDCA exerts direct anti-secretory actions on colonic epithelial cells and metabolically stable derivatives of the bile acid may offer a new approach for treating intestinal diseases associated with diarrhoea. PMID:23507881

  4. Staining-free gel electrophoresis-based multiplex enzyme assay using DNA and peptide dual-functionalized gold nanoparticles.

    PubMed

    Zhao, Wenting; Yao, Chunlei; Luo, Xiaoteng; Lin, Li; Hsing, I-Ming

    2012-04-01

    We report a simple staining-free gel electrophoresis method to simultaneously probe protease and nuclease. Utilizing gold nanoparticles (Au-NPs) dual-functionalized with DNA and peptide, the presence and concentration of nuclease and protease are determined concurrently from the relative position and intensity of the bands in the staining-free gel electrophoresis. The use of Au-NPs eliminates the need for staining processes and enables naked eye detection, while a mononucleotide-mediated approach facilitates the synthesis of DNA/peptide conjugated Au-NPs and simplifies the operation procedures. Multiplex detection and quantification of DNase I and trypsin are successfully demonstrated.

  5. Gold Nanoparticles Cytotoxicity

    NASA Astrophysics Data System (ADS)

    Mironava, Tatsiana

    Over the last two decades gold nanoparticles (AuNPs) have been used for many scientific applications and have attracted attention due to the specific chemical, electronic and optical size dependent properties that make them very promising agents in many fields such as medicine, imagine techniques and electronics. More specifically, biocompatible gold nanoparticles have a huge potential for use as the contrast augmentation agent in X-ray Computed Tomography and Photo Acoustic Tomography for early tumor diagnostic as well these nanoparticles are extensively researched for enhancing the targeted cancer treatment effectiveness such as photo-thermal and radiotherapy. In most biomedical applications biocompatible gold nanoparticles are labeled with specific tumor or other pathology targeting antibodies and used for site specific drug delivery. However, even though gold nanoparticles poses very high level of anti cancer properties, the question of their cytotoxicity ones they are released in normal tissue has to be researched. Moreover, the huge amount of industrially produced gold nanoparticles raises the question of these particles being a health hazard, since the penetration is fairly easy for the "nano" size substances. This study focuses on the effect of AuNPs on a human skin tissue, since it is fall in both categories -- the side effects for biomedical applications and industrial workers and users' exposure during production and handling. Therefore, in the present project, gold nanoparticles stabilized with the biocompatible agent citric acid were generated and characterized by Transmission Electron Microscopy (TEM) and Scanning Electron Microscopy (SEM). The cytotoxic effect of AuNPs release to healthy skin tissue was modeled on 3 different cell types: human keratinocytes, human dermal fibroblasts, and human adipose derived stromal (ADS) cells. The AuNPs localization inside the cell was found to be cell type dependent. Overall cytotoxicity was found to be dependent

  6. Enzyme-functionalized gold-coated magnetite nanoparticles as novel hybrid nanomaterials: synthesis, purification and control of enzyme function by low-frequency magnetic field.

    PubMed

    Majouga, Alexander; Sokolsky-Papkov, Marina; Kuznetsov, Artem; Lebedev, Dmitry; Efremova, Maria; Beloglazkina, Elena; Rudakovskaya, Polina; Veselov, Maxim; Zyk, Nikolay; Golovin, Yuri; Klyachko, Natalia; Kabanov, Alexander

    2015-01-01

    The possibility of remotely inducing a defined effect on NPs by means of electromagnetic radiation appears attractive. From a practical point of view, this effect opens horizons for remote control of drug release systems, as well as modulation of biochemical functions in cells. Gold-coated magnetite nanoparticles are perfect candidates for such application. Herein, we have successfully synthesized core-shell NPs having magnetite cores and gold shells modified with various sulphur containing ligands and developed a new, simple and robust procedure for the purification of the resulting nanoparticles. The carboxylic groups displayed at the surface of the NPs were utilized for NP conjugation with a model enzyme (ChT). In the present study, we report the effect of the low-frequency AC magnetic field on the catalytic activity of the immobilized ChT. We show that the enzyme activity decreases upon exposure of the NPs to the field.

  7. A one-pot gold seed-assisted synthesis of gold/platinum wire nanoassemblies and their enhanced electrocatalytic activity for the oxidation of oxalic acid

    NASA Astrophysics Data System (ADS)

    Bai, Juan; Fang, Chun-Long; Liu, Zong-Huai; Chen, Yu

    2016-01-01

    Three-dimensional (3D) noble metal nanoassemblies composed of one-dimensional (1D) nanowires have been attracting much interest due to the unique physical and chemical properties of 1D nanowires as well as the particular interconnected open-pore structure of 3D nanoassemblies. In this work, well-defined Au/Pt wire nanoassemblies were synthesized by using a facile NaBH4 reduction method in the presence of a branched form of polyethyleneimine (PEI). A study of the growth mechanism indicated the morphology of the final product to be highly related to the molecular structure of the polymeric amine. Also, the preferred Pt-on-Pt deposition contributed to the formation of the 1D Pt nanowires. The Au/Pt wire nanoassemblies were functionalized with PEI at the same time that these nanoassemblies were synthesized due to the strong N-Pt bond. The chemically functionalized Au/Pt wire nanoassemblies exhibited better electrocatalytic activity for the electro-oxidation of oxalic acid than did commercial Pt black.Three-dimensional (3D) noble metal nanoassemblies composed of one-dimensional (1D) nanowires have been attracting much interest due to the unique physical and chemical properties of 1D nanowires as well as the particular interconnected open-pore structure of 3D nanoassemblies. In this work, well-defined Au/Pt wire nanoassemblies were synthesized by using a facile NaBH4 reduction method in the presence of a branched form of polyethyleneimine (PEI). A study of the growth mechanism indicated the morphology of the final product to be highly related to the molecular structure of the polymeric amine. Also, the preferred Pt-on-Pt deposition contributed to the formation of the 1D Pt nanowires. The Au/Pt wire nanoassemblies were functionalized with PEI at the same time that these nanoassemblies were synthesized due to the strong N-Pt bond. The chemically functionalized Au/Pt wire nanoassemblies exhibited better electrocatalytic activity for the electro-oxidation of oxalic acid than

  8. Electrocatalytic oxidation of phytohormone salicylic acid at copper nanoparticles-modified gold electrode and its detection in oilseed rape infected with fungal pathogen Sclerotinia sclerotiorum.

    PubMed

    Wang, Zhan; Wei, Fang; Liu, Sheng-Yi; Xu, Qiao; Huang, Jun-Yan; Dong, Xu-Yan; Yu, Jiu-Hong; Yang, Qin; Zhao, Yuan-Di; Chen, Hong

    2010-01-15

    Salicylic acid (SA) is a biological substance that acts as a phytohormone and plays an important role in signal transduction in plants. It is important to accurately and sensitively detect SA levels. A gold electrode modified with copper nanoparticles was used to assay the electrocatalytic oxidation of salicylic acid. It was found that the electrochemical behavior of salicylic acid was greatly improved at copper nanoparticles, indicating that anodic oxidation could be catalyzed at copper nanoparticles. And the pH had remarkable effect on the electrochemical process, a very well-defined oxidation peak appeared at pH 13.3 (0.2M NaOH). The kinetics parameters of this process were calculated and the heterogeneous electron transfer rate constant (k) was determined to be 1.34x10(-3)cms(-1), and (1-alpha)n(alpha) was 1.22. The gold electrode modified with copper nanoparticles could detect SA at a higher sensitivity than common electrodes. The electrode was used to detect the SA levels in oilseed rape infected with the fungal pathogen Sclerotinia sclerotiorum. The results showed that the SA concentration reached a maximum during the 10th-25th hours after infection. This result was very similar to that determined by HPLC, indicating that the gold electrodes modified with copper nanoparticles could be used as salicylic acid sensors.

  9. Functionalized gold nanorod-based labels for amplified electrochemical immunoassay of E. coli as indicator bacteria relevant to the quality of dairy product.

    PubMed

    Zhang, Xinai; Zhang, Fan; Zhang, Hongyin; Shen, Jianzhong; Han, En; Dong, Xiaoya

    2015-01-01

    In this paper, we report an amplified electrochemical immunoassay for Escherichia coli as indicator bacteria relevant to the quality of dairy product using the functionalized gold nanorod-based labels ({dAb-AuNR-FCA}). The {dAb-AuNR-FCA} labels were designed by exploiting silica-functionalized gold nanorods (AuNR@SiO2) as the carriers for immobilization of detection antibody (dAb) and ferrocenecarboxylic acid (FCA), in which dAb was used for recognition of E. coli and FCA tags served as signal-generating molecule. Greatly amplified signal was achieved in the sandwich-type immunoassay when enormous FCA linked to AuNR@SiO2. Compared with the commercially available {dAb-FCA}, the {dAb-AuNR-FCA} labels exhibited a better performance for E. coli assay due to the advantages of AuNR@SiO2 as carriers. Under optimal experimental conditions, it showed a linear relationship between the peak current of FCA and the logarithmic value of E. coli concentration ranging from 1.0×10(2) to 5.0×10(4) cfu mL(-1) with a detection limit of 60 cfu mL(-1) (S/N=3), and the electrochemical detection of E. coli could be achieved in 3h. Moreover, the proposed strategy was used to determine E. coli in dairy product (pure fresh milk, yogurt in shelf-life, and expired yogurt), and the recoveries of standard additions were in the range of 95.1-106%. This proposed strategy exhibited rapid response, high sensitivity and specificity for E. coli assay in dairy product, and could become a promising technique to estimate the quality of dairy product.

  10. Optimization of modified carbon paste electrode with multiwalled carbon nanotube/ionic liquid/cauliflower-like gold nanostructures for simultaneous determination of ascorbic acid, dopamine and uric acid.

    PubMed

    Afraz, Ahmadreza; Rafati, Amir Abbas; Najafi, Mojgan

    2014-11-01

    We describe the modification of a carbon paste electrode (CPE) with multiwalled carbon nanotubes (MWCNTs) and an ionic liquid (IL). Electrochemical studies by using a D-optimal mixture design in Design-Expert software revealed an optimized composition of 60% graphite, 14.2% paraffin, 10.8% MWCNT and 15% IL. The optimal modified CPE shows good electrochemical properties that are well matched with model prediction parameters. In the next step, the optimized CPE was modified with gold nanostructures by applying a double-pulse electrochemical technique. The resulting electrode was characterized by scanning electron microscopy, energy dispersive X-ray spectroscopy, X-ray diffraction, and electrochemical impedance spectroscopy. It gives three sharp and well-separated oxidation peaks for ascorbic acid (AA), dopamine (DA), and uric acid (UA). The sensor enables simultaneous determination of AA, DA and UA with linear responses from 0.3 to 285, 0.08 to 200, and 0.1 to 450 μM, respectively, and with 120, 30 and 30 nM detection limits (at an S/N of 3). The method was successfully applied to the determination of AA, DA, and UA in spiked samples of human serum and urine.

  11. Gold(i)-catalyzed addition of carboxylic acids to internal alkynes in aqueous medium.

    PubMed

    González-Liste, Pedro J; García-Garrido, Sergio E; Cadierno, Victorio

    2017-02-21

    We report herein the efficient hydro-oxycarbonylation of symmetrical and unsymmetrical internal alkynes with carboxylic acids in water at 60 °C, employing the catalytic system [AuCl(PPh3)]/AgOAc (5 mol%). This simple and eco-friendly protocol allows for the synthesis of a wide variety of trisubstituted enol esters (37 examples) in high yields and with complete Z-stereoselectivity. The use of microwave irradiation as an alternative energy source has also been evaluated.

  12. Label-free detection of kanamycin based on the aptamer-functionalized conducting polymer/gold nanocomposite.

    PubMed

    Zhu, Ye; Chandra, Pranjal; Song, Kyung-Mi; Ban, Changill; Shim, Yoon-Bo

    2012-01-01

    Highly sensitive label-free detection of kanamycin is achieved with an aptamer sensor based on a conducting polymer/gold self-assembled nanocomposite. The sensor probe is fabricated by covalently immobilizing an in vitro selected DNA aptamer for kanamycin onto gold nanoparticle (AuNP)-comprised conducting polymer, poly-[2, 5-di-(2-thienyl)-1H-pyrrole-1-(p-benzoic acid)] (poly-DPB). The self-assembling of DPB on AuNP is investigated by TEM and UV-vis spectroscopy and the modification of the aptamer sensor is characterized using XPS and electrochemical impedance spectroscopy. The probe is applied to detect kanamycin by using voltammetric techniques. The sensor shows a pair of redox peaks around 0.26/ 0.08 V (vs. Ag/AgCl) for kanamycin captured by the aptamer-immobilized probe. The parameters that can affect the response, such as aptamer concentration, incubation time, temperature, and pH are optimized. The calibration plot shows a linear range from 0.05 μM to 9.0 μM kanamycin with a detection limit of 9.4±0.4 nM. The proposed aptamer sensor is examined with a real sample.

  13. A one-pot gold seed-assisted synthesis of gold/platinum wire nanoassemblies and their enhanced electrocatalytic activity for the oxidation of oxalic acid.

    PubMed

    Bai, Juan; Fang, Chun-Long; Liu, Zong-Huai; Chen, Yu

    2016-02-07

    Three-dimensional (3D) noble metal nanoassemblies composed of one-dimensional (1D) nanowires have been attracting much interest due to the unique physical and chemical properties of 1D nanowires as well as the particular interconnected open-pore structure of 3D nanoassemblies. In this work, well-defined Au/Pt wire nanoassemblies were synthesized by using a facile NaBH4 reduction method in the presence of a branched form of polyethyleneimine (PEI). A study of the growth mechanism indicated the morphology of the final product to be highly related to the molecular structure of the polymeric amine. Also, the preferred Pt-on-Pt deposition contributed to the formation of the 1D Pt nanowires. The Au/Pt wire nanoassemblies were functionalized with PEI at the same time that these nanoassemblies were synthesized due to the strong N-Pt bond. The chemically functionalized Au/Pt wire nanoassemblies exhibited better electrocatalytic activity for the electro-oxidation of oxalic acid than did commercial Pt black.

  14. Detection of the nanomolar level of total Cr[(iii) and (vi)] by functionalized gold nanoparticles and a smartphone with the assistance of theoretical calculation models

    NASA Astrophysics Data System (ADS)

    Chen, Wenwen; Cao, Fengjing; Zheng, Wenshu; Tian, Yue; Xianyu, Yunlei; Xu, Peng; Zhang, Wei; Wang, Zhuo; Deng, Ke; Jiang, Xingyu

    2015-01-01

    We report a method for rapid, effective detection of both Cr(iii) and Cr(vi) (in the form of Cr3+ and Cr2O72-, the main species of chromium in the natural environment) by making use of meso-2,3-dimercaptosuccinic acid (DMSA)-functionalized gold nanoparticles (Au NPs). The limit of detection (LOD) is 10 nM with the naked eye and the assay can be applied in detecting chromium in polluted soil from Yun-Nan Province in Southwest China. We use density functional theory to calculate the change of the Gibbs free energy (ΔG) of the interactions between the DMSA-Au NP system and various metal ions, which shows that DMSA-Au NPs have high specificity for both Cr3+ and Cr2O72-.We report a method for rapid, effective detection of both Cr(iii) and Cr(vi) (in the form of Cr3+ and Cr2O72-, the main species of chromium in the natural environment) by making use of meso-2,3-dimercaptosuccinic acid (DMSA)-functionalized gold nanoparticles (Au NPs). The limit of detection (LOD) is 10 nM with the naked eye and the assay can be applied in detecting chromium in polluted soil from Yun-Nan Province in Southwest China. We use density functional theory to calculate the change of the Gibbs free energy (ΔG) of the interactions between the DMSA-Au NP system and various metal ions, which shows that DMSA-Au NPs have high specificity for both Cr3+ and Cr2O72-. Electronic supplementary information (ESI) available: ΔG of the interactions between the DMSA-AuNPs and various metal ions, models of the metal ions (Mn+) and six water molecules, DLS results for DMSA-Au NPs before and after adding Cr3+, Cr2O72-, Cr3+ and Cr2O72- mixtures, comparison of the performance of different sensors. See DOI: 10.1039/c4nr06726f

  15. Fabrication of layer-by-layer modified multilayer films containing choline and gold nanoparticles and its sensing application for electrochemical determination of dopamine and uric acid.

    PubMed

    Wang, Po; Li, Yongxin; Huang, Xue; Wang, Lun

    2007-09-30

    A novel electrochemical sensor has been constructed by use of a glassy carbon electrode (GCE) coated with a gold nanoparticle/choline (GNP/Ch). Electrochemical impedance spectroscopy (EIS), field emission scanning electron microscope (SEM) and X-ray photoelectron spectroscopy (XPS) were used to characterize the properties of this modified electrode. It was demonstrated that choline was covalently bounded on the surface of glassy carbon electrode, and deposited gold nanoparticles with average size of about 100nm uniformly distributed on the surface of Ch. Moreover, the modified electrode exhibits strong electrochemical catalytic activity toward the oxidation of dopamine (DA), ascorbic acid (AA) and uric acid (UA) with obviously reduction of overpotentials. For the ternary mixture containing DA, AA and UA, these three compounds can be well separated from each other, allowing simultaneously determination of DA and UA under coexistence of AA. The proposed method can be applied to detect DA and UA in real samples with satisfactory results.

  16. Hybride magnetic nanostructure based on amino acids functionalized polypyrrole

    NASA Astrophysics Data System (ADS)

    Nan, Alexandrina; Bunge, Alexander; Turcu, Rodica

    2015-12-01

    Conducting polypyrrole is especially promising for many commercial applications because of its unique optical, electric, thermal and mechanical properties. We report the synthesis and characterization of novel pyrrole functionalized monomers and core-shell hybrid nanostructures, consisting of a conjugated polymer layer (amino acids functionalized pyrrole copolymers) and a magnetic nanoparticle core. For functionalization of the pyrrole monomer we used several amino acids: tryptophan, leucine, phenylalanine, serine and tyrosine. These amino acids were linked via different types of hydrophobic linkers to the nitrogen atom of the pyrrole monomer. The magnetic core-shell hybrid nanostructures are characterized by various methods such as FTIR spectroscopy, transmission electron microscopy (TEM) and magnetic measurements.

  17. Hybride magnetic nanostructure based on amino acids functionalized polypyrrole

    SciTech Connect

    Nan, Alexandrina Bunge, Alexander; Turcu, Rodica

    2015-12-23

    Conducting polypyrrole is especially promising for many commercial applications because of its unique optical, electric, thermal and mechanical properties. We report the synthesis and characterization of novel pyrrole functionalized monomers and core-shell hybrid nanostructures, consisting of a conjugated polymer layer (amino acids functionalized pyrrole copolymers) and a magnetic nanoparticle core. For functionalization of the pyrrole monomer we used several amino acids: tryptophan, leucine, phenylalanine, serine and tyrosine. These amino acids were linked via different types of hydrophobic linkers to the nitrogen atom of the pyrrole monomer. The magnetic core-shell hybrid nanostructures are characterized by various methods such as FTIR spectroscopy, transmission electron microscopy (TEM) and magnetic measurements.

  18. Oxidation and sensing of ascorbic acid and dopamine on self-assembled gold nanoparticles incorporated within polyaniline film

    NASA Astrophysics Data System (ADS)

    Chu, Wenya; Zhou, Qun; Li, Shuangshuang; Zhao, Wei; Li, Na; Zheng, Junwei

    2015-10-01

    Electrochemical biosensors based on conducting polymers incorporated with metallic nanoparticles can greatly enhance sensitivity and selectivity. Herein, we report a facile fabrication approach for polyaniline (PAN) incorporated with a gold nanoparticle (AuNP) composite electrode by electrodeposition of PAN on a self-assembled AuNP layer on the surface of an indium tin oxide electrode. The resulting AuNP/PAN composite electrode exhibits a remarkable synergistic effect on the electrocatalytic oxidation of ascorbic acid (AA) and dopamine (DA). It is demonstrated that the oxidation reaction of AA mainly occurs at AuNPs inside the PAN film as the ascorbate anions are doped into the polymer during the oxidation of the PAN film. Conversely, the oxidation of positively charged DA may only take place at the PAN/solution interface. The different mechanisms of the electrode reactions result in the oxidation of AA and DA occurring at different potentials. As a result, the AuNP/PAN composite electrode can be employed to simultaneously detect AA and DA with a good linear range, high sensitivity, and low detection limit.

  19. Detection of 3-phenoxybenzoic acid in river water with a colloidal gold-based lateral flow immunoassay.

    PubMed

    Liu, Yuan; Wu, Aihua; Hu, Jing; Lin, Manman; Wen, Mengtang; Zhang, Xiao; Xu, Chongxin; Hu, Xiaodan; Zhong, Jianfeng; Jiao, Lingxia; Xie, Yajing; Zhang, Cunzhen; Yu, Xiangyang; Liang, Ying; Liu, Xianjin

    2015-08-15

    3-Phenoxybenzoic acid (3-PBA) is a general metabolite of synthetic pyrethroids. It could be used as a generic biomarker for multiple pyrethroids exposure for human or pyrethroid residues in the environment. In this study, monoclonal antibodies (mAbs) against 3-PBA were developed by using PBA-bovine serum albumin (BSA) as an immunogen. In the competitive enzyme-linked immunosorbent assay (ELISA) format, the I50 and I10 values of purified mAbs were 0.63 and 0.13 μg/ml, respectively, with a dynamic range between 0.19 and 2.04 μg/ml. Then, the colloidal gold (CG)-based lateral flow immunoassay was established based on the mAbs. The working concentration of coating antigen and CG-labeled antibodies and the blocking effects were investigated to get optimal assay performance. The cutoff value for the assay was 1 μg/ml 3-PBA, and the detection time was within 10 min. A total of 40 river water samples were spiked with 3-PBA at different levels and determined by the lateral flow immunoassay without any sample pretreatments. The negative false rate was 2.5%, and no positive false results were observed at these levels. This lateral flow immunoassay has the potential to be an on-site screening method for monitoring 3-PBA or pyrethroid residues in environmental samples.

  20. Sensitive detection of clozapine using a gold electrode modified with 16-mercaptohexadecanoic acid self-assembled monolayer.

    PubMed

    Huang, Fei; Qu, Song; Zhang, Song; Liu, Baohong; Kong, Jilie

    2007-04-30

    Clozapine, an effective antipsychotic drug, was found generating a pair of redox peaks at about 0.33-0.4V (versus SCE) at 16-mercaptohexadecanoic acid (i.e. MHA) self-assembled monolayer (SAM) modified gold electrode (i.e. MHA/Au) in 0.05molL(-1) Tris-HCl (pH 8.1) buffer solution. Sensitive and quantitative measurement of clozapine based on anodic peak was established under optimum conditions. The anodic peak current was linear to clozapine concentration in the range from 1x10(-6) to 5x10(-5)molL(-1) with the detection limit of 7x10(-9)molL(-1). This method was successfully applied to the detection of clozapine in drug tablets and proved to be reliable compared with ultraviolet spectrophotometry (UV). The MHA SAM was characterized by Fourier transform infrared spectroscopy (FT-IR), X-ray photoelectron spectroscopy (XPS), contact angle goniometry, electrochemical impedance spectroscopy (EIS) and electrochemical probe.

  1. Quartz crystal microbalance study of bovine serum albumin adsorption onto self-assembled monolayer-functionalized gold with subsequent ligand binding.

    PubMed

    Thourson, Scott B; Marsh, Caitlin A; Doyle, Brian J; Timpe, Shannon J

    2013-11-01

    Adsorption characteristics of the model protein bovine serum albumin (BSA) onto gold surfaces were examined using a 5 MHz quartz crystal microbalance. Protein immobilization was executed in the presence and absence of a homogenous self-assembled monolayer (SAM) of NHS-terminated alkanethiols. BSA concentrations in the range of 3.2 × 10(-6) to 1.0 × 10(-3)mol/L were found to saturate both SAM-functionalized and non-functionalized surfaces with similar densities of 450 ± 26 ng/cm(2). The lack of functionalization dependence is attributed to the large protein size relative to the density of available binding sites in either surface condition. The BSA ligand 8-anilino-1-naphthalenesulfonic acid (ANS) was subsequently introduced to the immobilized BSA to determine any effects of the protein immobilization conditions on ligand binding. The rate of ANS binding to BSA was found to increase with increasing BSA concentration used in the immobilization step. This suggests that protein concentration affects morphology and ligand binding affinity without significantly altering adsorption quantity.

  2. Formation of substrate-based gold nanocage chains through dealloying with nitric acid

    PubMed Central

    Yan, Ziren; Wu, Ying

    2015-01-01

    Summary Metal nanocages have raised great interest because of their new properties and wide applications. Here, we report on the use of galvanic replacement reactions to synthesize substrate-supported Ag–Au nanocages from silver templates electrodeposited on transparent indium tin oxide (ITO) film coated glass. The residual Ag in the composition was dealloyed with 10% nitric acid. It was found that chains of Au nanocages were formed on the substrate surface during dealloying. When the concentration of HNO3 increased to 20%, the structures of nanocages were damaged and formed crescent or semi-circular shapes. The transfer process on the substrate surface was discussed. PMID:26199839

  3. Folic acid-conjugated silica capped gold nanoclusters for targeted fluorescence/X-ray computed tomography imaging

    PubMed Central

    2013-01-01

    Background Gastric cancer is 2th most common cancer in China, and is still the second most common cause of cancer-related death in the world. Successful development of safe and effective nanoprobes for in vivo gastric cancer targeting imaging is a big challenge. This study is aimed to develop folic acid (FA)-conjugated silica coated gold nanoclusters (AuNCs) for targeted dual-modal fluorescent and X-ray computed tomography imaging (CT) of in vivo gastric cancer cells. Method AuNCs were prepared, silica was coated on the surface of AuNCs, then folic acid was covalently anchored on the surface of AuNCs, resultant FA-conjugated AuNCs@SiO2 nanoprobes were investigated their cytotoxicity by MTT method, and their targeted ability to FR(+) MGC803 cells and FR(−) GES-1 cells. Nude mice model loaded with MGC803 cells were prepared, prepared nanoprobes were injected into nude mice via tail vein, and then were imaged by fluorescent and X-ray computed tomography (CT) imaging. Results FA-conjugated AuNCs@SiO2 nanoprobes exhibited good biocompatibility, and could target actively the FR(+) MGC-803 cells and in vivo gastric cancer tissues with 5 mm in diameter in nude mice models, exhibited excellent red emitting fluorescence imaging and CT imaging. Conclusion The high-performance FA-conjugated AuNCs@SiO2 nanoprobes can target in vivo gastric cancer cells, can be used for fluorescent and CT dual-mode imaging, and may own great potential in applications such as targeted dual-mode imaging of in vivo early gastric cancer and other tumors with FR positive expression in near future. PMID:23718865

  4. Potential driven deposition of poly(diallyldimethylammonium chloride) onto the surface of 3-mercaptopropionic acid monolayers assembled on gold.

    PubMed

    Sanders, Wesley; Anderson, Mark R

    2008-11-18

    Electrochemical impedance spectroscopy (EIS) and quartz crystal microbalance (QCM) measurements are used to examine the ability of applied potential to drive the ionic self-assembly of poly(diallyldimethylammonium) chloride (PDDA) onto a substrate modified with a monolayer of 3-mercaptopropionic acid (3-MPA). The potential of zero charge (PZC) of the gold electrode modified with a monolayer of 3-MPA was found by differential capacitance measurements to be -0.12 (+/-0.01) V versus Ag-AgCl. Changing the substrate potential to values positive (-0.01 V vs Ag-AgCl) of the PZC induces interfacial conditions that are favorable for the electrostatic deposition of cationic polymers onto the surface of 3-MPA monolayers. This result is also consistent with experimental observations obtained when the 3-MPA-modified substrate is exposed to 0.10 mol L (-1) NaOH solutions. When potentials equal or negative to the PZC are applied to the substrate, no significant accumulation of the PDDA is found by either QCM or EIS measurement. This result is consistent with results obtained when the 3-MPA modified substrate is exposed to 0.10 mol L (-1) HCl solutions where no PDDA adsorption is expected because the monolayer is neutral under these conditions. Changes in the impedance and quartz crystal frequency obtained after potential is applied to the substrate are interpreted in terms of the applied potential creating interfacial conditions that are favorable for the deprotonation of the terminal carboxylic acid groups and the subsequent electrostatic assembly of the polycation onto the negatively charged monolayer.

