Sample records for acid interference rnai

  1. Towards the elements of successful insect Ribonucleic acid interference (RNAi)

    USDA-ARS?s Scientific Manuscript database

    Ribonucleic acid interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that ...

  2. Ribonucleic acid interference (RNAi) and control of citrus pests

    USDA-ARS?s Scientific Manuscript database

    Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control. ...

  3. Ribonucleic acid interference (RNAi) technology for control of Asian citrus psyllid

    USDA-ARS?s Scientific Manuscript database

    Ribonucleic acid interference, RNAi, applications and function are described for the non-scientist to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry. Two part Video presentation....

  4. Ribonucleic acid interference (RNAi) Technology for control of Asian citrus psyllid - You Tube

    USDA-ARS?s Scientific Manuscript database

    RNAi, Ribonucleic acid interference, function and application are described to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry....

  5. Bringing RNA Interference (RNAi) into the High School Classroom

    ERIC Educational Resources Information Center

    Sengupta, Sibani

    2013-01-01

    RNA interference (abbreviated RNAi) is a relatively new discovery in the field of mechanisms that serve to regulate gene expression (a.k.a. protein synthesis). Gene expression can be regulated at the transcriptional level (mRNA production, processing, or stability) and at the translational level (protein synthesis). RNAi acts in a gene-specific…

  6. Emerging strategies for RNA interference (RNAi) applications in insects.

    PubMed

    Nandety, Raja Sekhar; Kuo, Yen-Wen; Nouri, Shahideh; Falk, Bryce W

    2015-01-01

    RNA interference (RNAi) in insects is a gene regulatory process that also plays a vital role in the maintenance and in the regulation of host defenses against invading viruses. Small RNAs determine the specificity of the RNAi through precise recognition of their targets. These small RNAs in insects comprise small interfering RNAs (siRNAs), micro RNAs (miRNAs) and Piwi interacting RNAs (piRNAs) of various lengths. In this review, we have explored different forms of the RNAi inducers that are presently in use, and their applications for an effective and efficient fundamental and practical RNAi research with insects. Further, we reviewed trends in next generation sequencing (NGS) technologies and their importance for insect RNAi, including the identification of novel insect targets as well as insect viruses. Here we also describe a rapidly emerging trend of using plant viruses to deliver the RNAi inducer molecules into insects for an efficient RNAi response.

  7. RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?

    PubMed Central

    Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N.

    2016-01-01

    The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term. PMID:26927085

  8. RNA Interference in the Age of CRISPR: Will CRISPR Interfere with RNAi?

    PubMed

    Unniyampurath, Unnikrishnan; Pilankatta, Rajendra; Krishnan, Manoj N

    2016-02-26

    The recent emergence of multiple technologies for modifying gene structure has revolutionized mammalian biomedical research and enhanced the promises of gene therapy. Over the past decade, RNA interference (RNAi) based technologies widely dominated various research applications involving experimental modulation of gene expression at the post-transcriptional level. Recently, a new gene editing technology, Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and the CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) system, has received unprecedented acceptance in the scientific community for a variety of genetic applications. Unlike RNAi, the CRISPR/Cas9 system is bestowed with the ability to introduce heritable precision insertions and deletions in the eukaryotic genome. The combination of popularity and superior capabilities of CRISPR/Cas9 system raises the possibility that this technology may occupy the roles currently served by RNAi and may even make RNAi obsolete. We performed a comparative analysis of the technical aspects and applications of the CRISPR/Cas9 system and RNAi in mammalian systems, with the purpose of charting out a predictive picture on whether the CRISPR/Cas9 system will eclipse the existence and future of RNAi. The conclusion drawn from this analysis is that RNAi will still occupy specific domains of biomedical research and clinical applications, under the current state of development of these technologies. However, further improvements in CRISPR/Cas9 based technology may ultimately enable it to dominate RNAi in the long term.

  9. Asian citrus psyllid RNAi pathway - RNAi evidence

    USDA-ARS?s Scientific Manuscript database

    In silico analyses of the draft genome of Diaphorina citri, the Asian citrus psyllid, for genes within the Ribonucleic acid interference(RNAi), pathway was successful. The psyllid is the vector of the plant-infecting bacterium, Candidatus Liberibacter asiaticus (CLas), which is linked to citrus gree...

  10. Factors affecting citrus tree absorption of double-stranded ribonucleic acid, and RNAi delivery to psyllids

    USDA-ARS?s Scientific Manuscript database

    Modern molecular biological techniques allow for the design of molecules of ribonucleic acid capable of disrupting key biological processes of pests and diseases. A major requirement for the practical application of ribonucleic acid interference (RNAi) against insect pests is an efficient entry path...

  11. RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding.

    PubMed

    Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

    2014-01-01

    RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties.

  12. RNA Interference (RNAi) Induced Gene Silencing: A Promising Approach of Hi-Tech Plant Breeding

    PubMed Central

    Younis, Adnan; Siddique, Muhammad Irfan; Kim, Chang-Kil; Lim, Ki-Byung

    2014-01-01

    RNA interference (RNAi) is a promising gene regulatory approach in functional genomics that has significant impact on crop improvement which permits down-regulation in gene expression with greater precise manner without affecting the expression of other genes. RNAi mechanism is expedited by small molecules of interfering RNA to suppress a gene of interest effectively. RNAi has also been exploited in plants for resistance against pathogens, insect/pest, nematodes, and virus that cause significant economic losses. Keeping beside the significance in the genome integrity maintenance as well as growth and development, RNAi induced gene syntheses are vital in plant stress management. Modifying the genes by the interference of small RNAs is one of the ways through which plants react to the environmental stresses. Hence, investigating the role of small RNAs in regulating gene expression assists the researchers to explore the potentiality of small RNAs in abiotic and biotic stress management. This novel approach opens new avenues for crop improvement by developing disease resistant, abiotic or biotic stress tolerant, and high yielding elite varieties. PMID:25332689

  13. Role of RNA Interference (RNAi) in Dengue Virus Replication and Identification of NS4B as an RNAi Suppressor

    PubMed Central

    Kakumani, Pavan Kumar; Ponia, Sanket Singh; S, Rajgokul K.; Sood, Vikas; Chinnappan, Mahendran; Banerjea, Akhil C.; Medigeshi, Guruprasad R.; Malhotra, Pawan

    2013-01-01

    RNA interference (RNAi) is an important antiviral defense response in plants and invertebrates; however, evidences for its contribution to mammalian antiviral defense are few. In the present study, we demonstrate the anti-dengue virus role of RNAi in mammalian cells. Dengue virus infection of Huh 7 cells decreased the mRNA levels of host RNAi factors, namely, Dicer, Drosha, Ago1, and Ago2, and in corollary, silencing of these genes in virus-infected cells enhanced dengue virus replication. In addition, we observed downregulation of many known human microRNAs (miRNAs) in response to viral infection. Using reversion-of-silencing assays, we further showed that NS4B of all four dengue virus serotypes is a potent RNAi suppressor. We generated a series of deletion mutants and demonstrated that NS4B mediates RNAi suppression via its middle and C-terminal domains, namely, transmembrane domain 3 (TMD3) and TMD5. Importantly, the NS4B N-terminal region, including the signal sequence 2K, which has been implicated in interferon (IFN)-antagonistic properties, was not involved in mediating RNAi suppressor activity. Site-directed mutagenesis of conserved residues revealed that a Phe-to-Ala (F112A) mutation in the TMD3 region resulted in a significant reduction of the RNAi suppression activity. The green fluorescent protein (GFP)-small interfering RNA (siRNA) biogenesis of the GFP-silenced line was considerably reduced by wild-type NS4B, while the F112A mutant abrogated this reduction. These results were further confirmed by in vitro dicer assays. Together, our results suggest the involvement of miRNA/RNAi pathways in dengue virus establishment and that dengue virus NS4B protein plays an important role in the modulation of the host RNAi/miRNA pathway to favor dengue virus replication. PMID:23741001

  14. Role of RNA interference (RNAi) in the Moss Physcomitrella patens.

    PubMed

    Arif, Muhammad Asif; Frank, Wolfgang; Khraiwesh, Basel

    2013-01-14

    RNA interference (RNAi) is a mechanism that regulates genes by either transcriptional (TGS) or posttranscriptional gene silencing (PTGS), required for genome maintenance and proper development of an organism. Small non-coding RNAs are the key players in RNAi and have been intensively studied in eukaryotes. In plants, several classes of small RNAs with specific sizes and dedicated functions have evolved. The major classes of small RNAs include microRNAs (miRNAs) and small interfering RNAs (siRNAs), which differ in their biogenesis. miRNAs are synthesized from a short hairpin structure while siRNAs are derived from long double-stranded RNAs (dsRNA). Both miRNA and siRNAs control the expression of cognate target RNAs by binding to reverse complementary sequences mediating cleavage or translational inhibition of the target RNA. They also act on the DNA and cause epigenetic changes such as DNA methylation and histone modifications. In the last years, the analysis of plant RNAi pathways was extended to the bryophyte Physcomitrella patens, a non-flowering, non-vascular ancient land plant that diverged from the lineage of seed plants approximately 450 million years ago. Based on a number of characteristic features and its phylogenetic key position in land plant evolution P. patens emerged as a plant model species to address basic as well as applied topics in plant biology. Here we summarize the current knowledge on the role of RNAi in P. patens that shows functional overlap with RNAi pathways from seed plants, and also unique features specific to this species.

  15. RNAi-induced silencing of embryonic tryptophan oxygenase in the Pyralid moth, Plodia interpunctella

    PubMed Central

    Fabrick, Jeffrey A.; Kanost, Michael R.; Baker, James E.

    2004-01-01

    Gene silencing through the introduction of double-stranded RNA (RNA interference, RNAi) provides a powerful tool for the elucidation of gene function in many systems, including those where genomics and proteomics are incomplete. The use of RNAi technology for gene silencing in Lepidoptera has lacked significant attention compared to other systems. To demonstrate that RNAi can be utilized in the lepidopteran, Plodia interpunctella, we cloned a cDNA for tryptophan oxygenase, and showed that silencing of tryptophan oxygenase through RNAi during embryonic development resulted in loss of eye-color pigmentation. The complete amino acid sequence of Plodia tryptophan oxygenase can be accessed through NCBI Protein Database under NCBI Accession # AY427951. Abbreviation RNAi RNA interference PCR polymerase chain reaction RT-PCR reverse transcription-PCR PMID:15861231

  16. Analysis of Nuclear RNA Interference (RNAi) in Human Cells by Subcellular Fractionation and Argonaute Loading

    PubMed Central

    Gagnon, Keith T.; Li, Liande; Janowski, Bethany A.; Corey, David R.

    2014-01-01

    RNA interference (RNAi) is well known for its ability to regulate gene expression in the cytoplasm of mammalian cells. In mammalian cell nuclei, however, the impact of RNAi has remained more controversial. A key technical hurdle has been a lack of optimized protocols for the isolation and analysis of cell nuclei. Here we describe a simplified protocol for nuclei isolation from cultured cells that incorporates a method for obtaining nucleoplasmic and chromatin fractions and removing cytoplasmic contamination. Cell fractions can then be used to detect the presence and activity of RNAi factors in the nucleus. We present a protocol for investigating an early step in RNAi, Argonaute protein loading with small RNAs, which is enabled by our improved extract preparations. These protocols facilitate characterization of nuclear RNAi and can be applied to the analysis of other nuclear proteins and pathways. From cellular fractionation to analysis of Argonaute loading results, this protocol takes 4–6 d to complete. PMID:25079428

  17. RNA interference in the Asian Longhorned Beetle:Identification of Key RNAi Genes and Reference Genes for RT-qPCR

    USDA-ARS?s Scientific Manuscript database

    Asian longhorned beetle (ALB), Anoplophora glabripennis, is a serious invasive forest pest in several countries including the United States, Canada, and Europe. RNA interference (RNAi)technology is being developed as a novel method for pest management. Here, we identified the ALB core RNAi genes in...

  18. Bacterial delivery of RNAi effectors: transkingdom RNAi.

    PubMed

    Lage, Hermann; Krühn, Andrea

    2010-08-18

    RNA interference (RNAi) represents a high effective mechanism for specific inhibition of mRNA expression. Besides its potential as a powerful laboratory tool, the RNAi pathway appears to be promising for therapeutic utilization. For development of RNA interference (RNAi)-based therapies, delivery of RNAi-mediating agents to target cells is one of the major obstacles. A novel strategy to overcome this hurdle is transkingdom RNAi (tkRNAi). This technology uses non-pathogenic bacteria, e.g. Escherichia coli, to produce and deliver therapeutic short hairpin RNA (shRNA) into target cells to induce RNAi. A first-generation tkRNAi-mediating vector, TRIP, contains the bacteriophage T7 promoter for expression regulation of a therapeutic shRNA of interest. Furthermore, TRIP has the Inv locus from Yersinia pseudotuberculosis that encodes invasin, which permits natural noninvasive bacteria to enter beta1-integrin-positive mammalian cells and the HlyA gene from Listeria monocytogenes, which produces listeriolysin O. This enzyme allows the therapeutic shRNA to escape from entry vesicles within the cytoplasm of the target cell. TRIP constructs are introduced into a competent non-pathogenic Escherichia coli strain, which encodes T7 RNA polymerase necessary for the T7 promoter-driven synthesis of shRNAs. A well-characterized cancer-associated target molecule for different RNAi strategies is ABCB1 (MDR1/P-glycoprotein, MDR1/P-gp). This ABC-transporter acts as a drug extrusion pump and mediates the "classical" ABCB1-mediated multidrug resistance (MDR) phenotype of human cancer cells which is characterized by a specific cross resistance pattern. Different ABCB1-expressing MDR cancer cells were treated with anti-ABCB1 shRNA expression vector bearing E. coli. This procedure resulted in activation of the RNAi pathways within the cancer cells and a considerable down regulation of the ABCB1 encoding mRNA as well as the corresponding drug extrusion pump. Accordingly, drug accumulation was

  19. RNAi revised--target mRNA-dependent enhancement of gene silencing.

    PubMed

    Dornseifer, Simon; Willkomm, Sarah; Far, Rosel Kretschmer-Kazemi; Liebschwager, Janine; Beltsiou, Foteini; Frank, Kirsten; Laufer, Sandra D; Martinetz, Thomas; Sczakiel, Georg; Claussen, Jens Christian; Restle, Tobias

    2015-12-15

    The discovery of RNA interference (RNAi) gave rise to the development of new nucleic acid-based technologies as powerful investigational tools and potential therapeutics. Mechanistic key details of RNAi in humans need to be deciphered yet, before such approaches take root in biomedicine and molecular therapy. We developed and validated an in silico-based model of siRNA-mediated RNAi in human cells in order to link in vitro-derived pre-steady state kinetic data with a quantitative and time-resolved understanding of RNAi on the cellular level. The observation that product release by Argonaute 2 is accelerated in the presence of an excess of target RNA in vitro inspired us to suggest an associative mechanism for the RNA slicer reaction where incoming target mRNAs actively promote dissociation of cleaved mRNA fragments. This novel associative model is compatible with high multiple turnover rates of RNAi-based gene silencing in living cells and accounts for target mRNA concentration-dependent enhancement of the RNAi machinery. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  20. GenomeRNAi: a database for cell-based RNAi phenotypes.

    PubMed

    Horn, Thomas; Arziman, Zeynep; Berger, Juerg; Boutros, Michael

    2007-01-01

    RNA interference (RNAi) has emerged as a powerful tool to generate loss-of-function phenotypes in a variety of organisms. Combined with the sequence information of almost completely annotated genomes, RNAi technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. As increasing large datasets of RNAi-induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. Genome-wide RNAi screens have been performed both in Caenorhabditis elegans and Drosophila for a variety of phenotypes and several RNAi libraries have become available to assess phenotypes for almost every gene in the genome. These screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. The GenomeRNAi database provides access to published RNAi phenotypes obtained from cell-based screens and maps them to their genomic locus, including possible non-specific regions. The database also gives access to sequence information of RNAi probes used in various screens. It can be searched by phenotype, by gene, by RNAi probe or by sequence and is accessible at http://rnai.dkfz.de.

  1. GenomeRNAi: a database for cell-based RNAi phenotypes

    PubMed Central

    Horn, Thomas; Arziman, Zeynep; Berger, Juerg; Boutros, Michael

    2007-01-01

    RNA interference (RNAi) has emerged as a powerful tool to generate loss-of-function phenotypes in a variety of organisms. Combined with the sequence information of almost completely annotated genomes, RNAi technologies have opened new avenues to conduct systematic genetic screens for every annotated gene in the genome. As increasing large datasets of RNAi-induced phenotypes become available, an important challenge remains the systematic integration and annotation of functional information. Genome-wide RNAi screens have been performed both in Caenorhabditis elegans and Drosophila for a variety of phenotypes and several RNAi libraries have become available to assess phenotypes for almost every gene in the genome. These screens were performed using different types of assays from visible phenotypes to focused transcriptional readouts and provide a rich data source for functional annotation across different species. The GenomeRNAi database provides access to published RNAi phenotypes obtained from cell-based screens and maps them to their genomic locus, including possible non-specific regions. The database also gives access to sequence information of RNAi probes used in various screens. It can be searched by phenotype, by gene, by RNAi probe or by sequence and is accessible at PMID:17135194

  2. Non-transgenic RNAi technology to control insects on citrus

    USDA-ARS?s Scientific Manuscript database

    This research demonstrated a non-transgenic delivery method for ribonucleic acid interference, RNAi, that reduced fitness as measured in increased mortality over time, of two insect pests of citrus, ie. psyllids and leafhoppers. The Asian citrus psyllid transmits a deadly plant-infecting bacterium o...

  3. RNAi Screening in Spodoptera frugiperda.

    PubMed

    Ghosh, Subhanita; Singh, Gatikrushna; Sachdev, Bindiya; Kumar, Ajit; Malhotra, Pawan; Mukherjee, Sunil K; Bhatnagar, Raj K

    2016-01-01

    RNA interference is a potent and precise reverse genetic approach to carryout large-scale functional genomic studies in a given organism. During the past decade, RNAi has also emerged as an important investigative tool to understand the process of viral pathogenesis. Our laboratory has successfully generated transgenic reporter and RNAi sensor line of Spodoptera frugiperda (Sf21) cells and developed a reversal of silencing assay via siRNA or shRNA guided screening to investigate RNAi factors or viral pathogenic factors with extraordinary fidelity. Here we describe empirical approaches and conceptual understanding to execute successful RNAi screening in Spodoptera frugiperda 21-cell line.

  4. Delivery of RNAi Therapeutics to the Airways-From Bench to Bedside.

    PubMed

    Qiu, Yingshan; Lam, Jenny K W; Leung, Susan W S; Liang, Wanling

    2016-09-20

    RNA interference (RNAi) is a potent and specific post-transcriptional gene silencing process. Since its discovery, tremendous efforts have been made to translate RNAi technology into therapeutic applications for the treatment of different human diseases including respiratory diseases, by manipulating the expression of disease-associated gene(s). Similar to other nucleic acid-based therapeutics, the major hurdle of RNAi therapy is delivery. Pulmonary delivery is a promising approach of delivering RNAi therapeutics directly to the airways for treating local conditions and minimizing systemic side effects. It is a non-invasive route of administration that is generally well accepted by patients. However, pulmonary drug delivery is a challenge as the lungs pose a series of anatomical, physiological and immunological barriers to drug delivery. Understanding these barriers is essential for the development an effective RNA delivery system. In this review, the different barriers to pulmonary drug delivery are introduced. The potential of RNAi molecules as new class of therapeutics, and the latest preclinical and clinical studies of using RNAi therapeutics in different respiratory conditions are discussed in details. We hope this review can provide some useful insights for moving inhaled RNAi therapeutics from bench to bedside.

  5. E-RNAi: a web application for the multi-species design of RNAi reagents—2010 update

    PubMed Central

    Horn, Thomas; Boutros, Michael

    2010-01-01

    The design of RNA interference (RNAi) reagents is an essential step for performing loss-of-function studies in many experimental systems. The availability of sequenced and annotated genomes greatly facilitates RNAi experiments in an increasing number of organisms that were previously not genetically tractable. The E-RNAi web-service, accessible at http://www.e-rnai.org/, provides a computational resource for the optimized design and evaluation of RNAi reagents. The 2010 update of E-RNAi now covers 12 genomes, including Drosophila, Caenorhabditis elegans, human, emerging model organisms such as Schmidtea mediterranea and Acyrthosiphon pisum, as well as the medically relevant vectors Anopheles gambiae and Aedes aegypti. The web service calculates RNAi reagents based on the input of target sequences, sequence identifiers or by visual selection of target regions through a genome browser interface. It identifies optimized RNAi target-sites by ranking sequences according to their predicted specificity, efficiency and complexity. E-RNAi also facilitates the design of secondary RNAi reagents for validation experiments, evaluation of pooled siRNA reagents and batch design. Results are presented online, as a downloadable HTML report and as tab-delimited files. PMID:20444868

  6. Recent advances in therapeutic recruitment of mammalian RNAi and bacterial CRISPR-Cas DNA interference pathways as emerging antiviral strategies.

    PubMed

    Chin, Wei-Xin; Ang, Swee Kim; Chu, Justin Jang Hann

    2017-01-01

    In invertebrate eukaryotes and prokaryotes, respectively, the RNAi and clustered regularly interspaced short palindromic repeats-CRISPR-associated (CRISPR-Cas) pathways are highly specific and efficient RNA and DNA interference systems, and are well characterised as potent antiviral systems. It has become possible to recruit or reconstitute these pathways in mammalian cells, where they can be directed against desired host or viral targets. The RNAi and CRISPR-Cas systems can therefore yield ideal antiviral therapeutics, capable of specific and efficient viral inhibition with minimal off-target effects, but development of such therapeutics can be slow. This review covers recent advances made towards developing RNAi or CRISPR-Cas strategies for clinical use. These studies address the delivery, toxicity or target design issues that typically plague the in vivo or clinical use of these technologies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Effective and specific in planta RNAi in cyst nematodes: expression interference of four parasitism genes reduces parasitic success.

    PubMed

    Sindhu, Anoop S; Maier, Tom R; Mitchum, Melissa G; Hussey, Richard S; Davis, Eric L; Baum, Thomas J

    2009-01-01

    Cyst nematodes are highly evolved sedentary plant endoparasites that use parasitism proteins injected through the stylet into host tissues to successfully parasitize plants. These secretory proteins likely are essential for parasitism as they are involved in a variety of parasitic events leading to the establishment of specialized feeding cells required by the nematode to obtain nourishment. With the advent of RNA interference (RNAi) technology and the demonstration of host-induced gene silencing in parasites, a new strategy to control pests and pathogens has become available, particularly in root-knot nematodes. Plant host-induced silencing of cyst nematode genes so far has had only limited success but similarly should disrupt the parasitic cycle and render the host plant resistant. Additional in planta RNAi data for cyst nematodes are being provided by targeting four parasitism genes through host-induced RNAi gene silencing in transgenic Arabidopsis thaliana, which is a host for the sugar beet cyst nematode Heterodera schachtii. Here it is reported that mRNA abundances of targeted nematode genes were specifically reduced in nematodes feeding on plants expressing corresponding RNAi constructs. Furthermore, this host-induced RNAi of all four nematode parasitism genes led to a reduction in the number of mature nematode females. Although no complete resistance was observed, the reduction of developing females ranged from 23% to 64% in different RNAi lines. These observations demonstrate the relevance of the targeted parasitism genes during the nematode life cycle and, potentially more importantly, suggest that a viable level of resistance in crop plants may be accomplished in the future using this technology against cyst nematodes.

  8. Next-generation transgenic cotton: pyramiding RNAi and Bt counters insect resistance.

    PubMed

    Ni, Mi; Ma, Wei; Wang, Xiaofang; Gao, Meijing; Dai, Yan; Wei, Xiaoli; Zhang, Lei; Peng, Yonggang; Chen, Shuyuan; Ding, Lingyun; Tian, Yue; Li, Jie; Wang, Haiping; Wang, Xiaolin; Xu, Guowang; Guo, Wangzhen; Yang, Yihua; Wu, Yidong; Heuberger, Shannon; Tabashnik, Bruce E; Zhang, Tianzhen; Zhu, Zhen

    2017-09-01

    Transgenic crops producing insecticidal proteins from the bacterium Bacillus thuringiensis (Bt) are extensively cultivated worldwide. To counter rapidly increasing pest resistance to crops that produce single Bt toxins, transgenic plant 'pyramids' producing two or more Bt toxins that kill the same pest have been widely adopted. However, cross-resistance and antagonism between Bt toxins limit the sustainability of this approach. Here we describe development and testing of the first pyramids of cotton combining protection from a Bt toxin and RNA interference (RNAi). We developed two types of transgenic cotton plants producing double-stranded RNA (dsRNA) from the global lepidopteran pest Helicoverpa armigera designed to interfere with its metabolism of juvenile hormone (JH). We focused on suppression of JH acid methyltransferase (JHAMT), which is crucial for JH synthesis, and JH-binding protein (JHBP), which transports JH to organs. In 2015 and 2016, we tested larvae from a Bt-resistant strain and a related susceptible strain of H. armigera on seven types of cotton: two controls, Bt cotton, two types of RNAi cotton (targeting JHAMT or JHBP) and two pyramids (Bt cotton plus each type of RNAi). Both types of RNAi cotton were effective against Bt-resistant insects. Bt cotton and RNAi acted independently against the susceptible strain. In computer simulations of conditions in northern China, where millions of farmers grow Bt cotton as well as abundant non-transgenic host plants of H. armigera, pyramided cotton combining a Bt toxin and RNAi substantially delayed resistance relative to using Bt cotton alone. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  9. In vivo RNAi: Today and Tomorrow

    PubMed Central

    Perrimon, Norbert; Ni, Jian-Quan; Perkins, Lizabeth

    2010-01-01

    SUMMARY RNA interference (RNAi) provides a powerful reverse genetics approach to analyze gene functions both in tissue culture and in vivo. Because of its widespread applicability and effectiveness it has become an essential part of the tool box kits of model organisms such as Caenorhabditis elegans, Drosophila, and the mouse. In addition, the use of RNAi in animals in which genetic tools are either poorly developed or nonexistent enables a myriad of fundamental questions to be asked. Here, we review the methods and applications of in vivo RNAi to characterize gene functions in model organisms and discuss their impact to the study of developmental as well as evolutionary questions. Further, we discuss the applications of RNAi technologies to crop improvement, pest control and RNAi therapeutics, thus providing an appreciation of the potential for phenomenal applications of RNAi to agriculture and medicine. PMID:20534712

  10. Targeting the undruggable: Advances and obstacles in current RNAi therapy

    PubMed Central

    Wu, Sherry Y.; Lopez-Berestein, Gabriel; Calin, George A.; Sood, Anil K.

    2014-01-01

    RNA interference (RNAi) therapeutics represents a rapidly emerging platform for personalized cancer treatment. Recent advances in delivery, target selection, and safety of RNAi cancer therapy provide unprecedented opportunities for clinical translation. Here, we discuss these advances and present strategies for making RNAi-based therapy a viable part of cancer management. PMID:24920658

  11. Conditional RNAi: towards a silent gene therapy.

    PubMed

    Lee, Sang-Kyung; Kumar, Priti

    2009-07-02

    RNA interference (RNAi) has the potential to permit the downregulation of virtually any gene. While transgenic RNAi enables stable propagation of the resulting phenotype to progeny, the dominant nature of RNAi limits its use to applications where the continued suppression of gene expression does not disturb normal cell functioning. This is of particular importance when the target gene product is essential for cell survival, development or differentiation. It is therefore desirable that knockdown be externally regulatable. This review is aimed at providing an overview of the approaches for conditional RNAi in mammalian systems, with a special mention of studies employing these approaches to target therapeutically/biologically relevant molecules, their advantages and disadvantages, and a pointer towards approaches best suited for RNAi-based gene therapy.

  12. Flavivirus RNAi suppression: decoding non-coding RNA.

    PubMed

    Pijlman, Gorben P

    2014-08-01

    Flaviviruses are important human pathogens that are transmitted by invertebrate vectors, mostly mosquitoes and ticks. During replication in their vector, flaviviruses are subject to a potent innate immune response known as antiviral RNA interference (RNAi). This defense mechanism is associated with the production of small interfering (si)RNA that lead to degradation of viral RNA. To what extent flaviviruses would benefit from counteracting antiviral RNAi is subject of debate. Here, the experimental evidence to suggest the existence of flavivirus RNAi suppressors is discussed. I will highlight the putative role of non-coding, subgenomic flavivirus RNA in suppression of RNAi in insect and mammalian cells. Novel insights from ongoing research will reveal how arthropod-borne viruses modulate innate immunity including antiviral RNAi. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Towards the elements of successful insect RNAi.

    PubMed

    Scott, Jeffrey G; Michel, Kristin; Bartholomay, Lyric C; Siegfried, Blair D; Hunter, Wayne B; Smagghe, Guy; Zhu, Kun Yan; Douglas, Angela E

    2013-12-01

    RNA interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that the efficiency of RNAi varies between different species, the mode of RNAi delivery, and the genes being targeted. There is also variation in the duration of transcript suppression. At present, we have a limited capacity to predict the ideal experimental strategy for RNAi of a particular gene/insect because of our incomplete understanding of whether and how the RNAi signal is amplified and spread among insect cells. Consequently, development of the optimal RNAi protocols is a highly empirical process. This limitation can be relieved by systematic analysis of the molecular physiological basis of RNAi mechanisms in insects. An enhanced conceptual understanding of RNAi function in insects will facilitate the application of RNAi for dissection of gene function, and to fast-track the application of RNAi to both control pests and develop effective methods to protect beneficial insects and non-insect arthropods, particularly the honey bee (Apis mellifera) and cultured Pacific white shrimp (Litopenaeus vannamei) from viral and parasitic diseases. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. RNAi control of aflatoxins in peanut plants, a multifactorial system

    USDA-ARS?s Scientific Manuscript database

    RNA-interference (RNAi)-mediated control of aflatoxin contamination in peanut plants is a multifactorial and hyper variable system. The use of RNAi biotechnology to silence single genes in plants has inherently high-variability among transgenic events. Also the level of expression of small interfe...

  15. Phosphorylation-specific status of RNAi triggers in pharmacokinetic and biodistribution analyses

    PubMed Central

    Trubetskoy, Vladimir S.; Griffin, Jacob B.; Nicholas, Anthony L.; Nord, Eric M.; Xu, Zhao; Peterson, Ryan M.; Wooddell, Christine I.; Rozema, David B.; Wakefield, Darren H.; Lewis, David L.

    2017-01-01

    Abstract The RNA interference (RNAi)-based therapeutic ARC-520 for chronic hepatitis B virus (HBV) infection consists of a melittin-derived peptide conjugated to N-acetylgalactosamine for hepatocyte targeting and endosomal escape, and cholesterol-conjugated RNAi triggers, which together result in HBV gene silencing. To characterize the kinetics of RNAi trigger delivery and 5΄-phosphorylation of guide strands correlating with gene knockdown, we employed a peptide-nucleic acid (PNA) hybridization assay. A fluorescent sense strand PNA probe binding to RNAi duplex guide strands was coupled with anion exchange high performance liquid chromatography to quantitate guide strands and metabolites. Compared to PCR- or ELISA-based methods, this assay enables separate quantitation of non-phosphorylated full-length guide strands from 5΄-phosphorylated forms that may associate with RNA-induced silencing complexes (RISC). Biodistribution studies in mice indicated that ARC-520 guide strands predominantly accumulated in liver. 5΄-phosphorylation of guide strands was observed within 5 min after ARC-520 injection, and was detected for at least 4 weeks corresponding to the duration of HBV mRNA silencing. Guide strands detected in RISC by AGO2 immuno-isolation represented 16% of total 5΄-phosphorylated guide strands in liver, correlating with a 2.7 log10 reduction of HBsAg. The PNA method enables pharmacokinetic analysis of RNAi triggers, elucidates potential metabolic processing events and defines pharmacokinetic-pharmacodynamic relationships. PMID:28180327

  16. Silence of the transcripts: RNA interference in medicine.

    PubMed

    Barik, Sailen

    2005-10-01

    Silencing of gene expression by ribonucleic acid (RNA), known as RNA interference (RNAi), is now recognized as a major means of gene regulation in biology. In this mechanism, small noncoding double-stranded RNA molecules knock down gene expression through a variety of mechanisms that include messenger RNA (mRNA) degradation, inhibition of mRNA translation, or chromatin remodeling. The posttranscriptional mechanism of RNAi has been embraced by researchers as a powerful tool for generating deficient phenotypes without mutating the gene. In parallel, exciting recent results have promised its application in disease therapy. This review aims to summarize the current knowledge in this area and provide a roadmap that may eventually launch RNAi from the research bench to the medicine chest.

  17. Considering RNAi experimental design in parasitic helminths.

    PubMed

    Dalzell, Johnathan J; Warnock, Neil D; McVeigh, Paul; Marks, Nikki J; Mousley, Angela; Atkinson, Louise; Maule, Aaron G

    2012-04-01

    Almost a decade has passed since the first report of RNA interference (RNAi) in a parasitic helminth. Whilst much progress has been made with RNAi informing gene function studies in disparate nematode and flatworm parasites, substantial and seemingly prohibitive difficulties have been encountered in some species, hindering progress. An appraisal of current practices, trends and ideals of RNAi experimental design in parasitic helminths is both timely and necessary for a number of reasons: firstly, the increasing availability of parasitic helminth genome/transcriptome resources means there is a growing need for gene function tools such as RNAi; secondly, fundamental differences and unique challenges exist for parasite species which do not apply to model organisms; thirdly, the inherent variation in experimental design, and reported difficulties with reproducibility undermine confidence. Ideally, RNAi studies of gene function should adopt standardised experimental design to aid reproducibility, interpretation and comparative analyses. Although the huge variations in parasite biology and experimental endpoints make RNAi experimental design standardization difficult or impractical, we must strive to validate RNAi experimentation in helminth parasites. To aid this process we identify multiple approaches to RNAi experimental validation and highlight those which we deem to be critical for gene function studies in helminth parasites.

  18. RNAi mediated, stable resistance to Triticum mosaic virus in wheat

    USDA-ARS?s Scientific Manuscript database

    Triticum mosaic virus (TriMV), discovered in 2006, affects wheat production systems in the Great Plains of the United States. There are no available TriMV resistant commercial varieties. RNA interference (RNAi) was evaluated as an alternative strategy to generate resistance to TriMV. An RNAi pANDA...

  19. Development of RNAi technology for targeted therapy--a track of siRNA based agents to RNAi therapeutics.

    PubMed

    Zhou, Yinjian; Zhang, Chunling; Liang, Wei

    2014-11-10

    RNA interference (RNAi) was intensively studied in the past decades due to its potential in therapy of diseases. The target specificity and universal treatment spectrum endowed siRNA advantages over traditional small molecules and protein drugs. However, barriers exist in the blood circulation system and the diseased tissues blocked the actualization of RNAi effect, which raised function versatility requirements to siRNA therapeutic agents. Appropriate functionalization of siRNAs is necessary to break through these barriers and target diseased tissues in local or systemic targeted application. In this review, we summarized that barriers exist in the delivery process and popular functionalized technologies for siRNA such as chemical modification and physical encapsulation. Preclinical targeted siRNA delivery and the current status of siRNA based RNAi therapeutic agents in clinical trial were reviewed and finally the future of siRNA delivery was proposed. The valuable experience from the siRNA agent delivery study and the RNAi therapeutic agents in clinical trial paved ways for practical RNAi therapeutics to emerge early. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. OfftargetFinder: a web tool for species-specific RNAi design.

    PubMed

    Good, R T; Varghese, T; Golz, J F; Russell, D A; Papanicolaou, A; Edwards, O; Robin, C

    2016-04-15

    RNA interference (RNAi) technology is being developed as a weapon for pest insect control. To maximize the specificity that such an approach affords we have developed a bioinformatic web tool that searches the ever-growing arthropod transcriptome databases so that pest-specific RNAi sequences can be identified. This will help technology developers finesse the design of RNAi sequences and suggests which non-target species should be assessed in the risk assessment process. http://rnai.specifly.org crobin@unimelb.edu.au. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Automated microscopy for high-content RNAi screening

    PubMed Central

    2010-01-01

    Fluorescence microscopy is one of the most powerful tools to investigate complex cellular processes such as cell division, cell motility, or intracellular trafficking. The availability of RNA interference (RNAi) technology and automated microscopy has opened the possibility to perform cellular imaging in functional genomics and other large-scale applications. Although imaging often dramatically increases the content of a screening assay, it poses new challenges to achieve accurate quantitative annotation and therefore needs to be carefully adjusted to the specific needs of individual screening applications. In this review, we discuss principles of assay design, large-scale RNAi, microscope automation, and computational data analysis. We highlight strategies for imaging-based RNAi screening adapted to different library and assay designs. PMID:20176920

  2. "Caenorhabditis Elegans" as an Undergraduate Educational Tool for Teaching RNAi

    ERIC Educational Resources Information Center

    Andersen, Janet; Krichevsky, Alexander; Leheste, Joerg R.; Moloney, Daniel J.

    2008-01-01

    Discovery of RNA-mediated interference (RNAi) is widely recognized as one of the most significant molecular biology breakthroughs in the past 10 years. There is a need for science educators to develop teaching tools and laboratory activities that demonstrate the power of this new technology and help students to better understand the RNAi process.…

  3. RNAi and retroviruses: are they in RISC?

    PubMed

    Vasselon, Thierry; Bouttier, Manuella; Saumet, Anne; Lecellier, Charles-Henri

    2013-02-01

    RNA interference (RNAi) is a potent cellular system against viruses in various organisms. Although common traits are observed in plants, insects, and nematodes, the situation observed in mammals appears more complex. In mammalian somatic cells, RNAi is implicated in endonucleolytic cleavage mediated by artificially delivered small interfering RNAs (siRNAs) as well as in translation repression mediated by microRNAs (miRNAs). Because siRNAs and miRNAs recognize viral mRNAs, RNAi inherently limits virus production and participates in antiviral defense. However, several observations made in the cases of hepatitis C virus and retroviruses (including the human immunodeficiency virus and the primate foamy virus) bring evidence that this relationship is much more complex and that certain components of the RNAi effector complex [called the RNA-induced silencing complex (RISC)], such as AGO2, are also required for viral replication. Here, we summarize recent discoveries that have revealed this dual implication in virus biology. We further discuss their potential implications for the functions of RNAi-related proteins, with special emphasis on retrotransposition and genome stability.

  4. Stacking up CRISPR against RNAi for therapeutic gene inhibition.

    PubMed

    Haussecker, Dirk

    2016-09-01

    Both RNA interference (RNAi) and clustered regularly-interspaced short palindromic repeats (CRISPR) technologies allow for the sequence-specific inhibition of gene function and therefore have the potential to be used as therapeutic modalities. By judging the current public and scientific journal interest, it would seem that CRISPR, by enabling clean, durable knockouts, will dominate therapeutic gene inhibition, also at the expense of RNAi. This review aims to look behind prevailing sentiments and to more clearly define the likely scope of the therapeutic applications of the more recently developed CRISPR technology and its relative strengths and weaknesses with regards to RNAi. It is found that largely because of their broadly overlapping delivery constraints, while CRISPR presents formidable competition for DNA-directed RNAi strategies, its impact on RNAi therapeutics triggered by synthetic oligonucleotides will likely be more moderate. Instead, RNAi and genome editing, and in particular CRISPR, are poised to jointly promote a further shift toward sequence-targeted precision medicines. © 2016 Federation of European Biochemical Societies.

  5. Logic integration of mRNA signals by an RNAi-based molecular computer.

    PubMed

    Xie, Zhen; Liu, Siyuan John; Bleris, Leonidas; Benenson, Yaakov

    2010-05-01

    Synthetic in vivo molecular 'computers' could rewire biological processes by establishing programmable, non-native pathways between molecular signals and biological responses. Multiple molecular computer prototypes have been shown to work in simple buffered solutions. Many of those prototypes were made of DNA strands and performed computations using cycles of annealing-digestion or strand displacement. We have previously introduced RNA interference (RNAi)-based computing as a way of implementing complex molecular logic in vivo. Because it also relies on nucleic acids for its operation, RNAi computing could benefit from the tools developed for DNA systems. However, these tools must be harnessed to produce bioactive components and be adapted for harsh operating environments that reflect in vivo conditions. In a step toward this goal, we report the construction and implementation of biosensors that 'transduce' mRNA levels into bioactive, small interfering RNA molecules via RNA strand exchange in a cell-free Drosophila embryo lysate, a step beyond simple buffered environments. We further integrate the sensors with our RNAi 'computational' module to evaluate two-input logic functions on mRNA concentrations. Our results show how RNA strand exchange can expand the utility of RNAi computing and point toward the possibility of using strand exchange in a native biological setting.

  6. Logic integration of mRNA signals by an RNAi-based molecular computer

    PubMed Central

    Xie, Zhen; Liu, Siyuan John; Bleris, Leonidas; Benenson, Yaakov

    2010-01-01

    Synthetic in vivo molecular ‘computers’ could rewire biological processes by establishing programmable, non-native pathways between molecular signals and biological responses. Multiple molecular computer prototypes have been shown to work in simple buffered solutions. Many of those prototypes were made of DNA strands and performed computations using cycles of annealing-digestion or strand displacement. We have previously introduced RNA interference (RNAi)-based computing as a way of implementing complex molecular logic in vivo. Because it also relies on nucleic acids for its operation, RNAi computing could benefit from the tools developed for DNA systems. However, these tools must be harnessed to produce bioactive components and be adapted for harsh operating environments that reflect in vivo conditions. In a step toward this goal, we report the construction and implementation of biosensors that ‘transduce’ mRNA levels into bioactive, small interfering RNA molecules via RNA strand exchange in a cell-free Drosophila embryo lysate, a step beyond simple buffered environments. We further integrate the sensors with our RNAi ‘computational’ module to evaluate two-input logic functions on mRNA concentrations. Our results show how RNA strand exchange can expand the utility of RNAi computing and point toward the possibility of using strand exchange in a native biological setting. PMID:20194121

  7. A status report on RNAi therapeutics

    PubMed Central

    2010-01-01

    Fire and Mello initiated the current explosion of interest in RNA interference (RNAi) biology with their seminal work in Caenorhabditis elegans. These observations were closely followed by the demonstration of RNAi in Drosophila melanogaster. However, the full potential of these new discoveries only became clear when Tuschl and colleagues showed that 21-22 bp RNA duplexes with 3" overhangs, termed small interfering (si)RNAs, could reliably execute RNAi in a range of mammalian cells. Soon afterwards, it became clear that many different human cell types had endogenous machinery, the RNA-induced silencing complex (RISC), which could be harnessed to silence any gene in the genome. Beyond the availability of a novel way to dissect biology, an important target validation tool was now available. More importantly, two key properties of the RNAi pathway - sequence-mediated specificity and potency - suggested that RNAi might be the most important pharmacological advance since the advent of protein therapeutics. The implications were profound. One could now envisage selecting disease-associated targets at will and expect to suppress proteins that had remained intractable to inhibition by conventional methods, such as small molecules. This review attempts to summarize the current understanding on siRNA lead discovery, the delivery of RNAi therapeutics, typical in vivo pharmacological profiles, preclinical safety evaluation and an overview of the 14 programs that have already entered clinical practice. PMID:20615220

  8. RNAi functionalized scaffold for scarless skin regeneration

    PubMed Central

    Liu, Xing; Ma, Lie; Gao, Changyou

    2013-01-01

    Combination of a 3-D scaffold with the emerging RNA interference (RNAi) technique represents the latest paradigm of regenerative medicine. In our recent paper “RNAi functionalized collagen-chitosan/silicone membrane bilayer dermal equivalent for full-thickness skin regeneration with inhibited scarring” in the journal Biomaterials, we not only demonstrated a 3-D system for siRNA sustained delivery, but also presented a comprehensive in vivo study by targeting a vital problem in skin regeneration: scarring. It is expected that further development of this kind of RNAi functionalized scaffold can provide a better platform for directing cell fates by integrating the “down-regulating” biomolecular cues into the cellular microenvironment, leading to the complete functional regeneration of skin. PMID:23811756

  9. Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella.

    PubMed

    Hameed, Muhammad Salman; Wang, Zhengbing; Vasseur, Liette; Yang, Guang

    2018-04-20

    Argonaute (Ago) protein family plays a key role in the RNA interference (RNAi) process in different insects including Lepidopteran. However, the role of Ago proteins in the RNAi pathway of Plutella xylostella is still unknown. We cloned an Argonaute3 gene in P. xylostella ( PxAgo3 ) with the complete coding sequence of 2832 bp. The encoded protein had 935 amino acids with an expected molecular weight of 108.9 kDa and an isoelectric point of 9.29. It contained a PAZ (PIWI/Argonaute/Zwile) domain and PIWI (P-element-induced whimpy testes) domain. PxAgo3 was classified into the Piwi subfamily of Ago proteins with a high similarity of 93.0% with Bombyx mori Ago3 (BmAgo3). The suppression of PxAgo3 by dsPxAgo3 was observed 3 h after treatment and was maintained until 24 h. Knockdown of PxAgo3 decreased the suppression level of PxActin by dsPxActin in P. xylostella cells, while overexpression of PxAgo3 increased the RNAi efficiency. Our results suggest that PxAgo3 play a key role in the double stranded RNA (dsRNA)-regulated RNAi pathway in P. xylostella .

  10. Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies.

    PubMed

    Wang, Leo L; Burdick, Jason A

    2017-01-01

    It has been nearly two decades since RNA-interference (RNAi) was first reported. While there are no approved clinical uses, several phase II and III clinical trials suggest the great promise of RNAi therapeutics. One challenge for RNAi therapies is the controlled localization and sustained presentation to target tissues, to both overcome systemic toxicity concerns and to enhance in vivo efficacy. One approach that is emerging to address these limitations is the entrapment of RNAi molecules within hydrogels for local and sustained release. In these systems, nucleic acids are either delivered as siRNA conjugates or within nanoparticles. A plethora of hydrogels has been implemented using these approaches, including both traditional hydrogels that have already been developed for other applications and new hydrogels developed specifically for RNAi delivery. These hydrogels have been applied to various applications in vivo, including cancer, bone regeneration, inflammation and cardiac repair. This review will examine the design and implementation of such hydrogel RNAi systems and will cover the most recent applications of these systems. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. CRISPR interference: RNA-directed adaptive immunity in bacteria and archaea

    PubMed Central

    Marraffini, Luciano A.; Sontheimer, Erik J.

    2010-01-01

    Sequence-directed genetic interference pathways control gene expression and preserve genome integrity in all kingdoms of life. The importance of such pathways is highlighted by the extensive study of RNA interference (RNAi) and related processes in eukaryotes. In many bacteria and most archaea, clustered, regularly interspaced short palindromic repeats (CRISPRs) are involved in a more recently discovered interference pathway that protects cells from bacteriophages and conjugative plasmids. CRISPR sequences provide an adaptive, heritable record of past infections and express CRISPR RNAs — small RNAs that target invasive nucleic acids. Here, we review the mechanisms of CRISPR interference and its roles in microbial physiology and evolution. We also discuss potential applications of this novel interference pathway. PMID:20125085

  12. RNA Interference in Infectious Tropical Diseases

    PubMed Central

    Hong, Young S.

    2008-01-01

    Introduction of double-stranded RNA (dsRNA) into some cells or organisms results in degradation of its homologous mRNA, a process called RNA interference (RNAi). The dsRNAs are processed into short interfering RNAs (siRNAs) that subsequently bind to the RNA-induced silencing complex (RISC), causing degradation of target mRNAs. Because of this sequence-specific ability to silence target genes, RNAi has been extensively used to study gene functions and has the potential to control disease pathogens or vectors. With this promise of RNAi to control pathogens and vectors, this paper reviews the current status of RNAi in protozoans, animal parasitic helminths and disease-transmitting vectors, such as insects. Many pathogens and vectors cause severe parasitic diseases in tropical regions and it is difficult to control once the host has been invaded. Intracellularly, RNAi can be highly effective in impeding parasitic development and proliferation within the host. To fully realize its potential as a means to control tropical diseases, appropriate delivery methods for RNAi should be developed, and possible off-target effects should be minimized for specific gene suppression. RNAi can also be utilized to reduce vector competence to interfere with disease transmission, as genes critical for pathogenesis of tropical diseases are knockdowned via RNAi. PMID:18344671

  13. Differential effects of RNAi treatments on field populations of the western corn rootworm.

    PubMed

    Chu, Chia-Ching; Sun, Weilin; Spencer, Joseph L; Pittendrigh, Barry R; Seufferheld, Manfredo J

    2014-03-01

    RNA interference (RNAi) mediated crop protection against insect pests is a technology that is greatly anticipated by the academic and industrial pest control communities. Prior to commercialization, factors influencing the potential for evolution of insect resistance to RNAi should be evaluated. While mutations in genes encoding the RNAi machinery or the sequences targeted for interference may serve as a prominent mechanism of resistance evolution, differential effects of RNAi on target pests may also facilitate such evolution. However, to date, little is known about how variation of field insect populations could influence the effectiveness of RNAi treatments. To approach this question, we evaluated the effects of RNAi treatments on adults of three western corn rootworm (WCR; Diabrotica virgifera virgifera LeConte) populations exhibiting different levels of gut cysteine protease activity, tolerance of soybean herbivory, and immune gene expression; two populations were collected from crop rotation-resistant (RR) problem areas and one from a location where RR was not observed (wild type; WT). Our results demonstrated that RNAi targeting DvRS5 (a highly expressed cysteine protease gene) reduced gut cysteine protease activity in all three WCR populations. However, the proportion of the cysteine protease activity that was inhibited varied across populations. When WCR adults were treated with double-stranded RNA of an immune gene att1, different changes in survival among WT and RR populations on soybean diets occurred. Notably, for both genes, the sequences targeted for RNAi were the same across all populations examined. These findings indicate that the effectiveness of RNAi treatments could vary among field populations depending on their physiological and genetic backgrounds and that the consistency of an RNAi trait's effectiveness on phenotypically different populations should be considered or tested prior to wide deployment. Also, genes that are potentially subjected

  14. Therapeutic application of RNAi: is mRNA targeting finally ready for prime time?

    PubMed Central

    Grimm, Dirk; Kay, Mark A.

    2007-01-01

    With unprecedented speed, RNA interference (RNAi) has advanced from its basic discovery in lower organisms to becoming a powerful genetic tool and perhaps our single most promising biotherapeutic for a wide array of diseases. Numerous studies document RNAi efficacy in laboratory animals, and the first clinical trials are underway and thus far suggest that RNAi is safe to use in humans. Yet substantial hurdles have also surfaced and must be surmounted before therapeutic RNAi applications can become a standard therapy. Here we review the most critical roadblocks and concerns for clinical RNAi transition, delivery, and safety. We highlight emerging solutions and concurrently discuss novel therapeutic RNAi-based concepts. The current rapid advances create realistic optimism that the establishment of RNAi as a new and potent clinical modality in humans is near. PMID:18060021

  15. Novel Methods for Mosquito Control using RNAi.

    USDA-ARS?s Scientific Manuscript database

    The discovery and development of novel insecticides for vector control is a primary focus of toxicology research conducted at the Mosquito and Fly Research Unit, Gainesville, FL. Targeting critical genes/proteins in mosquitoes using RNA interference (RNAi) is being investigated as a method to devel...

  16. Expression profiling and cross-species RNA interference (RNAi) of desiccation-induced transcripts in the anhydrobiotic nematode Aphelenchus avenae

    PubMed Central

    2010-01-01

    Background Some organisms can survive extreme desiccation by entering a state of suspended animation known as anhydrobiosis. The free-living mycophagous nematode Aphelenchus avenae can be induced to enter anhydrobiosis by pre-exposure to moderate reductions in relative humidity (RH) prior to extreme desiccation. This preconditioning phase is thought to allow modification of the transcriptome by activation of genes required for desiccation tolerance. Results To identify such genes, a panel of expressed sequence tags (ESTs) enriched for sequences upregulated in A. avenae during preconditioning was created. A subset of 30 genes with significant matches in databases, together with a number of apparently novel sequences, were chosen for further study. Several of the recognisable genes are associated with water stress, encoding, for example, two new hydrophilic proteins related to the late embryogenesis abundant (LEA) protein family. Expression studies confirmed EST panel members to be upregulated by evaporative water loss, and the majority of genes was also induced by osmotic stress and cold, but rather fewer by heat. We attempted to use RNA interference (RNAi) to demonstrate the importance of this gene set for anhydrobiosis, but found A. avenae to be recalcitrant with the techniques used. Instead, therefore, we developed a cross-species RNAi procedure using A. avenae sequences in another anhydrobiotic nematode, Panagrolaimus superbus, which is amenable to gene silencing. Of 20 A. avenae ESTs screened, a significant reduction in survival of desiccation in treated P. superbus populations was observed with two sequences, one of which was novel, while the other encoded a glutathione peroxidase. To confirm a role for glutathione peroxidases in anhydrobiosis, RNAi with cognate sequences from P. superbus was performed and was also shown to reduce desiccation tolerance in this species. Conclusions This study has identified and characterised the expression profiles of members

  17. The rde-1 gene, RNA interference, and transposon silencing in C. elegans.

    PubMed

    Tabara, H; Sarkissian, M; Kelly, W G; Fleenor, J; Grishok, A; Timmons, L; Fire, A; Mello, C C

    1999-10-15

    Double-stranded (ds) RNA can induce sequence-specific inhibition of gene function in several organisms. However, both the mechanism and the physiological role of the interference process remain mysterious. In order to study the interference process, we have selected C. elegans mutants resistant to dsRNA-mediated interference (RNAi). Two loci, rde-1 and rde-4, are defined by mutants strongly resistant to RNAi but with no obvious defects in growth or development. We show that rde-1 is a member of the piwi/sting/argonaute/zwille/eIF2C gene family conserved from plants to vertebrates. Interestingly, several, but not all, RNAi-deficient strains exhibit mobilization of the endogenous transposons. We discuss implications for the mechanism of RNAi and the possibility that one natural function of RNAi is transposon silencing.

  18. Molecular Characterization and the Function of Argonaute3 in RNAi Pathway of Plutella xylostella

    PubMed Central

    Hameed, Muhammad Salman; Wang, Zhengbing; Yang, Guang

    2018-01-01

    Argonaute (Ago) protein family plays a key role in the RNA interference (RNAi) process in different insects including Lepidopteran. However, the role of Ago proteins in the RNAi pathway of Plutella xylostella is still unknown. We cloned an Argonaute3 gene in P. xylostella (PxAgo3) with the complete coding sequence of 2832 bp. The encoded protein had 935 amino acids with an expected molecular weight of 108.9 kDa and an isoelectric point of 9.29. It contained a PAZ (PIWI/Argonaute/Zwile) domain and PIWI (P-element-induced whimpy testes) domain. PxAgo3 was classified into the Piwi subfamily of Ago proteins with a high similarity of 93.0% with Bombyx mori Ago3 (BmAgo3). The suppression of PxAgo3 by dsPxAgo3 was observed 3 h after treatment and was maintained until 24 h. Knockdown of PxAgo3 decreased the suppression level of PxActin by dsPxActin in P. xylostella cells, while overexpression of PxAgo3 increased the RNAi efficiency. Our results suggest that PxAgo3 play a key role in the double stranded RNA (dsRNA)-regulated RNAi pathway in P. xylostella. PMID:29677157

  19. RNAi in the mouse: rapid and affordable gene function studies in a vertebrate system.

    PubMed

    Rytlewski, Julie A; Beronja, Slobodan

    2015-01-01

    The addition of RNA interference (RNAi) to the mammalian genomic toolbox has significantly expanded our ability to use higher-order models in studies of development and disease. The mouse, in particular, has benefited most from RNAi technology. Unique combinations of RNAi vectors and delivery methods now offer a broad platform for gene silencing in transgenic mice, enabling the design of new physiologically relevant models. The era of RNAi mice has accelerated the pace of genetic study and made high-throughput screens not only feasible but also affordable. © 2014 Wiley Periodicals, Inc.

  20. Intelligent Interfaces for Mining Large-Scale RNAi-HCS Image Databases

    PubMed Central

    Lin, Chen; Mak, Wayne; Hong, Pengyu; Sepp, Katharine; Perrimon, Norbert

    2010-01-01

    Recently, High-content screening (HCS) has been combined with RNA interference (RNAi) to become an essential image-based high-throughput method for studying genes and biological networks through RNAi-induced cellular phenotype analyses. However, a genome-wide RNAi-HCS screen typically generates tens of thousands of images, most of which remain uncategorized due to the inadequacies of existing HCS image analysis tools. Until now, it still requires highly trained scientists to browse a prohibitively large RNAi-HCS image database and produce only a handful of qualitative results regarding cellular morphological phenotypes. For this reason we have developed intelligent interfaces to facilitate the application of the HCS technology in biomedical research. Our new interfaces empower biologists with computational power not only to effectively and efficiently explore large-scale RNAi-HCS image databases, but also to apply their knowledge and experience to interactive mining of cellular phenotypes using Content-Based Image Retrieval (CBIR) with Relevance Feedback (RF) techniques. PMID:21278820

  1. Potential and development of inhaled RNAi therapeutics for the treatment of pulmonary tuberculosis.

    PubMed

    Man, Dede K W; Chow, Michael Y T; Casettari, Luca; Gonzalez-Juarrero, Mercedes; Lam, Jenny K W

    2016-07-01

    Tuberculosis (TB), caused by the infection of Mycobacterium tuberculosis (Mtb), continues to pose a serious threat to public health, and the situation is worsening with the rapid emergence of multidrug resistant (MDR) TB. Current TB regimens require long duration of treatment, and their toxic side effects often lead to poor adherence and low success rates. There is an urgent need for shorter and more effective treatment for TB. In recent years, RNA interference (RNAi) has become a powerful tool for studying gene function by silencing the target genes. The survival of Mtb in host macrophages involves the attenuation of the antimicrobial responses mounted by the host cells. RNAi technology has helped to improve our understanding of how these bacilli interferes with the bactericidal effect and host immunity during TB infection. It has been suggested that the host-directed intervention by modulation of host pathways can be employed as a novel and effective therapy against TB. This therapeutic approach could be achieved by RNAi, which holds enormous potential beyond a laboratory to the clinic. RNAi therapy targeting TB is being investigated for enhancing host antibacterial capacity or improving drug efficacy on drug resistance strains while minimizing the associated adverse effects. One of the key challenges of RNAi therapeutics arises from the delivery of the RNAi molecules into the target cells, and inhalation could serve as a direct administration route for the treatment of pulmonary TB in a non-invasive manner. However, there are still major obstacles that need to be overcome. This review focuses on the RNAi candidates that are currently explored for the treatment of TB and discusses the major barriers of pulmonary RNAi delivery. From this, we hope to stimulate further studies of local RNAi therapeutics for pulmonary TB treatment. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. RNAi-based GM plants: food for thought for risk assessors.

    PubMed

    Ramon, Matthew; Devos, Yann; Lanzoni, Anna; Liu, Yi; Gomes, Ana; Gennaro, Andrea; Waigmann, Elisabeth

    2014-12-01

    RNA interference (RNAi) is an emerging technology that offers new opportunities for the generation of new traits in genetically modified (GM) plants. Potential risks associated with RNAi-based GM plants and issues specific to their risk assessment were discussed during an international scientific workshop (June 2014) organized by the European Food Safety Authority (EFSA). Selected key outcomes of the workshop are reported here. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  3. Assessment of psyllid double-stranded Ribonucleic acid, RNA, off-target effects on a ladybird beetle predator

    USDA-ARS?s Scientific Manuscript database

    Development of Ribonucleic acid interference, RNAi against insect pests needs to show species target specificity so that beneficial insects remain unharmed, as many pest insects are a food source for predatory insects like lady beetles. We evaluated an RNAi product specific to Asian citrus psyllid f...

  4. Beyond insects: current status, achievements and future perspectives of RNAi in mite pests.

    PubMed

    Niu, Jinzhi; Shen, Guangmao; Christiaens, Olivier; Smagghe, Guy; He, Lin; Wang, Jinjun

    2018-05-11

    Mites comprise a group of key agricultural pests on a wide range of crops. They cause harm through feeding on the plant and transferring dangerous pathogens, and the rapid evolution of pesticide resistance in mites highlights the need for novel control methods. Currently, RNA interference (RNAi) shows a great potential for insect pest control. Here, we review the literature associated with RNAi in mite pests. We discuss different target genes and RNAi efficiency in various mite species, a promising Varroa control program through RNAi, the synergy of RNAi with plant defense mechanisms and microorganisms, and the current understandings of systemic movement of dsRNA. Based on this, we can conclude that there is a clear potential for an RNAi-based mite control application but further research on several aspects is needed, including: (i) the factors influencing the RNAi efficiency, (ii) the mechanism of environmental RNAi and cross-kingdom dsRNA trafficking, (iii) the mechanism of possible systemic and parental RNAi, and (iv) non-target effects, specifically in predatory mites, should be considered during the RNAi target selection. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  5. Non-target Effects of Green Fluorescent Protein (GFP)-derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays

    PubMed Central

    Nunes, Francis M. F.; Aleixo, Aline C.; Barchuk, Angel R.; Bomtorin, Ana D.; Grozinger, Christina M.; Simões, Zilá L. P.

    2013-01-01

    RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control. PMID:26466797

  6. Non-Target Effects of Green Fluorescent Protein (GFP)-Derived Double-Stranded RNA (dsRNA-GFP) Used in Honey Bee RNA Interference (RNAi) Assays.

    PubMed

    Nunes, Francis M F; Aleixo, Aline C; Barchuk, Angel R; Bomtorin, Ana D; Grozinger, Christina M; Simões, Zilá L P

    2013-01-04

    RNA interference has been frequently applied to modulate gene function in organisms where the production and maintenance of mutants is challenging, as in our model of study, the honey bee, Apis mellifera. A green fluorescent protein (GFP)-derived double-stranded RNA (dsRNA-GFP) is currently commonly used as control in honey bee RNAi experiments, since its gene does not exist in the A. mellifera genome. Although dsRNA-GFP is not expected to trigger RNAi responses in treated bees, undesirable effects on gene expression, pigmentation or developmental timing are often observed. Here, we performed three independent experiments using microarrays to examine the effect of dsRNA-GFP treatment (introduced by feeding) on global gene expression patterns in developing worker bees. Our data revealed that the expression of nearly 1,400 genes was altered in response to dsRNA-GFP, representing around 10% of known honey bee genes. Expression changes appear to be the result of both direct off-target effects and indirect downstream secondary effects; indeed, there were several instances of sequence similarity between putative siRNAs generated from the dsRNA-GFP construct and genes whose expression levels were altered. In general, the affected genes are involved in important developmental and metabolic processes associated with RNA processing and transport, hormone metabolism, immunity, response to external stimulus and to stress. These results suggest that multiple dsRNA controls should be employed in RNAi studies in honey bees. Furthermore, any RNAi studies involving these genes affected by dsRNA-GFP in our studies should use a different dsRNA control.

  7. RNA interference of 1-aminocyclopropane-1-carboxylic acid oxidase (ACO1 and ACO2) genes expression prolongs the shelf life of Eksotika (Carica papaya L.) papaya fruit.

    PubMed

    Sekeli, Rogayah; Abdullah, Janna Ong; Namasivayam, Parameswari; Muda, Pauziah; Abu Bakar, Umi Kalsom; Yeong, Wee Chien; Pillai, Vilasini

    2014-06-19

    The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.

  8. RNAi mediates post-transcriptional repression of gene expression in fission yeast Schizosaccharomyces pombe

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Smialowska, Agata, E-mail: smialowskaa@gmail.com; School of Life Sciences, Södertörn Högskola, Huddinge 141-89; Djupedal, Ingela

    Highlights: • Protein coding genes accumulate anti-sense sRNAs in fission yeast S. pombe. • RNAi represses protein-coding genes in S. pombe. • RNAi-mediated gene repression is post-transcriptional. - Abstract: RNA interference (RNAi) is a gene silencing mechanism conserved from fungi to mammals. Small interfering RNAs are products and mediators of the RNAi pathway and act as specificity factors in recruiting effector complexes. The Schizosaccharomyces pombe genome encodes one of each of the core RNAi proteins, Dicer, Argonaute and RNA-dependent RNA polymerase (dcr1, ago1, rdp1). Even though the function of RNAi in heterochromatin assembly in S. pombe is established, its rolemore » in controlling gene expression is elusive. Here, we report the identification of small RNAs mapped anti-sense to protein coding genes in fission yeast. We demonstrate that these genes are up-regulated at the protein level in RNAi mutants, while their mRNA levels are not significantly changed. We show that the repression by RNAi is not a result of heterochromatin formation. Thus, we conclude that RNAi is involved in post-transcriptional gene silencing in S. pombe.« less

  9. RNAi technologies in agricultural biotechnology: The Toxicology Forum 40th Annual Summer Meeting.

    PubMed

    Sherman, James H; Munyikwa, Tichafa; Chan, Stephen Y; Petrick, Jay S; Witwer, Kenneth W; Choudhuri, Supratim

    2015-11-01

    During the 40th Annual Meeting of The Toxicology Forum, the current and potential future science, regulations, and politics of agricultural biotechnology were presented and discussed. The meeting session described herein focused on the technology of RNA interference (RNAi) in agriculture. The general process by which RNAi works, currently registered RNAi-based plant traits, example RNAi-based traits in development, potential use of double stranded RNA (dsRNA) as topically applied pesticide active ingredients, research related to the safety of RNAi, biological barriers to ingested dsRNA, recent regulatory RNAi science reviews, and regulatory considerations related to the use of RNAi in agriculture were discussed. Participants generally agreed that the current regulatory framework is robust and appropriate for evaluating the safety of RNAi employed in agricultural biotechnology and were also supportive of the use of RNAi to develop improved crop traits. However, as with any emerging technology, the potential range of future products, potential future regulatory frameworks, and public acceptance of the technology will continue to evolve. As such, continuing dialogue was encouraged to promote education of consumers and science-based regulations. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Differential gene expression in tomato fruit and Colletotrichum gloeosporioides during colonization of the RNAi-SlPH tomato line with reduced fruit acidity and higher pH.

    PubMed

    Barad, Shiri; Sela, Noa; Dubey, Amit K; Kumar, Dilip; Luria, Neta; Ment, Dana; Cohen, Shahar; Schaffer, Arthur A; Prusky, Dov

    2017-08-04

    The destructive phytopathogen Colletotrichum gloeosporioides causes anthracnose disease in fruit. During host colonization, it secretes ammonia, which modulates environmental pH and regulates gene expression, contributing to pathogenicity. However, the effect of host pH environment on pathogen colonization has never been evaluated. Development of an isogenic tomato line with reduced expression of the gene for acidity, SlPH (Solyc10g074790.1.1), enabled this analysis. Total RNA from C. gloeosporioides colonizing wild-type (WT) and RNAi-SlPH tomato lines was sequenced and gene-expression patterns were compared. C. gloeosporioides inoculation of the RNAi-SlPH line with pH 5.96 compared to the WT line with pH 4.2 showed 30% higher colonization and reduced ammonia accumulation. Large-scale comparative transcriptome analysis of the colonized RNAi-SlPH and WT lines revealed their different mechanisms of colonization-pattern activation: whereas the WT tomato upregulated 13-LOX (lipoxygenase), jasmonic acid and glutamate biosynthesis pathways, it downregulated processes related to chlorogenic acid biosynthesis II, phenylpropanoid biosynthesis and hydroxycinnamic acid tyramine amide biosynthesis; the RNAi-SlPH line upregulated UDP-D-galacturonate biosynthesis I and free phenylpropanoid acid biosynthesis, but mainly downregulated pathways related to sugar metabolism, such as the glyoxylate cycle and L-arabinose degradation II. Comparison of C. gloeosporioides gene expression during colonization of the WT and RNAi-SlPH lines showed that the fungus upregulates ammonia and nitrogen transport and the gamma-aminobutyric acid metabolic process during colonization of the WT, while on the RNAi-SlPH tomato, it mainly upregulates the nitrate metabolic process. Modulation of tomato acidity and pH had significant phenotypic effects on C. gloeosporioides development. The fungus showed increased colonization on the neutral RNAi-SlPH fruit, and limited colonization on the WT acidic fruit

  11. Using RNAi in C. "elegans" to Demonstrate Gene Knockdown Phenotypes in the Undergraduate Biology Lab Setting

    ERIC Educational Resources Information Center

    Roy, Nicole M.

    2013-01-01

    RNA interference (RNAi) is a powerful technology used to knock down genes in basic research and medicine. In 2006 RNAi technology using "Caenorhabditis elegans" ("C. elegans") was awarded the Nobel Prize in medicine and thus students graduating in the biological sciences should have experience with this technology. However,…

  12. RNA therapeutics: RNAi and antisense mechanisms and clinical applications.

    PubMed

    Chery, Jessica

    2016-07-01

    RNA therapeutics refers to the use of oligonucleotides to target primarily ribonucleic acids (RNA) for therapeutic efforts or in research studies to elucidate functions of genes. Oligonucleotides are distinct from other pharmacological modalities, such as small molecules and antibodies that target mainly proteins, due to their mechanisms of action and chemical properties. Nucleic acids come in two forms: deoxyribonucleic acids (DNA) and ribonucleic acids (RNA). Although DNA is more stable, RNA offers more structural variety ranging from messenger RNA (mRNA) that codes for protein to non-coding RNAs, microRNA (miRNA), transfer RNA (tRNA), short interfering RNAs (siRNAs), ribosomal RNA (rRNA), and long-noncoding RNAs (lncRNAs). As our understanding of the wide variety of RNAs deepens, researchers have sought to target RNA since >80% of the genome is estimated to be transcribed. These transcripts include non-coding RNAs such as miRNAs and siRNAs that function in gene regulation by playing key roles in the transfer of genetic information from DNA to protein, the final product of the central dogma in biology 1 . Currently there are two main approaches used to target RNA: double stranded RNA-mediated interference (RNAi) and antisense oligonucleotides (ASO). Both approaches are currently in clinical trials for targeting of RNAs involved in various diseases, such as cancer and neurodegeneration. In fact, ASOs targeting spinal muscular atrophy and amyotrophic lateral sclerosis have shown positive results in clinical trials 2 . Advantages of ASOs include higher affinity due to the development of chemical modifications that increase affinity, selectivity while decreasing toxicity due to off-target effects. This review will highlight the major therapeutic approaches of RNA medicine currently being applied with a focus on RNAi and ASOs.

  13. C3PO, an endoribonuclease that promotes RNAi by facilitating RISC activation.

    PubMed

    Liu, Ying; Ye, Xuecheng; Jiang, Feng; Liang, Chunyang; Chen, Dongmei; Peng, Junmin; Kinch, Lisa N; Grishin, Nick V; Liu, Qinghua

    2009-08-07

    The catalytic engine of RNA interference (RNAi) is the RNA-induced silencing complex (RISC), wherein the endoribonuclease Argonaute and single-stranded small interfering RNA (siRNA) direct target mRNA cleavage. We reconstituted long double-stranded RNA- and duplex siRNA-initiated RISC activities with the use of recombinant Drosophila Dicer-2, R2D2, and Ago2 proteins. We used this core reconstitution system to purify an RNAi regulator that we term C3PO (component 3 promoter of RISC), a complex of Translin and Trax. C3PO is a Mg2+-dependent endoribonuclease that promotes RISC activation by removing siRNA passenger strand cleavage products. These studies establish an in vitro RNAi reconstitution system and identify C3PO as a key activator of the core RNAi machinery.

  14. RNA interference: ready to silence cancer?

    PubMed

    Mocellin, Simone; Costa, Rodolfo; Nitti, Donato

    2006-01-01

    RNA interference (RNAi) is considered the most promising functional genomics tool recently developed. As in other medical fields, this biotechnology might revolutionize the approach to dissecting the biology of cancer, ultimately speeding up the discovery pace of novel targets suitable for molecularly tailored antitumor therapies. In addition, preclinical results suggest that RNAi itself might be used as a therapeutic weapon. With the aim of illustrating not only the potentials but also the current limitations of RNAi as a tool in the fight against cancer, here we summarize the physiology of RNAi, discuss the main technical issues of RNAi-based gene silencing, and review some of the most interesting preclinical results obtained so far with its implementation in the field of oncology.

  15. Establishment of a tissue-specific RNAi system in C. elegans.

    PubMed

    Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D; Amano, Mutsuki; Moerman, Donald G; Kaibuchi, Kozo

    2007-10-01

    In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal-and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues.

  16. Establishment of a tissue-specific RNAi system in C. elegans

    PubMed Central

    Qadota, Hiroshi; Inoue, Makiko; Hikita, Takao; Köppen, Mathias; Hardin, Jeffrey D.; Amano, Mutsuki; Moerman, Donald G.; Kaibuchi, Kozo

    2011-01-01

    In C. elegans, mosaic analysis is a powerful genetic tool for determining in which tissue or specific cells a gene of interest is required. For traditional mosaic analysis, a loss-of-function mutant and a genomic fragment that can rescue the mutant phenotype are required. Here we establish an easy and rapid mosaic system using RNAi (RNA mediated interference), using a rde-1 mutant that is resistant to RNAi. Tissue-specific expression of the wild type rde-1 cDNA in rde-1 mutants limits RNAi sensitivity to a specific tissue. We established hypodermal- and muscle-specific RNAi systems by expressing rde-1 cDNA under the control of the lin-26 and hlh-1 promoters, respectively. We confirmed tissue-specific RNAi using two assays: (1) tissue-specific knockdown of GFP expression, and (2) phenocopy of mutations in essential genes that were previously known to function in a tissue-specific manner. We also applied this system to an essential gene, ajm-1, expressed in hypodermis and gut, and show that lethality in ajm-1 mutants is due to loss of expression in hypodermal cells. Although we demonstrate tissue-specific RNAi in hypodermis and muscle, this method could be easily applied to other tissues. PMID:17681718

  17. Advance of RNA interference technique in Hemipteran insects.

    PubMed

    Li, Jie; Wang, Xiaoping; Wang, Manqun; Ma, Weihua; Hua, Hongxia

    2012-07-24

    RNA interference (RNAi) suppressed the expression of the target genes by post transcriptional regulation and the double-stranded RNA (dsRNA) mediated gene silencing has been a conserved mechanism in many eukaryotes, which prompted RNAi to become a valuable tool for unveiling the gene function in many model insects. Recent research attested that RNAi technique can be also effective in downregulation target genes in Hemipteran insects. In this review, we collected the researches of utilizing RNAi technique in gene functional analysis in Hemipteran insects, highlighted the methods of dsRNA/siRNA uptake by insects and discussed the knock-down efficiency of these techniques. Although the RNA interference technique has drawbacks and obscure points, our primary goal of this review is try to exploit it for further discovering gene functions and pest control tactic in the Hemipteran insects. © 2012 The Societies and Blackwell Publishing Asia Pty Ltd.

  18. Chromatin and RNAi factors protect the C. elegans germline against repetitive sequences

    PubMed Central

    Robert, Valérie J.P.; Sijen, Titia; van Wolfswinkel, Josien; Plasterk, Ronald H.A.

    2005-01-01

    Protection of genomes against invasion by repetitive sequences, such as transposons, viruses, and repetitive transgenes, involves strong and selective silencing of these sequences. During silencing of repetitive transgenes, a trans effect (“cosuppression”) occurs that results in silencing of cognate endogenous genes. Here we report RNA interference (RNAi) screens performed to catalog genes required for cosuppression in the Caenorhabditis elegans germline. We find factors with a putative role in chromatin remodeling and factors involved in RNAi. Together with molecular data also presented in this study, these results suggest that in C. elegans repetitive sequences trigger transcriptional gene silencing using RNAi and chromatin factors. PMID:15774721

  19. RNA interference for functional genomics and improvement of cotton (Gossypium species)

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium ssp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function ...

  20. RNA interference can target pre-mRNA: consequences for gene expression in a Caenorhabditis elegans operon.

    PubMed Central

    Bosher, J M; Dufourcq, P; Sookhareea, S; Labouesse, M

    1999-01-01

    In nematodes, flies, trypanosomes, and planarians, introduction of double-stranded RNA results in sequence-specific inactivation of gene function, a process termed RNA interference (RNAi). We demonstrate that RNAi against the Caenorhabditis elegans gene lir-1, which is part of the lir-1/lin-26 operon, induced phenotypes very different from a newly isolated lir-1 null mutation. Specifically, lir-1(RNAi) induced embryonic lethality reminiscent of moderately strong lin-26 alleles, whereas the lir-1 null mutant was viable. We show that the lir-1(RNAi) phenotypes resulted from a severe loss of lin-26 gene expression. In addition, we found that RNAi directed against lir-1 or lin-26 introns induced similar phenotypes, so we conclude that lir-1(RNAi) targets the lir-1/lin-26 pre-mRNA. This provides direct evidence that RNA interference can prevent gene expression by targeting nuclear transcripts. Our results highlight that caution may be necessary when interpreting RNA interference without the benefit of mutant alleles. PMID:10545456

  1. RNAi pathways in Mucor: A tale of proteins, small RNAs and functional diversity.

    PubMed

    Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M

    2016-05-01

    The existence of an RNA-mediated silencing mechanism in the opportunistic fungal pathogen Mucor circinelloides was first described in the early 2000. Since then, Mucor has reached an outstanding position within the fungal kingdom as a model system to achieve a deeper understanding of regulation of endogenous functions by the RNA interference (RNAi) machinery. M. circinelloides combines diverse components of its RNAi machinery to carry out functions not only limited to the defense against invasive nucleic acids, but also to regulate expression of its own genes by producing different classes of endogenous small RNA molecules (esRNAs). The recent discovery of a novel RNase that participates in a new RNA degradation pathway adds more elements to the gene silencing-mediated regulation. This review focuses on esRNAs in M. circinelloides, the different pathways involved in their biogenesis, and their roles in regulating specific physiological and developmental processes in response to environmental signals, highlighting the complexity of silencing-mediated regulation in fungi. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. RNAi of COL1A1 in mesenchymal progenitor cells.

    PubMed

    Millington-Ward, Sophia; McMahon, Helena P; Allen, Danny; Tuohy, Gearóid; Kiang, Anna-Sophia; Palfi, Arpad; Kenna, Paul F; Humphries, Peter; Farrar, G Jane

    2004-10-01

    Given that mutant COL1A1 is known to cause Osteogenesis Imperfecta (OI), tools to modulate COL1A1 expression are likely to be of significant therapeutic value. In this context, we have evaluated RNA interference (RNAi) as a means to downregulate COL1A1 expression in Cos-7 cells and in human mesenchymal progenitor stem cells (MPCs), the latter cells giving rise to bone and therefore representing a target cell type for collagen-related disorders. In addition, allele-specificity, a key factor to the success of RNAi-based suppression, was explored with a view to developing a mutation-independent RNAi-based therapeutic for OI by targeting an intragenic SNP within transcripts derived from the COL1A1 gene. Preferential suppression of individual polymorphic alleles that differed by a single nucleotide was observed.

  3. [Expression analysis of a transformer gene in Daphnia pulex after RNAi].

    PubMed

    Guo, C Y; Chen, P; Zhang, M M; Ning, J J; Wang, С L; Wang, D L; Zhao, Y L

    2016-01-01

    In order to explore the importance of the transformer (tra) gene in reproductive mode switching in Daphnia pulex, we studied the effect of silencing of this gene using RNA interference (RNAi). We obtained Dptra dsRNA by constructing and using a dsRNA expression vector and transcription method in vitro. D. pulex individuals in different reproductive modes were treated by soaking in a solution of Dptra dsRNA. We then assayed the expression of the endogenous Dptra mRNA after RNAi treatment using RT-PCR and obtained the suppression ratio. Expression of the tra gene in the RNAi groups was down-regulated compared with the controls after 16 h (p < 0.05). We also analyzed the effect of RNAi on the expression of the TRA protein using Western blot, which showed that the expression level of the TRA protein was reduced after RNAi treatment. Our experimental results showed that soaking of D. pulex adults in tra-specific dsRNA transcribed in vitro can specifically reduce the level of tra mRNA and also reduce the expression of the TRA protein, demonstrating effective in vivo silencing of the tra gene.

  4. RNA interference: learning gene knock-down from cell physiology

    PubMed Central

    Mocellin, Simone; Provenzano, Maurizio

    2004-01-01

    Over the past decade RNA interference (RNAi) has emerged as a natural mechanism for silencing gene expression. This ancient cellular antiviral response can be exploited to allow specific inhibition of the function of any chosen target gene. RNAi is proving to be an invaluable research tool, allowing much more rapid characterization of the function of known genes. More importantly, RNAi technology considerably bolsters functional genomics to aid in the identification of novel genes involved in disease processes. This review briefly describes the molecular principles underlying the biology of RNAi phenomenon and discuss the main technical issues regarding optimization of RNAi experimental design. PMID:15555080

  5. The effectiveness of RNAi in Caenorhabditis elegans is maintained during spaceflight.

    PubMed

    Etheridge, Timothy; Nemoto, Kanako; Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J; Higashitani, Atsushi

    2011-01-01

    Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at -80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space.

  6. The Effectiveness of RNAi in Caenorhabditis elegans Is Maintained during Spaceflight

    PubMed Central

    Hashizume, Toko; Mori, Chihiro; Sugimoto, Tomoko; Suzuki, Hiromi; Fukui, Keiji; Yamazaki, Takashi; Higashibata, Akira; Szewczyk, Nathaniel J.; Higashitani, Atsushi

    2011-01-01

    Background Overcoming spaceflight-induced (patho)physiologic adaptations is a major challenge preventing long-term deep space exploration. RNA interference (RNAi) has emerged as a promising therapeutic for combating diseases on Earth; however the efficacy of RNAi in space is currently unknown. Methods Caenorhabditis elegans were prepared in liquid media on Earth using standard techniques and treated acutely with RNAi or a vector control upon arrival in Low Earth Orbit. After culturing during 4 and 8 d spaceflight, experiments were stopped by freezing at −80°C until analysis by mRNA and microRNA array chips, microscopy and Western blot on return to Earth. Ground controls (GC) on Earth were simultaneously grown under identical conditions. Results After 8 d spaceflight, mRNA expression levels of components of the RNAi machinery were not different from that in GC (e.g., Dicer, Argonaute, Piwi; P>0.05). The expression of 228 microRNAs, of the 232 analysed, were also unaffected during 4 and 8 d spaceflight (P>0.05). In spaceflight, RNAi against green fluorescent protein (gfp) reduced chromosomal gfp expression in gonad tissue, which was not different from GC. RNAi against rbx-1 also induced abnormal chromosome segregation in the gonad during spaceflight as on Earth. Finally, culture in RNAi against lysosomal cathepsins prevented degradation of the muscle-specific α-actin protein in both spaceflight and GC conditions. Conclusions Treatment with RNAi works as effectively in the space environment as on Earth within multiple tissues, suggesting RNAi may provide an effective tool for combating spaceflight-induced pathologies aboard future long-duration space missions. Furthermore, this is the first demonstration that RNAi can be utilised to block muscle protein degradation, both on Earth and in space. PMID:21673804

  7. RNAi-mediated germline knockdown of FABP4 increases body weight but does not improve the deranged nutrient metabolism of diet-induced obese mice.

    PubMed

    Yang, R; Castriota, G; Chen, Y; Cleary, M A; Ellsworth, K; Shin, M K; Tran, J-Lv; Vogt, T F; Wu, M; Xu, S; Yang, X; Zhang, B B; Berger, J P; Qureshi, S A

    2011-02-01

    To investigate the impact of reduced adipocyte fatty acid-binding protein 4 (FABP4) in control of body weight, glucose and lipid homeostasis in diet-induced obese (DIO) mice. We applied RNA interference (RNAi) technology to generate FABP4 germline knockdown mice to investigate their metabolic phenotype. RNAi-mediated knockdown reduced FABP4 mRNA expression and protein levels by almost 90% in adipocytes of standard chow-fed mice. In adipocytes of DIO mice, RNAi reduced FABP4 expression and protein levels by 70 and 80%, respectively. There was no increase in adipocyte FABP5 expression in FABP4 knockdown mice. The knockdown of FABP4 significantly increased body weight and fat mass in DIO mice. However, FABP4 knockdown did not affect plasma glucose and lipid homeostasis in DIO mice; nor did it improve their insulin sensitivity. Our data indicate that robust knockdown of FABP4 increases body weight and fat mass without improving glucose and lipid homeostasis in DIO mice.

  8. Therapeutic potentials of gene silencing by RNA interference: principles, challenges, and new strategies.

    PubMed

    Deng, Yan; Wang, Chi Chiu; Choy, Kwong Wai; Du, Quan; Chen, Jiao; Wang, Qin; Li, Lu; Chung, Tony Kwok Hung; Tang, Tao

    2014-04-01

    During recent decades there have been remarkable advances in biology, in which one of the most important discoveries is RNA interference (RNAi). RNAi is a specific post-transcriptional regulatory pathway that can result in silencing gene functions. Efforts have been done to translate this new discovery into clinical applications for disease treatment. However, technical difficulties restrict the development of RNAi, including stability, off-target effects, immunostimulation and delivery problems. Researchers have attempted to surmount these barriers and improve the bioavailability and safety of RNAi-based therapeutics by optimizing the chemistry and structure of these molecules. This paper aimed to describe the principles of RNA interference, review the therapeutic potential in various diseases and discuss the new strategies for in vivo delivery of RNAi to overcome the challenges. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi.

    PubMed

    Swevers, Luc; Liu, Jisheng; Smagghe, Guy

    2018-05-01

    RNAi is considered a major antiviral defense mechanism in insects, but its relative importance as compared to other antiviral pathways has not been evaluated comprehensively. Here, it is attempted to give an overview of the antiviral defense mechanisms in Drosophila that involve both RNAi and non-RNAi. While RNAi is considered important in most viral infections, many other pathways can exist that confer antiviral resistance. It is noted that very few direct recognition mechanisms of virus infections have been identified in Drosophila and that the activation of immune pathways may be accomplished indirectly through cell damage incurred by viral replication. In several cases, protection against viral infection can be obtained in RNAi mutants by non-RNAi mechanisms, confirming the variability of the RNAi defense mechanism according to the type of infection and the physiological status of the host. This analysis is aimed at more systematically investigating the relative contribution of RNAi in the antiviral response and more specifically, to ask whether RNAi efficiency is affected when other defense mechanisms predominate. While Drosophila can function as a useful model, this issue may be more critical for economically important insects that are either controlled (agricultural pests and vectors of diseases) or protected from parasite infection (beneficial insects as bees) by RNAi products.

  10. Defense Mechanisms against Viral Infection in Drosophila: RNAi and Non-RNAi

    PubMed Central

    Liu, Jisheng

    2018-01-01

    RNAi is considered a major antiviral defense mechanism in insects, but its relative importance as compared to other antiviral pathways has not been evaluated comprehensively. Here, it is attempted to give an overview of the antiviral defense mechanisms in Drosophila that involve both RNAi and non-RNAi. While RNAi is considered important in most viral infections, many other pathways can exist that confer antiviral resistance. It is noted that very few direct recognition mechanisms of virus infections have been identified in Drosophila and that the activation of immune pathways may be accomplished indirectly through cell damage incurred by viral replication. In several cases, protection against viral infection can be obtained in RNAi mutants by non-RNAi mechanisms, confirming the variability of the RNAi defense mechanism according to the type of infection and the physiological status of the host. This analysis is aimed at more systematically investigating the relative contribution of RNAi in the antiviral response and more specifically, to ask whether RNAi efficiency is affected when other defense mechanisms predominate. While Drosophila can function as a useful model, this issue may be more critical for economically important insects that are either controlled (agricultural pests and vectors of diseases) or protected from parasite infection (beneficial insects as bees) by RNAi products. PMID:29723993

  11. [RNA interference library research progress and its application in cancer research].

    PubMed

    Zhao, Ning; Cai, Li

    2013-02-01

    RNA interference is a homologous mRNA special degradation phenomenon which is caused by the double-stranded RNA. RNAi library is a pooled library that is artificially constructed using RNAi technology. As RNAi library has made a major breakthrough in the field of genetic research, it has been widely used in the field of medical research, especially in the field of cancer research. This review discussed the research progress of RNAi library and its applications in cancer research.

  12. RNAi-mediated resistance to rice black-streaked dwarf virus in transgenic rice.

    PubMed

    Ahmed, Mohamed M S; Bian, Shiquan; Wang, Muyue; Zhao, Jing; Zhang, Bingwei; Liu, Qiaoquan; Zhang, Changquan; Tang, Shuzhu; Gu, Minghong; Yu, Hengxiu

    2017-04-01

    Rice black-streaked dwarf virus (RBSDV), a member of the genus Fijivirus in the family Reoviridae, causes significant economic losses in rice production in China and many other Asian countries. Development of resistant varieties by using conventional breeding methods is limited, as germplasm with high level of resistance to RBSDV have not yet been found. One of the most promising methods to confer resistance against RBSDV is the use of RNA interference (RNAi) technology. RBSDV non-structural protein P7-2, encoded by S7-2 gene, is a potential F-box protein and involved in the plant-virus interaction through the ubiquitination pathway. P8, encoded by S8 gene, is the minor core protein that possesses potent active transcriptional repression activity. In this study, we transformed rice calli using a mini-twin T-DNA vector harboring RNAi constructs of the RBSDV genes S7-2 or S8, and obtained plants harboring the target gene constructs and the selectable marker gene, hygromycin phosphotransferase (HPT). From the offspring of these transgenic plants, we obtained selectable marker (HPT gene)-free plants. Homozygous T 5 transgenic lines which harbored either S7-2-RNAi or S8-RNAi exhibited high level resistance against RBSDV under field infection pressure from indigenous viruliferous small brown planthoppers. Thus, our results showed that RNA interference with the expression of S7-2 or S8 genes seemed an effective way to induce high level resistance in rice against RBSD disease.

  13. RNA Interference in Insect Vectors for Plant Viruses.

    PubMed

    Kanakala, Surapathrudu; Ghanim, Murad

    2016-12-12

    Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists.

  14. RNA Interference in Insect Vectors for Plant Viruses

    PubMed Central

    Kanakala, Surapathrudu; Ghanim, Murad

    2016-01-01

    Insects and other arthropods are the most important vectors of plant pathogens. The majority of plant pathogens are disseminated by arthropod vectors such as aphids, beetles, leafhoppers, planthoppers, thrips and whiteflies. Transmission of plant pathogens and the challenges in managing insect vectors due to insecticide resistance are factors that contribute to major food losses in agriculture. RNA interference (RNAi) was recently suggested as a promising strategy for controlling insect pests, including those that serve as important vectors for plant pathogens. The last decade has witnessed a dramatic increase in the functional analysis of insect genes, especially those whose silencing results in mortality or interference with pathogen transmission. The identification of such candidates poses a major challenge for increasing the role of RNAi in pest control. Another challenge is to understand the RNAi machinery in insect cells and whether components that were identified in other organisms are also present in insect. This review will focus on summarizing success cases in which RNAi was used for silencing genes in insect vector for plant pathogens, and will be particularly helpful for vector biologists. PMID:27973446

  15. The dose can make the poison: lessons learned from adverse in vivo toxicities caused by RNAi overexpression.

    PubMed

    Grimm, Dirk

    2011-10-26

    For the past five years, evidence has accumulated that vector-mediated robust RNA interference (RNAi) expression can trigger severe side effects in small and large animals, from cytotoxicity and accelerated tumorigenesis to organ failure and death. The recurring notions in these studies that a critical parameter is the strength of RNAi expression and that Exportin-5 and the Argonaute proteins are rate-limiting mammalian RNAi, strongly imply dose-dependent saturation of the endogenous miRNA pathway as one of the underlying mechanisms. This minireview summarizes the relevant work and data leading to this intriguing model and highlights potential avenues by which to alleviate RNAi-induced toxicities in future clinical applications.

  16. Accumulation of dsRNA in endosomes contributes to inefficient RNA interference in the fall armyworm, Spodoptera frugiperda.

    PubMed

    Yoon, June-Sun; Gurusamy, Dhandapani; Palli, Subba Reddy

    2017-11-01

    RNA interference (RNAi) efficiency varies among insects studied. The barriers for successful RNAi include the presence of double-stranded ribonucleases (dsRNase) in the lumen and hemolymph that could potentially digest double-stranded RNA (dsRNA) and the variability in the transport of dsRNA into and within the cells. We recently showed that the dsRNAs are transported into lepidopteran cells, but they are not processed into small interference RNAs (siRNAs) because they are trapped in acidic bodies. In the current study, we focused on the identification of acidic bodies in which dsRNAs accumulate in Sf9 cells. Time-lapse imaging studies showed that dsRNAs enter Sf9 cells and accumulate in acidic bodies within 20 min after their addition to the medium. CypHer-5E-labeled dsRNA also accumulated in the midgut and fat body dissected from Spodoptera frugiperda larvae with similar patterns observed in Sf9 cells. Pharmacological inhibitor assays showed that the dsRNAs use clathrin mediated endocytosis pathway for transport into the cells. We investigated the potential dsRNA accumulation sites employing LysoTracker and double labeling experiments using the constructs to express a fusion of green fluorescence protein with early or late endosomal marker proteins and CypHer-5E-labeled dsRNA. Interestingly, CypHer-5E-labeled dsRNA accumulated predominantly in early and late endosomes. These data suggest that entrapment of internalized dsRNA in endosomes is one of the major factors contributing to inefficient RNAi response in lepidopteran insects. Copyright © 2017 Elsevier Ltd. All rights reserved.

  17. Reciprocal inhibition between intracellular antiviral signaling and the RNAi machinery in mammalian cells

    PubMed Central

    Seo, Gil Ju; Kincaid, Rodney P.; Phanaksri, Teva; Burke, James M.; Pare, Justin M.; Cox, Jennifer E.; Hsiang, Tien-Ying; Krug, Robert M.; Sullivan, Christopher S.

    2013-01-01

    SUMMARY RNA interference (RNAi) is an established antiviral defense mechanism in plants and invertebrates. Whether RNAi serves a similar function in mammalian cells remains unresolved. We find that in some cell types, mammalian RNAi activity is reduced shortly after viral infection via poly ADP-ribosylation of the RNA induced silencing complex (RISC), a core component of RNAi. Well-established antiviral signaling pathways, including RIG-I/MAVS and RNAseL, contribute to inhibition of RISC. In the absence of virus infection, microRNAs repress interferon-stimulated genes (ISGs) associated with cell death and proliferation, thus maintaining homeostasis. Upon detection of intracellular pathogen-associated molecular patterns, RISC activity decreases, contributing to increased expression of ISGs. Our results suggest that unlike in lower eukaryotes, mammalian RISC is not antiviral in some contexts, but rather, RISC has been co-opted to negatively regulate toxic host antiviral effectors via microRNAs. PMID:24075860

  18. Deconvolution of seed and RNA-binding protein crosstalk in RNAi-based functional genomics.

    PubMed

    Suzuki, Hiroshi I; Spengler, Ryan M; Grigelioniene, Giedre; Kobayashi, Tatsuya; Sharp, Phillip A

    2018-05-01

    RNA interference (RNAi) is a major, powerful platform for gene perturbations, but is restricted by off-target mechanisms. Communication between RNAs, small RNAs, and RNA-binding proteins (RBPs) is a pervasive feature of cellular RNA networks. We present a crosstalk scenario, designated as crosstalk with endogenous RBPs' (ceRBP), in which small interfering RNAs or microRNAs with seed sequences that overlap RBP motifs have extended biological effects by perturbing endogenous RBP activity. Systematic analysis of small interfering RNA (siRNA) off-target data and genome-wide RNAi cancer lethality screens using 501 human cancer cell lines, a cancer dependency map, identified that seed-to-RBP crosstalk is widespread, contributes to off-target activity, and affects RNAi performance. Specifically, deconvolution of the interactions between gene knockdown and seed-mediated silencing effects in the cancer dependency map showed widespread contributions of seed-to-RBP crosstalk to growth-phenotype modulation. These findings suggest a novel aspect of microRNA biology and offer a basis for improvement of RNAi agents and RNAi-based functional genomics.

  19. RNA interference in the clinic: challenges and future directions

    PubMed Central

    Pecot, Chad V.; Calin, George A.; Coleman, Robert L.; Lopez-Berestein, Gabriel; Sood, Anil K.

    2011-01-01

    Inherent difficulties with blocking many desirable targets using conventional approaches have prompted many to consider using RNA interference (RNAi) as a therapeutic approach. Although exploitation of RNAi has immense potential as a cancer therapeutic, many physiological obstacles stand in the way of successful and efficient delivery. This Review explores current challenges to the development of synthetic RNAi-based therapies and considers new approaches to circumvent biological barriers, to avoid intolerable side effects and to achieve controlled and sustained release. PMID:21160526

  20. RNA interference-mediated intrinsic antiviral immunity in invertebrates.

    PubMed

    Nayak, Arabinda; Tassetto, Michel; Kunitomi, Mark; Andino, Raul

    2013-01-01

    In invertebrates such as insects and nematodes, RNA interference (RNAi) provides RNA-based protection against viruses. This form of immunity restricts viral replication and dissemination from infected cells and viruses, in turn, have evolved evasion mechanisms or RNAi suppressors to counteract host defenses. Recent advances indicate that, in addition to RNAi, other related small RNA pathways contribute to antiviral functions in invertebrates. This has led to a deeper understanding of fundamental aspects of small RNA-based antiviral immunity in invertebrates and its contribution to viral spread and pathogenesis.

  1. Modeling RNA interference in mammalian cells

    PubMed Central

    2011-01-01

    Background RNA interference (RNAi) is a regulatory cellular process that controls post-transcriptional gene silencing. During RNAi double-stranded RNA (dsRNA) induces sequence-specific degradation of homologous mRNA via the generation of smaller dsRNA oligomers of length between 21-23nt (siRNAs). siRNAs are then loaded onto the RNA-Induced Silencing multiprotein Complex (RISC), which uses the siRNA antisense strand to specifically recognize mRNA species which exhibit a complementary sequence. Once the siRNA loaded-RISC binds the target mRNA, the mRNA is cleaved and degraded, and the siRNA loaded-RISC can degrade additional mRNA molecules. Despite the widespread use of siRNAs for gene silencing, and the importance of dosage for its efficiency and to avoid off target effects, none of the numerous mathematical models proposed in literature was validated to quantitatively capture the effects of RNAi on the target mRNA degradation for different concentrations of siRNAs. Here, we address this pressing open problem performing in vitro experiments of RNAi in mammalian cells and testing and comparing different mathematical models fitting experimental data to in-silico generated data. We performed in vitro experiments in human and hamster cell lines constitutively expressing respectively EGFP protein or tTA protein, measuring both mRNA levels, by quantitative Real-Time PCR, and protein levels, by FACS analysis, for a large range of concentrations of siRNA oligomers. Results We tested and validated four different mathematical models of RNA interference by quantitatively fitting models' parameters to best capture the in vitro experimental data. We show that a simple Hill kinetic model is the most efficient way to model RNA interference. Our experimental and modeling findings clearly show that the RNAi-mediated degradation of mRNA is subject to saturation effects. Conclusions Our model has a simple mathematical form, amenable to analytical investigations and a small set of

  2. Phylogenetic Origin and Diversification of RNAi Pathway Genes in Insects.

    PubMed

    Dowling, Daniel; Pauli, Thomas; Donath, Alexander; Meusemann, Karen; Podsiadlowski, Lars; Petersen, Malte; Peters, Ralph S; Mayer, Christoph; Liu, Shanlin; Zhou, Xin; Misof, Bernhard; Niehuis, Oliver

    2016-12-01

    RNA interference (RNAi) refers to the set of molecular processes found in eukaryotic organisms in which small RNA molecules mediate the silencing or down-regulation of target genes. In insects, RNAi serves a number of functions, including regulation of endogenous genes, anti-viral defense, and defense against transposable elements. Despite being well studied in model organisms, such as Drosophila, the distribution of core RNAi pathway genes and their evolution in insects is not well understood. Here we present the most comprehensive overview of the distribution and diversity of core RNAi pathway genes across 100 insect species, encompassing all currently recognized insect orders. We inferred the phylogenetic origin of insect-specific RNAi pathway genes and also identified several hitherto unrecorded gene expansions using whole-body transcriptome data from the international 1KITE (1000 Insect Transcriptome Evolution) project as well as other resources such as i5K (5000 Insect Genome Project). Specifically, we traced the origin of the double stranded RNA binding protein R2D2 to the last common ancestor of winged insects (Pterygota), the loss of Sid-1/Tag-130 orthologs in Antliophora (fleas, flies and relatives, and scorpionflies in a broad sense), and confirm previous evidence for the splitting of the Argonaute proteins Aubergine and Piwi in Brachyceran flies (Diptera, Brachycera). Our study offers new reference points for future experimental research on RNAi-related pathway genes in insects. © The Author(s) 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. RNAi-mediated resistance to viruses in genetically engineered plants.

    PubMed

    Ibrahim, Abdulrazak B; Aragão, Francisco J L

    2015-01-01

    RNA interference (RNAi) has emerged as a leading technology in designing genetically modified crops engineered to resist viral infection. The last decades have seen the development of a large number of crops whose inherent posttranscriptional gene silencing mechanism has been exploited to target essential viral genes through the production of dsRNA that triggers an endogenous RNA-induced silencing complex (RISC), leading to gene silencing in susceptible viruses conferring them with resistance even before the onset of infection. Selection and breeding events have allowed for establishing this highly important agronomic trait in diverse crops. With improved techniques and the availability of new data on genetic diversity among several viruses, significant progress is being made in engineering plants using RNAi with the release of a number of commercially available crops. Biosafety concerns with respect to consumption of RNAi crops, while relevant, have been addressed, given the fact that experimental evidence using miRNAs associated with the crops shows that they do not pose any health risk to humans and animals.

  4. Parameters on plant absortion of double-stranded Ribonucleic acid, dsRNA

    USDA-ARS?s Scientific Manuscript database

    Efficient absorption of double-stranded Ribonucleic acid, dsRNA, into citrus is critical for effective psyllid management by RNA interference, RNAi. Parameters which might affect absorption into citrus trees and subsequent ingestion by Asian citrus psyllid were evaluated. Age of leaves, variety of c...

  5. Multimodality Imaging of RNA Interference

    PubMed Central

    Nayak, Tapas R.; Krasteva, Lazura K.; Cai, Weibo

    2013-01-01

    The discovery of small interfering RNAs (siRNAs) and their potential to knock down virtually any gene of interest has ushered in a new era of RNA interference (RNAi). Clinical use of RNAi faces severe limitations due to inefficiency delivery of siRNA or short hairpin RNA (shRNA). Many molecular imaging techniques have been adopted in RNAi-related research for evaluation of siRNA/shRNA delivery, biodistribution, pharmacokinetics, and the therapeutic effect. In this review article, we summarize the current status of in vivo imaging of RNAi. The molecular imaging techniques that have been employed include bioluminescence/fluorescence imaging, magnetic resonance imaging/spectroscopy, positron emission tomography, single-photon emission computed tomography, and various combinations of these techniques. Further development of non-invasive imaging strategies for RNAi, not only focusing on the delivery of siRNA/shRNA but also the therapeutic efficacy, is critical for future clinical translation. Rigorous validation will be needed to confirm that biodistribution of the carrier is correlated with that of siRNA/shRNA, since imaging only detects the label (e.g. radioisotopes) but not the gene or carrier themselves. It is also essential to develop multimodality imaging approaches for realizing the full potential of therapeutic RNAi, as no single imaging modality may be sufficient to simultaneously monitor both the gene delivery and silencing effect of RNAi. PMID:23745567

  6. Interference of ascorbic acid with chemical analytes.

    PubMed

    Meng, Qing H; Irwin, William C; Fesser, Jennifer; Massey, K Lorne

    2005-11-01

    Ascorbic acid can interfere with methodologies involving redox reactions, while comprehensive studies on main chemistry analysers have not been reported. We therefore attempted to determine the interference of ascorbic acid with analytes on the Beckman Synchron LX20. Various concentrations of ascorbic acid were added to serum, and the serum analytes were measured on the LX20. With a serum ascorbic acid concentration of 12.0 mmol/L, the values for sodium, potassium, calcium and creatinine increased by 43%, 58%, 103% and 26%, respectively (P<0.01). With a serum ascorbic acid concentration of 12.0 mmol/L, the values for chloride, total bilirubin and uric acid decreased by 33%, 62% and 83%, respectively (P<0.01), and were undetectable for total cholesterol, triglyceride, ammonia and lactate. There was no definite influence of ascorbic acid on analytical values for total CO(2), urea, glucose, phosphate, total protein, albumin, amylase, creatine kinase, creatine kinase-MB, aspartate aminotransferase, alanine aminotransferase, alkaline phosphatase, total iron, unbound iron-binding capacity or magnesium. Ascorbic acid causes a false increase in sodium, potassium, calcium and creatinine results and a false decrease in chloride, total bilirubin, uric acid, total cholesterol, triglyceride, ammonia and lactate results.

  7. RNAi Technology for Insect Management and Protection of Beneficial Insects from Diseases: Lessons, Challenges and Risk Assessments.

    PubMed

    Zotti, M J; Smagghe, G

    2015-06-01

    The time has passed for us to wonder whether RNA interference (RNAi) effectively controls pest insects or protects beneficial insects from diseases. The RNAi era in insect science began with studies of gene function and genetics that paved the way for the development of novel and highly specific approaches for the management of pest insects and, more recently, for the treatment and prevention of diseases in beneficial insects. The slight differences in components of RNAi pathways are sufficient to provide a high degree of variation in responsiveness among insects. The current framework to assess the negative effects of genetically modified (GM) plants on human health is adequate for RNAi-based GM plants. Because of the mode of action of RNAi and the lack of genomic data for most exposed non-target organisms, it becomes difficult to determine the environmental risks posed by RNAi-based technologies and the benefits provided for the protection of crops. A better understanding of the mechanisms that determine the variability in the sensitivity of insects would accelerate the worldwide release of commercial RNAi-based approaches.

  8. Design and assembly of new non-viral RNAi delivery agents by microwave-assisted quaternization (MAQ) of tertiary amines

    PubMed Central

    Ghosh, Animesh; Mukherjee, Koushik; Jiang, Xinpeng; Zhou, Ying; McCarroll, Joshua; Qu, James; Swain, Pamela M.; Baigude, Huricha; Rana, Tariq M.

    2010-01-01

    RNA interference (RNAi), a gene-silencing phenomenon whereby double-stranded RNA (dsRNA) triggers the sequence-specific degradation of homologous mRNA. RNAi has been quickly and widely applied to discover gene functions and holds great potential to provide a new class of therapeutic agents. However, new chemistry and delivery approaches are greatly needed to silence disease-causing genes without toxic effects. We reasoned that conjugation of the cholesterol moiety to cationic lipids would enhance RNAi efficiencies and lower the toxic effects of lipid-mediated RNAi delivery. Here, we report the first design and synthesis of new cholesterol-conjugated cationic lipids for RNAi delivery using microwave-assisted quaternization (MAQ) of tertiary amines. This strategy can be employed to develop new classes of non-viral gene delivery agents under safe and fast reaction conditions. PMID:20722369

  9. Argonaute2 is the catalytic engine of mammalian RNAi.

    PubMed

    Liu, Jidong; Carmell, Michelle A; Rivas, Fabiola V; Marsden, Carolyn G; Thomson, J Michael; Song, Ji-Joon; Hammond, Scott M; Joshua-Tor, Leemor; Hannon, Gregory J

    2004-09-03

    Gene silencing through RNA interference (RNAi) is carried out by RISC, the RNA-induced silencing complex. RISC contains two signature components, small interfering RNAs (siRNAs) and Argonaute family proteins. Here, we show that the multiple Argonaute proteins present in mammals are both biologically and biochemically distinct, with a single mammalian family member, Argonaute2, being responsible for messenger RNA cleavage activity. This protein is essential for mouse development, and cells lacking Argonaute2 are unable to mount an experimental response to siRNAs. Mutations within a cryptic ribonuclease H domain within Argonaute2, as identified by comparison with the structure of an archeal Argonaute protein, inactivate RISC. Thus, our evidence supports a model in which Argonaute contributes "Slicer" activity to RISC, providing the catalytic engine for RNAi.

  10. Silencing of ATP11B by RNAi-Induced Changes in Neural Stem Cell Morphology.

    PubMed

    Wang, Jiao; Wang, Qian; Zhou, Fangfang; Wang, Dong; Wen, Tieqiao

    2017-01-01

    RNA interference (RNAi) technology is one of the main research tools in many studies of neural stem cells. This study describes effects of ATP11B on the morphology change of neural stem cells by using RNAi. ATP11B belongs to P4-ATPases family, which is preferential translocate phosphatidylserine of cell membrane. Although it exists in neural stem cells, its physiological function is poorly understood. By using RNAi technology to downregulate expression of ATP11B, we found distinct morphological changes in neural stem cells. More important, psiRNA-ATP11B-transfected cells displayed short neurite outgrowth compared to the control cells. These data strongly suggest that ATP11B plays a key role in the morphological change of neural stem cells.

  11. iScreen: Image-Based High-Content RNAi Screening Analysis Tools.

    PubMed

    Zhong, Rui; Dong, Xiaonan; Levine, Beth; Xie, Yang; Xiao, Guanghua

    2015-09-01

    High-throughput RNA interference (RNAi) screening has opened up a path to investigating functional genomics in a genome-wide pattern. However, such studies are often restricted to assays that have a single readout format. Recently, advanced image technologies have been coupled with high-throughput RNAi screening to develop high-content screening, in which one or more cell image(s), instead of a single readout, were generated from each well. This image-based high-content screening technology has led to genome-wide functional annotation in a wider spectrum of biological research studies, as well as in drug and target discovery, so that complex cellular phenotypes can be measured in a multiparametric format. Despite these advances, data analysis and visualization tools are still largely lacking for these types of experiments. Therefore, we developed iScreen (image-Based High-content RNAi Screening Analysis Tool), an R package for the statistical modeling and visualization of image-based high-content RNAi screening. Two case studies were used to demonstrate the capability and efficiency of the iScreen package. iScreen is available for download on CRAN (http://cran.cnr.berkeley.edu/web/packages/iScreen/index.html). The user manual is also available as a supplementary document. © 2014 Society for Laboratory Automation and Screening.

  12. Single-cell analysis of population context advances RNAi screening at multiple levels

    PubMed Central

    Snijder, Berend; Sacher, Raphael; Rämö, Pauli; Liberali, Prisca; Mench, Karin; Wolfrum, Nina; Burleigh, Laura; Scott, Cameron C; Verheije, Monique H; Mercer, Jason; Moese, Stefan; Heger, Thomas; Theusner, Kristina; Jurgeit, Andreas; Lamparter, David; Balistreri, Giuseppe; Schelhaas, Mario; De Haan, Cornelis A M; Marjomäki, Varpu; Hyypiä, Timo; Rottier, Peter J M; Sodeik, Beate; Marsh, Mark; Gruenberg, Jean; Amara, Ali; Greber, Urs; Helenius, Ari; Pelkmans, Lucas

    2012-01-01

    Isogenic cells in culture show strong variability, which arises from dynamic adaptations to the microenvironment of individual cells. Here we study the influence of the cell population context, which determines a single cell's microenvironment, in image-based RNAi screens. We developed a comprehensive computational approach that employs Bayesian and multivariate methods at the single-cell level. We applied these methods to 45 RNA interference screens of various sizes, including 7 druggable genome and 2 genome-wide screens, analysing 17 different mammalian virus infections and four related cell physiological processes. Analysing cell-based screens at this depth reveals widespread RNAi-induced changes in the population context of individual cells leading to indirect RNAi effects, as well as perturbations of cell-to-cell variability regulators. We find that accounting for indirect effects improves the consistency between siRNAs targeted against the same gene, and between replicate RNAi screens performed in different cell lines, in different labs, and with different siRNA libraries. In an era where large-scale RNAi screens are increasingly performed to reach a systems-level understanding of cellular processes, we show that this is often improved by analyses that account for and incorporate the single-cell microenvironment. PMID:22531119

  13. Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences.

    PubMed

    Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccas e 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like ( Sil1 ), scavenger receptor class C ( Src ), and scavenger receptor class B ( Srb3 and Srb4 ) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean.