  5. A benzophenone-bearing acid oligodimethacrylate and its application to the preparation of silver/gold nanoparticles/polymer nanocomposites

    NASA Astrophysics Data System (ADS)

    Buruiana, Emil C.; Chibac, Andreea Laura; Buruiana, Tinca; Melinte, Violeta; Balan, Lavinia

    2013-01-01

    The synthesis of photosensitive urethane dimethacrylate that contains poly(ethylene oxide) sequence (PEG, Mw: 400), carboxylic and benzophenone moieties, and its characterization by specific methods (1H and 13C NMR, FTIR, UV and electrospray ionization-mass spectroscopy) are reported. UV curing parameters of this macromer (BP-UDMA) alone and in monomer combinations was evaluated through FTIR spectroscopy and photo-differential scanning calorimetry using 1 wt% 4-(dimethylamino)phenylacetic acid as co-initiator or Irgacure 819 (Irg819). The results show that the photopolymerization rates of the BP-UDMA are higher in the case of Irg819 (R max P : 0.108 s-1) due to its synergic action, whereas the degree of conversion of C=C double bond (DC, after 120 s of UV irradiation) is over 77 %. When other co-monomers (non-acid urethane dimethacrylate and silyl urea methacrylate) are incorporated into the formulation, the photopolymerization rate (0.095-0.132 s-1) and DC (84.59-79.69 %) varied in reasonable limits. Depending of the photoinitiator type, as well as the monomer composition, the addition of 0.5, 1 and 3 wt% noble metal precursors (AgNO3 and AuBr3) led to the formation of hybrid composites with in situ-synthesized nanoparticles (NPs), where the variations in the intensity of the surface plasmon absorption bands appeared in the range 400-456 nm (Silver) or 500-553 nm (Gold), better results being obtained in the first initiating system. Homogeneous dispersion of nanoparticles into the polymer matrix was evidenced by EDX and TEM analysis, the last proving the existence of nanoparticles with sizes around 10 nm and variable morphologies. X-ray diffraction analysis complemented these results.

  6. Relative binding affinity of carboxylate-, phosphonate-, and bisphosphonate-functionalized gold nanoparticles targeted to damaged bone tissue

    NASA Astrophysics Data System (ADS)

    Ross, Ryan D.; Cole, Lisa E.; Roeder, Ryan K.

    2012-10-01

    Functionalized Au NPs have received considerable recent interest for targeting and labeling cells and tissues. Damaged bone tissue can be targeted by functionalizing Au NPs with molecules exhibiting affinity for calcium. Therefore, the relative binding affinity of Au NPs surface functionalized with either carboxylate ( l-glutamic acid), phosphonate (2-aminoethylphosphonic acid), or bisphosphonate (alendronate) was investigated for targeted labeling of damaged bone tissue in vitro. Targeted labeling of damaged bone tissue was qualitatively verified by visual observation and backscattered electron microscopy, and quantitatively measured by the surface density of Au NPs using field-emission scanning electron microscopy. The surface density of functionalized Au NPs was significantly greater within damaged tissue compared to undamaged tissue for each functional group. Bisphosphonate-functionalized Au NPs exhibited a greater surface density labeling damaged tissue compared to glutamic acid- and phosphonic acid-functionalized Au NPs, which was consistent with the results of previous work comparing the binding affinity of the same functionalized Au NPs to synthetic hydroxyapatite crystals. Targeted labeling was enabled not only by the functional groups but also by the colloidal stability in solution. Functionalized Au NPs were stabilized by the presence of the functional groups, and were shown to remain well dispersed in ionic (phosphate buffered saline) and serum (fetal bovine serum) solutions for up to 1 week. Therefore, the results of this study suggest that bisphosphonate-functionalized Au NPs have potential for targeted delivery to damaged bone tissue in vitro and provide motivation for in vivo investigation.

  7. Thiacalix[4]arene functionalized gold nano-assembly for recognition of isoleucine in aqueous solution and its antioxidant study

    NASA Astrophysics Data System (ADS)

    Darjee, Savan M.; Bhatt, Keyur; Kongor, Anita; Panchal, Manthan K.; Jain, Vinod K.

    2017-01-01

    Thiacalix[4]arenes comes under heteracalixarene class which has notable utility in the area of nanoscience. This stimulation has led to the synthesis of water-dispersible gold nanoparticles (AuNps) using thiacalix[4]arene tetrahydrazide (TCTH) as both reducing as well as stabilizing agent. The synthesized nanoparticles (TCTH-AuNps) were characterized by SPR, TEM and EDX. TCTH-AuNps were found to be selective and sensitive for isoleucine. The concentration of isoleucine was detected in the limit of 1 nM to 1.2 μM based on fluorescence enhancement. TCTH-AuNps were also used to measure antioxidant capacity against the standard ascorbic acid.

  8. Effects of nanoscale confinement on the functionality of nucleic acids: implications for nanomedicine.

    PubMed

    Castronovo, M; Stopar, A; Coral, L; Redhu, S K; Vidonis, M; Kumar, V; Ben, F Del; Grassi, M; Nicholson, A W

    2013-01-01

    The facile self-assembly and nanomanipulation of nucleic acids hold great promise in the design of innovative, programmable materials, with applications ranging from biosensing to cellular targeting and drug delivery. Little is known, however, of the effects of confinement on biochemical reactions within such systems, in which the level of packing and crowding is similar to that of intracellular environments. In this review article we outline novel, unexpected properties of nucleic acids that arise from nanoscale confinement, as mainly revealed by atomic force and electron microscopy, electrochemistry, fluorescence spectroscopy, and gel electrophoresis. We review selected scientific studies over the last decade that describe the novel behavior of nanoconfined nucleic acids with respect to hybridization, denaturation, conformation, stability, and enzyme accessibility. The nanoscale systems discussed include self-assembled, water-soluble, DNA or RNA nanostructures, ranging in width from a few to several tens of nm; gold nanoparticles coated with DNA monolayers; and self-assembled monolayers of DNA, from a few to several hundreds of bp in length. These studies reveal that the functionality of nucleic acid-based nanosystems is highly dependent upon the local density, molecular flexibility and network of weak interactions between adjacent molecules. These factors significantly affect steric hindrance, molecular crowding and hydration, which in turn control nucleic acid hybridization, denaturation, conformation, and enzyme accessibility. The findings discussed in this review article demonstrate that nucleic acids function in a qualitatively different manner within nanostructured systems, and suggest that these novel properties, if better understood, will enable the development of powerful molecular tools for nanomedicine.

  9. Influence of gold, silver and gold–silver alloy nanoparticles on germ cell function and embryo development

    PubMed Central

    Rehbock, Christoph; Kues, Wilfried A

    2015-01-01

    Summary The use of engineered nanoparticles has risen exponentially over the last decade. Applications are manifold and include utilisation in industrial goods as well as medical and consumer products. Gold and silver nanoparticles play an important role in the current increase of nanoparticle usage. However, our understanding concerning possible side effects of this increased exposure to particles, which are frequently in the same size regime as medium sized biomolecules and accessorily possess highly active surfaces, is still incomplete. That particularly applies to reproductive aspects, were defects can be passed onto following generations. This review gives a brief overview of the most recent findings concerning reprotoxicological effects. The here presented data elucidate how composition, size and surface modification of nanoparticles influence viablility and functionality of reproduction relevant cells derived from various animal models. While in vitro cultured embryos displayed no toxic effects after the microinjection of gold and silver nanoparticles, sperm fertility parameters deteriorated after co-incubation with ligand free gold nanoparticles. However, the effect could be alleviated by bio-coating the nanoparticles, which even applies to silver and silver-rich alloy nanoparticles. The most sensitive test system appeared to be in vitro oocyte maturation showing a dose-dependent response towards protein (BSA) coated gold–silver alloy and silver nanoparticles leading up to complete arrest of maturation. Recent biodistribution studies confirmed that nanoparticles gain access to the ovaries and also penetrate the blood–testis and placental barrier. Thus, the design of nanoparticles with increased biosafety is highly relevant for biomedical applications. PMID:25821705

  10. Omega-3 fatty acids and the benefits of fish consumption: is all that glitters gold?

    PubMed

    Domingo, José L

    2007-10-01

    In recent years, a number of studies have clearly remarked the nutritional benefits of fish consumption: proteins, vitamins, minerals, and especially omega-3 polyunsaturated fatty acids (PUFAs), which may protect against several adverse health effects, including coronary heart disease mortality and stroke. However, some concerns about potential health risks derived from the environmental contaminants found in fish have been also raised. Therefore, balancing adequately the risks and benefits of fish consumption is currently a nutritional/environmental health key issue. In this paper, the most recent available scientific information concerning this issue is reviewed. It is concluded that although it seems evident that fish must be an important part of a balanced diet, to choose the most suitable species in terms of levels of PUFAs and pollutants, the frequency of consumption, and the meal size are essential aspects to balance benefits and risks of a regular consumption.

  11. In Vitro Structural and Functional Evaluation of Gold Nanoparticles Conjugated Antibiotics

    NASA Astrophysics Data System (ADS)

    Saha, Biswarup; Bhattacharya, Jaydeep; Mukherjee, Ananda; Ghosh, Anup Kumar; Santra, Chitta Ranjan; Dasgupta, Anjan K.; Karmakar, Parimal

    2007-12-01

    Bactericidal efficacy of gold nanoparticles conjugated with ampicillin, streptomycin and kanamycin were evaluated. Gold nanoparticles (Gnps) were conjugated with the antibiotics during the synthesis of nanoparticles utilizing the combined reducing property of antibiotics and sodium borohydride. The conjugation of nanoparticles was confirmed by dynamic light scattering (DLS) and electron microscopic (EM) studies. Such Gnps conjugated antibiotics showed greater bactericidal activity in standard agar well diffusion assay. The minimal inhibitory concentration (MIC) values of all the three antibiotics along with their Gnps conjugated forms were determined in three bacterial strains, Escherichia coli DH5α, Micrococcus luteus and Staphylococcus aureus. Among them, streptomycin and kanamycin showed significant reduction in MIC values in their Gnps conjugated form whereas; Gnps conjugated ampicillin showed slight decrement in the MIC value compared to its free form. On the other hand, all of them showed more heat stability in their Gnps conjugated forms. Thus, our findings indicated that Gnps conjugated antibiotics are more efficient and might have significant therapeutic implications.

  12. Ochratoxin A Detection on Antibody- Immobilized on BSA-Functionalized Gold Electrodes

    PubMed Central

    2016-01-01

    Ochratoxin A (OTA)—a toxin produced by Aspergillus carbonarius, Aspergillus ochraceus, and Penicillium verrucosum—is one of the most-abundant food-contaminating mycotoxins. To avoid the risk of OTA consumption for humans and animals, the rapid detection and quantitation of OTA level in different commodities are of great importance. In this work, an impedimetric immunosensor for ochratoxin A (OTA) detection, a common toxic botanical contaminant, was developed via the immobilization of anti-OTA antibody on bovine serum albumin modified gold electrodes. A four-step reaction protocol was tested to modify the gold electrode and obtain the sensing substrate. All the steps of the immunosensor elaboration and also the immunochemical reaction between surface-bound antibody and ochratoxin A were analyzed using cyclic voltammetry and electrochemical impedance spectroscopy. Modification of the impedance due to the specific antigen-antibody reaction at immunosensor surface, was used in order to detect ochratoxin A. Linear proportionality of the charge transfer resistance to the concentration of OTA allows ochratoxin A detection in the range of 2.5–100 ng/mL. PMID:27467684

  13. Multipath colourimetric assay for copper(II) ions utilizing MarR functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Wang, Yulong; Wang, Limin; Su, Zhenhe; Xue, Juanjuan; Dong, Jinbo; Zhang, Cunzheng; Hua, Xiude; Wang, Minghua; Liu, Fengquan

    2017-02-01

    We use the multiple antibiotic resistance regulator (MarR), as a highly selective biorecognition elements in a multipath colourimetric sensing strategy for the fast detection of Cu2+ in water samples. The colourimetric assay is based on the aggregation of MarR-coated gold nanoparticles in the presence of Cu2+ ions, which induces a red-to-purple colour change of the solution. The colour variation in the gold nanoparticle aggregation process can be used for qualitative and quantitative detection of Cu2+ by the naked eye, and with UV–vis and smartphone-based approaches. The three analysis techniques used in the multipath colourimetric assay complement each other and provide greater flexibility for differing requirements and conditions, making the assay highly applicable for Cu2+ detection. Under optimal conditions, the Cu2+ concentration was quantified in less than 5 min with limits of detection for the naked eye, UV–vis and smartphone-based approaches of 1 μM, 405 nM and 61 nM, respectively. Moreover, the sensing system exhibited excellent selectivity and practical application for Cu2+ detection in real water samples. Thus, our strategy has great potential for application in on-site monitoring of Cu2+, and the unique response of MarR towards copper ions may provide a new approach to Cu2+ sensing.

  14. Multipath colourimetric assay for copper(II) ions utilizing MarR functionalized gold nanoparticles

    PubMed Central

    Wang, Yulong; Wang, Limin; Su, Zhenhe; Xue, Juanjuan; Dong, Jinbo; Zhang, Cunzheng; Hua, Xiude; Wang, Minghua; Liu, Fengquan

    2017-01-01

    We use the multiple antibiotic resistance regulator (MarR), as a highly selective biorecognition elements in a multipath colourimetric sensing strategy for the fast detection of Cu2+ in water samples. The colourimetric assay is based on the aggregation of MarR-coated gold nanoparticles in the presence of Cu2+ ions, which induces a red-to-purple colour change of the solution. The colour variation in the gold nanoparticle aggregation process can be used for qualitative and quantitative detection of Cu2+ by the naked eye, and with UV–vis and smartphone-based approaches. The three analysis techniques used in the multipath colourimetric assay complement each other and provide greater flexibility for differing requirements and conditions, making the assay highly applicable for Cu2+ detection. Under optimal conditions, the Cu2+ concentration was quantified in less than 5 min with limits of detection for the naked eye, UV–vis and smartphone-based approaches of 1 μM, 405 nM and 61 nM, respectively. Moreover, the sensing system exhibited excellent selectivity and practical application for Cu2+ detection in real water samples. Thus, our strategy has great potential for application in on-site monitoring of Cu2+, and the unique response of MarR towards copper ions may provide a new approach to Cu2+ sensing. PMID:28155905

  15. Engineering a well-ordered, functional protein-gold nanoparticle assembly.

    PubMed

    Cheung-Lau, Jasmina C; Liu, Dage; Pulsipher, Katherine W; Liu, Weiren; Dmochowski, Ivan J

    2014-01-01

    The study of interactions between proteins and nanoparticles is important to advancing applications of nanoparticles in biology, medicine, and materials science. Here, we report the encapsulation of a 5-nm diameter gold nanoparticle (AuNP) by thermophilic ferritin (tF), achieved in nearly quantitative yield under mild conditions that preserved the secondary structure, ferroxidase activity, and thermal stability of the native, 4-helix bundle protein subunits. Chromatography-based assays determined that stable protein assembly around AuNPs occurred on long time scales (~48h) and was reversible. Apparent association constants were determined at 25°C for equilibrated tF-BSPP-capped AuNP samples (KA=(2.1±0.4)×10(78)M(-11)) and compared favorably to salt-assembled tF samples (KA=(2.2±0.5)×10(68)M(-11)) at the same protein concentration (0.3mg/mL). Finally, addition of gold ions and mild reducing agent to the tF-AuNP assembly produced 8-nm diameter AuNPs with surface plasmon resonance band unchanged at 520nm, indicative of templating by the protein shell.

  16. Guanidylated hollow fiber membranes based on brominated poly (2,6-dimethyl-1,4-phenylene oxide) (BPPO) for gold sorption from acid solutions.

    PubMed

    Ran, Jin; Wang, Na; You, Xue; Wu, Cuiming; Li, Qiuhua; Gong, Ming; Xu, Tongwen

    2012-11-30

    Novel guanidylated hollow fiber membranes are prepared based on brominated poly (2,6-dimethyl-1,4-phenylene oxide) (BPPO) under mild reaction conditions. 1H-pyrazole-1-carboxamidine hydrochloride (HPCA) is employed for the guanidylation in aqueous solution at room temperature. The obtained guanidylated PPO hollow fiber membranes (GPPO HFMs) contain 0.31-0.95 mmol/g guanidyl groups and show high affinity to tetrachloroauric anions (AuCl(4)(-)) in acid solutions. For 0.1M HCl solution containing 57.8 mg gold/L, the sorption amount can get as high as 130 mg/g. Besides, the GPPO HFMs show preferable selectivity toward gold in multicomponent solution containing Mg(II), Fe(III), Co(II), Ni(II), Cu(II), Zn(II) and Pb(II). A system of comparison experiments involving the sorption behavior of GPPO HFMs and quaternary aminated HFMs are also performed. The results reveal that driving forces for the high adsorption of gold mainly involve complexation mechanism. Overall, the obtained GPPO HFM is a promising chelating material for the recovery of gold.

  17. Aptasensor for electrochemical sensing of angiogenin based on electrode modified by cationic polyelectrolyte-functionalized graphene/gold nanoparticles composites.

    PubMed

    Chen, Zhengbo; Zhang, Chenmeng; Li, Xiaoxiao; Ma, He; Wan, Chongqing; Li, Kai; Lin, Yuqing

    2015-03-15

    Herein, a label-free and highly sensitive electrochemical aptasensor for the detection of angiogenin was proposed based on a conformational change of aptamer and amplification by poly(diallyldimethyl ammonium chloride) (PDDA)-functionalized graphene/gold nanoparticles (AuNPs) composites-modified electrode. PDDA-functionalized graphene (P-GR) nanosheets as the building block in the self-assembly of GR nanosheets/AuNPs heterostructure enhanced the electrochemical detection performance. The electrochemical aptasensor has an extraordinarily sensitive response to angiogenin in a linear range from 0.1pM to 5nM with a detection limit of 0.064pM. The developed sensor provides a promising strategy for the cancer diagnosis in medical application in the future.

  18. Targeting polymeric fluorescent nanodiamond-gold/silver multi-functional nanoparticles as a light-transforming hyperthermia reagent for cancer cells

    NASA Astrophysics Data System (ADS)

    Cheng, Liang-Chien; Chen, Hao Ming; Lai, Tsung-Ching; Chan, Yung-Chieh; Liu, Ru-Shi; Sung, James C.; Hsiao, Michael; Chen, Chung-Hsuan; Her, Li-Jane; Tsai, Din Ping

    2013-04-01

    This work demonstrates a simple route for synthesizing multi-functional fluorescent nanodiamond-gold/silver nanoparticles. The fluorescent nanodiamond is formed by the surface passivation of poly(ethylene glycol) bis(3-aminopropyl) terminated. Urchin-like gold/silver nanoparticles can be obtained via one-pot synthesis, and combined with each other via further thiolation of nanodiamond. The morphology of the nanodiamond-gold/silver nanoparticles thus formed was identified herein by high-resolution transmission electron microscopy, and clarified using diffraction patterns. Fourier transform infrared spectroscopy clearly revealed the surface functionalization of the nanoparticles. The fluorescence of the materials with high photo stability was examined by high power laser irradiation and long-term storage at room temperature. To develop the bio-recognition of fluorescent nanodiamond-gold/silver nanoparticles, pre-modified transferrin was conjugated with the gold/silver nanoparticles, and the specificity and activity were confirmed in vitro using human hepatoma cell line (J5). The cellular uptake analysis that was conducted using flow cytometry and inductively coupled plasma mass spectrometry exhibited that twice as many transferrin-modified nanoparticles as bare nanoparticles were engulfed, revealing the targeting and ease of internalization of the human hepatoma cell. Additionally, the in situ monitoring of photothermal therapeutic behavior reveals that the nanodiamond-gold/silver nanoparticles conjugated with transferrin was more therapeutic than the bare nanodiamond-gold/silver materials, even when exposed to a less energetic laser source. Ultimately, this multi-functional material has great potential for application in simple synthesis. It is non-cytotoxic, supports long-term tracing and can be used in highly efficient photothermal therapy against cancer cells.This work demonstrates a simple route for synthesizing multi-functional fluorescent nanodiamond-gold

  19. Nucleic acid-functionalized transition metal nanosheets for biosensing applications.

    PubMed

    Mo, Liuting; Li, Juan; Liu, Qiaoling; Qiu, Liping; Tan, Weihong

    2017-03-15

    In clinical diagnostics, as well as food and environmental safety practices, biosensors are powerful tools for monitoring biological or biochemical processes. Two-dimensional (2D) transition metal nanomaterials, including transition metal chalcogenides (TMCs) and transition metal oxides (TMOs), are receiving growing interest for their use in biosensing applications based on such unique properties as high surface area and fluorescence quenching abilities. Meanwhile, nucleic acid probes based on Watson-Crick base-pairing rules are also being widely applied in biosensing based on their excellent recognition capability. In particular, the emergence of functional nucleic acids in the 1980s, especially aptamers, has substantially extended the recognition capability of nucleic acids to various targets, ranging from small organic molecules and metal ions to proteins and cells. Based on π-π stacking interaction between transition metal nanosheets and nucleic acids, biosensing systems can be easily assembled. Therefore, the combination of 2D transition metal nanomaterials and nucleic acids brings intriguing opportunities in bioanalysis and biomedicine. In this review, we summarize recent advances of nucleic acid-functionalized transition metal nanosheets in biosensing applications. The structure and properties of 2D transition metal nanomaterials are first discussed, emphasizing the interaction between transition metal nanosheets and nucleic acids. Then, the applications of nucleic acid-functionalized transition metal nanosheet-based biosensors are discussed in the context of different signal transducing mechanisms, including optical and electrochemical approaches. Finally, we provide our perspectives on the current challenges and opportunities in this promising field.

  20. Targeting polymeric fluorescent nanodiamond-gold/silver multi-functional nanoparticles as a light-transforming hyperthermia reagent for cancer cells.

    PubMed

    Cheng, Liang-Chien; Chen, Hao Ming; Lai, Tsung-Ching; Chan, Yung-Chieh; Liu, Ru-Shi; Sung, James C; Hsiao, Michael; Chen, Chung-Hsuan; Her, Li-Jane; Tsai, Din Ping

    2013-05-07

    This work demonstrates a simple route for synthesizing multi-functional fluorescent nanodiamond-gold/silver nanoparticles. The fluorescent nanodiamond is formed by the surface passivation of poly(ethylene glycol) bis(3-aminopropyl) terminated. Urchin-like gold/silver nanoparticles can be obtained via one-pot synthesis, and combined with each other via further thiolation of nanodiamond. The morphology of the nanodiamond-gold/silver nanoparticles thus formed was identified herein by high-resolution transmission electron microscopy, and clarified using diffraction patterns. Fourier transform infrared spectroscopy clearly revealed the surface functionalization of the nanoparticles. The fluorescence of the materials with high photo stability was examined by high power laser irradiation and long-term storage at room temperature. To develop the bio-recognition of fluorescent nanodiamond-gold/silver nanoparticles, pre-modified transferrin was conjugated with the gold/silver nanoparticles, and the specificity and activity were confirmed in vitro using human hepatoma cell line (J5). The cellular uptake analysis that was conducted using flow cytometry and inductively coupled plasma mass spectrometry exhibited that twice as many transferrin-modified nanoparticles as bare nanoparticles were engulfed, revealing the targeting and ease of internalization of the human hepatoma cell. Additionally, the in situ monitoring of photothermal therapeutic behavior reveals that the nanodiamond-gold/silver nanoparticles conjugated with transferrin was more therapeutic than the bare nanodiamond-gold/silver materials, even when exposed to a less energetic laser source. Ultimately, this multi-functional material has great potential for application in simple synthesis. It is non-cytotoxic, supports long-term tracing and can be used in highly efficient photothermal therapy against cancer cells.

  1. The effect of surface symmetry on the adsorption energetics of SCH 3 on gold surfaces studied using Density Functional Theory

    NASA Astrophysics Data System (ADS)

    Masens, C.; Ford, M. J.; Cortie, M. B.

    2005-04-01

    Adsorption of methanethiol onto the three, high symmetry gold surfaces has been studied at the density functional level using a linear combination of atomic orbitals approach. In all three cases the bond energy between the thiolate radical and surface is typical of a covalent bond, and is of the order of 40 kcal mol -1. For the (1 1 1) surface the fcc hollow site is slightly more stable than the bridge site. For the (1 0 0) surfaces the four-fold hollow is clearly the most stable, and for the reconstructed (1 1 0) surface the bridge/edge sites either side of the first layer atoms are preferred. The calculated differences in binding energy between the three surfaces indicate that the thiolate will preferentially bind to the Au(1 1 0) or (1 0 0) before (1 1 1) surface, by about 10 kcal mol -1. The (1 1 0) surface is slightly more favourable than the (1 0 0), although the energy difference is only 3 kcal mol -1. The results suggest the possibility of selectively functionalising the different facets offered by a gold nanoparticle.

  2. Fatty acids as modulators of neutrophil recruitment, function and survival.

    PubMed

    Rodrigues, Hosana G; Takeo Sato, Fabio; Curi, Rui; Vinolo, Marco A R

    2016-08-15

    Neutrophils are well-known to act in the destruction of invading microorganisms. They have also been implicated in the activation of other immune cells including B- and T-lymphocytes and in the resolution of inflammation and tissue regeneration. Neutrophils are produced in the bone marrow and released into the circulation from where they migrate to tissues to perform their effector functions. Neutrophils are in constant contact with fatty acids that can modulate their function, activation and fate (survival or cell death) through different mechanisms. In this review, the effects of fatty acids pertaining to five classes, namely, long-chain saturated fatty acids (LCSFAs), short-chain fatty acids (SCFAs), and omega-3 (n-3), omega-6 (n-6) and omega-9 (n-9) unsaturated fatty acids, on neutrophils and the relevance of these effects for disease development are discussed.

  3. Functionalized gold nanoparticles/reduced graphene oxide nanocomposites for ultrasensitive electrochemical sensing of mercury ions based on thymine-mercury-thymine structure.

    PubMed

    Wang, Nan; Lin, Meng; Dai, Hongxiu; Ma, Houyi

    2016-05-15

    A sensitive, selective and reusable electrochemical biosensor for the determination of mercury ions (Hg(2+)) has been developed based on thymine (T) modified gold nanoparticles/reduced graphene oxide (AuNPs/rGO) nanocomposites. Graphene oxide (GO) was electrochemically reduced on a glassy carbon substrate. Subsequently, AuNPs were deposited onto the surface of rGO by cyclic voltammetry. For functionalization of the electrode, the carboxylic group of the thymine-1-acetic acid was covalently coupled with the amine group of the cysteamine which self-assembled onto AuNPs. The structural features of the T bases functionalized AuNPs/rGO electrode were confirmed by attenuated total reflection infrared (ATR-IR) spectroscopy and scanning electron microscopy (SEM) spectroscopy. Each step of the modification process was characterized by cyclic voltammetry (CV) and electrochemical impedence spectroscopy (EIS). The T bases modified AuNPs/rGO electrode was applied to detect various trace metal ions by differential pulse voltammetry (DPV). The proposed biosensor was found to be highly sensitive to Hg(2+) in the range of 10 ng/L-1.0 µg/L. The biosensor afforded excellent selectivity for Hg(2+) against other heavy metal ions such as Zn(2+), Cd(2+), Pb(2+), Cu(2+), Ni(2+), and Co(2+). Furthermore, the developed sensor exhibited a high reusability through a simple washing. In addition, the prepared biosensor was successfully applied to assay Hg(2+) in real environmental samples.

  4. Nucleic acid functionalized graphene for biosensing.

    PubMed

    Bonanni, Alessandra; Ambrosi, Adriano; Pumera, Martin

    2012-02-06

    There is immense demand for complex nanoarchitectures based on graphene nanostructures in the fields of biosensing or nanoelectronics. DNA molecules represent the most versatile and programmable recognition element and can provide a unique massive parallel assembly strategy with graphene nanomaterials. Here we demonstrate a facile strategy for covalent linking of single stranded DNA (ssDNA) to graphene using carbodiimide chemistry and apply it to genosensing. Since graphenes can be prepared by different methods and can contain various oxygen containing groups, we thoroughly investigated the utility of four different chemically modified graphenes for functionalization by ssDNA. The materials were characterized in detail and the different DNA functionalized graphene platforms were then employed for the detection of DNA hybridization and DNA polymorphism by using impedimetric methods. We believe that our findings are very important for the development of novel devices that can be used as alternatives to classical techniques for sensitive and fast DNA analysis. In addition, covalent functionalization of graphene with ssDNA is expected to have broad implications, from biosensing to nanoelectronics and directed, DNA programmable, self-assembly.

  5. Gold Nanoparticles Decorated with Sialic Acid Terminated Bi‐antennary N‐Glycans for the Detection of Influenza Virus at Nanomolar Concentrations†

    PubMed Central

    Poonthiyil, Vivek; Nagesh, Prashanth T.; Husain, Matloob

    2015-01-01

    Abstract Gold nanoparticles decorated with full‐length sialic acid terminated complex bi‐antennary N‐glycans, synthesized with glycans isolated from egg yolk, were used as a sensor for the detection of both recombinant hemagglutinin (HA) and whole influenza A virus particles of the H1N1 subtype. Nanoparticle aggregation was induced by interaction between the sialic acid termini of the glycans attached to gold and the multivalent sialic acid binding sites of HA. Both dynamic light scattering (DLS) and UV/Vis spectroscopy demonstrated the efficiency of the sensor, which could detect viral HA at nanomolar concentrations and revealed a linear relationship between the extent of nanoparticle aggregation and the concentration of HA. UV/Vis studies also showed that these nanoparticles can selectively detect an influenza A virus strain that preferentially binds sialic acid terminated glycans with α(2→6) linkages over a strain that prefers glycans with terminal α(2→3)‐linked sialic acids. PMID:27308196

  6. In situ synthesis and surface functionalization of gold nanoparticles with curcumin and their antioxidant properties: an experimental and density functional theory investigation

    NASA Astrophysics Data System (ADS)

    Singh, Dheeraj K.; Jagannathan, Ramya; Khandelwal, Puneet; Abraham, Priya Mary; Poddar, Pankaj

    2013-02-01

    Curcumin ((1E,6E)-1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione) is an active component of turmeric; it is responsible for its characteristic yellow color and therapeutic potential, but its poor bioavailability remains a major challenge. In order to improve the bioavailability of curcumin, various approaches have been used. One of the possible approaches to increase the bioavailability of curcumin is its conjugation on the surface of metal nanoparticles. Therefore, in the present study, we report the binding of curcumin on the surface of gold nanoparticles (AuNPs). The AuNPs were synthesized by the direct reduction of HAuCl4 using curcumin in the aqueous phase, without the use of any other reducing agents. We found that curcumin acts both as a reducing and capping agent, stabilizing the gold sol for many months. Moreover, these curcumin-capped AuNPs also show good antioxidant activity which was confirmed by the DPPH (2,2-diphenyl-l-picrylhydrazyl) radical test. Thus, the surface functionalization of AuNPs with curcumin may pave a new way of using the curcuminoids towards possible drug delivery and therapeutics. Apart from the experimental study, a detailed quantum chemical calculation using density functional theory (DFT) has been performed, in order to investigate the formation of a complex of curcumin with Au3+ ions in different possible conformational isomeric forms. Our theoretical calculations indicate the evidence of electron transfer from curcumin into the Au center and essentially indicate that as a consequence of complexation, Au3+ ions are reduced to Au0. Our theoretical results also propose that it is the breakage of intramolecular H-bonding that probably leads to the increased availability of curcumin in the presence of gold ions and water molecules.Curcumin ((1E,6E)-1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione) is an active component of turmeric; it is responsible for its characteristic yellow color and therapeutic

  7. Non-invasive molecular profiling of cancer using photoacoustic imaging of functionalized gold nanorods

    NASA Astrophysics Data System (ADS)

    Shah, Anant J.; Alles, Erwin J.; Box, Carol; Eccles, Suzanne A.; Robinson, Simon P.; deSouza, Nandita; Bamber, Jeffrey C.