  14. Functional Analysis of RNA Interference-Related Soybean Pod Borer (Lepidoptera) Genes Based on Transcriptome Sequences

    PubMed Central

    Meng, Fanli; Yang, Mingyu; Li, Yang; Li, Tianyu; Liu, Xinxin; Wang, Guoyue; Wang, Zhanchun; Jin, Xianhao; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) is useful for controlling pests of agriculturally important crops. The soybean pod borer (SPB) is the most important soybean pest in Northeastern Asia. In an earlier study, we confirmed that the SPB could be controlled via transgenic plant-mediated RNAi. Here, the SPB transcriptome was sequenced to identify RNAi-related genes, and also to establish an RNAi-of-RNAi assay system for evaluating genes involved in the SPB systemic RNAi response. The core RNAi genes, as well as genes potentially involved in double-stranded RNA (dsRNA) uptake were identified based on SPB transcriptome sequences. A phylogenetic analysis and the characterization of these core components as well as dsRNA uptake related genes revealed that they contain conserved domains essential for the RNAi pathway. The results of the RNAi-of-RNAi assay involving Laccase 2 (a critical cuticle pigmentation gene) as a marker showed that genes encoding the sid-like (Sil1), scavenger receptor class C (Src), and scavenger receptor class B (Srb3 and Srb4) proteins of the endocytic pathway were required for SPB cellular uptake of dsRNA. The SPB response was inferred to contain three functional small RNA pathways (i.e., miRNA, siRNA, and piRNA pathways). Additionally, the SPB systemic RNA response may rely on systemic RNA interference deficient transmembrane channel-mediated and receptor-mediated endocytic pathways. The results presented herein may be useful for developing RNAi-mediated methods to control SPB infestations in soybean. PMID:29773992

  15. Suppression of RNA Interference by Adenovirus Virus-Associated RNA†

    PubMed Central

    Andersson, M. Gunnar; Haasnoot, P. C. Joost; Xu, Ning; Berenjian, Saideh; Berkhout, Ben; Akusjärvi, Göran

    2005-01-01

    We show that human adenovirus inhibits RNA interference (RNAi) at late times of infection by suppressing the activity of two key enzyme systems involved, Dicer and RNA-induced silencing complex (RISC). To define the mechanisms by which adenovirus blocks RNAi, we used a panel of mutant adenoviruses defective in virus-associated (VA) RNA expression. The results show that the virus-associated RNAs, VA RNAI and VA RNAII, function as suppressors of RNAi by interfering with the activity of Dicer. The VA RNAs bind Dicer and function as competitive substrates squelching Dicer. Further, we show that VA RNAI and VA RNAII are processed by Dicer, both in vitro and during a lytic infection, and that the resulting short interfering RNAs (siRNAs) are incorporated into active RISC. Dicer cleaves the terminal stem of both VA RNAI and VA RNAII. However, whereas both strands of the VA RNAI-specific siRNA are incorporated into RISC, the 3′ strand of the VA RNAII-specific siRNA is selectively incorporated during a lytic infection. In summary, our work shows that adenovirus suppresses RNAi during a lytic infection and gives insight into the mechanisms of RNAi suppression by VA RNA. PMID:16014917

  16. Respiratory viral diseases: access to RNA interference therapy

    PubMed Central

    Bitko, Vira; Barik, Sailen

    2008-01-01

    This review summarizes recent experimental achievements in the area of the development of new RNA interference (RNAi) therapeutics for the treatment of viral respiratory diseases. Delivery of siRNA to their intended target tissue remains the biggest problem for most therapeutic applications of these compounds. Appropriate formulations and chemical modifications for improved stability will boost the probability of utilization of RNAi drugs in the clinical applications. PMID:19081824

  17. Gene Silencing in Insect Cells Using RNAi.

    PubMed

    Wu, Hsuan-Chen; March, John C; Bentley, William E

    2016-01-01

    A technique is described for synthesizing and transfecting double stranded RNA (dsRNA) for RNA interference (RNAi) in Sf-21 cell culture. Transfection with dsRNA only requires an hour and the cells usually recover within 12 h. Suggestions for designing dsRNA are included in the methods. Furthermore, websites are provided for rapid and effective dsRNA design. Three kits are essential for using the described methods: RNAqueous®-4PCR, Megascript™ T7 kit, and the Superscript™ III kit from Life Technologies, Inc.

  18. Human health and ecological risk assessments for SmartStax PRO (MON 89034 x TC1507 x MON 87411 x DAS-59122-7), a plant-incorporated protectant intended to control corn rootworm through ribonucleic acid (RNA) interference

    EPA Science Inventory

    The use of RNA interference (RNAi) gene silencing technology, particularly RNAi for pesticidal purposes to control macroorganism pests, is a relatively recent innovation. Post-transcriptional silencing of gene function is a very rapid process where double-stranded RNA (dsRNA) dir...

  19. Soaking RNAi in Bombyx mori BmN4-SID1 Cells Arrests Cell Cycle Progression

    PubMed Central

    Mon, Hiroaki; Li, Zhiqing; Kobayashi, Isao; Tomita, Shuichiro; Lee, JaeMan; Sezutsu, Hideki; Tamura, Toshiki; Kusakabe, Takahiro

    2013-01-01

    RNA interference (RNAi) is an evolutionarily conserved mechanism for sequence-specific gene silencing. Previously, the BmN4-SID1 cell expressing Caenorhabditis ele gans SID-1 was established, in which soaking RNAi could induce effective gene silencing. To establish its utility, 6 cell cycle progression related cDNAs, CDK1, MYC, MYB, RNRS, CDT1, and GEMININ, were isolated from the silkworm, Bombyx mori L. (Lepidoptera: Bombycidae), and their expressions were further silenced by soaking RNAi in the BmN4-SID1 cells. The cell cycle progression analysis using flow cytometer demonstrated that the small amount of double stranded RNA was enough to arrest cell cycle progression at the specific cell phases. These data suggest that RNAi in the BmN4-SID1 cells can be used as a powerful tool for loss-of-function analysis of B. mori genes. PMID:24773378

  20. Photoinduced RNA interference.

    PubMed

    Matsushita-Ishiodori, Yuka; Ohtsuki, Takashi

    2012-07-17

    Because RNA interference (RNAi) can be applied to any gene, this technique has been widely used for studying gene functions. In addition, many researchers are attempting to use RNAi technology in RNAi-based therapies. However, several challenging and controversial issues have arisen during the widespread application of RNAi including target gene specificity, target cell specificity, and spatiotemporal control of gene silencing. To address these issues, several groups have utilized photochemistry to control the RNA release, both spatially and temporally. In this Account, we focus on recent studies using photocleavable protecting groups, photosensitizers, Hand gold nanoparticles for photoinduced RNAi. In 2005 the first report of photoinduced RNAi used a caged short interfering RNA (siRNA), an siRNA carrying a photocleavable protecting group. Caging groups block the bioactivities of target molecules, but allow for complete recovery of these functions via photoactivation. However, some RNAi activity can occur in these caged siRNAs, so it will be necessary to decrease this "leakage" and raise the RNAi activity restored after irradiation. This technique also uses UV light around 350 nm, which is cytotoxic, but in the near future we expect that it will be possible to use visible and near-infrared light We also examine the application of photochemical internalization (PCI) to RNAi technology, which involves a combination of photosensitizers and light. Instead of inducing RNAi using light, the strategy behind this method was to enhance RNAi using RNA carriers. Many wellknown RNA carriers deliver siRNAs into cells by endocytosis. The siRNAs are trapped in endocytic vesicles and have to be released into the cytoplasm in order to express their activity. To achieve the endosomal escape of siRNAs, PCI technology employed photosensitizers to generate light-dependent reactive oxygen species (ROS) that disrupted the endocytic vesicles. In most studies, RNAi-mediated knockdown of

  1. Core RNAi machinery and gene knockdown in the emerald ash borer (Agrilus planipennis)

    Treesearch

    Chaoyang Zhao; Miguel A. Alvarez Gonzales; Therese M. Poland; Omprakash Mittapalli

    2015-01-01

    The RNA interference (RNAi) technology has been widely used in insect functional genomics research and provides an alternative approach for insect pest management. To understand whether the emerald ash borer (Agrilus planipennis), an invasive and destructive coleopteran insect pest of ash tree (Fraxinus spp.), possesses a strong...

  2. Molecular mechanisms influencing efficiency of RNA interference in insects.

    PubMed

    Cooper, Anastasia M W; Silver, Kristopher; Jianzhen, Zhang; Park, Yoonseong; Zhu, Kun Yan

    2018-06-21

    RNA interference (RNAi) is an endogenous, sequence-specific gene silencing mechanism elicited by small RNA molecules. RNAi is a powerful reverse genetic tool, and is currently being utilized for managing insects and viruses. Widespread implementation of RNAi-based pest management strategies is currently hindered by inefficient and highly variable results when different insect species, strains, developmental stages, tissues, and genes are targeted. Mechanistic studies have shown that double-stranded ribonucleases (dsRNases), endosomal entrapment, deficient function of the core machinery, and inadequate immune stimulation contribute to limited RNAi efficiency. However, a comprehensive understanding of the molecular mechanisms limiting RNAi efficiency remains elusive. The recent advances in dsRNA stability in physiological tissues, dsRNA internalization into cells, the composition and function of the core RNAi machinery, as well as small-interfering RNA/double-stranded RNA amplification and spreading mechanisms are reviewed to establish a global understanding of the obstacles impeding wider understanding of RNAi mechanisms in insects. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  3. Core RNAi machinery and gene knockdown in the emerald ash borer (Agrilus planipennis).

    PubMed

    Zhao, Chaoyang; Alvarez Gonzales, Miguel A; Poland, Therese M; Mittapalli, Omprakash

    2015-01-01

    The RNA interference (RNAi) technology has been widely used in insect functional genomics research and provides an alternative approach for insect pest management. To understand whether the emerald ash borer (Agrilus planipennis), an invasive and destructive coleopteran insect pest of ash tree (Fraxinus spp.), possesses a strong RNAi machinery that is capable of degrading target mRNA as a response to exogenous double-stranded RNA (dsRNA) induction, we identified three RNAi pathway core component genes, Dicer-2, Argonaute-2 and R2D2, from the A. planipennis genome sequence. Characterization of these core components revealed that they contain conserved domains essential for the proteins to function in the RNAi pathway. Phylogenetic analyses showed that they are closely related to homologs derived from other coleopteran species. We also delivered the dsRNA fragment of AplaScrB-2, a β-fructofuranosidase-encoding gene horizontally acquired by A. planipennis as we reported previously, into A. planipennis adults through microinjection. Quantitative real-time PCR analysis on the dsRNA-treated beetles demonstrated a significantly decreased gene expression level of AplaScrB-2 appearing on day 2 and lasting until at least day 6. This study is the first record of RNAi applied in A. planipennis. Copyright © 2015 Elsevier Ltd. All rights reserved.

  4. Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics.

    PubMed

    Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A; Ji, Lin

    2017-07-18

    RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo.

  5. Cationic liquid crystalline nanoparticles for the delivery of synthetic RNAi-based therapeutics

    PubMed Central

    Gentile, Emanuela; Oba, Taro; Lin, Jing; Shao, Ruping; Meng, Feng; Cao, Xiaobo; Lin, Heather Y.; Mourad, Majidi; Pataer, Apar; Baladandayuthapani, Veerabhadran; Cai, Dong; Roth, Jack A.; Ji, Lin

    2017-01-01

    RNA interference (RNAi)-based therapeutics have been used to silence the expression of targeted pathological genes. Small interfering RNA (siRNAs) and microRNA (miRNAs) inhibitor have performed this function. However, short half-life, poor cellular uptake, and nonspecific distribution of small RNAs call for the development of novel delivery systems to facilitate the use of RNAi. We developed a novel cationic liquid crystalline nanoparticle (CLCN) to efficiently deliver synthetic siRNAs and miRNAs. CLCNs were prepared by using high-speed homogenization and assembled with synthetic siRNA or miRNA molecules in nuclease-free water to create CLCN/siRNA or miRNA complexes. The homogeneous and stable CLCNs and CLCN-siRNA complexes were about 100 nm in diameter, with positively charged surfaces. CLCNs are nontoxic and are taken up by human cells though endocytosis. Significant inhibition of gene expression was detected in transiently transfected lung cancer H1299 cells treated with CLCNs/anti-GFP complexes 24 hours after transfection. Biodistribution analysis showed that the CLCNs and CLCNs-RNAi complexes were successfully delivered to various organs and into the subcutaneous human lung cancer H1299 tumor xenografts in mice 24 hours after systemic administration. These results suggest that CLCNs are a unique and advanced delivery system capable of protecting RNAi from degradation and of efficiently delivering RNAi in vitro and in vivo. PMID:28637023

  6. A Perspective on the Future of High-Throughput RNAi Screening: Will CRISPR Cut Out the Competition or Can RNAi Help Guide the Way?

    PubMed

    Taylor, Jessica; Woodcock, Simon

    2015-09-01

    For more than a decade, RNA interference (RNAi) has brought about an entirely new approach to functional genomics screening. Enabling high-throughput loss-of-function (LOF) screens against the human genome, identifying new drug targets, and significantly advancing experimental biology, RNAi is a fast, flexible technology that is compatible with existing high-throughput systems and processes; however, the recent advent of clustered regularly interspaced palindromic repeats (CRISPR)-Cas, a powerful new precise genome-editing (PGE) technology, has opened up vast possibilities for functional genomics. CRISPR-Cas is novel in its simplicity: one piece of easily engineered guide RNA (gRNA) is used to target a gene sequence, and Cas9 expression is required in the cells. The targeted double-strand break introduced by the gRNA-Cas9 complex is highly effective at removing gene expression compared to RNAi. Together with the reduced cost and complexity of CRISPR-Cas, there is the realistic opportunity to use PGE to screen for phenotypic effects in a total gene knockout background. This review summarizes the exciting development of CRISPR-Cas as a high-throughput screening tool, comparing its future potential to that of well-established RNAi screening techniques, and highlighting future challenges and opportunities within these disciplines. We conclude that the two technologies actually complement rather than compete with each other, enabling greater understanding of the genome in relation to drug discovery. © 2015 Society for Laboratory Automation and Screening.

  7. Structurally flexible triethanolamine-core poly(amidoamine) dendrimers as effective nanovectors to deliver RNAi-based therapeutics.

    PubMed

    Liu, Xiaoxuan; Liu, Cheng; Catapano, Carlo V; Peng, Ling; Zhou, Jiehua; Rocchi, Palma

    2014-01-01

    RNAi-based nucleic acid molecules have attracted considerable attention as compelling therapeutics providing safe and competent delivery systems are available. Dendrimers are emerging as appealing nanocarriers for nucleic acid delivery thanks to their unique well-defined architecture and the resulting cooperativity and multivalency confined within a nanostructure. The present review offers a brief overview of the structurally flexible triethanolamine-core poly(amidoamine) (PAMAM) dendrimers developed in our group as nanovectors for the delivery of RNAi therapeutics. Their excellent activity for delivering different RNAi therapeutics in various disease models in vitro and in vivo will be highlighted here. © 2013.

  8. Biosafety research for non-target organism risk assessment of RNAi-based GE plants

    PubMed Central

    Roberts, Andrew F.; Devos, Yann; Lemgo, Godwin N. Y.; Zhou, Xuguo

    2015-01-01

    RNA interference, or RNAi, refers to a set of biological processes that make use of conserved cellular machinery to silence genes. Although there are several variations in the source and mechanism, they are all triggered by double stranded RNA (dsRNA) which is processed by a protein complex into small, single stranded RNA, referred to as small interfering RNAs (siRNA) with complementarity to sequences in genes targeted for silencing. The use of the RNAi mechanism to develop new traits in plants has fueled a discussion about the environmental safety of the technology for these applications, and this was the subject of a symposium session at the 13th ISBGMO in Cape Town, South Africa. This paper continues that discussion by proposing research areas that may be beneficial for future environmental risk assessments of RNAi-based genetically modified plants, with a particular focus on non-target organism assessment. PMID:26594220

  9. Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference

    PubMed Central

    Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

    2015-01-01

    RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells. PMID:25731667

  10. Endocytic pathway mediates refractoriness of insect Bactrocera dorsalis to RNA interference.

    PubMed

    Li, Xiaoxue; Dong, Xiaolong; Zou, Cong; Zhang, Hongyu

    2015-03-03

    RNA interference (RNAi) is a powerful and convenient tool for sequence-specific gene silencing, and it is triggered by double-stranded RNA (dsRNA). RNAi can be easily achieved in many eukaryotes by either injecting or feeding dsRNAs. This mechanism has demonstrated its potential in fundamental research on genetics, medicine and agriculture. However, the possibility that insects might develop refractoriness to RNAi remains unexplored. In this study, we report that the oriental fruit fly, Bactrocera dorsalis, became refractory to RNAi using orally administered dsRNA targeting endogenous genes. Furthermore, refractoriness to RNAi is not gene-specific, and its duration depends on the dsRNA concentration. RNAi blockage requires the endocytic pathway. Fluorescence microscopy indicated that in RNAi refractory flies, dsRNA uptake is blocked. Genes involved in the entry of dsRNAs into cells, including chc, cog3, light and others, are down-regulated in RNAi refractory flies. Increasing the endocytic capacity by improving F-actin polymerization disrupts RNAi refractoriness after both primary and secondary dsRNA exposures. Our results demonstrate that an insect can become refractory to RNAi by preventing the entry of dsRNA into its cells.

  11. Affinity approaches in RNAi-based therapeutics purification.

    PubMed

    Pereira, Patrícia; Queiroz, João A; Figueiras, Ana; Sousa, Fani

    2016-05-15

    The recent investigation on RNA interference (RNAi) related mechanisms and applications led to an increased awareness of the importance of RNA in biology. Nowadays, RNAi-based technology has emerged as a potentially powerful tool for silencing gene expression, being exploited to develop new therapeutics for treating a vast number of human disease conditions, as it is expected that this technology can be translated onto clinical applications in a near future. This approach makes use of a large number of small (namely short interfering RNAs, microRNAs and PIWI-interacting RNAs) and long non-coding RNAs (ncRNAs), which are likely to have a crucial role as the next generation therapeutics. The commercial and biomedical interest in these RNAi-based therapy applications have fostered the need to develop innovative procedures to easily and efficiently purify RNA, aiming to obtain the final product with high purity degree, good quality and biological activity. Recently, affinity chromatography has been applied to ncRNAs purification, in view of the high specificity. Therefore, this article intends to review the biogenesis pathways of regulatory ncRNAs and also to discuss the most significant and recent developments as well as applications of affinity chromatography in the challenging task of purifying ncRNAs. In addition, the importance of affinity chromatography in ncRNAs purification is addressed and prospects for what is forthcoming are presented. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Induction of RNA interference in dendritic cells.

    PubMed

    Li, Mu; Qian, Hua; Ichim, Thomas E; Ge, Wei-Wen; Popov, Igor A; Rycerz, Katarzyna; Neu, John; White, David; Zhong, Robert; Min, Wei-Ping

    2004-01-01

    Dendritic cells (DC) reside at the center of the immunological universe, possessing the ability both to stimulate and inhibit various types of responses. Tolerogenic/regulatory DC with therapeutic properties can be generated through various means of manipulations in vitro and in vivo. Here we describe several attractive strategies for manipulation of DC using the novel technique of RNA interference (RNAi). Additionally, we overview some of our data regarding yet undescribed characteristics of RNAi in DC such as specific transfection strategies, persistence of gene silencing, and multi-gene silencing. The advantages of using RNAi for DC genetic manipulation gives rise to the promise of generating tailor-made DC that can be used effectively to treat a variety of immunologically mediated diseases.

  13. Novel Drosophila Viruses Encode Host-Specific Suppressors of RNAi

    PubMed Central

    van Mierlo, Joël T.; Overheul, Gijs J.; Obadia, Benjamin; van Cleef, Koen W. R.; Webster, Claire L.; Saleh, Maria-Carla; Obbard, Darren J.; van Rij, Ronald P.

    2014-01-01

    The ongoing conflict between viruses and their hosts can drive the co-evolution between host immune genes and viral suppressors of immunity. It has been suggested that an evolutionary ‘arms race’ may occur between rapidly evolving components of the antiviral RNAi pathway of Drosophila and viral genes that antagonize it. We have recently shown that viral protein 1 (VP1) of Drosophila melanogaster Nora virus (DmelNV) suppresses Argonaute-2 (AGO2)-mediated target RNA cleavage (slicer activity) to antagonize antiviral RNAi. Here we show that viral AGO2 antagonists of divergent Nora-like viruses can have host specific activities. We have identified novel Nora-like viruses in wild-caught populations of D. immigrans (DimmNV) and D. subobscura (DsubNV) that are 36% and 26% divergent from DmelNV at the amino acid level. We show that DimmNV and DsubNV VP1 are unable to suppress RNAi in D. melanogaster S2 cells, whereas DmelNV VP1 potently suppresses RNAi in this host species. Moreover, we show that the RNAi suppressor activity of DimmNV VP1 is restricted to its natural host species, D. immigrans. Specifically, we find that DimmNV VP1 interacts with D. immigrans AGO2, but not with D. melanogaster AGO2, and that it suppresses slicer activity in embryo lysates from D. immigrans, but not in lysates from D. melanogaster. This species-specific interaction is reflected in the ability of DimmNV VP1 to enhance RNA production by a recombinant Sindbis virus in a host-specific manner. Our results emphasize the importance of analyzing viral RNAi suppressor activity in the relevant host species. We suggest that rapid co-evolution between RNA viruses and their hosts may result in host species-specific activities of RNAi suppressor proteins, and therefore that viral RNAi suppressors could be host-specificity factors. PMID:25032815

  14. FlyRNAi.org—the database of the Drosophila RNAi screening center and transgenic RNAi project: 2017 update

    PubMed Central

    Hu, Yanhui; Comjean, Aram; Roesel, Charles; Vinayagam, Arunachalam; Flockhart, Ian; Zirin, Jonathan; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

    2017-01-01

    The FlyRNAi database of the Drosophila RNAi Screening Center (DRSC) and Transgenic RNAi Project (TRiP) at Harvard Medical School and associated DRSC/TRiP Functional Genomics Resources website (http://fgr.hms.harvard.edu) serve as a reagent production tracking system, screen data repository, and portal to the community. Through this portal, we make available protocols, online tools, and other resources useful to researchers at all stages of high-throughput functional genomics screening, from assay design and reagent identification to data analysis and interpretation. In this update, we describe recent changes and additions to our website, database and suite of online tools. Recent changes reflect a shift in our focus from a single technology (RNAi) and model species (Drosophila) to the application of additional technologies (e.g. CRISPR) and support of integrated, cross-species approaches to uncovering gene function using functional genomics and other approaches. PMID:27924039

  15. Prokaryotic Argonautes - variations on the RNA interference theme.

    PubMed

    van der Oost, John; Swarts, Daan C; Jore, Matthijs M

    2014-04-15

    The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes.

  16. Prokaryotic Argonautes - variations on the RNA interference theme

    PubMed Central

    van der Oost, John; Swarts, Daan C.; Jore, Matthijs M.

    2014-01-01

    The discovery of RNA interference (RNAi) has been a major scientific breakthrough. This RNA-guided RNA interference system plays a crucial role in a wide range of regulatory and defense mechanisms in eukaryotes. The key enzyme of the RNAi system is Argonaute (Ago), an endo-ribonuclease that uses a small RNA guide molecule to specifically target a complementary RNA transcript. Two functional classes of eukaryotic Ago have been described: catalytically active Ago that cleaves RNA targets complementary to its guide, and inactive Ago that uses its guide to bind target RNA to down-regulate translation efficiency. A recent comparative genomics study has revealed that Argonaute-like proteins are also encoded by prokaryotic genomes. Interestingly, there is a lot of variation among these prokaryotic Argonaute (pAgo) proteins with respect to domain architecture: some resemble the eukaryotic Ago (long pAgo) containing a complete or disrupted catalytic site, while others are truncated versions (short pAgo) that generally contain an incomplete catalytic site. Prokaryotic Agos with an incomplete catalytic site often co-occur with (predicted) nucleases. Based on this diversity, and on the fact that homologs of other RNAi-related protein components (such as Dicer nucleases) have never been identified in prokaryotes, it has been predicted that variations on the eukaryotic RNAi theme may occur in prokaryotes. PMID:28357239

  17. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.)

    PubMed Central

    Abdurakhmonov, Ibrokhim Y.; Ayubov, Mirzakamol S.; Ubaydullaeva, Khurshida A.; Buriev, Zabardast T.; Shermatov, Shukhrat E.; Ruziboev, Haydarali S.; Shapulatov, Umid M.; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z.; Percy, Richard G.; Devor, Eric J.; Sharma, Govind C.; Sripathi, Venkateswara R.; Kumpatla, Siva P.; van der Krol, Alexander; Kater, Hake D.; Khamidov, Khakimdjan; Salikhov, Shavkat I.; Jenkins, Johnie N.; Abdukarimov, Abdusattor; Pepper, Alan E.

    2016-01-01

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization. PMID:26941765

  18. RNA Interference for Functional Genomics and Improvement of Cotton (Gossypium sp.).

    PubMed

    Abdurakhmonov, Ibrokhim Y; Ayubov, Mirzakamol S; Ubaydullaeva, Khurshida A; Buriev, Zabardast T; Shermatov, Shukhrat E; Ruziboev, Haydarali S; Shapulatov, Umid M; Saha, Sukumar; Ulloa, Mauricio; Yu, John Z; Percy, Richard G; Devor, Eric J; Sharma, Govind C; Sripathi, Venkateswara R; Kumpatla, Siva P; van der Krol, Alexander; Kater, Hake D; Khamidov, Khakimdjan; Salikhov, Shavkat I; Jenkins, Johnie N; Abdukarimov, Abdusattor; Pepper, Alan E

    2016-01-01

    RNA interference (RNAi), is a powerful new technology in the discovery of genetic sequence functions, and has become a valuable tool for functional genomics of cotton (Gossypium sp.). The rapid adoption of RNAi has replaced previous antisense technology. RNAi has aided in the discovery of function and biological roles of many key cotton genes involved in fiber development, fertility and somatic embryogenesis, resistance to important biotic and abiotic stresses, and oil and seed quality improvements as well as the key agronomic traits including yield and maturity. Here, we have comparatively reviewed seminal research efforts in previously used antisense approaches and currently applied breakthrough RNAi studies in cotton, analyzing developed RNAi methodologies, achievements, limitations, and future needs in functional characterizations of cotton genes. We also highlighted needed efforts in the development of RNAi-based cotton cultivars, and their safety and risk assessment, small and large-scale field trials, and commercialization.

  19. RNA interference-based therapeutics for inherited long QT syndrome.

    PubMed

    Li, Guoliang; Ma, Shuting; Sun, Chaofeng

    2015-08-01

    Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved.

  20. RNA interference-based therapeutics for inherited long QT syndrome

    PubMed Central

    LI, GUOLIANG; MA, SHUTING; SUN, CHAOFENG

    2015-01-01

    Inherited long QT syndrome (LQTS) is an electrical heart disorder that manifests with syncope, seizures, and increased risk of torsades de pointes and sudden cardiac death. Dominant-negative current suppression is a mechanism by which pathogenic proteins disrupt the function of ion channels in inherited LQTS. However, current approaches for the management of inherited LQTS are inadequate. RNA interference (RNAi) is a powerful technique that is able to suppress or silence the expression of mutant genes. RNAi may be harnessed to knock out mRNAs that code for toxic proteins, and has been increasingly recognized as a potential therapeutic intervention for a range of conditions. The present study reviews the literature for RNAi-based therapeutics in the treatment of inherited LQTS. Furthermore, this review discusses the combined use of RNAi with the emerging technology of induced pluripotent stem cells for the treatment of inherited LQTS. In addition, key challenges that must be overcome prior to RNAi-based therapies becoming clinically applicable are addressed. In summary, RNAi-based therapy is potentially a powerful therapeutic intervention, although a number of difficulties remain unresolved. PMID:26622327

  1. Genome-wide RNAi Screening to Identify Host Factors That Modulate Oncolytic Virus Therapy.

    PubMed

    Allan, Kristina J; Mahoney, Douglas J; Baird, Stephen D; Lefebvre, Charles A; Stojdl, David F

    2018-04-03

    High-throughput genome-wide RNAi (RNA interference) screening technology has been widely used for discovering host factors that impact virus replication. Here we present the application of this technology to uncovering host targets that specifically modulate the replication of Maraba virus, an oncolytic rhabdovirus, and vaccinia virus with the goal of enhancing therapy. While the protocol has been tested for use with oncolytic Maraba virus and oncolytic vaccinia virus, this approach is applicable to other oncolytic viruses and can also be utilized for identifying host targets that modulate virus replication in mammalian cells in general. This protocol describes the development and validation of an assay for high-throughput RNAi screening in mammalian cells, the key considerations and preparation steps important for conducting a primary high-throughput RNAi screen, and a step-by-step guide for conducting a primary high-throughput RNAi screen; in addition, it broadly outlines the methods for conducting secondary screen validation and tertiary validation studies. The benefit of high-throughput RNAi screening is that it allows one to catalogue, in an extensive and unbiased fashion, host factors that modulate any aspect of virus replication for which one can develop an in vitro assay such as infectivity, burst size, and cytotoxicity. It has the power to uncover biotherapeutic targets unforeseen based on current knowledge.

  2. Combined lentiviral and RNAi technologies for the delivery and permanent silencing of the hsp25 gene.

    PubMed

    Kaur, Punit; Nagaraja, Ganachari M; Asea, Alexzander

    2011-01-01

    Elevated heat shock protein 27 (Hsp27) expression has been found in a number of tumors, including breast, prostate, gastric, uterine, ovarian, head and neck, and tumor arising from the nervous system and urinary system, and determined to be a predictor of poor clinical outcome. Although the mechanism of action of Hsp27 has been well documented, there are currently no available inhibitors of Hsp27 in clinical trials. RNA interference (RNAi) has the potential to offer more specificity and flexibility than traditional drugs to silence gene expression. Not surprisingly, RNAi has become a major focus for biotechnology and pharmaceutical companies, which are now in the early stages of developing RNAi therapeutics, mostly based on short interfering RNA (siRNAs), to target viral infection, cancer, hypercholesterolemia, cardiovascular disease, macular degeneration, and neurodegenerative diseases. However, the critical issues associated with RNAi as a therapeutic are delivery, specificity, and stability of the RNAi reagents. To date, the delivery is currently considered the biggest hurdle, as the introduction of siRNAs systemically into body fluids can result in their degradation, off-target effects, and immune detection. In this chapter, we discuss a method of combined lentiviral and RNAi-based technology for the delivery and permanent silencing of the hsp25 gene.

  3. Tumor-specific RNA interference targeting Pokemon suppresses tumor growth and induces apoptosis in prostate cancer.

    PubMed

    Li, Yining; Xu, Shuxiong; Wang, Xiangwei; Shi, Hua; Sun, Zhaolin; Yang, Zhao

    2013-02-01

    To explore the exact mechanism of Pokemon in prostate cancer. Pokemon is a member of the POK family of transcriptional repressors. Its main function is suppression of the p14ARF (alternate reading frame) tumor suppressor gene. Although Pokemon expression has been found to be increased in various types of lymphoma, the exact mechanism of the gene in prostate cancer is not clear. In the present study, prostate cancer cells were transfected with the specific short hairpin ribonucleic acid (RNA) expression vector targeting Pokemon. The expression of Pokemon messenger RNA and its protein was detected by semiquantitative reverse transcriptase-polymerase chain reaction and Western blotting, respectively. The cell growth and cell apoptosis were also examined using the methyl thiazolyl tetrazolium assay and flow cytometry. The results demonstrated that specific RNA interference (RNAi) could decrease the expression levels of Pokemon gene messenger RNA and protein in prostate cancer cells. In addition, that specific RNAi significantly inhibited the cell proliferation and increased the apoptotic rate. In vivo experiments showed that specific RNAi inhibited the tumorigenicity of prostate cancer cells and significantly suppressed tumor growth. Therefore, an RNAi-targeted Pokemon gene strategy could be a potential approach to prostate cancer therapy. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. Symbiont-mediated RNA interference in insects

    PubMed Central

    Whitten, Miranda M. A.; Facey, Paul D.; Del Sol, Ricardo; Fernández-Martínez, Lorena T.; Evans, Meirwyn C.; Mitchell, Jacob J.; Bodger, Owen G.

    2016-01-01

    RNA interference (RNAi) methods for insects are often limited by problems with double-stranded (ds) RNA delivery, which restricts reverse genetics studies and the development of RNAi-based biocides. We therefore delegated to insect symbiotic bacteria the task of: (i) constitutive dsRNA synthesis and (ii) trauma-free delivery. RNaseIII-deficient, dsRNA-expressing bacterial strains were created from the symbionts of two very diverse pest species: a long-lived blood-sucking bug, Rhodnius prolixus, and a short-lived globally invasive polyphagous agricultural pest, western flower thrips (Frankliniella occidentalis). When ingested, the manipulated bacteria colonized the insects, successfully competed with the wild-type microflora, and sustainably mediated systemic knockdown phenotypes that were horizontally transmissible. This represents a significant advance in the ability to deliver RNAi, potentially to a large range of non-model insects. PMID:26911963

  5. Identifying Breast Tumor Suppressors Using in Vitro and in Vivo RNAi Screens

    DTIC Science & Technology

    2011-10-01

    vivo RNA interference screen, breast cancer , tumor suppressor, leukemia inhibitory factor receptor (LIFR) 16. SECURITY CLASSIFICATION OF: 17...The identification of these genes will improve the understanding of the causes of breast cancer , which may lead to therapeutic advancements for... breast cancer prevention and treatment. BODY Objective 1: Identification of breast tumor suppressors using in vitro and in vivo RNAi screens

  6. Functional analysis of pathogenicity proteins of the potato cyst nematode Globodera rostochiensis using RNAi.

    PubMed

    Chen, Qing; Rehman, S; Smant, G; Jones, John T

    2005-07-01

    RNA interference (RNAi) has been used widely as a tool for examining gene function and a method that allows its use with plant-parasitic nematodes recently has been described. Here, we use a modified method to analyze the function of secreted beta-1,4, endoglucanases of the potato cyst nematode Globodera rostochiensis, the first in vivo functional analysis of a pathogenicity protein of a plant-parasitic nematode. Knockout of the beta-1,4, endoglucanases reduced the ability of the nematodes to invade roots. We also use RNAi to show that gr-ams-1, a secreted protein of the main sense organs (the amphids), is essential for host location.

  7. The insect ecdysone receptor is a good potential target for RNAi-based pest control.

    PubMed

    Yu, Rong; Xu, Xinping; Liang, Yongkang; Tian, Honggang; Pan, Zhanqing; Jin, Shouheng; Wang, Na; Zhang, Wenqing

    2014-01-01

    RNA interference (RNAi) has great potential for use in insect pest control. However, some significant challenges must be overcome before RNAi-based pest control can become a reality. One challenge is the proper selection of a good target gene for RNAi. Here, we report that the insect ecdysone receptor (EcR) is a good potential target for RNAi-based pest control in the brown planthopper Nilaparvata lugens, a serious insect pest of rice plants. We demonstrated that the use of a 360 bp fragment (NlEcR-c) that is common between NlEcR-A and NlEcR-B for feeding RNAi experiments significantly decreased the relative mRNA expression levels of NlEcR compared with those in the dsGFP control. Feeding RNAi also resulted in a significant reduction in the number of offspring per pair of N. lugens. Consequently, a transgenic rice line expressing NlEcR dsRNA was constructed by Agrobacterium- mediated transformation. The results of qRT-PCR showed that the total copy number of the target gene in all transgenic rice lines was 2. Northern blot analysis showed that the small RNA of the hairpin dsNlEcR-c was successfully expressed in the transgenic rice lines. After newly hatched nymphs of N. lugens fed on the transgenic rice lines, effective RNAi was observed. The NlEcR expression levels in all lines examined were decreased significantly compared with the control. In all lines, the survival rate of the nymphs was nearly 90%, and the average number of offspring per pair in the treated groups was significantly less than that observed in the control, with a decrease of 44.18-66.27%. These findings support an RNAi-based pest control strategy and are also important for the management of rice insect pests.

  8. The FLIGHT Drosophila RNAi database

    PubMed Central

    Bursteinas, Borisas; Jain, Ekta; Gao, Qiong; Baum, Buzz; Zvelebil, Marketa

    2010-01-01

    FLIGHT (http://flight.icr.ac.uk/) is an online resource compiling data from high-throughput Drosophila in vivo and in vitro RNAi screens. FLIGHT includes details of RNAi reagents and their predicted off-target effects, alongside RNAi screen hits, scores and phenotypes, including images from high-content screens. The latest release of FLIGHT is designed to enable users to upload, analyze, integrate and share their own RNAi screens. Users can perform multiple normalizations, view quality control plots, detect and assign screen hits and compare hits from multiple screens using a variety of methods including hierarchical clustering. FLIGHT integrates RNAi screen data with microarray gene expression as well as genomic annotations and genetic/physical interaction datasets to provide a single interface for RNAi screen analysis and datamining in Drosophila. PMID:20855970

  9. New insights into siRNA amplification and RNAi

    PubMed Central

    Zhang, Chi; Ruvkun, Gary

    2012-01-01

    In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes. PMID:22858672

  10. New insights into siRNA amplification and RNAi.

    PubMed

    Zhang, Chi; Ruvkun, Gary

    2012-08-01

    In the nematode Caenorhabditis elegans (C. elegans), gene inactivation by RNA interference can achieve remarkable potency due to the amplification of initial silencing triggers by RNA-dependent RNA polymerases (RdRPs). RdRPs catalyze the biogenesis of an abundant species of secondary small interfering RNAs (siRNAs) using the target mRNA as template. The interaction between primary siRNAs derived from the exogenous double-stranded RNA (dsRNA) trigger and the target mRNA is required for the recruitment of RdRPs. Other genetic requirements for RdRP activities have not been characterized. Recent studies have identified the RDE-10/RDE-11 complex which interacts with the primary siRNA bound target mRNA and acts upstream of the RdRPs. rde-10 and rde-11 mutants show an RNAi defective phenotype because the biogenesis of secondary siRNAs is completely abolished. In addition, the RDE-10/RDE-11 complex plays a similar role in the endogenous RNAi pathway for the biogenesis of a subset of siRNAs targeting recently acquired, duplicated genes.

  11. RNAi-dependent and -independent antiviral phenotypes of chromosomally integrated shRNA clones: role of VASP in respiratory syncytial virus growth.

    PubMed

    Musiyenko, Alla; Bitko, Vira; Barik, Sailen

    2007-07-01

    Stable RNA interference (RNAi) is commonly achieved by recombinant expression of short hairpin RNA (shRNA). To generate virus-resistant cell lines, we cloned a shRNA cassette against the phosphoprotein gene of respiratory syncytial virus (RSV) into a polIII-driven plasmid vector. Analysis of individual stable transfectants showed a spectrum of RSV resistance correlating with the levels of shRNA expressed from different chromosomal locations. Interestingly, resistance in a minority of clones was due to mono-allelic disruption of the cellular gene for vasodilator-stimulated phosphoprotein (VASP). Thus, pure clones of chromosomally integrated DNA-directed RNAi can exhibit gene disruption phenotypes resembling but unrelated to RNAi.

  12. A forward genetic screen reveals essential and non-essential RNAi factors in Paramecium tetraurelia

    PubMed Central

    Marker, Simone; Carradec, Quentin; Tanty, Véronique; Arnaiz, Olivier; Meyer, Eric

    2014-01-01

    In most eukaryotes, small RNA-mediated gene silencing pathways form complex interacting networks. In the ciliate Paramecium tetraurelia, at least two RNA interference (RNAi) mechanisms coexist, involving distinct but overlapping sets of protein factors and producing different types of short interfering RNAs (siRNAs). One is specifically triggered by high-copy transgenes, and the other by feeding cells with double-stranded RNA (dsRNA)-producing bacteria. In this study, we designed a forward genetic screen for mutants deficient in dsRNA-induced silencing, and a powerful method to identify the relevant mutations by whole-genome sequencing. We present a set of 47 mutant alleles for five genes, revealing two previously unknown RNAi factors: a novel Paramecium-specific protein (Pds1) and a Cid1-like nucleotidyl transferase. Analyses of allelic diversity distinguish non-essential and essential genes and suggest that the screen is saturated for non-essential, single-copy genes. We show that non-essential genes are specifically involved in dsRNA-induced RNAi while essential ones are also involved in transgene-induced RNAi. One of the latter, the RNA-dependent RNA polymerase RDR2, is further shown to be required for all known types of siRNAs, as well as for sexual reproduction. These results open the way for the dissection of the genetic complexity, interconnection, mechanisms and natural functions of RNAi pathways in P. tetraurelia. PMID:24860163

  13. Key enzymes and proteins of crop insects as candidate for RNAi based gene silencing

    PubMed Central

    Kola, Vijaya Sudhakara Rao; Renuka, P.; Madhav, Maganti Sheshu; Mangrauthia, Satendra K.

    2015-01-01

    RNA interference (RNAi) is a mechanism of homology dependent gene silencing present in plants and animals. It operates through 21–24 nucleotides small RNAs which are processed through a set of core enzymatic machinery that involves Dicer and Argonaute proteins. In recent past, the technology has been well appreciated toward the control of plant pathogens and insects through suppression of key genes/proteins of infecting organisms. The genes encoding key enzymes/proteins with the great potential for developing an effective insect control by RNAi approach are actylcholinesterase, cytochrome P450 enzymes, amino peptidase N, allatostatin, allatotropin, tryptophan oxygenase, arginine kinase, vacuolar ATPase, chitin synthase, glutathione-S-transferase, catalase, trehalose phosphate synthase, vitellogenin, hydroxy-3-methylglutaryl coenzyme A reductase, and hormone receptor genes. Through various studies, it is demonstrated that RNAi is a reliable molecular tool which offers great promises in meeting the challenges imposed by crop insects with careful selection of key enzymes/proteins. Utilization of RNAi tool to target some of these key proteins of crop insects through various approaches is described here. The major challenges of RNAi based insect control such as identifying potential targets, delivery methods of silencing trigger, off target effects, and complexity of insect biology are very well illustrated. Further, required efforts to address these challenges are also discussed. PMID:25954206

  14. RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design

    USDA-ARS?s Scientific Manuscript database

    Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive ex...

  15. The double-stranded RNA binding protein RDE-4 can act cell autonomously during feeding RNAi in C. elegans.

    PubMed

    Raman, Pravrutha; Zaghab, Soriayah M; Traver, Edward C; Jose, Antony M

    2017-08-21

    Long double-stranded RNA (dsRNA) can silence genes of matching sequence upon ingestion in many invertebrates and is therefore being developed as a pesticide. Such feeding RNA interference (RNAi) is best understood in the worm Caenorhabditis elegans, where the dsRNA-binding protein RDE-4 initiates silencing by recruiting an endonuclease to process long dsRNA into short dsRNA. These short dsRNAs are thought to move between cells because muscle-specific rescue of rde-4 using repetitive transgenes enables silencing in other tissues. Here, we extend this observation using additional promoters, report an inhibitory effect of repetitive transgenes, and discover conditions for cell-autonomous silencing in animals with tissue-specific rescue of rde-4. While expression of rde-4(+) in intestine, hypodermis, or neurons using a repetitive transgene can enable silencing also in unrescued tissues, silencing can be inhibited wihin tissues that express a repetitive transgene. Single-copy transgenes that express rde-4(+) in body-wall muscles or hypodermis, however, enable silencing selectively in the rescued tissue but not in other tissues. These results suggest that silencing by the movement of short dsRNA between cells is not an obligatory feature of feeding RNAi in C. elegans. We speculate that similar control of dsRNA movement could modulate tissue-specific silencing by feeding RNAi in other invertebrates. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. The interaction of fungi with the environment orchestrated by RNAi.

    PubMed

    Villalobos-Escobedo, José Manuel; Herrera-Estrella, Alfredo; Carreras-Villaseñor, Nohemí

    2016-01-01

    The fungal kingdom has been key in the investigation of the biogenesis and function of small RNAs (sRNAs). The discovery of phenomena such as quelling in Neurospora crassa represents pioneering work in the identification of the main elements of the RNA interference (RNAi) machinery. Recent discoveries in the regulatory mechanisms in some yeast and filamentous fungi are helping us reach a deeper understanding of the transcriptional and post-transcriptional gene-silencing mechanisms involved in genome protection against viral infections, DNA damage and transposon activity. Although most of these mechanisms are reasonably well understood, their role in the physiology, response to the environment and interaction of fungi with other organisms had remained elusive. Nevertheless, studies in fungi such as Mucor circinelloides, Magnaporthe oryzae, Cryptococcus neoformans, Trichoderma atroviride, Botrytis cinerea and others have started to shed light on the relevance of the RNAi pathway. In these fungi gene regulation by RNAi is important for growth, reproduction, control of viral infections and transposon activity, as well as in the development of antibiotic resistance and interactions with their hosts. Moreover, the increasing number of reports of the discovery of microRNA-like RNAs in fungi under different conditions highlights the importance of fungi as models for understanding adaptation to the environment using regulation by sRNAs. The goal of this review is to provide the reader with an up-to-date overview of the importance of RNAi in the interaction of fungi with their environment. © 2016 by The Mycological Society of America.

  17. RNA interference-based nanosystems for inflammatory bowel disease therapy

    PubMed Central

    Guo, Jian; Jiang, Xiaojing; Gui, Shuangying

    2016-01-01

    Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn’s disease, is a chronic, recrudescent disease that invades the gastrointestinal tract, and it requires surgery or lifelong medicinal therapy. The conventional medicinal therapies for IBD, such as anti-inflammatories, glucocorticoids, and immunosuppressants, are limited because of their systemic adverse effects and toxicity during long-term treatment. RNA interference (RNAi) precisely regulates susceptibility genes to decrease the expression of proinflammatory cytokines related to IBD, which effectively alleviates IBD progression and promotes intestinal mucosa recovery. RNAi molecules generally include short interfering RNA (siRNA) and microRNA (miRNA). However, naked RNA tends to degrade in vivo as a consequence of endogenous ribonucleases and pH variations. Furthermore, RNAi treatment may cause unintended off-target effects and immunostimulation. Therefore, nanovectors of siRNA and miRNA were introduced to circumvent these obstacles. Herein, we introduce non-viral nanosystems of RNAi molecules and discuss these systems in detail. Additionally, the delivery barriers and challenges associated with RNAi molecules will be discussed from the perspectives of developing efficient delivery systems and potential clinical use. PMID:27789943

  18. Double strand RNA-mediated RNA interference through feeding in larval gypsy moth, Lymantria dispar (Lepidoptera: Erebidae)

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi) has gained popularity in several fields of research, silencing targeted genes by degradation of RNA. The objective of this study was to develop RNAi for use as a molecular tool in the control of the invasive pest Lymantria dispar (Lepidoptera: Erebidae), gypsy moth, which ha...

  19. Role of RNA interference in plant improvement

    NASA Astrophysics Data System (ADS)

    Jagtap, Umesh Balkrishna; Gurav, Ranjit Gajanan; Bapat, Vishwas Anant

    2011-06-01

    Research to alter crops for their better performance involving modern technology is underway in numerous plants, and achievements in transgenic plants are impacting crop improvements in unparalleled ways. Striking progress has been made using genetic engineering technology over the past two decades in manipulating genes from diverse and exotic sources, and inserting them into crop plants for inducing desirable characteristics. RNA interference (RNAi) has recently been identified as a natural mechanism for regulation of gene expression in all higher organisms from plants to humans and promises greater accuracy and precision to plant improvement. The expression of any gene can be down-regulated in a highly explicit manner exclusive of affecting the expression of any other gene by using RNAi technologies. Additional research in this field has been focused on a number of other areas including microRNAs, hairpin RNA, and promoter methylation. Manipulating new RNAi pathways, which generate small RNA molecules to amend gene expression in crops, can produce new quality traits and having better potentiality of protection against abiotic and biotic stresses. Nutritional improvement, change in morphology, or enhanced secondary metabolite synthesis are some of the other advantages of RNAi technology. In addition to its roles in regulating gene expression, RNAi is also used as a natural defense mechanism against molecular parasites such as jumping genes and viral genetic elements that affect genome stability. Even though much advancement has been made on the field of RNAi over the preceding few years, the full prospective of RNAi for crop improvement remains to be fully realized. The intricacy of RNAi pathway, the molecular machineries, and how it relates to plant development are still to be explained.

  20. RNAi-mediated gene silencing as a principle of action of venoms and poisons.

    PubMed

    Pereira, Tiago Campos; Lopes-Cendes, Iscia

    2008-01-01

    RNA interference (RNAi) is a natural phenomenon in which double-stranded RNA molecules (dsRNAs) promote silencing of genes with similar sequence. It is noteworthy that in some instances the effects of gene silencing are similar to those caused by venoms and natural poisons (e.g., hemorrhage and low blood pressure). This observation raises the possibility that venomous/poisonous species in fact produce dsRNAs in their venoms/poisons and leading to the deleterious effects in the victim by RNAi-mediated gene silencing. Two approaches could be used to test this hypothesis, first, the neutralization of the dsRNAs and comparing to a non-treated venom sample; and second, to identify the dsRNA present in the venom and attempt to artificially reproduce its effects in the laboratory. In addition, we present three innovative treatment strategies for accidental interactions with venomous or poisonous species. RNAi has several roles in biological systems: gene regulation, antiviral defense, transposon silencing and heterochromatin formation. The hypothesis presented here provides a new role: a natural attack mechanism.

  1. The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides.

    PubMed

    Nicolás, Francisco E; Vila, Ana; Moxon, Simon; Cascales, María D; Torres-Martínez, Santiago; Ruiz-Vázquez, Rosa M; Garre, Victoriano

    2015-03-25

    RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which they derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants. Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. This work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M. circinelloides during exponential

  2. The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nicolas, Francisco E.; Vila, Ana; Moxon, Simon

    Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M

  3. The RNAi machinery controls distinct responses to environmental signals in the basal fungus Mucor circinelloides

    DOE PAGES

    Nicolas, Francisco E.; Vila, Ana; Moxon, Simon; ...

    2015-03-25

    Here, RNA interference (RNAi) is a conserved mechanism of genome defence that can also have a role in the regulation of endogenous functions through endogenous small RNAs (esRNAs). In fungi, knowledge of the functions regulated by esRNAs has been hampered by lack of clear phenotypes in most mutants affected in the RNAi machinery. Mutants of Mucor circinelloides affected in RNAi genes show defects in physiological and developmental processes, thus making Mucor an outstanding fungal model for studying endogenous functions regulated by RNAi. Some classes of Mucor esRNAs map to exons (ex-siRNAs) and regulate expression of the genes from which theymore » derive. To have a broad picture of genes regulated by the silencing machinery during vegetative growth, we have sequenced and compared the mRNA profiles of mutants in the main RNAi genes by using RNA-seq. In addition, we have achieved a more complete phenotypic characterization of silencing mutants Deletion of any main RNAi gene provoked a deep impact in mRNA accumulation at exponential and stationary growth. Genes showing increased mRNA levels, as expected for direct ex-siRNAs targets, but also genes with decreased expression were detected, suggesting that, most probably, the initial ex-siRNA targets regulate the expression of other genes, which can be up- or down-regulated. Expression of 50% of the genes was dependent on more than one RNAi gene in agreement with the existence of several classes of ex-siRNAs produced by different combinations of RNAi proteins. These combinations of proteins have also been involved in the regulation of different cellular processes. Besides genes regulated by the canonical RNAi pathway, this analysis identified processes, such as growth at low pH and sexual interaction that are regulated by a dicer-independent non-canonical RNAi pathway. In conclusion, this work shows that the RNAi pathways play a relevant role in the regulation of a significant number of endogenous genes in M

  4. The RNAi Inheritance Machinery of Caenorhabditis elegans.

    PubMed

    Spracklin, George; Fields, Brandon; Wan, Gang; Becker, Diveena; Wallig, Ashley; Shukla, Aditi; Kennedy, Scott

    2017-07-01

    Gene silencing mediated by dsRNA (RNAi) can persist for multiple generations in Caenorhabditis elegans (termed RNAi inheritance). Here we describe the results of a forward genetic screen in C. elegans that has identified six factors required for RNAi inheritance: GLH-1/VASA, PUP-1/CDE-1, MORC-1, SET-32, and two novel nematode-specific factors that we term here (heritable RNAi defective) HRDE-2 and HRDE-4 The new RNAi inheritance factors exhibit mortal germline (Mrt) phenotypes, which we show is likely caused by epigenetic deregulation in germ cells. We also show that HRDE-2 contributes to RNAi inheritance by facilitating the binding of small RNAs to the inheritance Argonaute (Ago) HRDE-1 Together, our results identify additional components of the RNAi inheritance machinery whose conservation provides insights into the molecular mechanism of RNAi inheritance, further our understanding of how the RNAi inheritance machinery promotes germline immortality, and show that HRDE-2 couples the inheritance Ago HRDE-1 with the small RNAs it needs to direct RNAi inheritance and germline immortality. Copyright © 2017 by the Genetics Society of America.

  5. Environmental RNAi in herbivorous insects.

    PubMed

    Ivashuta, Sergey; Zhang, Yuanji; Wiggins, B Elizabeth; Ramaseshadri, Partha; Segers, Gerrit C; Johnson, Steven; Meyer, Steve E; Kerstetter, Randy A; McNulty, Brian C; Bolognesi, Renata; Heck, Gregory R

    2015-05-01

    Environmental RNAi (eRNAi) is a sequence-specific regulation of endogenous gene expression in a receptive organism by exogenous double-stranded RNA (dsRNA). Although demonstrated under artificial dietary conditions and via transgenic plant presentations in several herbivorous insects, the magnitude and consequence of exogenous dsRNA uptake and the role of eRNAi remains unknown under natural insect living conditions. Our analysis of coleopteran insects sensitive to eRNAi fed on wild-type plants revealed uptake of plant endogenous long dsRNAs, but not small RNAs. Subsequently, the dsRNAs were processed into 21 nt siRNAs by insects and accumulated in high quantities in insect cells. No accumulation of host plant-derived siRNAs was observed in lepidopteran larvae that are recalcitrant to eRNAi. Stability of ingested dsRNA in coleopteran larval gut followed by uptake and transport from the gut to distal tissues appeared to be enabling factors for eRNAi. Although a relatively large number of distinct coleopteran insect-processed plant-derived siRNAs had sequence complementarity to insect transcripts, the vast majority of the siRNAs were present in relatively low abundance, and RNA-seq analysis did not detect a significant effect of plant-derived siRNAs on insect transcriptome. In summary, we observed a broad genome-wide uptake of plant endogenous dsRNA and subsequent processing of ingested dsRNA into 21 nt siRNAs in eRNAi-sensitive insects under natural feeding conditions. In addition to dsRNA stability in gut lumen and uptake, dosage of siRNAs targeting a given insect transcript is likely an important factor in order to achieve measurable eRNAi-based regulation in eRNAi-competent insects that lack an apparent silencing amplification mechanism. © 2015 Ivashuta et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  6. Distinct RNAi Pathways in the Regulation of Physiology and Development in the Fungus Mucor circinelloides.

    PubMed

    Ruiz-Vázquez, Rosa M; Nicolás, Francisco E; Torres-Martínez, Santiago; Garre, Victoriano

    2015-01-01

    The basal fungus Mucor circinelloides has become, in recent years, a valuable model to study RNA-mediated gene silencing or RNA interference (RNAi). Serendipitously discovered in the late 1900s, the gene silencing in M. circinelloides is a landscape of consensus and dissents. Although similar to other classical fungal models in the basic design of the essential machinery that is responsible for silencing of gene expression, the existence of small RNA molecules of different sizes generated during this process and the presence of a mechanism that amplifies the silencing signal, give it a unique identity. In addition, M. circinelloides combines the components of RNAi machinery to carry out functions that not only limit themselves to the defense against foreign genetic material, but it uses some of these elements to regulate the expression of its own genes. Thus, different combinations of RNAi elements produce distinct classes of endogenous small RNAs (esRNAs) that regulate different physiological and developmental processes in response to environmental signals. The recent discovery of a new RNAi pathway involved in the specific degradation of endogenous mRNAs, using a novel RNase protein, adds one more element to the exciting puzzle of the gene silencing in M. circinelloides, in addition to providing hints about the evolutionary origin of the RNAi mechanism. Copyright © 2015 Elsevier Inc. All rights reserved.

  7. Next-generation libraries for robust RNA interference-based genome-wide screens

    PubMed Central

    Kampmann, Martin; Horlbeck, Max A.; Chen, Yuwen; Tsai, Jordan C.; Bassik, Michael C.; Gilbert, Luke A.; Villalta, Jacqueline E.; Kwon, S. Chul; Chang, Hyeshik; Kim, V. Narry; Weissman, Jonathan S.

    2015-01-01

    Genetic screening based on loss-of-function phenotypes is a powerful discovery tool in biology. Although the recent development of clustered regularly interspaced short palindromic repeats (CRISPR)-based screening approaches in mammalian cell culture has enormous potential, RNA interference (RNAi)-based screening remains the method of choice in several biological contexts. We previously demonstrated that ultracomplex pooled short-hairpin RNA (shRNA) libraries can largely overcome the problem of RNAi off-target effects in genome-wide screens. Here, we systematically optimize several aspects of our shRNA library, including the promoter and microRNA context for shRNA expression, selection of guide strands, and features relevant for postscreen sample preparation for deep sequencing. We present next-generation high-complexity libraries targeting human and mouse protein-coding genes, which we grouped into 12 sublibraries based on biological function. A pilot screen suggests that our next-generation RNAi library performs comparably to current CRISPR interference (CRISPRi)-based approaches and can yield complementary results with high sensitivity and high specificity. PMID:26080438

  8. RNAiFold 2.0: a web server and software to design custom and Rfam-based RNA molecules.

    PubMed

    Garcia-Martin, Juan Antonio; Dotu, Ivan; Clote, Peter

    2015-07-01

    Several algorithms for RNA inverse folding have been used to design synthetic riboswitches, ribozymes and thermoswitches, whose activity has been experimentally validated. The RNAiFold software is unique among approaches for inverse folding in that (exhaustive) constraint programming is used instead of heuristic methods. For that reason, RNAiFold can generate all sequences that fold into the target structure or determine that there is no solution. RNAiFold 2.0 is a complete overhaul of RNAiFold 1.0, rewritten from the now defunct COMET language to C++. The new code properly extends the capabilities of its predecessor by providing a user-friendly pipeline to design synthetic constructs having the functionality of given Rfam families. In addition, the new software supports amino acid constraints, even for proteins translated in different reading frames from overlapping coding sequences; moreover, structure compatibility/incompatibility constraints have been expanded. With these features, RNAiFold 2.0 allows the user to design single RNA molecules as well as hybridization complexes of two RNA molecules. the web server, source code and linux binaries are publicly accessible at http://bioinformatics.bc.edu/clotelab/RNAiFold2.0. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. RNA interference as a method for target-site screening in the Western Corn Rootworm, Diabrotica virgifera virgifera

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi) is one of the most powerful and extraordinarily-specific means by which to silence genes. The ability of RNAi to silence genes makes it possible to ascertain function from genomic data, thereby making it an excellent choice for target-site screening. To test the efficacy of...