    2014-03-01

    Although molecularly targeted cancer therapies have shown great promise, it is now evident that responses are dependent upon the molecular genetic context. Spatial and temporal tumour heterogeneity renders biopsy of solid tumours unsuitable for determining the genetic profile of the disease, making adaptation of appropriate therapy difficult. We have utilized the tunable optical absorption characteristic of gold nanorods to assess the potential of photoacoustics for non-invasive multiplexed molecular imaging. Gold nanorods with resonance peaks at 700nm and 900nm were functionalised with in-house antibodies ICR55 and ICR62, targeted to HER2 and EGFR transmembrane receptors, respectively. Three human squamous carcinoma cell lines (LICR-LON-HN4 expressing high HER2 and low EGFR, LICR-LON-HN3 expressing intermediate levels of HER2 and EGFR and A431 expressing high EGFR and low HER2) were incubated with the targeted nanorods for 24 hours. Cells were then incorporated as simulated tumours in tissue-like phantoms composed of 7.5% gelatin containing 0.5% Intralipid® for optical scattering and imaged at a depth of 2.5 cm, using a new clinical in-house multi-spectral photoacoustic imaging system. Images were obtained from the cell inclusions for wavelengths ranging from 710 to 950 nm at 40 nm intervals, and the mean amplitude of the photoacoustic image was computed for each wavelength, to determine their relative receptor expression levels. The molecular profile of the cells obtained using multi-wavelength photoacoustics had substantial similarity to that obtained using flow cytometry. These preliminary results confirm selective uptake of the functionalised nanorods, which reflects the cellular expression of therapeutically important oncoproteins, and give an indication of the potential of photoacoustics for multiplexed molecular profiling.

  8. In situ synthesis and surface functionalization of gold nanoparticles with curcumin and their antioxidant properties: an experimental and density functional theory investigation.

    PubMed

    Singh, Dheeraj K; Jagannathan, Ramya; Khandelwal, Puneet; Abraham, Priya Mary; Poddar, Pankaj

    2013-03-07

    Curcumin ((1E,6E)-1,7-bis(4-hydroxy-3-methoxyphenyl)-1,6-heptadiene-3,5-dione) is an active component of turmeric; it is responsible for its characteristic yellow color and therapeutic potential, but its poor bioavailability remains a major challenge. In order to improve the bioavailability of curcumin, various approaches have been used. One of the possible approaches to increase the bioavailability of curcumin is its conjugation on the surface of metal nanoparticles. Therefore, in the present study, we report the binding of curcumin on the surface of gold nanoparticles (AuNPs). The AuNPs were synthesized by the direct reduction of HAuCl(4) using curcumin in the aqueous phase, without the use of any other reducing agents. We found that curcumin acts both as a reducing and capping agent, stabilizing the gold sol for many months. Moreover, these curcumin-capped AuNPs also show good antioxidant activity which was confirmed by the DPPH (2,2-diphenyl-l-picrylhydrazyl) radical test. Thus, the surface functionalization of AuNPs with curcumin may pave a new way of using the curcuminoids towards possible drug delivery and therapeutics. Apart from the experimental study, a detailed quantum chemical calculation using density functional theory (DFT) has been performed, in order to investigate the formation of a complex of curcumin with Au(3+) ions in different possible conformational isomeric forms. Our theoretical calculations indicate the evidence of electron transfer from curcumin into the Au center and essentially indicate that as a consequence of complexation, Au(3+) ions are reduced to Au(0). Our theoretical results also propose that it is the breakage of intramolecular H-bonding that probably leads to the increased availability of curcumin in the presence of gold ions and water molecules.

  9. A microchip-based flow injection-amperometry system with mercaptopropionic acid modified electroless gold microelectrode for the selective determination of dopamine.

    PubMed

    Wang, Yi; Luo, Jie; Chen, Hengwu; He, Qiaohong; Gan, Nin; Li, Tianhua

    2008-09-12

    A novel chip-based flow injection analysis (FIA) system has been developed for automatic, rapid and selective determination of dopamine (DA) in the presence of ascorbic acid (AA). The system is composed of a polycarbonate (PC) microfluidic chip with an electrochemical detector (ED), a gravity pump, and an automatic sample loading and injection unit. The selectivity of the ED was improved by modification of the gold working microelectrode, which was fabricated on the PC chip by UV-directed electroless gold plating, with a self-assembled monolayer (SAM) of 3-mercaptopropionic acid (MPA). Postplating treatment methods for cleaning the surface of electroless gold microelectrodes were investigated to ensure the formation of high quality SAMs. The effects of detection potential, flow rate, and sampling volume on the performance of the chip-based FIA system were studied. Under optimum conditions, a detection limit of 74 nmol L(-1) for DA was achieved at the sample throughput rate of 180 h(-1). A RSD of 0.9% for peak heights was observed for 19 runs of a 100 micromol L(-1) DA solution. Interference-free determination of DA could be conducted if the concentration ratio of AA-DA was no more than 10.

  10. Phytoproteins in green leaves as building blocks for photosynthesis of gold nanoparticles: An efficient electrocatalyst towards the oxidation of ascorbic acid and the reduction of hydrogen peroxide.

    PubMed

    Megarajan, Sengan; Ayaz Ahmed, Khan Behlol; Rajendra Kumar Reddy, G; Suresh Kumar, P; Anbazhagan, Veerappan

    2016-02-01

    Herein, we present a simple and green method for the synthesis of gold nanoparticles (AuNPs) using the phytoproteins of spinach leaves. Under ambient sunlight irradiation, the isolated phytoprotein complex from spinach leaves reduces the gold chloride aqueous solution and stabilizes the formed AuNPs. As prepared nanoparticles were characterized by UV-visible spectroscopy, Fourier transform infra-red (FTIR) spectroscopy, zeta potential, transmission electron microscopy (TEM) and energy dispersive X-ray analysis (EDS). The surface plasmon resonance (SPR) maximum for AuNPs was observed at 520 nm. The zeta potential value estimated for the AuNPs is -27.0 mV, indicating that the NPs are well separated. Transmission electron micrographs revealed that the particles are spherical in nature with the size range from 10 to 15 nm. AuNPs act as a catalyst in the degradation of an azo dye, methyl orange in an aqueous environment. The reduction rate was determined to be pseudo-first order. Electrocatalytic efficiency of the synthesized AuNPs via this green approach was studied by chronoamperometry using ascorbic acid and hydrogen peroxide as a model compound for oxidation and reduction, respectively. Electrocatalytic studies indicate that the gold nanoparticles can be used to detect ascorbic acid and hydrogen peroxide in micromolar concentrations with response time less than 3s.

  11. Chemistry for oncotheranostic gold nanoparticles.

    PubMed

    Trouiller, Anne Juliette; Hebié, Seydou; El Bahhaj, Fatima; Napporn, Teko W; Bertrand, Philippe

    2015-06-24

    This review presents in a comprehensive ways the chemical methods used to functionalize gold nanoparticles with focus on anti-cancer applications. The review covers the parameters required for the synthesis gold nanoparticles with defined shapes and sizes, method for targeted delivery in tumours, and selected examples of anti-cancers compounds delivered with gold nanoparticles. A short survey of bioassays for oncology based on gold nanoparticles is also presented.

  12. Density functional theory study of the oligomerization of carboxylic acids.

    PubMed

    Di Tommaso, Devis; Watson, Ken L

    2014-11-20

    We present a density functional theory [M06-2X/6-31+G(d,p)] study of the structures and free energies of formation of oligomers of four carboxylic acids (formic acid, acetic acid, tetrolic acid, and benzoic acid) in water, chloroform, and carbon tetrachloride. Solvation effects were treated using the SMD continuum solvation model. The low-lying energy structures of molecular complexes were located by adopting an efficient search procedure to probe the potential energy surfaces of the oligomers of carboxylic acids (CA)n (n = 2-6). The free energies of the isomers of (CA)n in solution were determined as the sum of the electronic energy, vibrational-rotational-translational gas-phase contribution, and solvation free energy. The assessment of the computational protocol adopted in this study with respect to the dimerization of acetic acid, (AA)2, and formic acid, (FA)2, located new isomers of (AA)2 and (FA)2 and gave dimerization constants in good agreement with the experimental values. The calculation of the self-association of acetic acid, tetrolic acid, and benzoic acid shows the following: (i) Classic carboxylic dimers are the most stable isomer of (CA)2 in both the gas phase and solution. (ii) Trimers of carboxylic acid are stable in apolar aprotic solvents. (iii) Molecular clusters consisting of two interacting classic carboxylic dimers (CA)4,(D+D) are the most stable type of tetramers, but their formation from the self-association of classic carboxylic dimers is highly unfavorable. (iv) For acetic acid and tetrolic acid the reactions (CA)2 + 2CA → (CA)4,(D+D) and (CA)3 + CA → (CA)4,(D+D) are exoergonic, but these aggregation pathways go through unstable clusters that could hinder the formation of tetrameric species. (v) For tetrolic acid the prenucleation species that are more likely to form in solution are dimeric and trimeric structures that have encoded structural motifs resembling the α and β solid forms of tetrolic acid. (vi) Stable tetramers of

  13. Synthesis of polysubstituted cyclopenta[b]indoles via relay gold(I)/Brønsted acid catalysis.

    PubMed

    Dhiman, Seema; Ramasastry, S S V

    2015-01-11

    An efficient relay catalytic process involving Au(i)/Brønsted acid to access various polysubstituted cyclopentannulated indoles from easily accessible 1-(2-aminophenyl)prop-2-ynols and readily available 1,3-dicarbonyls has been developed. In an unprecedented event, the intermediate 2-indolylmethyl cations undergo the cation-Ene reaction with various 1,3-dicarbonyls followed by an intramolecular Friedel-Crafts-type reaction generating functionalized cyclopenta[b]indoles.

  14. Broadband gain in poly(3-hexylthiophene):phenyl-C{sub 61}-butyric-acid-methyl-ester photodetectors enabled by a semicontinuous gold interlayer

    SciTech Connect

    Melancon, Justin M.; Živanović, Sandra R.

    2014-10-20

    Substantial broadband photoconductive gain has been realized for organic, thin-film photodetectors with a poly(3-hexylthiophene):phenyl-C{sub 61}-butyric-acid-methyl-ester (P3HT:PCBM) active layer at low bias voltages. External quantum efficiencies upwards of 1500% were achieved when a semicontinuous gold layer was introduced at the anode interface. Significant gain was also observed in the sub-band gap, near infrared region where the external quantum efficiency approached 100% despite the lack of a sensitizer. The gain response was highly dependent on the thickness of the active layer of the photodetector with the best results achieved with the thinnest devices. The gain is the result of the injection of secondary electrons due to hole charge trapping at the semicontinuous gold layer.

  15. Acid-Sensing Ion Channels in Gastrointestinal Function

    PubMed Central

    Holzer, Peter

    2015-01-01

    Gastric acid is of paramount importance for digestion and protection from pathogens but, at the same time, is a threat to the integrity of the mucosa in the upper gastrointestinal tract and may give rise to pain if inflammation or ulceration ensues. Luminal acidity in the colon is determined by lactate production and microbial transformation of carbohydrates to short chain fatty acids as well as formation of ammonia. The pH in the oesophagus, stomach and intestine is surveyed by a network of acid sensors among which acid-sensing ion channels (ASICs) and acid-sensitive members of transient receptor potential ion channels take a special place. In the gut, ASICs (ASIC1, ASIC2, ASIC3) are primarily expressed by the peripheral axons of vagal and spinal afferent neurons and are responsible for distinct proton-gated currents in these neurons. ASICs survey moderate decreases in extracellular pH and through these properties contribute to a protective blood flow increase in the face of mucosal acid challenge. Importantly, experimental studies provide increasing evidence that ASICs contribute to gastric acid hypersensitivity and pain under conditions of gastritis and peptic ulceration but also participate in colonic hypersensitivity to mechanical stimuli (distension) under conditions of irritation that are not necessarily associated with overt inflammation. These functional implications and their upregulation by inflammatory and non-inflammatory pathologies make ASICs potential targets to manage visceral hypersensitivity and pain associated with functional gastrointestinal disorders. PMID:25582294

  16. Dual-responsive and Multi-functional Plasmonic Hydrogel Valves and Biomimetic Architectures Formed with Hydrogel and Gold Nanocolloids

    NASA Astrophysics Data System (ADS)

    Song, Ji Eun; Cho, Eun Chul

    2016-10-01

    We present a straightforward approach with high moldability for producing dual-responsive and multi-functional plasmonic hydrogel valves and biomimetic architectures that reversibly change volumes and colors in response to temperature and ion variations. Heating of a mixture of hybrid colloids (gold nanoparticles assembled on a hydrogel colloid) and hydrogel colloids rapidly induces (within 30 min) the formation of hydrogel architectures resembling mold shapes (cylinder, fish, butterfly). The biomimetic fish and butterfly display reversible changes in volumes and colors with variations of temperature and ionic conditions in aqueous solutions. The cylindrical plasmonic valves installed in flow tubes rapidly control water flow rate in on-off manner by responding to these stimuli. They also report these changes in terms of their colors. Therefore, the approach presented here might be helpful in developing new class of biomimetic and flow control systems where liquid conditions should be visually notified (e.g., glucose or ion concentration changes).

  17. Dual-responsive and Multi-functional Plasmonic Hydrogel Valves and Biomimetic Architectures Formed with Hydrogel and Gold Nanocolloids

    PubMed Central

    Song, Ji Eun; Cho, Eun Chul

    2016-01-01

    We present a straightforward approach with high moldability for producing dual-responsive and multi-functional plasmonic hydrogel valves and biomimetic architectures that reversibly change volumes and colors in response to temperature and ion variations. Heating of a mixture of hybrid colloids (gold nanoparticles assembled on a hydrogel colloid) and hydrogel colloids rapidly induces (within 30 min) the formation of hydrogel architectures resembling mold shapes (cylinder, fish, butterfly). The biomimetic fish and butterfly display reversible changes in volumes and colors with variations of temperature and ionic conditions in aqueous solutions. The cylindrical plasmonic valves installed in flow tubes rapidly control water flow rate in on-off manner by responding to these stimuli. They also report these changes in terms of their colors. Therefore, the approach presented here might be helpful in developing new class of biomimetic and flow control systems where liquid conditions should be visually notified (e.g., glucose or ion concentration changes). PMID:27703195

  18. Gold nanoparticles: sonocatalytic synthesis using ethanolic extract of Andrographis paniculata and functionalization with polycaprolactone-gelatin composites

    NASA Astrophysics Data System (ADS)

    Babu, Punuri Jayasekhar; Saranya, Sibyala; Sharma, Pragya; Tamuli, Ranjan; Bora, Utpal

    2012-09-01

    Gold nanoparticles (AuNPs) were synthesized by sonication using ethanolic leaf extract of Andrographis paniculata. We investigated the optimum parameters for AuNP synthesis and functionalization with polycaprolactone-gelatin (PCL-GL) composites. The AuNPs were characterized with various biophysical techniques such as TEM, XRD, FT-IR and EDX spectroscopy. TEM images showed that nanoparticles were spherical in shape with a size range from 5 to 75 nm. EDX analysis revealed the presence of molecular oxygen and carbon on the surface of AuNPs. The synthesized AuNPs were tested for their effect on HeLa (human cervical cancer) and MCF-7 (human breast cancer) cell lines and found to be nontoxic and biocompatible, which are potential carriers for hydrophobic drugs.

  19. Inhibition of hydrolytic enzymes by gold compounds. I. beta-Glucuronidase and acid phosphatase by sodium tetrachloroaurate (III) and potassium tetrabromoaurate (III).

    PubMed

    Lee, M T; Ahmed, T; Friedman, M E

    1989-01-01

    Purified bovine liver beta-glucuronidase (beta-D-glucuronide glucuronohydrolase, EC 3.2.1.32) and wheat germ acid phosphatase (orthophosphoric monoesterphosphohydrolase, EC 3.1.3.2) were inhibited with freshly dissolved and 24 h aquated tetrahaloaurate (III) compounds. Rate and equilibrium inhibition constants were measured. From this data two acid phosphatases species were observed. Equilibrium inhibition constants ranged from 1 to 12.5 microM for the various gold compounds toward both enzymes. The first order rate constants ranged between 0.005 and 0.04 min.-1 for most reactions with the exception of the fast reacting acid phosphatase which had values as high as 2.6 and 2.8 min.-1. It is observed that the beta-glucuronidase is rapidly inhibited during the equilibrium phase before the more slower reaction covalent bond formation takes place. The acid phosphatases form the covalent bonds more rapidly, especially the faster reacting species suggesting a unique difference in the active site geometry to that of the more slowly reacting species. The tightly bonded gold (III)-enzyme complex is probably the reason for its toxicity and non-anti-inflammatory use as a drug.

  20. A label-free electrochemiluminescence aptasensor for thrombin based on novel assembly strategy of oligonucleotide and luminol functionalized gold nanoparticles.

    PubMed

    Li, Fang; Cui, Hua

    2013-01-15

    In the work, a label-free electrochemiluminescence (ECL) aptasensor for the sensitive and selective detection of thrombin was constructed based on target-induced direct ECL signal change by virtue of a novel assembly strategy of oligonucleotide and luminol functionalized gold nanoparticles (luminol-AuNPs). It is the first label-free ECL biosensor based on luminol and its analogs functionalized AuNPs. Streptavidin AuNPs coated with biotinylated DNA capture probe 1 (AuNPs-probe 1) were firstly assembled onto an gold electrode through 1,3-propanedithiol. Then luminol-AuNPs co-loaded with thiolated DNA capture probe 2 and thiolated thrombin binding aptamer (TBA) (luminol-AuNPs-probe 2/TBA) were assembled onto AuNPs-probe 1 modified electrode through the hybridization between capture probes 1 and 2. The luminol-AuNPs-probe 2/TBA acted as both molecule recognition probe and sensing interface. An Au/AuNPs/ds-DNA/luminol-AuNPs/TBA multilayer architecture was obtained. In the presence of target thrombin, TBA on the luminol-AuNPs could capture the thrombin onto the electrode surface, which produced a barrier for electro-transfer and influenced the electro-oxidation reaction of luminol, leading to a decrease in ECL intensity. The change of ECL intensity indirectly reflected the concentration of thrombin. Thus, the approach showed a high sensitivity and a wider linearity for the detection of thrombin in the range of 0.005-50nM with a detection limit of 1.7pM. This work reveals that luminol-AuNPs are ideal platform for label-free ECL bioassays.

  1. Comparison of four functionalization methods of gold nanoparticles for enhancing the enzyme-linked immunosorbent assay (ELISA)

    PubMed Central

    Ciaurriz, Paula; Fernández, Fátima; Tellechea, Edurne; Moran, Jose F

    2017-01-01

    The enzyme-linked immunosorbent assay (ELISA) technique is based on the specific recognition ability of the molecular structure of an antigen (epitope) by an antibody and is likely the most important diagnostic technique used today in bioscience. With this methodology, it is possible to diagnose illness, allergies, alimentary fraud, and even to detect small molecules such as toxins, pesticides, heavy metals, etc. For this reason, any procedures that improve the detection limit, sensitivity or reduce the analysis time could have an important impact in several fields. In this respect, many methods have been developed for improving the technique, ranging from fluorescence substrates to methods for increasing the number of enzyme molecules involved in the detection such as the biotin–streptavidin method. In this context, nanotechnology has offered a significant number of proposed solutions, mainly based on the functionalization of nanoparticles from gold to carbon which could be used as antibody carriers as well as reporter enzymes like peroxidase. However, few works have focused on the study of best practices for nanoparticle functionalization for ELISA enhancement. In this work, we use 20 nm gold nanoparticles (AuNPs) as a vehicle for secondary antibodies and peroxidase (HRP). The design of experiments technique (DOE) and four different methods for biomolecule loading were compared using a rabbit IgG/goat anti-rabbit IgG ELISA model (adsorption, directional, covalent and a combination thereof). As a result, AuNP probes prepared by direct adsorption were the most effective method. AuNPs probes were then used to detect gliadin, one of the main components of wheat gluten, the protein composite that causes celiac disease. With this optimized approach, our data showed a sensitivity increase of at least five times and a lower detection limit with respect to a standard ELISA of at least three times. Additionally, the assay time was remarkably decreased. PMID:28243563

  2. Highly efficient inhibition of human immunodeficiency virus type 1 reverse transcriptase by aptamers functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Shiang, Yen-Chun; Ou, Chung-Mao; Chen, Shih-Ju; Ou, Ting-Yu; Lin, Han-Jia; Huang, Chih-Ching; Chang, Huan-Tsung

    2013-03-01

    We have developed aptamer (Apt)-conjugated gold nanoparticles (Apt-Au NPs, 13 nm in diameter) as highly effective inhibitors for human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT). Two Apts, RT1t49 (Aptpol) and ODN 93 (AptRH), which recognize the polymerase and RNase H regions of HIV-1 RT, are used to conjugate Au NPs to prepare Aptpol-Au NPs and AptRH-Au NPs, respectively. In addition to DNA sequence, the surface density of the aptamers on Au NPs (nApt-Au NPs; n is the number of aptamer molecules on each Au NP) and the linker length number (Tm; m is the base number of the deoxythymidine linker) between the aptamer and Au NPs play important roles in determining their inhibition activity. A HIV-lentiviral vector-based antiviral assay has been applied to determine the inhibitory effect of aptamers or Apt-Au NPs on the early stages of their replication cycle. The nuclease-stable G-quadruplex structure of 40AptRH-T45-Au NPs shows inhibitory efficiency in the retroviral replication cycle with a decreasing infectivity (40.2%).We have developed aptamer (Apt)-conjugated gold nanoparticles (Apt-Au NPs, 13 nm in diameter) as highly effective inhibitors for human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT). Two Apts, RT1t49 (Aptpol) and ODN 93 (AptRH), which recognize the polymerase and RNase H regions of HIV-1 RT, are used to conjugate Au NPs to prepare Aptpol-Au NPs and AptRH-Au NPs, respectively. In addition to DNA sequence, the surface density of the aptamers on Au NPs (nApt-Au NPs; n is the number of aptamer molecules on each Au NP) and the linker length number (Tm; m is the base number of the deoxythymidine linker) between the aptamer and Au NPs play important roles in determining their inhibition activity. A HIV-lentiviral vector-based antiviral assay has been applied to determine the inhibitory effect of aptamers or Apt-Au NPs on the early stages of their replication cycle. The nuclease-stable G-quadruplex structure of 40AptRH-T45

  3. Electrochemical immunosensor for ultrasensitive detection of microcystin-LR based on graphene-gold nanocomposite/functional conducting polymer/gold nanoparticle/ionic liquid composite film with electrodeposition.

    PubMed

    Ruiyi, Li; Qianfang, Xia; Zaijun, Li; Xiulan, Sun; Junkang, Liu

    2013-06-15

    The study developed an electrochemical immunosensor for ultrasensitive detection of microcystin-LR in water. Graphene oxide and chloroauric acid were alternately electrodeposited on the surface of glassy carbon electrode for 20 cycles to fabricate graphene-gold nanocomposite. The composite was characterized and its apparent heterogeneous electron transfer rate constant (37.28±0.16 cm s (-1)) was estimated by Laviron's model. To immobilize microcystin-LR antibody and improve the electrical conductivity, 2,5-di-(2-thienyl)-1-pyrrole-1-(p-benzoic acid) and chloroauric acid were electrodeposited on the modified electrode in sequence. The ionic liquid was then dropped on the electrode surface and finally microcystin-LR antibody was covalently connected to the conducting polymer film. Experiment showed the electrochemical technique offers control over reaction parameters and excellent repeatability. The graphene-gold nanocomposite and gold nanoparticles enhance electron transfer of Fe(CN)6(3-/4-) to the electrode. The ionic liquid, 1-isobutyl-3-methylimidazolium bis(trifluoromethane-sulfonyl)imide, improves stability of the antibody. The sensor displays good repeatability (RSD=1.2%), sensitive electrochemical response to microcystin-LR in the range of 1.0×10(-16)-8.0×10(-15)M and detection limit of 3.7×10(-17)M (S/N=3). The peak current change of the sensor after and before incubation with 2.0×10(-15)M of microcystin-LR can retain 95% over a 20-weeks storage period. Proposed method presents remarkable improvement of sensitivity, repeatability and stability when compared to present microcystin-LR sensors. It has been successfully applied to the microcystin-LR determination in water samples with a spiked recovery in the range of 96.3-105.8%.

  4. Glassy carbon electrodes sequentially modified by cysteamine-capped gold nanoparticles and poly(amidoamine) dendrimers generation 4.5 for detecting uric acid in human serum without ascorbic acid interference.

    PubMed

    Ramírez-Segovia, A S; Banda-Alemán, J A; Gutiérrez-Granados, S; Rodríguez, A; Rodríguez, F J; Godínez, Luis A; Bustos, E; Manríquez, J

    2014-02-17

    Glassy carbon electrodes (GCE) were sequentially modified by cysteamine-capped gold nanoparticles (AuNp@cysteamine) and PAMAM dendrimers generation 4.5 bearing 128-COOH peripheral groups (GCE/AuNp@cysteamine/PAMAM), in order to explore their capabilities as electrochemical detectors of uric acid (UA) in human serum samples at pH 2. The results showed that concentrations of UA detected by cyclic voltammetry with GCE/AuNp@cysteamine/PAMAM were comparable (deviation <±10%; limits of detection (LOD) and quantification (LOQ) were 1.7×10(-4) and 5.8×10(-4) mg dL(-1), respectively) to those concentrations obtained using the uricase-based enzymatic-colorimetric method. It was also observed that the presence of dendrimers in the GCE/AuNp@cysteamine/PAMAM system minimizes ascorbic acid (AA) interference during UA oxidation, thus improving the electrocatalytic activity of the gold nanoparticles.

  5. Influence of stearic acid on postprandial lipemia and hemostatic function.

    PubMed

    Sanders, Thomas A B; Berry, Sarah E E

    2005-12-01

    It has been suggested that fats rich in stearic acid may result in exaggerated postprandial lipemia and have adverse effects on hemostatic function. The effects of test meals containing different saturated and monounsaturated FA were compared in healthy subjects in a series of studies to investigate this hypothesis. Stearic acid, when present as cocoa butter, resulted in similar postprandial lipemia and factor VII activation compared with a meal containing high-oleic sunflower oil. Stearic acid when presented as shea butter or as randomized stearate-rich TAG resulted in decreased postprandial lipemia and decreased postprandial activation of factor VII. Stearic acid-rich test meals did not result in impaired fibrinolytic activity compared with either a low-fat meal or a meal high in oleate. The difference in responses between the different stearic acid-rich fats appears to be due to varying solid fat contents of the fats at 37 degrees C.

  6. Glucose-Sensitive Hydrogel Optical Fibers Functionalized with Phenylboronic Acid.

    PubMed

    Yetisen, Ali K; Jiang, Nan; Fallahi, Afsoon; Montelongo, Yunuen; Ruiz-Esparza, Guillermo U; Tamayol, Ali; Zhang, Yu Shrike; Mahmood, Iram; Yang, Su-A; Kim, Ki Su; Butt, Haider; Khademhosseini, Ali; Yun, Seok-Hyun

    2017-02-13

    Hydrogel optical fibers are utilized for continuous glucose sensing in real time. The hydrogel fibers consist of poly(acrylamide-co-poly(ethylene glycol) diacrylate) cores functionalized with phenylboronic acid. The complexation of the phenylboronic acid and cis-diol groups of glucose enables reversible changes of the hydrogel fiber diameter. The analyses of light propagation loss allow for quantitative glucose measurements within the physiological range.

  7. A DFT study of a new class of gold nanocluster-photochrome multi-functional switches.

    PubMed

    Fihey, Arnaud; Maurel, François; Perrier, Aurélie

    2014-12-21

    With the help of a computational scheme combining molecular dynamics, DFT and TD-DFT methods, the conformational, electronic and optical properties of a new class of hybrid compounds where a photochromic molecule belonging to the dithienylethene family (DTE) is covalently linked to a Au25 nanocluster (gold nanocluster or GNC) are investigated. We compare two types of hybrid GNC-DTE systems where the aromatic linker between the metallic and the DTE moieties is either a phenyl or a thiophene ring. By examining the perturbation of the DTE electronic structure after grafting upon the GNC, we show that the hybrid system with a phenyl linker should preserve its photochromic activity. For the latter system, we have then studied the possible energy and electron transfer between the GNC and the DTE units. The energy transfer between the two moieties can be a priori discarded while a uni-directional electron transfer should take place from the GNC to the excited DTE. We show that this transfer can be controlled by switching the state of the molecule.

  8. A microcantilever-based silver ion sensor using DNA-functionalized gold nanoparticles as mass amplifier.

    PubMed

    You, Juneseok; Song, Yeongjin; Park, Chanho; Jang, Kuewhan; Na, Sungsoo

    2017-04-13

    Silver ions have been used to sterilize many products, however, it has recently been demonstrated that silver ions can be toxic. This toxicity has been researched over many years with the lethal concentration at 10 μM. Silver ions can accumulate through the food chain, causing serious health problems in species. Hence, there is a need for a commercially available silver ion sensor, with high detection sensitivity. In this work, we develop an ultra-sensitive silver ion sensor platform, using cytosine-based DNA and gold nanoparticle as the mass amplifier. We achieve a lower detection limit for silver ions of 10 pM; this detection limit is one million times lower than the toxic concentration. Using our sensor platform we examine highly selective characteristics of other typical ions in water from natural sources. Furthermore, our sensor platform is able to detect silver ions in a real practical sample of commercially available drinking water. Our sensor platform, which we have termed a 'MAIS' (Mass Amplifier Ion Sensor), with the simple detection procedure, high sensitivity, selectivity and real practical applicability has shown potential as an early toxicity assessment of silver ions for the environment.

  9. DNA Functionalized Direct Electro-deposited Gold nanoaggregates for Efficient Detection of Salmonella typhi.

    PubMed

    Singh, Anu; Choudhary, Meenakshi; Singh, M P; Verma, H N; Singh, Surinder P; Arora, Kavita

    2015-10-01

    Direct electro-deposition of gold nano-aggregates (GNAs) was carried out to fabricate electrochemical DNA biosensor for the detection of Salmonella typhi in urine and blood samples. Size of depositing GNAs was controlled by regulating electro-deposition parameters at physiological pH. This facilitated achieving biocompatible GNAs with desired electrochemical behaviour and enhanced surface area to achieve higher DNA loading. Salmonella typhi (S. typhi) specific 5'amine modified single stranded DNA (ssDNA, NH2-(C6)-5'CGTGCGCGACGCCCGCCGCC3') was covalently immobilized on to GNAs-ITO (indium tin oxide) electrode. Dynamic detection range of 4 aM - 24 fM. using methylene blue (MB) redox indicator at 25 °C was achieved using ssDNA-GNAs-ITO bio-electrode to detect the complimentary target sequence (5'GGCGGCGGGCGTCGCGCACG 3') through differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Selectivity of designed electrode was ascertained by response signal for complementary, non-complementary and 1 base mismatch sequences. Furthermore, clear distinction in complementary and non-complimentary targets was obtained by EIS studies for genomic DNA in culture spiked biological fluids 'CSBF' (blood and urine). This study for detection of S. typhi from urine and blood samples using fabricated ssDNA-GNA-ITO bio-electrode showed promising results and have potential to be used as sensor for real patient samples.

  10. Coalescence of functional gold and monodisperse silver nanoparticles mediated by black Panax ginseng Meyer root extract.

    PubMed

    Wang, Dandan; Markus, Josua; Kim, Yeon-Ju; Wang, Chao; Jiménez Pérez, Zuly Elizabeth; Ahn, Sungeun; Aceituno, Verónica Castro; Mathiyalagan, Ramya; Yang, Deok Chun

    A rapid biological synthesis of multifunctional gold nanoparticle (AuNp) and monodisperse silver nanoparticle (AgNp) was achieved by an aqueous extract of black Panax ginseng Meyer root. The physicochemical transformation into black ginseng (BG) greatly enhanced the pharmacological activities of white ginseng and its minor ginsenoside content. The optimal temperature conditions and kinetics of bioreduction were investigated. Formation of BG-AuNps and BG-AgNps was verified by ultraviolet-visible spectrophotometry at 548 and 412 nm, respectively. The biosynthesized BG-AgNps were spherical and monodisperse with narrow distribution, while BG-AuNps were icosahedral-shaped and moderately polydisperse. Synthesized nanoparticles exhibited long-term stability in buffers of pH 7.0-8.0 and biological media (5% bovine serum albumin) at an ambient temperature and at 37°C. BG-AgNps showed effective antibacterial activity against Escherichia coli and Staphylococcus aureus. BG-AuNps and BG-AgNps demonstrated increased scavenging activity against 2,2-diphenyl-1-picrylhydrazyl free radicals. In addition, BG-AuNps and BG-AgNps were nontoxic to HaCaT and MCF-7 cells; the latter showed no cytotoxicity at concentrations lower than 10 µg/mL. At higher concentrations, BG-AgNps exhibited apparent apoptotic activity in MCF-7 breast cancer cell line through reactive oxygen species generation and nuclear fragmentation.

  11. Coalescence of functional gold and monodisperse silver nanoparticles mediated by black Panax ginseng Meyer root extract

    PubMed Central

    Wang, Dandan; Markus, Josua; Kim, Yeon-Ju; Wang, Chao; Jiménez Pérez, Zuly Elizabeth; Ahn, Sungeun; Aceituno, Verónica Castro; Mathiyalagan, Ramya; Yang, Deok Chun

    2016-01-01

    A rapid biological synthesis of multifunctional gold nanoparticle (AuNp) and monodisperse silver nanoparticle (AgNp) was achieved by an aqueous extract of black Panax ginseng Meyer root. The physicochemical transformation into black ginseng (BG) greatly enhanced the pharmacological activities of white ginseng and its minor ginsenoside content. The optimal temperature conditions and kinetics of bioreduction were investigated. Formation of BG-AuNps and BG-AgNps was verified by ultraviolet–visible spectrophotometry at 548 and 412 nm, respectively. The biosynthesized BG-AgNps were spherical and monodisperse with narrow distribution, while BG-AuNps were icosahedral-shaped and moderately polydisperse. Synthesized nanoparticles exhibited long-term stability in buffers of pH 7.0–8.0 and biological media (5% bovine serum albumin) at an ambient temperature and at 37°C. BG-AgNps showed effective antibacterial activity against Escherichia coli and Staphylococcus aureus. BG-AuNps and BG-AgNps demonstrated increased scavenging activity against 2,2-diphenyl-1-picrylhydrazyl free radicals. In addition, BG-AuNps and BG-AgNps were nontoxic to HaCaT and MCF-7 cells; the latter showed no cytotoxicity at concentrations lower than 10 µg/mL. At higher concentrations, BG-AgNps exhibited apparent apoptotic activity in MCF-7 breast cancer cell line through reactive oxygen species generation and nuclear fragmentation. PMID:28008248

  12. Esterification of fatty acid catalyzed by hydrothermally stable propylsulfonic acid-functionalized mesoporous silica SBA-15.

    PubMed

    Mar, Win Win; Somsook, Ekasith

    2013-01-01

    Propylsulfonic acid-functionalized mesoporous silica SBA-15 has been synthesized via one-step strategy at 130°C based on the co-condensation of TEOS and MPTMS in the presence of Pluronic 123 polymer and H₂O₂ in HCl aqueous solution. The synthesized solid exhibited hydrothermal stability in boiling water without significant change in textural properties. The catalytic performance of the synthesized solid was studied in the esterification of oleic acid with methanol. The experimental results revealed that the large mesopore structures of SBA-15-PrSO₃H solid synthesized at 130°C could favor a facile access of oleic acid to the acid sites, making the comparable activity to that of phenyl ethyl sulfonic acid functionalized silica and higher than that of dry amberlyst-15.

  13. New Functions and Potential Applications of Amino Acids.

    PubMed

    Uneyama, Hisayuki; Kobayashi, Hisamine; Tonouchi, Naoto

    2016-11-22

    Currently, several types of amino acids are being produced and used worldwide. Nevertheless, several new functions of amino acids have been recently discovered that could result in other applications. For example, oral stimulation by glutamate triggers the cephalic phase response to prepare for food digestion. Further, the stomach and intestines have specific glutamate-recognizing systems in their epithelial mucosa. Regarding clinical applications, addition of monosodium glutamate to the medicinal diet has been shown to markedly enhance gastric secretion in a vagus-dependent manner. Branched-chain amino acids (BCAAs) are the major components of muscles, and ingestion of BCAAs has been found to be effective for decreasing muscle pain. BCAAs are expected to be a solution for the serious issue of aging. Further, ingestion of specific amino acids could be beneficial. Glycine can be ingested for good night's sleep: glycine ingestion before bedtime significantly improved subjective sleep quality. Ingestion of alanine and glutamine effectively accelerates alcohol metabolism, and ingestion of cystine and theanine effectively prevents colds. Finally, amino acids could be used in a novel clinical diagnostic method: the balance of amino acids in the blood could be an indicator of the risk of diseases such as cancer. These newly discovered functions of amino acids are expected to contribute to the resolution of various issues.

  14. Biological functions of iduronic acid in chondroitin/dermatan sulfate.

    PubMed

    Thelin, Martin A; Bartolini, Barbara; Axelsson, Jakob; Gustafsson, Renata; Tykesson, Emil; Pera, Edgar; Oldberg, Åke; Maccarana, Marco; Malmstrom, Anders

    2013-05-01

    The presence of iduronic acid in chondroitin/dermatan sulfate changes the properties of the polysaccharides because it generates a more flexible chain with increased binding potentials. Iduronic acid in chondroitin/dermatan sulfate influences multiple cellular properties, such as migration, proliferation, differentiation, angiogenesis and the regulation of cytokine/growth factor activities. Under pathological conditions such as wound healing, inflammation and cancer, iduronic acid has diverse regulatory functions. Iduronic acid is formed by two epimerases (i.e. dermatan sulfate epimerase 1 and 2) that have different tissue distribution and properties. The role of iduronic acid in chondroitin/dermatan sulfate is highlighted by the vast changes in connective tissue features in patients with a new type of Ehler-Danlos syndrome: adducted thumb-clubfoot syndrome. Future research aims to understand the roles of the two epimerases and their interplay with the sulfotransferases involved in chondroitin sulfate/dermatan sulfate biosynthesis. Furthermore, a better definition of chondroitin/dermatan sulfate functions using different knockout models is needed. In this review, we focus on the two enzymes responsible for iduronic acid formation, as well as the role of iduronic acid in health and disease.

  15. Folic acid-Functionalized Nanoparticles for Enhanced Oral Drug Delivery

    PubMed Central

    Roger, Emilie; Kalscheuer, Stephen; Kirtane, Ameya; Guru, Bharath Raja; Grill, Alex E.; Whittum-Hudson, Judith; Panyam, Jayanth

    2012-01-01

    The oral absorption of drugs that have poor bioavailability can be enhanced by encapsulation in polymeric nanoparticles. Transcellular transport of nanoparticle-encapsulated drug, possibly through transcytosis, is likely the major mechanism through which nanoparticles improve drug absorption. We hypothesized that the cellular uptake and transport of nanoparticles can be further increased by targeting the folate receptors expressed on the intestinal epithelial cells. The objective of this research was to study the effect of folic acid functionalization on transcellular transport of nanoparticle-encapsulated paclitaxel, a chemotherapeutic with poor oral bioavailability. Surface-functionalized poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles loaded with paclitaxel were prepared by the interfacial activity assisted surface functionalization technique. Transport of paclitaxel-loaded nanoparticles was investigated using Caco-2 cell monolayers as an in vitro model. Caco-2 cells were found to express folate receptor and the drug efflux protein, p-glycoprotein, to high levels. Encapsulation of paclitaxel in PLGA nanoparticles resulted in a 5-fold increase in apparent permeability (Papp) across Caco-2 cells. Functionalization of nanoparticles with folic acid further increased the transport (8-fold higher transport compared to free paclitaxel). Confocal microscopic studies showed that folic acid-functionalized nanoparticles were internalized by the cells and that nanoparticles did not have any gross effects on tight junction integrity. In conclusion, our studies indicate that folic acid functionalized nanoparticles have the potential to enhance the oral absorption of drugs with poor oral bioavailability. PMID:22670575

  16. Sensitive immunosensor for tumor necrosis factor α based on dual signal amplification of ferrocene modified self-assembled peptide nanowire and glucose oxidase functionalized gold nanorod.

    PubMed

    Sun, Zhifang; Deng, Liu; Gan, Hao; Shen, Rujuan; Yang, Minghui; Zhang, Yi

    2013-01-15

    Sensitive electrochemical immunosensor for the detection of protein biomarker tumor necrosis factor α (TNF-α) was reported that uses ferrocene carboxylic acid (Fc) functionalized self-assembled peptide nanowire (Fc-PNW) as sensor platform and glucose oxidase (GOx) modified gold nanorod (GNR) as label. Greatly enhanced sensitivity is achieved based on a dual signal amplification strategy: first, the synthesized Fc-PNW used as the sensor platform increased the loading of primary anti-TNF-α antibody (Ab(1)) onto electrode surface due to its large surface area. At the same time, the Fc moiety on the nanowire is used as a mediator for GOx to catalyze the glucose reaction. Second, multiple GOx and secondary anti-TNF-α antibody (Ab(2)) molecules are bounded onto each GNR to increase the sensitivity of the immunosensor. After the preparation of the immunosensor based on the traditional sandwich protocol, the response of the immunosensor towards glucose was used as a signal to differentiate various concentrations of TNF-α. The resulting immunosensor has high sensitivity, wide linear range (0.005-10ng/mL) and good selectivity. This immunosensor preparation strategy is a promising platform for clinical screening of protein biomarkers.

  17. An Electrochemical Immunosensor for Detection of Staphylococcus aureus Bacteria Based on Immobilization of Antibodies on Self-Assembled Monolayers-Functionalized Gold Electrode

    PubMed Central

    Braiek, Mohamed; Rokbani, Karima Bekir; Chrouda, Amani; Mrabet, Béchir; Bakhrouf, Amina; Maaref, Abderrazak; Jaffrezic-Renault, Nicole

    2012-01-01

    The detection of pathogenic bacteria remains a challenge for the struggle against biological weapons, nosocomial diseases, and for food safety. In this research, our aim was to develop an easy-to-use electrochemical immunosensor for the detection of pathogenic Staphylococcus aureus ATCC25923. The biosensor was elaborated by the immobilization of anti-S. aureus antibodies using a self-assembled monolayer (SAMs) of 3-Mercaptopropionic acid (MPA). These molecular assemblies were spontaneously formed by the immersion of the substrate in an organic solvent containing the SAMs that can covalently bond to the gold surface. The functionalization of the immunosensor was characterized using two electrochemical techniques: cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). Here, the analysis was performed in phosphate buffer with ferro/ferricyanide as the redox probe. The EIS technique was used for affinity assays: antibody-cell binding. A linear relationship between the increment in the electron transfer resistance (RCT) and the logarithmic value of S. aureus concentration was observed between 10 and 106 CFU/mL. The limit of detection (LOD) was observed at 10 CFU/mL, and the reproducibility was calculated to 8%. Finally, a good selectivity versus E. coli and S. epidermidis was obtained for our developed immunosensor demonstrating its specificity towards only S. aureus. PMID:25586032

  18. Gold Nanorods, DNA Origami, and Porous Silicon Nanoparticle-functionalized Biocompatible Double Emulsion for Versatile Targeted Therapeutics and Antibody Combination Therapy.

    PubMed

    Kong, Feng; Zhang, Hongbo; Qu, Xiangmeng; Zhang, Xu; Chen, Dong; Ding, Ruihua; Mäkilä, Ermei; Salonen, Jarno; Santos, Hélder A; Hai, Mingtan

    2016-12-01

    Gold nanorods, DNA origami, and porous silicon nanoparticle-functionalized biocompatible double emulsion are developed for versatile molecular targeted therapeutics and antibody combination therapy. This advanced photothermal responsive all-in-one biocompatible platform can be easily formed with great therapeutics loading capacity for different cancer treatments with synergism and multidrug resistance inhibition, which has great potential in advancing biomedical applications.

  19. Anacardic Acid, Salicylic Acid, and Oleic Acid Differentially Alter Cellular Bioenergetic Function in Breast Cancer Cells.

    PubMed

    Radde, Brandie N; Alizadeh-Rad, Negin; Price, Stephanie M; Schultz, David J; Klinge, Carolyn M

    2016-11-01

    Anacardic acid is a dietary and medicinal phytochemical that inhibits breast cancer cell proliferation and uncouples oxidative phosphorylation (OXPHOS) in isolated rat liver mitochondria. Since mitochondrial-targeted anticancer therapy (mitocans) may be useful in breast cancer, we examined the effect of anacardic acid on cellular bioenergetics and OXPHOS pathway proteins in breast cancer cells modeling progression to endocrine-independence: MCF-7 estrogen receptor α (ERα)+ endocrine-sensitive; LCC9 and LY2 ERα+, endocrine-resistant, and MDA-MB-231 triple negative breast cancer (TNBC) cells. At concentrations similar to cell proliferation IC50 s, anacardic acid reduced ATP-linked oxygen consumption rate (OCR), mitochondrial reserve capacity, and coupling efficiency while increasing proton leak, reflecting mitochondrial toxicity which was greater in MCF-7 compared to endocrine-resistant and TNBC cells. These results suggest tolerance in endocrine-resistant and TNBC cells to mitochondrial stress induced by anacardic acid. Since anacardic acid is an alkylated 2-hydroxybenzoic acid, the effects of salicylic acid (SA, 2-hydroxybenzoic acid moiety) and oleic acid (OA, monounsaturated alkyl moiety) were tested. SA inhibited whereas OA stimulated cell viability. In contrast to stimulation of basal OCR by anacardic acid (uncoupling effect), neither SA nor OA altered basal OCR- except OA inhibited basal and ATP-linked OCR, and increased ECAR, in MDA-MB-231 cells. Changes in OXPHOS proteins correlated with changes in OCR. Overall, neither the 2-hydroxybenzoic acid moiety nor the monounsaturated alky moiety of anacardic acid is solely responsible for the observed mitochondria-targeted anticancer activity in breast cancer cells and hence both moieties are required in the same molecule for the observed effects. J. Cell. Biochem. 117: 2521-2532, 2016. © 2016 Wiley Periodicals, Inc.

  20. Direct Filling Golds: An In-Vitro Study of Microleakage as a Function of Condensation Force: An In-Vivo Study of Marginal Quality

    DTIC Science & Technology

    1979-01-01

    properties of direct gold restorative materials. Peterson23 determined that as the annealing temperature of gold foil increases above 2000 C both the...controlled mica tray was below 2000 C. _ Spencer et a124 measured the BIN as a function of annealing temperature between 260 and 4500 C and determined that the...Pacific Society of Periodontology I i ° i - - ~ K iiI IN III I V -I I II? I F I I I I I ~~1:1 II Ii I a I pI I I I I _ _____ -~ - ____ ~ -~-~ DIRECT

  1. Two-dimensional self-assembly of DNA-functionalized gold nanoparticles

    NASA Astrophysics Data System (ADS)

    Wang, Wenjie; Zhang, Honghu; Hagen, Noah; Kuzmenko, Ivan; Akinc, Mufit; Travesset, Alex; Mallapragada, Surya; Vaknin, David

    2D superlattices of nanoparticles (NPs) are promising candidates for nano-devices. It is still challenging to develop a simple yet efficient protocol to assemble NPs in a controlled manner. Here, we report on formation of 2D Gibbs monolayers of single-stranded DNA-coated gold nanoparticles (ssDNA-AuNPs) at the air-water interface by manipulation of salts contents. MgCl2 and CaCl2 in solutions facilitate the accumulation of the non-complementary ssDNA-AuNPs on aqueous surfaces. Grazing-incidence small-angle X-ray scattering (GISAXS) and X-ray reflectivity show that the surface AuNPs assembly forms a mono-particle layer and undergoes a transformation from short-range to long-range (hexagonal) order above a threshold of [MgCl2] or [CaCl2]. For solutions that include two kinds of ssDNA-AuNPs with complementary base-pairing, the surface AuNPs form a thicker film and only in-plane short-range order is observed. By using other salts (NaCl or LaCl3) at concentrations of similar ionic strength to those of MgCl2 or CaCl2, we find that surface adsorbed NPs lack any orders. X-ray fluorescence measurements provide direct evidence of surface enrichment of AuNPs and divalent ions (Ca2 +) . The work was supported by the Office of Basic Energy Sciences, USDOE under Contract No. DE-AC02-07CH11358 and DE-AC02-06CH11357.

  2. Functional characterization of Caenorhabditis elegans heteromeric amino acid transporters.

    PubMed

    Veljkovic, Emilija; Stasiuk, Susan; Skelly, Patrick J; Shoemaker, Charles B; Verrey, François

    2004-02-27

    Mammalian heteromeric amino acid transporters (HATs) are composed of a multi-transmembrane spanning catalytic protein covalently associated with a type II glycoprotein (e.g. 4F2hc, rBAT) through a disulfide bond. Caenorhabditis elegans has nine genes encoding close homologues of the HAT catalytic proteins. Three of these genes (designated AAT-1 to AAT-3) have a much higher degree of similarity to the mammalian homologues than the other six, including the presence of a cysteine residue at the position known to form a disulfide bridge to the glycoprotein partner in mammalian HATs. C. elegans also has two genes encoding homologues of the heteromeric amino acid transporter type II glycoprotein subunits (designated ATG-1 and ATG-2). Both ATG, and/or AAT-1, -2, -3 proteins were expressed in Xenopus oocytes and tested for amino acid transport function. This screen revealed that AAT-1 and AAT-3 facilitate amino acid transport when expressed together with ATG-2 but not with ATG-1 or the mammalian type II glycoproteins 4F2hc and rBAT. AAT-1 and AAT-3 covalently bind to both C. elegans ATG glycoproteins, but only the pairs with ATG-2 traffic to the oocyte surface. Both of these functional, surface-expressed C. elegans HATs transport most neutral amino acids and display the highest transport rate for l-Ala and l-Ser (apparent K(m) 100 microm range). Similar to their mammalian counterparts, the C. elegans HATs function as (near) obligatory amino acid exchangers. Taken together, this study demonstrates that the heteromeric structure and the amino acid exchange function of HATs have been conserved throughout the evolution of nematodes to mammals.

  3. Acid-sensing ion channels in gastrointestinal function.

    PubMed

    Holzer, Peter

    2015-07-01

    Gastric acid is of paramount importance for digestion and protection from pathogens but, at the same time, is a threat to the integrity of the mucosa in the upper gastrointestinal tract and may give rise to pain if inflammation or ulceration ensues. Luminal acidity in the colon is determined by lactate production and microbial transformation of carbohydrates to short chain fatty acids as well as formation of ammonia. The pH in the oesophagus, stomach and intestine is surveyed by a network of acid sensors among which acid-sensing ion channels (ASICs) and acid-sensitive members of transient receptor potential ion channels take a special place. In the gut, ASICs (ASIC1, ASIC2, ASIC3) are primarily expressed by the peripheral axons of vagal and spinal afferent neurons and are responsible for distinct proton-gated currents in these neurons. ASICs survey moderate decreases in extracellular pH and through these properties contribute to a protective blood flow increase in the face of mucosal acid challenge. Importantly, experimental studies provide increasing evidence that ASICs contribute to gastric acid hypersensitivity and pain under conditions of gastritis and peptic ulceration but also participate in colonic hypersensitivity to mechanical stimuli (distension) under conditions of irritation that are not necessarily associated with overt inflammation. These functional implications and their upregulation by inflammatory and non-inflammatory pathologies make ASICs potential targets to manage visceral hypersensitivity and pain associated with functional gastrointestinal disorders. This article is part of the Special Issue entitled 'Acid-Sensing Ion Channels in the Nervous System'.

  4. Simple and Rapid Functionalization of Gold Nanorods with Oligonucleotides Using an mPEG-SH/Tween 20-Assisted Approach.

    PubMed

    Li, Jiuxing; Zhu, Bingqing; Zhu, Zhi; Zhang, Yicong; Yao, Xiujie; Tu, Song; Liu, Rudi; Jia, Shasha; Yang, Chaoyong James

    2015-07-21

    DNA conjugated gold nanorods (AuNRs) are widely applied for nanostructure assembly, gene therapy, biosensing, and drug delivery. However, it is still a great challenge to attach thiolated DNA on AuNRs, because the positively charged AuNRs readily aggregate in the presence of negatively charged DNA. This article reports an mPEG-SH/Tween 20-assisted method to load thiolated DNA on AuNRs in 1 h. Tween 20 and mPEG-SH are used to synergistically displace CTAB on the surface of AuNRs by repeated centrifugation and resuspension, and thiolated DNA are attached to AuNRs in the presence of 1 M NaCl, 100 mM MgCl2, or 100 mM citrate. AuNRs with different sizes and aspect ratios can be functionalized with DNA by this method. The number of DNA loaded on each AuNR can be easily controlled by the concentrations of mPEG-SH and Tween 20 or the ratio between DNA and AuNR. Functionalized AuNRs were used for nanoparticle assembly and cancer cell imaging to confirm that DNA anchored on the surface of AuNRs retains its hybridization and molecular recognition capability. The new method is easy, rapid, and robust for the preparation of DNA functionalized AuNRs for a variety of applications such as cancer therapy, drug delivery, self-assembly, and imaging.

  5. Catalytic reduction of organic dyes at gold nanoparticles impregnated silica materials: influence of functional groups and surfactants

    NASA Astrophysics Data System (ADS)

    Azad, Uday Pratap; Ganesan, Vellaichamy; Pal, Manas

    2011-09-01

    Gold nanoparticles (Au NPs) in three different silica based sol-gel matrixes with and without surfactants are prepared. They are characterized by UV-vis absorbance and transmission electron microscopic (TEM) studies. The size and shape of Au NPs varied with the organo-functional group present in the sol-gel matrix. In the presence of mercaptopropyl functionalized organo-silica, large sized (200-280 nm) spherical Au NPs are formed whereas in the presence of aminopropyl functionalized organo-silica small sized (5-15 nm) Au NPs are formed inside the tube like organo-silica. Further, it is found that Au NPs act as efficient catalyst for the reduction of organic dyes. The catalytic rate constant is evaluated from the decrease in absorbance of the dye molecules. Presence of cationic or anionic surfactants greatly influences the catalytic reaction. The other factors like hydrophobicity of the organic dyes, complex formation of the dyes with anionic surfactants, repulsion between dyes and cationic surfactant, adsorption of dyes on the Au NPs also play important role on the reaction rate.

  6. Aptamer functionalized hydrophilic polymer monolith with gold nanoparticles modification for the sensitive detection of human α-thrombin.

    PubMed

    Chen, Yuanbo; Deng, Nan; Wu, Ci; Liang, Yu; Jiang, Bo; Yang, Kaiguang; Liang, Zhen; Zhang, Lihua; Zhang, Yukui

    2016-07-01

    Low abundant proteins of body fluids participate nearly all physiological processes and indicate various kinds of diseases. The development of specific enrichment techniques is the key to identify and quantify the low abundant proteins. Herein, a novel kind of aptamer functionalized hydrophilic polymer monolith was developed for the specific enrichment and detection of human α-thrombin from the human plasma. Human α-thrombin aptamer, with thiol group modified at the 5' terminal, was immobilized on the gold nanoparticles (AuNPs) modified poly(glycidyl methacrylate-co-poly(ethylene glycol) diacrylate) monolithic column, with the binding capacity of 277.1μmol/L. Due to the hydrophilic poly(ethylene glycol) diacrylate) as the cross-linking monomer, the detection recovery of the aptamer-functionalized hydrophilic polymer monolithic column could reach to 92.6±5.2% (n=3) and the dynamic range could reach 0.5-300ng/μL (S/N>10) with on-line UV detection. Meanwhile, the column could run over 100 times, because the poly(glycidyl methacrylate-co-poly(ethylene glycol) diacrylate) stability structure and the AuNPs improved the stability of the matrix material. Furthermore, this column could even capture the target α-thrombin, which was spiked in 1000 folds of original human plasma. All these results demonstrated the great potential of the prepared aptamer functionalized hydrophilic polymer monolith for the recognition of the trace proteins in the biological samples.

  7. Direct Synthesis and Morphological Characterization of Gold-Dendrimer Nanocomposites Prepared Using PAMAM Succinamic Acid Dendrimers: Preliminary Study of the Calcification Potential

    PubMed Central

    Vasile, E.; Serafim, A.; Petre, D.; Giol, D.; Dubruel, P.; Iovu, H.; Stancu, I. C.