  10. RDE-1 slicer activity is required only for passenger-strand cleavage during RNAi in Caenorhabditis elegans.

    PubMed

    Steiner, Florian A; Okihara, Kristy L; Hoogstrate, Suzanne W; Sijen, Titia; Ketting, René F

    2009-02-01

    RNA interference (RNAi) is a process in which double-stranded RNA is cleaved into small interfering RNAs (siRNAs) that induce the destruction of homologous single-stranded mRNAs. Argonaute proteins are essential components of this silencing process; they bind siRNAs directly and can cleave RNA targets using a conserved RNase H motif. In Caenorhabditis elegans, the Argonaute protein RDE-1 has a central role in RNAi. In animals lacking RDE-1, the introduction of double-stranded RNA does not trigger any detectable level of RNAi. Here we show that RNase H activity of RDE-1 is required only for efficient removal of the passenger strand of the siRNA duplex and not for triggering the silencing response at the target-mRNA level. These results uncouple the role of the RDE-1 RNase H activity in small RNA maturation from its role in target-mRNA silencing in vivo.

  11. Genome characterization of Sugarcane Yellow Leaf Virus with special reference to RNAi based molecular breeding.

    PubMed

    Khalil, Farghama; Yueyu, Xu; Naiyan, Xiao; Di, Liu; Tayyab, Muhammad; Hengbo, Wang; Islam, Waqar; Rauf, Saeed; Pinghua, Chen

    2018-05-04

    Sugarcane is an essential crop for sugar and biofuel. Globally, its production is severely affected by sugarcane yellow leaf disease (SCYLD) caused by Sugarcane Yellow Leaf Virus (SCYLV). Many aphid vectors are involved in the spread of the disease which reduced the effectiveness of cultural and chemical management. Empirical methods of plant breeding such as introgression from wild and cultivated germplasm were not possible or at least challenging due to the absence of resistance in cultivated and wild germplasm of sugarcane. RNA interference (RNAi) transformation is an effective method to create virus-resistant varieties. Nevertheless, limited progress has been made due to lack of comprehensive research program on SCYLV based on RNAi technique. In order to show improvement and to propose future strategies for the feasibility of the RNAi technique to cope SCYLV, genome-wide consensus sequences of SCYLV were analyzed through GenBank. The coverage rates of every consensus sequence in SCYLV isolates were calculated to evaluate their practicability. Our analysis showed that single consensus sequence from SCYLV could not work well for RNAi based sugarcane breeding programs. This may be due to high mutation rate and continuous recombination within and between various viral strains. Alternative multi-target RNAi strategy is suggested to combat several strains of the viruses and to reduce the silencing escape. The multi-target small interfering RNA (siRNA) can be used together to construct RNAi plant expression plasmid, and to transform sugarcane tissues to develop new sugarcane varieties resistant to SCYLV. Copyright © 2018 Elsevier Ltd. All rights reserved.

  12. Efficacy of a Novel Class of RNA Interference Therapeutic Agents

    PubMed Central

    Matsumoto, Takahiro; D'Alessandro-Gabazza, Corina N.; Gil-Bernabe, Paloma; Boveda-Ruiz, Daniel; Naito, Masahiro; Kobayashi, Tetsu; Toda, Masaaki; Mizutani, Takayuki; Taguchi, Osamu; Morser, John; Eguchi, Yutaka; Kuroda, Masahiko; Ochiya, Takahiro; Hayashi, Hirotake; Gabazza, Esteban C.; Ohgi, Tadaaki

    2012-01-01

    RNA interference (RNAi) is being widely used in functional gene research and is an important tool for drug discovery. However, canonical double-stranded short interfering RNAs are unstable and induce undesirable adverse effects, and thus there is no currently RNAi-based therapy in the clinic. We have developed a novel class of RNAi agents, and evaluated their effectiveness in vitro and in mouse models of acute lung injury (ALI) and pulmonary fibrosis. The novel class of RNAi agents (nkRNA®, PnkRNA™) were synthesized on solid phase as single-stranded RNAs that, following synthesis, self-anneal into a unique helical structure containing a central stem and two loops. They are resistant to degradation and suppress their target genes. nkRNA and PnkRNA directed against TGF-β1mRNA ameliorate outcomes and induce no off-target effects in three animal models of lung disease. The results of this study support the pathological relevance of TGF-β1 in lung diseases, and suggest the potential usefulness of these novel RNAi agents for therapeutic application. PMID:22916145

  13. RNAi and Antiviral Defense in the Honey Bee.

    PubMed

    Brutscher, Laura M; Flenniken, Michelle L

    2015-01-01

    Honey bees play an important agricultural and ecological role as pollinators of numerous agricultural crops and other plant species. Therefore, investigating the factors associated with high annual losses of honey bee colonies in the US is an important and active area of research. Pathogen incidence and abundance correlate with Colony Collapse Disorder- (CCD-) affected colonies in the US and colony losses in the US and in some European countries. Honey bees are readily infected by single-stranded positive sense RNA viruses. Largely dependent on the host immune response, virus infections can either remain asymptomatic or result in deformities, paralysis, or death of adults or larvae. RNA interference (RNAi) is an important antiviral defense mechanism in insects, including honey bees. Herein, we review the role of RNAi in honey bee antiviral defense and highlight some parallels between insect and mammalian immune systems. A more thorough understanding of the role of pathogens on honey bee health and the immune mechanisms bees utilize to combat infectious agents may lead to the development of strategies that enhance honey bee health and result in the discovery of additional mechanisms of immunity in metazoans.

  14. RNAi and Antiviral Defense in the Honey Bee

    PubMed Central

    Brutscher, Laura M.; Flenniken, Michelle L.

    2015-01-01

    Honey bees play an important agricultural and ecological role as pollinators of numerous agricultural crops and other plant species. Therefore, investigating the factors associated with high annual losses of honey bee colonies in the US is an important and active area of research. Pathogen incidence and abundance correlate with Colony Collapse Disorder- (CCD-) affected colonies in the US and colony losses in the US and in some European countries. Honey bees are readily infected by single-stranded positive sense RNA viruses. Largely dependent on the host immune response, virus infections can either remain asymptomatic or result in deformities, paralysis, or death of adults or larvae. RNA interference (RNAi) is an important antiviral defense mechanism in insects, including honey bees. Herein, we review the role of RNAi in honey bee antiviral defense and highlight some parallels between insect and mammalian immune systems. A more thorough understanding of the role of pathogens on honey bee health and the immune mechanisms bees utilize to combat infectious agents may lead to the development of strategies that enhance honey bee health and result in the discovery of additional mechanisms of immunity in metazoans. PMID:26798663

  15. Illuminating the gateway of gene silencing: perspective of RNA interference technology in clinical therapeutics.

    PubMed

    Sindhu, Annu; Arora, Pooja; Chaudhury, Ashok

    2012-07-01

    A novel laboratory revolution for disease therapy, the RNA interference (RNAi) technology, has adopted a new era of molecular research as the next generation "Gene-targeted prophylaxis." In this review, we have focused on the chief technological challenges associated with the efforts to develop RNAi-based therapeutics that may guide the biomedical researchers. Many non-curable maladies, like neurodegenerative diseases and cancers have effectively been cured using this technology. Rapid advances are still in progress for the development of RNAi-based technologies that will be having a major impact on medical research. We have highlighted the recent discoveries associated with the phenomenon of RNAi, expression of silencing molecules in mammals along with the vector systems used for disease therapeutics.

  16. RNAi-mediated male sterility of tobacco by silencing TA29.

    PubMed

    Nawaz-ul-Rehman, Muhammad Shah; Mansoor, Shahid; Khan, Asif Ali; Zafar, Yusuf; Briddon, Rob W

    2007-06-01

    The superior performance of F1 hybrids has a significant impact on agricultural productivity. For commercial application, the availability of an efficient system for obtaining male-sterile lines of crops is an essential prerequisite. Here we have investigated the use of RNA interference (RNAi) technology to silence a male-specific gene in the model host tobacco. TA29 is expressed exclusively in anthers at the time of microspore development. About 10 out of 13 tobacco lines transformed with a hairpin RNAi construct containing TA29 sequences were male sterile. Transgenic plants were phenotypically indistinguishable from non-transgenic plants. At the anthesis stage, pollen grains from transgenic, male-sterile plants were aborted and lysed in comparison to the round and fully developed pollen in non-transgenic plants. Microscopic analysis of anthers showed selective degradation of tapetum in transgenic plants with no microspore development. One week after self-pollination, the ovules of non-transgenic plants were double the size of those in transgenic plants, due to successful self-fertilization. Male sterile transgenic plants set seed normally, when cross-pollinated with pollen from non-transgenic plants, confirming no adverse effect on the female parts of the flower. These results show that silencing of male-specific genes by RNAi is potentially a useful tool for generating male-sterile lines for producing hybrid seed.

  17. RNAi: a potential new class of therapeutic for human genetic disease.

    PubMed

    Seyhan, Attila A

    2011-11-01

    Dominant negative genetic disorders, in which a mutant allele of a gene causes disease in the presence of a second, normal copy, have been challenging since there is no cure and treatments are only to alleviate the symptoms. Current therapies involving pharmacological and biological drugs are not suitable to target mutant genes selectively due to structural indifference of the normal variant of their targets from the disease-causing mutant ones. In instances when the target contains single nucleotide polymorphism (SNP), whether it is an enzyme or structural or receptor protein are not ideal for treatment using conventional drugs due to their lack of selectivity. Therefore, there is a need to develop new approaches to accelerate targeting these previously inaccessible targets by classical therapeutics. Although there is a cooling trend by the pharmaceutical industry for the potential of RNA interference (RNAi), RNAi and other RNA targeting drugs (antisense, ribozyme, etc.) still hold their promise as the only drugs that provide an opportunity to target genes with SNP mutations found in dominant negative disorders, genes specific to pathogenic tumor cells, and genes that are critical for mediating the pathology of various other diseases. Because of its exquisite specificity and potency, RNAi has attracted a considerable interest as a new class of therapeutic for genetic diseases including amyotrophic lateral sclerosis, Huntington's disease (HD), Alzheimer's disease (AD), Parkinson's disease (PD), spinocerebellar ataxia, dominant muscular dystrophies, and cancer. In this review, progress and challenges in developing RNAi therapeutics for genetic diseases will be discussed.

  18. Blood-brain barrier transport of non-viral gene and RNAi therapeutics.

    PubMed

    Boado, Ruben J

    2007-09-01

    The development of gene- and RNA interference (RNAi)-based therapeutics represents a challenge for the drug delivery field. The global brain distribution of DNA genes, as well as the targeting of specific regions of the brain, is even more complicated because conventional delivery systems, i.e. viruses, have poor diffusion in brain when injected in situ and do not cross the blood-brain barrier (BBB), which is only permeable to lipophilic molecules of less than 400 Da. Recent advances in the "Trojan Horse Liposome" (THL) technology applied to the transvascular non-viral gene therapy of brain disorders presents a promising solution to the DNA/RNAi delivery obstacle. The THL is comprised of immunoliposomes carrying either a gene for protein replacement or small hairpin RNA (shRNA) expression plasmids for RNAi effect, respectively. The THL is engineered with known lipids containing polyethyleneglycol (PEG), which stabilizes its structure in vivo in circulation. The tissue target specificity of THL is given by conjugation of approximately 1% of the PEG residues to peptidomimetic monoclonal antibodies (MAb) that bind to specific endogenous receptors (i.e. insulin and transferrin receptors) located on both the BBB and the brain cellular membranes, respectively. These MAbs mediate (a) receptor-mediated transcytosis of the THL complex through the BBB, (b) endocytosis into brain cells and (c) transport to the brain cell nuclear compartment. The present review presents an overview of the THL technology and its current application to gene therapy and RNAi, including experimental models of Parkinson's disease and brain tumors.

  19. New wind in the sails: improving the agronomic value of crop plants through RNAi-mediated gene silencing.

    PubMed

    Koch, Aline; Kogel, Karl-Heinz

    2014-09-01

    RNA interference (RNAi) has emerged as a powerful genetic tool for scientific research over the past several years. It has been utilized not only in fundamental research for the assessment of gene function, but also in various fields of applied research, such as human and veterinary medicine and agriculture. In plants, RNAi strategies have the potential to allow manipulation of various aspects of food quality and nutritional content. In addition, the demonstration that agricultural pests, such as insects and nematodes, can be killed by exogenously supplied RNAi targeting their essential genes has raised the possibility that plant predation can be controlled by lethal RNAi signals generated in planta. Indeed, recent evidence argues that this strategy, called host-induced gene silencing (HIGS), is effective against sucking insects and nematodes; it also has been shown to compromise the growth and development of pathogenic fungi, as well as bacteria and viruses, on their plant hosts. Here, we review recent studies that reveal the enormous potential RNAi strategies hold not only for improving the nutritive value and safety of the food supply, but also for providing an environmentally friendly mechanism for plant protection. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Exploring Fusarium head blight disease control by RNA interference

    USDA-ARS?s Scientific Manuscript database

    RNA interference (RNAi) technology provides a novel tool to study gene function and plant protection strategies. Fusarium graminearum is the causal agent of Fusarium head blight (FHB), which reduces crop yield and quality by producing trichothecene mycotoxins including 3-acetyl deoxynivalenol (3-ADO...

  1. Evaluation of RNAi and CRISPR technologies by large-scale gene expression profiling in the Connectivity Map.

    PubMed

    Smith, Ian; Greenside, Peyton G; Natoli, Ted; Lahr, David L; Wadden, David; Tirosh, Itay; Narayan, Rajiv; Root, David E; Golub, Todd R; Subramanian, Aravind; Doench, John G

    2017-11-01

    The application of RNA interference (RNAi) to mammalian cells has provided the means to perform phenotypic screens to determine the functions of genes. Although RNAi has revolutionized loss-of-function genetic experiments, it has been difficult to systematically assess the prevalence and consequences of off-target effects. The Connectivity Map (CMAP) represents an unprecedented resource to study the gene expression consequences of expressing short hairpin RNAs (shRNAs). Analysis of signatures for over 13,000 shRNAs applied in 9 cell lines revealed that microRNA (miRNA)-like off-target effects of RNAi are far stronger and more pervasive than generally appreciated. We show that mitigating off-target effects is feasible in these datasets via computational methodologies to produce a consensus gene signature (CGS). In addition, we compared RNAi technology to clustered regularly interspaced short palindromic repeat (CRISPR)-based knockout by analysis of 373 single guide RNAs (sgRNAs) in 6 cells lines and show that the on-target efficacies are comparable, but CRISPR technology is far less susceptible to systematic off-target effects. These results will help guide the proper use and analysis of loss-of-function reagents for the determination of gene function.

  2. RNA interference inhibits yellow fever virus replication in vitro and in vivo.

    PubMed

    Pacca, Carolina C; Severino, Adriana A; Mondini, Adriano; Rahal, Paula; D'avila, Solange G P; Cordeiro, José Antonio; Nogueira, Mara Correa Lelles; Bronzoni, Roberta V M; Nogueira, Maurício L

    2009-04-01

    RNA interference (RNAi) is a process that is induced by double stranded RNA and involves the degradation of specific sequences of mRNA in the cytoplasm of the eukaryotic cells. It has been used as an antiviral tool against many viruses, including flaviviruses. The genus Flavivirus contains the most important arboviruses in the world, i.e., dengue (DENV) and yellow fever (YFV). In our study, we investigated the in vitro and in vivo effect of RNAi against YFV. Using stable cell lines that expressed RNAi against YFV, the cell lines were able to inhibit as much as 97% of the viral replication. Two constructions (one against NS1 and the other against E region of YFV genome) were able to protect the adult Balb/c mice against YFV challenge. The histopathologic analysis demonstrated an important protection of the central nervous system by RNAi after 10 days of viral challenge. Our data suggests that RNAi is a potential viable therapeutic weapon against yellow fever.

  3. RNA Interference in Moths: Mechanisms, Applications, and Progress

    PubMed Central

    Xu, Jin; Wang, Xia-Fei; Chen, Peng; Liu, Fang-Tao; Zheng, Shuai-Chao; Ye, Hui; Mo, Ming-He

    2016-01-01

    The vast majority of lepidopterans, about 90%, are moths. Some moths, particularly their caterpillars, are major agricultural and forestry pests in many parts of the world. However, some other members of moths, such as the silkworm Bombyx mori, are famous for their economic value. Fire et al. in 1998 initially found that exogenous double-stranded RNA (dsRNA) can silence the homolog endogenous mRNA in organisms, which is called RNA interference (RNAi). Soon after, the RNAi technique proved to be very promising not only in gene function determination but also in pest control. However, later studies demonstrate that performing RNAi in moths is not as straightforward as shown in other insect taxa. Nevertheless, since 2007, especially after 2010, an increasing number of reports have been published that describe successful RNAi experiments in different moth species either on gene function analysis or on pest management exploration. So far, more than 100 peer-reviewed papers have reported successful RNAi experiments in moths, covering 10 families and 25 species. By using classic and novel dsRNA delivery methods, these studies effectively silence the expression of various target genes and determine their function in larval development, reproduction, immunology, resistance against chemicals, and other biological processes. In addition, a number of laboratory and field trials have demonstrated that RNAi is also a potential strategy for moth pest management. In this review, therefore, we summarize and discuss the mechanisms and applications of the RNAi technique in moths by focusing on recent progresses. PMID:27775569

  4. Therapeutic RNA interference for neurodegenerative diseases: From promise to progress.

    PubMed

    Gonzalez-Alegre, Pedro

    2007-04-01

    RNA interference (RNAi) has emerged as a powerful tool to manipulate gene expression in the laboratory. Due to its remarkable discriminating properties, individual genes, or even alleles can be targeted with exquisite specificity in cultured cells or living animals. Among its many potential biomedical applications, silencing of disease-linked genes stands out as a promising therapeutic strategy for many incurable disorders. Neurodegenerative diseases represent one of the more attractive targets for the development of therapeutic RNAi. In this group of diseases, the progressive loss of neurons leads to the gradual appearance of disabling neurological symptoms and premature death. Currently available therapies aim to improve the symptoms but not to halt the process of neurodegeneration. The increasing prevalence and economic burden of some of these diseases, such as Alzheimer's disease (AD) or Parkinson's disease (PD), has boosted the efforts invested in the development of interventions, such as RNAi, aimed at altering their natural course. This review will summarize where we stand in the therapeutic application of RNAi for neurodegenerative diseases. The basic principles of RNAi will be reviewed, focusing on features important for its therapeutic manipulation. Subsequently, a stepwise strategy for the development of therapeutic RNAi will be presented. Finally, the different preclinical trials of therapeutic RNAi completed in disease models will be summarized, stressing the experimental questions that need to be addressed before planning application in human disease.

  5. Larval RNA Interference in the Red Flour Beetle, Tribolium castaneum

    PubMed Central

    Tomoyasu, Yoshinori

    2014-01-01

    The red flour beetle, Tribolium castaneum, offers a repertoire of experimental tools for genetic and developmental studies, including a fully annotated genome sequence, transposon-based transgenesis, and effective RNA interference (RNAi). Among these advantages, RNAi-based gene knockdown techniques are at the core of Tribolium research. T. castaneum show a robust systemic RNAi response, making it possible to perform RNAi at any life stage by simply injecting double-stranded RNA (dsRNA) into the beetle’s body cavity. In this report, we provide an overview of our larval RNAi technique in T. castaneum. The protocol includes (i) isolation of the proper stage of T. castaneum larvae for injection, (ii) preparation for the injection setting, and (iii) dsRNA injection. Larval RNAi is a simple, but powerful technique that provides us with quick access to loss-of-function phenotypes, including multiple gene knockdown phenotypes as well as a series of hypomorphic phenotypes. Since virtually all T. castaneum tissues are susceptible to extracellular dsRNA, the larval RNAi technique allows researchers to study a wide variety of tissues in diverse contexts, including the genetic basis of organismal responses to the outside environment. In addition, the simplicity of this technique stimulates more student involvement in research, making T. castaneum an ideal genetic system for use in a classroom setting. PMID:25350485

  6. EPA Registers Innovative Tool to Control Corn Rootworm

    EPA Pesticide Factsheets

    Ribonucleic acid interference (RNAi) based Plant Incorporated Protectant (PIP) technology is a new and innovative scientific tool utilized by U.S. growers. Learn more about RNAi technology and the 4 new products containing the RNAi based PIP called SMARTST

  7. Investigating Engineered Ribonucleoprotein Particles to Improve Oral RNAi Delivery in Crop Insect Pests

    PubMed Central

    Gillet, François-Xavier; Garcia, Rayssa A.; Macedo, Leonardo L. P.; Albuquerque, Erika V. S.; Silva, Maria C. M.; Grossi-de-Sa, Maria F.

    2017-01-01

    Genetically modified (GM) crops producing double-stranded RNAs (dsRNAs) are being investigated largely as an RNA interference (RNAi)-based resistance strategy against crop insect pests. However, limitations of this strategy include the sensitivity of dsRNA to insect gut nucleases and its poor insect cell membrane penetration. Working with the insect pest cotton boll weevil (Anthonomus grandis), we showed that the chimeric protein PTD-DRBD (peptide transduction domain—dsRNA binding domain) combined with dsRNA forms a ribonucleoprotein particle (RNP) that improves the effectiveness of the RNAi mechanism in the insect. The RNP slows down nuclease activity, probably by masking the dsRNA. Furthermore, PTD-mediated internalization in insect gut cells is achieved within minutes after plasma membrane contact, limiting the exposure time of the RNPs to gut nucleases. Therefore, the RNP provides an approximately 2-fold increase in the efficiency of insect gene silencing upon oral delivery when compared to naked dsRNA. Taken together, these data demonstrate the role of engineered RNPs in improving dsRNA stability and cellular entry, representing a path toward the design of enhanced RNAi strategies in GM plants against crop insect pests. PMID:28503153

  8. Investigating Engineered Ribonucleoprotein Particles to Improve Oral RNAi Delivery in Crop Insect Pests.

    PubMed

    Gillet, François-Xavier; Garcia, Rayssa A; Macedo, Leonardo L P; Albuquerque, Erika V S; Silva, Maria C M; Grossi-de-Sa, Maria F

    2017-01-01

    Genetically modified (GM) crops producing double-stranded RNAs (dsRNAs) are being investigated largely as an RNA interference (RNAi)-based resistance strategy against crop insect pests. However, limitations of this strategy include the sensitivity of dsRNA to insect gut nucleases and its poor insect cell membrane penetration. Working with the insect pest cotton boll weevil ( Anthonomus grandis ), we showed that the chimeric protein PTD-DRBD (peptide transduction domain-dsRNA binding domain) combined with dsRNA forms a ribonucleoprotein particle (RNP) that improves the effectiveness of the RNAi mechanism in the insect. The RNP slows down nuclease activity, probably by masking the dsRNA. Furthermore, PTD-mediated internalization in insect gut cells is achieved within minutes after plasma membrane contact, limiting the exposure time of the RNPs to gut nucleases. Therefore, the RNP provides an approximately 2-fold increase in the efficiency of insect gene silencing upon oral delivery when compared to naked dsRNA. Taken together, these data demonstrate the role of engineered RNPs in improving dsRNA stability and cellular entry, representing a path toward the design of enhanced RNAi strategies in GM plants against crop insect pests.

  9. Potential applications of RNA interference-based therapeutics in the treatment of cardiovascular disease.

    PubMed

    Hassan, Ali

    2006-06-01

    RNA interference (RNAi) in eukaryotes is a recently identified phenomenon in which small double stranded RNA molecules called short interfering RNA (siRNA) interact with messenger RNA (mRNA) containing homologous sequences in a sequence-specific manner. Ultimately, this interaction results in degradation of the target mRNA. Because of the high sequence specificity of the RNAi process, and the apparently ubiquitous expression of the endogenous protein components necessary for RNAi, there appears to be little limitation to the genes that can be targeted for silencing by RNAi. Thus, RNAi has enormous potential, both as a research tool and as a mode of therapy. Several recent patents have described advances in RNAi technology that are likely to lead to new treatments for cardiovascular disease. These patents have described methods for increased delivery of siRNA to cardiovascular target tissues, chemical modifications of siRNA that improve their pharmacokinetic characteristics, and expression vectors capable of expressing RNAi effectors in situ. Though RNAi has only recently been demonstrated to occur in mammalian tissues, work has advanced rapidly in the development of RNAi-based therapeutics. Recently, therapeutic silencing of apoliporotein B, the ligand for the low density lipoprotein receptor, has been demonstrated in adult mice by systemic administration of chemically modified siRNA. This demonstrates the potential for RNAi-based therapeutics, and suggests that the future for RNAi in the treatment of cardiovascular disease is bright.

  10. RNA interference (RNAI) as a tool to engineer high nutritional value in chicory (Chicorium intybus).

    PubMed

    Asad, M

    2006-01-01

    The major component of chicory (Chicorium intybus) root is inulin, which is a polymer of fructose. Inulin production from chicory is hampered by the enzyme fructan 1-exohydrolase (1-FEH) that degrades inulin and limits its yield. Increased FEH activity results in massive breakdown of fructan and production of Fructose and inulo-n-oses. The latter phenomena are to be avoided for industrial fructan production. RNA silencing, which is termed post-transcriptional gene silencing (PTGS) in plants, is an RNA degradation process through sequence specific nucleotide interactions induced by double-stranded RNA. For genetic improvement of crop plants, RNAi has advantages over antisense-mediated gene silencing and co-suppression, in terms of its efficiency and stability. We are generating a transgenic chicory plants with suppressed FEH (exohydrolas) genes using RNAi resulting in supressed inulin degradation. A small but important part of the construct is a sequence unique for the target gene (exons) or genes,which were cloned. The hairpin constructs were made and chicory was transformed by Agrobacterium tumifaciense, strain (C58C1). The transgenics should be select and check by means of molecular techniques.

  11. Ewing's Sarcoma: Development of RNA Interference-Based Therapy for Advanced Disease

    PubMed Central

    Simmons, Olivia; Maples, Phillip B.; Senzer, Neil; Nemunaitis, John

    2012-01-01

    Ewing's sarcoma tumors are associated with chromosomal translocation between the EWS gene and the ETS transcription factor gene. These unique target sequences provide opportunity for RNA interference(i)-based therapy. A summary of RNAi mechanism and therapeutically designed products including siRNA, shRNA and bi-shRNA are described. Comparison is made between each of these approaches. Systemic RNAi-based therapy, however, requires protected delivery to the Ewing's sarcoma tumor site for activity. Delivery systems which have been most effective in preclinical and clinical testing are reviewed, followed by preclinical assessment of various silencing strategies with demonstration of effectiveness to EWS/FLI-1 target sequences. It is concluded that RNAi-based therapeutics may have testable and achievable activity in management of Ewing's sarcoma. PMID:22523703

  12. Clathrin Heavy Chain Is Important for Viability, Oviposition, Embryogenesis and, Possibly, Systemic RNAi Response in the Predatory Mite Metaseiulus occidentalis

    PubMed Central

    Wu, Ke; Hoy, Marjorie A.

    2014-01-01

    Clathrin heavy chain has been shown to be important for viability, embryogenesis, and RNA interference (RNAi) in arthropods such as Drosophila melanogaster. However, the functional roles of clathrin heavy chain in chelicerate arthropods, such as the predatory mite Metaseiulus occidentalis, remain unknown. We previously showed that dsRNA ingestion, followed by feeding on spider mites, induced systemic and robust RNAi in M. occidentalis females. In the current study, we performed a loss-of-function analysis of the clathrin heavy chain gene in M. occidentalis using RNAi. We showed that ingestion of clathrin heavy chain dsRNA by M. occidentalis females resulted in gene knockdown and reduced longevity. In addition, clathrin heavy chain dsRNA treatment almost completely abolished oviposition by M. occidentalis females and the few eggs produced did not hatch. Finally, we demonstrated that clathrin heavy chain gene knockdown in M. occidentalis females significantly reduced a subsequent RNAi response induced by ingestion of cathepsin L dsRNA. The last finding suggests that clathrin heavy chain may be involved in systemic RNAi responses mediated by orally delivered dsRNAs in M. occidentalis. PMID:25329675

  13. RNAi trigger fragment truncation attenuates soybean FAD2-1 transcript suppression and yields intermediate oil phenotypes.

    PubMed

    Wagner, Nicholas; Mroczka, Andrew; Roberts, Peter D; Schreckengost, William; Voelker, Toni

    2011-09-01

    Suppression of the microsomal ω6 oleate desaturase during the seed development of soybean (Glycine max) with the 420-bp soybean FAD2-1A intron as RNAi trigger shifts the conventional fatty acid composition of soybean oil from 20% oleic and 60% polyunsaturates to one containing greater than 80% oleic acid and less than 10% polyunsaturates. To determine whether RNAi could be attenuated by reducing the trigger fragment length, transgenic plants were generated to express successively shorter 5' or 3' deletion derivatives of the FAD2-1A intron. We observed a gradual reduction in transcript suppression with shorter trigger fragments. Fatty acid composition was less affected with shorter triggers, and triggers less than 60 bp had no phenotypic effect. No trigger sequences conferring significantly higher or lower suppression efficiencies were found, and the primary determinant of suppression effect was sequence length. The observed relationship of transcript suppression with the induced fatty acid phenotype indicates that RNAi is a saturation process and not a step change between suppressed and nonsuppressed states and intermediate suppression states can be achieved. © 2010 Monsanto. Plant Biotechnology Journal © 2010 Society for Experimental Biology and Blackwell Publishing Ltd.

  14. Automatic Segmentation of High-Throughput RNAi Fluorescent Cellular Images

    PubMed Central

    Yan, Pingkum; Zhou, Xiaobo; Shah, Mubarak; Wong, Stephen T. C.

    2010-01-01

    High-throughput genome-wide RNA interference (RNAi) screening is emerging as an essential tool to assist biologists in understanding complex cellular processes. The large number of images produced in each study make manual analysis intractable; hence, automatic cellular image analysis becomes an urgent need, where segmentation is the first and one of the most important steps. In this paper, a fully automatic method for segmentation of cells from genome-wide RNAi screening images is proposed. Nuclei are first extracted from the DNA channel by using a modified watershed algorithm. Cells are then extracted by modeling the interaction between them as well as combining both gradient and region information in the Actin and Rac channels. A new energy functional is formulated based on a novel interaction model for segmenting tightly clustered cells with significant intensity variance and specific phenotypes. The energy functional is minimized by using a multiphase level set method, which leads to a highly effective cell segmentation method. Promising experimental results demonstrate that automatic segmentation of high-throughput genome-wide multichannel screening can be achieved by using the proposed method, which may also be extended to other multichannel image segmentation problems. PMID:18270043

  15. RNA Interference: Biology, Mechanism, and Applications

    PubMed Central

    Agrawal, Neema; Dasaradhi, P. V. N.; Mohmmed, Asif; Malhotra, Pawan; Bhatnagar, Raj K.; Mukherjee, Sunil K.

    2003-01-01

    Double-stranded RNA-mediated interference (RNAi) is a simple and rapid method of silencing gene expression in a range of organisms. The silencing of a gene is a consequence of degradation of RNA into short RNAs that activate ribonucleases to target homologous mRNA. The resulting phenotypes either are identical to those of genetic null mutants or resemble an allelic series of mutants. Specific gene silencing has been shown to be related to two ancient processes, cosuppression in plants and quelling in fungi, and has also been associated with regulatory processes such as transposon silencing, antiviral defense mechanisms, gene regulation, and chromosomal modification. Extensive genetic and biochemical analysis revealed a two-step mechanism of RNAi-induced gene silencing. The first step involves degradation of dsRNA into small interfering RNAs (siRNAs), 21 to 25 nucleotides long, by an RNase III-like activity. In the second step, the siRNAs join an RNase complex, RISC (RNA-induced silencing complex), which acts on the cognate mRNA and degrades it. Several key components such as Dicer, RNA-dependent RNA polymerase, helicases, and dsRNA endonucleases have been identified in different organisms for their roles in RNAi. Some of these components also control the development of many organisms by processing many noncoding RNAs, called micro-RNAs. The biogenesis and function of micro-RNAs resemble RNAi activities to a large extent. Recent studies indicate that in the context of RNAi, the genome also undergoes alterations in the form of DNA methylation, heterochromatin formation, and programmed DNA elimination. As a result of these changes, the silencing effect of gene functions is exercised as tightly as possible. Because of its exquisite specificity and efficiency, RNAi is being considered as an important tool not only for functional genomics, but also for gene-specific therapeutic activities that target the mRNAs of disease-related genes. PMID:14665679

  16. Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

    PubMed

    Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

    2007-07-26

    Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most

  17. Mechanism of ascorbic acid interference in biochemical tests that use peroxide and peroxidase to generate chromophore.

    PubMed

    Martinello, Flávia; Luiz da Silva, Edson

    2006-11-01

    Ascorbic acid interferes negatively in peroxidase-based tests (Trinder method). However, the precise mechanism remains unclear for tests that use peroxide, a phenolic compound and 4-aminophenazone (4-AP). We determined the chemical mechanism of this interference, by examining the effects of ascorbic acid in the reaction kinetics of the production and reduction of the oxidized chromophore in urate, cholesterol, triglyceride and glucose tests. Reaction of ascorbic acid with the Trinder method constituents was also verified. Ascorbic acid interfered stoichiometrically with all tests studied. However, it had two distinct effects on the reaction rate. In the urate test, ascorbic acid decreased the chromophore formation with no change in its production kinetics. In contrast, in cholesterol, triglyceride and glucose tests, an increase in the lag phase of color development occurred. Of all the Trinder constituents, only peroxide reverted the interference. In addition, ascorbic acid did not interfere with oxidase activity nor reduce significantly the chromophore formed. Peroxide depletion was the predominant chemical mechanism of ascorbic acid interference in the Trinder method with phenolics and 4-AP. Distinctive effects of ascorbic acid on the reaction kinetics of urate, cholesterol, glucose and triglyceride might be due to the rate of peroxide production by oxidases.

  18. RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems.

    PubMed

    Dietrich, Isabelle; Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Brennan, Benjamin; Elliott, Richard M; Diallo, Mawlouth; Sall, Amadou A; Failloux, Anna-Bella; Schnettler, Esther; Kohl, Alain; Becker, Stefanie C

    2017-01-01

    The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus , Bunyaviridae ) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect Drosophila

  19. RNA Interference Restricts Rift Valley Fever Virus in Multiple Insect Systems

    PubMed Central

    Jansen, Stephanie; Fall, Gamou; Lorenzen, Stephan; Rudolf, Martin; Huber, Katrin; Heitmann, Anna; Schicht, Sabine; Ndiaye, El Hadji; Watson, Mick; Castelli, Ilaria; Elliott, Richard M.; Diallo, Mawlouth; Sall, Amadou A.; Failloux, Anna-Bella; Schnettler, Esther

    2017-01-01

    ABSTRACT The emerging bunyavirus Rift Valley fever virus (RVFV) is transmitted to humans and livestock by a large number of mosquito species. RNA interference (RNAi) has been characterized as an important innate immune defense mechanism used by mosquitoes to limit replication of positive-sense RNA flaviviruses and togaviruses; however, little is known about its role against negative-strand RNA viruses such as RVFV. We show that virus-specific small RNAs are produced in infected mosquito cells, in Drosophila melanogaster cells, and, most importantly, also in RVFV vector mosquitoes. By addressing the production of small RNAs in adult Aedes sp. and Culex quinquefasciatus mosquitoes, we showed the presence of virus-derived Piwi-interacting RNAs (piRNAs) not only in Aedes sp. but also in C. quinquefasciatus mosquitoes, indicating that antiviral RNA interference in C. quinquefasciatus mosquitoes is similar to the described activities of RNAi in Aedes sp. mosquitoes. We also show that these have antiviral activity, since silencing of RNAi pathway effectors enhances viral replication. Moreover, our data suggest that RVFV does not encode a suppressor of RNAi. These findings point toward a significant role of RNAi in the control of RVFV in mosquitoes. IMPORTANCE Rift Valley fever virus (RVFV; Phlebovirus, Bunyaviridae) is an emerging zoonotic mosquito-borne pathogen of high relevance for human and animal health. Successful strategies of intervention in RVFV transmission by its mosquito vectors and the prevention of human and veterinary disease rely on a better understanding of the mechanisms that govern RVFV-vector interactions. Despite its medical importance, little is known about the factors that govern RVFV replication, dissemination, and transmission in the invertebrate host. Here we studied the role of the antiviral RNA interference immune pathways in the defense against RVFV in natural vector mosquitoes and mosquito cells and draw comparisons to the model insect

  20. Robust RNAi enhancement via human Argonaute-2 overexpression from plasmids, viral vectors and cell lines

    PubMed Central

    Börner, Kathleen; Niopek, Dominik; Cotugno, Gabriella; Kaldenbach, Michaela; Pankert, Teresa; Willemsen, Joschka; Zhang, Xian; Schürmann, Nina; Mockenhaupt, Stefan; Serva, Andrius; Hiet, Marie-Sophie; Wiedtke, Ellen; Castoldi, Mirco; Starkuviene, Vytaute; Erfle, Holger; Gilbert, Daniel F.; Bartenschlager, Ralf; Boutros, Michael; Binder, Marco; Streetz, Konrad; Kräusslich, Hans-Georg; Grimm, Dirk

    2013-01-01

    As the only mammalian Argonaute protein capable of directly cleaving mRNAs in a small RNA-guided manner, Argonaute-2 (Ago2) is a keyplayer in RNA interference (RNAi) silencing via small interfering (si) or short hairpin (sh) RNAs. It is also a rate-limiting factor whose saturation by si/shRNAs limits RNAi efficiency and causes numerous adverse side effects. Here, we report a set of versatile tools and widely applicable strategies for transient or stable Ago2 co-expression, which overcome these concerns. Specifically, we engineered plasmids and viral vectors to co-encode a codon-optimized human Ago2 cDNA along with custom shRNAs. Furthermore, we stably integrated this Ago2 cDNA into a panel of standard human cell lines via plasmid transfection or lentiviral transduction. Using various endo- or exogenous targets, we demonstrate the potential of all three strategies to boost mRNA silencing efficiencies in cell culture by up to 10-fold, and to facilitate combinatorial knockdowns. Importantly, these robust improvements were reflected by augmented RNAi phenotypes and accompanied by reduced off-targeting effects. We moreover show that Ago2/shRNA-co-encoding vectors can enhance and prolong transgene silencing in livers of adult mice, while concurrently alleviating hepatotoxicity. Our customizable reagents and avenues should broadly improve future in vitro and in vivo RNAi experiments in mammalian systems. PMID:24049077

  1. Interference of hepatitis C virus RNA replication by short interfering RNAs

    NASA Astrophysics Data System (ADS)

    Kapadia, Sharookh B.; Brideau-Andersen, Amy; Chisari, Francis V.

    2003-02-01

    Hepatitis C virus (HCV) infection is a major cause of chronic liver disease, which can lead to the development of liver cirrhosis and hepatocellular carcinoma. Current therapy of patients with chronic HCV infection includes treatment with IFN in combination with ribavirin. Because most treated patients do not resolve the infection, alternative treatment is essential. RNA interference (RNAi) is a recently discovered antiviral mechanism present in plants and animals that induces double-stranded RNA degradation. Using a selectable subgenomic HCV replicon cell culture system, we have shown that RNAi can specifically inhibit HCV RNA replication and protein expression in Huh-7 cells that stably replicate the HCV genome, and that this antiviral effect is independent of IFN. These results suggest that RNAi may represent a new approach for the treatment of persistent HCV infection.

  2. Autoantigen La promotes efficient RNAi, antiviral response, and transposon silencing by facilitating multiple-turnover RISC catalysis

    PubMed Central

    Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua

    2011-01-01

    SUMMARY The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used human Ago2 minimal RISC system to purify Sjögren’s syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. PMID:22055194

  3. Genome-wide identification and characterization of microRNAs differenytially expressed in fibers in a cotton phytochrome A1 RNAi line

    USDA-ARS?s Scientific Manuscript database

    Silencing phytochrome A1 gene (PHYA1) by RNA interference in Upland cotton (Gossypium hirsutum L. cv. Coker 312) had generated PHYA1 RNAi lines with simultaneously improved fiber quality (longer, stronger and finer fiber) and other key agronomic traits. Comparative analyses of altered molecular proc...

  4. Aedes aegypti uses RNA interference in defense against Sindbis virus infection.

    PubMed

    Campbell, Corey L; Keene, Kimberly M; Brackney, Douglas E; Olson, Ken E; Blair, Carol D; Wilusz, Jeffrey; Foy, Brian D

    2008-03-17

    RNA interference (RNAi) is an important anti-viral defense mechanism. The Aedes aegypti genome encodes RNAi component orthologs, however, most populations of this mosquito are readily infected by, and subsequently transmit flaviviruses and alphaviruses. The goal of this study was to use Ae. aegypti as a model system to determine how the mosquito's anti-viral RNAi pathway interacts with recombinant Sindbis virus (SINV; family Togaviridae, genus Alphavirus). SINV (TR339-eGFP) (+) strand RNA, infectious virus titers and infection rates transiently increased in mosquitoes following dsRNA injection to cognate Ago2, Dcr2, or TSN mRNAs. Detection of SINV RNA-derived small RNAs at 2 and 7 days post-infection in non-silenced mosquitoes provided important confirmation of RNAi pathway activity. Two different recombinant SINV viruses (MRE16-eGFP and TR339-eGFP) with significant differences in infection kinetics were used to delineate vector/virus interactions in the midgut. We show virus-dependent effects on RNAi component transcript and protein levels during infection. Monitoring midgut Ago2, Dcr2, and TSN transcript levels during infection revealed that only TSN transcripts were significantly increased in midguts over blood-fed controls. Ago2 protein levels were depleted immediately following a non-infectious bloodmeal and varied during SINV infection in a virus-dependent manner. We show that silencing RNAi components in Ae. aegypti results in transient increases in SINV replication. Furthermore, Ae. aegypti RNAi is active during SINV infection as indicated by production of virus-specific siRNAs. Lastly, the RNAi response varies in a virus-dependent manner. These data define important features of RNAi anti-viral defense in Ae. aegypti.

  5. AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals

    PubMed Central

    Fagard, Mathilde; Boutet, Stéphanie; Morel, Jean-Benoit; Bellini, Catherine; Vaucheret, Hervé

    2000-01-01

    Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants. PMID:11016954

  6. AGO1, QDE-2, and RDE-1 are related proteins required for post-transcriptional gene silencing in plants, quelling in fungi, and RNA interference in animals.

    PubMed

    Fagard, M; Boutet, S; Morel, J B; Bellini, C; Vaucheret, H

    2000-10-10

    Introduction of transgene DNA may lead to specific degradation of RNAs that are homologous to the transgene transcribed sequence through phenomena named post-transcriptional gene silencing (PTGS) in plants, quelling in fungi, and RNA interference (RNAi) in animals. It was shown previously that PTGS, quelling, and RNAi require a set of related proteins (SGS2, QDE-1, and EGO-1, respectively). Here we report the isolation of Arabidopsis mutants impaired in PTGS which are affected at the Argonaute1 (AGO1) locus. AGO1 is similar to QDE-2 required for quelling and RDE-1 required for RNAi. Sequencing of ago1 mutants revealed one amino acid essential for PTGS that is also present in QDE-2 and RDE-1 in a highly conserved motif. Taken together, these results confirm the hypothesis that these processes derive from a common ancestral mechanism that controls expression of invading nucleic acid molecules at the post-transcriptional level. As opposed to rde-1 and qde-2 mutants, which are viable, ago1 mutants display several developmental abnormalities, including sterility. These results raise the possibility that PTGS, or at least some of its elements, could participate in the regulation of gene expression during development in plants.

  7. Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

    PubMed

    Parrish, S; Fire, A

    2001-10-01

    RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed.

  8. Distinct roles for RDE-1 and RDE-4 during RNA interference in Caenorhabditis elegans.

    PubMed Central

    Parrish, S; Fire, A

    2001-01-01

    RNA interference (RNAi) is a cellular defense mechanism that uses double-stranded RNA (dsRNA) as a sequence-specific trigger to guide the degradation of homologous single-stranded RNAs. RNAi is a multistep process involving several proteins and at least one type of RNA intermediate, a population of small 21-25 nt RNAs (called siRNAs) that are initially derived from cleavage of the dsRNA trigger. Genetic screens in Caenorhabditis elegans have identified numerous mutations that cause partial or complete loss of RNAi. In this work, we analyzed cleavage of injected dsRNA to produce the initial siRNA population in animals mutant for rde-1 and rde-4, two genes that are essential for RNAi but that are not required for organismal viability or fertility. Our results suggest distinct roles for RDE-1 and RDE-4 in the interference process. Although null mutants lacking rde-1 show no phenotypic response to dsRNA, the amount of siRNAs generated from an injected dsRNA trigger was comparable to that of wild-type. By contrast, mutations in rde-4 substantially reduced the population of siRNAs derived from an injected dsRNA trigger. Injection of chemically synthesized 24- or 25-nt siRNAs could circumvent RNAi resistance in rde-4 mutants, whereas no bypass was observed in rde-1 mutants. These results support a model in which RDE-4 is involved before or during production of siRNAs, whereas RDE-1 acts after the siRNAs have been formed. PMID:11680844

  9. The impact of HIV-1 genetic diversity on the efficacy of a combinatorial RNAi-based gene therapy.

    PubMed

    Herrera-Carrillo, E; Berkhout, B

    2015-06-01

    A hurdle for human immunodeficiency virus (HIV-1) therapy is the genomic diversity of circulating viruses and the possibility that drug-resistant virus variants are selected. Although RNA interference (RNAi) is a powerful tool to stably inhibit HIV-1 replication by the expression of antiviral short hairpin RNAs (shRNAs) in transduced T cells, this approach is also vulnerable to pre-existing genetic variation and the development of viral resistance through mutation. To prevent viral escape, we proposed to combine multiple shRNAs against important regions of the HIV-1 RNA genome, which should ideally be conserved in all HIV-1 subtypes. The vulnerability of RNAi therapy to viral escape has been studied for a single subtype B strain, but it is unclear whether the antiviral shRNAs can inhibit diverse virus isolates and subtypes, including drug-resistant variants that could be present in treated patients. To determine the breadth of the RNAi gene therapy approach, we studied the susceptibility of HIV-1 subtypes A-E and drug-resistant variants. In addition, we monitored the evolution of HIV-1 escape variants. We demonstrate that the combinatorial RNAi therapy is highly effective against most isolates, supporting the future testing of this gene therapy in appropriate in vivo models.

  10. RNA Interference for improving the Outcome of Islet Transplantation

    PubMed Central

    Li, Feng; Mahato, Ram I

    2010-01-01

    Islet transplantation has the potential to cure type 1 diabetes. Despite recent therapeutic success, it is still not common because a large number of transpanted islets get damaged by multiple challenges including instant blood mediated inflammatory reaction, hypoxia/reperfusion injury, inflammatory cytokines, and immune rejection. RNA interference (RNAi) is an novel strategy to selectively degrade target mRNA. The use of RNAi technologies to downregulate the expression of harmful genes has the potential to improve the outcome of islet transplantation. The aim of this review is to gain a thorough understanding of biological obstacles to islet transplantation and discuss how to overcome these barriers using different RNAi technologies. This eventually will help improve islet survival and function post transplantaion. Chemically synthesized small interferring RNA (siRNA), vector based short haripin RNA (shRNA), and their critical design elements (such as sequences, promoters, backbone) are discussed. The application of combinatorial RNAi in islet transplantation is also discussed. Last but not the least, several delivery strategies for enhanced gene silencing are discussed, including chemical modification of siRNA, complex formation, bioconjugation, and viral vectors. PMID:21156190

  11. RNAi-mediated silencing of MAP kinase signalling genes (Fmk1, Hog1, and Pbs2) in Fusarium oxysporum reduces pathogenesis on tomato plants.

    PubMed

    Pareek, Manish; Rajam, Manchikatla Venkat

    2017-09-01

    Fusarium oxysporum is a soil-borne plant fungal pathogen, and causes colossal losses in several crop plants including tomato. Effective control measures include the use of harmful fungicides and resistant cultivars, but these methods have shown limited success. Conventional methods to validate fungal pathogenic genes are labour intensive. Therefore, an alternative strategy is required to efficiently characterize unknown pathogenic genes. RNA interference (RNAi) has emerged as a potential tool to functionally characterize novel fungal pathogenic genes and also to control fungal diseases. Here, we report an efficient method to produce stable RNAi transformants of F. oxysporum using Agrobacterium-mediated transformation (AMT). We have transformed F. oxysporum spores using RNAi constructs of Fmk1, Hog1, and Pbs2 MAP kinase signalling genes. Fmk1 RNAi fungal transformants showed loss of surface hydrophobicity, reduced invasive growth on tomato fruits and hypo-virulence on tomato seedlings. Hog1 and Pbs2 RNAi transformants showed altered conidial size, and reduced invasive growth and pathogenesis. These results showed that AMT using RNAi constructs is an effective approach for dissecting the role of genes involved in pathogenesis in F. oxysporum and this could be extended for other fungal systems. The obtained knowledge can be easily translated for developing fungal resistant crops by RNAi. Copyright © 2017 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  12. RNA interference: Applications and advances in insect toxicology and insect pest management.

    PubMed

    Kim, Young Ho; Soumaila Issa, Moustapha; Cooper, Anastasia M W; Zhu, Kun Yan

    2015-05-01

    Since its discovery, RNA interference (RNAi) has revolutionized functional genomic studies due to its sequence-specific nature of post-transcriptional gene silencing. In this paper, we provide a comprehensive review of the recent literature and summarize the current knowledge and advances in the applications of RNAi technologies in the field of insect toxicology and insect pest management. Many recent studies have focused on identification and validation of the genes encoding insecticide target proteins, such as acetylcholinesterases, ion channels, Bacillus thuringiensis receptors, and other receptors in the nervous system. RNAi technologies have also been widely applied to reveal the role of genes encoding cytochrome P450 monooxygenases, carboxylesterases, and glutathione S-transferases in insecticide detoxification and resistance. More recently, studies have focused on understanding the mechanism of insecticide-mediated up-regulation of detoxification genes in insects. As RNAi has already shown great potentials for insect pest management, many recent studies have also focused on host-induced gene silencing, in which several RNAi-based transgenic plants have been developed and tested as proof of concept for insect pest management. These studies indicate that RNAi is a valuable tool to address various fundamental questions in insect toxicology and may soon become an effective strategy for insect pest management. Copyright © 2015 Elsevier Inc. All rights reserved.

  13. Advances in genome-wide RNAi cellular screens: a case study using the Drosophila JAK/STAT pathway

    PubMed Central

    2012-01-01

    Background Genome-scale RNA-interference (RNAi) screens are becoming ever more common gene discovery tools. However, whilst every screen identifies interacting genes, less attention has been given to how factors such as library design and post-screening bioinformatics may be effecting the data generated. Results Here we present a new genome-wide RNAi screen of the Drosophila JAK/STAT signalling pathway undertaken in the Sheffield RNAi Screening Facility (SRSF). This screen was carried out using a second-generation, computationally optimised dsRNA library and analysed using current methods and bioinformatic tools. To examine advances in RNAi screening technology, we compare this screen to a biologically very similar screen undertaken in 2005 with a first-generation library. Both screens used the same cell line, reporters and experimental design, with the SRSF screen identifying 42 putative regulators of JAK/STAT signalling, 22 of which verified in a secondary screen and 16 verified with an independent probe design. Following reanalysis of the original screen data, comparisons of the two gene lists allows us to make estimates of false discovery rates in the SRSF data and to conduct an assessment of off-target effects (OTEs) associated with both libraries. We discuss the differences and similarities between the resulting data sets and examine the relative improvements in gene discovery protocols. Conclusions Our work represents one of the first direct comparisons between first- and second-generation libraries and shows that modern library designs together with methodological advances have had a significant influence on genome-scale RNAi screens. PMID:23006893

  14. Constraint factor graph cut-based active contour method for automated cellular image segmentation in RNAi screening.

    PubMed

    Chen, C; Li, H; Zhou, X; Wong, S T C

    2008-05-01

    Image-based, high throughput genome-wide RNA interference (RNAi) experiments are increasingly carried out to facilitate the understanding of gene functions in intricate biological processes. Automated screening of such experiments generates a large number of images with great variations in image quality, which makes manual analysis unreasonably time-consuming. Therefore, effective techniques for automatic image analysis are urgently needed, in which segmentation is one of the most important steps. This paper proposes a fully automatic method for cells segmentation in genome-wide RNAi screening images. The method consists of two steps: nuclei and cytoplasm segmentation. Nuclei are extracted and labelled to initialize cytoplasm segmentation. Since the quality of RNAi image is rather poor, a novel scale-adaptive steerable filter is designed to enhance the image in order to extract long and thin protrusions on the spiky cells. Then, constraint factor GCBAC method and morphological algorithms are combined to be an integrated method to segment tight clustered cells. Compared with the results obtained by using seeded watershed and the ground truth, that is, manual labelling results by experts in RNAi screening data, our method achieves higher accuracy. Compared with active contour methods, our method consumes much less time. The positive results indicate that the proposed method can be applied in automatic image analysis of multi-channel image screening data.

  15. RNAi for functional genomics in plants.

    PubMed

    McGinnis, Karen M

    2010-03-01

    RNAi refers to several different types of gene silencing mediated by small, dsRNA molecules. Over the course of 20 years, the scientific understanding of RNAi has developed from the initial observation of unexpected expression patterns to a sophisticated understanding of a multi-faceted, evolutionarily conserved network of mechanisms that regulate gene expression in many organisms. It has also been developed as a genetic tool that can be exploited in a wide range of species. Because transgene-induced RNAi has been effective at silencing one or more genes in a wide range of plants, this technology also bears potential as a powerful functional genomics tool across the plant kingdom. Transgene-induced RNAi has indeed been shown to be an effective mechanism for silencing many genes in many organisms, but the results from multiple projects which attempted to exploit RNAi on a genome-wide scale suggest that there is a great deal of variation in the silencing efficacy between transgenic events, silencing targets and silencing-induced phenotype. The results from these projects indicate several important variables that should be considered in experimental design prior to the initiation of functional genomics efforts based on RNAi silencing. In recent years, alternative strategies have been developed for targeted gene silencing, and a combination of approaches may also enhance the use of targeted gene silencing for functional genomics.

  16. Using RNA interference to knock down the adhesion protein TES.

    PubMed

    Griffith, Elen

    2007-01-01

    RNA interference (RNAi) is a specific and efficient method to knock down protein levels using small interfering RNAs (siRNAs), which target mRNA degradation. RNAi can be used in mammalian cell culture systems to target any protein of interest, and several studies have used this method to knock down adhesion proteins. We used siRNAs to knock down the levels of TES, a focal adhesion protein, in HeLa cells. We demonstrated knockdown of both TES mRNA and TES protein. Although total knockdown of TES was not achieved, the observed reduction in TES protein was sufficient to result in a cellular phenotype of reduced actin stress fibers.

  17. Current issues of RNAi therapeutics delivery and development.

    PubMed

    Haussecker, D

    2014-12-10

    12 years following the discovery of the RNAi mechanism in Man, a number of RNAi therapeutics development candidates have emerged with profiles suggesting that they could become drugs of significant medical importance for diseases like TTR amyloidosis, HBV, solid cancers, and hemophilia. Despite this robust progress, the perception of RNAi therapeutics has been on a roller-coaster ride driven not only by science, but also regulatory trends, the stock markets, and Big Pharma business development decisions [1]. This presentation provides an update on the current state of RNAi therapeutics development with a particular focus on what RNAi delivery can achieve today and key challenges to be overcome to expand therapeutic opportunities. The delivery of RNAi triggers to disease-relevant cell types clearly represents the rate-limiting factor in broadly expanding the applicability of RNAi therapeutics. Today, with at least 3 delivery options (lipid nanoparticles/LNPs, GalNAc-siRNA conjugates, Dynamic PolyConjugates/DPCs) for which profound gene knockdowns have been demonstrated in non-human primates and in the clinic, RNAi therapeutics should in principle be able to address most diseases related to gene expression in the liver. Given the central importance of the liver in systemic physiology, this already represents a significant therapeutic and commercial opportunity rivaling that of e.g. monoclonal antibodies. Beyond the liver, there is a reason to believe that current RNAi therapeutics technologies can address a number of solid tumors (e.g. LNPs), diseases of the eye (e.g. self-delivering RNAi triggers) as well as diseases involving the respiratory epithelium (e.g. aerosolized LNPs), certain phagocytic cells (LNPs), hematopoietic stem cells and their progeny (lentiviral DNA-directed RNAi), vascular endothelial cells (cationic lipoplexes), and certain cell types in the kidney (self-delivering RNAi triggers, DPCs; Table 1). Despite this success, there has been a sense that

  18. RNA Interference: A Novel Source of Resistance to Combat Plant Parasitic Nematodes.

    PubMed

    Banerjee, Sagar; Banerjee, Anamika; Gill, Sarvajeet S; Gupta, Om P; Dahuja, Anil; Jain, Pradeep K; Sirohi, Anil

    2017-01-01

    Plant parasitic nematodes cause severe damage and yield loss in major crops all over the world. Available control strategies include use of insecticides/nematicides but these have proved detrimental to the environment, while other strategies like crop rotation and resistant cultivars have serious limitations. This scenario provides an opportunity for the utilization of technological advances like RNA interference (RNAi) to engineer resistance against these devastating parasites. First demonstrated in the model free living nematode, Caenorhabtidis elegans ; the phenomenon of RNAi has been successfully used to suppress essential genes of plant parasitic nematodes involved in parasitism, nematode development and mRNA metabolism. Synthetic neurotransmitants mixed with dsRNA solutions are used for in vitro RNAi in plant parasitic nematodes with significant success. However, host delivered in planta RNAi has proved to be a pioneering phenomenon to deliver dsRNAs to feeding nematodes and silence the target genes to achieve resistance. Highly enriched genomic databases are exploited to limit off target effects and ensure sequence specific silencing. Technological advances like gene stacking and use of nematode inducible and tissue specific promoters can further enhance the utility of RNAi based transgenics against plant parasitic nematodes.