    2014-01-01

    Gold-dendrimer nanocomposites were obtained for the first time by a simple colloidal approach based on the use of polyamidoamine dendrimers with succinamic acid terminal groups and dodecanediamine core. Spherical and highly crystalline nanoparticles with dimensions between 3 nm and 60 nm, and size-polydispersity depending on the synthesis conditions, have been generated. The influence of the stoichiometric ratio and the structural and architectural features of the dendrimers on the properties of the nanocomposites has been described. The self-assembling behaviour of these materials produces gold-dendrimer nanostructured porous networks with variable density, porosity, and composition. The investigations of the reaction systems, by TEM, at two postsynthesis moments, allowed to preliminary establish the control over the properties of the nanocomposite products. Furthermore, this study allowed better understanding of the mechanism of nanocomposite generation. Impressively, in the early stages of the synthesis, the organization of gold inside the dendrimer molecules has been evidenced by micrographs. Growth and ripening mechanisms further lead to nanoparticles with typical characteristics. The potential of such nanocomposite particles to induce calcification when coating a polymer substrate was also investigated. PMID:24600316

  8. Functional amino acids in fish nutrition, health and welfare.

    PubMed

    Andersen, Synne M; Waagbø, Rune; Espe, Marit

    2016-01-01

    Protein is the most expensive part of fish diets and supplies amino acids (AA) for energy, growth, protein synthesis and as substrates for key metabolic pathways. Functional AA is a term used to describe AA that are involved in cellular processes apart from protein synthesis. A deficiency, or imbalance, in functional AA may impair body metabolism and homeostasis. Recent years have seen an increased interest in AA to increase disease resistance, immune response, reproduction, behavior and more. This has led to a boost of commercially available functional fish feeds that aim to optimize fish performance and quality of the product. This review aim to collect recent findings of functional AA and of how they may improve fish health and welfare. It will focus on functional properties of some of the most studied AA, namely arginine, glutamine, glutamate, tryptophan, sulfur amino acids (methionine, cysteine and taurine), histidine and branched chain amino acids. Where information is not available in fish, we will point towards functions known in animals and humans, with possible translational functions to fish.

  9. AFM Study of Surface Nanobubbles on Binary Self-Assembled Monolayers on Ultraflat Gold with Identical Macroscopic Static Water Contact Angles and Different Terminal Functional Groups.

    PubMed

    Song, Bo; Chen, Kun; Schmittel, Michael; Schönherr, Holger

    2016-11-01

    All experimental findings related to surface nanobubbles, such as their pronounced stability and the striking differences of macroscopic and apparent nanoscopic contact angles, need to be addressed in any theory or model of surface nanobubbles. In this work we critically test a recent explanation of surface nanobubble stability and their consequences and contrast this with previously proposed models. In particular, we elucidated the effect of surface chemical composition of well-controlled solid-aqueous interfaces of identical roughness and defect density on the apparent nanoscopic contact angles. Expanding on a previous atomic force microscopy (AFM) study on the systematic variation of the macroscopic wettability using binary self-assembled monolayers (SAMs) on ultraflat template stripped gold (TSG), we assessed here the effect of different surface chemical composition for macroscopically identical static water contact angles. SAMs on TSG with a constant macroscopic water contact angle of 81 ± 2° were obtained by coadsorption of a methyl-terminated thiol and a second thiol with different terminal functional groups, including hydroxy, amino, and carboxylic acid groups. In addition, surface nanobubbles formed by entrainment of air on SAMs of a bromoisobutyrate-terminated thiol were analyzed by AFM. Despite the widely differing surface potentials and different functionality, such as hydrogen bond acceptor or donor, and different dipole moments and polarizability, the nanoscopic contact angles (measured through the condensed phase and corrected for AFM tip broadening effects) were found to be 145 ± 10° for all surfaces. Hence, different chemical functionalities at identical macroscopic static water contact angle do not noticeably influence the apparent nanoscopic contact angle of surface nanobubbles. This universal contact angle is in agreement with recent models that rely on contact line pinning and the equilibrium of gas outflux due to the Laplace pressure and

  10. Specific Neuron Placement on Gold and Silicon Nitride-Patterned Substrates through a Two-Step Functionalization Method.

    PubMed

    Mescola, Andrea; Canale, Claudio; Prato, Mirko; Diaspro, Alberto; Berdondini, Luca; Maccione, Alessandro; Dante, Silvia

    2016-06-28

    The control of neuron-substrate adhesion has been always a challenge for fabricating neuron-based cell chips and in particular for multielectrode array (MEA) devices, which warrants the investigation of the electrophysiological activity of neuronal networks. The recent introduction of high-density chips based on the complementary metal oxide semiconductor (CMOS) technology, integrating thousands of electrodes, improved the possibility to sense large networks and raised the challenge to develop newly adapted functionalization techniques to further increase neuron electrode localization to avoid the positioning of cells out of the recording area. Here, we present a simple and straightforward chemical functionalization method that leads to the precise and exclusive positioning of the neural cell bodies onto modified electrodes and inhibits, at the same time, cellular adhesion in the surrounding insulator areas. Different from other approaches, this technique does not require any adhesion molecule as well as complex patterning technique such as μ-contact printing. The functionalization was first optimized on gold (Au) and silicon nitride (Si3N4)-patterned surfaces. The procedure consisted of the introduction of a passivating layer of hydrophobic silane molecules (propyltriethoxysilane [PTES]) followed by a treatment of the Au surface using 11-amino-1-undecanethiol hydrochloride (AT). On model substrates, well-ordered neural networks and an optimal coupling between a single neuron and single micrometric functionalized Au surface were achieved. In addition, we presented the preliminary results of this functionalization method directly applied on a CMOS-MEA: the electrical spontaneous spiking and bursting activities of the network recorded for up to 4 weeks demonstrate an excellent and stable neural adhesion and functional behavior comparable with what expected using a standard adhesion factor, such as polylysine or laminin, thus demonstrating that this procedure can be

  11. Synthesis and characterization of carboxylic acid functionalized silicon nanoparticles

    NASA Astrophysics Data System (ADS)

    Shaner, Ted V.

    Silicon nanoparticles are of great interest in a great number of fields. Silicon nanoparticles show great promise particularly in the field of bioimaging. Carboxylic acid functionalized silicon nanoparticles have the ability to covalently bond to biomolecules through the conjugation of the carboxylic acid to an amine functionalized biomolecule. This thesis explores the synthesis of silicon nanoparticles functionalized by both carboxylic acids and alkenes and their carboxylic acid functionality. Also discussed is the characterization of the silicon nanoparticles by the use of x-ray spectroscopy. Finally, the nature of the Si-H bond that is observed on the surface of the silicon nanoparticles will be investigated using photoassisted exciton mediated hydrosilation reactions. The silicon nanoparticles are synthesized from both carboxylic acids and alkenes. However, the lack of solubility of diacids is a significant barrier to carboxylic acid functionalization by a mixture of monoacids and diacids. A synthesis route to overcome this obstacle is to synthesize silicon nanoparticles with terminal vinyl group. This terminal vinyl group is distal to the surface of the silicon nanoparticle. The conversion of the vinyl group to a carboxylic acid is accomplished by oxidative cleavage using ozonolysis. The carboxylic acid functionalized silicon nanoparticles were then successfully conjugated to amine functionalized DNA strand through an n-hydroxy succinimide ester activation step, which promotes the formation of the amide bond. Conjugation was characterized by TEM and polyacrylamide gel electrophoresis (PAGE). The PAGE results show that the silicon nanoparticle conjugates move slower through the polyacrylamide gel, resulting in a significant separation from the nonconjugated DNA. The silicon nanoparticles were then characterized by the use of x-ray absorption near edge spectroscopy (Xanes) and x-ray photoelectron spectroscopy (XPS) to investigate the bonding and chemical

  12. Scaffold electrodes based on thioctic acid-capped gold nanoparticles coordinated Alcohol Dehydrogenase and Azure A films for high performance biosensor.

    PubMed

    Gómez-Anquela, C; García-Mendiola, T; Abad, José M; Pita, M; Pariente, F; Lorenzo, E

    2015-12-01

    Nanometric size gold nanoparticles capped with thiotic acid are used to coordinate with the Zn (II) present in the catalytic center of Alcohol Dehydrogenase (ADH). In combination with the NADH oxidation molecular catalyst Azure A, electrografted onto carbon screen-printed electrodes, they are used as scaffold electrodes for the construction of a very efficient ethanol biosensor. The final biosensing device exhibits a highly efficient ethanol oxidation with low overpotential of -0.25 V besides a very good analytical performance with a detection limit of 0.14±0.01 μM and a stable response for more than one month.

  13. Sialic acid metabolism and sialyltransferases: natural functions and applications

    PubMed Central

    Li, Yanhong

    2012-01-01

    Sialic acids are a family of negatively charged monosaccharides which are commonly presented as the terminal residues in glycans of the glycoconjugates on eukaryotic cell surface or as components of capsular polysaccharides or lipooligosaccharides of some pathogenic bacteria. Due to their important biological and pathological functions, the biosynthesis, activation, transfer, breaking down, and recycle of sialic acids are attracting increasing attention. The understanding of the sialic acid metabolism in eukaryotes and bacteria leads to the development of metabolic engineering approaches for elucidating the important functions of sialic acid in mammalian systems and for large-scale production of sialosides using engineered bacterial cells. As the key enzymes in biosynthesis of sialylated structures, sialyltransferases have been continuously identified from various sources and characterized. Protein crystal structures of seven sialyltransferases have been reported. Wild-type sialyltransferases and their mutants have been applied with or without other sialoside biosynthetic enzymes for producing complex sialic acid-containing oligosaccharides and glycoconjugates. This mini-review focuses on current understanding and applications of sialic acid metabolism and sialyltransferases. PMID:22526796

  14. A biomimetic colorimetric logic gate system based on multi-functional peptide-mediated gold nanoparticle assembly

    NASA Astrophysics Data System (ADS)

    Li, Yong; Li, Wang; He, Kai-Yu; Li, Pei; Huang, Yan; Nie, Zhou; Yao, Shou-Zhuo

    2016-04-01

    In natural biological systems, proteins exploit various functional peptide motifs to exert target response and activity switch, providing a functional and logic basis for complex cellular activities. Building biomimetic peptide-based bio-logic systems is highly intriguing but remains relatively unexplored due to limited logic recognition elements and complex signal outputs. In this proof-of-principle work, we attempted to address these problems by utilizing multi-functional peptide probes and the peptide-mediated nanoparticle assembly system. Here, the rationally designed peptide probes function as the dual-target responsive element specifically responsive to metal ions and enzymes as well as the mediator regulating the assembly of gold nanoparticles (AuNPs). Taking advantage of Zn2+ ions and chymotrypsin as the model inputs of metal ions and enzymes, respectively, we constructed the peptide logic system computed by the multi-functional peptide probes and outputted by the readable colour change of AuNPs. In this way, the representative binary basic logic gates (AND, OR, INHIBIT, NAND, IMPLICATION) have been achieved by delicately coding the peptide sequence, demonstrating the versatility of our logic system. Additionally, we demonstrated that the three-input combinational logic gate (INHIBIT-OR) could also be successfully integrated and applied as a multi-tasking biosensor for colorimetric detection of dual targets. This nanoparticle-based peptide logic system presents a valid strategy to illustrate peptide information processing and provides a practical platform for executing peptide computing or peptide-related multiplexing sensing, implying that the controllable nanomaterial assembly is a promising and potent methodology for the advancement of biomimetic bio-logic computation.In natural biological systems, proteins exploit various functional peptide motifs to exert target response and activity switch, providing a functional and logic basis for complex cellular

  15. 4-Aminothiophenol functionalized gold nanoparticle-based colorimetric sensor for the determination of nitramine energetic materials.

    PubMed

    Üzer, Ayşem; Can, Ziya; Akın, Ilknur; Erçağ, Erol; Apak, Reşat

    2014-01-07

    The heterocyclic nitramine compounds, hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) and octahydro-1,3,5,7-tetranitro-1,3,5,7-tetrazocine (HMX), are two most important military-purpose high explosives. Differentiation of RDX and HMX with colorimetric methods of determination has not yet been made because of their similar chemical structures. In this study, a sensitive colorimetric method for the determination of RDX and HMX was proposed on the basis of differential kinetics in the hydrolysis of the two compounds (yielding nitrite as a product) followed by their colorimetric determination using 4-aminothiophenol (4-ATP) modified gold nanoparticles (AuNPs) and naphthylethylene diamine (NED) as coupling agent for azo-dye formation, abbreviated as "4-ATP-AuNP+NED" colorimetric method. After alkaline hydrolysis in a 1 M Na2CO3 + 0.04 M NaOH mixture solution at room temperature, only RDX (but not HMX) was hydrolyzed to give a sufficient colorimetric response in neutralized solution, the molar absorptivity (ε) at 565 nm and the limit of detection (LOD) for RDX being (17.6 ± 1.3) × 10(3) L mol(-1) cm(-1) and 0.55 μg mL(-1), respectively. On the other hand, hot water bath (at 60 °C) hydrolysis enabled both nitramines, RDX and HMX, to give substantial colorimetric responses; i.e., ε and LOD for RDX were (32.8 ± 0.5) × 10(3) L mol(-1)cm(-1) and 0.20 μg mL(-1) and for HMX were (37.1 ± 2.8) × 10(3) L mol(-1)cm(-1) and 0.24 μg mL(-1), respectively. Unlike other AuNP-based nitrite sensors in the literature showing absorbance quenching within a relatively narrow concentration range, the developed sensor operated with an absorbance increase over a wide range of nitrite. Synthetic mixtures of (RDX + HMX) gave additive responses, and the proposed method was statistically validated against HPLC using nitramine mixtures.

  16. A biomimetic colorimetric logic gate system based on multi-functional peptide-mediated gold nanoparticle assembly.

    PubMed

    Li, Yong; Li, Wang; He, Kai-Yu; Li, Pei; Huang, Yan; Nie, Zhou; Yao, Shou-Zhuo

    2016-04-28

    In natural biological systems, proteins exploit various functional peptide motifs to exert target response and activity switch, providing a functional and logic basis for complex cellular activities. Building biomimetic peptide-based bio-logic systems is highly intriguing but remains relatively unexplored due to limited logic recognition elements and complex signal outputs. In this proof-of-principle work, we attempted to address these problems by utilizing multi-functional peptide probes and the peptide-mediated nanoparticle assembly system. Here, the rationally designed peptide probes function as the dual-target responsive element specifically responsive to metal ions and enzymes as well as the mediator regulating the assembly of gold nanoparticles (AuNPs). Taking advantage of Zn2+ ions and chymotrypsin as the model inputs of metal ions and enzymes, respectively, we constructed the peptide logic system computed by the multi-functional peptide probes and outputted by the readable colour change of AuNPs. In this way, the representative binary basic logic gates (AND, OR, INHIBIT, NAND, IMPLICATION) have been achieved by delicately coding the peptide sequence, demonstrating the versatility of our logic system. Additionally, we demonstrated that the three-input combinational logic gate (INHIBIT-OR) could also be successfully integrated and applied as a multi-tasking biosensor for colorimetric detection of dual targets. This nanoparticle-based peptide logic system presents a valid strategy to illustrate peptide information processing and provides a practical platform for executing peptide computing or peptide-related multiplexing sensing, implying that the controllable nanomaterial assembly is a promising and potent methodology for the advancement of biomimetic bio-logic computation.

  17. Ionic liquid-stabilized non-spherical gold nanofluids synthesized using a one-step method

    NASA Astrophysics Data System (ADS)

    Zhang, Hao; Cui, Hua; Yao, Shiwei; Zhang, Kelong; Tao, Haikun; Meng, Haibo

    2012-10-01

    Ionic liquid (IL)-stabilized non-spherical gold nanofluids have been synthesized by a one-step method in aqueous solution. The whole reaction proceeded in room temperature. In the presence of amino-functionalized ionic liquids, gold nanofluids with long-wave surface plasmon resonance (SPR) absorption (>600 nm) could be obtained by adopting tannic acid as the reductant. The specific SPR absorption was related to the non-spherical gold nanoparticles including gold triangle, decahedra, and icosahedra nanocrystals. All the nanocrystals were observed by transmission electron microscopy. It was deduced that the formation of non-spherical gold nanofluids was related to the hydroxyls in tannic acid while IL acted as the synthesis template.

  18. Ionic liquid-stabilized non-spherical gold nanofluids synthesized using a one-step method

    PubMed Central

    2012-01-01

    Ionic liquid (IL)-stabilized non-spherical gold nanofluids have been synthesized by a one-step method in aqueous solution. The whole reaction proceeded in room temperature. In the presence of amino-functionalized ionic liquids, gold nanofluids with long-wave surface plasmon resonance (SPR) absorption (>600 nm) could be obtained by adopting tannic acid as the reductant. The specific SPR absorption was related to the non-spherical gold nanoparticles including gold triangle, decahedra, and icosahedra nanocrystals. All the nanocrystals were observed by transmission electron microscopy. It was deduced that the formation of non-spherical gold nanofluids was related to the hydroxyls in tannic acid while IL acted as the synthesis template. PMID:23092303

  19. Ionic liquid-stabilized non-spherical gold nanofluids synthesized using a one-step method.

    PubMed

    Zhang, Hao; Cui, Hua; Yao, Shiwei; Zhang, Kelong; Tao, Haikun; Meng, Haibo

    2012-10-23

    Ionic liquid (IL)-stabilized non-spherical gold nanofluids have been synthesized by a one-step method in aqueous solution. The whole reaction proceeded in room temperature. In the presence of amino-functionalized ionic liquids, gold nanofluids with long-wave surface plasmon resonance (SPR) absorption (>600 nm) could be obtained by adopting tannic acid as the reductant. The specific SPR absorption was related to the non-spherical gold nanoparticles including gold triangle, decahedra, and icosahedra nanocrystals. All the nanocrystals were observed by transmission electron microscopy. It was deduced that the formation of non-spherical gold nanofluids was related to the hydroxyls in tannic acid while IL acted as the synthesis template.

  20. A General Ligand Design for Gold Catalysis allowing Ligand-Directed Anti Nucleophilic Attack of Alkynes

    PubMed Central

    Wang, Yanzhao; Wang, Zhixun; Li, Yuxue; Wu, Gongde; Cao, Zheng; Zhang, Liming

    2014-01-01

    Most homogenous gold catalyses demand ≥0.5 mol % catalyst loading. Due to the high cost of gold, these reactions are unlikely to be applicable in medium or large scale applications. Here we disclose a novel ligand design based on the privileged biphenyl-2-phosphine framework that offers a potentially general approach to dramatically lowering catalyst loading. In this design, an amide group at the 3’ position of the ligand framework directs and promotes nucleophilic attack at the ligand gold complex-activated alkyne, which is unprecedented in homogeneous gold catalysis considering the spatial challenge of using ligand to reach antiapproaching nucleophile in a linear P-Au-alkyne centroid structure. With such a ligand, the gold(I) complex becomes highly efficient in catalyzing acid addition to alkynes, with a turnover number up to 99,000. Density functional theory calculations support the role of the amide moiety in directing the attack of carboxylic acid via hydrogen bonding. PMID:24704803

  1. Surface-enhanced Raman scattering for 2-D WSe2 hybridized with functionalized gold nanoparticles.

    PubMed

    Kim, Jun Young; Kim, Jeongyong; Joo, Jinsoo

    2016-11-28

    Two-dimensional (2-D) transition metal dichalcogenides, such as MoS2, WSe2, and WS2, are promising materials for application in field effect transistors, optoelectronics, and sensing devices. In this study, 2-D WSe2 samples with various numbers of layers were hybridized with functionalized gold nanoparticles (Au-NPs) to achieve surface-enhanced Raman scattering (SERS). The nanoscale Raman and photoluminescence spectra of the WSe2 layers and WSe2/Au-NP hybrids were measured using a high-resolution laser confocal microscope. The WSe2 exhibited distinct optical characteristics depending on the number of WSe2 layers. The intensities of the Raman characteristic modes of the WSe2 layers were significantly enhanced after hybridization with functionalized Au-NPs, indicating the SERS effect. The SERS effect weakened with increasing the number of WSe2 layers. The SERS effect was more pronounced for mono- and bi-layer WSe2 systems compared with the multi-layer WSe2 systems.

  2. An amperometric urea biosensor based on covalently immobilized urease on an electrode made of hyperbranched polyester functionalized gold nanoparticles.

    PubMed

    Tiwari, Ashutosh; Aryal, Santosh; Pilla, Srikanth; Gong, Shaoqin

    2009-06-15

    An amperometric biosensor was fabricated for the quantitative determination of urea in aqueous medium using hematein, a pH-sensitive natural dye. The urease (Urs) was covalently immobilized onto an electrode made of gold nanoparticles functionalized with hyperbranched polyester-Boltron H40 (H40-Au) coated onto an indium-tin oxide (ITO) covered glass substrate. The covalent linkage between the Urs enzyme and H40-Au nanoparticles provided the resulting enzyme electrode (Urs/H40-Au/ITO) with a high level of enzyme immobilization and excellent lifetime stability. The response studies were carried out as a function of urea concentration with amperometric and photometric measurements. The biosensor based on Urs/H40-Au/ITO as the working electrode showed a linear current response to the urea concentration ranging from 0.01 to 35 mM. The urea biosensor exhibited a sensitivity of 7.48 nA/mM with a response time of 3s. The Michaelis-Menten constant for the Urs/H40-Au/ITO biosensor was calculated to be 0.96 mM, indicating the Urs enzyme immobilized on the electrode surface had a high affinity to urea.

  3. Bacteriochlorophyll aggregates self-assembled on functionalized gold nanorod cores as mimics of photosynthetic chlorosomal antennae: a single molecule study.

    PubMed

    Furumaki, Shu; Vacha, Frantisek; Hirata, Shuzo; Vacha, Martin

    2014-03-25

    We prepare artificial aggregates that mimic the structure and function of natural chlorosomal light harvesting complexes of green photosynthetic bacteria. Gold nanorods functionalized with hydroxyl groups and immobilized on a substrate serve as cores for the growth of bacteriochlorophyll (BChl) aggregates from a buffer solution. The BChl pigments form large self-assembled aggregate particles with sizes more than twice that of natural chlorosomes. The size is controllable by the aggregation time. The aggregates are characterized on a single-particle level by atomic force microscopy, electron microscopy, and single-molecule spectroscopy. The absorption and fluorescence spectral properties which reflect the molecular level arrangement of the BChl aggregates closely resemble those of the natural chlorosomes of the photosynthetic bacterium Chlorobaculum tepidum. On the other hand, the results of linear dichroism and circular dichroism are different from those of the chlorosomes and indicate a different mesoscopic structure for the artificial aggregates. These results emphasize the structural role played by the baseplate pigment-protein complex in natural chlorosomes.

  4. Functional genomics of lactic acid bacteria: from food to health

    PubMed Central

    2014-01-01

    Genome analysis using next generation sequencing technologies has revolutionized the characterization of lactic acid bacteria and complete genomes of all major groups are now available. Comparative genomics has provided new insights into the natural and laboratory evolution of lactic acid bacteria and their environmental interactions. Moreover, functional genomics approaches have been used to understand the response of lactic acid bacteria to their environment. The results have been instrumental in understanding the adaptation of lactic acid bacteria in artisanal and industrial food fermentations as well as their interactions with the human host. Collectively, this has led to a detailed analysis of genes involved in colonization, persistence, interaction and signaling towards to the human host and its health. Finally, massive parallel genome re-sequencing has provided new opportunities in applied genomics, specifically in the characterization of novel non-GMO strains that have potential to be used in the food industry. Here, we provide an overview of the state of the art of these functional genomics approaches and their impact in understanding, applying and designing lactic acid bacteria for food and health. PMID:25186768

  5. Functional genomics of lactic acid bacteria: from food to health.

    PubMed

    Douillard, François P; de Vos, Willem M

    2014-08-29

    Genome analysis using next generation sequencing technologies has revolutionized the characterization of lactic acid bacteria and complete genomes of all major groups are now available. Comparative genomics has provided new insights into the natural and laboratory evolution of lactic acid bacteria and their environmental interactions. Moreover, functional genomics approaches have been used to understand the response of lactic acid bacteria to their environment. The results have been instrumental in understanding the adaptation of lactic acid bacteria in artisanal and industrial food fermentations as well as their interactions with the human host. Collectively, this has led to a detailed analysis of genes involved in colonization, persistence, interaction and signaling towards to the human host and its health. Finally, massive parallel genome re-sequencing has provided new opportunities in applied genomics, specifically in the characterization of novel non-GMO strains that have potential to be used in the food industry. Here, we provide an overview of the state of the art of these functional genomics approaches and their impact in understanding, applying and designing lactic acid bacteria for food and health.

  6. Probing the Structures and Electronic Properties of Dual-Phosphorus-Doped Gold Cluster Anions (AunP-2, n = 1–8): A Density functional Theory Investigation

    SciTech Connect

    Xu, Kang-Ming; Huang, Teng; Liu, Yi-Rong; Jiang, Shuai; Zhang, Yang; Lv, Yu-Zhou; Gai, Yan-Bo; Huang, Wei

    2015-07-29

    The geometries of gold clusters doped with two phosphorus atoms, (AunP-2, n = 1–8) were investigated using density functional theory (DFT) methods. Various two-dimensional (2D) and three-dimensional (3D) structures of the doped clusters were studied. The results indicate that the structures of dual-phosphorus-doped gold clusters exhibit large differences from those of pure gold clusters with small cluster sizes. In our study, as for Au6P-2, two cis–trans isomers were found. The global minimum of Au8P-2 presents a similar configuration to that of Au-20, a pyramid-shaped unit, and the potential novel optical and catalytic properties of this structure warrant further attention. The higher stability of AunP-2 clusters relative to Au-n+2 (n = 1–8) clusters was verified based on various energy parameters, and the results indicate that the phosphorus atom can improve the stabilities of the gold clusters. We then explored the evolutionary path of (n = 1–8) clusters. We found that AunP-2 clusters exhibit the 2D–3D structural transition at n = 6, which is much clearer and faster than that of pure gold clusters and single-phosphorus-doped clusters. The electronic properties of AunP-2 (n = 1–8) were then investigated. The photoelectron spectra provide additional fundamental information on the structures and molecular orbitals shed light on the evolution of AunP-2 (n = 1–8). Natural bond orbital (NBO) described the charge distribution in stabilizing structures and revealed the strong relativistic effects of the gold atoms.

  7. Uncoupling of Energy-Linked Functions of Corn Mitochondria by Linoleic Acid and Monomethyldecenylsuccinic Acid 1

    PubMed Central

    Baddeley, M. Susan; Hanson, J. B.

    1967-01-01

    Linoleic acid and monomethyldecenylsuccinic acid were tested as uncoupling agents for energy linked functions of corn mitochondria. 2,4-dinitrophenol was used as a standard for comparison. Both compounds uncoupled oxidative phosphorylation, released oligomycin-blocked respiration, and accelerated adenosine triphosphatase. Linoleic acid uncoupled calcium-activated phosphate accumulation and the increase in light scattering that accompanies the accumulation. Unlike dinitrophenol, linoleic acid at 0.1 mm had a destructive effect on membrane semipermeability. Kinetic studies indicated that dinitrophenol and linoleic acid compete with phosphate for active sites in oxidative phosphorylation. Some linoleic acid is taken up by respiring mitochondria and a major share of the uptake is incorporated into phospholipids. Calcium ion and oligomycin promote the uptake, but coenzyme A does not. It is deduced that fatty acid probably attacks the non-phosphorylated intermediate, I∼X, producing X∼acyl. Uncoupling results from breakdown of X∼acyl, but sufficient X∼acyl is maintained to serve as a source of activated fatty acid. PMID:16656708

  8. XPS and NRA investigations during the fabrication of gold nanostructured functionalized screen-printed sensors for the detection of metallic pollutants

    NASA Astrophysics Data System (ADS)

    Jasmin, Jean-Philippe; Miserque, Frédéric; Dumas, Eddy; Vickridge, Ian; Ganem, Jean-Jacques; Cannizzo, Caroline; Chaussé, Annie

    2017-03-01

    An all covalent nanostructured lead sensor was built by the successive grafting of gold nanoparticles and carboxylic ligands at the surface of self-adhesive carbon screen-printed electrodes (SPEs). Surface analysis techniques were used in each step in order to investigate the structuration of this sensor. The self-adhesive surfaces were made from the electrochemical grafting of p-phenylenediamine at the surface of the SPEs via diazonium salts chemistry. The quantity of grafted aniline functions, estimated by Nuclear Reaction Analysis (NRA) performed with p-phenylenediamine labelled with 15N isotope, is in agreement with an almost complete coverage of the electrode surface. The subsequent diazotization of the aniline functions at the surface of the SPEs was performed; X-ray Photoelectron Spectroscopy (XPS) allowed us to consider a quantitative conversion of the aniline functions into diazonium moieties. The spontaneous grafting of gold nanoparticles on the as-obtained reactive surfaces ensures the nanostructuration of the material, and XPS studies showed that the covalent bonding of the gold nanoparticles at the surface of the SPEs induces a change both in the Au-4f (gold nanoparticles) and Cl-2p (carbon ink) core level signals. These unusual observations are explained by an interaction between the carbon ink constituting the substrate and the gold nanoparticles. Heavy and toxic metals are considered of major environmental concern because of their non-biodegradability. In a final step, the grafting of the carboxylic ligands at the surface of the SPEs and an accumulation step in the presence of lead(II) cations allowed us to evidence the interest of nanostructured materials as metallic pollutants sensors.

  9. Distinguishing Between Legally and Illegally Produced Gold in South Africa.

    PubMed

    Roberts, Richard J; Dixon, Roger D; Merkle, Roland K W

    2016-01-01

    The identification of gold-bearing material is essential for combating the theft of gold in South Africa. Material seized in police operations is generally a mixture of gold from different mines, and as such cannot be traced back to a single location. ICP-OES analysis of material dissolved by acid dissolution provided a database of gold compositions comprising gold from South African mines, illegal gold stolen from the mines, and commercial gold alloys and jewelery. Discrimination between legal and illegal gold was possible due to the presence of Pb, As, Sb, Sn, Se, and Te in the stolen material, elements which are not present in legally produced gold. The presence of these elements is a quick and simple way to distinguish between gold alloys based on refined gold, such as in commercially manufactured jewelery, and gold alloys containing a proportion of unrefined and therefore illegally obtained gold.

  10. Polysilicon-chromium-gold intracellular chips for multi-functional biomedical applications.

    PubMed

    Patiño, Tania; Soriano, Jorge; Amirthalingam, Ezhil; Durán, Sara; González-Campo, Arántzazu; Duch, Marta; Ibáñez, Elena; Barrios, Leonardo; Plaza, Jose Antonio; Pérez-García, Lluïsa; Nogués, Carme

    2016-04-28

    The development of micro- and nanosystems for their use in biomedicine is a continuously growing field. One of the major goals of such platforms is to combine multiple functions in a single entity. However, achieving the design of an efficient and safe micro- or nanoplatform has shown to be strongly influenced by its interaction with the biological systems, where particle features or cell types play a critical role. In this work, the feasibility of using multi-material pSi-Cr-Au intracellular chips (MMICCs) for multifunctional applications by characterizing their interactions with two different cell lines, one tumorigenic and one non-tumorigenic, in terms of biocompatibility, internalization and intracellular fate, has been explored. Moreover, the impact of MMICCs on the induction of an inflammatory response has been assessed by evaluating TNFα, IL1b, IL6, and IL10 human inflammatory cytokines secretion by macrophages. Results show that MMICCs are biocompatible and their internalization efficiency is strongly dependent on the cell type. Finally as a proof-of-concept, MMICCs have been dually functionalized with transferrin and pHrodo™ Red, SE to target cancer cells and detect intracellular pH, respectively. In conclusion, MMICCs can be used as multi-functional devices due to their high biocompatibility, non-inflammatory properties and the ability of developing multiple functions.

  11. Nanomechanical characterization of chemical interaction between gold nanoparticles and chemical functional groups.

    PubMed

    Lee, Gyudo; Lee, Hyungbeen; Nam, Kihwan; Han, Jae-Hee; Yang, Jaemoon; Lee, Sang Woo; Yoon, Dae Sung; Eom, Kilho; Kwon, Taeyun

    2012-10-31

    We report on how to quantify the binding affinity between a nanoparticle and chemical functional group using various experimental methods such as cantilever assay, PeakForce quantitative nanomechanical property mapping, and lateral force microscopy. For the immobilization of Au nanoparticles (AuNPs) onto a microscale silicon substrate, we have considered two different chemical functional molecules of amine and catecholamine (here, dopamine was used). It is found that catecholamine-modified surface is more effective for the functionalization of AuNPs onto the surface than the amine-modified surface, which has been shown from our various experiments. The dimensionless parameter (i.e., ratio of binding affinity) introduced in this work from such experiments is useful in quantitatively depicting such binding affinity, indicating that the binding affinity and stability between AuNPs and catecholamine is approximately 1.5 times stronger than that between amine and AuNPs. Our study sheds light on the experiment-based quantitative characterization of the binding affinity between nanomaterial and chemical groups, which will eventually provide an insight into how to effectively design the functional material using chemical groups.

  12. Nanomechanical characterization of chemical interaction between gold nanoparticles and chemical functional groups

    PubMed Central

    2012-01-01

    We report on how to quantify the binding affinity between a nanoparticle and chemical functional group using various experimental methods such as cantilever assay, PeakForce quantitative nanomechanical property mapping, and lateral force microscopy. For the immobilization of Au nanoparticles (AuNPs) onto a microscale silicon substrate, we have considered two different chemical functional molecules of amine and catecholamine (here, dopamine was used). It is found that catecholamine-modified surface is more effective for the functionalization of AuNPs onto the surface than the amine-modified surface, which has been shown from our various experiments. The dimensionless parameter (i.e., ratio of binding affinity) introduced in this work from such experiments is useful in quantitatively depicting such binding affinity, indicating that the binding affinity and stability between AuNPs and catecholamine is approximately 1.5 times stronger than that between amine and AuNPs. Our study sheds light on the experiment-based quantitative characterization of the binding affinity between nanomaterial and chemical groups, which will eventually provide an insight into how to effectively design the functional material using chemical groups. PMID:23113991

  13. Polysilicon-chromium-gold intracellular chips for multi-functional biomedical applications

    NASA Astrophysics Data System (ADS)

    Patiño, Tania; Soriano, Jorge; Amirthalingam, Ezhil; Durán, Sara; González-Campo, Arántzazu; Duch, Marta; Ibáñez, Elena; Barrios, Leonardo; Plaza, Jose Antonio; Pérez-García, Lluïsa; Nogués, Carme

    2016-04-01

    The development of micro- and nanosystems for their use in biomedicine is a continuously growing field. One of the major goals of such platforms is to combine multiple functions in a single entity. However, achieving the design of an efficient and safe micro- or nanoplatform has shown to be strongly influenced by its interaction with the biological systems, where particle features or cell types play a critical role. In this work, the feasibility of using multi-material pSi-Cr-Au intracellular chips (MMICCs) for multifunctional applications by characterizing their interactions with two different cell lines, one tumorigenic and one non-tumorigenic, in terms of biocompatibility, internalization and intracellular fate, has been explored. Moreover, the impact of MMICCs on the induction of an inflammatory response has been assessed by evaluating TNFα, IL1b, IL6, and IL10 human inflammatory cytokines secretion by macrophages. Results show that MMICCs are biocompatible and their internalization efficiency is strongly dependent on the cell type. Finally as a proof-of-concept, MMICCs have been dually functionalized with transferrin and pHrodo™ Red, SE to target cancer cells and detect intracellular pH, respectively. In conclusion, MMICCs can be used as multi-functional devices due to their high biocompatibility, non-inflammatory properties and the ability of developing multiple functions.

  14. Gold nanoprobes for theranostics

    PubMed Central

    Panchapakesan, Balaji; Book-Newell, Brittany; Sethu, Palaniappan; Rao, Madhusudhana; Irudayaraj, Joseph

    2011-01-01

    Gold nanoprobes have become attractive diagnostic and therapeutic agents in medicine and life sciences research owing to their reproducible synthesis with atomic level precision, unique physical and chemical properties, versatility of their morphologies, flexibility in functionalization, ease of targeting, efficiency in drug delivery and opportunities for multimodal therapy. This review highlights some of the recent advances and the potential for gold nanoprobes in theranostics. PMID:22122586

  15. Loss of lung function associated with exposure to silica dust and with smoking and its relation to disability and mortality in South African gold miners.

    PubMed Central

    Hnizdo, E

    1992-01-01

    The data from a lung function study on 2209 white 45-54 year old South African gold miners in 1968-71 and at a five year follow up examination, were analysed to establish the actual loss of lung function associated with exposure to silica dust and with smoking. Ex-smokers were excluded from the analysis. Of the remaining 1625 subjects, 1249 had the five year follow up test of lung function. The estimated excess loss of lung function for a 50 year old gold miner, associated with 24 years of underground dust exposure of an average respirable dust concentration of 0.30 mg m-3 (14.4 ghm-3) was 236 ml of FEV1 (95% confidence interval (95% CI 134-337) and 217 ml of FVC (95% CI 110-324). By comparison, the effect of smoking one packet of cigarettes a day over 30 years was associated with an estimated loss of 552 ml of FEV1 (95% CI 461-644) and 335 ml of FVC (95% CI 170-500). The cumulative dust exposure was not associated with the longitudinal loss of FEV1 or FVC when the initial FEV1 and FVC were adjusted in the models. According to the predicted values, however, gold miners appear to have a greater loss of lung function from 50 to 55 years of age than that predicted for a general population. PMID:1322158

  16. Functionalization of gold and graphene electrodes by p-maleimido-phenyl towards thiol-sensing systems investigated by EQCM and IR ellipsometric spectroscopy

    NASA Astrophysics Data System (ADS)

    Neubert, Tilmann Joachim; Rösicke, Felix; Sun, Guoguang; Janietz, Silvia; Gluba, Marc A.; Hinrichs, Karsten; Nickel, Norbert H.; Rappich, Jörg

    2017-01-01

    Electrografting of gold and graphene surfaces by functional p-(N-maleimido)phenyl groups was performed by reduction of p-(N-maleimido)phenyldiazonium tetrafluoroborate. The reduction was carried out using cyclo voltammetry coupled with micro-gravimetric measurements by means of electrochemical quartz crystal microbalance (EQCM). The overall deposited mass on gold was higher than on graphene. However, the Faradaic efficiency was lower on Au (14%) compared to graphene (22%) after the first potential scan. Subsequently, the maleimide functional groups have been tested for immobilization of terminal thiols using 2-(4-nitrobenzene)-ethane-thiol for the functionalized graphene surface and a cysteine-modified peptide for the functionalized gold surface. The functionalization by p-(N-maleimido)phenyl groups and the following thiol coupling of the particular surface was proven by infrared spectroscopic ellipsometry (IRSE). In addition, the interaction of the tetrabutylammonium and tetrafluoroborate ions present in the electrolyte with the Au and graphene electrodes was investigated by EQCM and revealed less electrostatic interaction of graphene with these ions in solution compared to the metal (Au) surface.

  17. Loss of lung function associated with exposure to silica dust and with smoking and its relation to disability and mortality in South African gold miners.

    PubMed

    Hnizdo, E

    1992-07-01

    The data from a lung function study on 2209 white 45-54 year old South African gold miners in 1968-71 and at a five year follow up examination, were analysed to establish the actual loss of lung function associated with exposure to silica dust and with smoking. Ex-smokers were excluded from the analysis. Of the remaining 1625 subjects, 1249 had the five year follow up test of lung function. The estimated excess loss of lung function for a 50 year old gold miner, associated with 24 years of underground dust exposure of an average respirable dust concentration of 0.30 mg m-3 (14.4 ghm-3) was 236 ml of FEV1 (95% confidence interval (95% CI 134-337) and 217 ml of FVC (95% CI 110-324). By comparison, the effect of smoking one packet of cigarettes a day over 30 years was associated with an estimated loss of 552 ml of FEV1 (95% CI 461-644) and 335 ml of FVC (95% CI 170-500). The cumulative dust exposure was not associated with the longitudinal loss of FEV1 or FVC when the initial FEV1 and FVC were adjusted in the models. According to the predicted values, however, gold miners appear to have a greater loss of lung function from 50 to 55 years of age than that predicted for a general population.

  18. Pharmacokinetic and toxicological evaluation of multi-functional thiol-6-fluoro-6-deoxy-d-glucose gold nanoparticles in vivo

    NASA Astrophysics Data System (ADS)

    Roa, Wilson; Xiong, Yeping; Chen, Jie; Yang, Xiaoyan; Song, Kun; Yang, Xiaohong; Kong, Beihua; Wilson, John; Xing, James Z.

    2012-09-01

    We synthesized a novel, multi-functional, radiosensitizing agent by covalently linking 6-fluoro-6-deoxy-d-glucose (6-FDG) to gold nanoparticles (6-FDG-GNPs) via a thiol functional group. We then assessed the bio-distribution and pharmacokinetic properties of 6-FDG-GNPs in vivo using a murine model. At 2 h, following intravenous injection of 6-FDG-GNPs into the murine model, approximately 30% of the 6-FDG-GNPs were distributed to three major organs: the liver, the spleen and the kidney. PEGylation of the 6-FDG-GNPs was found to significantly improve the bio-distribution of 6-FDG-GNPs by avoiding unintentional uptake into these organs, while simultaneously doubling the cellular uptake of GNPs in implanted breast MCF-7 adenocarcinoma. When combined with radiation, PEG-6-FDG-GNPs were found to increase the apoptosis of the MCF-7 breast adenocarinoma cells by radiation both in vitro and in vivo. Pharmacokinetic data indicate that GNPs reach their maximal concentrations at a time window of two to four hours post-injection, during which optimal radiation efficiency can be achieved. PEG-6-FDG-GNPs are thus novel nanoparticles that preferentially accumulate in targeted cancer cells where they act as potent radiosensitizing agents. Future research will aim to substitute the 18F atom into the 6-FDG molecule so that the PEG-6-FDG-GNPs can also function as radiotracers for use in positron emission tomography scanning to aid cancer diagnosis and image guided radiation therapy planning.

  19. GoldMag nanocomposite-functionalized graphene sensing platform for one-step electrochemical immunoassay of alpha-fetoprotein.

    PubMed

    Zhang, Bing; Tang, Dianping; Liu, Bingqian; Chen, Huafeng; Cui, Yuling; Chen, Guonan

    2011-10-15

    A new flow-through electrochemical immunosensor was designed for sensitive detection of alpha-fetoprotein (AFP) in human serum by using nanogold-functionalized magnetic graphene nanosheets as immunosensing probes. Initially, amino functionalized magnetic beads were covalently immobilized on the surface of graphene oxide nanosheets (MGPs), then nanogold particles were adsorbed on the amino groups of the MGPs to construct GoldMag nanocomposites functionalized graphene nanosheets (GMGPs), and then horseradish peroxidase-anti-AFP conjugates (HRP-anti-AFP) were assembled onto the surface of nanogold particles (bio-GMGP). With the aid of an external magnet, the formed bio-GMGPs were attached onto the base electrode in the flow system. With a non-competitive immunoassay format, the injected sample containing AFP antigens was produced transparent immunoaffinity reaction with the immobilized HRP-anti-AFP on the bio-GMGPs. The formed immunocomplex inhibited partly the active center of HRP, and decreased the labeled HRP toward the reduction of H(2)O(2). The performance and factors influencing the performance of the immunosensor were investigated in detail. Under optimal conditions, the electrochemical immunosensor displayed a wide working range of 0.01-200 ng mL(-1) with a low detection limit (LOD) of 1.0 pg mL(-1) AFP (at 3s(B)). Intra- and inter-assay coefficients of variation (CV) were below 10%. In addition, the methodology was validated with real serum samples, receiving a good correlation with the results obtained from commercially available electrochemiluminescence automated analyzer.

  20. Branched-chain amino acids and brain function.

    PubMed

    Fernstrom, John D

    2005-06-01

    Branched-chain amino acids (BCAAs) influence brain function by modifying large, neutral amino acid (LNAA) transport at the blood-brain barrier. Transport is shared by several LNAAs, notably the BCAAs and the aromatic amino acids (ArAAs), and is competitive. Consequently, when plasma BCAA concentrations rise, which can occur in response to food ingestion or BCAA administration, or with the onset of certain metabolic diseases (e.g., uncontrolled diabetes), brain BCAA concentrations rise, and ArAA concentrations decline. Such effects occur acutely and chronically. Such reductions in brain ArAA concentrations have functional consequences: biochemically, they reduce the synthesis and the release of neurotransmitters derived from ArAAs, notably serotonin (from tryptophan) and catecholamines (from tyrosine and phenylalanine). The functional effects of such neurochemical changes include altered hormonal function, blood pressure, and affective state. Although the BCAAs thus have biochemical and functional effects in the brain, few attempts have been made to characterize time-course or dose-response relations for such effects. And, no studies have attempted to identify levels of BCAA intake that might produce adverse effects on the brain. The only "model" of very high BCAA exposure is a very rare genetic disorder, maple syrup urine disease, a feature of which is substantial brain dysfunction but that probably cannot serve as a useful model for excessive BCAA intake by normal individuals. Given the known biochemical and functional effects of the BCAAs, it should be a straightforward exercise to design studies to assess dose-response relations for biochemical and functional effects and, in this context, to explore for adverse effect thresholds.

  1. Disruption of biomolecule function by nanoparticles: how do gold nanoparticles affect Phase I biotransformation of persistent organic pollutants?

    PubMed

    Lu, Zhe; Ma, Guibin; Veinot, Jonathan G C; Wong, Charles S

    2013-09-01

    The potential influence of nanoparticles on cytochrome P-450 (CYP) isozyme mediated Phase I biotransformation of persistent organic pollutants (POPs) in vitro was investigated using citrate-capped gold nanoparticles (AuNPs) and 2,2',3,5',6-pentachlorobiphenyl (PCB 95) as the probe nanoparticle and compound, respectively. AuNPs affected the biotransformation activity of rat CYP2B1 and changed the atropisomeric composition of PCB 95, depending on the incubation time and the AuNP concentration. Electrostatic repulsion between citrate-coated AuNPs and rat CYP2B1 may influence the active conformation of the isozyme and consequently affect its activity and stereoselectivity. In addition, the effects of AuNPs on rat CYP2B1 activity also appeared to be through interference with the CYP catalytic cycle's electron transfer chain. Incubations with AuNPs had a decline in buffer conductance and an absorbance band red shift of AuNPs, from electrostatic interactions of K(+) with negatively-charged AuNP aggregates. These ionic strength changes affected the formation rate of nicotinamide adenine dinucleotide phosphate, which provides electrons for the oxidative reaction cycle, and the biotransformation activity and stereoselectivity of CYP. This study suggests that charged nanoparticles may be able to alter the functions of biomolecules directly, by electrostatic interaction, or indirectly, by changes to the surrounding ionic strength. These factors should be taken into account for further understanding and prediction of the environmental behavior and fate of POPs and nanoparticles.

  2. Size-Dependent Effects of Gold Nanoparticles Uptake on Maturation and Antitumor Functions of Human Dendritic Cells In Vitro

    PubMed Central

    Tomić, Sergej; Đokić, Jelena; Vasilijić, Saša; Ogrinc, Nina; Rudolf, Rebeka; Pelicon, Primož; Vučević, Dragana; Milosavljević, Petar; Janković, Srđa; Anžel, Ivan; Rajković, Jelena; Rupnik, Marjan Slak; Friedrich, Bernd; Čolić, Miodrag

    2014-01-01

    Gold nanoparticles (GNPs) are claimed as outstanding biomedical tools for cancer diagnostics and photo-thermal therapy, but without enough evidence on their potentially adverse immunological effects. Using a model of human dendritic cells (DCs), we showed that 10 nm- and 50 nm-sized GNPs (GNP10 and GNP50, respectively) were internalized predominantly via dynamin-dependent mechanisms, and they both impaired LPS-induced maturation and allostimulatory capacity of DCs, although the effect of GNP10 was more prominent. However, GNP10 inhibited LPS-induced production of IL-12p70 by DCs, and potentiated their Th2 polarization capacity, while GNP50 promoted Th17 polarization. Such effects of GNP10 correlated with a stronger inhibition of LPS-induced changes in Ca2+ oscillations, their higher number per DC, and more frequent extra-endosomal localization, as judged by live-cell imaging, proton, and electron microscopy, respectively. Even when released from heat-killed necrotic HEp-2 cells, GNP10 inhibited the necrotic tumor cell-induced maturation and functions of DCs, potentiated their Th2/Th17 polarization capacity, and thus, impaired the DCs' capacity to induce T cell-mediated anti-tumor cytotoxicity in vitro. Therefore, GNP10 could potentially induce more adverse DC-mediated immunological effects, compared to GNP50. PMID:24802102

  3. A functional graphene oxide-ionic liquid composites-gold nanoparticle sensing platform for ultrasensitive electrochemical detection of Hg2+.

    PubMed

    Zhou, Na; Li, Jinhua; Chen, Hao; Liao, Chunyang; Chen, Lingxin

    2013-02-21

    A simple and sensitive electrochemical assay strategy of stripping voltammetry for mercury ions (Hg(2+)) detection is described based on the synergistic effect between ionic liquid functionalized graphene oxide (GO-IL) and gold nanoparticles (AuNPs). The AuNPs-GO-IL modified onto glassy carbon electrode (GCE) resulted in highly enhanced electron conductive nanostructured membrane and large electroactive surface area, which was excellently examined by scanning electron microscopy and cyclic voltammetry. After accumulating Hg(2+), anodic stripping voltammetry (ASV) was performed, and differential pulse voltammetry (DPV) was employed for signal recording of Hg(2+). Several main experimental parameters were optimized, i.e., deposition potential and time of AuNPs were -0.2 V and 180 s, respectively, and accumulation potential and time of Hg(2+) were -0.3 V and 660 s, respectively. Under the optimal conditions, this AuNPs-GO-IL-GCE sensor attained a good linearity in a wide range of 0.1-100 nM (R = 0.9808) between the concentration of the Hg(2+) standard and peak current. The limit of detection was estimated to be 0.03 nM at a signal-to-noise ratio of 3σ. A variety of common coexistent ions in water samples were investigated, showing no obvious interferences on the Hg(2+) detection. The practical application of the proposed sensor has been carried out and demonstrated as feasible for determination of trace levels of Hg(2+) in drinking and environmental water samples.

  4. Highly sensitive visual detection of copper (II) using water-soluble azide-functionalized gold nanoparticles and silver enhancement.

    PubMed

    Zhang, Zhen; Li, Wenqing; Zhao, Qiuling; Cheng, Ming; Xu, Li; Fang, Xiaohong

    2014-09-15

    A high-sensitive method for the visual detection of copper ions in aqueous solution is developed. The method is based on copper ion-catalyzed 'click' reaction between the water-soluble azide-functionalized gold nanoparticles (AuNPs) and alkyne-modified glass slide. The PEG linker was employed as a stabilizing component along with the terminal azide group to keep the AuNPs stably dispersed in water without the assistance of any organic solvent. In the presence of copper ions, the AuNPs are 'clicked' on the slide, and the darkness of the AuNPs in the sample spot is promoted by silver enhancement process. Only a tiny amount of sample (10 μl) is needed with the detectable concentration down to 62 pM by the commonly used flatbed scanner, which is 2-3 orders of magnitude lower than those in previous reports. The selectivity relative to other potentially interfering ions and the applicability in real samples, human serum and tap water, have also been evaluated. Our method has a good potential in point-of-use applications and environment surveys.

  5. Label-free electrochemiluminescence immunosensor for cardiac troponin I using luminol functionalized gold nanoparticles as a sensing platform.

    PubMed

    Li, Fang; Yu, Yuqi; Cui, Hua; Yang, Di; Bian, Zhiping

    2013-03-21

    A simple and sensitive label-free electrochemiluminescence (ECL) immunosensor based on the use of luminol functionalized gold nanoparticles (luminol-AuNPs) as antibody carriers and sensing platform is described for detecting the acute myocardial infarction biomarker cTnI. The ECL immunosensor was fabricated by the assembly of luminol-AuNPs conjugated with biotinylated antibodies against cTnI (biotin-anti-cTnI-luminol-AuNPs) with the streptavidin coated AuNPs (SA-AuNPs) modified Au electrode directly by virtue of the biotin-SA system. The fabricated sensing platform exhibited stable and strong ECL intensity and could be used for the recognition of target antigen. In the presence of cTnI, a decrease in the ECL intensity was observed. Direct detection of the ECL signal changes during antigen-antibody immunoreactions can be used for the quantification of cTnI. The ECL response exhibited a quite wide dynamic range from 1000 ng mL(-1) down to 0.1 ng mL(-1). The proposed method has been successfully applied in the detection of cTnI in real plasma samples. This protocol is simple, fast, sensitive, specific, stable and reliable. This work reveals that the luminol-AuNPs are excellent sensing platforms for the fabrication of simple and sensitive immunosensors. Moreover, the proposed strategy may also be extended for the detection of other biomarkers, which is of great application potential in clinical and pharmaceutical analysis.

  6. Selective detection and estimation of C-reactive protein in serum using surface-functionalized gold nano-particles.

    PubMed

    Raj, Vidya; Sreenivasan, K

    2010-03-10

    A new method for the detection of C-reactive protein (CRP) in serum using functionalized gold nano-particles (GNP) is reported. The affinity towards CRP is imparted to GNP by tethering O-phosphorylethanolamine (PEA) onto their surface. GNP and modified GNP were characterized using TEM, particle size analysis, zeta potential measurements, absorption spectroscopy and FT-IR techniques. The event of binding of CRP onto the PEA-GNP is followed by visibly observable colour change. We observed a red shift as well as a decrease in absorption in the plasmon peak of the modified GNP with the concentration of CRP. When the concentration of CRP exceeded 450 ng mL(-1), particles were aggregated and the solution became turbid. The method exhibited a linear range for CRP from 50 to 450 ng mL(-1) with a detection limit of 50 ng mL(-1). The colour change and the variation in absorption of the GNP were highly specific to CRP even in the presence of albumin. We estimated CRP in blood serum collected from patients and the results obtained compared well with the estimation using the technique of nephelometry based on the antibody-antigen interaction.

  7. Aspheric Solute Ions Modulate Gold Nanoparticle Interactions in an Aqueous Solution: An Optimal Way to Reversibly Concentrate Functionalized Nanoparticles

    PubMed Central

    Villarreal, Oscar D; Chen, Liao Y; Whetten, Robert L; Demeler, Borries

    2015-01-01

    Nanometer-sized gold particles (AuNPs) are of peculiar interest because their behaviors in an aqueous solution are sensitive to changes in environmental factors including the size and shape of the solute ions. In order to determine these important characteristics, we performed all-atom molecular dynamics simulations on the icosahedral Au144 nanoparticles each coated with a homogeneous set of 60 thiolates (4-mercapto-benzoate, pMBA) in eight aqueous solutions having ions of varying sizes and shapes (Na+, K+, tetramethylamonium cation TMA+, trisamonium cation TRS+, Cl−, and OH−). For each solution, we computed the reversible work (potential of mean of force) to bring two nanoparticles together as a function of their separation distance. We found that the behavior of pMBA protected Au144 nanoparticles can be readily modulated by tuning their aqueous environmental factors (pH and solute ion combinations). We examined the atomistic details on how the sizes and shapes of solute ions quantitatively factor in the definitive characteristics of nanoparticle-environment and nanoparticle-nanoparticle interactions. We predict that tuning the concentrations of non-spherical composite ions such as TRS+ in an aqueous solution of AuNPs be an effective means to modulate the aggregation propensity desired in biomedical and other applications of small charged nanoparticles. PMID:26581232

  8. Horseradish peroxidase functionalized gold nanorods as a label for sensitive electrochemical detection of alpha-fetoprotein antigen.

    PubMed

    Guo, Jinjin; Han, Xiaowei; Wang, Junchun; Zhao, Junqing; Guo, Zilin; Zhang, Yuzhong

    2015-12-15

    In this study, a novel tracer, horseradish peroxidase (HRP) functionalized gold nanorods (Au NRs) nanocomposites (HRP-Au NRs), was designed to label the signal antibodies for sensitive electrochemical measurement of alpha-fetoprotein (AFP). The preparation of HRP-Au NRs nanocomposites and the labeling of secondary antibody (Ab2) were performed by one-pot assembly of HRP and Ab2 on the surface of Au NRs. The immunosensor was fabricated by assembling carbon nanotubes (CNTs), Au NRs, and capture antibodies (Ab1) on the glassy carbon electrode. In the presence of AFP antigen, the labels were captured on the surface of the Au NRs/CNTs via specific recognition of antigen-antibody, resulting in the signal intensity being clearly increased. Differential pulse voltammetry (DPV) was employed to record the response signal of the immunosensor in phosphate-buffered saline (PBS) containing hydrogen peroxide (H2O2) and 3,3',5,5'-tetramethylbenzidine (TMB). Under optimal conditions, the signal intensity was linearly related to the concentration of AFP in the range of 0.1-100 ng ml(-1), and the limit of detection was 30 pg ml(-1) (at signal/noise [S/N] = 3). Furthermore, the immunoassay method was evaluated using human serum samples, and the recovery obtained was within 99.0 and 102.7%, indicating that the immunosensor has potential clinical applications.

  9. Chiral recognition of penicillamine enantiomers using hemoglobin and gold nanoparticles functionalized graphite-like carbon nitride nanosheets via electrochemiluminescence.

    PubMed

    Lin, Xia; Zhu, Shu; Wang, Qinghong; Xia, Qiao; Ran, Peiyao; Fu, Yingzi

    2016-12-01

    A new stable and stereo-selective electrochemiluminescence (ECL) interface has been designed for specific recognition of penicillamine (Pen) enantiomers by using hemoglobin (Hb) and gold nanoparticles functionalized graphite-like carbon nitride nanosheets composite (Au-g-C3N4 NHs) modified glassy carbon electrodes (Hb/Au-g-C3N4/GCE). The advantages of Hb as chiral selector and Au-g-C3N4 NHs as luminophore were perfectly displayed in this novel interface. The obviously different ECL intensity was exhibited after l-Pen and d-Pen adsorbed on Hb/Au-g-C3N4/GCE, and a larger response was observed on d-Pen/Hb/Au-g-C3N4/GCE. Under the optimum conditions, the developed ECL chiral sensor showed excellent analytical property for detection of Pen enantiomers in a linear range of 1.0×10(-4)M to 5.0×10(-3)M, and the detection limits of l-Pen and d-Pen were 3.1×10(-5)M and 3.3×10(-5)M (S/N=3) respectively. This work with high selectivity, stability and reproducibility may open a new door based on ECL to discriminate Pen enantiomers.

  10. Synthesis of palladium@gold nanoalloys/nitrogen and sulphur-functionalized multiple graphene aerogel for electrochemical detection of dopamine.