  19. The dsRNA binding protein RDE-4 interacts with RDE-1, DCR-1, and a DExH-box helicase to direct RNAi in C. elegans.

    PubMed

    Tabara, Hiroaki; Yigit, Erbay; Siomi, Haruhiko; Mello, Craig C

    2002-06-28

    Double-stranded (ds) RNA induces potent gene silencing, termed RNA interference (RNAi). At an early step in RNAi, an RNaseIII-related enzyme, Dicer (DCR-1), processes long-trigger dsRNA into small interfering RNAs (siRNAs). DCR-1 is also required for processing endogenous regulatory RNAs called miRNAs, but how DCR-1 recognizes its endogenous and foreign substrates is not yet understood. Here we show that the C. elegans RNAi pathway gene, rde-4, encodes a dsRNA binding protein that interacts during RNAi with RNA identical to the trigger dsRNA. RDE-4 protein also interacts in vivo with DCR-1, RDE-1, and a conserved DExH-box helicase. Our findings suggest a model in which RDE-4 and RDE-1 function together to detect and retain foreign dsRNA and to present this dsRNA to DCR-1 for processing.

  20. RNAi-mediated mortality of the whitefly through transgenic expression of double-stranded RNA homologous to acetylcholinesterase and ecdysone receptor in tobacco plants

    USDA-ARS?s Scientific Manuscript database

    The whitefly Bemisia tabaci (Genn.) is a pest and vector of plant viruses affecting plants worldwide. Using RNA interference (RNAi) to downregulate whitefly genes by expressing their homologous double stranded RNAs in plants has great potential for management of whiteflies to reduce plant virus dise...

  1. A member of the polymerase beta nucleotidyltransferase superfamily is required for RNA interference in C. elegans.

    PubMed

    Chen, Chun-Chieh G; Simard, Martin J; Tabara, Hiroaki; Brownell, Daniel R; McCollough, Jennifer A; Mello, Craig C

    2005-02-22

    RNA interference (RNAi) is an ancient, highly conserved mechanism in which small RNA molecules (siRNAs) guide the sequence-specific silencing of gene expression . Several silencing machinery protein components have been identified, including helicases, RNase-related proteins, double- and single-stranded RNA binding proteins, and RNA-dependent RNA polymerase-related proteins . Work on these factors has led to the revelation that RNAi mechanisms intersect with cellular pathways required for development and fertility . Despite rapid progress in understanding key steps in the RNAi pathway, it is clear that many factors required for both RNAi and related developmental mechanisms have not yet been identified. Here, we report the characterization of the C. elegans gene rde-3. Genetic analysis of presumptive null alleles indicates that rde-3 is required for siRNA accumulation and for efficient RNAi in all tissues, and it is essential for fertility and viability at high temperatures. RDE-3 contains conserved domains found in the polymerase beta nucleotidyltransferase superfamily, which includes conventional poly(A) polymerases, 2'-5' oligoadenylate synthetase (OAS), and yeast Trf4p . These findings implicate a new enzymatic modality in RNAi and suggest possible models for the role of RDE-3 in the RNAi mechanism.

  2. Harnessing RNA interference to develop neonatal therapies: from Nobel Prize winning discovery to proof of concept clinical trials.

    PubMed

    DeVincenzo, John P

    2009-10-01

    A revolution in the understanding of RNA biological processing and control is leading to revolutionary new concepts in human therapeutics. It has become increasingly clear that the so called "non-coding RNA" exerts specific and profound functional control on regulation of protein production and indeed controls the expression of all genes. Harnessing this naturally-occurring RNA-mediated regulation of protein production has immense human therapeutic potential. These processes are collectively known as RNA interference (RNAi). RNAi is a recently discovered, naturally-occurring intracellular process that regulates gene expression through the silencing of specific mRNAs. Methods of harnessing this natural pathway are being developed that allow the catalytic degradation of targeted mRNAs using specifically designed complementary small inhibitory RNAs (siRNA). siRNAs are being chemically modified to acquire drug-like properties. Numerous recent high profile publications have provided proofs of concept that RNA interference may be useful therapeutically. Much of the design of these siRNAs can be accomplished bioinformatically, thus potentially expediting drug discovery and opening new avenues of therapy for many uncommon, orphan, or emerging diseases. This makes this approach very attractive for developing therapies targeting orphan diseases including neonatal diseases. Theoretically, any disease that can be ameliorated through knockdown of any endogenous or exogenous protein is a potential therapeutic target for RNAi-based therapeutics. Lung diseases are particularly attractive targets for RNAi therapeutics since the affected cells' location increases their accessibility to topical administration of siRNA, for example by aerosol. Respiratory viral infections and chronic lung disease are examples of such diseases. RNAi therapeutics have been shown to be active against RSV, parainfluenza and human metapneumoviruses in vitro and in vivo resulting in profound antiviral

  3. RNAi Experiments in D. melanogaster: Solutions to the Overlooked Problem of Off-Targets Shared by Independent dsRNAs

    PubMed Central

    Seinen, Erwin; Burgerhof, Johannes G. M.; Jansen, Ritsert C.; Sibon, Ody C. M.

    2010-01-01

    Background RNAi technology is widely used to downregulate specific gene products. Investigating the phenotype induced by downregulation of gene products provides essential information about the function of the specific gene of interest. When RNAi is applied in Drosophila melanogaster or Caenorhabditis elegans, often large dsRNAs are used. One of the drawbacks of RNAi technology is that unwanted gene products with sequence similarity to the gene of interest can be down regulated too. To verify the outcome of an RNAi experiment and to avoid these unwanted off-target effects, an additional non-overlapping dsRNA can be used to down-regulate the same gene. However it has never been tested whether this approach is sufficient to reduce the risk of off-targets. Methodology We created a novel tool to analyse the occurance of off-target effects in Drosophila and we analyzed 99 randomly chosen genes. Principal Findings Here we show that nearly all genes contain non-overlapping internal sequences that do show overlap in a common off-target gene. Conclusion Based on our in silico findings, off-target effects should not be ignored and our presented on-line tool enables the identification of two RNA interference constructs, free of overlapping off-targets, from any gene of interest. PMID:20957038

  4. Evidence of a tick RNAi pathway by comparative genomics and reverse genetics screen of targets with known loss-of-function phenotypes in Drosophila

    PubMed Central

    Kurscheid, Sebastian; Lew-Tabor, Ala E; Rodriguez Valle, Manuel; Bruyeres, Anthea G; Doogan, Vivienne J; Munderloh, Ulrike G; Guerrero, Felix D; Barrero, Roberto A; Bellgard, Matthew I

    2009-01-01

    Background The Arthropods are a diverse group of organisms including Chelicerata (ticks, mites, spiders), Crustacea (crabs, shrimps), and Insecta (flies, mosquitoes, beetles, silkworm). The cattle tick, Rhipicephalus (Boophilus) microplus, is an economically significant ectoparasite of cattle affecting cattle industries world wide. With the availability of sequence reads from the first Chelicerate genome project (the Ixodes scapularis tick) and extensive R. microplus ESTs, we investigated evidence for putative RNAi proteins and studied RNA interference in tick cell cultures and adult female ticks targeting Drosophila homologues with known cell viability phenotype. Results We screened 13,643 R. microplus ESTs and I. scapularis genome reads to identify RNAi related proteins in ticks. Our analysis identified 31 RNAi proteins including a putative tick Dicer, RISC associated (Ago-2 and FMRp), RNA dependent RNA polymerase (EGO-1) and 23 homologues implicated in dsRNA uptake and processing. We selected 10 R. microplus ESTs with >80% similarity to D. melanogaster proteins associated with cell viability for RNAi functional screens in both BME26 R. microplus embryonic cells and female ticks in vivo. Only genes associated with proteasomes had an effect on cell viability in vitro. In vivo RNAi showed that 9 genes had significant effects either causing lethality or impairing egg laying. Conclusion We have identified key RNAi-related proteins in ticks and along with our loss-of-function studies support a functional RNAi pathway in R. microplus. Our preliminary studies indicate that tick RNAi pathways may differ from that of other Arthropods such as insects. PMID:19323841

  5. Bactrocera dorsalis male sterilization by targeted RNA interference of spermatogenesis: empowering sterile insect technique programs

    PubMed Central

    Dong, Yong-Cheng; Wang, Zhi-Jian; Chen, Zhen-Zhong; Clarke, Anthony R.; Niu, Chang-Ying

    2016-01-01

    RNA interference (RNAi) is a genetic technique which has novel application for sustainable pest control. The Sterile Insect Technique (SIT) uses releases of mass-produced, sterile male insects to out-compete wild males for mates to reduce pest populations. RNAi sterilization of SIT males would have several advantages over radiation sterilization, but to achieve this appropriate target genes must first be identified and then targeted with interference technology. With this goal, eight spermatogenesis related candidate genes were cloned and tested for potential activity in Bactrocera dorsalis. The knockdown of candidate genes by oral delivery of dsRNAs did not influence the mating of male flies, but significantly affected the daily average number of eggs laid by females, and reduced egg hatching rate by 16–60%. RNAi negatively affected spermatozoa quantitatively and qualitatively. Following the mating of lola-/topi-/rac-/rho-/upd-/magu-silenced males, we recorded a significant decrease in number and length of spermatozoa in female spermatheca compared to gfp-silenced control group. In a greenhouse trial, the number of damaged oranges and B. dorsalis larvae were significantly reduced in a dsrho-treated group compared with the dsgfp group. This study provides strong evidence for the use RNAi in pest management, especially for the improvement of SIT against B. dorsalis and other species. PMID:27767174

  6. Pathogen and Pest Responses Are Altered Due to RNAi-Mediated Knockdown of GLYCOALKALOID METABOLISM 4 in Solanum tuberosum.

    PubMed

    Paudel, Jamuna Risal; Davidson, Charlotte; Song, Jun; Maxim, Itkin; Aharoni, Asaph; Tai, Helen H

    2017-11-01

    Steroidal glycoalkaloids (SGAs) are major secondary metabolites constitutively produced in cultivated potato Solanum tuberosum, and α-solanine and α-chaconine are the most abundant SGAs. SGAs are toxic to humans at high levels but their role in plant protection against pests and pathogens is yet to be established. In this study, levels of SGAs in potato were reduced by RNA interference (RNAi)-mediated silencing of GLYCOALKALOID METABOLISM 4 (GAME4)-a gene encoding cytochrome P450, involved in an oxidation step in the conversion of cholesterol to SGA aglycones. Two GAME4 RNAi lines, T8 and T9, were used to investigate the effects of manipulation of the SGA biosynthetic pathway in potato. Growth and development of an insect pest, Colorado potato beetle (CPB), were affected in these lines. While no effect on CPB leaf consumption or weight gain was observed, early instar larval death and accelerated development of the insect was found while feeding on leaves of GAME4 RNAi lines. Modulation of SGA biosynthetic pathway in GAME4 RNAi plants was associated with a larger alteration to the metabolite profile, including increased levels of one or both the steroidal saponins or phytoecdysteroids, which could affect insect mortality as well as development time. Colonization by Verticillium dahliae on GAME4 RNAi plants was also tested. There were increased pathogen levels in the T8 GAME4 RNAi line but not in the T9. Metabolite differences between T8 and T9 were found and may have contributed to differences in V. dahliae infection. Drought responses created by osmotic stress were not affected by modulation of SGA biosynthetic pathway in potato.

  7. A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.

    PubMed

    Tsai, Hsin-Yue; Chen, Chun-Chieh G; Conte, Darryl; Moresco, James J; Chaves, Daniel A; Mitani, Shohei; Yates, John R; Tsai, Ming-Daw; Mello, Craig C

    2015-01-29

    Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering RNAs (siRNAs) are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However, in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3' uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3' uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi

    PubMed Central

    Tsai, Hsin-Yue; Chen, Chun-Chieh G.; Conte, Darryl; Moresco, James J.; Chaves, Daniel A.; Mitani, Shohei; Yates, John R.; Tsai, Ming-Daw; Mello, Craig C.

    2015-01-01

    SUMMARY Effective silencing by RNA-interference (RNAi) depends on mechanisms that amplify and propagate the silencing signal. In some organisms, small-interfering (si) RNAs are amplified from target mRNAs by RNA-dependent RNA polymerase (RdRP). Both RdRP recruitment and mRNA silencing require Argonaute proteins, which are generally thought to degrade RNAi targets by directly cleaving them. However in C. elegans, the enzymatic activity of the primary Argonaute, RDE-1, is not required for silencing activity. We show that RDE-1 can instead recruit an endoribonuclease, RDE-8, to target RNA. RDE-8 can cleave RNA in vitro and is needed for the production of 3′ uridylated fragments of target mRNA in vivo. We also find that RDE-8 promotes RdRP activity, thereby ensuring amplification of siRNAs. Together, our findings suggest a model in which RDE-8 cleaves target mRNAs to mediate silencing, while generating 3’ uridylated mRNA fragments to serve as templates for the RdRP-directed amplification of the silencing signal. PMID:25635455

  9. Multiple Renal Cyst Development but Not Situs Abnormalities in Transgenic RNAi Mice against Inv::GFP Rescue Gene

    PubMed Central

    Kamijho, Yuki; Shiozaki, Yayoi; Sakurai, Eiki; Hanaoka, Kazunori; Watanabe, Daisuke

    2014-01-01

    In this study we generated RNA interference (RNAi)-mediated gene knockdown transgenic mice (transgenic RNAi mice) against the functional Inv gene. Inv mutant mice show consistently reversed internal organs (situs inversus), multiple renal cysts and neonatal lethality. The Inv::GFP-rescue mice, which introduced the Inv::GFP fusion gene, can rescue inv mutant mice phenotypes. This indicates that the Inv::GFP gene is functional in vivo. To analyze the physiological functions of the Inv gene, and to demonstrate the availability of transgenic RNAi mice, we introduced a short hairpin RNA expression vector against GFP mRNA into Inv::GFP-rescue mice and analyzed the gene silencing effects and Inv functions by examining phenotypes. Transgenic RNAi mice with the Inv::GFP-rescue gene (Inv-KD mice) down-regulated Inv::GFP fusion protein and showed hypomorphic phenotypes of inv mutant mice, such as renal cyst development, but not situs abnormalities or postnatal lethality. This indicates that shRNAi-mediated gene silencing systems that target the tag sequence of the fusion gene work properly in vivo, and suggests that a relatively high level of Inv protein is required for kidney development in contrast to left/right axis determination. Inv::GFP protein was significantly down-regulated in the germ cells of Inv-KD mice testis compared with somatic cells, suggesting the existence of a testicular germ cell-specific enhanced RNAi system that regulates germ cell development. The Inv-KD mouse is useful for studying Inv gene functions in adult tissue that are unable to be analyzed in inv mutant mice showing postnatal lethality. In addition, the shRNA-based gene silencing system against the tag sequence of the fusion gene can be utilized as a new technique to regulate gene expression in either in vitro or in vivo experiments. PMID:24586938

  10. In C. elegans, high levels of dsRNA allow RNAi in the absence of RDE-4.

    PubMed

    Habig, Jeffrey W; Aruscavage, P Joseph; Bass, Brenda L

    2008-01-01

    C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals.

  11. In C. elegans, High Levels of dsRNA Allow RNAi in the Absence of RDE-4

    PubMed Central

    Habig, Jeffrey W.; Aruscavage, P. Joseph; Bass, Brenda L.

    2008-01-01

    C. elegans Dicer requires an accessory double-stranded RNA binding protein, RDE-4, to enact the first step of RNA interference, the cleavage of dsRNA to produce siRNA. While RDE-4 is typically essential for RNAi, we report that in the presence of high concentrations of trigger dsRNA, rde-4 deficient animals are capable of silencing a transgene. By multiple criteria the silencing occurs by the canonical RNAi pathway. For example, silencing is RDE-1 dependent and exhibits a decrease in the targeted mRNA in response to an increase in siRNA. We also find that high concentrations of dsRNA trigger lead to increased accumulation of primary siRNAs, consistent with the existence of a rate-limiting step during the conversion of primary to secondary siRNAs. Our studies also revealed that transgene silencing occurs at low levels in the soma, even in the presence of ADARs, and that at least some siRNAs accumulate in a temperature-dependent manner. We conclude that an RNAi response varies with different conditions, and this may allow an organism to tailor a response to specific environmental signals. PMID:19112503

  12. Autoantigen La promotes efficient RNAi, antiviral response, and transposon silencing by facilitating multiple-turnover RISC catalysis.

    PubMed

    Liu, Ying; Tan, Huiling; Tian, Hui; Liang, Chunyang; Chen, She; Liu, Qinghua

    2011-11-04

    The effector of RNA interference (RNAi) is the RNA-induced silencing complex (RISC). C3PO promotes the activation of RISC by degrading the Argonaute2 (Ago2)-nicked passenger strand of duplex siRNA. Active RISC is a multiple-turnover enzyme that uses the guide strand of siRNA to direct the Ago2-mediated sequence-specific cleavage of complementary mRNA. How this effector step of RNAi is regulated is currently unknown. Here, we used the human Ago2 minimal RISC system to purify Sjögren's syndrome antigen B (SSB)/autoantigen La as an activator of the RISC-mediated mRNA cleavage activity. Our reconstitution studies showed that La could promote multiple-turnover RISC catalysis by facilitating the release of cleaved mRNA from RISC. Moreover, we demonstrated that La was required for efficient RNAi, antiviral defense, and transposon silencing in vivo. Taken together, the findings of C3PO and La reveal a general concept that regulatory factors are required to remove Ago2-cleaved products to assemble or restore active RISC. Copyright © 2011 Elsevier Inc. All rights reserved.

  13. Effects of HBV Genetic Variability on RNAi Strategies

    PubMed Central

    Panjaworayan, Nattanan; Brown, Chris M.

    2011-01-01

    RNAi strategies present promising antiviral strategies against HBV. RNAi strategies require base pairing between short RNAi effectors and targets in the HBV pregenome or other RNAs. Natural variation in HBV genotypes, quasispecies variation, or mutations selected by the RNAi strategy could potentially make these strategies less effective. However, current and proposed antiviral strategies against HBV are being, or could be, designed to avoid this. This would involve simultaneous targeting of multiple regions of the genome, or regions in which variation or mutation is not tolerated. RNAi strategies against single genotypes or against variable regions of the genome would need to have significant other advantages to be part of robust therapies. PMID:21760994

  14. Strand antagonism in RNAi: an explanation of differences in potency between intracellularly expressed siRNA and shRNA

    PubMed Central

    Jin, Xin; Sun, Tingting; Zhao, Chuanke; Zheng, Yongxiang; Zhang, Yufan; Cai, Weijing; He, Qiuchen; Taira, Kaz; Zhang, Lihe; Zhou, Demin

    2012-01-01

    Strategies to regulate gene function frequently use small interfering RNAs (siRNAs) that can be made from their shRNA precursors via Dicer. However, when the duplex components of these siRNA effectors are expressed from their respective coding genes, the RNA interference (RNAi) activity is much reduced. Here, we explored the mechanisms of action of shRNA and siRNA and found the expressed siRNA, in contrast to short hairpin RNA (shRNA), exhibits strong strand antagonism, with the sense RNA negatively and unexpectedly regulating RNAi. Therefore, we altered the relative levels of strands of siRNA duplexes during their expression, increasing the level of the antisense component, reducing the level of the sense component, or both and, in this way we were able to enhance the potency of the siRNA. Such vector-delivered siRNA attacked its target effectively. These findings provide new insight into RNAi and, in particular, they demonstrate that strand antagonism is responsible for making siRNA far less potent than shRNA. PMID:22039150

  15. Advances in CRISPR-Cas9 genome engineering: lessons learned from RNA interference

    PubMed Central

    Barrangou, Rodolphe; Birmingham, Amanda; Wiemann, Stefan; Beijersbergen, Roderick L.; Hornung, Veit; Smith, Anja van Brabant

    2015-01-01

    The discovery that the machinery of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-Cas9 bacterial immune system can be re-purposed to easily create deletions, insertions and replacements in the mammalian genome has revolutionized the field of genome engineering and re-invigorated the field of gene therapy. Many parallels have been drawn between the newly discovered CRISPR-Cas9 system and the RNA interference (RNAi) pathway in terms of their utility for understanding and interrogating gene function in mammalian cells. Given this similarity, the CRISPR-Cas9 field stands to benefit immensely from lessons learned during the development of RNAi technology. We examine how the history of RNAi can inform today's challenges in CRISPR-Cas9 genome engineering such as efficiency, specificity, high-throughput screening and delivery for in vivo and therapeutic applications. PMID:25800748

  16. Conversion of pre-RISC to holo-RISC by Ago2 during assembly of RNAi complexes

    PubMed Central

    Kim, Kevin; Lee, Young Sik; Carthew, Richard W.

    2007-01-01

    In the Drosophila RNA interference (RNAi) pathway, small interfering RNAs (siRNAs) direct Argonaute2 (Ago2), an endonuclease, within the RNA-induced silencing complex (RISC) to cleave complementary mRNA targets. In vitro studies have shown that, for each siRNA duplex, RISC retains only one strand, the guide, and releases the other, the passenger, to form a holo-RISC complex. Here, we have isolated a new Ago2 mutant allele and provide, for the first time, in vivo evidence that endogenous Ago2 slicer activity is important to mount an RNAi response in Drosophila. We demonstrate in vivo that efficient removal of the passenger strand from RISC requires the cleavage activity of Ago2. We have also identified a new intermediate complex in the RISC assembly pathway, pre-RISC, in which Ago2 is stably bound to double-stranded siRNA. PMID:17123955

  17. Reliance of Wolbachia on High Rates of Host Proteolysis Revealed by a Genome-Wide RNAi Screen of Drosophila Cells.

    PubMed

    White, Pamela M; Serbus, Laura R; Debec, Alain; Codina, Adan; Bray, Walter; Guichet, Antoine; Lokey, R Scott; Sullivan, William

    2017-04-01

    Wolbachia are gram-negative, obligate, intracellular bacteria carried by a majority of insect species worldwide. Here we use a Wolbachia -infected Drosophila cell line and genome-wide RNA interference (RNAi) screening to identify host factors that influence Wolbachia titer. By screening an RNAi library targeting 15,699 transcribed host genes, we identified 36 candidate genes that dramatically reduced Wolbachia titer and 41 that increased Wolbachia titer. Host gene knockdowns that reduced Wolbachia titer spanned a broad array of biological pathways including genes that influenced mitochondrial function and lipid metabolism. In addition, knockdown of seven genes in the host ubiquitin and proteolysis pathways significantly reduced Wolbachia titer. To test the in vivo relevance of these results, we found that drug and mutant inhibition of proteolysis reduced levels of Wolbachia in the Drosophila oocyte. The presence of Wolbachia in either cell lines or oocytes dramatically alters the distribution and abundance of ubiquitinated proteins. Functional studies revealed that maintenance of Wolbachia titer relies on an intact host Endoplasmic Reticulum (ER)-associated protein degradation pathway (ERAD). Accordingly, electron microscopy studies demonstrated that Wolbachia is intimately associated with the host ER and dramatically alters the morphology of this organelle. Given Wolbachia lack essential amino acid biosynthetic pathways, the reliance of Wolbachia on high rates of host proteolysis via ubiquitination and the ERAD pathways may be a key mechanism for provisioning Wolbachia with amino acids. In addition, the reliance of Wolbachia on the ERAD pathway and disruption of ER morphology suggests a previously unsuspected mechanism for Wolbachia ' s potent ability to prevent RNA virus replication. Copyright © 2017 by the Genetics Society of America.

  18. RNA-Interference Pathways Display High Rates of Adaptive Protein Evolution in Multiple Invertebrates

    PubMed Central

    Palmer, William H.; Hadfield, Jarrod D.; Obbard, Darren J.

    2018-01-01

    Conflict between organisms can lead to a reciprocal adaptation that manifests as an increased evolutionary rate in genes mediating the conflict. This adaptive signature has been observed in RNA-interference (RNAi) pathway genes involved in the suppression of viruses and transposable elements in Drosophila melanogaster, suggesting that a subset of Drosophila RNAi genes may be locked in an arms race with these parasites. However, it is not known whether rapid evolution of RNAi genes is a general phenomenon across invertebrates, or which RNAi genes generally evolve adaptively. Here we use population genomic data from eight invertebrate species to infer rates of adaptive sequence evolution, and to test for past and ongoing selective sweeps in RNAi genes. We assess rates of adaptive protein evolution across species using a formal meta-analytic framework to combine data across species and by implementing a multispecies generalized linear mixed model of mutation counts. Across species, we find that RNAi genes display a greater rate of adaptive protein substitution than other genes, and that this is primarily mediated by positive selection acting on the genes most likely to defend against viruses and transposable elements. In contrast, evidence for recent selective sweeps is broadly spread across functional classes of RNAi genes and differs substantially among species. Finally, we identify genes that exhibit elevated adaptive evolution across the analyzed insect species, perhaps due to concurrent parasite-mediated arms races. PMID:29437826

  19. RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental design.

    PubMed

    Terenius, Olle; Papanicolaou, Alexie; Garbutt, Jennie S; Eleftherianos, Ioannis; Huvenne, Hanneke; Kanginakudru, Sriramana; Albrechtsen, Merete; An, Chunju; Aymeric, Jean-Luc; Barthel, Andrea; Bebas, Piotr; Bitra, Kavita; Bravo, Alejandra; Chevalier, François; Collinge, Derek P; Crava, Cristina M; de Maagd, Ruud A; Duvic, Bernard; Erlandson, Martin; Faye, Ingrid; Felföldi, Gabriella; Fujiwara, Haruhiko; Futahashi, Ryo; Gandhe, Archana S; Gatehouse, Heather S; Gatehouse, Laurence N; Giebultowicz, Jadwiga M; Gómez, Isabel; Grimmelikhuijzen, Cornelis J P; Groot, Astrid T; Hauser, Frank; Heckel, David G; Hegedus, Dwayne D; Hrycaj, Steven; Huang, Lihua; Hull, J Joe; Iatrou, Kostas; Iga, Masatoshi; Kanost, Michael R; Kotwica, Joanna; Li, Changyou; Li, Jianghong; Liu, Jisheng; Lundmark, Magnus; Matsumoto, Shogo; Meyering-Vos, Martina; Millichap, Peter J; Monteiro, Antónia; Mrinal, Nirotpal; Niimi, Teruyuki; Nowara, Daniela; Ohnishi, Atsushi; Oostra, Vicencio; Ozaki, Katsuhisa; Papakonstantinou, Maria; Popadic, Aleksandar; Rajam, Manchikatla V; Saenko, Suzanne; Simpson, Robert M; Soberón, Mario; Strand, Michael R; Tomita, Shuichiro; Toprak, Umut; Wang, Ping; Wee, Choon Wei; Whyard, Steven; Zhang, Wenqing; Nagaraju, Javaregowda; Ffrench-Constant, Richard H; Herrero, Salvador; Gordon, Karl; Swevers, Luc; Smagghe, Guy

    2011-02-01

    Gene silencing through RNA interference (RNAi) has revolutionized the study of gene function, particularly in non-model insects. However, in Lepidoptera (moths and butterflies) RNAi has many times proven to be difficult to achieve. Most of the negative results have been anecdotal and the positive experiments have not been collected in such a way that they are possible to analyze. In this review, we have collected detailed data from more than 150 experiments including all to date published and many unpublished experiments. Despite a large variation in the data, trends that are found are that RNAi is particularly successful in the family Saturniidae and in genes involved in immunity. On the contrary, gene expression in epidermal tissues seems to be most difficult to silence. In addition, gene silencing by feeding dsRNA requires high concentrations for success. Possible causes for the variability of success in RNAi experiments in Lepidoptera are discussed. The review also points to a need to further investigate the mechanism of RNAi in lepidopteran insects and its possible connection to the innate immune response. Our general understanding of RNAi in Lepidoptera will be further aided in the future as our public database at http://insectacentral.org/RNAi will continue to gather information on RNAi experiments. Copyright © 2010 Elsevier Ltd. All rights reserved.

  20. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System.

    PubMed

    Pompey, Justine M; Foda, Bardees; Singh, Upinder

    2015-01-01

    Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway.

  1. A Single RNaseIII Domain Protein from Entamoeba histolytica Has dsRNA Cleavage Activity and Can Help Mediate RNAi Gene Silencing in a Heterologous System

    PubMed Central

    Singh, Upinder

    2015-01-01

    Dicer enzymes process double-stranded RNA (dsRNA) into small RNAs that target gene silencing through the RNA interference (RNAi) pathway. Dicer enzymes are complex, multi-domain RNaseIII proteins, however structural minimalism of this protein has recently emerged in parasitic and fungal systems. The most minimal Dicer, Saccharomyces castellii Dicer1, has a single RNaseIII domain and two double stranded RNA binding domains. In the protozoan parasite Entamoeba histolytica 27nt small RNAs are abundant and mediate silencing, yet no canonical Dicer enzyme has been identified. Although EhRNaseIII does not exhibit robust dsRNA cleavage in vitro, it can process dsRNA in the RNAi-negative background of Saccharomyces cerevisiae, and in conjunction with S. castellii Argonaute1 can partially reconstitute the RNAi pathway. Thus, although EhRNaseIII lacks the domain architecture of canonical or minimal Dicer enzymes, it has dsRNA processing activity that contributes to gene silencing via RNAi. Our data advance the understanding of small RNA biogenesis in Entamoeba as well as broaden the spectrum of non-canonical Dicer enzymes that contribute to the RNAi pathway. PMID:26230096

  2. funRNA: a fungi-centered genomics platform for genes encoding key components of RNAi.

    PubMed

    Choi, Jaeyoung; Kim, Ki-Tae; Jeon, Jongbum; Wu, Jiayao; Song, Hyeunjeong; Asiegbu, Fred O; Lee, Yong-Hwan

    2014-01-01

    RNA interference (RNAi) is involved in genome defense as well as diverse cellular, developmental, and physiological processes. Key components of RNAi are Argonaute, Dicer, and RNA-dependent RNA polymerase (RdRP), which have been functionally characterized mainly in model organisms. The key components are believed to exist throughout eukaryotes; however, there is no systematic platform for archiving and dissecting these important gene families. In addition, few fungi have been studied to date, limiting our understanding of RNAi in fungi. Here we present funRNA http://funrna.riceblast.snu.ac.kr/, a fungal kingdom-wide comparative genomics platform for putative genes encoding Argonaute, Dicer, and RdRP. To identify and archive genes encoding the abovementioned key components, protein domain profiles were determined from reference sequences obtained from UniProtKB/SwissProt. The domain profiles were searched using fungal, metazoan, and plant genomes, as well as bacterial and archaeal genomes. 1,163, 442, and 678 genes encoding Argonaute, Dicer, and RdRP, respectively, were predicted. Based on the identification results, active site variation of Argonaute, diversification of Dicer, and sequence analysis of RdRP were discussed in a fungus-oriented manner. funRNA provides results from diverse bioinformatics programs and job submission forms for BLAST, BLASTMatrix, and ClustalW. Furthermore, sequence collections created in funRNA are synced with several gene family analysis portals and databases, offering further analysis opportunities. funRNA provides identification results from a broad taxonomic range and diverse analysis functions, and could be used in diverse comparative and evolutionary studies. It could serve as a versatile genomics workbench for key components of RNAi.

  3. Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

    PubMed

    Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

    2014-05-16

    Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

  4. RNA interference mediated in human primary cells via recombinant baculoviral vectors.

    PubMed

    Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

    2005-04-01

    The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

  5. Sex determination in beetles: Production of all male progeny by Parental RNAi knockdown of transformer

    PubMed Central

    Shukla, Jayendra Nath; Palli, Subba Reddy

    2012-01-01

    Sex in insects is determined by a cascade of regulators ultimately controlling sex-specific splicing of a transcription factor, Doublesex (Dsx). We recently identified homolog of dsx in the red flour beetle, Tribolium castaneum (Tcdsx). Here, we report on the identification and characterization of a regulator of Tcdsx splicing in T. castaneum. Two male-specific and one female-specific isoforms of T. castaneum transformer (Tctra) were identified. RNA interference-aided knockdown of Tctra in pupa or adults caused a change in sex from females to males by diverting the splicing of Tcdsx pre-mRNA to male-specific isoform. All the pupa and adults developed from Tctra dsRNA injected final instar larvae showed male-specific sexually dimorphic structures. Tctra parental RNAi caused an elimination of females from the progeny resulting in production of all male progeny. Transformer parental RNAi could be used to produce all male population for use in pest control though sterile male release methods. PMID:22924109

  6. RNA interference-based therapeutics: new strategies to fight infectious disease.

    PubMed

    López-Fraga, M; Wright, N; Jiménez, A

    2008-12-01

    For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.

  7. Lipid and polymeric carrier-mediated nucleic acid delivery

    PubMed Central

    Zhu, Lin; Mahato, Ram I

    2010-01-01

    Importance of the field Nucleic acids such as plasmid DNA, antisense oligonucleotide, and RNA interference (RNAi) molecules, have a great potential to be used as therapeutics for the treatment of various genetic and acquired diseases. To design a successful nucleic acid delivery system, the pharmacological effect of nucleic acids, the physiological condition of the subjects or sites, and the physicochemical properties of nucleic acid and carriers have to be thoroughly examined. Areas covered in this review The commonly used lipids, polymers and corresponding delivery systems are reviewed in terms of their characteristics, applications, advantages and limitations. What the reader will gain This article aims to provide an overview of biological barriers and strategies to overcome these barriers by properly designing effective synthetic carriers for nucleic acid delivery. Take home message A thorough understanding of biological barriers and the structure–activity relationship of lipid and polymeric carriers is the key for effective nucleic acid therapy. PMID:20836625

  8. Knockdown of genes in the Toll pathway reveals new lethal RNA interference targets for insect pest control.

    PubMed

    Bingsohn, L; Knorr, E; Billion, A; Narva, K E; Vilcinskas, A

    2017-02-01

    RNA interference (RNAi) is a promising alternative strategy for ecologically friendly pest management. However, the identification of RNAi candidate genes is challenging owing to the absence of laboratory strains and the seasonality of most pest species. Tribolium castaneum is a well-established model, with a strong and robust RNAi response, which can be used as a high-throughput screening platform to identify potential RNAi target genes. Recently, the cactus gene was identified as a sensitive RNAi target for pest control. To explore whether the spectrum of promising RNAi targets can be expanded beyond those found by random large-scale screening, to encompass others identified using targeted knowledge-based approaches, we constructed a Cactus interaction network. We tested nine genes in this network and found that the delivery of double-stranded RNA corresponding to fusilli and cactin showed lethal effects. The silencing of cactin resulted in 100% lethality at every developmental stage from the larva to the adult. The knockdown of pelle, Dorsal-related immunity factor and short gastrulation reduced or even prevented egg hatching in the next generation. The combination of such targets with lethal and parental RNAi effects can now be tested against different pest species in field studies. © 2016 The Royal Entomological Society.

  9. RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea.

    PubMed

    Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L; Mukherjee, Sunil Kumar; Sahoo, Lingaraj

    2017-01-01

    Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea.

  10. RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea

    PubMed Central

    Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L.; Mukherjee, Sunil Kumar

    2017-01-01

    Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea. PMID:29077738

  11. Citrus tristeza virus-based RNAi in citrus plants induces gene silencing in Diaphorina citri, a phloem-sap sucking insect vector of citrus greening disease (Huanglongbing).

    PubMed

    Hajeri, Subhas; Killiny, Nabil; El-Mohtar, Choaa; Dawson, William O; Gowda, Siddarame

    2014-04-20

    A transient expression vector based on Citrus tristeza virus (CTV) is unusually stable. Because of its stability it is being considered for use in the field to control Huanglongbing (HLB), which is caused by Candidatus Liberibacter asiaticus (CLas) and vectored by Asian citrus psyllid, Diaphorina citri. In the absence of effective control strategies for CLas, emphasis has been on control of D. citri. Coincident cohabitation in phloem tissue by CLas, D. citri and CTV was exploited to develop a novel method to mitigate HLB through RNA interference (RNAi). Since CTV has three RNA silencing suppressors, it was not known if CTV-based vector could induce RNAi in citrus. Yet, expression of sequences targeting citrus phytoene desaturase gene by CTV-RNAi resulted in photo-bleaching phenotype. CTV-RNAi vector, engineered with truncated abnormal wing disc (Awd) gene of D. citri, induced altered Awd expression when silencing triggers ingested by feeding D. citri nymphs. Decreased Awd in nymphs resulted in malformed-wing phenotype in adults and increased adult mortality. This impaired ability of D. citri to fly would potentially limit the successful vectoring of CLas bacteria between citrus trees in the grove. CTV-RNAi vector would be relevant for fast-track screening of candidate sequences for RNAi-mediated pest control. Copyright © 2014. Published by Elsevier B.V.

  12. Engineering host-derived resistance against plant parasites through RNA interference: challenges and opportunities.

    PubMed

    Runo, Steven

    2011-01-01

    RNA interference (RNAi) has rapidly advanced to become a powerful genetic tool and holds promise to revolutionizing agriculture by providing a strategy for controlling a wide array of crop pests. Numerous studies document RNAi efficacy in achieving silencing in viruses, insects, nematodes and weeds parasitizing crops. In general, host derived pest resistance through RNAi is achieved by genetically transforming host plants with double stranded RNA constructs targeted at essential parasite genes leading to generation of small interfering RNAs (siRNAs). Small interfering RNAs formed in the host are then delivered to the parasite and transported to target cells. Delivery can be oral - worms and insects, viral infections, viruses - or through a vascular connections - parasitic plants, while delivery to target cells is by cell to cell systemic movement of the silencing signal. Despite the overall optimism in generating pest resistant crops through RNAi-mediated silencing, some hurdles have recently begun to emerge. Presently, the main challenge is delivery of sufficient siRNAs, in the right cells, and at the right time to mount; a strong, durable, and broad-spectrum posttranscriptional gene silencing (PTGS) signal. This review highlights the novel strategies available for improving host derived RNAi resistance in downstream applied agriculture.

  13. The near demise and subsequent revival of classical genetics for investigating Caenorhabditis elegans embryogenesis: RNAi meets next-generation DNA sequencing.

    PubMed

    Bowerman, Bruce

    2011-10-01

    Molecular genetic investigation of the early Caenorhabditis elegans embryo has contributed substantially to the discovery and general understanding of the genes, pathways, and mechanisms that regulate and execute developmental and cell biological processes. Initially, worm geneticists relied exclusively on a classical genetics approach, isolating mutants with interesting phenotypes after mutagenesis and then determining the identity of the affected genes. Subsequently, the discovery of RNA interference (RNAi) led to a much greater reliance on a reverse genetics approach: reducing the function of known genes with RNAi and then observing the phenotypic consequences. Now the advent of next-generation DNA sequencing technologies and the ensuing ease and affordability of whole-genome sequencing are reviving the use of classical genetics to investigate early C. elegans embryogenesis.

  14. The novel ABC transporter ABCH1 is a potential target for RNAi-based insect pest control and resistance management.

    PubMed

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

    2015-09-03

    Insect pests cause serious crop damage and develop high-level resistance to chemical insecticides and Bacillus thuringiensis (Bt) insecticidal Cry toxins. A new promising approach for controlling them and overcoming this resistance is RNA interference (RNAi). The RNAi-based insect control strategy depends on the selection of suitable target genes. In this study, we cloned and characterized a novel ABC transporter gene PxABCH1 in diamondback moth, Plutella xylostella (L.). Phylogenetic analysis showed that PxABCH1 is closely related to ABCA and ABCG subfamily members. Spatial-temporal expression detection revealed that PxABCH1 was expressed in all tissues and developmental stages, and highest expressed in head and male adult. Midgut sequence variation and expression analyses of PxABCH1 in all the susceptible and Bt-resistant P. xylostella strains and the functional analysis by sublethal RNAi demonstrated that Cry1Ac resistance was independent of this gene. Silencing of PxABCH1 by a relatively high dose of dsRNA dramatically reduced its expression and resulted in larval and pupal lethal phenotypes in both susceptible and Cry1Ac-resistant P. xylostella strains. To our knowledge, this study provides the first insight into ABCH1 in lepidopterans and reveals it as an excellent target for RNAi-based insect pest control and resistance management.

  15. The novel ABC transporter ABCH1 is a potential target for RNAi-based insect pest control and resistance management

    PubMed Central

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

    2015-01-01

    Insect pests cause serious crop damage and develop high-level resistance to chemical insecticides and Bacillus thuringiensis (Bt) insecticidal Cry toxins. A new promising approach for controlling them and overcoming this resistance is RNA interference (RNAi). The RNAi-based insect control strategy depends on the selection of suitable target genes. In this study, we cloned and characterized a novel ABC transporter gene PxABCH1 in diamondback moth, Plutella xylostella (L.). Phylogenetic analysis showed that PxABCH1 is closely related to ABCA and ABCG subfamily members. Spatial-temporal expression detection revealed that PxABCH1 was expressed in all tissues and developmental stages, and highest expressed in head and male adult. Midgut sequence variation and expression analyses of PxABCH1 in all the susceptible and Bt-resistant P. xylostella strains and the functional analysis by sublethal RNAi demonstrated that Cry1Ac resistance was independent of this gene. Silencing of PxABCH1 by a relatively high dose of dsRNA dramatically reduced its expression and resulted in larval and pupal lethal phenotypes in both susceptible and Cry1Ac-resistant P. xylostella strains. To our knowledge, this study provides the first insight into ABCH1 in lepidopterans and reveals it as an excellent target for RNAi-based insect pest control and resistance management. PMID:26333918

  16. FlyPrimerBank: An Online Database for Drosophila melanogaster Gene Expression Analysis and Knockdown Evaluation of RNAi Reagents

    PubMed Central

    Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.

    2013-01-01

    The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746

  17. Autonomously folded α-helical lockers promote RNAi*

    NASA Astrophysics Data System (ADS)

    Guyader, Christian P. E.; Lamarre, Baptiste; de Santis, Emiliana; Noble, James E.; Slater, Nigel K.; Ryadnov, Maxim G.

    2016-10-01

    RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi.

  18. Autonomously folded α-helical lockers promote RNAi*

    PubMed Central

    Guyader, Christian P. E.; Lamarre, Baptiste; De Santis, Emiliana; Noble, James E.; Slater, Nigel K.; Ryadnov, Maxim G.

    2016-01-01

    RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi. PMID:27721465

  19. Autonomously folded α-helical lockers promote RNAi.

    PubMed

    Guyader, Christian P E; Lamarre, Baptiste; De Santis, Emiliana; Noble, James E; Slater, Nigel K; Ryadnov, Maxim G

    2016-10-10

    RNAi is an indispensable research tool with a substantial therapeutic potential. However, the complete transition of the approach to an applied capability remains hampered due to poorly understood relationships between siRNA delivery and gene suppression. Here we propose that interfacial tertiary contacts between α-helices can regulate siRNA cytoplasmic delivery and RNAi. We introduce a rationale of helical amphipathic lockers that differentiates autonomously folded helices, which promote gene silencing, from helices folded with siRNA, which do not. Each of the helical designs can deliver siRNA into cells via energy-dependent endocytosis, while only autonomously folded helices with pre-locked hydrophobic interfaces were able to promote statistically appreciable gene silencing. We propose that it is the amphipathic locking of interfacing helices prior to binding to siRNA that enables RNAi. The rationale offers structurally balanced amphipathic scaffolds to advance the exploitation of functional RNAi.

  20. RNAi therapeutics for brain cancer: current advancements in RNAi delivery strategies.

    PubMed

    Malhotra, Meenakshi; Toulouse, André; Godinho, Bruno M D C; Mc Carthy, David John; Cryan, John F; O'Driscoll, Caitriona M

    2015-10-01

    Malignant primary brain tumors are aggressive cancerous cells that invade the surrounding tissues of the central nervous system. The current treatment options for malignant brain tumors are limited due to the inability to cross the blood-brain barrier. The advancements in current research has identified and characterized certain molecular markers that are essential for tumor survival, progression, metastasis and angiogenesis. These molecular markers have served as therapeutic targets for the RNAi based therapies, which enable site-specific silencing of the gene responsible for tumor proliferation. However, to bring about therapeutic success, an efficient delivery carrier that can cross the blood-brain barrier and reach the targeted site is essential. The current review focuses on the potential of targeted, non-viral and viral particles containing RNAi therapeutic molecules as delivery strategies specifically for brain tumors.

  1. Dimethylated H3K27 Is a Repressive Epigenetic Histone Mark in the Protist Entamoeba histolytica and Is Significantly Enriched in Genes Silenced via the RNAi Pathway*

    PubMed Central

    Foda, Bardees M.; Singh, Upinder

    2015-01-01

    RNA interference (RNAi) is a fundamental biological process that plays a crucial role in regulation of gene expression in many organisms. Transcriptional gene silencing (TGS) is one of the important nuclear roles of RNAi. Our previous data show that Entamoeba histolytica has a robust RNAi pathway that links to TGS via Argonaute 2-2 (Ago2-2) associated 27-nucleotide small RNAs with 5′-polyphosphate termini. Here, we report the first repressive histone mark to be identified in E. histolytica, dimethylation of H3K27 (H3K27Me2), and demonstrate that it is enriched at genes that are silenced by RNAi-mediated TGS. An RNAi-silencing trigger can induce H3K27Me2 deposits at both episomal and chromosomal loci, mediating gene silencing. Our data support two phases of RNAi-mediated TGS: an active silencing phase where the RNAi trigger is present and both H3K27Me2 and Ago2-2 concurrently enrich at chromosomal loci; and an established silencing phase in which the RNAi trigger is removed, but gene silencing with H3K27Me2 enrichment persist independently of Ago2-2 deposition. Importantly, some genes display resistance to chromosomal silencing despite induction of functional small RNAs. In those situations, the RNAi-triggering plasmid that is maintained episomally gets partially silenced and has H3K27Me2 enrichment, but the chromosomal copy displays no repressive histone enrichment. Our data are consistent with a model in which H3K27Me2 is a repressive histone modification, which is strongly associated with transcriptional repression. This is the first example of an epigenetic histone modification that functions to mediate RNAi-mediated TGS in the deep-branching eukaryote E. histolytica. PMID:26149683

  2. Suppression of Bedbug’s Reproduction by RNA Interference of Vitellogenin

    PubMed Central

    Moriyama, Minoru; Hosokawa, Takahiro; Tanahashi, Masahiko; Nikoh, Naruo; Fukatsu, Takema

    2016-01-01

    Recent resurgence of the bedbug Cimex lectularius is a global problem on the public health. On account of the worldwide rise of insecticide-resistant bedbug populations, exploration of new approaches to the bedbug control and management is anticipated. In this context, gene silencing by RNA interference (RNAi) has been considered for its potential application to pest control and management, because RNAi enables specific suppression of target genes and thus flexible selection of target traits to be disrupted. In this study, in an attempt to develop a control strategy targeting reproduction of the bedbug, we investigated RNAi-mediated gene silencing of vitellogenin (Vg), a major yolk protein precursor essential for oogenesis. From the bedbug transcriptomes, we identified a typical Vg gene and a truncated Vg gene, which were designated as ClVg and ClVg-like, respectively. ClVg gene was highly expressed mainly in the fat body of adult females, which was more than 100 times higher than the expression level of ClVg-like gene, indicating that ClVg gene is the primary functional Vg gene in the bedbug. RNAi-mediated suppression of ClVg gene expression in adult females resulted in drastically reduced egg production, atrophied ovaries, and inflated abdomen due to hypertrophied fat bodies. These phenotypic consequences are expected not only to suppress the bedbug reproduction directly but also to deteriorate its feeding and survival indirectly via behavioral modifications. These results suggest the potential of ClVg gene as a promising target for RNAi-based population management of the bedbug. PMID:27096422

  3. How Golden Is Silence? Teaching Undergraduates the Power and Limits of RNA Interference

    ERIC Educational Resources Information Center

    Kuldell, Natalie H.

    2006-01-01

    It is hard and getting harder to strike a satisfying balance in teaching. Time dedicated to student-generated models or ideas is often sacrificed in an effort to "get through the syllabus." I describe a series of RNA interference (RNAi) experiments for undergraduate students that simultaneously explores fundamental concepts in gene regulation,…

  4. Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing.

    PubMed

    Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao

    2015-10-08

    Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and

  5. Ascorbic acid interference in the measurement of serum biochemical parameters: in vivo and in vitro studies.

    PubMed

    Martinello, Flávia; da Silva, Edson Luiz

    2006-04-01

    To investigate the negative interference of ascorbic acid in serum biochemical tests in relation to the dose of vitamin C intake and to the time of blood collection. Healthy volunteers (n = 18) consumed daily doses of vitamin C (0.25-4.0 g) for 1 week and serum parameters were assayed prior to the experiment and on the eighth day of consumption. Blood samples were collected 4, 12 and 24 h after vitamin C intake. Serum levels of ascorbic acid increased significantly after vitamin C ingestion inhibiting urate and total bilirubin tests 4 and 12 h after intake (P < 0.01). A significant negative interference occurred up to 24 h after consumption of 4 g vitamin C for the urate test. In contrast, ingestion of vitamin C did not show interference in glucose, triglyceride and cholesterol tests. Addition of ascorbic acid to serum inhibited the urate test to a similar extent to that observed after vitamin C intake. However, after ingesting vitamin C, the interference for the bilirubin test was greater than that of the in vitro interference. Commonly taken doses of supplementary vitamin C interfered negatively with the serum urate test based on the Trinder method, and with bilirubin metabolism.

  6. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens

    PubMed Central

    Meliopoulos, Victoria A.; Andersen, Lauren E.; Birrer, Katherine F.; Simpson, Kaylene J.; Lowenthal, John W.; Bean, Andrew G. D.; Stambas, John; Stewart, Cameron R.; Tompkins, S. Mark; van Beusechem, Victor W.; Fraser, Iain; Mhlanga, Musa; Barichievy, Samantha; Smith, Queta; Leake, Devin; Karpilow, Jon; Buck, Amy; Jona, Ghil; Tripp, Ralph A.

    2012-01-01

    Influenza virus encodes only 11 viral proteins but replicates in a broad range of avian and mammalian species by exploiting host cell functions. Genome-wide RNA interference (RNAi) has proven to be a powerful tool for identifying the host molecules that participate in each step of virus replication. Meta-analysis of findings from genome-wide RNAi screens has shown influenza virus to be dependent on functional nodes in host cell pathways, requiring a wide variety of molecules and cellular proteins for replication. Because rapid evolution of the influenza A viruses persistently complicates the effectiveness of vaccines and therapeutics, a further understanding of the complex host cell pathways coopted by influenza virus for replication may provide new targets and strategies for antiviral therapy. RNAi genome screening technologies together with bioinformatics can provide the ability to rapidly identify specific host factors involved in resistance and susceptibility to influenza virus, allowing for novel disease intervention strategies.—Meliopoulos, V. A., Andersen, L. E., Birrer, K. F., Simpson, K. J., Lowenthal, J. W., Bean, A. G. D., Stambas, J., Stewart, C. R., Tompkins, S. M., van Beusechem, V. W., Fraser, I., Mhlanga, M., Barichievy, S., Smith, Q., Leake, D., Karpilow, J., Buck, A., Jona, G., Tripp, R. A. Host gene targets for novel influenza therapies elucidated by high-throughput RNA interference screens. PMID:22247330

  7. Cardiac RNAi therapy using RAGE siRNA/deoxycholic acid-modified polyethylenimine complexes for myocardial infarction.

    PubMed

    Hong, Jueun; Ku, Sook Hee; Lee, Min Sang; Jeong, Ji Hoon; Mok, Hyejung; Choi, Donghoon; Kim, Sun Hwa

    2014-08-01

    Inflammatory response in myocardial ischemia-reperfusion injury plays a critical role in ventricular remodeling. To avoid deleterious effects of overwhelming inflammation, we blocked the expression of receptor for advanced glycation end-products (RAGE), a key mediator of the local and systemic inflammatory responses, via RNAi mechanism. Herein, a facial amphipathic deoxycholic acid-modified low molecular weight polyethylenimine (DA-PEI) was used as a siRNA delivery carrier to myocardium. The DA-PEI conjugate formed a stable complex with siRNA via electrostatic and hydrophobic interactions. The siRAGE/DA-PEI formulation having negligible toxicity could enhance intracellular delivery efficiency and successfully suppress RAGE expression both in vitro and in vivo. Furthermore, the cardiac administration of siRAGE/DA-PEI reduced apoptosis and inflammatory cytokine release, subsequently led to attenuation of left ventricular remodeling in rat myocardial infarction model. The potential therapeutic effects of RAGE gene silencing on myocardial ischemia-reperfusion injury may suggest that the siRAGE/DA-PEI delivery system can be considered as a promising strategy for treating myocardial infarction. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. RNA interference targets arbovirus replication in Culicoides cells.

    PubMed

    Schnettler, Esther; Ratinier, Maxime; Watson, Mick; Shaw, Andrew E; McFarlane, Melanie; Varela, Mariana; Elliott, Richard M; Palmarini, Massimo; Kohl, Alain

    2013-03-01

    Arboviruses are transmitted to vertebrate hosts by biting arthropod vectors such as mosquitoes, ticks, and midges. These viruses replicate in both arthropods and vertebrates and are thus exposed to different antiviral responses in these organisms. RNA interference (RNAi) is a sequence-specific RNA degradation mechanism that has been shown to play a major role in the antiviral response against arboviruses in mosquitoes. Culicoides midges are important vectors of arboviruses, known to transmit pathogens of humans and livestock such as bluetongue virus (BTV) (Reoviridae), Oropouche virus (Bunyaviridae), and likely the recently discovered Schmallenberg virus (Bunyaviridae). In this study, we investigated whether Culicoides cells possess an antiviral RNAi response and whether this is effective against arboviruses, including those with double-stranded RNA (dsRNA) genomes, such as BTV. Using reporter gene-based assays, we established the presence of a functional RNAi response in Culicoides sonorensis-derived KC cells which is effective in inhibiting BTV infection. Sequencing of small RNAs from KC and Aedes aegypti-derived Aag2 cells infected with BTV or the unrelated Schmallenberg virus resulted in the production of virus-derived small interfering RNAs (viRNAs) of 21 nucleotides, similar to the viRNAs produced during arbovirus infections of mosquitoes. In addition, viRNA profiles strongly suggest that the BTV dsRNA genome is accessible to a Dicer-type nuclease. Thus, we show for the first time that midge cells target arbovirus replication by mounting an antiviral RNAi response mainly resembling that of other insect vectors of arboviruses.

  9. Identification of highly effective target genes for RNAi-mediated control of emerald ash borer, Agrilus planipennis.

    PubMed

    Rodrigues, Thais B; Duan, Jian J; Palli, Subba R; Rieske, Lynne K

    2018-03-22

    Recent study has shown that RNA interference (RNAi) is efficient in emerald ash borer (EAB), Agrilus planipennis, and that ingestion of double-stranded RNA (dsRNA) targeting specific genes causes gene silencing and mortality in neonates. Here, we report on the identification of highly effective target genes for RNAi-mediated control of EAB. We screened 13 candidate genes in neonate larvae and selected the most effective target genes for further investigation, including their effect on EAB adults and on a non-target organism, Tribolium castaneum. The two most efficient target genes selected, hsp (heat shock 70-kDa protein cognate 3) and shi (shibire), caused up to 90% mortality of larvae and adults. In EAB eggs, larvae, and adults, the hsp is expressed at higher levels when compared to that of shi. Ingestion of dsHSP and dsSHI caused mortality in both neonate larvae and adults. Administration of a mixture of both dsRNAs worked better than either dsRNA by itself. In contrast, injection of EAB.dsHSP and EAB.dsSHI did not cause mortality in T. castaneum. Thus, the two genes identified cause high mortality in the EAB with no apparent phenotype effects in a non-target organism, the red flour beetle, and could be used in RNAi-mediated control of this invasive pest.

  10. RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1

    PubMed Central

    Keiser, Megan S.; Geoghegan, James C.; Boudreau, Ryan L.; Lennox, Kim A.; Davidson, Beverly L.