    PubMed

    Li, Ruiyi; Yang, Tingting; Li, Zaijun; Gu, Zhiguo; Wang, Guangli; Liu, Junkang

    2017-02-15

    Integration of noble metal nanomaterials on graphene nanosheets potentially paves one way to improve their electronic, chemical and electrochemical properties. The study reported synthesis of palladium@gold nanoalloys/nitrogen and sulphur-functionalized multiple graphene aerogel composite (Pd@Au/N,S-MGA). The as-prepared composite offers a well-defined three-dimensional architecture with rich of mesopores. The Pd@Au nanoalloys were dispersed on the graphene framework networks and their active sites were fully exposed. The unique structure achieves to ultra high electron/ion conductivity, electrocatalytic activity and structural stability. The sensor based on the Pd@Au/N,S-MGA creates ultrasensitive electrochemical response towards dopamine due to significantly electrochemical synergy between Pd, Au and N,S-MGA. Its differential pulse voltammetric signal linearly increases with the increase of dopamine concentration in the range from 1.0 × 10(-9) M to 4.0 × 10(-5) M with the detection limit of 3.6 × 10(-10) M (S/N = 3). The analytical method provides the advantage of sensitivity, reproducibility, rapidity and long-term stability. It has been successfully applied in the detection of trace dopamine in biological samples. The study also opens a window on the electronic properties of graphene aerogel and metal nanomaterials as well their nanohybrids to meet needs of further applications as nanoelectronics in diagnosis, bioanalysis and catalysis.

  11. One step electrodeposition of dendritic gold nanostructures on β-lactoglobulin-functionalized reduced graphene oxide for glucose sensing.

    PubMed

    Du, Xin; Zhang, Zhenguo; Miao, Zhiying; Ma, Min; Zhang, Yanyan; Zhang, Cong; Wang, Weizhen; Han, Bingkai; Chen, Qiang

    2015-11-01

    Dendritic gold nanostructures (AuNDs) were successfully synthesized by one step electrodeposition on reduced graphene oxide (rGO) functionalized by a globular protein, β-lactoglobulin (BLG), for the first time. Owing to its sulfhydryl groups, water-soluble BLG-rGO provided a superb platform for the growth of AuNDs. Scanning electron microscopy, Raman spectroscopy and X-ray spectroscopy analysis were used to investigate the as prepared BLG-rGO-AuNDs nanocomposite. Electrocatalytic ability of the nanocomposite was evaluated by cyclic voltammetry and chronoamperometric method. In order to prove the superiority of BLG-rGO-AuNDs, we developed a novel glucose biosensor on the nanocomposite modified glassy carbon electrode (GCE) through a cross-linking method. The biosensor exhibited a remarkable sensitivity of 46.2 μA mM(-1) cm(-2), a wide linear range of 0.05-6 mM glucose, a low detection limit of 22.9 µM (S/N=3), and a rapid response time (within 6 s). The prepared biosensor also used to detect glucose in human serum and statistical analysis in the respect of reproducibility was done.

  12. Aspheric Solute Ions Modulate Gold Nanoparticle Interactions in an Aqueous Solution: An Optimal Way To Reversibly Concentrate Functionalized Nanoparticles.

    PubMed

    Villarreal, Oscar D; Chen, Liao Y; Whetten, Robert L; Demeler, Borries

    2015-12-17

    Nanometer-sized gold particles (AuNPs) are of peculiar interest because their behaviors in an aqueous solution are sensitive to changes in environmental factors including the size and shape of the solute ions. In order to determine these important characteristics, we performed all-atom molecular dynamics simulations on the icosahedral Au144 nanoparticles each coated with a homogeneous set of 60 thiolates (4-mercaptobenzoate, pMBA) in eight aqueous solutions having ions of varying sizes and shapes (Na(+), K(+), tetramethylamonium cation TMA(+), tris-ammonium cation TRS(+), Cl(-), and OH(-)). For each solution, we computed the reversible work (potential of mean of force) to bring two nanoparticles together as a function of their separation distance. We found that the behavior of pMBA protected Au144 nanoparticles can be readily modulated by tuning their aqueous environmental factors (pH and solute ion combinations). We examined the atomistic details on how the sizes and shapes of solute ions quantitatively factor in the definitive characteristics of nanoparticle-environment and nanoparticle-nanoparticle interactions. We predict that tuning the concentrations of nonspherical composite ions such as TRS(+) in an aqueous solution of AuNPs be an effective means to modulate the aggregation propensity desired in biomedical and other applications of small charged nanoparticles.

  13. Functionalization of indium-tin-oxide electrodes by laser-nanostructured gold thin films for biosensing applications

    NASA Astrophysics Data System (ADS)

    Grochowska, Katarzyna; Siuzdak, Katarzyna; Karczewski, Jakub; Śliwiński, Gerard

    2015-12-01

    The production and properties of the indium-tin-oxide (ITO) electrodes functionalized by Au nanoparticle (NP) arrays of a relatively large area formed by pulsed laser nanostructuring of thin gold films are reported and discussed. The SEM inspection of modified electrodes reveals the presence of the nearly spherical and disc-shaped particles of dimensions in the range of 40-120 nm. The NP-array geometry can be controlled by selection of the laser processing conditions. It is shown that particle size and packing density of the array are important factors which determine the electrode performance. In the case of NP-modified electrodes the peak current corresponding to the glucose direct oxidation process shows rise with increasing glucose concentration markedly higher comparing to the reference Au disc electrode. The detection limit reaches 12 μM and linear response of the sensor is observed from 0.1 to 47 mM that covers the normal physiological range of the blood sugar detection.

  14. Biosorption of heavy metal ions onto agricultural residues buckwheat hulls functionalized with 1-hydroxylethylidenediphosphonic acid.

    PubMed

    Yin, Ping; Wang, Zengdi; Qu, Rongjun; Liu, Xiguang; Zhang, Jiang; Xu, Qiang

    2012-11-28

    Novel biosorbent materials obtained from agricultural residues buckwheat hulls (BH) were successfully developed through functionalization with 1-hydroxylethylidenediphosphonic acid (HEDP), and they were characterized. This paper reports the feasibility of using HEDP-BH for removal of heavy metals from stimulated wastewater, the experimental results revealed that the adsorption property of functionalized buckwheat hulls with 120 mesh 120-HEDP-BH for Au(III) was very excellent, and the monolayer maximum adsorption capacity for Au(III) calculated from the Langmuir isotherm models was up to 450.45 mg/g at 35 °C. The combined effect of initial solution pH, 120-HEDP-BH dosage, and initial Au(III) concentration was investigated using response surface methodology (RSM), and the result showed that biomass dosage exerted a stronger influence on Au(III) uptake than those of initial pH and initial Au(III) concentration. Analysis of variance (ANOVA) of the quadratic model demonstrated that the model was highly significant. Moreover, investigation on the adsorption selectivity showed that 120-HEDP-BH displayed strong affinity for gold in aqueous solutions and even exhibited 100% selectivity for Au(III) ions in the presence of Zn(II) and Co(II). Regeneration capacities of 120-HEDP-BH were studied using the eluent solutions of 0.0-5.0% thiourea in 0.1 mmol/L HCl, and it was found that the adsorption capability remains high after several cycles of adsorption-desorption process.

  15. ELECTROLYTIC CORROSION OF GOLD AND THE FORMATION OF Au//2(SO//4)//3 IN CONCENTRATED SULFURIC ACID.

    USGS Publications Warehouse

    Senftle, Frank E.; Wright, Donald B.

    1985-01-01

    The authors have examined the direct anodic oxidation of gold in concentrated H//2SO//4 to more fully understand the chemical reactions. Au//2(SO//4)//3 is unstable and cannot be isolated for chemical analysis, but our experiments are consistent with the formation of Au//2(SO//4)//3 in concentrated H//2SO//4, in which it is stable. Equations describing chemical reactions which are compatible with the experimental data are presented.

  16. Photo-bio-synthesis of irregular shaped functionalized gold nanoparticles using edible mushroom Pleurotus florida and its anticancer evaluation.

    PubMed

    Bhat, Ravishankar; Sharanabasava, V G; Deshpande, Raghunandan; Shetti, Ullas; Sanjeev, Ganesh; Venkataraman, A

    2013-08-05

    A green chemistry approach to the synthesis of gold nanoparticles using edible mushroom Pleurotus florida (Oyster mushroom) by photo-irradiation method has been attempted. The mixture containing the aqueous gold ions and the mushroom extract was exposed to sunlight; this resulted in the formation of biofunctionalized gold nanoparticles. These nanoparticles were characterized using various techniques like UV-visible spectroscopy; X-ray diffraction studies, Energy dispersive X-ray analysis, Field emission scanning electron microscopy, Atomic force microscopy, Transmission electron microscopy and Fourier transform infrared spectrometry. The obtained biofunctionalized gold nanoparticles showed effective anti-cancer property against four different cancer cell lines A-549 (Human lung carcinoma), K-562 (Human chronic myelogenous leukemia bone marrow), HeLa (Human cervix) and MDA-MB (Human adenocarcinoma mammary gland) and no lethal effect is observed in Vero (African green monkey kidney normal cell) cell lines.

  17. Amino acid rejection behaviour as a function of concentration.

    PubMed

    Shirley, Jason; Mandale, Stephen; Williams, Paul M

    2011-05-11

    The solute rejection versus concentration behaviour of five different amino acids has been investigated using a Nitto Denko NTR7450 nanofiltration membrane. The experimental data for amino acid rejection was also compared against a combined steric and charge rejection model. At its isoelectric point, lysine was effectively neutral and its behaviour was well described by the model incorporating a steric function only. For phenylalanine, the combined model was found to fit the data well. In contrast there was poor agreement between the model and rejection data for glutamine, glutamic acid and glycine whose rejection values at first increased with concentration. This result implied that another governing process was in operation. Dimerisation as an explanation for the observed phenomena was also investigated. Size analysis of amino acid molecules as a function of the prevailing concentration using dynamic light scattering was limited but showed no evidence of dimerisation. This data was supported by osmotic pressure measurements which demonstrated no evidence of non-linearity in the relation between osmotic pressure and concentration.

  18. Preparation and Electrocatalytic Activity of Gold Nanoparticles Immobilized on the Surface of 4-Mercaptobenzoyl-Functionalized Multiwalled Carbon Nanotubes

    DTIC Science & Technology

    2010-12-20

    Friedel - Crafts acylation reaction. 24-26 The reaction medium is both mild and nondestructive and plays two important roles for the effective dispersion...the functionalization of multiwalled carbon nano- tubes (MWCNTs) with 4-mercaptobenzoic acid by a “direct” Friedel - Crafts acylation reaction to afford...MWCNTs were prepared using a “direct” Friedel - Crafts acylation reaction in a PPA/P2O5 medium. The reaction between the MWCNTs and MBAc typi- cally

  19. Synthesis and functionalization of gold nanorods for probing plasmonic enhancement mechanisms in organic photovoltaic active layers

    NASA Astrophysics Data System (ADS)

    Wadams, Robert Christopher

    DNA nanotechnology is one of the most flourishing interdisciplinary research fields. Through the features of programmability and predictability, DNA nanostructures can be designed to self-assemble into a variety of periodic or aperiodic patterns of different shapes and length scales, and more importantly, they can be used as scaffolds for organizing other nanoparticles, proteins and chemical groups. By leveraging these molecules, DNA nanostructures can be used to direct the organization of complex bio-inspired materials that may serve as smart drug delivery systems and in vitro or in vivo bio-molecular computing and diagnostic devices. In this dissertation I describe a systematic study of the thermodynamic properties of complex DNA nanostructures, including 2D and 3D DNA origami, in order to understand their assembly, stability and functionality and inform future design endeavors. It is conceivable that a more thorough understanding of DNA self-assembly can be used to guide the structural design process and optimize the conditions for assembly, manipulation, and functionalization, thus benefiting both upstream design and downstream applications. As a biocompatible nanoscale motif, the successful integration, stabilization and separation of DNA nanostructures from cells/cell lysate suggests its potential to serve as a diagnostic platform at the cellular level. Here, DNA origami was used to capture and identify multiple T cell receptor mRNA species from single cells within a mixed cell population. This demonstrates the potential of DNA nanostructure as an ideal nano scale tool for biological applications.

  20. Unraveling the dynamics and structure of functionalized self-assembled monolayers on gold using 2D IR spectroscopy and MD simulations

    PubMed Central

    Yan, Chang; Yuan, Rongfeng; Pfalzgraff, William C.; Nishida, Jun; Wang, Lu; Markland, Thomas E.; Fayer, Michael D.

    2016-01-01

    Functionalized self-assembled monolayers (SAMs) are the focus of ongoing investigations because they can be chemically tuned to control their structure and dynamics for a wide variety of applications, including electrochemistry, catalysis, and as models of biological interfaces. Here we combine reflection 2D infrared vibrational echo spectroscopy (R-2D IR) and molecular dynamics simulations to determine the relationship between the structures of functionalized alkanethiol SAMs on gold surfaces and their underlying molecular motions on timescales of tens to hundreds of picoseconds. We find that at higher head group density, the monolayers have more disorder in the alkyl chain packing and faster dynamics. The dynamics of alkanethiol SAMs on gold are much slower than the dynamics of alkylsiloxane SAMs on silica. Using the simulations, we assess how the different molecular motions of the alkyl chain monolayers give rise to the dynamics observed in the experiments. PMID:27044113

  1. Functional nucleic acids as in vivo metabolite and ion biosensors.

    PubMed

    Alsaafin, Alaa; McKeague, Maureen

    2017-02-21

    Characterizing the role of metabolites, metals, and proteins is required to understand normal cell function, and ultimately, elucidate the mechanism of disease. Metabolite concentration and transformation results collected from cell lysates or fixed-cells conceal important dynamic information and differences between individual cells that often have profound functional consequences. Functional nucleic acid-based biosensors are emerging tools that are capable of monitoring ions and metabolites in cell populations or whole animals. Functional nucleic acids (FNAs) are a class of biomolecules that can exhibit either ligand binding or enzymatic activity. Unlike their protein analogues or the use of instrument-based analysis, FNA-based biosensors are capable of entering cells without disruption to the cellular environment and can report on the concentration, dynamics, and spatial localization of molecules in cells. Here, we review the types of FNAs that have been used as in vivo biosensors, and how FNAs can be coupled to transduction systems and delivered inside cells. We also provide examples from the literature that demonstrate their impact in practical applications. Finally, we comment on the critical limitations that need to be addressed to enable their use for single-cell dynamic tracking of metabolites and ions in vivo.

  2. Picomolar melamine enhanced the fluorescence of gold nanoparticles: spectrofluorimetric determination of melamine in milk and infant formulas using functionalized triazole capped gold nanoparticles.

    PubMed

    Vasimalai, N; Abraham John, S

    2013-04-15

    We wish to report a simple and sensitive method to determine the melamine in milk and infant formulas using 3-amino-5-mercapto-1,2,4-triazole capped gold nanoparticles (AMTr-AuNPs) as fluorophore. The AMTr-AuNPs were synthesized by a wet chemical method and were characterized by high-resolution transmission electron microscopy (HR-TEM), and X-ray diffraction, UV-visible and fluorescence spectroscopic techniques. The AMTr-AuNPs show the absorption maximum at 520 nm and emission maximum at 759 nm (λ(ex)=520 nm). While adding 10 μM melamine, the wine red color of AMTr-AuNPs was changed into purple and the absorption band at 520 nm was decreased. The observed changes were ascribed to the hydrogen bonding interaction between melamine and AMTr-AuNPs, which led to the aggregation of the nanoparticles. This was confirmed by dynamic light scattering and HR-TEM measurements. No appreciable absorption change was observed for AMTr-AuNPs in the presence of less than micromolar concentrations of melamine. But, the emission intensity of AMTr-AuNPs was enhanced even in the presence of picomolar concentration of melamine. Based on the enhancement of emission intensity, the concentration of melamine was determined. The present fluorophore showed an extreme selectivity towards the determination of 100 nM melamine in the presence of 500-fold common interferents. The good linearly was observed from 1×10⁻⁹ to 100×10⁻¹² M melamine and a detection limit was found to be 10 fM/L (S/N=3). The proposed method was successfully applied to determine melamine in cow milk and infant formulas. The obtained results were validated with HPLC.

  3. A simple and efficient electrochemical sensor for folic acid determination in human blood plasma based on gold nanoparticles-modified carbon paste electrode.

    PubMed

    Arvand, Majid; Dehsaraei, Mohammad

    2013-08-01

    Folic acid (FA) is a water soluble vitamin that exists in many natural species. The lack of FA causes some deficiencies in human body, so finding a simple and sensitive method for determining the FA is important. A new chemically modified electrode was fabricated for determination of FA in human blood plasma using gold nanoparticles (AuNPs) and carbon paste electrode (CPE). Gold nanoparticles-modified carbon paste electrode (AuNPs/CPE) was characterized by transmission electron microscopy (TEM) and scanning electron microscopy (SEM). The experimental parameters such as pH, scan rate (ν) and amount of modifier were studied by cyclic voltammetry and the optimized values were chosen. The electrochemical parameters such as diffusion coefficient of FA (D(FA)), electrode surface area (A) and electron transfer coefficient (α) were calculated. Square wave voltammetry as an accurate technique was used for quantitative calculations. A good linear relation was observed between anodic peak current (ipa) and FA concentration (CFA) in the range of 6×10(-8) to 8×10(-5) mol L(-1), and the detection limit (LOD) achieved 2.7×10(-8) mol L(-1), that is comparable with recently studies. This paper demonstrated a novel, simple, selective and rapid sensor for determining the FA in the biological samples.

  4. Poly(acrylic acid) Bridged Gadolinium Metal-Organic Framework-Gold Nanoparticle Composites as Contrast Agents for Computed Tomography and Magnetic Resonance Bimodal Imaging

    PubMed Central

    Tian, Chixia; Zhu, Liping; Lin, Feng; Boyes, Stephen G.

    2015-01-01

    Imaging contrast agents for magnetic resonance imaging (MRI) and computed tomography (CT) have received significant attention in the development of techniques for early-stage cancer diagnosis. Gadolinium (Gd) (III), which has seven unpaired electrons and a large magnetic moment, can dramatically influence the water proton relaxation and hence exhibits excellent MRI contrast. On the other hand, gold (Au), which has a high atomic number and high x-ray attenuation coefficient, is an ideal contrast agent candidate for x-ray based CT imaging. Gd metal organic framework (MOF) nanoparticles with tunable size, high Gd (III) loading and multivalency can potentially overcome the limitations of clinically utilized Gd chelate contrast agents. In this work, we report for the first time the integration of GdMOF nanoparticles with gold nanoparticles (AuNPs) for the preparation of a MRI/CT bimodal imaging agent. Highly stable hybrid GdMOF/AuNPs composites have been prepared by using poly(acrylic acid) as a bridge between the GdMOF nanoparticles and AuNPs. The hybrid nanocomposites were then evaluated in MRI and CT imaging. The results revealed high longitudinal relaxivity in MRI and excellent CT imaging performance. Therefore, these GdMOF/AuNPs hybrid nanocomposites potentially provide a new platform for the development of multi-modal imaging probes. PMID:26147906

  5. Structure and function of eukaryotic fatty acid synthases.

    PubMed

    Maier, Timm; Leibundgut, Marc; Boehringer, Daniel; Ban, Nenad

    2010-08-01

    In all organisms, fatty acid synthesis is achieved in variations of a common cyclic reaction pathway by stepwise, iterative elongation of precursors with two-carbon extender units. In bacteria, all individual reaction steps are carried out by monofunctional dissociated enzymes, whereas in eukaryotes the fatty acid synthases (FASs) have evolved into large multifunctional enzymes that integrate the whole process of fatty acid synthesis. During the last few years, important advances in understanding the structural and functional organization of eukaryotic FASs have been made through a combination of biochemical, electron microscopic and X-ray crystallographic approaches. They have revealed the strikingly different architectures of the two distinct types of eukaryotic FASs, the fungal and the animal enzyme system. Fungal FAS is a 2·6 MDa α₆β₆ heterododecamer with a barrel shape enclosing two large chambers, each containing three sets of active sites separated by a central wheel-like structure. It represents a highly specialized micro-compartment strictly optimized for the production of saturated fatty acids. In contrast, the animal FAS is a 540 kDa X-shaped homodimer with two lateral reaction clefts characterized by a modular domain architecture and large extent of conformational flexibility that appears to contribute to catalytic efficiency.

  6. Plant amino acid-derived vitamins: biosynthesis and function.

    PubMed

    Miret, Javier A; Munné-Bosch, Sergi

    2014-04-01

    Vitamins are essential organic compounds for humans, having lost the ability to de novo synthesize them. Hence, they represent dietary requirements, which are covered by plants as the main dietary source of most vitamins (through food or livestock's feed). Most vitamins synthesized by plants present amino acids as precursors (B1, B2, B3, B5, B7, B9 and E) and are therefore linked to plant nitrogen metabolism. Amino acids play different roles in their biosynthesis and metabolism, either incorporated into the backbone of the vitamin or as amino, sulfur or one-carbon group donors. There is a high natural variation in vitamin contents in crops and its exploitation through breeding, metabolic engineering and agronomic practices can enhance their nutritional quality. While the underlying biochemical roles of vitamins as cosubstrates or cofactors are usually common for most eukaryotes, the impact of vitamins B and E in metabolism and physiology can be quite different on plants and animals. Here, we first aim at giving an overview of the biosynthesis of amino acid-derived vitamins in plants, with a particular focus on how this knowledge can be exploited to increase vitamin contents in crops. Second, we will focus on the functions of these vitamins in both plants and animals (and humans in particular), to unravel common and specific roles for vitamins in evolutionary distant organisms, in which these amino acid-derived vitamins play, however, an essential role.

  7. Molecular acidity: A quantitative conceptual density functional theory description.

    PubMed

    Liu, Shubin; Schauer, Cynthia K; Pedersen, Lee G

    2009-10-28

    Accurate predictions of molecular acidity using ab initio and density functional approaches are still a daunting task. Using electronic and reactivity properties, one can quantitatively estimate pKa values of acids. In a recent paper [S. B. Liu and L. G. Pedersen, J. Phys. Chem. A 113, 3648 (2009)], we employed the molecular electrostatic potential (MEP) on the nucleus and the sum of valence natural atomic orbital (NAO) energies for the purpose. In this work, we reformulate these relationships on the basis of conceptual density functional theory and compare the results with those from the thermodynamic cycle method. We show that MEP and NAO properties of the dissociating proton of an acid should satisfy the same relationships with experimental pKa data. We employ 27 main groups and first to third row transition metal-water complexes as illustrative examples to numerically verify the validity of these strong linear correlations. Results also show that the accuracy of our approach and that of the conventional method through the thermodynamic cycle are statistically similar.

  8. Efficient, dual-stimuli responsive cytosolic gene delivery using a RGD modified disulfide-linked polyethylenimine functionalized gold nanorod.

    PubMed

    Wang, Feihu; Shen, Yuanyuan; Zhang, Wenjun; Li, Min; Wang, Yun; Zhou, Dejian; Guo, Shengrong

    2014-12-28

    Controlled-release systems capable of responding to external stimuli and/or unique internal environments have received great interests in site-specific gene and/or drug delivery. In this work, a functionalized gene nanocarrier for dual-stimuli triggered cytosolic gene delivery is developed and showing high gene delivery efficacy with low cytotoxicity. The nanocarrier is prepared by conjugating gold nanorod (GNR) with multiple disulfide cross-linked short PEIs to harness the advantageous properties of GNR based near infrared (NIR) laser induced photothermal heating and intracellular stimuli-triggered degradability of disulfide cross-linked short PEIs (DSPEI). The DSPEI is further grafted with a poly(ethylene glycol) (PEG) section to afford high carrier stability in cell cultures and a terminal RGD peptide for specific targeting of cancer cells. The nanocarrier is found to effectively condense plasmid DNA to form a highly stable GNR-DSPEI-PEG-RGD/DNA complex with tumor cell-targeting ability that can be efficiently uptaken by cancer cells. Moreover, the loaded genes can be effectively released from the complex triggered by the high intracellular glutathione content and/or by photothermal effect of NIR irradiation at 808 nm. Interestingly, the GNRs-based complex can easily escape from intracellular endo-/lyso-somal compartments and release the gene load into the cytosol upon exposure to NIR irradiation, resulting in significantly improved gene transfection efficiency. Our new gene carrier exhibits high gene transfection efficiency, comparable to or even better than that of high MW PEIs, but with a much lower cytotoxicity. Additionally, neither the GNR-based carrier nor the laser treatment shows any significant evidence of cytotoxicity. This work demonstrates a promising strategy for intracellular stimuli triggered, photothermal controllable gene delivery system, which can be further applied to many other nanomedicine fields.

  9. Chemical analysis of the superatom model for sulfur-stabilized gold nanoparticles.

    PubMed

    Reimers, Jeffrey R; Wang, Yun; Cankurtaran, Burak O; Ford, Michael J

    2010-06-23

    The superatom model for nanoparticle structure is shown to be inadequate for the prediction of the thermodynamic stability of gold nanoparticles. The observed large HOMO-LUMO gaps for stable nanoparticles predicted by this model are, for sulfur-stabilized gold nanoparticles, attributed to covalent interactions of the metal with thiyl adsorbate radicals rather than ionic interactions with thiolate adsorbate ions, as is commonly presumed. In particular, gold adatoms in the stabilizing layer are shown to be of Au(0) nature, subtle but significantly different from the atoms of the gold core owing to the variations in the proportion of gold-gold and gold-sulfur links that form. These interactions explain the success of the superatom model in describing the electronic structure of both known and informatory nanoparticle compositions. Nanoparticle reaction energies are, however, found not to correlate with the completion of superatom shells. Instead, local structural effects are found to dominate the chemistry and in particular the significantly different chemical properties of gold nanoparticle and bulk surfaces. These conclusions are drawn from density-functional-theory calculations for the Au(102)(p-mercaptobenzoic acid)(44) nanoparticle based on the X-ray structure (Jadzinsky, P. D.; et al. Science 2007, 318, 430), as well calculations for the related Au(102)(S(*)-CH(3))(44) nanoparticle, for the inner gold-cluster cores, for partially and overly reacted cores, and for Au(111) surface adsorbates.

  10. Electron and ion transfer through multilayers of gold nanoclusters covered by self-assembled monolayers of alkylthiols with various functional groups.

    PubMed

    Uosaki, Kohei; Kondo, Toshihiro; Okamura, Masayuki; Song, Wenbo

    2002-01-01

    The electrochemical characteristics of various kinds of multilayers of gold nanoclusters (GNCs) were investigated. Two types of gold nanoclusters, one covered by self-assembled monolayers (SAMs) of mercaptoundecanoic acid (MUA), hexanethiol (C6SH), and ferrocenylhexanethiol (FcC6SH), MHF-GNC, and the other with MUA and C6SH, MH-GNC, were used. The multilayers were constructed on a Au(111) surface based on a carboxylate/metal cation (Cu++)/carboxylate or carboxylate/cationic polymer (poly(allylamine hydrochloride):PAH)/carboxylate electrostatic interaction. While the multilayers constructed by the former method were stable only in nonaqueous solutions, those constructed by the latter method were stable even in aqueous solutions. Electrochemical measurements of the multilayers of MHF-GNCs showed a pair of waves corresponding to the redox of the ferrocene group around 350-480 mV and the charge of these peaks, i.e., the amount of adsorbed GNC, increased linearly with the construction cycle up to 6 cycles in the former and to 18 cycles in the latter. A rather reversible redox response of the ferrocene moiety was observed even at the gold electrodes with five GNC layers of two different sequences in which MHF-GNC exists as the layer closest to the gold electrode, ie., the first layer, or as the outermost layer with MH-GNC in the other layers. These results show the facile transfer of electrons and ions through the multilayers of the SAM-covered GNCs and electron transfer between the ferrocene moiety and the Au(111) electrode takes place through the GNC cores by hopping.