    2014-01-01

    Spinocerebellar Ataxia Type 1 (SCA1) is an autosomal dominant late onset neurodegenerative disease caused by an expanded polyglutamine tract in ataxin-1. Here, we compared the protective effects of overexpressing ataxin-1-like using recombinant AAVs, or reducing expression of mutant ataxin-1 using virally delivered RNA interference (RNAi), in a transgenic mouse model of SCA1. For the latter, we used an artificial microRNA (miR) design that optimizes potency, efficacy and safety to suppress ataxin-1 expression (miS1). Delivery of either ataxin-1-like or miS1 viral vectors to SCA1 mice cerebella resulted in widespread cerebellar Purkinje cell transduction and improved behavioral and histological phenotypes. Our data indicate the utility of either approach as a possible therapy for SCA1 patients. PMID:23583610

  11. Engineering cherry rootstocks with resistance to Prunus necrotic ring spot virus through RNAi-mediated silencing.

    PubMed

    Song, Guo-qing; Sink, Kenneth C; Walworth, Aaron E; Cook, Meridith A; Allison, Richard F; Lang, Gregory A

    2013-08-01

    Prunus necrotic ringspot virus (PNRSV) is a major pollen-disseminated ilarvirus that adversely affects many Prunus species. In this study, an RNA interference (RNAi) vector pART27-PNRSV containing an inverted repeat (IR) region of PNRSV was transformed into two hybrid (triploid) cherry rootstocks, 'Gisela 6' (GI 148-1) and 'Gisela 7'(GI 148-8)', which are tolerant and sensitive, respectively, to PNRSV infection. One year after inoculation with PNRSV plus Prune Dwarf Virus, nontransgenic 'Gisela 6' exhibited no symptoms but a significant PNRSV titre, while the transgenic 'Gisela 6' had no symptoms and minimal PNRSV titre. The nontransgenic 'Gisela 7' trees died, while the transgenic 'Gisela 7' trees survived. These results demonstrate the RNAi strategy is useful for developing viral resistance in fruit rootstocks, and such transgenic rootstocks may have potential to enhance production of standard, nongenetically modified fruit varieties while avoiding concerns about transgene flow and exogenous protein production that are inherent for transformed fruiting genotypes. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

  12. RNAi as a Routine Route Toward Breast Cancer Therapy

    DTIC Science & Technology

    2013-09-01

    Award Number: W81XWH-08-1-0572 TITLE: RNAi as a Routine Route Toward Breast Cancer Therapy...To) 1 SEP 2012 - 31 AUG 2013 4. TITLE AND SUBTITLE RNAi as a Routine Route Toward Breast Cancer Therapy 5a. CONTRACT NUMBER...generation RNAi library and made that available to the breast cancer community. This resource has nearly 75,000 independent, sequence verified clones

  13. RNA interference by feeding in vitro synthesized double-stranded RNA to planarians: methodology and dynamics

    PubMed Central

    Rouhana, Labib; Weiss, Jennifer A.; Forsthoefel, David J.; Lee, Hayoung; King, Ryan S.; Inoue, Takeshi; Shibata, Norito; Agata, Kiyokazu; Newmark, Phillip A.

    2013-01-01

    Background The ability to assess gene function is essential for understanding biological processes. Currently, RNA interference (RNAi) is the only technique available to assess gene function in planarians, in which it has been induced via injection of double-stranded RNA (dsRNA), soaking, or ingestion of bacteria expressing dsRNA. Results We describe a simple and robust RNAi protocol, involving in vitro synthesis of dsRNA that is fed to the planarians. Advantages of this protocol include the ability to produce dsRNA from any vector without subcloning, resolution of ambiguities in quantity and quality of input dsRNA, as well as time, and ease of application. We have evaluated the logistics of inducing RNAi in planarians using this methodology in careful detail, from the ingestion and processing of dsRNA in the intestine, to timing and efficacy of knockdown in neoblasts, germline, and soma. We also present systematic comparisons of effects of amount, frequency, and mode of dsRNA delivery. Conclusions This method gives robust and reproducible results and is amenable to high-throughput studies. Overall, this RNAi methodology provides a significant advance by combining the strengths of current protocols available for dsRNA delivery in planarians and has the potential to benefit RNAi methods in other systems. PMID:23441014

  14. Modulating the tumor microenvironment with RNA interference as a cancer treatment strategy.

    PubMed

    Zins, Karin; Sioud, Mouldy; Aharinejad, Seyedhossein; Lucas, Trevor; Abraham, Dietmar

    2015-01-01

    The tumor microenvironment is composed of accessory cells and immune cells in addition to extracellular matrix (ECM) components. The stromal compartment interacts with cancer cells in a complex crosstalk to support tumor development. Growth factors and cytokines produced by stromal cells support the growth of tumor cells and promote interaction with the vasculature to enhance tumor progression and invasion. The activation of autocrine and paracrine oncogenic signaling pathways by growth factors, cytokines, and proteases derived from both tumor cells and the stromal compartment is thought to play a major role in assisting tumor cells during metastasis. Consequently, targeting tumor-stroma interactions by RNA interference (RNAi)-based approaches is a promising strategy in the search for novel treatment modalities in human cancer. Recent advances in packaging technology including the use of polymers, peptides, liposomes, and nanoparticles to deliver small interfering RNAs (siRNAs) into target cells may overcome limitations associated with potential RNAi-based therapeutics. Newly developed nonviral gene delivery approaches have shown improved anticancer efficacy suggesting that RNAi-based therapeutics provide novel opportunities to elicit significant gene silencing and induce regression of tumor growth. This chapter summarizes our current understanding of the tumor microenvironment and highlights some potential targets for therapeutic intervention with RNAi-based cancer therapeutics.

  15. A Simple Laboratory Practical to Illustrate RNA Mediated Gene Interference Using Drosophila Cell Culture

    ERIC Educational Resources Information Center

    Buluwela, Laki; Kamalati, Tahereh; Photiou, Andy; Heathcote, Dean A.; Jones, Michael D.; Ali, Simak

    2010-01-01

    RNA mediated gene interference (RNAi) is now a key tool in eukaryotic cell and molecular biology research. This article describes a five session laboratory practical, spread over a seven day period, to introduce and illustrate the technique. During the exercise, students working in small groups purify PCR products that encode "in vitro"…

  16. Ebolavirus proteins suppress the effects of small interfering RNA by direct interaction with the mammalian RNA interference pathway.

    PubMed

    Fabozzi, Giulia; Nabel, Christopher S; Dolan, Michael A; Sullivan, Nancy J

    2011-03-01

    Cellular RNA interference (RNAi) provides a natural response against viral infection, but some viruses have evolved mechanisms to antagonize this form of antiviral immunity. To determine whether Ebolavirus (EBOV) counters RNAi by encoding suppressors of RNA silencing (SRSs), we screened all EBOV proteins using an RNAi assay initiated by exogenously delivered small interfering RNAs (siRNAs) against either an EBOV or a reporter gene. In addition to viral protein 35 (VP35), we found that VP30 and VP40 independently act as SRSs. Here, we present the molecular mechanisms of VP30 and VP35. VP30 interacts with Dicer independently of siRNA and with one Dicer partner, TRBP, only in the presence of siRNA. VP35 directly interacts with Dicer partners TRBP and PACT in an siRNA-independent fashion and in the absence of effects on interferon (IFN). Taken together, our findings elucidate a new mechanism of RNAi suppression that extends beyond the role of SRSs in double-stranded RNA (dsRNA) binding and IFN antagonism. The presence of three suppressors highlights the relevance of host RNAi-dependent antiviral immunity in EBOV infection and illustrates the importance of RNAi in shaping the evolution of RNA viruses.

  17. RNA interference can be used to disrupt gene function in tardigrades.

    PubMed

    Tenlen, Jennifer R; McCaskill, Shaina; Goldstein, Bob

    2013-05-01

    How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We showed that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments.

  18. An RNAi Screen To Identify Protein Phosphatases That Function Within the Drosophila Circadian Clock.

    PubMed

    Agrawal, Parul; Hardin, Paul E

    2016-12-07

    Circadian clocks in eukaryotes keep time via cell-autonomous transcriptional feedback loops. A well-characterized example of such a transcriptional feedback loop is in Drosophila, where CLOCK-CYCLE (CLK-CYC) complexes activate transcription of period (per) and timeless (tim) genes, rising levels of PER-TIM complexes feed-back to repress CLK-CYC activity, and degradation of PER and TIM permits the next cycle of CLK-CYC transcription. The timing of CLK-CYC activation and PER-TIM repression is regulated posttranslationally, in part through rhythmic phosphorylation of CLK, PER, and TIM. Previous behavioral screens identified several kinases that control CLK, PER, and TIM levels, subcellular localization, and/or activity, but two phosphatases that function within the clock were identified through the analysis of candidate genes from other pathways or model systems. To identify phosphatases that play a role in the clock, we screened clock cell-specific RNA interference (RNAi) knockdowns of all annotated protein phosphatases and protein phosphatase regulators in Drosophila for altered activity rhythms. This screen identified 19 protein phosphatases that lengthened or shortened the circadian period by ≥1 hr (p ≤ 0.05 compared to controls) or were arrhythmic. Additional RNAi lines, transposon inserts, overexpression, and loss-of-function mutants were tested to independently confirm these RNAi phenotypes. Based on genetic validation and molecular analysis, 15 viable protein phosphatases remain for future studies. These candidates are expected to reveal novel features of the circadian timekeeping mechanism in Drosophila that are likely to be conserved in all animals including humans. Copyright © 2016 Agrawal and Hardin.

  19. Knockdown of Midgut Genes by dsRNA-Transgenic Plant-Mediated RNA Interference in the Hemipteran Insect Nilaparvata lugens

    PubMed Central

    Zha, Wenjun; Peng, Xinxin; Chen, Rongzhi; Du, Bo; Zhu, Lili; He, Guangcun

    2011-01-01

    Background RNA interference (RNAi) is a powerful technique for functional genomics research in insects. Transgenic plants producing double-stranded RNA (dsRNA) directed against insect genes have been reported for lepidopteran and coleopteran insects, showing potential for field-level control of insect pests, but this has not been reported for other insect orders. Methodology/Principal Findings The Hemipteran insect brown planthopper (Nilaparvata lugens Stål) is a typical phloem sap feeder specific to rice (Oryza sativa L.). To analyze the potential of exploiting RNAi-mediated effects in this insect, we identified genes (Nlsid-1 and Nlaub) encoding proteins that might be involved in the RNAi pathway in N. lugens. Both genes are expressed ubiquitously in nymphs and adult insects. Three genes (the hexose transporter gene NlHT1, the carboxypeptidase gene Nlcar and the trypsin-like serine protease gene Nltry) that are highly expressed in the N. lugens midgut were isolated and used to develop dsRNA constructs for transforming rice. RNA blot analysis showed that the dsRNAs were transcribed and some of them were processed to siRNAs in the transgenic lines. When nymphs were fed on rice plants expressing dsRNA, levels of transcripts of the targeted genes in the midgut were reduced; however, lethal phenotypic effects after dsRNA feeding were not observed. Conclusions Our study shows that genes for the RNAi pathway (Nlsid-1 and Nlaub) are present in N. lugens. When insects were fed on rice plant materials expressing dsRNAs, RNA interference was triggered and the target genes transcript levels were suppressed. The gene knockdown technique described here may prove to be a valuable tool for further investigations in N. lugens. The results demonstrate the potential of dsRNA-mediated RNAi for field-level control of planthoppers, but appropriate target genes must be selected when designing the dsRNA-transgenic plants. PMID:21655219

  20. Intrajugular Vein Delivery of AAV9-RNAi Prevents Neuropathological Changes and Weight Loss in Huntington's Disease Mice

    PubMed Central

    Dufour, Brett D; Smith, Catherine A; Clark, Randall L; Walker, Timothy R; McBride, Jodi L

    2014-01-01

    Huntington's disease (HD) is a fatal neurological disorder caused by a CAG repeat expansion in the HTT gene, which encodes a mutant huntingtin protein (mHTT). The mutation confers a toxic gain of function on huntingtin, leading to widespread neurodegeneration and inclusion formation in many brain regions. Although the hallmark symptom of HD is hyperkinesia stemming from striatal degeneration, several other brain regions are affected which cause psychiatric, cognitive, and metabolic symptoms. Additionally, mHTT expression in peripheral tissue is associated with skeletal muscle atrophy, cardiac failure, weight loss, and diabetes. We, and others, have demonstrated a prevention of motor symptoms in HD mice following direct striatal injection of adeno-associated viral vector (AAV) serotype 1 encoding an RNA interference (RNAi) construct targeting mutant HTT mRNA (mHTT). Here, we expand these efforts and demonstrate that an intrajugular vein injection of AAV serotype 9 (AAV9) expressing a mutant HTT-specific RNAi construct significantly reduced mHTT expression in multiple brain regions and peripheral tissues affected in HD. Correspondingly, this approach prevented atrophy and inclusion formation in key brain regions as well as the severe weight loss germane to HD transgenic mice. These results demonstrate that systemic delivery of AAV9-RNAi may provide more widespread clinical benefit for patients suffering from HD. PMID:24390280

  1. Enhanced susceptibility of cancer cells to oncolytic rhabdo-virotherapy by expression of Nodamura virus protein B2 as a suppressor of RNA interference.

    PubMed

    Bastin, Donald; Aitken, Amelia S; Pelin, Adrian; Pikor, Larissa A; Crupi, Mathieu J F; Huh, Michael S; Bourgeois-Daigneault, Marie-Claude; Bell, John C; Ilkow, Carolina S

    2018-06-19

    Antiviral responses are barriers that must be overcome for efficacy of oncolytic virotherapy. In mammalian cells, antiviral responses involve the interferon pathway, a protein-signaling cascade that alerts the immune system and limits virus propagation. Tumour-specific defects in interferon signaling enhance viral infection and responses to oncolytic virotherapy, but many human cancers are still refractory to oncolytic viruses. Given that invertebrates, fungi and plants rely on RNA interference pathways for antiviral protection, we investigated the potential involvement of this alternative antiviral mechanism in cancer cells. Here, we detected viral genome-derived small RNAs, indicative of RNAi-mediated antiviral responses, in human cancer cells. As viruses may encode suppressors of the RNA interference pathways, we engineered an oncolytic vesicular stomatitis virus variant to encode the Nodamura virus protein B2, a known inhibitor of RNAi-mediated immune responses. B2-expressing oncolytic virus showed enhanced viral replication and cytotoxicity, impaired viral genome cleavage and altered microRNA processing in cancer cells. Our data establish the improved therapeutic potential of our novel virus which targets the RNAi-mediated antiviral defense of cancer cells.

  2. Induction and suppression of antiviral RNA interference by influenza A virus in mammalian cells.

    PubMed

    Li, Yang; Basavappa, Megha; Lu, Jinfeng; Dong, Shuwei; Cronkite, D Alexander; Prior, John T; Reinecker, Hans-Christian; Hertzog, Paul; Han, Yanhong; Li, Wan-Xiang; Cheloufi, Sihem; Karginov, Fedor V; Ding, Shou-Wei; Jeffrey, Kate L

    2016-12-05

    Influenza A virus (IAV) causes annual epidemics and occasional pandemics, and is one of the best-characterized human RNA viral pathogens 1 . However, a physiologically relevant role for the RNA interference (RNAi) suppressor activity of the IAV non-structural protein 1 (NS1), reported over a decade ago 2 , remains unknown 3 . Plant and insect viruses have evolved diverse virulence proteins to suppress RNAi as their hosts produce virus-derived small interfering RNAs (siRNAs) that direct specific antiviral defence 4-7 by an RNAi mechanism dependent on the slicing activity of Argonaute proteins (AGOs) 8,9 . Recent studies have documented induction and suppression of antiviral RNAi in mouse embryonic stem cells and suckling mice 10,11 . However, it is still under debate whether infection by IAV or any other RNA virus that infects humans induces and/or suppresses antiviral RNAi in mature mammalian somatic cells 12-21 . Here, we demonstrate that mature human somatic cells produce abundant virus-derived siRNAs co-immunoprecipitated with AGOs in response to IAV infection. We show that the biogenesis of viral siRNAs from IAV double-stranded RNA (dsRNA) precursors in infected cells is mediated by wild-type human Dicer and potently suppressed by both NS1 of IAV as well as virion protein 35 (VP35) of Ebola and Marburg filoviruses. We further demonstrate that the slicing catalytic activity of AGO2 inhibits IAV and other RNA viruses in mature mammalian cells, in an interferon-independent fashion. Altogether, our work shows that IAV infection induces and suppresses antiviral RNAi in differentiated mammalian somatic cells.

  3. RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans.

    PubMed

    Tops, Bastiaan B J; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C; Plasterk, Ronald H A; Ketting, René F

    2005-01-01

    In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of approximately 250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step.

  4. RDE-2 interacts with MUT-7 to mediate RNA interference in Caenorhabditis elegans

    PubMed Central

    Tops, Bastiaan B. J.; Tabara, Hiroaki; Sijen, Titia; Simmer, Femke; Mello, Craig C.; Plasterk, Ronald H. A.; Ketting, René F.

    2005-01-01

    In Caenorhabditis elegans, the activity of transposable elements is repressed in the germline. One of the mechanisms involved in this repression is RNA interference (RNAi), a process in which dsRNA targets cleavage of mRNAs in a sequence-specific manner. The first gene found to be involved in RNAi and transposon silencing in C.elegans is mut-7, a gene encoding a putative exoribonuclease. Here, we show that the MUT-7 protein resides in complexes of ∼250 kDa in the nucleus and in the cytosol. In addition, we find that upon triggering of RNAi the cytosolic MUT-7 complex increases in size. This increase is independent of the presence of target RNA, but does depend on the presence of RDE-1 and RDE-4, two proteins involved in small interfering RNA (siRNA) production. Finally, using a yeast two-hybrid screen, we identified RDE-2/MUT-8 as one of the other components of this complex. This protein is encoded by the rde-2/mut-8 locus, previously implicated in RNAi and transposon silencing. Using genetic complementation analysis, we show that the interaction between these two proteins is required for efficient RNAi in vivo. Together these data support a role for the MUT-7/RDE-2 complex downstream of siRNA formation, but upstream of siRNA mediated target RNA recognition, possibly indicating a role in the siRNA amplification step. PMID:15653635

  5. RNA Interference Using c-Myc-Conjugated Nanoparticles Suppresses Breast and Colorectal Cancer Models.

    PubMed

    Tangudu, Naveen K; Verma, Vinod K; Clemons, Tristan D; Beevi, Syed S; Hay, Trevor; Mahidhara, Ganesh; Raja, Meera; Nair, Rekha A; Alexander, Liza E; Patel, Anant B; Jose, Jedy; Smith, Nicole M; Zdyrko, Bogdan; Bourdoncle, Anne; Luzinov, Igor; Iyer, K Swaminathan; Clarke, Alan R; Dinesh Kumar, Lekha

    2015-05-01

    In this article, we report the development and preclinical validation of combinatorial therapy for treatment of cancers using RNA interference (RNAi). RNAi technology is an attractive approach to silence genes responsible for disease onset and progression. Currently, the critical challenge facing the clinical success of RNAi technology is in the difficulty of delivery of RNAi inducers, due to low transfection efficiency, difficulties of integration into host DNA and unstable expression. Using the macromolecule polyglycidal methacrylate (PGMA) as a platform to graft multiple polyethyleneimine (PEI) chains, we demonstrate effective delivery of small oligos (anti-miRs and mimics) and larger DNAs (encoding shRNAs) in a wide variety of cancer cell lines by successful silencing/activation of their respective target genes. Furthermore, the effectiveness of this therapy was validated for in vivo tumor suppression using two transgenic mouse models; first, tumor growth arrest and increased animal survival was seen in mice bearing Brca2/p53-mutant mammary tumors following daily intratumoral treatment with nanoparticles conjugated to c-Myc shRNA. Second, oral delivery of the conjugate to an Apc-deficient crypt progenitor colon cancer model increased animal survival and returned intestinal tissue to a non-wnt-deregulated state. This study demonstrates, through careful design of nonviral nanoparticles and appropriate selection of therapeutic gene targets, that RNAi technology can be made an affordable and amenable therapy for cancer. ©2015 American Association for Cancer Research.

  6. A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter

    PubMed Central

    Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang

    2009-01-01

    RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553

  7. Silencing the HaHR3 Gene by Transgenic Plant-mediated RNAi to Disrupt Helicoverpa armigera Development

    PubMed Central

    Xiong, Yehui; Zeng, Hongmei; Zhang, Yuliang; Xu, Dawei; Qiu, Dewen

    2013-01-01

    RNA interference (RNAi) caused by exogenous double-stranded RNA (dsRNA) has developed into a powerful technique in functional genomics, and to date it is widely used to down-regulate crucial physiology-related genes to control pest insects. A molt-regulating transcription factor gene, HaHR3, of cotton bollworm (Helicoverpa armigera) was selected as the target gene. Four different fragments covering the coding sequence (CDS) of HaHR3 were cloned into vector L4440 to express dsRNAs in Escherichia coli. The most effective silencing fragment was then cloned into a plant over-expression vector to express a hairpin RNA (hpRNA) in transgenic tobacco (Nicotiana tabacum). When H. armigera larvae were fed the E. coli or transgenic plants, the HaHR3 mRNA and protein levels dramatically decreased, resulting developmental deformity and larval lethality. The results demonstrate that both recombinant bacteria and transgenic plants could induce HaHR3 silence to disrupt H. armigera development, transgenic plant-mediated RNAi is emerging as a powerful approach for controlling insect pests. PMID:23630449

  8. RNA interference: from biology to drugs and therapeutics.

    PubMed

    Appasani, Krishnarao

    2004-07-01

    RNA interference (RNAi) is a newly discovered and popular technology platform among researchers not only in the fields of RNA biology and molecular cell biology. It has created excitement in clinical sciences such as oncology, neurology, endocrinology, infectious diseases and drug discovery. There is an urgent need to educate and connect academic and industry researchers for the purpose of knowledge transfer. Thus, GeneExpression Systems of Waltham organized its Second International Conference in Waltham City (May 2-4, 2004, MA, USA) on the theme of 'RNA interference: From Biology to Drugs & Therapeutics.' About 200 participants and 32 speakers attended this two and half-day event which was arranged in six scientific and three technology sessions and ended with a panel discussion. This report covers a few representative talks from academia, biotech and the drug industry.

  9. Analysis of Variability in HIV-1 Subtype A Strains in Russia Suggests a Combination of Deep Sequencing and Multitarget RNA Interference for Silencing of the Virus.

    PubMed

    Kretova, Olga V; Chechetkin, Vladimir R; Fedoseeva, Daria M; Kravatsky, Yuri V; Sosin, Dmitri V; Alembekov, Ildar R; Gorbacheva, Maria A; Gashnikova, Natalya M; Tchurikov, Nickolai A

    2017-02-01

    Any method for silencing the activity of the HIV-1 retrovirus should tackle the extremely high variability of HIV-1 sequences and mutational escape. We studied sequence variability in the vicinity of selected RNA interference (RNAi) targets from isolates of HIV-1 subtype A in Russia, and we propose that using artificial RNAi is a potential alternative to traditional antiretroviral therapy. We prove that using multiple RNAi targets overcomes the variability in HIV-1 isolates. The optimal number of targets critically depends on the conservation of the target sequences. The total number of targets that are conserved with a probability of 0.7-0.8 should exceed at least 2. Combining deep sequencing and multitarget RNAi may provide an efficient approach to cure HIV/AIDS.

  10. Lignin Down-regulation of Zea mays via dsRNAi and Klason Lignin Analysis

    PubMed Central

    Park, Sang-Hyuck; Ong, Rebecca Garlock; Mei, Chuansheng; Sticklen, Mariam

    2014-01-01

    To facilitate the use of lignocellulosic biomass as an alternative bioenergy resource, during biological conversion processes, a pretreatment step is needed to open up the structure of the plant cell wall, increasing the accessibility of the cell wall carbohydrates. Lignin, a polyphenolic material present in many cell wall types, is known to be a significant hindrance to enzyme access. Reduction in lignin content to a level that does not interfere with the structural integrity and defense system of the plant might be a valuable step to reduce the costs of bioethanol production. In this study, we have genetically down-regulated one of the lignin biosynthesis-related genes, cinnamoyl-CoA reductase (ZmCCR1) via a double stranded RNA interference technique. The ZmCCR1_RNAi construct was integrated into the maize genome using the particle bombardment method. Transgenic maize plants grew normally as compared to the wild-type control plants without interfering with biomass growth or defense mechanisms, with the exception of displaying of brown-coloration in transgenic plants leaf mid-ribs, husks, and stems. The microscopic analyses, in conjunction with the histological assay, revealed that the leaf sclerenchyma fibers were thinned but the structure and size of other major vascular system components was not altered. The lignin content in the transgenic maize was reduced by 7-8.7%, the crystalline cellulose content was increased in response to lignin reduction, and hemicelluloses remained unchanged. The analyses may indicate that carbon flow might have been shifted from lignin biosynthesis to cellulose biosynthesis. This article delineates the procedures used to down-regulate the lignin content in maize via RNAi technology, and the cell wall compositional analyses used to verify the effect of the modifications on the cell wall structure. PMID:25080235

  11. Lignin down-regulation of Zea mays via dsRNAi and klason lignin analysis.

    PubMed

    Park, Sang-Hyuck; Ong, Rebecca Garlock; Mei, Chuansheng; Sticklen, Mariam

    2014-07-23

    To facilitate the use of lignocellulosic biomass as an alternative bioenergy resource, during biological conversion processes, a pretreatment step is needed to open up the structure of the plant cell wall, increasing the accessibility of the cell wall carbohydrates. Lignin, a polyphenolic material present in many cell wall types, is known to be a significant hindrance to enzyme access. Reduction in lignin content to a level that does not interfere with the structural integrity and defense system of the plant might be a valuable step to reduce the costs of bioethanol production. In this study, we have genetically down-regulated one of the lignin biosynthesis-related genes, cinnamoyl-CoA reductase (ZmCCR1) via a double stranded RNA interference technique. The ZmCCR1_RNAi construct was integrated into the maize genome using the particle bombardment method. Transgenic maize plants grew normally as compared to the wild-type control plants without interfering with biomass growth or defense mechanisms, with the exception of displaying of brown-coloration in transgenic plants leaf mid-ribs, husks, and stems. The microscopic analyses, in conjunction with the histological assay, revealed that the leaf sclerenchyma fibers were thinned but the structure and size of other major vascular system components was not altered. The lignin content in the transgenic maize was reduced by 7-8.7%, the crystalline cellulose content was increased in response to lignin reduction, and hemicelluloses remained unchanged. The analyses may indicate that carbon flow might have been shifted from lignin biosynthesis to cellulose biosynthesis. This article delineates the procedures used to down-regulate the lignin content in maize via RNAi technology, and the cell wall compositional analyses used to verify the effect of the modifications on the cell wall structure.

  12. The Vasa homolog RDE-12 engages target mRNA and multiple Argonaute proteins to promote RNAi in C. elegans

    PubMed Central

    Shirayama, Masaki; Stanney, William; Gu, Weifeng; Seth, Meetu; Mello, Craig C.

    2014-01-01

    Summary Argonaute proteins (AGOs) are key nuclease effectors of RNA interference (RNAi) [1]. Although purified AGOs can mediate a single round of target-RNA cleavage in vitro, accessory factors are required for short-interfering (si)RNAs loading and to achieve multiple-target turnover [2, 3]. To identify AGO co-factors we immunoprecipitated the C. elegans AGO WAGO-1, which engages amplified small RNAs during RNAi [4]. These studies identified a robust association between WAGO-1 and a conserved Vasa ATPase-related protein RDE-12. rde-12 mutants are deficient in RNAi including viral suppression, and fail to produce amplified secondary siRNAs and certain endogenous siRNAs (endo-siRNAs). RDE-12 co-localizes with WAGO-1 in germline P-granules and in cytoplasmic and peri-nuclear foci in somatic cells. These findings and our genetic studies suggest that RDE-12 is first recruited to target mRNA by upstream AGOs (RDE-1 and ERGO-1) where it promotes small-RNA amplification and/or WAGO-1 loading. Downstream of these events, RDE-12 forms an RNase-resistant (target mRNA-independent) complex with WAGO-1 and may thus have additional functions in target mRNA surveillance and silencing. PMID:24684931

  13. In silico molecular docking analysis of the human Argonaute 2 PAZ domain reveals insights into RNA interference.

    PubMed

    Kandeel, Mahmoud; Kitade, Yukio

    2013-07-01

    RNA interference (RNAi) is a critical cellular pathway activated by double stranded RNA and regulates the gene expression of target mRNA. During RNAi, the 3' end of siRNA binds with the PAZ domain, followed by release and rebinding in a cyclic manner, which deemed essential for proper gene silencing. Recently, we provided the forces underlying the recognition of small interfering RNA by PAZ in a computational study based on the structure of Drosophila Argonaute 2 (Ago2) PAZ domain. We have now reanalyzed these data within the view of the new available structures from human Argonauts. While the parameters of weak binding are correlated with higher (RNAi) in the Drosophila model, a different profile is predicted with the human Ago2 PAZ domain. On the basis of the human Ago2 PAZ models, the indicators of stronger binding as the total binding energy and the free energy were associated with better RNAi efficacy. This discrepancy might be attributable to differences in the binding site topology and the difference in the conformation of the bound nucleotides.

  14. Physiological roles of trehalose in Leptinotarsa larvae revealed by RNA interference of trehalose-6-phosphate synthase and trehalase genes.

    PubMed

    Shi, Ji-Feng; Xu, Qing-Yu; Sun, Qiang-Kun; Meng, Qing-Wei; Mu, Li-Li; Guo, Wen-Chao; Li, Guo-Qing

    2016-10-01

    Trehalose is proposed to serve multiple physiological roles in insects. However, its importance remains largely unconfirmed. In the present paper, we knocked down either a trehalose biosynthesis gene (trehalose-6-phosphate synthase, LdTPS) or each of three degradation genes (soluble trehalases LdTRE1a, LdTRE1b or membrane-bound LdTRE2) in Leptinotarsa decemlineata by RNA interference (RNAi). Knockdown of LdTPS decreased trehalose content and caused larval and pupal lethality. The LdTPS RNAi survivors consumed a greater amount of foliage, obtained a heavier body mass, accumulated more glycogen, lipid and proline, and had a smaller amount of chitin compared with the controls. Ingestion of trehalose but not glucose rescued the food consumption increase and larval mass rise, increased survivorship, and recovered glycogen, lipid and chitin to the normal levels. In contrast, silencing of LdTRE1a increased trehalose content and resulted in larval and pupal lethality. The surviving LdTRE1a RNAi hypomorphs fed a smaller quantity of food, had a lighter body weight, depleted lipid and several glucogenic amino acids, and contained a smaller amount of chitin. Neither trehalose nor glucose ingestion rescued these LdTRE1a RNAi defects. Silencing of LdTRE1b caused little effects. Knockdown of LdTRE2 caused larval death, increased trehalose contents in several tissues and diminished glycogen in the brain-corpora cardiaca-corpora allata complex (BCC). Feeding glucose but not trehalose partially rescued the high mortality rate and recovered glycogen content in the BCC. It seems that trehalose is involved in feeding regulation, sugar absorption, brain energy supply and chitin biosynthesis in L. decemlineata larvae. Copyright © 2016 Elsevier Ltd. All rights reserved.

  15. RNA interference in a cestode reveals specific silencing of selected highly expressed gene transcripts.

    PubMed

    Pierson, Lisa; Mousley, Angela; Devine, Lynda; Marks, Nikki J; Day, Tim A; Maule, Aaron G

    2010-04-01

    Evolving RNA interference (RNAi) platforms are providing opportunities to probe gene function in parasitic helminths using reverse genetics. Although relatively robust methods for the application of RNAi in parasitic flatworms have been established, reports of successful RNAi are confined to three genera and there are no known reports of the application of RNAi to the class Cestoda. Here we report the successful application of RNAi to a cestode. Our target species was the common ruminant tapeworm, Moniezia expansa which can significantly impact the health/productivity of cattle, sheep and goats. Initial efforts aimed to silence the neuronally expressed neuropeptide F gene (Me-npf-1), which encodes one of the most abundant neuropeptides in flatworms and a homologue of vertebrate neuropeptide Y (NPY). Double stranded (ds)RNAs, delivered by electroporation and soaking (4-8h), failed to trigger consistent Me-npf-1 transcript knock-down in adult worms; small interfering RNAs (siRNAs) were also ineffective. Identical approaches resulted in significant and consistent transcript knock-down of actin transcript (71+/-4%) following soaking in Me-act-1 dsRNA. Similar successes were seen with hydrophobic lipid-binding protein (Me-lbp-1), with a dsRNA inducing significant target transcript reduction (72+/-5%). To confirm the validity of the observed transcript knock-downs we further investigated Me-act-1 RNAi worms for associated changes in protein levels, morphology and phenotype. Me-act-1 RNAi worms displayed significant reductions in both filamentous actin immunostaining (62+/-3%) and the amount of actin detected in Western blots (54+/-13%). Morphologically, Me-act-1 RNAi worms displayed profound tegumental disruption/blebbing. Further, muscle tension recordings from Me-act-1 RNAi worms revealed a significant reduction in both the number of worms contracting in response to praziquantel (20+/-12%) and in their contractile ability. These data demonstrate, to our knowledge for

  16. RNA Interference towards the Potato Psyllid, Bactericera cockerelli, Is Induced in Plants Infected with Recombinant Tobacco mosaic virus (TMV)

    PubMed Central

    Wuriyanghan, Hada; Falk, Bryce W.

    2013-01-01

    The potato/tomato psyllid, Bactericera cockerelli (B. cockerelli), is an important plant pest and the vector of the phloem-limited bacterium Candidatus Liberibacter psyllaurous (solanacearum), which is associated with the zebra chip disease of potatoes. Previously, we reported induction of RNA interference effects in B. cockerelli via in vitro-prepared dsRNA/siRNAs after intrathoracic injection, and after feeding of artificial diets containing these effector RNAs. In order to deliver RNAi effectors via plant hosts and to rapidly identify effective target sequences in plant-feeding B. cockerelli, here we developed a plant virus vector-based in planta system for evaluating candidate sequences. We show that recombinant Tobacco mosaic virus (TMV) containing B. cockerelli sequences can efficiently infect and generate small interfering RNAs in tomato (Solanum lycopersicum), tomatillo (Physalis philadelphica) and tobacco (Nicotiana tabacum) plants, and more importantly delivery of interfering sequences via TMV induces RNAi effects, as measured by actin and V-ATPase mRNA reductions, in B. cockerelli feeding on these plants. RNAi effects were primarily detected in the B. cockerelli guts. In contrast to our results with TMV, recombinant Potato virus X (PVX) and Tobacco rattle virus (TRV) did not give robust infections in all plants and did not induce detectable RNAi effects in B. cockerelli. The greatest RNA interference effects were observed when B. cockerelli nymphs were allowed to feed on leaf discs collected from inoculated or lower expanded leaves from corresponding TMV-infected plants. Tomatillo plants infected with recombinant TMV containing B. cockerelli actin or V-ATPase sequences also showed phenotypic effects resulting in decreased B. cockerelli progeny production as compared to plants infected by recombinant TMV containing GFP. These results showed that RNAi effects can be achieved in plants against the phloem feeder, B. cockerelli, and the TMV-plant system will

  17. RNA interference technology in crop protection against arthropod pests, pathogens and nematodes.

    PubMed

    Zotti, Moises; Dos Santos, Ericmar Avila; Cagliari, Deise; Christiaens, Olivier; Taning, Clauvis Nji Tizi; Smagghe, Guy

    2018-06-01

    Scientists have made significant progress in understanding and unraveling several aspects of double-stranded RNA (dsRNA)-mediated gene silencing during the last two decades. Now that the RNA interference (RNAi) mechanism is well understood, it is time to consider how to apply the acquired knowledge to agriculture and crop protection. Some RNAi-based products are already available for farmers and more are expected to reach the market soon. Tailor-made dsRNA as an active ingredient for biopesticide formulations is considered a raw material that can be used for diverse purposes, from pest control and bee protection against viruses to pesticide resistance management. The RNAi mechanism works at the messenger RNA (mRNA) level, exploiting a sequence-dependent mode of action, which makes it unique in potency and selectivity compared with conventional agrochemicals. Furthermore, the use of RNAi in crop protection can be achieved by employing plant-incorporated protectants through plant transformation, but also by non-transformative strategies such as the use of formulations of sprayable RNAs as direct control agents, resistance factor repressors or developmental disruptors. In this review, RNAi is presented in an agricultural context (discussing products that have been launched on the market or will soon be available), and we go beyond the classical presentation of successful examples of RNAi in pest-insect control and comprehensively explore its potential for the control of plant pathogens, nematodes and mites, and to fight against diseases and parasites in beneficial insects. Moreover, we also discuss its use as a repressor for the management of pesticide-resistant weeds and insects. Finally, this review reports on the advances in non-transformative dsRNA delivery and the production costs of dsRNA, and discusses environmental considerations. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  18. RNAi-mediated resistance to whitefly (Bemisia tabaci) in genetically engineered lettuce (Lactuca sativa).

    PubMed

    Ibrahim, Abdulrazak B; Monteiro, Tatiane R; Cabral, Glaucia B; Aragão, Francisco J L

    2017-10-01

    RNA interference (RNAi)-based transgenic technologies have evolved as potent biochemical tools for silencing specific genes of plant pathogens and pests. The approach has been demonstrated to be useful in silencing genes in insect species. Here, we report on the successful construction of RNAi-based plasmid containing an interfering cassette designed to generate dsRNAs that target a novel v-ATPase transcript in whitefly (Bemisia tabaci), an important agricultural pest in tropical and sub-tropical regions. The presence of the transgene was confirmed in T 0 and T 1 generations of transgenic lettuce lines, segregating in a Mendelian fashion. Seven lines were infested with whiteflies and monitored over a period of 32 days. Analysis of mortality showed that within five days of feeding, insects on transgenic plants showed a mortality rate of 83.8-98.1%. In addition, a reduced number of eggs (95 fold less) was observed in flies feeding on transgenic lettuce plants than insects on control lines. Quantitative reverse transcription PCR showed decreased expression level of endogenous v-ATPase gene in whiteflies feeding on transgenic plants. This technology is a foundation for the production of whitefly-resistant commercial crops, improving agricultural sustainability and food security, reducing the use of more environmentally aggressive methods of pest control.

  19. The DEAD box helicase RDE-12 promotes amplification of RNAi in cytoplasmic foci in C. elegans

    PubMed Central

    Yang, Huan; Vallandingham, Jim; Shiu, Philip; Li, Hua; Hunter, Craig P.; Mak, Ho Yi

    2014-01-01

    Summary RNA interference (RNAi) is a potent mechanism for down-regulating gene expression. Conserved RNAi pathway components are found in animals, plants, fungi and other eukaryotes [1–3]. In C. elegans, the RNAi response is greatly amplified by the synthesis of abundant secondary siRNAs [4–6]. Exogenous double stranded RNA is processed by Dicer and RDE-1/Argonaute into primary siRNA that guides target mRNA recognition. The RDE-10/RDE-11 complex and the RNA dependent RNA polymerase RRF-1 then engage the target mRNA for secondary siRNA synthesis [7, 8]. However, the molecular link between primary siRNA production and secondary siRNA synthesis remains largely unknown. Furthermore, it is unclear if the sub-cellular sites for target mRNA recognition and degradation coincide with sites where siRNA synthesis and amplification occur. In the C. elegans germline, cytoplasmic P granules at the nuclear pores and perinuclear Mutator foci contribute to target mRNA surveillance and siRNA amplification, respectively [9–11]. We report that RDE-12, a conserved FG domain containing DEAD-box helicase, localizes in P-granules and cytoplasmic foci that are enriched in RSD-6 but are excluded from the Mutator foci. Our results suggest that RDE-12 promotes secondary siRNA synthesis by orchestrating the recruitment of RDE-10 and RRF-1 to primary siRNA targeted mRNA in distinct cytoplasmic compartments. PMID:24684930

  20. RNA interference of tubulin genes has lethal effects in Mythimna separate.

    PubMed

    Wang, Jin-da; Wang, Ya-Ru; Wang, Yong-Zhi; Wang, Wei-Zhong; Wang, Rong; Gao, San-Ji

    2018-05-23

    RNAi (RNA interference) is a technology for silencing expression of target genes via sequence-specific double-stranded RNA (dsRNA). Recently, dietary introduction of bacterially expressed dsRNA has shown great potential in the field of pest management. Identification of potential candidate genes for RNAi is the first step in this application. The oriental armyworm, Mythimna separata Walker (Lepidoptera: Noctuidae) is a polyphagous, migratory pest, and outbreaks have led to severe crop damage in China. In the present study, two tubulin genes were chosen as target genes because of their crucial role in insect development. Both Msα-tubulin and Msβ-tubulin genes are expressed across all life stages and are highly expressed in the head and epidermis. Feeding of bacterially expressed dsRNA of Msα-tubulin and Msβ-tubulin to third-instar larvae knocked down target mRNAs. A lethal phenotype was observed with knockdown of Msα-tubulin and Msβ-tubulin concurrent with reduction in body weight. Bacterially expressed dsRNA can be used to control M. separata, and tubulin genes could be effective candidate genes for an RNAi-based control strategy of this pest. Copyright © 2017. Published by Elsevier B.V.

  1. RNA interference targeting cytosolic NADP(+)-dependent isocitrate dehydrogenase exerts anti-obesity effect in vitro and in vivo.

    PubMed

    Nam, Woo Suk; Park, Kwon Moo; Park, Jeen-Woo

    2012-08-01

    A metabolic abnormality in lipid biosynthesis is frequently associated with obesity and hyperlipidemia. Nicotinamide adenine dinucleotide phosphate-oxidase (NADPH) is an essential reducing equivalent for numerous enzymes required in fat and cholesterol biosynthesis. Cytosolic NADP(+)-dependent isocitrate dehydrogenase (IDPc) has been proposed as a key enzyme for supplying cytosolic NADPH. We report here that knockdown of IDPc expression by Ribonucleic acid (RNA) interference (RNAi) inhibited adipocyte differentiation and lipogenesis in 3T3-L1 preadipocytes and mice. Attenuated IDPc expression by IDPc small interfering RNA (siRNA) resulted in a reduction of differentiation and triglyceride level and adipogenic protein expression as well as suppression of glucose uptake in cultured adipocytes. In addition, the attenuation of Nox activity and Reactive oxygen species (ROS) generation accompanied with knockdown of IDPc was associated with inhibition of adipogenesis and lipogenesis. The loss of body weight and the reduction of triglyceride level were also observed in diet-induced obese mice transduced with IDPc short-hairpin (shRNA). Taken together, the inhibiting effect of RNAi targeting IDPc on adipogenesis and lipid biosynthesis is considered to be of therapeutic value in the treatment and prevention of obesity and obesity-associated metabolic syndrome. © 2012 Elsevier B.V. All rights reserved.

  2. On future's doorstep: RNA interference and the pharmacopeia of tomorrow.

    PubMed

    Gewirtz, Alan M

    2007-12-01

    Small molecules and antibodies have revolutionized the treatment of malignant diseases and appear promising for the treatment of many others. Nonetheless, there are many candidate therapeutic targets that are not amenable to attack by the current generation of targeted therapies, and in a small but growing number of patients, resistance to initially successful treatments evolves. This Review Series on the medicinal promise of posttranscriptional gene silencing with small interfering RNA and other molecules capable of inducing RNA interference (RNAi) is motivated by the hypothesis that effectors of RNAi can be developed into effective drugs for treating malignancies as well as many other types of disease. As this Review Series points out, there is still much to do, but many in the field now hope that the time has finally arrived when "antisense" therapies will finally come of age and fulfill their promise as the magic bullets of the 21st century.

  3. The double-stranded RNA binding protein RDE-4 can act cell autonomously during feeding RNAi in C. elegans

    PubMed Central

    Raman, Pravrutha; Zaghab, Soriayah M.; Traver, Edward C.

    2017-01-01

    Abstract Long double-stranded RNA (dsRNA) can silence genes of matching sequence upon ingestion in many invertebrates and is therefore being developed as a pesticide. Such feeding RNA interference (RNAi) is best understood in the worm Caenorhabditis elegans, where the dsRNA-binding protein RDE-4 initiates silencing by recruiting an endonuclease to process long dsRNA into short dsRNA. These short dsRNAs are thought to move between cells because muscle-specific rescue of rde-4 using repetitive transgenes enables silencing in other tissues. Here, we extend this observation using additional promoters, report an inhibitory effect of repetitive transgenes, and discover conditions for cell-autonomous silencing in animals with tissue-specific rescue of rde-4. While expression of rde-4(+) in intestine, hypodermis, or neurons using a repetitive transgene can enable silencing also in unrescued tissues, silencing can be inhibited wihin tissues that express a repetitive transgene. Single-copy transgenes that express rde-4(+) in body-wall muscles or hypodermis, however, enable silencing selectively in the rescued tissue but not in other tissues. These results suggest that silencing by the movement of short dsRNA between cells is not an obligatory feature of feeding RNAi in C. elegans. We speculate that similar control of dsRNA movement could modulate tissue-specific silencing by feeding RNAi in other invertebrates. PMID:28541563

  4. Knockdown of RNA interference pathway genes impacts the fitness of western corn rootworm.

    PubMed

    Davis-Vogel, Courtney; Ortiz, Angel; Procyk, Lisa; Robeson, Jonathan; Kassa, Adane; Wang, Yiwei; Huang, Emily; Walker, Carl; Sethi, Amit; Nelson, Mark E; Sashital, Dipali G

    2018-05-18

    Western corn rootworm (Diabrotica virgifera virgifera) is a serious agricultural pest known for its high adaptability to various management strategies, giving rise to a continual need for new control options. Transgenic maize expressing insecticidal RNAs represents a novel mode of action for rootworm management that is dependent on the RNA interference (RNAi) pathways of the insect for efficacy. Preliminary evidence suggests that western corn rootworm could develop broad resistance to all insecticidal RNAs through changes in RNAi pathway genes; however, the likelihood of field-evolved resistance occurring through this mechanism remains unclear. In the current study, eight key genes involved in facilitating interference in the microRNA and small interfering RNA pathways were targeted for knockdown in order to evaluate impact on fitness of western corn rootworm. These genes include drosha, dicer-1, dicer-2, pasha, loquacious, r2d2, argonaute 1, and argonaute 2. Depletion of targeted transcripts in rootworm larvae led to changes in microRNA expression, decreased ability to pupate, reduced adult beetle emergence, and diminished reproductive capacity. The observed effects do not support evolution of resistance through changes in expression of these eight genes due to reduced insect fitness.

  5. Development of RNAi method for screening candidate genes to control emerald ash borer, Agrilus planipennis.

    PubMed

    Rodrigues, Thais B; Rieske, Lynne K; J Duan, Jian; Mogilicherla, Kanakachari; Palli, Subba R

    2017-08-07

    The ingestion of double-strand RNAs (dsRNA) targeting essential genes in an insect could cause mortality. Based on this principle, a new generation of insect control methods using RNA interference (RNAi) are being developed. In this work, we developed a bioassay for oral delivery of dsRNA to an invasive forest and urban tree pest, the emerald ash borer (EAB, Agrilus planipennis). EAB feeds and develops beneath the bark, killing trees rapidly. This behavior, coupled with the lack of a reliable artificial diet for rearing larvae and adults, make them difficult to study. We found that dsRNA is transported and processed to siRNAs by EAB larvae within 72 h after ingestion. Also, feeding neonate larvae with IAP (inhibitor of apoptosis) or COP (COPI coatomer, β subunit) dsRNA silenced their target genes and caused mortality. Both an increase in the concentration of dsRNA fed and sequential feeding of two different dsRNAs increased mortality. Here we provide evidence for successful RNAi in EAB, and demonstrate the development of a rapid and effective bioassay for oral delivery of dsRNA to screen additional genes.

  6. Establishment of lysozyme gene RNA interference systemand its involvement in salinity tolerance in sea cucumber (Apostichopus japonicus).

    PubMed

    Tian, Yi; Jiang, Yanan; Shang, Yanpeng; Zhang, Yu-Peng; Geng, Chen-Fan; Wang, Li-Qiang; Chang, Ya-Qing

    2017-06-01

    The lysozyme gene was silenced using RNA interference (RNAi) to analyze the function of lysozyme in sea cucumber under salt stress. The interfering efficiency of four lysozyme RNAi oligos ranged from 0.55 to 0.70. From the four oligos, p-miR-L245 was used for further interfering experiments because it had the best silencing efficiency. Peristomial film injection of p-miR-L245 (10 μg) was used for further interfering experiments. The lowest gene expression, determined by RT-PCR assay, in muscle, coelomic fluid, and parapodium occurred 48 h after p-miR-L245 injection, while that of body wall and tube foot was 96 h and 24 h, respectively. Lysozyme activity in muscle and body wall was significantly lower than the controls. The lowest lysozyme activity in muscle, body wall and parapodium, was found at 48, 72, and 48 h, respectively, which was consistent with the transcription expression of lysozyme. The lowest point of lysozyme activity was at 96 h in coelomic fluid and tube foot, which was laid behind lysozyme expression in transcription level. The expression profile of the lysozyme transcription level and lysozyme activity in the body wall and tube foot increased at 12 h after p-miR-L245 injection before the interference effect appeared. NKA gene expression was expressed at a high level in the positive control (PC) and negative control (NC) groups at 12, 24, and 48 h, while NKA was expressed at low levels in the lysozyme RNAi injection group at 12 and 24 h. The level of NKA gene expression recovered to the level of the PC and NC group at 48, 72, and 96 h after the lysozyme RNAi injection. NKCC1 gene expression was high in the PC and NC groups at 96 h, while the NKCC1 was expressed at a low level 96 h after lysozyme RNAi injection. The results suggest that lysozyme decay involves NKA and NKCC1 gene expression under salinity 18 psμ. The K + and Cl - concentration after lysozyme RNAi injection was lower than in the PC and NC group. Copyright © 2017

  7. RNA interference can be used to disrupt gene function in tardigrades

    PubMed Central

    Tenlen, Jennifer R.; McCaskill, Shaina; Goldstein, Bob

    2012-01-01

    How morphological diversity arises is a key question in evolutionary developmental biology. As a long-term approach to address this question, we are developing the water bear Hypsibius dujardini (Phylum Tardigrada) as a model system. We expect that using a close relative of two well-studied models, Drosophila (Phylum Arthropoda) and Caenorhabditis elegans (Phylum Nematoda), will facilitate identifying genetic pathways relevant to understanding the evolution of development. Tardigrades are also valuable research subjects for investigating how organisms and biological materials can survive extreme conditions. Methods to disrupt gene activity are essential to each of these efforts, but no such method yet exists for the Phylum Tardigrada. We developed a protocol to disrupt tardigrade gene functions by double-stranded RNA-mediated RNA interference (RNAi). We show that targeting tardigrade homologs of essential developmental genes by RNAi produced embryonic lethality, whereas targeting green fluorescent protein did not. Disruption of gene functions appears to be relatively specific by two criteria: targeting distinct genes resulted in distinct phenotypes that were consistent with predicted gene functions, and by RT-PCR, RNAi reduced the level of a target mRNA and not a control mRNA. These studies represent the first evidence that gene functions can be disrupted by RNAi in the phylum Tardigrada. Our results form a platform for dissecting tardigrade gene functions for understanding the evolution of developmental mechanisms and survival in extreme environments. PMID:23187800

  8. A novel therapeutic strategy for cartilage diseases based on lipid nanoparticle-RNAi delivery system.

    PubMed

    Wang, Shaowei; Wei, Xiaochun; Sun, Xiaojuan; Chen, Chongwei; Zhou, Jingming; Zhang, Ge; Wu, Heng; Guo, Baosheng; Wei, Lei

    2018-01-01

    Cartilage degeneration affects millions of people but preventing its degeneration is a big challenge. Although RNA interference (RNAi) has been used in human trials via silencing specific genes, the cartilage RNAi has not been possible to date because the cartilage is an avascular and very dense tissue with very low permeability. The objective of this study was to develop and validate a novel lipid nanoparticle (LNP)-siRNA delivery system that can prevent cartilage degeneration by knocking down specific genes. LNP transfection efficiency was evaluated in vitro and ex vivo. Indian Hedgehog ( Ihh ) has been correlated with cartilage degeneration. The in vivo effects of LNP-Ihh siRNA complexes on cartilage degeneration were evaluated in a rat model of surgery-induced osteoarthritis (OA). In vitro, 100% of chondrocytes were transfected with siRNA in the LNP-siRNA group. In accordance with the cell culture results, red positive signals could be detected even in the deep layer of cartilage tissue cultures treated by LNP-beacon. In vivo data showed that LNP is specific for cartilage, since positive signals were detected by fluorescence molecular tomography and confocal microscopy in joint cartilage injected with LNP-beacon, but not on the surface of the synovium. In the rat model of OA, intraarticular injection of LNP-Ihh siRNA attenuated OA progression, and PCR results showed LNP-Ihh siRNA exerted a positive impact on anabolic metabolism and negative impact on catabolic metabolism. This study demonstrates that our LNP-RNAi delivery system has a significantly chondroprotective effect that attenuates cartilage degeneration and holds great promise as a powerful tool for treatment of cartilage diseases by knocking down specific genes.

  9. Using RNA Interference to Reveal Genetic Vulnerabilities in Human Cancer Cells

    DTIC Science & Technology

    2005-07-01

    pl of RNase/DNase free water and performed PCR amplification in 50pl reaction volumes using Invitrogen’s Platinum® Pfx DNA Polymerase . To obtain a...destroyed1’ 2. This pathway, known as RNA interference (RNAi), has been exploited in organisms ranging from plants to fungi to animals for...experimentally alter its targeting capability. Indeed such strategies have previously succeeded in both plants and animals23󈧜. My initial studies

  10. Precision breeding for RNAi suppression of a major 4-coumarate:coenzyme A ligase gene improves cell wall saccharification from field grown sugarcane.

    PubMed

    Jung, Je Hyeong; Kannan, Baskaran; Dermawan, Hugo; Moxley, Geoffrey W; Altpeter, Fredy

    2016-11-01

    Sugarcane (Saccharum spp. hybrids) is a major feedstock for commercial bioethanol production. The recent integration of conversion technologies that utilize lignocellulosic sugarcane residues as well as sucrose from stem internodes has elevated bioethanol yields. RNAi suppression of lignin biosynthetic enzymes is a successful strategy to improve the saccharification of lignocellulosic biomass. 4-coumarate:coenzyme A ligase (4CL) is a key enzyme in the biosynthesis of phenylpropanoid metabolites, such as lignin and flavonoids. Identifying a major 4CL involved in lignin biosynthesis among multiple isoforms with functional divergence is key to manipulate lignin biosynthesis. In this study, two full length 4CL genes (Sh4CL1 and Sh4CL2) were isolated and characterized in sugarcane. Phylogenetic, expression and RNA interference (RNAi) analysis confirmed that Sh4CL1 is a major lignin biosynthetic gene. An intragenic precision breeding strategy may facilitate the regulatory approval of the genetically improved events and was used for RNAi suppression of Sh4CL1. Both, the RNAi inducing cassette and the expression cassette for the mutated ALS selection marker consisted entirely of DNA sequences from sugarcane or the sexually compatible species Sorghum bicolor. Field grown sugarcane with intragenic RNAi suppression of Sh4CL1 resulted in reduction of the total lignin content by up to 16.5 % along with altered monolignol ratios without reduction in biomass yield. Mature, field grown, intragenic sugarcane events displayed 52-76 % improved saccharification efficiency of lignocellulosic biomass compared to wild type (WT) controls. This demonstrates for the first time that an intragenic approach can add significant value to lignocellulosic feedstocks for biofuel and biochemical production.

  11. Delivery of RNAi reagents in murine models of obesity and diabetes.

    PubMed

    Wilcox, Denise M; Yang, Ruojing; Morgan, Sherry J; Nguyen, Phong T; Voorbach, Martin J; Jung, Paul M; Haasch, Deanna L; Lin, Emily; Bush, Eugene N; Opgenorth, Terry J; Jacobson, Peer B; Collins, Christine A; Rondinone, Cristina M; Surowy, Terry; Landschulz, Katherine T

    2006-11-29

    RNA interference (RNAi) is an exciting new tool to effect acute in vivo knockdown of genes for pharmacological target validation. Testing the application of this technology to metabolic disease targets, three RNAi delivery methods were compared in two frequently utilized preclinical models of obesity and diabetes, the diet-induced obese (DIO) and B6.V-Lep/J (ob/ob) mouse. Intraperitoneal (i.p.) and high pressure hydrodynamic intravenous (i.v.) administration of naked siRNA, and low pressure i.v. administration of shRNA-expressing adenovirus were assessed for both safety and gene knockdown efficacy using constructs targeting cJun N-terminal kinase 1 (JNK1). Hydrodynamic delivery of siRNA lowered liver JNK1 protein levels 40% in DIO mice, but was accompanied by iatrogenic liver damage. The ob/ob model proved even more intolerant of this technique, with hydrodynamic delivery resulting in severe liver damage and death of most animals. While well-tolerated, i.p. injections of siRNA in DIO mice did not result in any knockdown or phenotypic changes in the mice. On the other hand, i.v. injected adenovirus expressing shRNA potently reduced expression of JNK1 in vivo by 95% without liver toxicity. In conclusion, i.p. and hydrodynamic injections of siRNA were ineffective and/or inappropriate for in vivo gene targeting in DIO and ob/ob mice, while adenovirus-mediated delivery of shRNA provided a relatively benign and effective method for exploring liver target silencing.

  12. False negative rates in Drosophila cell-based RNAi screens: a case study

    PubMed Central

    2011-01-01

    Background High-throughput screening using RNAi is a powerful gene discovery method but is often complicated by false positive and false negative results. Whereas false positive results associated with RNAi reagents has been a matter of extensive study, the issue of false negatives has received less attention. Results We performed a meta-analysis of several genome-wide, cell-based Drosophila RNAi screens, together with a more focused RNAi screen, and conclude that the rate of false negative results is at least 8%. Further, we demonstrate how knowledge of the cell transcriptome can be used to resolve ambiguous results and how the number of false negative results can be reduced by using multiple, independently-tested RNAi reagents per gene. Conclusions RNAi reagents that target the same gene do not always yield consistent results due to false positives and weak or ineffective reagents. False positive results can be partially minimized by filtering with transcriptome data. RNAi libraries with multiple reagents per gene also reduce false positive and false negative outcomes when inconsistent results are disambiguated carefully. PMID:21251254

  13. Homo sapiens Systemic RNA Interference-defective-1 Transmembrane Family Member 1 (SIDT1) Protein Mediates Contact-dependent Small RNA Transfer and MicroRNA-21-driven Chemoresistance*

    PubMed Central

    Elhassan, Mohamed O.; Christie, Jennifer; Duxbury, Mark S.

    2012-01-01

    Locally initiated RNA interference (RNAi) has the potential for spatial propagation, inducing posttranscriptional gene silencing in distant cells. In Caenorhabditis elegans, systemic RNAi requires a phylogenetically conserved transmembrane channel, SID-1. Here, we show that a human SID-1 orthologue, SIDT1, facilitates rapid, contact-dependent, bidirectional small RNA transfer between human cells, resulting in target-specific non-cell-autonomous RNAi. Intercellular small RNA transfer can be both homotypic and heterotypic. We show SIDT1-mediated intercellular transfer of microRNA-21 to be a driver of resistance to the nucleoside analog gemcitabine in human adenocarcinoma cells. Documentation of a SIDT1-dependent small RNA transfer mechanism and the associated phenotypic effects on chemoresistance in human cancer cells raises the possibility that conserved systemic RNAi pathways contribute to the acquisition of drug resistance. Mediators of non-cell-autonomous RNAi may be tractable targets for novel therapies aimed at improving the efficacy of current cytotoxic agents. PMID:22174421

  14. Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice.

    PubMed

    Judge, Adam D; Robbins, Marjorie; Tavakoli, Iran; Levi, Jasna; Hu, Lina; Fronda, Anna; Ambegia, Ellen; McClintock, Kevin; MacLachlan, Ian

    2009-03-01

    siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncology. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid particles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This was correlated with target gene silencing following a single intravenous administration that was sufficient to cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing. Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target's biological activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggesting a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics.

  15. Confirming the RNAi-mediated mechanism of action of siRNA-based cancer therapeutics in mice

    PubMed Central

    Judge, Adam D.; Robbins, Marjorie; Tavakoli, Iran; Levi, Jasna; Hu, Lina; Fronda, Anna; Ambegia, Ellen; McClintock, Kevin; MacLachlan, Ian

    2009-01-01

    siRNAs that specifically silence the expression of cancer-related genes offer a therapeutic approach in oncology. However, it remains critical to determine the true mechanism of their therapeutic effects. Here, we describe the preclinical development of chemically modified siRNA targeting the essential cell-cycle proteins polo-like kinase 1 (PLK1) and kinesin spindle protein (KSP) in mice. siRNA formulated in stable nucleic acid lipid particles (SNALP) displayed potent antitumor efficacy in both hepatic and subcutaneous tumor models. This was correlated with target gene silencing following a single intravenous administration that was sufficient to cause extensive mitotic disruption and tumor cell apoptosis. Our siRNA formulations induced no measurable immune response, minimizing the potential for nonspecific effects. Additionally, RNAi-specific mRNA cleavage products were found in tumor cells, and their presence correlated with the duration of target mRNA silencing. Histological biomarkers confirmed that RNAi-mediated gene silencing effectively inhibited the target’s biological activity. This report supports an RNAi-mediated mechanism of action for siRNA antitumor effects, suggesting a new methodology for targeting other key genes in cancer development with siRNA-based therapeutics. PMID:19229107

  16. RNA Interference Based Approach to Down Regulate Osmoregulators of Whitefly (Bemisia tabaci): Potential Technology for the Control of Whitefly

    USDA-ARS?s Scientific Manuscript database

    Over the past decade RNA interference (RNAi) technology has emerged as a successful tool not only for functional genomics, but in planta expression of short interfering RNAs (siRNAs) could offer potential for insect pest management. Insects feeding exclusively on plant sap depend on osmotic pressure...

  17. Host-induced silencing of essential genes in Puccinia triticina through transgenic expression of RNAi sequences reduces severity of leaf rust infection in wheat.

    PubMed

    Panwar, Vinay; Jordan, Mark; McCallum, Brent; Bakkeren, Guus

    2018-05-01

    Leaf rust, caused by the pathogenic fungus Puccinia triticina (Pt), is one of the most serious biotic threats to sustainable wheat production worldwide. This obligate biotrophic pathogen is prevalent worldwide and is known for rapid adaptive evolution to overcome resistant wheat varieties. Novel disease control approaches are therefore required to minimize the yield losses caused by Pt. Having shown previously the potential of host-delivered RNA interference (HD-RNAi) in functional screening of Pt genes involved in pathogenesis, we here evaluated the use of this technology in transgenic wheat plants as a method to achieve protection against wheat leaf rust (WLR) infection. Stable expression of hairpin RNAi constructs with sequence homology to Pt MAP-kinase (PtMAPK1) or a cyclophilin (PtCYC1) encoding gene in susceptible wheat plants showed efficient silencing of the corresponding genes in the interacting fungus resulting in disease resistance throughout the T 2 generation. Inhibition of Pt proliferation in transgenic lines by in planta-induced RNAi was associated with significant reduction in target fungal transcript abundance and reduced fungal biomass accumulation in highly resistant plants. Disease protection was correlated with the presence of siRNA molecules specific to targeted fungal genes in the transgenic lines harbouring the complementary HD-RNAi construct. This work demonstrates that generating transgenic wheat plants expressing RNAi-inducing transgenes to silence essential genes in rust fungi can provide effective disease resistance, thus opening an alternative way for developing rust-resistant crops. © 2017 Her Majesty the Queen in Right of Canada. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  18. Virus-Derived Gene Expression and RNA Interference Vector for Grapevine

    PubMed Central

    Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.

    2012-01-01

    The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553

  19. Knockdown of the Chromatin Remodeling Gene Brahma by RNA Interference Reduces Reproductive Fitness and Lifespan in Common Bed Bug (Hemiptera: Cimicidae).

    PubMed

    Basnet, Sanjay; Kamble, Shripat T

    2018-05-04

    The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) is a nuisance household pest causing significant medical and economic impacts. RNA interference (RNAi) of genes that are involved in vital physiological processes can serve as potential RNAi targets for insect control. Brahma is an ATPase subunit of a chromatin-remodeling complex involved in transcription of several genes for cellular processes, most importantly the homeotic genes. In this study, we used a microinjection technique to deliver double stranded RNA into female bed bugs. Delivery of 0.05 and 0.5 µg/insect of brahma dsRNA directly into hemocele resulted substantial reduction in oviposition. Eggs laid by bed bugs receiving both doses of brahma dsRNA exhibited significantly lower hatching percentage as compared to controls. In addition, brahma RNAi in female bed bugs caused significant mortality. Our results disclosed the potential of brahma RNAi to suppress bed bug population through injection of specific dsRNA, suggesting a critical function of this gene in bed bugs' reproduction and survival. Based on our data, brahma can be a promising RNAi target for suppression of bed bug population.

  20. Hepatocyte-targeted RNAi Therapeutics for the Treatment of Chronic Hepatitis B Virus Infection

    PubMed Central

    Wooddell, Christine I; Rozema, David B; Hossbach, Markus; John, Matthias; Hamilton, Holly L; Chu, Qili; Hegge, Julia O; Klein, Jason J; Wakefield, Darren H; Oropeza, Claudia E; Deckert, Jochen; Roehl, Ingo; Jahn-Hofmann, Kerstin; Hadwiger, Philipp; Vornlocher, Hans-Peter; McLachlan, Alan; Lewis, David L

    2013-01-01

    RNA interference (RNAi)-based therapeutics have the potential to treat chronic hepatitis B virus (HBV) infection in a fundamentally different manner than current therapies. Using RNAi, it is possible to knock down expression of viral RNAs including the pregenomic RNA from which the replicative intermediates are derived, thus reducing viral load, and the viral proteins that result in disease and impact the immune system's ability to eliminate the virus. We previously described the use of polymer-based Dynamic PolyConjugate (DPC) for the targeted delivery of siRNAs to hepatocytes. Here, we first show in proof-of-concept studies that simple coinjection of a hepatocyte-targeted, N-acetylgalactosamine-conjugated melittin-like peptide (NAG-MLP) with a liver-tropic cholesterol-conjugated siRNA (chol-siRNA) targeting coagulation factor VII (F7) results in efficient F7 knockdown in mice and nonhuman primates without changes in clinical chemistry or induction of cytokines. Using transient and transgenic mouse models of HBV infection, we show that a single coinjection of NAG-MLP with potent chol-siRNAs targeting conserved HBV sequences resulted in multilog repression of viral RNA, proteins, and viral DNA with long duration of effect. These results suggest that coinjection of NAG-MLP and chol-siHBVs holds great promise as a new therapeutic for patients chronically infected with HBV. PMID:23439496

  1. Genome-Wide RNAi Screen Identifies Broadly-Acting Host Factors That Inhibit Arbovirus Infection

    PubMed Central

    Yasunaga, Ari; Hanna, Sheri L.; Li, Jianqing; Cho, Hyelim; Rose, Patrick P.; Spiridigliozzi, Anna; Gold, Beth; Diamond, Michael S.; Cherry, Sara

    2014-01-01

    Vector-borne viruses are an important class of emerging and re-emerging pathogens; thus, an improved understanding of the cellular factors that modulate infection in their respective vertebrate and insect hosts may aid control efforts. In particular, cell-intrinsic antiviral pathways restrict vector-borne viruses including the type I interferon response in vertebrates and the RNA interference (RNAi) pathway in insects. However, it is likely that additional cell-intrinsic mechanisms exist to limit these viruses. Since insects rely on innate immune mechanisms to inhibit virus infections, we used Drosophila as a model insect to identify cellular factors that restrict West Nile virus (WNV), a flavivirus with a broad and expanding geographical host range. Our genome-wide RNAi screen identified 50 genes that inhibited WNV infection. Further screening revealed that 17 of these genes were antiviral against additional flaviviruses, and seven of these were antiviral against other vector-borne viruses, expanding our knowledge of invertebrate cell-intrinsic immunity. Investigation of two newly identified factors that restrict diverse viruses, dXPO1 and dRUVBL1, in the Tip60 complex, demonstrated they contributed to antiviral defense at the organismal level in adult flies, in mosquito cells, and in mammalian cells. These data suggest the existence of broadly acting and functionally conserved antiviral genes and pathways that restrict virus infections in evolutionarily divergent hosts. PMID:24550726

  2. Chronic Cardiac-Targeted RNA Interference for the Treatment of Heart Failure Restores Cardiac Function and Reduces Pathological Hypertrophy

    PubMed Central

    Suckau, Lennart; Fechner, Henry; Chemaly, Elie; Krohn, Stefanie; Hadri, Lahouaria; Kockskämper, Jens; Westermann, Dirk; Bisping, Egbert; Ly, Hung; Wang, Xiaomin; Kawase, Yoshiaki; Chen, Jiqiu; Liang, Lifan; Sipo, Isaac; Vetter, Roland; Weger, Stefan; Kurreck, Jens; Erdmann, Volker; Tschope, Carsten; Pieske, Burkert; Lebeche, Djamel; Schultheiss, Heinz-Peter; Hajjar, Roger J.; Poller, Wolfgang Ch.

    2009-01-01

    Background RNA interference (RNAi) has the potential to be a novel therapeutic strategy in diverse areas of medicine. We report on targeted RNAi for the treatment of heart failure (HF), an important disorder in humans resulting from multiple etiologies. Successful treatment of HF is demonstrated in a rat model of transaortic banding by RNAi targeting of phospholamban (PLB), a key regulator of cardiac Ca2+ homeostasis. Whereas gene therapy rests on recombinant protein expression as its basic principle, RNAi therapy employs regulatory RNAs to achieve its effect. Methods and Results We describe structural requirements to obtain high RNAi activity from adenoviral (AdV) and adeno-associated virus (AAV9) vectors and show that an AdV short hairpin RNA vector (AdV-shRNA) silenced PLB in cardiomyocytes (NRCMs) and improved hemodynamics in HF rats 1 month after aortic root injection. For simplified long-term therapy we developed a dimeric cardiotropic AAV vector (rAAV9-shPLB) delivering RNAi activity to the heart via intravenous injection. Cardiac PLB protein was reduced to 25% and SERCA2a suppression in the HF groups was rescued. In contrast to traditional vectors rAAV9 shows high affinity for myocardium, but low affinity for liver and other organs. rAAV9-shPLB therapy restored diastolic (LVEDP, dp/dtmin, Tau) and systolic (fractional shortening) functional parameters to normal range. The massive cardiac dilation was normalized and the cardiac hypertrophy, cardiomyocyte diameter and cardiac fibrosis significantly reduced. Importantly, there was no evidence of microRNA deregulation or hepatotoxicity during these RNAi therapies. Conclusion Our data show, for the first time, high efficacy of an RNAi therapeutic strategy in a cardiac disease. PMID:19237664

  3. Knockdown of nuclease activity in the gut enhances RNAi efficiency in the Colorado potato beetle, Leptinotarsa decemlineata, but not in the desert locust, Schistocerca gregaria.

    PubMed

    Spit, Jornt; Philips, Annelies; Wynant, Niels; Santos, Dulce; Plaetinck, Geert; Vanden Broeck, Jozef

    2017-02-01

    The responsiveness towards orally delivered dsRNA and the potency of a subsequent environmental RNA interference (RNAi) response strongly differs between different insect species. While some species are very sensitive to dsRNA delivery through the diet, others are not. The underlying reasons for this may vary, but degradation of dsRNA by nucleases in the gut lumen is believed to play a crucial role. The Colorado potato beetle, Leptinotarsa decemlineata, is a voracious defoliator of potato crops worldwide, and is currently under investigation for novel control methods based on dsRNA treatments. Here we describe the identification and characterization of two nuclease genes exclusively expressed in the gut of this pest species. Removal of nuclease activity in adults increased the sensitivity towards dsRNA and resulted in improved protection of potato plants. A similar strategy in the desert locust, Schistocerca gregaria, for which we show a far more potent nuclease activity in the gut juice, did however not lead to an improvement of the RNAi response. Possible reasons for this are discussed. Taken together, the present data confirm a negative effect of nucleases in the gut on the environmental RNAi response, and further suggest that interfering with this activity is a strategy worth pursuing for improving RNAi efficacy in insect pest control applications. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Assessment of RNAi-induced silencing in banana (Musa spp.).

    PubMed

    Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge

    2014-09-18

    In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target

  5. A novel therapeutic strategy for cartilage diseases based on lipid nanoparticle-RNAi delivery system

    PubMed Central

    Wang, Shaowei; Wei, Xiaochun; Sun, Xiaojuan; Chen, Chongwei; Zhou, Jingming; Zhang, Ge; Wu, Heng; Guo, Baosheng

    2018-01-01

    Background Cartilage degeneration affects millions of people but preventing its degeneration is a big challenge. Although RNA interference (RNAi) has been used in human trials via silencing specific genes, the cartilage RNAi has not been possible to date because the cartilage is an avascular and very dense tissue with very low permeability. Purpose The objective of this study was to develop and validate a novel lipid nanoparticle (LNP)-siRNA delivery system that can prevent cartilage degeneration by knocking down specific genes. Methods LNP transfection efficiency was evaluated in vitro and ex vivo. Indian Hedgehog (Ihh) has been correlated with cartilage degeneration. The in vivo effects of LNP-Ihh siRNA complexes on cartilage degeneration were evaluated in a rat model of surgery-induced osteoarthritis (OA). Results In vitro, 100% of chondrocytes were transfected with siRNA in the LNP-siRNA group. In accordance with the cell culture results, red positive signals could be detected even in the deep layer of cartilage tissue cultures treated by LNP-beacon. In vivo data showed that LNP is specific for cartilage, since positive signals were detected by fluorescence molecular tomography and confocal microscopy in joint cartilage injected with LNP-beacon, but not on the surface of the synovium. In the rat model of OA, intraarticular injection of LNP-Ihh siRNA attenuated OA progression, and PCR results showed LNP-Ihh siRNA exerted a positive impact on anabolic metabolism and negative impact on catabolic metabolism. Conclusion This study demonstrates that our LNP-RNAi delivery system has a significantly chondroprotective effect that attenuates cartilage degeneration and holds great promise as a powerful tool for treatment of cartilage diseases by knocking down specific genes. PMID:29440889

  6. Discovery and Characterization of the 3-Hydroxyacyl-ACP Dehydratase Component of the Plant Mitochondrial Fatty Acid Synthase System1[OPEN

    PubMed Central

    Okazaki, Yozo; Lithio, Andrew; Jin, Huanan

    2017-01-01

    We report the characterization of the Arabidopsis (Arabidopsis thaliana) 3-hydroxyacyl-acyl carrier protein dehydratase (mtHD) component of the mitochondrial fatty acid synthase (mtFAS) system, encoded by AT5G60335. The mitochondrial localization and catalytic capability of mtHD were demonstrated with a green fluorescent protein transgenesis experiment and by in vivo complementation and in vitro enzymatic assays. RNA interference (RNAi) knockdown lines with reduced mtHD expression exhibit traits typically associated with mtFAS mutants, namely a miniaturized morphological appearance, reduced lipoylation of lipoylated proteins, and altered metabolomes consistent with the reduced catalytic activity of lipoylated enzymes. These alterations are reversed when mthd-rnai mutant plants are grown in a 1% CO2 atmosphere, indicating the link between mtFAS and photorespiratory deficiency due to the reduced lipoylation of glycine decarboxylase. In vivo biochemical feeding experiments illustrate that sucrose and glycolate are the metabolic modulators that mediate the alterations in morphology and lipid accumulation. In addition, both mthd-rnai and mtkas mutants exhibit reduced accumulation of 3-hydroxytetradecanoic acid (i.e. a hallmark of lipid A-like molecules) and abnormal chloroplastic starch granules; these changes are not reversible by the 1% CO2 atmosphere, demonstrating two novel mtFAS functions that are independent of photorespiration. Finally, RNA sequencing analysis revealed that mthd-rnai and mtkas mutants are nearly equivalent to each other in altering the transcriptome, and these analyses further identified genes whose expression is affected by a functional mtFAS system but independent of photorespiratory deficiency. These data demonstrate the nonredundant nature of the mtFAS system, which contributes unique lipid components needed to support plant cell structure and metabolism. PMID:28202596

  7. Host-directed combinatorial RNAi improves inhibition of diverse strains of influenza A virus in human respiratory epithelial cells.

    PubMed

    Estrin, Michael A; Hussein, Islam T M; Puryear, Wendy B; Kuan, Anne C; Artim, Stephen C; Runstadler, Jonathan A

    2018-01-01

    Influenza A virus infections are important causes of morbidity and mortality worldwide, and currently available prevention and treatment methods are suboptimal. In recent years, genome-wide investigations have revealed numerous host factors that are required for influenza to successfully complete its life cycle. However, only a select, small number of influenza strains were evaluated using this platform, and there was considerable variation in the genes identified across different investigations. In an effort to develop a universally efficacious therapeutic strategy with limited potential for the emergence of resistance, this study was performed to investigate the effect of combinatorial RNA interference (RNAi) on inhibiting the replication of diverse influenza A virus subtypes and strains. Candidate genes were selected for targeting based on the results of multiple previous independent genome-wide studies. The effect of single and combinatorial RNAi on the replication of 12 diverse influenza A viruses, including three strains isolated from birds and one strain isolated from seals, was then evaluated in primary normal human bronchial epithelial cells. After excluding overly toxic siRNA, two siRNA combinations were identified that reduced mean viral replication by greater than 79 percent in all mammalian strains, and greater than 68 percent in all avian strains. Host-directed combinatorial RNAi effectively prevents growth of a broad range of influenza virus strains in vitro, and is a potential therapeutic candidate for further development and future in vivo studies.

  8. RNAi-mediated silencing of enolase confirms its biological importance in Clonorchis sinensis.

    PubMed

    Wang, Xiaoyun; Chen, Wenjun; Tian, Yanli; Huang, Yan; Li, Xuerong; Yu, Xinbing

    2014-04-01

    Clonorchis sinensis (C. sinensis) infection is still a common public health problem in freshwater fish consumption areas in Asian countries. More molecular evidence are required to speed up the prevention strategies to control this kind of infectious disease. In the present study, to confirm the biological importance of Csenolase followed by our previous observations of the key metabolic enzyme, we explored the RNA silence effect of the Csenolase-derived RNA interference (RNAi) in C. sinensis. The extramembranous region aa105-226 was selected as the target sequence of RNA silence. Csenolase-derived double strand RNA (dsRNA-Csenolase, 366 bp) was synthetized and delivered into C. sinensis by soaking approach. The penetration of dsRNA into adult worms and metacercariae was tracked using fluorescently labeled RNA. Western blotting and qRT-PCR experiments were performed to determine dsRNA-Csenolase-silencing effect. Our results showed that, after incubating for 120 h, dsRNA-Csenolase could effectively target and downregulate the expression of Csenolase in both adult worms (P < 0.001) and metacercariae (P < 0.01), resulting in a remarkable killing effect on C. sinensis adult worms (P < 0.01). Fluorescent Cy3-labeled dsRNA was mostly deposited in the uterus and vitellarium of adult worm and in the cyst wall of metacercaria. The present study is the first report of RNAi trials in C. sinensis, allowing further applications in identifying functional genes in C. sinensis.

  9. RNAi Technique in Stem Cell Research: Current Status and Future Perspectives.

    PubMed

    Zou, Gang-Ming

    2017-01-01

    RNAi is a mechanism displayed by most eukaryotic cells to rid themselves of foreign double-strand RNA molecules. In the 18 years since the initial report, RNAi has now been demonstrated to function in mammalian cells to alter gene expression and has been used as a means for genetic discovery as well as a possible strategy for genetic correction and genetic therapy in cancer and other disease. The aim of this review is to provide a general overview of how RNAi suppresses gene expression and to examine some published RNAi approaches that have resulted in changes in stem cell function and suggest the possible clinical relevance of this work in cancer therapy through targeting cancer stem cells.

  10. Protection from feed-forward amplification in an amplified RNAi mechanism

    PubMed Central

    Pak, Julia; Maniar, Jay Mahesh; Mello, Cecilia Cabral; Fire, Andrew

    2012-01-01

    SUMMARY The effectiveness of RNA interference (RNAi) in many organisms is potentiated through the signal-amplifying activity of a targeted RNA directed RNA polymerase (RdRP) system that can convert a small population of exogenously-encountered dsRNA fragments into an abundant internal pool of small interfering RNA (siRNA). As for any biological amplification system, we expect an underlying architecture that will limit the ability of a randomly encountered trigger to produce an uncontrolled and self-escalating response. Investigating such limits in C. elegans, we find that feed-forward amplification is limited by a critical biosynthetic and structural distinction at the RNA level between (i) triggers that can produce amplification and (ii) siRNA products of the amplification reaction. By assuring that initial (primary) siRNAs can act as triggers but not templates for activation, and that the resulting (secondary) siRNAs can enforce gene silencing on additional targets without unbridled trigger amplification, the system achieves substantial but fundamentally limited signal amplification. PMID:23141544

  11. Efficient CRISPR-rAAV engineering of endogenous genes to study protein function by allele-specific RNAi.

    PubMed

    Kaulich, Manuel; Lee, Yeon J; Lönn, Peter; Springer, Aaron D; Meade, Bryan R; Dowdy, Steven F

    2015-04-20

    Gene knockout strategies, RNAi and rescue experiments are all employed to study mammalian gene function. However, the disadvantages of these approaches include: loss of function adaptation, reduced viability and gene overexpression that rarely matches endogenous levels. Here, we developed an endogenous gene knockdown/rescue strategy that combines RNAi selectivity with a highly efficient CRISPR directed recombinant Adeno-Associated Virus (rAAV) mediated gene targeting approach to introduce allele-specific mutations plus an allele-selective siRNA Sensitive (siSN) site that allows for studying gene mutations while maintaining endogenous expression and regulation of the gene of interest. CRISPR/Cas9 plus rAAV targeted gene-replacement and introduction of allele-specific RNAi sensitivity mutations in the CDK2 and CDK1 genes resulted in a >85% site-specific recombination of Neo-resistant clones versus ∼8% for rAAV alone. RNAi knockdown of wild type (WT) Cdk2 with siWT in heterozygotic knockin cells resulted in the mutant Cdk2 phenotype cell cycle arrest, whereas allele specific knockdown of mutant CDK2 with siSN resulted in a wild type phenotype. Together, these observations demonstrate the ability of CRISPR plus rAAV to efficiently recombine a genomic locus and tag it with a selective siRNA sequence that allows for allele-selective phenotypic assays of the gene of interest while it remains expressed and regulated under endogenous control mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  12. Effect of North Bicyclo[3.1.0]hexane 2'-Deoxypseudosugars on RNA Interference: A Novel Class of siRNA Modification | Center for Cancer Research

    Cancer.gov

    The inside cover picture shows how siRNAs modified with North bicyclo[3.1.0]hexane 2'-deoxy-pseudosugars are able to activate the RNA interference machinery. The paper confirms that the North conformation is critical for RNAi activity.

  13. Single-target RNA interference for the blockade of multiple interacting proinflammatory and profibrotic pathways in cardiac fibroblasts.

    PubMed

    Tank, Juliane; Lindner, Diana; Wang, Xiaomin; Stroux, Andrea; Gilke, Leona; Gast, Martina; Zietsch, Christin; Skurk, Carsten; Scheibenbogen, Carmen; Klingel, Karin; Lassner, Dirk; Kühl, Uwe; Schultheiss, Heinz-Peter; Westermann, Dirk; Poller, Wolfgang

    2014-01-01

    Therapeutic targets of broad relevance are likely located in pathogenic pathways common to disorders of various etiologies. Screening for targets of this type revealed CCN genes to be consistently upregulated in multiple cardiomyopathies. We developed RNA interference (RNAi) to silence CCN2 and found this single-target approach to block multiple proinflammatory and profibrotic pathways in activated primary cardiac fibroblasts (PCFBs). The RNAi-strategy was developed in murine PCFBs and then investigated in "individual" human PCFBs grown from human endomyocardial biopsies (EMBs). Screening of short hairpin RNA (shRNA) sequences for high silencing efficacy and specificity yielded RNAi adenovectors silencing CCN2 in murine or human PCFBs, respectively. Comparison of RNAi with CCN2-modulating microRNA (miR) vectors expressing miR-30c or miR-133b showed higher efficacy of RNAi. In murine PCFBs, CCN2 silencing resulted in strongly reduced expression of stretch-induced chemokines (Ccl2, Ccl7, Ccl8), matrix metalloproteinases (MMP2, MMP9), extracellular matrix (Col3a1), and a cell-to-cell contact protein (Cx43), suggesting multiple signal pathways to be linked to CCN2. Immune cell chemotaxis towards CCN2-depleted PCFBs was significantly reduced. We demonstrate here that this RNAi strategy is technically applicable to "individual" human PCFBs, too, but that these display individually strikingly different responses to CCN2 depletion. Either genomically encoded factors or stable epigenetic modification may explain different responses between individual PCFBs. The new RNAi approach addresses a key regulator protein induced in cardiomyopathies. Investigation of this and other molecular therapies in individual human PCBFs may help to dissect differential pathogenic processes between otherwise similar disease entities and individuals. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. [Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

    PubMed

    Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

    2010-10-01

    This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

  15. An RNAi-mediated screen identifies novel targets for next-generation antiepileptic drugs based on increased expression of the homeostatic regulator pumilio.

    PubMed

    Lin, Wei-Hsiang; He, Miaomiao; Fan, Yuen Ngan; Baines, Richard A

    2018-05-02

    Despite availability of a diverse range of anti-epileptic drugs (AEDs), only about two-thirds of epilepsy patients respond well to drug treatment. Thus, novel targets are required to catalyse the design of next-generation AEDs. Manipulation of neuron firing-rate homoeostasis, through enhancing Pumilio (Pum) activity, has been shown to be potently anticonvulsant in Drosophila. In this study, we performed a genome-wide RNAi screen in S2R + cells, using a luciferase-based dPum activity reporter and identified 1166 genes involved in dPum regulation. Of these genes, we focused on 699 genes that, on knock-down, potentiate dPum activity/expression. Of this subgroup, 101 genes are activity-dependent based on comparison with genes previously identified as activity-dependent by RNA-sequencing. Functional cluster analysis shows these genes are enriched in pathways involved in DNA damage, regulation of cell cycle and proteasomal protein catabolism. To test for anticonvulsant activity, we utilised an RNA-interference approach in vivo. RNAi-mediated knockdown showed that 57/101 genes (61%) are sufficient to significantly reduce seizure duration in the characterized seizure mutant, para bss . We further show that chemical inhibitors of protein products of some of the genes targeted are similarly anticonvulsant. Finally, to establish whether the anticonvulsant activity of identified compounds results from increased dpum transcription, we performed a luciferase-based assay to monitor dpum promoter activity. Third instar larvae exposed to sodium fluoride, gemcitabine, metformin, bestatin, WP1066 or valproic acid all showed increased dpum promoter activity. Thus, this study validates Pum as a favourable target for AED design and, moreover, identifies a number of lead compounds capable of increasing the expression of this homeostatic regulator.

  16. New RNAi strategy for selective suppression of a mutant allele in polyglutamine disease.

    PubMed

    Kubodera, Takayuki; Yokota, Takanori; Ishikawa, Kinya; Mizusawa, Hidehiro

    2005-12-01

    In gene therapy of dominantly inherited diseases with small interfering RNA (siRNA), mutant allele specific suppression may be necessary for diseases in which the defective gene normally has an important role. It is difficult, however, to design a mutant allele-specific siRNA for trinucleotide repeat diseases in which the difference of sequences is only repeat length. To overcome this problem, we use a new RNA interference (RNAi) strategy for selective suppression of mutant alleles. Both mutant and wild-type alleles are inhibited by the most effective siRNA, and wild-type protein is restored using the wild-type mRNA modified to be resistant to the siRNA. Here, we applied this method to spinocerebellar ataxia type 6 (SCA6). We discuss its feasibility and problems for future gene therapy.

  17. Salicylic acid interferes with GFP fluorescence in vivo

    PubMed Central

    de Jonge, Jennifer; Hofius, Daniel

    2017-01-01

    Abstract Fluorescent proteins have become essential tools for cell biologists. They are routinely used by plant biologists for protein and promoter fusions to infer protein localization, tissue‐specific expression and protein abundance. When studying the effects of biotic stress on chromatin, we unexpectedly observed a decrease in GFP signal intensity upon salicylic acid (SA) treatment in Arabidopsis lines expressing histone H1-GFP fusions. This GFP signal decrease was dependent on SA concentration. The effect was not specific to the linker histone H1-GFP fusion but was also observed for the nucleosomal histone H2A-GFP fusion. This result prompted us to investigate a collection of fusion proteins, which included different promoters, subcellular localizations and fluorophores. In all cases, fluorescence signals declined strongly or disappeared after SA application. No changes were detected in GFP‐fusion protein abundance when fluorescence signals were lost indicating that SA does not interfere with protein stability but GFP fluorescence. In vitro experiments showed that SA caused GFP fluorescence reduction only in vivo but not in vitro, suggesting that SA requires cellular components to cause fluorescence reduction. Together, we conclude that SA can interfere with the fluorescence of various GFP‐derived reporter constructs in vivo. Assays that measure relocation or turnover of GFP‐tagged proteins upon SA treatment should therefore be evaluated with caution. PMID:28369601

  18. A potential role for RNA interference in controlling the activity of the human LINE-1 retrotransposon.

    PubMed

    Soifer, Harris S; Zaragoza, Adriana; Peyvan, Maany; Behlke, Mark A; Rossi, John J

    2005-01-01

    Long interspersed nuclear elements (LINE-1 or L1) comprise 17% of the human genome, although only 80-100 L1s are considered retrotransposition-competent (RC-L1). Despite their small number, RC-L1s are still potential hazards to genome integrity through insertional mutagenesis, unequal recombination and chromosome rearrangements. In this study, we provide several lines of evidence that the LINE-1 retrotransposon is susceptible to RNA interference (RNAi). First, double-stranded RNA (dsRNA) generated in vitro from an L1 template is converted into functional short interfering RNA (siRNA) by DICER, the RNase III enzyme that initiates RNAi in human cells. Second, pooled siRNA from in vitro cleavage of L1 dsRNA, as well as synthetic L1 siRNA, targeting the 5'-UTR leads to sequence-specific mRNA degradation of an L1 fusion transcript. Finally, both synthetic and pooled siRNA suppressed retrotransposition from a highly active RC-L1 clone in cell culture assay. Our report is the first to demonstrate that a human transposable element is subjected to RNAi.

  19. RNA interference-mediated silencing of mutant superoxide dismutase rescues cyclosporin A-induced death in cultured neuroblastoma cells

    PubMed Central

    Maxwell, Michele M.; Pasinelli, Piera; Kazantsev, Aleksey G.; Brown, Robert H.

    2004-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disorder resulting from selective death of motor neurons in the brain and spinal cord. In ≈25% of familial ALS cases, the disease is caused by dominantly acting point mutations in the gene encoding cytosolic Cu,Zn superoxide dismutase (SOD1). In cell culture and in rodent models of ALS, mutant SOD1 proteins exhibit dose-dependent toxicity; thus, agents that reduce mutant protein expression would be powerful therapeutic tools. A wealth of recent evidence has demonstrated that the mechanism of RNA-mediated interference (RNAi) can be exploited to achieve potent and specific gene silencing in vitro and in vivo. We have evaluated the utility of RNAi for selective silencing of mutant SOD1 expression in cultured cells and have identified small interfering RNAs capable of specifically inhibiting expression of ALS-linked mutant, but not wild-type, SOD1. We have investigated the functional effects of RNAi-mediated silencing of mutant SOD1 in cultured murine neuroblastoma cells. In this model, stable expression of mutant, but not wild-type, human SOD1 sensitizes cells to cytotoxic stimuli. We find that silencing of mutant SOD1 protects these cells against cyclosporin A-induced cell death. These results demonstrate a positive physiological effect caused by RNAi-mediated silencing of a dominant disease allele. The present study further supports the therapeutic potential of RNAi-based methods for the treatment of inherited human diseases, including ALS. PMID:14981234

  20. Prediction of effective RNA interference targets and pathway-related genes in lepidopteran insects by RNA sequencing analysis.

    PubMed

    Guan, Ruo-Bing; Li, Hai-Chao; Miao, Xue-Xia

    2018-06-01

    When using RNA interference (RNAi) to study gene functions in Lepidoptera insects, we discovered that some genes could not be suppressed; instead, their expression levels could be up-regulated by double-stranded RNA (dsRNA). To predict which genes could be easily silenced, we treated the Asian corn borer (Ostrinia furnacalis) with dsGFP (green fluorescent protein) and dsMLP (muscle lim protein). A transcriptome sequence analysis was conducted using the cDNAs 6 h after treatment with dsRNA. The results indicated that 160 genes were up-regulated and 44 genes were down-regulated by the two dsRNAs. Then, 50 co-up-regulated, 25 co-down-regulated and 43 unaffected genes were selected to determine their RNAi responses. All the 25 down-regulated genes were knocked down by their corresponding dsRNA. However, several of the up-regulated and unaffected genes were up-regulated when treated with their corresponding dsRNAs instead of being knocked down. The genes up-regulated by the dsGFP treatment may be involved in insect immune responses or the RNAi pathway. When the immune-related genes were excluded, only seven genes were induced by dsGFP, including ago-2 and dicer-2. These results not only provide a reference for efficient RNAi target predications, but also provide some potential RNAi pathway-related genes for further study. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  1. RNA Interference Knockdown of BRASSINOSTEROID INSENSITIVE1 in Maize Reveals Novel Functions for Brassinosteroid Signaling in Controlling Plant Architecture1[OPEN

    PubMed Central

    Kir, Gokhan; Ye, Huaxun; Nelissen, Hilde; Neelakandan, Anjanasree K.; Kusnandar, Andree S.; Luo, Anding; Inzé, Dirk; Sylvester, Anne W.; Yin, Yanhai; Becraft, Philip W.

    2015-01-01

    Brassinosteroids (BRs) are plant hormones involved in various growth and developmental processes. The BR signaling system is well established in Arabidopsis (Arabidopsis thaliana) and rice (Oryza sativa) but poorly understood in maize (Zea mays). BRASSINOSTEROID INSENSITIVE1 (BRI1) is a BR receptor, and database searches and additional genomic sequencing identified five maize homologs including duplicate copies of BRI1 itself. RNA interference (RNAi) using the extracellular coding region of a maize zmbri1 complementary DNA knocked down the expression of all five homologs. Decreased response to exogenously applied brassinolide and altered BR marker gene expression demonstrate that zmbri1-RNAi transgenic lines have compromised BR signaling. zmbri1-RNAi plants showed dwarf stature due to shortened internodes, with upper internodes most strongly affected. Leaves of zmbri1-RNAi plants are dark green, upright, and twisted, with decreased auricle formation. Kinematic analysis showed that decreased cell division and cell elongation both contributed to the shortened leaves. A BRASSINOSTEROID INSENSITIVE1-ETHYL METHANESULFONATE-SUPPRESSOR1-yellow fluorescent protein (BES1-YFP) transgenic line was developed that showed BR-inducible BES1-YFP accumulation in the nucleus, which was decreased in zmbri1-RNAi. Expression of the BES1-YFP reporter was strong in the auricle region of developing leaves, suggesting that localized BR signaling is involved in promoting auricle development, consistent with the zmbri1-RNAi phenotype. The blade-sheath boundary disruption, shorter ligule, and disrupted auricle morphology of RNAi lines resemble KNOTTED1-LIKE HOMEOBOX (KNOX) mutants, consistent with a mechanistic connection between KNOX genes and BR signaling. PMID:26162429

  2. Reduction of Tubulin Expression in Angomonas deanei by RNAi Modifies the Ultrastructure of the Trypanosomatid Protozoan and Impairs Division of Its Endosymbiotic Bacterium.

    PubMed

    Catta-Preta, Carolina Moura Costa; Dos Santos Pascoalino, Bruno; de Souza, Wanderley; Mottram, Jeremy C; Motta, Maria Cristina M; Schenkman, Sergio

    2016-11-01

    In the last two decades, RNA interference pathways have been employed as a useful tool for reverse genetics in trypanosomatids. Angomonas deanei is a nonpathogenic trypanosomatid that maintains an obligatory endosymbiosis with a bacterium related to the Alcaligenaceae family. Studies of this symbiosis can help us to understand the origin of eukaryotic organelles. The recent elucidation of both the A. deanei and the bacterium symbiont genomes revealed that the host protozoan codes for the enzymes necessary for RNAi activity in trypanosomatids. Here, we tested the functionality of the RNAi machinery by transfecting cells with dsRNA to a reporter gene (green fluorescent protein), which had been previously expressed in the parasite and to α-tubulin, an endogenous gene. In both cases, protein expression was reduced by the presence of specific dsRNA, inducing, respectively, a decreased GFP fluorescence and the formation of enlarged cells with modified arrangement of subpellicular microtubules. Furthermore, symbiont division was impaired. These results indicate that the RNAi system is active in A. deanei and can be used to further explore gene function in symbiont-containing trypanosomatids and to clarify important aspects of symbiosis and cell evolution. © 2016 The Author(s) Journal of Eukaryotic Microbiology © 2016 International Society of Protistologists.

  3. Engineered disease resistance in cotton using RNA-interference to knock down cotton leaf curl kokhran virus-Burewala and cotton leaf curl Multan betasatellite

    USDA-ARS?s Scientific Manuscript database

    Cotton Leaf Curl virus Disease (CLCuD) has caused enormous losses in cotton (Gossypium hirsutum) production in Pakistan. RNA interference (RNAi) is an emerging technique that could knock out CLCuD by targeting different regions of the pathogen genome that are important for replication, transcription...

  4. The role of co-opted ESCRT proteins and lipid factors in protection of tombusviral double-stranded RNA replication intermediate against reconstituted RNAi in yeast

    PubMed Central

    Nagy, Peter D.

    2017-01-01

    Reconstituted antiviral defense pathway in surrogate host yeast is used as an intracellular probe to further our understanding of virus-host interactions and the role of co-opted host factors in formation of membrane-bound viral replicase complexes in protection of the viral RNA against ribonucleases. The inhibitory effect of the RNA interference (RNAi) machinery of S. castellii, which only consists of the two-component DCR1 and AGO1 genes, was measured against tomato bushy stunt virus (TBSV) in wild type and mutant yeasts. We show that deletion of the co-opted ESCRT-I (endosomal sorting complexes required for transport I) or ESCRT-III factors makes TBSV replication more sensitive to the RNAi machinery in yeast. Moreover, the lack of these pro-viral cellular factors in cell-free extracts (CFEs) used for in vitro assembly of the TBSV replicase results in destruction of dsRNA replication intermediate by a ribonuclease at the 60 min time point when the CFE from wt yeast has provided protection for dsRNA. In addition, we demonstrate that co-opted oxysterol-binding proteins and membrane contact sites, which are involved in enrichment of sterols within the tombusvirus replication compartment, are required for protection of viral dsRNA. We also show that phosphatidylethanolamine level influences the formation of RNAi-resistant replication compartment. In the absence of peroxisomes in pex3Δ yeast, TBSV subverts the ER membranes, which provide as good protection for TBSV dsRNA against RNAi or ribonucleases as the peroxisomal membranes in wt yeast. Altogether, these results demonstrate that co-opted protein factors and usurped lipids are exploited by tombusviruses to build protective subcellular environment against the RNAi machinery and possibly other cellular ribonucleases. PMID:28759634

  5. RNAi-Mediated Knockdown of vATPase Subunits Affects Survival and Reproduction of Bed Bugs (Hemiptera: Cimicidae).

    PubMed

    Basnet, Sanjay; Kamble, Shripat T

    2018-05-04

    The common bed bug, Cimex lectularius L. (Hemiptera: Cimicidae) has resurged as one of the most troublesome household pests affecting people across the globe. Bed bug infestations have increased in recent years primarily due to the evolution of insecticide resistance and the insect's ability to hitchhike with travelers. vATPases are one of the most evolutionarily conserved holoenzymes in eukaryotes, which are mainly involved in proton transport across the plasma membranes and intracellular organelles. RNA interference (RNAi) has been developed as a promising tool for insect control. In this study, we used RNAi as an approach to knock down subunits A and E of the vATPase gene of bed bugs. Delivery of 0.2 µg/insect of dsRNA specific to vATPase-A and vATPase-E into female bed bugs dramatically impaired the laying and viability of eggs over time. Injection of the vATPase-E dsRNA decreased survival of the bed bugs over 30 d. Our results also showed that the knockdown of mRNA is highly effective and persistent up to 30 d post injection. This research demonstrated that silencing of the two vATPase subunits A and E offers a potential strategy to suppress bed bug populations.

  6. The Transgenic RNAi Project at Harvard Medical School: Resources and Validation.

    PubMed

    Perkins, Lizabeth A; Holderbaum, Laura; Tao, Rong; Hu, Yanhui; Sopko, Richelle; McCall, Kim; Yang-Zhou, Donghui; Flockhart, Ian; Binari, Richard; Shim, Hye-Seok; Miller, Audrey; Housden, Amy; Foos, Marianna; Randkelv, Sakara; Kelley, Colleen; Namgyal, Pema; Villalta, Christians; Liu, Lu-Ping; Jiang, Xia; Huan-Huan, Qiao; Wang, Xia; Fujiyama, Asao; Toyoda, Atsushi; Ayers, Kathleen; Blum, Allison; Czech, Benjamin; Neumuller, Ralph; Yan, Dong; Cavallaro, Amanda; Hibbard, Karen; Hall, Don; Cooley, Lynn; Hannon, Gregory J; Lehmann, Ruth; Parks, Annette; Mohr, Stephanie E; Ueda, Ryu; Kondo, Shu; Ni, Jian-Quan; Perrimon, Norbert

    2015-11-01

    To facilitate large-scale functional studies in Drosophila, the Drosophila Transgenic RNAi Project (TRiP) at Harvard Medical School (HMS) was established along with several goals: developing efficient vectors for RNAi that work in all tissues, generating a genome-scale collection of RNAi stocks with input from the community, distributing the lines as they are generated through existing stock centers, validating as many lines as possible using RT-qPCR and phenotypic analyses, and developing tools and web resources for identifying RNAi lines and retrieving existing information on their quality. With these goals in mind, here we describe in detail the various tools we developed and the status of the collection, which is currently composed of 11,491 lines and covering 71% of Drosophila genes. Data on the characterization of the lines either by RT-qPCR or phenotype is available on a dedicated website, the RNAi Stock Validation and Phenotypes Project (RSVP, http://www.flyrnai.org/RSVP.html), and stocks are available from three stock centers, the Bloomington Drosophila Stock Center (United States), National Institute of Genetics (Japan), and TsingHua Fly Center (China). Copyright © 2015 by the Genetics Society of America.

  7. The Transgenic RNAi Project at Harvard Medical School: Resources and Validation

    PubMed Central

    Perkins, Lizabeth A.; Holderbaum, Laura; Tao, Rong; Hu, Yanhui; Sopko, Richelle; McCall, Kim; Yang-Zhou, Donghui; Flockhart, Ian; Binari, Richard; Shim, Hye-Seok; Miller, Audrey; Housden, Amy; Foos, Marianna; Randkelv, Sakara; Kelley, Colleen; Namgyal, Pema; Villalta, Christians; Liu, Lu-Ping; Jiang, Xia; Huan-Huan, Qiao; Wang, Xia; Fujiyama, Asao; Toyoda, Atsushi; Ayers, Kathleen; Blum, Allison; Czech, Benjamin; Neumuller, Ralph; Yan, Dong; Cavallaro, Amanda; Hibbard, Karen; Hall, Don; Cooley, Lynn; Hannon, Gregory J.; Lehmann, Ruth; Parks, Annette; Mohr, Stephanie E.; Ueda, Ryu; Kondo, Shu; Ni, Jian-Quan; Perrimon, Norbert

    2015-01-01

    To facilitate large-scale functional studies in Drosophila, the Drosophila Transgenic RNAi Project (TRiP) at Harvard Medical School (HMS) was established along with several goals: developing efficient vectors for RNAi that work in all tissues, generating a genome-scale collection of RNAi stocks with input from the community, distributing the lines as they are generated through existing stock centers, validating as many lines as possible using RT–qPCR and phenotypic analyses, and developing tools and web resources for identifying RNAi lines and retrieving existing information on their quality. With these goals in mind, here we describe in detail the various tools we developed and the status of the collection, which is currently composed of 11,491 lines and covering 71% of Drosophila genes. Data on the characterization of the lines either by RT–qPCR or phenotype is available on a dedicated website, the RNAi Stock Validation and Phenotypes Project (RSVP, http://www.flyrnai.org/RSVP.html), and stocks are available from three stock centers, the Bloomington Drosophila Stock Center (United States), National Institute of Genetics (Japan), and TsingHua Fly Center (China). PMID:26320097

  8. RNA interference-mediated silencing of genes involved in the immune responses of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Olethreutidae).

    PubMed

    Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin; Meng, Fanli

    2018-01-01

    RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella ), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods.

  9. RNA interference-mediated silencing of genes involved in the immune responses of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Olethreutidae)

    PubMed Central

    Ran, Ruixue; Li, Tianyu; Liu, Xinxin; Ni, Hejia; Li, Wenbin

    2018-01-01

    RNA interference (RNAi) technology may be useful for developing new crop protection strategies against the soybean pod borer (SPB; Leguminivora glycinivorella), which is a critical soybean pest in northeastern Asia. Immune-related genes have been recently identified as potential RNAi targets for controlling insects. However, little is known about these genes or mechanisms underlying their expression in the SPB. In this study, we completed a transcriptome-wide analysis of SPB immune-related genes. We identified 41 genes associated with SPB microbial recognition proteins, immune-related effectors or signalling molecules in immune response pathways (e.g., Toll and immune deficiency pathways). Eleven of these genes were selected for a double-stranded RNA artificial feeding assay. The down-regulated expression levels of LgToll-5-1a and LgPGRP-LB2a resulted in relatively high larval mortality rates and abnormal development. Our data represent a comprehensive genetic resource for immune-related SPB genes, and may contribute to the elucidation of the mechanism regulating innate immunity in Lepidoptera species. Furthermore, two immune-related SPB genes were identified as potential RNAi targets, which may be used in the development of RNAi-mediated SPB control methods. PMID:29910977

  10. Knockdown of RRS1 by lentiviral-mediated RNAi promotes apoptosis and suppresses proliferation of human hepatocellular carcinoma cells.

    PubMed

    Wang, Jitao; Li, Zhi; Zuo, Changzeng; Xie, Qingfan; Li, Hui; Jia, Junhong; Zhen, Zhongguang; Qi, Ruizhao; Li, Zhiwei; Liu, Dengxiang; Sun, Baijun

    2017-10-01

    In recent years it was found that the synthesis and biological activity of ribosomes are closely associated with tumor cell growth, tumorigenesis, and malignant transformation. However, the role of regulator of ribosome synthesis 1 (RRS1) in hepatocellular carcinoma (HCC) has not yet been reported. In the present study, we aimed to examine the potential role of RRS1 in tumor cell growth by using a lentivirus-mediated RNA interference (RNAi) system in the HCC cell line SMMC-7721 in vitro. Compared with that of the negative control group (Lv-shCon), the mRNA and protein expression levels of RRS1 in SMMC-7721 cells transfected with Lv-shRRS1 were significantly decreased. Further experiments found that silencing of RRS1 gene expression in SMMC-7721 cells significantly suppressed cell proliferation, inhibited colony formation capacity, increased apoptosis and arrested cells in the G1 phase. These results suggest that the RRS1 gene plays a critical role in cell proliferation, colony formation, cell apoptosis and cell cycle distribution in human HCC cells, and that silencing of RRS1 by RNAi is a promising therapeutic approach for the treatment of HCC, and should be further developed.

  11. Large-scale field application of RNAi technology reducing Israeli acute paralysis virus disease in honey bees (Apis mellifera, Hymenoptera: Apidae).

    PubMed

    Hunter, Wayne; Ellis, James; Vanengelsdorp, Dennis; Hayes, Jerry; Westervelt, Dave; Glick, Eitan; Williams, Michael; Sela, Ilan; Maori, Eyal; Pettis, Jeffery; Cox-Foster, Diana; Paldi, Nitzan

    2010-12-23

    The importance of honey bees to the world economy far surpasses their contribution in terms of honey production; they are responsible for up to 30% of the world's food production through pollination of crops. Since fall 2006, honey bees in the U.S. have faced a serious population decline, due in part to a phenomenon called Colony Collapse Disorder (CCD), which is a disease syndrome that is likely caused by several factors. Data from an initial study in which investigators compared pathogens in honey bees affected by CCD suggested a putative role for Israeli Acute Paralysis Virus, IAPV. This is a single stranded RNA virus with no DNA stage placed taxonomically within the family Dicistroviridae. Although subsequent studies have failed to find IAPV in all CCD diagnosed colonies, IAPV has been shown to cause honey bee mortality. RNA interference technology (RNAi) has been used successfully to silence endogenous insect (including honey bee) genes both by injection and feeding. Moreover, RNAi was shown to prevent bees from succumbing to infection from IAPV under laboratory conditions. In the current study IAPV specific homologous dsRNA was used in the field, under natural beekeeping conditions in order to prevent mortality and improve the overall health of bees infected with IAPV. This controlled study included a total of 160 honey bee hives in two discrete climates, seasons and geographical locations (Florida and Pennsylvania). To our knowledge, this is the first successful large-scale real world use of RNAi for disease control.

  12. Salicylic acid interferes with GFP fluorescence in vivo.

    PubMed

    de Jonge, Jennifer; Hofius, Daniel; Hennig, Lars

    2017-03-01

    Fluorescent proteins have become essential tools for cell biologists. They are routinely used by plant biologists for protein and promoter fusions to infer protein localization, tissue-specific expression and protein abundance. When studying the effects of biotic stress on chromatin, we unexpectedly observed a decrease in GFP signal intensity upon salicylic acid (SA) treatment in Arabidopsis lines expressing histone H1-GFP fusions. This GFP signal decrease was dependent on SA concentration. The effect was not specific to the linker histone H1-GFP fusion but was also observed for the nucleosomal histone H2A-GFP fusion. This result prompted us to investigate a collection of fusion proteins, which included different promoters, subcellular localizations and fluorophores. In all cases, fluorescence signals declined strongly or disappeared after SA application. No changes were detected in GFP-fusion protein abundance when fluorescence signals were lost indicating that SA does not interfere with protein stability but GFP fluorescence. In vitro experiments showed that SA caused GFP fluorescence reduction only in vivo but not in vitro, suggesting that SA requires cellular components to cause fluorescence reduction. Together, we conclude that SA can interfere with the fluorescence of various GFP-derived reporter constructs in vivo. Assays that measure relocation or turnover of GFP-tagged proteins upon SA treatment should therefore be evaluated with caution. © The Author 2017. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  13. Transcriptional silencing of a transgene by RNAi in the soma of C. elegans.

    PubMed

    Grishok, Alla; Sinskey, Jina L; Sharp, Phillip A

    2005-03-15

    The silencing of transgene expression at the level of transcription in the soma of Caenorhabditis elegans through an RNAi-dependent pathway has not been previously characterized. Most gene silencing due to RNAi in C. elegans occurs at the post-transcriptional level. We observed transcriptional silencing when worms containing the elt-2::gfp/LacZ transgene were fed RNA produced from the commonly used L4440 vector. The transgene and the vector share plasmid backbone sequences. This transgene silencing depends on multiple RNAi pathway genes, including dcr-1, rde-1, rde-4, and rrf-1. Unlike post-transcriptional gene silencing in worms, elt-2::gfp/LacZ silencing is dependent on the PAZ-PIWI protein Alg-1 and on the HP1 homolog Hpl-2. The latter is a chromatin silencing factor, and expression of the transgene is inhibited at the level of intron-containing precursor mRNA. This inhibition is accompanied by a decrease in the acetylation of histones associated with the transgene. This transcriptional silencing in the soma can be distinguished from transgene silencing in the germline by its inability to be transmitted across generations and its dependence on the rde-1 gene. We therefore define this type of silencing as RNAi-induced Transcriptional Gene Silencing (RNAi-TGS). Additional chromatin-modifying components affecting RNAi-TGS were identified in a candidate RNAi screen.

  14. RNAi screening comes of age: improved techniques and complementary approaches

    PubMed Central

    Mohr, Stephanie E.; Smith, Jennifer A.; Shamu, Caroline E.; Neumüller, Ralph A.; Perrimon, Norbert

    2014-01-01

    Gene silencing through sequence-specific targeting of mRNAs by RNAi has enabled genome-wide functional screens in cultured cells and in vivo in model organisms. These screens have resulted in the identification of new cellular pathways and potential drug targets. Considerable progress has been made to improve the quality of RNAi screen data through the development of new experimental and bioinformatics approaches. The recent availability of genome-editing strategies, such as the CRISPR (clustered regularly interspaced short palindromic repeats)-Cas9 system, when combined with RNAi, could lead to further improvements in screen data quality and follow-up experiments, thus promoting our understanding of gene function and gene regulatory networks. PMID:25145850

  15. RNA interference targeting the ACE gene reduced blood pressure and improved myocardial remodelling in SHRs.

    PubMed

    He, Junhua; Bian, Yunfei; Gao, Fen; Li, Maolian; Qiu, Ling; Wu, Weidong; Zhou, Hua; Liu, Gaizhen; Xiao, Chuanshi

    2009-02-01

    The purpose of the present study was to investigate the effects on blood pressure and myocardial hypertrophy in SHRs (spontaneously hypertensive rats) of RNAi (RNA interference) targeting ACE (angiotensin-converting enzyme). SHRs were treated with normal saline as vehicle controls, with Ad5-EGFP as vector controls, and with recombinant adenoviral vectors Ad5-EGFP-ACE-shRNA, carrying shRNA (small hairpin RNA) for ACE as ACE-RNAi. WKY (Wistar-Kyoto) rats were used as normotensive controls treated with normal saline. The systolic blood pressure of the caudal artery was recorded. Serum levels of ACE and AngII (angiotensin II) were determined using ELISA. ACE mRNA and protein levels were determined in aorta, myocardium, kidney and lung. On day 32 of the experiment, the heart was pathologically examined. The ratios of heart weight/body weight and left ventricular weight/body weight were calculated. The serum concentration of ACE was lower in ACE-RNAi rats (16.37+/-3.90 ng/ml) compared with vehicle controls and vector controls (48.26+/-1.50 ng/ml and 46.67+/-2.82 ng/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (14.88+/-3.15 ng/ml; P>0.05). The serum concentration of AngII was also significantly lower in ACE-RNAi rats (18.24+/-3.69 pg/ml) compared with vehicle controls and vector controls (46.21+/-5.06 pg/ml and 44.93+/-4.12 pg/ml respectively; both P<0.05), but comparable between ACE-RNAi rats and WKY rats (16.06+/-3.11 pg/ml; P>0.05). The expression of ACE mRNA and ACE protein were significantly reduced in the myocardium, aorta, kidney and lung in ACE-RNAi rats compared with that in vehicle controls and in vector controls (all P<0.05). ACE-RNAi treatment resulted in a reduction in systolic blood pressure by 22+/-3 mmHg and the ACE-RNAi-induced reduction lasted for more than 14 days. In contrast, blood pressure was continuously increased in the vehicle controls as well as in the vector controls. The ratios of heart weight/body weight

  16. RNA interference-mediated survivin gene knockdown induces growth arrest and reduced migration of vascular smooth muscle cells.