  11. Plasma Polyunsaturated Fatty Acids and the Decline of Renal Function

    PubMed Central

    Lauretani, Fulvio; Semba, Richard D.; Bandinelli, Stefania; Miller, Edgar R.; Ruggiero, Carmelinda; Cherubini, Antonio; Guralnik, Jack M.; Ferrucci, Luigi

    2009-01-01

    Background Recent studies suggest an association between polyunsaturated fatty acids (PUFAs) and the development of chronic kidney disease. The aim of this study was to examine the relationship between PUFAs and renal function in older adults. Methods We performed a cross-sectional and prospective analysis of 931 adults, ≥65 years old, enrolled in the InCHIANTI study, a population-based cohort in Tuscany, Italy. Plasma PUFAs were measured at enrollment, and creatinine clearance was estimated by the Cockcroft-Gault equation at baseline and after 3-year follow-up. Results At enrollment, participants with higher creatinine clearance had higher concentrations of HDL cholesterol, total plasma PUFAs, plasma n-3 fatty acid (FA), and plasma n-6 FA and lower triglycerides. From enrollment to the 3-year follow-up visit, creatinine clearance declined by 7.8 (12.2) mL/min (P <0.0001). Baseline total plasma PUFAs, n-3 FA, n-6 FA, and linoleic, linolenic, and arachidonic acids were strong independent predictors of less steep decline in creatinine clearance from baseline to follow-up (P <0.0001, after adjusting for baseline creatinine clearance). After adjusting for baseline creatinine, baseline total plasma PUFAs, n-3 FA, and linoleic, linolenic, and arachidonic acids were negatively associated with creatinine at 3-year follow-up. Participants with higher plasma PUFAs at enrollment had a lower risk of developing renal insufficiency, defined by a creatinine clearance <60 mL/min, during 3-year follow-up. Conclusion High PUFA concentrations, both n-3 FA and n-6 FA, may attenuate the age-associated decline in renal function among older community-dwelling women and men. PMID:18202159

  12. Phosphonic Acid-Functionalized Polyurethane Dispersions with Improved Adhesion Properties.

    PubMed

    Breucker, Laura; Landfester, Katharina; Taden, Andreas

    2015-11-11

    A facile route to phosphorus-functionalized polyurethane dispersions (P-PUDs) with improved adhesion properties is presented. (Bis)phosphonic acid moieties serve as adhesion promoting sites that are covalently attached via an end-capping reaction to isocyanate-reactive polyurethane particles under aqueous conditions. The synthetic approach circumvents solubility issues, offers great flexibility in terms of polyurethane composition, and allows for the synthesis of semicrystalline systems with thermomechanical response due to reversible physical cross-linking. Differential scanning calorimetry (DSC) is used to investigate the effect of functionalization on the semicrystallinity. The end-capping conversion was determined via inductively-coupled plasma optical emission spectroscopy (ICP-OES) and was surprisingly found to be almost independent of the stoichiometry of reaction, suggesting an adsorption-dominated process. Particle charge detection (PCD) experiments reveal that a dense surface coverage of phosphonic acid groups can be attained and that, at high functionalization degrees, the phosphonic adhesion moieties are partially dragged inside the colloidal P-PUD particle. Quartz crystal microbalance with dissipation (QCMD) investigations conducted with hydroxyapatite (HAP) and stainless steel sensors as model surfaces show a greatly enhanced affinity of the aqueous P-PUDs and furthermore indicate polymer chain rearrangements and autonomous film formation under wet conditions. Due to their facile synthesis, significantly improved adhesion, and variable film properties, P-PUD systems such as the one described here are believed to be of great interest for multiple applications, e.g., adhesives, paints, anticorrosion, or dentistry.

  13. Identification of Novel Functional Inhibitors of Acid Sphingomyelinase

    PubMed Central

    Trapp, Stefan; Pechmann, Stefanie; Friedl, Astrid; Reichel, Martin; Mühle, Christiane; Terfloth, Lothar; Groemer, Teja W.; Spitzer, Gudrun M.; Liedl, Klaus R.; Gulbins, Erich; Tripal, Philipp

    2011-01-01

    We describe a hitherto unknown feature for 27 small drug-like molecules, namely functional inhibition of acid sphingomyelinase (ASM). These entities named FIASMAs (Functional Inhibitors of Acid SphingoMyelinAse), therefore, can be potentially used to treat diseases associated with enhanced activity of ASM, such as Alzheimer's disease, major depression, radiation- and chemotherapy-induced apoptosis and endotoxic shock syndrome. Residual activity of ASM measured in the presence of 10 µM drug concentration shows a bimodal distribution; thus the tested drugs can be classified into two groups with lower and higher inhibitory activity. All FIASMAs share distinct physicochemical properties in showing lipophilic and weakly basic properties. Hierarchical clustering of Tanimoto coefficients revealed that FIASMAs occur among drugs of various chemical scaffolds. Moreover, FIASMAs more frequently violate Lipinski's Rule-of-Five than compounds without effect on ASM. Inhibition of ASM appears to be associated with good permeability across the blood-brain barrier. In the present investigation, we developed a novel structure-property-activity relationship by using a random forest-based binary classification learner. Virtual screening revealed that only six out of 768 (0.78%) compounds of natural products functionally inhibit ASM, whereas this inhibitory activity occurs in 135 out of 2028 (6.66%) drugs licensed for medical use in humans. PMID:21909365

  14. Impact of fatty acids on brain circulation, structure and function.

    PubMed

    Haast, Roy A M; Kiliaan, Amanda J

    2015-01-01

    The use of dietary intervention has evolved into a promising approach to prevent the onset and progression of brain diseases. The positive relationship between intake of omega-3 long chain polyunsaturated fatty acids (ω3-LCPUFAs) and decreased onset of disease- and aging-related deterioration of brain health is increasingly endorsed across epidemiological and diet-interventional studies. Promising results are found regarding to the protection of proper brain circulation, structure and functionality in healthy and diseased humans and animal models. These include enhanced cerebral blood flow (CBF), white and gray matter integrity, and improved cognitive functioning, and are possibly mediated through increased neurovascular coupling, neuroprotection and neuronal plasticity, respectively. Contrary, studies investigating diets high in saturated fats provide opposite results, which may eventually lead to irreversible damage. Studies like these are of great importance given the high incidence of obesity caused by the increased and decreased consumption of respectively saturated fats and ω3-LCPUFAs in the Western civilization. This paper will review in vivo research conducted on the effects of ω3-LCPUFAs and saturated fatty acids on integrity (circulation, structure and function) of the young, aging and diseased brain.

  15. Density functional theory based studies on the nature of Raman and resonance Raman scattering of nerve agent bound to gold and oxide-supported gold clusters: a plausible way of detection.

    PubMed

    Majumdar, D; Roszak, Szczepan; Leszczynski, Jerzy

    2010-04-01

    A detailed theoretical investigation has been carried out at the density functional level of theories to investigate the nature of Raman intensities of the -P=O stretching mode of a model nerve agent DFP (diisopropylfluorophosphate) when bound to different gold (Au(8), Au(20)) and oxide-supported gold (MgO...Au(4), CaO...Au(4), TiO(2)...Au(4), Al(2)O(3)...Au(4), M(16)O(16)...Au(8), and [M(16)O(15)...Au(8)](2+), M = Ca, Mg) clusters. All of these clusters and the DFP-bound clusters are fully optimized, and the computed energetics shows that DFP attaches itself weakly to these clusters. The normal Raman spectra calculations on these clusters show that there is substantial enhancement of the -P=O stretching mode of DFP compared to the isolated species. This enhancement has been found to be due to the polarization of the -P=O bond of DFP when bound to the clusters. Significant enhancement in intensity has been observed in the case of Au(n)...DFP (n = 8, 20), M(16)O(16)...Au(8)...DFP, and [M(16)O(15)...Au(8)](2+)...DFP (M = Ca, Mg) clusters. The resonance Raman calculations on the Au(n)...DFP (n = 8, 20) reveals that this enhancement could be made quite large and selective, which is a feature that is unique to the nerve agents and could be used as a property for detecting them.

  16. Reversible lysine modification on proteins by using functionalized boronic acids.

    PubMed

    Cal, Pedro M S D; Frade, Raquel F M; Cordeiro, Carlos; Gois, Pedro M P

    2015-05-26

    Iminoboronates have been utilized to successfully install azide and alkyne bioorthogonal functions on proteins, which may then be further reacted with their bioorthogonal counterparts. These constructs were also used to add polyethylene glycol (PEG) to insulin, a modification which has been shown to be reversible in the presence of fructose. Finally, iminoboronates were used to assemble a folic acid/paclitaxel small-molecule/drug conjugate in situ with an IC50  value of 20.7 nM against NCI-H460 cancer cells and negligible cytotoxicity against the CRL-1502 noncancer cells.

  17. Structure and function analysis of protein-nucleic acid complexes

    NASA Astrophysics Data System (ADS)

    Kuznetsova, S. A.; Oretskaya, T. S.

    2016-05-01

    The review summarizes published data on the results and achievements in the field of structure and function analysis of protein-nucleic acid complexes by means of main physical and biochemical methods, including X-ray diffraction, nuclear magnetic resonance spectroscopy, electron and atomic force microscopy, small-angle X-ray and neutron scattering, footprinting and cross-linking. Special attention is given to combined approaches. The advantages and limitations of each method are considered, and the prospects of their application for wide-scale structural studies in vivo are discussed. The bibliography includes 145 references.

  18. Highly selective capture of nucleosides with boronic acid functionalized polymer brushes prepared by atom transfer radical polymerization.

    PubMed

    Cheng, Ting; Zhu, Shuqiang; Zhu, Bin; Liu, Xiaoyan; Zhang, Haixia

    2016-04-01

    The nucleoside or modified nucleoside level in biological fluids reflects the pathological or physiological state of the body. Boronate affinity absorbents are widely used to selectively extract nucleosides from complex samples. In this work, a novel functionalized absorbent was synthesized by attaching 4-mercaptophenylboronic acid to gold nanoparticles on modified attapulgite. The surface of the attapulgite was modified by poly(acryloyloxyethyltrimethyl ammonium chloride) by atom transfer radical polymerization, creating many polymer brushes on the surface. The resultant material exhibited superior binding capacity (30.83 mg/g) for adenosine and was able to capture cis-diol nucleosides from 1000-fold interferences. Finally, to demonstrate its potential for biomolecule extraction, this boronate affinity material was used to preconcentrate nucleosides from human urine and plasma.

  19. Development of phenylboronic acid-functionalized nanoparticles for emodin delivery

    PubMed Central

    Wang, Bo; Chen, Limin; Sun, Yingjuan; Zhu, Youliang; Sun, Zhaoyan; An, Tiezhu; Li, Yuhua; Lin, Yuan; Fan, Daping; Wang, Qian

    2015-01-01

    Stable and monodisperse phenylboronic acid-functionalized nanoparticles (PBA-NPs) were fabricated using 3-((acrylamido)methyl)phenylboronic acid homopolymer (PBAH) via solvent displacement technique. The effect of operating parameters, including stirring time, initial polymer concentration and the proportion of methanol on the self-assembly process were systematically investigated. The diameters of the PBA-NPs were increased as increasing the initial PBAH concentration and the proportion of methanol. Likewise, there was a linear dependence between the size of self-assembled nanoparticles and the polymer concentration. Moreover, the dissipative particle dynamics (DPD) simulation technique was used to investigate the mechanism of self-assembly behavior of PBAH, which indicated that the interior of PBA-NPs was hydrophobic and compact, and the boronic acid groups were displayed on both the outermost and interior of PBA-NPs. The resulting PBA-NPs could successfully encapsulate emodin through PBA-diol interaction and the encapsulation efficiency (EE%) and drug loading content (DLC%) of drug-loaded PBA-NPs were 78% and 2.1%, respectively. Owing to the acid-labile feature of the boronate linkage, a reduction in environmental pH from pH 7.4 to 5.0 could trigger the disassociation of the boronate ester bonds, which could accelerate the drug release from PBA-Emodin-NPs. Besides, PBA-Emodin-NPs showed a much higher cytotoxicity to HepG2 cells (cancer cells) than that to MC-3T3-E1 cells (normal cells). These results imply that PBA-NPs would be a promising scaffold for the delivery of polyphenolic drugs. PMID:25960874

  20. Dietary fatty acids influence sperm quality and function.

    PubMed

    Ferramosca, A; Moscatelli, N; Di Giacomo, M; Zara, V

    2017-03-23

    Recently, obesity has been linked to male infertility. In animal models the administration of a high-fat diet caused a reduction in sperm quality, by impairing gamete energy metabolism. The aim of this study was to investigate a possible effect of dietary fatty acids supplementation in the modulation of sperm energy metabolism and, in turn, in the improvement of sperm quality in rats fed a high-fat diet. Sexually mature male Sprague-Dawley rats were divided into four groups and fed for 4 weeks a standard diet (control group), a high-fat diet (enriched in 35% of fat and 15% sucrose), a high-fat diet supplemented with 2.5% olive oil (a source of monounsaturated fatty acids) or a high-fat diet supplemented with 2.5% krill oil (a source of n-3 polyunsaturated fatty acids). Liver and adipose tissue weight, plasma glucose, insulin and lipid concentrations were determined. Activities of enzymes involved in sperm energetic metabolism were evaluated by spectrophotometric assays. Sperm mitochondrial respiratory efficiency was also assayed. The obtained results suggest that olive oil partially counteracts the negative effects of a high-fat diet on sperm quality, by increasing gamete motility, by reducing oxidative stress and slightly improving mitochondrial respiration efficiency. On the other hand, krill oil determines an increase in sperm concentration and motility, an increase in the activities of lactate dehydrogenase, Krebs cycle enzymes and respiratory chain complexes; a parallel increase in the cellular levels of ATP and a reduction in oxidative damage were also observed. These results suggest that dietary fatty acids are able to positively influence sperm quality and function.

  1. Functional nucleic-acid-based sensors for environmental monitoring.

    PubMed

    Sett, Arghya; Das, Suradip; Bora, Utpal

    2014-10-01

    Efforts to replace conventional chromatographic methods for environmental monitoring with cheaper and easy to use biosensors for precise detection and estimation of hazardous environmental toxicants, water or air borne pathogens as well as various other chemicals and biologics are gaining momentum. Out of the various types of biosensors classified according to their bio-recognition principle, nucleic-acid-based sensors have shown high potential in terms of cost, sensitivity, and specificity. The discovery of catalytic activities of RNA (ribozymes) and DNA (DNAzymes) which could be triggered by divalent metallic ions paved the way for their extensive use in detection of heavy metal contaminants in environment. This was followed with the invention of small oligonucleotide sequences called aptamers which can fold into specific 3D conformation under suitable conditions after binding to target molecules. Due to their high affinity, specificity, reusability, stability, and non-immunogenicity to vast array of targets like small and macromolecules from organic, inorganic, and biological origin, they can often be exploited as sensors in industrial waste management, pollution control, and environmental toxicology. Further, rational combination of the catalytic activity of DNAzymes and RNAzymes along with the sequence-specific binding ability of aptamers have given rise to the most advanced form of functional nucleic-acid-based sensors called aptazymes. Functional nucleic-acid-based sensors (FNASs) can be conjugated with fluorescent molecules, metallic nanoparticles, or quantum dots to aid in rapid detection of a variety of target molecules by target-induced structure switch (TISS) mode. Although intensive research is being carried out for further improvements of FNAs as sensors, challenges remain in integrating such bio-recognition element with advanced transduction platform to enable its use as a networked analytical system for tailor made analysis of environmental

  2. Density Functional Investigation of the Inclusion of Gold Clusters on a CH 3 S Self-Assembled Lattice on Au(111)

    DOE PAGES

    Allen, Darnel J.; Archibald, Wayne E.; Harper, John A.; ...

    2016-01-01

    We employ first-principles density functional theoretical calculations to address the inclusion of gold (Au) clusters in a well-packed CH 3 S self-assembled lattice. We compute CH 3 S adsorption energies to quantify the energetic stability of the self-assembly and gold adsorption and dissolution energies to characterize the structural stability of a series of Au clusters adsorbed at the SAM-Au interface. Our results indicate that the inclusion of Au clusters with less than four Au atoms in the SAM-Au interface enhances the binding of CH 3 S species. In contrast, larger Au clusters destabilize the self-assembly. We attribute this effectmore » to the low-coordinated gold atoms in the cluster. For small clusters, these low-coordinated sites have significantly different electronic properties compared to larger islands, which makes the binding with the self-assembly energetically more favorable. Our results further indicate that Au clusters in the SAM-Au interface are thermodynamically unstable and they will tend to dissolve, producing Au adatoms incorporated in the self-assembly in the form of CH 3 S-Au-SCH 3 species. This is due to the strong S-Au bond which stabilizes single Au adatoms in the self-assembly. Our results provide solid insight into the impact of adatom islands at the CH 3 S-Au interface.« less

  3. Highly active thermally stable nanoporous gold catalyst

    SciTech Connect

    Biener, Juergen; Wittstock, Arne; Biener, Monika M.; Bagge-Hansen, Michael; Baeumer, Marcus; Wichmann, Andre; Neuman, Bjoern

    2016-12-20

    In one embodiment, a system includes a nanoporous gold structure and a plurality of oxide particles deposited on the nanoporous gold structure; the oxide particles are characterized by a crystalline phase. In another embodiment, a method includes depositing oxide nanoparticles on a nanoporous gold support to form an active structure and functionalizing the deposited oxide nanoparticles.

  4. Colorimetric detection of platelet-derived growth factors through competitive interactions between proteins and functional gold nanoparticles.

    PubMed

    Lin, Tzu-En; Chen, Wei-His; Shiang, Yen-Chun; Huang, Chih-Ching; Chang, Huan-Tsung

    2011-11-15

    We have developed a colorimetric assay-using aptamer modified 13-nm gold nanoparticles (Apt-Au NPs) and fibrinogen adsorbed Au NPs (Fib-Au NPs, 56nm)-for the highly selective and sensitive detection of platelet-derived growth factors (PDGF). Apt-Au NPs and Fib-Au NPs act as recognition and reporting units, respectively. PDGF-binding-aptamer (Apt(PDGF)) and 29-base-long thrombin-binding-aptamer (Apt(thr29)) are conjugated with Au NPs to prepare functional Apt-Au NPs (Apt(PDGF)/Apt(thr29)-Au NPs) for specific interaction with PDGF and thrombin, respectively. Thrombin interacts with Fib-Au NPs in solutions to catalyze the formation of insoluble fibrillar fibrin-Au NPs agglutinates through the polymerization of the unconjugated and conjugated fibrinogen. The activity of thrombin is suppressed once it interacts with the Apt(PDGF)/Apt(thr29)-Au NPs. The suppression decreases due to steric effects through the specific interaction of PDGF with Apt(PDGF), occurring on the surfaces of Apt(PDGF)/Apt(thr29)-Au NPs. Under optimal conditions [Apt(PDGF)/Apt(thr29)-Au NPs (25pM), thrombin (400pM) and Fib-Au NPs (30pM)], the Apt(PDGF)/Apt(thr29)-Au NPs/Fib-Au NPs probe responds linearly to PDGF over the concentration range of 0.5-20nM with a correlation coefficient of 0.96. The limit of detection (LOD, signal-to-noise ratio=3) for each of the three PDGF isoforms is 0.3nM in the presence of bovine serum albumin at 100μM. When using the Apt(PDGF)/Apt(thr29)-Au NPs as selectors for the enrichment of PDGF and for the removal of interferences from cell media, the LOD for PDGF provided by this probe is 35pM. The present probe reveals that the concentration of PDGF in the three cell media is 230 (±20)pM, showing its advantages of simplicity, sensitivity, and specificity.

  5. Docosahexaenoic acid and visual functioning in preterm infants: a review.

    PubMed

    Molloy, Carly; Doyle, Lex W; Makrides, Maria; Anderson, Peter J

    2012-12-01

    Preterm children are at risk for a number of visual impairments which can be important for a range of other more complex visuocognitive tasks reliant on visual information. Despite the relatively high incidence of visual impairments in this group there are no good predictors that would allow early identification of those at risk for adverse outcomes. Several lines of evidence suggest that docosahexaenoic acid (DHA) supplementation for preterm infants may improve outcomes in this area. For example, diets deficient in the long-chain polyunsaturated fatty acid DHA have been shown to reduce its concentration in the cerebral cortex and retina, which interferes with physiological processes important for cognition and visual functioning. Further, various studies with pregnant and lactating women, as well as formula-fed infants, have demonstrated a general trend that supplementation with dietary DHA is associated with better childhood outcomes on tests of visual and cognitive development over the first year of life. However, research to date has several methodological limitations, including concentrations of DHA supplementation that have been too low to emulate the in utero accretion of DHA, using single measures of visual acuity to make generalised assumptions about the entire visual system, and little attempt to match what we know about inadequate DHA and structural ramifications with how specific functions may be affected. The objective of this review is to consider the role of DHA in the context of visual processing with a specific emphasis on preterm infants and to illustrate how future research may benefit from marrying what we know about structural consequences to inadequate DHA with functional outcomes that likely have far-reaching ramifications. Factors worth considering for clinical neuropsychological evaluation are also discussed.

  6. An electrochemical biosensor based on nanoporous stainless steel modified by gold and palladium nanoparticles for simultaneous determination of levodopa and uric acid.

    PubMed

    Rezaei, Behzad; Shams-Ghahfarokhi, Leila; Havakeshian, Elaheh; Ensafi, Ali A

    2016-09-01

    In this paper, an electrochemical biosensor based on gold and palladium nano particles-modified nanoporous stainless steel (Au-Pd/NPSS) electrode has been introduced for the simultaneous determination of levodopa (LD) and uric acid (UA). To prepare the electrode, the stainless steel was anodized to fabricate NPSS and then Cu was electrodeposited onto the nanoporous steel by applying the multiple step potential. Finally, the electrode was immersed into a gold and palladium precursor's solution by the atomic ratio of 9:1 to form Au-Pd/NPSS through the galvanic replacement reaction. Morphological aspects, structural properties and the electroanalytical behavior of the Au-Pd/NPSS electrode were studied using field emission scanning electron microscopy (FE-SEM), energy dispersive X-ray spectroscopy (EDX), X-ray diffraction (XRD), electrochemical impedance spectroscopy (EIS) and voltammetric techniques. Also, differential pulse voltammetry (DPV) was used for the simultaneous determination of LD and UA. According to results, the surface of Au-Pd/NPSS electrode contained Au and Pd nanoparticles with an average diameter of 75nm. The electrode acted better than Au/NPSS and Pd/NPSS electrodes for the simultaneous determination of LD and UA, with the peak separation potential of about 220mV. Also, the calibration plot for LD was in two linear concentration ranges of 5.0-10.0 and 10.0-55.0μmolL(-1) and for UA, it was in the range of 100-1200μmolL(-1). The detection limit for LD and UA was 0.2 and 15μmolL(-1), respectively. The modified electrode had a good performance for LD and UA detection in urine, blood serum and levodopa C-Forte tablet.

  7. Extraction of gold(III) from hydrochloric acid solutions by CTAB/n-heptane/iso-amyl alcohol/Na2SO3 microemulsion.

    PubMed

    Lu, Wenjuan; Lu, Yanmin; Liu, Fei; Shang, Kai; Wang, Wei; Yang, Yanzhao

    2011-02-28

    The extraction of Au(III) from hydrochloric acid solutions by microemulsion was studied. The extraction experiments were carried out using cetyltrimethylammonium bromide (CTAB) as surfactant and iso-amyl alcohol as co-surfactant. Au(III) was found to be extracted into the microemulsion phase due to ion pair formation such as AuCl(4)(-)CTAB(+). The influence of temperature on the extraction of Au(III) has been investigated at temperatures ranging from 288 to 313 K. Temperature was found to decrease the distribution of Au(III). Thermodynamic parameters like enthalpy and entropy of the extraction, calculated by applying Van't Hoff equation, were -36.76 kJ mol(-1) and -84.87 J mol(-1) K(-1), respectively. Furthermore, the influence of the concentrations of hydrogen ion and chloride anion on the extraction efficiency (E%) were verified. Au(III) was extracted quantitatively (E%>99%) and selectively at the whole range of HCl concentrations (0.2-5 M). Recovery of gold from electrical waste and treatment of CTAB wastewater generated from the extraction were also discussed. Thus, the extraction of Au(III) from hydrochloric acid solutions by microemulsion is an effective approach.

  8. Guiding Brain-Tumor Surgery via Blood-Brain-Barrier-Permeable Gold Nanoprobes with Acid-Triggered MRI/SERRS Signals.

    PubMed

    Gao, Xihui; Yue, Qi; Liu, Zining; Ke, Mengjing; Zhou, Xingyu; Li, Sihan; Zhang, Jianping; Zhang, Ren; Chen, Liang; Mao, Ying; Li, Cong

    2017-03-15

    Surgical resection is a mainstay in the treatment of malignant brain tumors. Surgeons, however, face great challenges in distinguishing tumor margins due to their infiltrated nature. Here, a pair of gold nanoprobes that enter a brain tumor by crossing the blood-brain barrier is developed. The acidic tumor environment triggers their assembly with the concomitant activation of both magnetic resonance (MR) and surface-enhanced resonance Raman spectroscopy (SERRS) signals. While the bulky aggregates continuously trap into the tumor interstitium, the intact nanoprobes in normal brain tissue can be transported back into the blood stream in a timely manner. Experimental results show that physiological acidity triggers nanoparticle assembly by forming 3D spherical nanoclusters with remarkable MR and SERRS signal enhancements. The nanoprobes not only preoperatively define orthotopic glioblastoma xenografts by magnetic resonance imaging (MRI) with high sensitivity and durability in vivo, but also intraoperatively guide tumor excision with the assistance of a handheld Raman scanner. Microscopy studies verify the precisely demarcated tumor margin marked by the assembled nanoprobes. Taking advantage of the nanoprobes' rapid excretion rate and the extracellular acidification as a hallmark of solid tumors, these nanoprobes are promising in improving brain-tumor surgical outcome with high specificity, safety, and universality.

  9. Acid-sensing ion channels: trafficking and synaptic function

    PubMed Central

    2013-01-01

    Extracellular acidification occurs in the brain with elevated neural activity, increased metabolism, and neuronal injury. This reduction in pH can have profound effects on brain function because pH regulates essentially every single biochemical reaction. Therefore, it is not surprising to see that Nature evolves a family of proteins, the acid-sensing ion channels (ASICs), to sense extracellular pH reduction. ASICs are proton-gated cation channels that are mainly expressed in the nervous system. In recent years, a growing body of literature has shown that acidosis, through activating ASICs, contributes to multiple diseases, including ischemia, multiple sclerosis, and seizures. In addition, ASICs play a key role in fear and anxiety related psychiatric disorders. Several recent reviews have summarized the importance and therapeutic potential of ASICs in neurological diseases, as well as the structure-function relationship of ASICs. However, there is little focused coverage on either the basic biology of ASICs or their contribution to neural plasticity. This review will center on these topics, with an emphasis on the synaptic role of ASICs and molecular mechanisms regulating the spatial distribution and function of these ion channels. PMID:23281934

  10. AHL-priming functions via oxylipin and salicylic acid

    PubMed Central

    Schenk, Sebastian T.; Schikora, Adam

    2015-01-01

    Collaborative action between the host plant and associated bacteria is crucial for the establishment of an efficient interaction. In bacteria, the synchronized behavior of a population is often achieved by a density-dependent communication called quorum sensing. This behavior is based on signaling molecules, which influence bacterial gene expression. N-acyl homoserine lactones (AHLs) are such molecules in many Gram-negative bacteria. Moreover, some AHLs are responsible for the beneficial effect of bacteria on plants, for example the long chain N-3-oxo-tetradecanoyl-L-homoserine lactone (oxo-C14-HSL) can prime Arabidopsis and barley plants for an enhanced defense. This AHL-induced resistance phenomenon, named AHL-priming, was observed in several independent laboratories during the last two decades. Very recently, the mechanism of priming with oxo-C14-HSL was shown to depend on an oxylipin and salicylic acid (SA). SA is a key element in plant defense, it accumulates during different plant resistance responses and is the base of systemic acquired resistance. In addition, SA itself can prime plants for an enhanced resistance against pathogen attack. On the other side, oxylipins, including jasmonic acid (JA) and related metabolites, are lipid-derived signaling compounds. Especially the oxidized fatty acid derivative cis-OPDA, which is the precursor of JA, is a newly described player in plant defense. Unlike the antagonistic effect of SA and JA in plant–microbe interactions, the recently described pathway functions through a synergistic effect of oxylipins and SA, and is independent of the JA signaling cascade. Interestingly, the oxo-C14-HSL-induced oxylipin/SA signaling pathway induces stomata defense responses and cell wall strengthening thus prevents pathogen invasion. In this review, we summarize the findings on AHL-priming and the related signaling cascade. In addition, we discuss the potential of AHL-induced resistance in new strategies of plant protection. PMID

  11. Cell wall structure and function in lactic acid bacteria

    PubMed Central

    2014-01-01

    The cell wall of Gram-positive bacteria is a complex assemblage of glycopolymers and proteins. It consists of a thick peptidoglycan sacculus that surrounds the cytoplasmic membrane and that is decorated with teichoic acids, polysaccharides, and proteins. It plays a major role in bacterial physiology since it maintains cell shape and integrity during growth and division; in addition, it acts as the interface between the bacterium and its environment. Lactic acid bacteria (LAB) are traditionally and widely used to ferment food, and they are also the subject of more and more research because of their potential health-related benefits. It is now recognized that understanding the composition, structure, and properties of LAB cell walls is a crucial part of developing technological and health applications using these bacteria. In this review, we examine the different components of the Gram-positive cell wall: peptidoglycan, teichoic acids, polysaccharides, and proteins. We present recent findings regarding the structure and function of these complex compounds, results that have emerged thanks to the tandem development of structural analysis and whole genome sequencing. Although general structures and biosynthesis pathways are conserved among Gram-positive bacteria, studies have revealed that LAB cell walls demonstrate unique properties; these studies have yielded some notable, fundamental, and novel findings. Given the potential of this research to contribute to future applied strategies, in our discussion of the role played by cell wall components in LAB physiology, we pay special attention to the mechanisms controlling bacterial autolysis, bacterial sensitivity to bacteriophages and the mechanisms underlying interactions between probiotic bacteria and their hosts. PMID:25186919

  12. Cancer-targeted functional gold nanoparticles for apoptosis induction and real-time imaging based on FRET

    NASA Astrophysics Data System (ADS)

    Chen, Wei-Hai; Luo, Guo-Feng; Xu, Xiao-Ding; Jia, Hui-Zhen; Lei, Qi; Han, Kai; Zhang, Xian-Zheng

    2014-07-01

    A versatile gold nanoparticle-based multifunctional RB-DEVD-AuNP-DTP has been developed to induce the targeted apoptosis of cancer cells and image in real time the progress of the apoptosis. The multifunctional nanoparticles were demonstrated to have the ability to initiate mitochondria-dependent apoptosis and activate caspase-3 for real-time imaging of the progression of apoptosis.A versatile gold