    PubMed

    Nabzdyk, Christoph S; Lancero, Hope; Nguyen, Khanh P; Salek, Sherveen; Conte, Michael S

    2011-11-01

    Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G(2)/M fraction consistent with a mitotic defect; 4',6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G(2)/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular

  17. RNA interference-mediated survivin gene knockdown induces growth arrest and reduced migration of vascular smooth muscle cells

    PubMed Central

    Nabzdyk, Christoph S.; Lancero, Hope; Nguyen, Khanh P.; Salek, Sherveen

    2011-01-01

    Survivin (SVV) is a multifunctional protein that has been implicated in the development of neointimal hyperplasia. Nuclear SVV is essential for mitosis, whereas in mitochondria SVV has a cytoprotective function. Here, we investigated the effects of RNA interference (RNAi)-mediated SVV knockdown on cell cycle kinetics, apoptosis, migration, and gene expression in primary cultured vascular smooth muscle cells (VSMCs) from the human saphenous vein. Primary Human VSMCs were obtained from saphenous veins and cultured under standard conditions. SVV knockdown was achieved by either small interfering RNA or lentiviral transduction of short hairpin RNA, reducing SVV gene expression by quantitative PCR (>75%, P < 0.01) without a loss of cell viability. Subcellular fractionation revealed that RNAi treatment effectively targeted the nuclear SVV pool, whereas the larger mitochondrial pool was much less sensitive to transient knockdown. Both p53 and p27 protein levels were notably increased. SVV RNAi treatment significantly blocked VSMC proliferation in response to serum and PDGF-AB, arresting VSMC growth. Cell cycle analysis revealed an increased G2/M fraction consistent with a mitotic defect; 4′,6-diamidino-2-phenylindole staining confirmed an increased frequency of polyploid and abnormal nuclei. In a transwell assay, SVV knockdown reduced migration to PDGF-AB, and actin-phalloidin staining revealed disorganized actin filaments and polygonal cell shape. However, apoptosis (DNA content and annexin V flow cytometry) was not directly induced by SVV RNAi, and sensitivity to apoptotic agonists (e.g., staurosporine and cytokines) was unchanged. In conclusion, RNAi-mediated SVV knockdown in VSMCs leads to profound cell cycle arrest at G2/M and impaired chemotaxis without cytotoxicity. The regulation of mitosis and apoptosis in VSMC involves differentially regulated subcellular pools of SVV. Thus, treatment of VSMC with RNAi targeting SVV might limit the response to vascular injury

  18. RNAi Screening with Self-Delivering, Synthetic siRNAs for Identification of Genes That Regulate Primary Human T Cell Migration.

    PubMed

    Freeley, Michael; Derrick, Emily; Dempsey, Eugene; Hoff, Antje; Davies, Anthony; Leake, Devin; Vermeulen, Annaleen; Kelleher, Dermot; Long, Aideen

    2015-09-01

    Screening of RNA interference (RNAi) libraries in primary T cells is labor-intensive and technically challenging because these cells are hard to transfect. Chemically modified, self-delivering small interfering RNAs (siRNAs) offer a solution to this problem, because they enter hard-to-transfect cell types without needing a delivery reagent and are available in library format for RNAi screening. In this study, we have screened a library of chemically modified, self-delivering siRNAs targeting the expression of 72 distinct genes in conjunction with an image-based high-content-analysis platform as a proof-of-principle strategy to identify genes involved in lymphocyte function-associated antigen-1 (LFA-1)-mediated migration in primary human T cells. Our library-screening strategy identified the small GTPase RhoA as being crucial for T cell polarization and migration in response to LFA-1 stimulation and other migratory ligands. We also demonstrate that multiple downstream assays can be performed within an individual RNAi screen and have used the remainder of the cells for additional assays, including cell viability and adhesion to ICAM-1 (the physiological ligand for LFA-1) in the absence or presence of the chemokine SDF-1α. This study therefore demonstrates the ease and benefits of conducting siRNA library screens in primary human T cells using self-delivering, chemically modified siRNAs, and it emphasizes the feasibility and potential of this approach for elucidating the signaling pathways that regulate T cell function. © 2015 Society for Laboratory Automation and Screening.

  19. RNAi in Arthropods: Insight into the Machinery and Applications for Understanding the Pathogen-Vector Interface

    PubMed Central

    Barnard, Annette-Christi; Nijhof, Ard M.; Fick, Wilma; Stutzer, Christian; Maritz-Olivier, Christine

    2012-01-01

    The availability of genome sequencing data in combination with knowledge of expressed genes via transcriptome and proteome data has greatly advanced our understanding of arthropod vectors of disease. Not only have we gained insight into vector biology, but also into their respective vector-pathogen interactions. By combining the strengths of postgenomic databases and reverse genetic approaches such as RNAi, the numbers of available drug and vaccine targets, as well as number of transgenes for subsequent transgenic or paratransgenic approaches, have expanded. These are now paving the way for in-field control strategies of vectors and their pathogens. Basic scientific questions, such as understanding the basic components of the vector RNAi machinery, is vital, as this allows for the transfer of basic RNAi machinery components into RNAi-deficient vectors, thereby expanding the genetic toolbox of these RNAi-deficient vectors and pathogens. In this review, we focus on the current knowledge of arthropod vector RNAi machinery and the impact of RNAi on understanding vector biology and vector-pathogen interactions for which vector genomic data is available on VectorBase. PMID:24705082

  20. Specific Silencing of L392V PSEN1 Mutant Allele by RNA Interference

    PubMed Central

    Sierant, Malgorzata; Paduszynska, Alina; Kazmierczak-Baranska, Julia; Nacmias, Benedetta; Sorbi, Sandro; Bagnoli, Silvia; Sochacka, Elzbieta; Nawrot, Barbara

    2011-01-01

    RNA interference (RNAi) technology provides a powerful molecular tool to reduce an expression of selected genes in eukaryotic cells. Short interfering RNAs (siRNAs) are the effector molecules that trigger RNAi. Here, we describe siRNAs that discriminate between the wild type and mutant (1174 C→G) alleles of human Presenilin1 gene (PSEN1). This mutation, resulting in L392V PSEN1 variant, contributes to early onset familial Alzheimer's disease. Using the dual fluorescence assay, flow cytometry and fluorescent microscopy we identified positions 8th–11th, within the central part of the antisense strand, as the most sensitive to mismatches. 2-Thiouridine chemical modification introduced at the 3′-end of the antisense strand improved the allele discrimination, but wobble base pairing adjacent to the mutation site abolished the siRNA activity. Our data indicate that siRNAs can be designed to discriminate between the wild type and mutant alleles of genes that differ by just a single nucleotide. PMID:21559198

  1. Biotechnological uses of RNAi in plants: risk assessment considerations.

    PubMed

    Casacuberta, Josep M; Devos, Yann; du Jardin, Patrick; Ramon, Matthew; Vaucheret, Hervé; Nogué, Fabien

    2015-03-01

    RNAi offers opportunities to generate new traits in genetically modified (GM) plants. Instead of expressing novel proteins, RNAi-based GM plants reduce target gene expression. Silencing of off-target genes may trigger unintended effects, and identifying these genes would facilitate risk assessment. However, using bioinformatics alone is not reliable, due to the lack of genomic data and insufficient knowledge of mechanisms governing mRNA-small (s)RNA interactions. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. High throughput RNAi assay optimization using adherent cell cytometry.

    PubMed

    Nabzdyk, Christoph S; Chun, Maggie; Pradhan, Leena; Logerfo, Frank W

    2011-04-25

    siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). AoSMC were seeded at a density of 3000-8000 cells/well of a 96 well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs.

  3. High throughput RNAi assay optimization using adherent cell cytometry

    PubMed Central

    2011-01-01

    Background siRNA technology is a promising tool for gene therapy of vascular disease. Due to the multitude of reagents and cell types, RNAi experiment optimization can be time-consuming. In this study adherent cell cytometry was used to rapidly optimize siRNA transfection in human aortic vascular smooth muscle cells (AoSMC). Methods AoSMC were seeded at a density of 3000-8000 cells/well of a 96well plate. 24 hours later AoSMC were transfected with either non-targeting unlabeled siRNA (50 nM), or non-targeting labeled siRNA, siGLO Red (5 or 50 nM) using no transfection reagent, HiPerfect or Lipofectamine RNAiMax. For counting cells, Hoechst nuclei stain or Cell Tracker green were used. For data analysis an adherent cell cytometer, Celigo® was used. Data was normalized to the transfection reagent alone group and expressed as red pixel count/cell. Results After 24 hours, none of the transfection conditions led to cell loss. Red fluorescence counts were normalized to the AoSMC count. RNAiMax was more potent compared to HiPerfect or no transfection reagent at 5 nM siGLO Red (4.12 +/-1.04 vs. 0.70 +/-0.26 vs. 0.15 +/-0.13 red pixel/cell) and 50 nM siGLO Red (6.49 +/-1.81 vs. 2.52 +/-0.67 vs. 0.34 +/-0.19). Fluorescence expression results supported gene knockdown achieved by using MARCKS targeting siRNA in AoSMCs. Conclusion This study underscores that RNAi delivery depends heavily on the choice of delivery method. Adherent cell cytometry can be used as a high throughput-screening tool for the optimization of RNAi assays. This technology can accelerate in vitro cell assays and thus save costs. PMID:21518450

  4. A simple and robust vector-based shRNA expression system used for RNA interference.

    PubMed

    Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

    2013-01-01

    RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

  5. DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells

    PubMed Central

    Spike, Caroline A.; Bader, Jason; Reinke, Valerie; Strome, Susan

    2008-01-01

    P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs). PMID:18234720

  6. DEPS-1 promotes P-granule assembly and RNA interference in C. elegans germ cells.

    PubMed

    Spike, Caroline A; Bader, Jason; Reinke, Valerie; Strome, Susan

    2008-03-01

    P granules are germ-cell-specific cytoplasmic structures containing RNA and protein, and required for proper germ cell development in C. elegans. PGL-1 and GLH-1 were previously identified as critical components of P granules. We have identified a new P-granule-associated protein, DEPS-1, the loss of which disrupts P-granule structure and function. DEPS-1 is required for the proper localization of PGL-1 to P granules, the accumulation of glh-1 mRNA and protein, and germ cell proliferation and fertility at elevated temperatures. In addition, DEPS-1 is required for RNA interference (RNAi) of germline-expressed genes, possibly because DEPS-1 promotes the accumulation of RDE-4, a dsRNA-binding protein required for RNAi. A genome wide analysis of gene expression in deps-1 mutant germ lines identified additional targets of DEPS-1 regulation, many of which are also regulated by the RNAi factor RDE-3. Our studies suggest that DEPS-1 is a key component of the P-granule assembly pathway and that its roles include promoting accumulation of some mRNAs, such as glh-1 and rde-4, and reducing accumulation of other mRNAs, perhaps by collaborating with RDE-3 to generate endogenous short interfering RNAs (endo-siRNAs).

  7. Long-term absorption of poly-L-lactic Acid interference screws.

    PubMed

    Barber, F Alan; Dockery, W Dee

    2006-08-01

    To evaluate the long term in vivo degradation of poly-L-lactic acid (PLLA) interference screws with computed tomography (CT) and radiography as used in patellar tendon autograft anterior cruciate ligament (ACL) reconstruction. A total of 20 patients who had undergone patellar tendon autograft ACL reconstruction fixed with PLLA screws at least 7 years earlier were evaluated by physical examination, radiography, and CT to determine whether PLLA screw reabsorption and bone ingrowth had occurred. This study was granted Institutional Review Board approval. Lysholm, Tegner, Cincinnati, and International Knee Documentation Committee (IKDC) scores were obtained. CT data were measured in Hounsfield units. In all, 15 men and 5 women were evaluated 104 months after surgery (range, 89 to 124 months). CT and radiography demonstrated that the bone plug had fused to the tunnel wall, and that no intact interference screw was left. A parallel, threaded, and corticated screw tract was visible adjacent to the bone plug. No bone ingrowth had occurred at the screw site, although, occasionally, minimal calcification was seen. This was never as dense as cancellous bone, and no trabeculae were ever present. No positive pivot-shift test results were obtained. Lysholm, Tegner, and Cincinnati scores were 83, 5.6, and 75, respectively, at follow-up. Average KT difference was 0.7 mm. PLLA interference screws completely degraded, and the resulting area demonstrated a low Hounsfield count, consistent with soft tissue 7 years after insertion. No significant bone ingrowth occurred at the screw site. Femoral and tibial ACL tunnels were absent of anything but fibrous tissue and usually had a sclerotic cortical lining. PLLA biodegradable ACL screws eventually disappear completely. PLLA material is not replaced by bone. ACL graft tunnels are filled with nonossified material. This study provides a baseline for comparison with other biodegradable interference screws that may encourage bone ingrowth as

  8. Versatile RNA Interference Nanoplatform for Systemic Delivery of RNAs

    PubMed Central

    2015-01-01

    Development of nontoxic, tumor-targetable, and potent in vivo RNA delivery systems remains an arduous challenge for clinical application of RNAi therapeutics. Herein, we report a versatile RNAi nanoplatform based on tumor-targeted and pH-responsive nanoformulas (NFs). The NF was engineered by combination of an artificial RNA receptor, Zn(II)-DPA, with a tumor-targetable and drug-loadable hyaluronic acid nanoparticle, which was further modified with a calcium phosphate (CaP) coating by in situ mineralization. The NF can encapsulate small-molecule drugs within its hydrophobic inner core and strongly secure various RNA molecules (siRNAs, miRNAs, and oligonucleotides) by utilizing Zn(II)-DPA and a robust CaP coating. We substantiated the versatility of the RNAi nanoplatform by demonstrating effective delivery of siRNA and miRNA for gene silencing or miRNA replacement into different human types of cancer cells in vitro and into tumor-bearing mice in vivo by intravenous administration. The therapeutic potential of NFs coloaded with an anticancer drug doxorubicin (Dox) and multidrug resistance 1 gene target siRNA (siMDR) was also demonstrated in this study. NFs loaded with Dox and siMDR could successfully sensitize drug-resistant OVCAR8/ADR cells to Dox and suppress OVCAR8/ADR tumor cell proliferation in vitro and tumor growth in vivo. This gene/drug delivery system appears to be a highly effective nonviral method to deliver chemo- and RNAi therapeutics into host cells. PMID:24779637

  9. Systemic RNAi-mediated Gene Silencing in Nonhuman Primate and Rodent Myeloid Cells

    PubMed Central

    Novobrantseva, Tatiana I; Borodovsky, Anna; Wong, Jamie; Klebanov, Boris; Zafari, Mohammad; Yucius, Kristina; Querbes, William; Ge, Pei; Ruda, Vera M; Milstein, Stuart; Speciner, Lauren; Duncan, Rick; Barros, Scott; Basha, Genc; Cullis, Pieter; Akinc, Akin; Donahoe, Jessica S; Narayanannair Jayaprakash, K; Jayaraman, Muthusamy; Bogorad, Roman L; Love, Kevin; Whitehead, Katie; Levins, Chris; Manoharan, Muthiah; Swirski, Filip K; Weissleder, Ralph; Langer, Robert; Anderson, Daniel G; de Fougerolles, Antonin; Nahrendorf, Matthias; Koteliansky, Victor

    2012-01-01

    Leukocytes are central regulators of inflammation and the target cells of therapies for key diseases, including autoimmune, cardiovascular, and malignant disorders. Efficient in vivo delivery of small interfering RNA (siRNA) to immune cells could thus enable novel treatment strategies with broad applicability. In this report, we develop systemic delivery methods of siRNA encapsulated in lipid nanoparticles (LNP) for durable and potent in vivo RNA interference (RNAi)-mediated silencing in myeloid cells. This work provides the first demonstration of siRNA-mediated silencing in myeloid cell types of nonhuman primates (NHPs) and establishes the feasibility of targeting multiple gene targets in rodent myeloid cells. The therapeutic potential of these formulations was demonstrated using siRNA targeting tumor necrosis factor-α (TNFα) which induced substantial attenuation of disease progression comparable to a potent antibody treatment in a mouse model of rheumatoid arthritis (RA). In summary, we demonstrate a broadly applicable and therapeutically relevant platform for silencing disease genes in immune cells. PMID:23344621

  10. Salicylic Acid Interferes with Tobacco Mosaic Virus Replication via a Novel Salicylhydroxamic Acid-Sensitive Mechanism.

    PubMed Central

    Chivasa, S.; Murphy, A. M.; Naylor, M.; Carr, J. P.

    1997-01-01

    Salicylic acid (SA) induces resistance to all plant pathogens, including bacteria, fungi, and viruses, but the mechanism by which SA engenders resistance to viruses is not known. Pretreatment of tobacco mosaic virus (TMV)-susceptible (nn genotype) tobacco tissue with SA reduced the levels of viral RNAs and viral coat protein accumulating after inoculation with TMV. Viral RNAs were not affected equally, suggesting that SA treatment interferes with TMV replication. Salicylhydroxamic acid (SHAM), an inhibitor of the mitochondrial alternative oxidase, antagonized both SA-induced resistance to TMV in nn genotype plants and SA-induced acquired resistance in resistant (NN genotype) tobacco. SHAM did not inhibit induction of the PR-1 pathogenesis-related protein or induction of resistance to Erwinia carotovora or Botrytis cinerea by SA. This indicates that SA induces resistance to TMV via a novel SHAM-sensitive signal transduction pathway (potentially involving alternative oxidase), which is distinct from that leading to resistance to bacteria and fungi. PMID:12237364

  11. Combining RNA interference and kinase inhibitors against cell signalling components involved in cancer

    PubMed Central

    O'Grady, Michael; Raha, Debasish; Hanson, Bonnie J; Bunting, Michaeline; Hanson, George T

    2005-01-01

    Background The transcription factor activator protein-1 (AP-1) has been implicated in a large variety of biological processes including oncogenic transformation. The tyrosine kinases of the epidermal growth factor receptor (EGFR) constitute the beginning of one signal transduction cascade leading to AP-1 activation and are known to control cell proliferation and differentiation. Drug discovery efforts targeting this receptor and other pathway components have centred on monoclonal antibodies and small molecule inhibitors. Resistance to such inhibitors has already been observed, guiding the prediction of their use in combination therapies with other targeted agents such as RNA interference (RNAi). This study examines the use of RNAi and kinase inhibitors for qualification of components involved in the EGFR/AP-1 pathway of ME180 cells, and their inhibitory effects when evaluated individually or in tandem against multiple components of this important disease-related pathway. Methods AP-1 activation was assessed using an ME180 cell line stably transfected with a beta-lactamase reporter gene under the control of AP-1 response element following epidermal growth factor (EGF) stimulation. Immunocytochemistry allowed for further quantification of small molecule inhibition on a cellular protein level. RNAi and RT-qPCR experiments were performed to assess the amount of knockdown on an mRNA level, and immunocytochemistry was used to reveal cellular protein levels for the targeted pathway components. Results Increased potency of kinase inhibitors was shown by combining RNAi directed towards EGFR and small molecule inhibitors acting at proximal or distal points in the pathway. After cellular stimulation with EGF and analysis at the level of AP-1 activation using a β-lactamase reporter gene, a 10–12 fold shift or 2.5–3 fold shift toward greater potency in the IC50 was observed for EGFR and MEK-1 inhibitors, respectively, in the presence of RNAi targeting EGFR. Conclusion EGFR

  12. RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans

    PubMed Central

    Hall, Sarah E.; Chirn, Gung-Wei; Lau, Nelson C.; Sengupta, Piali

    2013-01-01

    Early environmental experiences profoundly influence adult phenotypes through complex mechanisms that are poorly understood. We previously showed that adult Caenorhabditis elegans that transiently passed through the stress-induced dauer larval stage (post-dauer adults) exhibit significant changes in gene expression profiles, chromatin states, and life history traits when compared with adults that bypassed the dauer stage (control adults). These wild-type, isogenic animals of equivalent developmental stages exhibit different signatures of molecular marks that reflect their distinct developmental trajectories. To gain insight into the mechanisms that contribute to these developmental history-dependent phenotypes, we profiled small RNAs from post-dauer and control adults by deep sequencing. RNA interference (RNAi) pathways are known to regulate genome-wide gene expression both at the chromatin and post-transcriptional level. By quantifying changes in endogenous small interfering RNA (endo-siRNA) levels in post-dauer as compared with control animals, our analyses identified a subset of genes that are likely targets of developmental history-dependent reprogramming through a complex RNAi-mediated mechanism. Mutations in specific endo-siRNA pathways affect expected gene expression and chromatin state changes for a subset of genes in post-dauer animals, as well as disrupt their increased brood size phenotype. We also find that both chromatin state and endo-siRNA distribution in dauers are unique, and suggest that remodeling in dauers provides a template for the subsequent establishment of adult post-dauer profiles. Our results indicate a role for endo-siRNA pathways as a contributing mechanism to early experience-dependent phenotypic plasticity in adults, and describe how developmental history can program adult physiology and behavior via epigenetic mechanisms. PMID:23329696

  13. Search for Limiting Factors in the RNAi Pathway in Silkmoth Tissues and the Bm5 Cell Line: The RNA-Binding Proteins R2D2 and Translin

    PubMed Central

    Swevers, Luc; Liu, Jisheng; Huvenne, Hanneke; Smagghe, Guy

    2011-01-01

    RNA interference (RNAi), an RNA-dependent gene silencing process that is initiated by double-stranded RNA (dsRNA) molecules, has been applied with variable success in lepidopteran insects, in contrast to the high efficiency achieved in the coleopteran Tribolium castaneum. To gain insight into the factors that determine the efficiency of RNAi, a survey was carried out to check the expression of factors that constitute the machinery of the small interfering RNA (siRNA) and microRNA (miRNA) pathways in different tissues and stages of the silkmoth, Bombyx mori. It was found that the dsRNA-binding protein R2D2, an essential component in the siRNA pathway in Drosophila, was expressed at minimal levels in silkmoth tissues. The silkmoth-derived Bm5 cell line was also deficient in expression of mRNA encoding full-length BmTranslin, an RNA-binding factor that has been shown to stimulate the efficiency of RNAi. However, despite the lack of expression of the RNA-binding proteins, silencing of a luciferase reporter gene was observed by co-transfection of luc dsRNA using a lipophilic reagent. In contrast, gene silencing was not detected when the cells were soaked in culture medium supplemented with dsRNA. The introduction of an expression construct for Tribolium R2D2 (TcR2D2) did not influence the potency of luc dsRNA to silence the luciferase reporter. Immunostaining experiments further showed that both TcR2D2 and BmTranslin accumulated at defined locations within the cytoplasm of transfected cells. Our results offer a first evaluation of the expression of the RNAi machinery in silkmoth tissues and Bm5 cells and provide evidence for a functional RNAi response to intracellular dsRNA in the absence of R2D2 and Translin. The failure of TcR2D2 to stimulate the intracellular RNAi pathway in Bombyx cells is discussed. PMID:21637842

  14. RNAi as an emerging approach to control Fusarium head blight disease and mycotoxin contamination in cereals

    PubMed Central

    Machado, Ana Karla; Brown, Neil A; Urban, Martin; Kanyuka, Kostya

    2017-01-01

    Abstract Fusarium graminearum is a major fungal pathogen of cereals worldwide, causing seedling, stem base and floral diseases, including Fusarium head blight (FHB). In addition to yield and quality losses, FHB contaminates cereal grain with mycotoxins, including deoxynivalenol, which are harmful to human, animal and ecosystem health. Currently, FHB control is only partially effective due to several intractable problems. RNA interference (RNAi) is a natural mechanism that regulates gene expression. RNAi has been exploited in the development of new genomic tools that allow the targeted silencing of genes of interest in many eukaryotes. Host‐induced gene silencing (HIGS) is a transgenic technology used to silence fungal genes in planta during attempted infection and thereby reduces disease levels. HIGS relies on the host plant's ability to produce mobile small interfering RNA molecules, generated from long double‐stranded RNA, which are complementary to targeted fungal genes. These molecules are transferred from the plant to invading fungi via an uncharacterised mechanism, to cause gene silencing. Here, we describe recent advances in RNAi‐mediated control of plant pathogenic fungi, highlighting the key advantages and disadvantages. We then discuss the developments and implications of combining HIGS with other methods of disease control. © 2017 The Authors. Pest Management Science published by John Wiley & Sons Ltd on behalf of Society of Chemical Industry. PMID:28967180

  15. RNAiFold2T: Constraint Programming design of thermo-IRES switches.

    PubMed

    Garcia-Martin, Juan Antonio; Dotu, Ivan; Fernandez-Chamorro, Javier; Lozano, Gloria; Ramajo, Jorge; Martinez-Salas, Encarnacion; Clote, Peter

    2016-06-15

    RNA thermometers (RNATs) are cis-regulatory elements that change secondary structure upon temperature shift. Often involved in the regulation of heat shock, cold shock and virulence genes, RNATs constitute an interesting potential resource in synthetic biology, where engineered RNATs could prove to be useful tools in biosensors and conditional gene regulation. Solving the 2-temperature inverse folding problem is critical for RNAT engineering. Here we introduce RNAiFold2T, the first Constraint Programming (CP) and Large Neighborhood Search (LNS) algorithms to solve this problem. Benchmarking tests of RNAiFold2T against existent programs (adaptive walk and genetic algorithm) inverse folding show that our software generates two orders of magnitude more solutions, thus allowing ample exploration of the space of solutions. Subsequently, solutions can be prioritized by computing various measures, including probability of target structure in the ensemble, melting temperature, etc. Using this strategy, we rationally designed two thermosensor internal ribosome entry site (thermo-IRES) elements, whose normalized cap-independent translation efficiency is approximately 50% greater at 42 °C than 30 °C, when tested in reticulocyte lysates. Translation efficiency is lower than that of the wild-type IRES element, which on the other hand is fully resistant to temperature shift-up. This appears to be the first purely computational design of functional RNA thermoswitches, and certainly the first purely computational design of functional thermo-IRES elements. RNAiFold2T is publicly available as part of the new release RNAiFold3.0 at https://github.com/clotelab/RNAiFold and http://bioinformatics.bc.edu/clotelab/RNAiFold, which latter has a web server as well. The software is written in C ++ and uses OR-Tools CP search engine. clote@bc.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  16. Use of double-stranded RNA-mediated interference to determine the substrates of protein tyrosine kinases and phosphatases.

    PubMed

    Muda, Marco; Worby, Carolyn A; Simonson-Leff, Nancy; Clemens, James C; Dixon, Jack E

    2002-08-15

    Despite the wealth of information generated by genome-sequencing projects, the identification of in vivo substrates of specific protein kinases and phosphatases is hampered by the large number of candidate enzymes, overlapping enzyme specificity and sequence similarity. In the present study, we demonstrate the power of RNA interference (RNAi) to dissect signal transduction cascades involving specific kinases and phosphatases. RNAi is used to identify the cellular tyrosine kinases upstream of the phosphorylation of Down-Syndrome cell-adhesion molecule (Dscam), a novel cell-surface molecule of the immunoglobulin-fibronectin super family, which has been shown to be important for axonal path-finding in Drosophila. Tyrosine phosphorylation of Dscam recruits the Src homology 2 domain of the adaptor protein Dock to the receptor. Dock, the ortho- logue of mammalian Nck, is also essential for correct axonal path-finding in Drosophila. We further determined that Dock is tyrosine-phosphorylated in vivo and identified DPTP61F as the protein tyrosine phosphatase responsible for maintaining Dock in its non-phosphorylated state. The present study illustrates the versatility of RNAi in the identification of the physiological substrates for protein kinases and phosphatases.

  17. Melamine and Cyanuric Acid do not interfere with Bradford and Ninhydrin assays for protein determination.

    PubMed

    Field, Anjalie; Field, Jeffrey

    2010-08-01

    In the fall of 2007 pet food contaminated with melamine and cyanuric acid caused kidney stones in thousands of animals. In the summer of 2008, a more serious outbreak of adulterated dairy food caused the deaths of six infants and sickened about 290,000 children in China. In all cases, melamine was likely added to inflate the apparent protein content of the foods. To determine if we could measure protein without interference from melamine and cyanuric acid we tested these compounds in the Bradford and Ninhydrin assays, two common dye-based assays for protein, as well as by ammonia release, the most common assay used in the food industry. Neither compound was detected in the Ninhydrin and Bradford assays at concentrations of >100 μg/ml. The ammonia assay detected melamine but was inconclusive with respect to cyanuric acid. To develop an accurate test for food that would not detect either chemical as a protein, assays were run on cat food and reconstituted milk powder. The Bradford assay readily measured the protein content of each food, and importantly, the addition of melamine or cyanuric acid to reconstituted milk did not affect the readings. The protein concentrations obtained for reconstituted milk powder were as expected, but those for the cat food were 10 to 30-fold lower, due to its low solubility. We conclude that dye-binding assays can be employed to detect protein in food without interference from melamine and cyanuric acid, thus reducing the incentive to use them as additives.

  18. The Caenorhabditis elegans RDE-10/RDE-11 complex regulates RNAi by promoting secondary siRNA amplification.

    PubMed

    Zhang, Chi; Montgomery, Taiowa A; Fischer, Sylvia E J; Garcia, Susana M D A; Riedel, Christian G; Fahlgren, Noah; Sullivan, Christopher M; Carrington, James C; Ruvkun, Gary

    2012-05-22

    In nematodes, plants, and fungi, RNAi is remarkably potent and persistent due to the amplification of initial silencing signals by RNA-dependent RNA polymerases (RdRPs). In Caenorhabditis elegans (C. elegans), the interaction between the RNA-induced silencing complex (RISC) loaded with primary small interfering RNAs (siRNAs) and the target messenger RNA (mRNA) leads to the recruitment of RdRPs and synthesis of secondary siRNAs using the target mRNA as the template. The mechanism and genetic requirements for secondary siRNA accumulation are not well understood. From a forward genetic screen for C. elegans genes required for RNAi, we identified rde-10, and through proteomic analysis of RDE-10-interacting proteins, we identified a protein complex containing the new RNAi factor RDE-11, the known RNAi factors RSD-2 and ERGO-1, and other candidate RNAi factors. The RNAi defective genes rde-10 and rde-11 encode a novel protein and a RING-type zinc finger domain protein, respectively. Mutations in rde-10 and rde-11 genes cause dosage-sensitive RNAi deficiencies: these mutants are resistant to low dosage but sensitive to high dosage of double-stranded RNAs. We assessed the roles of rde-10, rde-11, and other dosage-sensitive RNAi-defective genes rsd-2, rsd-6, and haf-6 in both exogenous and endogenous small RNA pathways using high-throughput sequencing and qRT-PCR. These genes are required for the accumulation of secondary siRNAs in both exogenous and endogenous RNAi pathways. The RDE-10/RDE-11 complex is essential for the amplification of RNAi in C. elegans by promoting secondary siRNA accumulation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  19. The Caenorhabditis elegans RDE-10/RDE-11 complex regulates RNAi by promoting secondary siRNA amplification

    PubMed Central

    Zhang, Chi; Montgomery, Taiowa A.; Fischer, Sylvia E. J.; Garcia, Susana M. D. A.; Riedel, Christian G.; Fahlgren, Noah; Sullivan, Christopher M.; Carrington, James C.; Ruvkun, Gary

    2012-01-01

    SUMMARY Background In nematodes, plants and fungi, RNAi is remarkably potent and persistent due to the amplification of initial silencing signals by RNA-dependent RNA polymerases (RdRPs). In Caenorhabditis elegans (C. elegans), the interaction between the RNA-induced silencing complex (RISC) loaded with primary siRNAs and the target mRNA leads to the recruitment of RdRPs and synthesis of secondary siRNAs using the target mRNA as the template. The mechanism and genetic requirements for secondary siRNA accumulation are not well understood. Results From a forward genetic screen for C. elegans genes required for RNAi, we identified rde-10 and through proteomic analysis of RDE-10-interacting proteins, we identified a protein complex containing the new RNAi factor RDE-11, the known RNAi factors RSD-2 and ERGO-1, as well as other candidate RNAi factors. The RNAi defective genes rde-10 and rde-11 encode a novel protein and a RING-type zinc finger domain protein, respectively. Mutations in rde-10 and rde-11 genes cause dosage-sensitive RNAi deficiencies: these mutants are resistant to low dosage, but sensitive to high dosage of double-stranded RNAs (dsRNAs). We assessed the roles of rde-10, rde-11, and other dosage-sensitive RNAi-defective genes rsd-2, rsd-6 and haf-6 in both exogenous and endogenous small RNA pathways using high-throughput sequencing and qRT-PCR. These genes are required for the accumulation of secondary siRNAs in both exogenous and endogenous RNAi pathways. Conclusions The RDE-10/RDE-11 complex is essential for the amplification of RNAi in C. elegans by promoting secondary siRNA accumulation. PMID:22542102

  20. RNA interference of chitin synthase genes inhibits chitin biosynthesis and affects larval performance in Leptinotarsa decemlineata (Say).

    PubMed

    Shi, Ji-Feng; Mu, Li-Li; Chen, Xu; Guo, Wen-Chao; Li, Guo-Qing

    2016-01-01

    Dietary introduction of bacterially expressed double-stranded RNA (dsRNA) has great potential for management of Leptinotarsa decemlineata . Identification of the most attractive candidate genes for RNA interference (RNAi) is the first step. In the present paper, three complete chitin synthase cDNA sequences ( LdChSAa , LdChSAb and LdChSB ) were cloned. LdChSAa and LdChSAb , two splicing variants of LdChSA gene, were highly expressed in ectodermally-derived epidermal cells forming epidermis, trachea, foregut and hindgut, whereas LdChSB was mainly transcribed in midgut cells. Feeding bacterially expressed ds ChSA (derived from a common fragment of LdChSAa and LdChSAb ), ds ChSAa , ds ChSAb and ds ChSB in the second- and fourth-instar larvae specifically knocked down their target mRNAs. RNAi of LdChSAa + LdChSAb and LdChSAa lowered chitin contents in whole body and integument samples, and thinned tracheal taenidia. The resulting larvae failed to ecdyse, pupate, or emerge as adults. Comparably, knockdown of LdChSAb mainly affected pupal-adult molting. The LdChSAb RNAi pupae did not completely shed the old larval exuviae, which caused failure of adult emergence. In contrast, silencing of LdChSB significantly reduced foliage consumption, decreased chitin content in midgut sample, damaged midgut peritrophic matrix, and retarded larval growth. As a result, the development of the LdChSB RNAi hypomorphs was arrested. Our data reveal that these LdChS s are among the effective candidate genes for an RNAi-based control strategy against L. decemlineata .

  1. Suppression of polygalacturonase gene expression in the phytopathogenic fungus Ophiostoma novo-ulmi by RNA interference.

    PubMed

    Carneiro, Joyce S; de la Bastide, Paul Y; Chabot, Meghan; Lerch, Lindsey; Hintz, William E

    2010-05-01

    The fungal pathogen, Ophiostomo novo-ulmi, has been responsible for the rapid decline of American elm (Ulmus americana) across North America and remains a serious threat to surviving elm populations. The production of pectinolytic polygalacturonase enzymes has been implicated as a virulence factor for many fungal pathogens, including O. novo-ulmi. Previous work has shown that the targeted disruption of the endopolygalacturonase gene locus epg1 of O. novo-ulmi reduced, but did not eliminate pectinase activity. In the present study, we evaluated the use of RNA interference (RNAi) as a method of suppressing expression of the epg1 locus in O. novo-ulmi and compared its efficiency to the gene disruption method. While there was a reduction in epg1-specific mRNA transcripts and in the amount of polygalacturonase enzyme secreted for both methods of gene regulation, neither method completely suppressed the expression of pectinase activity. There was, however, a significantly greater reduction in both transcript levels and secreted enzyme observed for some of the RNAi transformants. As the first demonstration of RNAi in O. novo-ulmi, this method of gene regulation shows promise in future studies of gene expression and pathogenicity. Copyright 2010 Elsevier Inc. All rights reserved.

  2. RNA interference as a resistance mechanism against crop parasites in Africa: a 'Trojan horse' approach.

    PubMed

    Runo, Steven; Alakonya, Amos; Machuka, Jesse; Sinha, Neelima

    2011-02-01

    Biological crop pests cause serious economic losses. In Africa, the most prevalent parasites are insect pests, plant pathogenic root-knot nematodes, viruses and parasitic plants. African smallholder farmers struggle to overcome these parasitic constraints to agricultural production. Crop losses and the host range of these parasites have continued to increase in spite of the use of widely advocated control methods. A sustainable method to overcome biological pests in Africa would be to develop crop germplasm resistant to parasites. This is achievable using either genetic modification (GM) or a non-GM approach. However, there is a paucity of resistant genes available for introduction. Additionally, the biological processes underpinning host parasite resistance are not sufficiently well understood. The authors review a technology platform for using RNA-mediated interference (RNAi) as bioengineered resistance to important crop parasites in Africa. To achieve acquired resistance, a host crop is stably transformed with a transgene that encodes a hairpin RNA targeting essential parasitic genes. The RNAi sequence is chosen in such a way that it shares no homology with the host's genes, so it remains 'inactive' until parasitism. Upon parasitism, the RNAi sequence enters the parasite and post-transcriptional gene silencing (PTGS) mechanisms are activated, leading to the death of the parasite. Copyright © 2010 Society of Chemical Industry.

  3. RNAi therapeutics and applications of microRNAs in cancer treatment.

    PubMed

    Uchino, Keita; Ochiya, Takahiro; Takeshita, Fumitaka

    2013-06-01

    RNA interference-based therapies are proving to be powerful tools for combating various diseases, including cancer. Scientists are researching the development of safe and efficient systems for the delivery of small RNA molecules, which are extremely fragile in serum, to target organs and cells in the human body. A dozen pre-clinical and clinical trials have been under way over the past few years involving biodegradable nanoparticles, lipids, chemical modification and conjugation. On the other hand, microRNAs, which control the balance of cellular biological processes, have been studied as attractive therapeutic targets in cancer treatment. In this review, we provide an overview of RNA interference-based therapeutics in clinical trials and discuss the latest technology for the systemic delivery of nucleic acid drugs. Furthermore, we focus on dysregulated microRNAs in human cancer, which have progressed in pre-clinical trials as therapeutic targets, and describe a wide range of strategies to control the expression levels of endogenous microRNAs. Further development of RNA interference technologies and progression of clinical trials will contribute to the achievement of practical applications of nucleic acid drugs.

  4. RNAi-mediated Control of Aflatoxins in Peanut: Method to Analyze Mycotoxin Production and Transgene Expression in the Peanut/Aspergillus Pathosystem

    PubMed Central

    Arias, Renée S.; Dang, Phat M.; Sobolev, Victor S.

    2015-01-01

    The Food and Agriculture Organization of the United Nations estimates that 25% of the food crops in the world are contaminated with aflatoxins. That represents 100 million tons of food being destroyed or diverted to non-human consumption each year. Aflatoxins are powerful carcinogens normally accumulated by the fungi Aspergillus flavus and A. parasiticus in cereals, nuts, root crops and other agricultural products. Silencing of five aflatoxin-synthesis genes by RNA interference (RNAi) in peanut plants was used to control aflatoxin accumulation following inoculation with A. flavus. Previously, no method existed to analyze the effectiveness of RNAi in individual peanut transgenic events, as these usually produce few seeds, and traditional methods of large field experiments under aflatoxin-conducive conditions were not an option. In the field, the probability of finding naturally contaminated seeds is often 1/100 to 1/1,000. In addition, aflatoxin contamination is not uniformly distributed. Our method uses few seeds per transgenic event, with small pieces processed for real-time PCR (RT-PCR) or small RNA sequencing, and for analysis of aflatoxin accumulation by ultra-performance liquid chromatography (UPLC). RNAi-expressing peanut lines 288-72 and 288-74, showed up to 100% reduction (p≤0.01) in aflatoxin B1 and B2 compared to the control that accumulated up to 14,000 ng.g-1 of aflatoxin B1 when inoculated with aflatoxigenic A. flavus. As reference, the maximum total of aflatoxins allowable for human consumption in the United States is 20 ng.g-1. This protocol describes the application of RNAi-mediated control of aflatoxins in transgenic peanut seeds and methods for its evaluation. We believe that its application in breeding of peanut and other crops will bring rapid advancement in this important area of science, medicine and human nutrition, and will significantly contribute to the international effort to control aflatoxins, and potentially other mycotoxins in major

  5. RNAi-mediated Control of Aflatoxins in Peanut: Method to Analyze Mycotoxin Production and Transgene Expression in the Peanut/Aspergillus Pathosystem.

    PubMed

    Arias, Renée S; Dang, Phat M; Sobolev, Victor S

    2015-12-21

    The Food and Agriculture Organization of the United Nations estimates that 25% of the food crops in the world are contaminated with aflatoxins. That represents 100 million tons of food being destroyed or diverted to non-human consumption each year. Aflatoxins are powerful carcinogens normally accumulated by the fungi Aspergillus flavus and A. parasiticus in cereals, nuts, root crops and other agricultural products. Silencing of five aflatoxin-synthesis genes by RNA interference (RNAi) in peanut plants was used to control aflatoxin accumulation following inoculation with A. flavus. Previously, no method existed to analyze the effectiveness of RNAi in individual peanut transgenic events, as these usually produce few seeds, and traditional methods of large field experiments under aflatoxin-conducive conditions were not an option. In the field, the probability of finding naturally contaminated seeds is often 1/100 to 1/1,000. In addition, aflatoxin contamination is not uniformly distributed. Our method uses few seeds per transgenic event, with small pieces processed for real-time PCR (RT-PCR) or small RNA sequencing, and for analysis of aflatoxin accumulation by ultra-performance liquid chromatography (UPLC). RNAi-expressing peanut lines 288-72 and 288-74, showed up to 100% reduction (p ≤ 0.01) in aflatoxin B1 and B2 compared to the control that accumulated up to 14,000 ng · g(-1) of aflatoxin B1 when inoculated with aflatoxigenic A. flavus. As reference, the maximum total of aflatoxins allowable for human consumption in the United States is 20 ng · g(-1). This protocol describes the application of RNAi-mediated control of aflatoxins in transgenic peanut seeds and methods for its evaluation. We believe that its application in breeding of peanut and other crops will bring rapid advancement in this important area of science, medicine and human nutrition, and will significantly contribute to the international effort to control aflatoxins, and potentially other

  6. Dicer and Argonaute Genes Involved in RNA Interference in the Entomopathogenic Fungus Metarhizium robertsii.

    PubMed

    Meng, Huimin; Wang, Zhangxun; Wang, Yulong; Zhu, Hong; Huang, Bo

    2017-04-01

    RNA interference (RNAi) is a gene-silencing mechanism that plays an important role in gene regulation in a number of eukaryotic organisms. Two core components, Dicer and Argonaute, are central in the RNAi machinery. However, the physiological roles of Dicer and Argonaute in the entomopathogenic fungus Metarhizium robertsii have remained unclear. Here, the roles of genes encoding Dicer ( M. robertsii dcl1 [ Mrdcl1 ] and Mrdcl2 ) and Argonaute ( Mrago1 and Mrago2 ) proteins in M. robertsii were investigated. The results showed that the Dicer-like protein MrDCL2 and Argonaute protein MrAGO1 are the major components of the RNAi process occurring in M. robertsii The Dicer and Argonaute genes were not involved in the regulation of growth and diverse abiotic stress response in M. robertsii under the tested conditions. Moreover, our results showed that the Dicer and Argonaute gene mutants demonstrated reduced abilities to produce conidia, compared to the wild type (WT) and the gene-rescued mutant. In particular, the conidial yields in the Δ dcl2 and Δ ago1 mutants were reduced by 55.8% and 59.3%, respectively, compared with those from the control strains. Subsequently, for the WT and Δ dcl2 mutant strains, digital gene expression (DGE) profiling analysis of the stage of mycelium growth and conidiogenesis revealed that modest changes occur in development or metabolism processes, which may explain the reduction in conidiation in the Δ dcl2 mutant. In addition, we further applied high-throughput sequencing technology to identify small RNAs (sRNAs) that are differentially expressed in the WT and the Δ dcl2 mutant and found that 4 known microRNA-like small RNAs (milRNAs) and 8 novel milRNAs were Mrdcl2 dependent in M. robertsii IMPORTANCE The identification and characterization of components in RNAi have contributed significantly to our understanding of the mechanism and functions of RNAi in eukaryotes. Here, we found that Dicer and Argonaute genes play an important role

  7. Delivery of dsRNA through topical feeding for RNA interference in the citrus sap piercing-sucking hemipteran, Diaphorina citri.

    PubMed

    Killiny, Nabil; Kishk, Abdelaziz

    2017-06-01

    RNA interference (RNAi) is a powerful means to study functional genomics in insects. The delivery of dsRNA is a challenging step in the development of RNAi assay. Here, we describe a new delivery method to increase the effectiveness of RNAi in the Asian citrus psyllid Diaphorina citri. Bromophenol blue droplets were topically applied to fifth instar nymphs and adults on the ventral side of the thorax between the three pairs of legs. In addition to video recordings that showed sucking of the bromophenol blue by the stylets, dissected guts turned blue indicating that the uptake was through feeding. Thus, we called the method topical feeding. We targeted the abnormal wing disc gene (awd), also called nucleoside diphosphate kinase (NDPK), as a reporter gene to prove the uptake of dsRNA via this method of delivery. Our results showed that dsRNA-awd caused reduction of awd expression and nymph mortality. Survival and lifespan of adults emerged from treated nymphs and treated adults were affected. Silencing awd caused wing malformation in the adults emerged from treated nymphs. Topical feeding as a delivery of dsRNA is highly efficient for both nymphs and adults. The described method could be used to increase the efficiency of RNAi in D. citri and other sap piercing-sucking hemipterans. © 2017 Wiley Periodicals, Inc.

  8. RNAi-mediated knockdown of serine protease inhibitor genes increases the mortality of Plutella xylostella challenged by destruxin A.

    PubMed

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G S; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides.

  9. RNAi-Mediated Knockdown of Serine Protease Inhibitor Genes Increases the Mortality of Plutella xylostella Challenged by Destruxin A

    PubMed Central

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G. S.; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides. PMID:24837592

  10. RNAi-mediated knockdown of the voltage gated sodium ion channel TcNav causes mortality in Tribolium castaneum.

    PubMed

    Abd El Halim, Hesham M; Alshukri, Baida M H; Ahmad, Munawar S; Nakasu, Erich Y T; Awwad, Mohammed H; Salama, Elham M; Gatehouse, Angharad M R; Edwards, Martin G

    2016-07-14

    The voltage-gated sodium ion channel (VGSC) belongs to the largest superfamily of ion channels. Since VGSCs play key roles in physiological processes they are major targets for effective insecticides. RNA interference (RNAi) is widely used to analyse gene function, but recently, it has shown potential to contribute to novel strategies for selectively controlling agricultural insect pests. The current study evaluates the delivery of dsRNA targeted to the sodium ion channel paralytic A (TcNav) gene in Tribolium castaneum as a viable means of controlling this insect pest. Delivery of TcNav dsRNA caused severe developmental arrest with larval mortalities up to 73% post injection of dsRNA. Injected larvae showed significant (p < 0.05) knockdown in gene expression between 30-60%. Expression was also significantly (p < 0.05) reduced in pupae following injection causing 30% and 42% knockdown for early and late pupal stages, respectively. Oral delivery of dsRNA caused dose-dependant mortalities of between 19 and 51.34%; this was accompanied by significant (p < 0.05) knockdown in gene expression following 3 days of continuous feeding. The majority of larvae injected with, or fed, dsRNA died during the final larval stage prior to pupation. This work provides evidence of a viable RNAi-based strategy for insect control.

  11. Biodegradable lipids enabling rapidly eliminated lipid nanoparticles for systemic delivery of RNAi therapeutics.

    PubMed

    Maier, Martin A; Jayaraman, Muthusamy; Matsuda, Shigeo; Liu, Ju; Barros, Scott; Querbes, William; Tam, Ying K; Ansell, Steven M; Kumar, Varun; Qin, June; Zhang, Xuemei; Wang, Qianfan; Panesar, Sue; Hutabarat, Renta; Carioto, Mary; Hettinger, Julia; Kandasamy, Pachamuthu; Butler, David; Rajeev, Kallanthottathil G; Pang, Bo; Charisse, Klaus; Fitzgerald, Kevin; Mui, Barbara L; Du, Xinyao; Cullis, Pieter; Madden, Thomas D; Hope, Michael J; Manoharan, Muthiah; Akinc, Akin

    2013-08-01

    In recent years, RNA interference (RNAi) therapeutics, most notably with lipid nanoparticle-based delivery systems, have advanced into human clinical trials. The results from these early clinical trials suggest that lipid nanoparticles (LNPs), and the novel ionizable lipids that comprise them, will be important materials in this emerging field of medicine. A persistent theme in the use of materials for biomedical applications has been the incorporation of biodegradability as a means to improve biocompatibility and/or to facilitate elimination. Therefore, the aim of this work was to further advance the LNP platform through the development of novel, next-generation lipids that combine the excellent potency of the most advanced lipids currently available with biodegradable functionality. As a representative example of this novel class of biodegradable lipids, the lipid evaluated in this work displays rapid elimination from plasma and tissues, substantially improved tolerability in preclinical studies, while maintaining in vivo potency on par with that of the most advanced lipids currently available.

  12. Defining the molecular profile of planarian pluripotent stem cells using a combinatorial RNAseq, RNA interference and irradiation approach.

    PubMed

    Solana, Jordi; Kao, Damian; Mihaylova, Yuliana; Jaber-Hijazi, Farah; Malla, Sunir; Wilson, Ray; Aboobaker, Aziz

    2012-01-01

    Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology.

  13. siRNA Delivery to the Lung: What’s New?

    PubMed Central

    Merkel, Olivia M.; Rubinstein, Israel; Kissel, Thomas

    2014-01-01

    RNA interference (RNAi) has been thought of as the general answer to many unmet medical needs. After the first success stories, it soon became obvious that short interfering RNA (siRNA) is not suitable for systemic administration due to its poor pharmacokinetics. Therefore local administration routes have been adopted for more successful in vivo RNAi. This paper reviews nucleic acid modifications, nanocarrier chemistry, animal models used in successful pulmonary siRNA delivery, as well as clinical translation approaches. We summarize what has been published recently and conclude with the potential problems that may still hamper the efficient clinical application of RNAi in the lung. PMID:24907426

  14. RNAi down-regulation of cinnamate-4-hydroxylase increases artemisinin biosynthesis in Artemisia annua.

    PubMed

    Kumar, Ritesh; Vashisth, Divya; Misra, Amita; Akhtar, Md Qussen; Jalil, Syed Uzma; Shanker, Karuna; Gupta, Madan Mohan; Rout, Prashant Kumar; Gupta, Anil Kumar; Shasany, Ajit Kumar

    2016-05-25

    Cinnamate-4-hydroxylase (C4H) converts trans-cinnamic acid (CA) to p-coumaric acid (COA) in the phenylpropanoid/lignin biosynthesis pathway. Earlier we reported increased expression of AaCYP71AV1 (an important gene of artemisinin biosynthesis pathway) caused by CA treatment in Artemisia annua. Hence, AaC4H gene was identified, cloned, characterized and silenced in A. annua with the assumption that the elevated internal CA due to knock down may increase the artemisinin yield. Accumulation of trans-cinnamic acid in the plant due to AaC4H knockdown was accompanied with the reduction of p-coumaric acid, total phenolics, anthocyanin, cinnamate-4-hydroxylase (C4H) and phenylalanine ammonia lyase (PAL) activities but increase in salicylic acid (SA) and artemisinin. Interestingly, feeding trans-cinnamic acid to the RNAi line increased the level of artemisinin along with benzoic (BA) and SA with no effect on the downstream metabolites p-coumaric acid, coniferylaldehyde and sinapaldehyde, whereas p-coumaric acid feeding increased the content of downstream coniferylaldehyde and sinapaldehyde with no effect on BA, SA, trans-cinnamic acid or artemisinin. SA is reported earlier to be inducing the artemisinin yield. This report demonstrates the link between the phenylpropanoid/lignin pathway with artemisinin pathway through SA, triggered by accumulation of trans-cinnamic acid because of the blockage at C4H.

  15. RNAi down-regulation of cinnamate-4-hydroxylase increases artemisinin biosynthesis in Artemisia annua

    PubMed Central

    Kumar, Ritesh; Vashisth, Divya; Misra, Amita; Akhtar, Md Qussen; Jalil, Syed Uzma; Shanker, Karuna; Gupta, Madan Mohan; Rout, Prashant Kumar; Gupta, Anil Kumar; Shasany, Ajit Kumar

    2016-01-01

    Cinnamate-4-hydroxylase (C4H) converts trans-cinnamic acid (CA) to p-coumaric acid (COA) in the phenylpropanoid/lignin biosynthesis pathway. Earlier we reported increased expression of AaCYP71AV1 (an important gene of artemisinin biosynthesis pathway) caused by CA treatment in Artemisia annua. Hence, AaC4H gene was identified, cloned, characterized and silenced in A. annua with the assumption that the elevated internal CA due to knock down may increase the artemisinin yield. Accumulation of trans-cinnamic acid in the plant due to AaC4H knockdown was accompanied with the reduction of p-coumaric acid, total phenolics, anthocyanin, cinnamate-4-hydroxylase (C4H) and phenylalanine ammonia lyase (PAL) activities but increase in salicylic acid (SA) and artemisinin. Interestingly, feeding trans-cinnamic acid to the RNAi line increased the level of artemisinin along with benzoic (BA) and SA with no effect on the downstream metabolites p-coumaric acid, coniferylaldehyde and sinapaldehyde, whereas p-coumaric acid feeding increased the content of downstream coniferylaldehyde and sinapaldehyde with no effect on BA, SA, trans-cinnamic acid or artemisinin. SA is reported earlier to be inducing the artemisinin yield. This report demonstrates the link between the phenylpropanoid/lignin pathway with artemisinin pathway through SA, triggered by accumulation of trans-cinnamic acid because of the blockage at C4H. PMID:27220407

  16. RNAimmuno: A database of the nonspecific immunological effects of RNA interference and microRNA reagents

    PubMed Central

    Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J.

    2012-01-01

    The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies. PMID:22411954

  17. RNAimmuno: a database of the nonspecific immunological effects of RNA interference and microRNA reagents.

    PubMed

    Olejniczak, Marta; Galka-Marciniak, Paulina; Polak, Katarzyna; Fligier, Andrzej; Krzyzosiak, Wlodzimierz J

    2012-05-01

    The RNAimmuno database was created to provide easy access to information regarding the nonspecific effects generated in cells by RNA interference triggers and microRNA regulators. Various RNAi and microRNA reagents, which differ in length and structure, often cause non-sequence-specific immune responses, in addition to triggering the intended sequence-specific effects. The activation of the cellular sensors of foreign RNA or DNA may lead to the induction of type I interferon and proinflammatory cytokine release. Subsequent changes in the cellular transcriptome and proteome may result in adverse effects, including cell death during therapeutic treatments or the misinterpretation of experimental results in research applications. The manually curated RNAimmuno database gathers the majority of the published data regarding the immunological side effects that are caused in investigated cell lines, tissues, and model organisms by different reagents. The database is accessible at http://rnaimmuno.ibch.poznan.pl and may be helpful in the further application and development of RNAi- and microRNA-based technologies.

  18. Unbiased RNAi screen for hepcidin regulators links hepcidin suppression to proliferative Ras/RAF and nutrient-dependent mTOR signaling

    PubMed Central

    Mleczko-Sanecka, Katarzyna; Roche, Franziska; Rita da Silva, Ana; Call, Debora; D’Alessio, Flavia; Ragab, Anan; Lapinski, Philip E.; Ummanni, Ramesh; Korf, Ulrike; Oakes, Christopher; Damm, Georg; D’Alessandro, Lorenza A.; Klingmüller, Ursula; King, Philip D.; Boutros, Michael; Hentze, Matthias W.

    2014-01-01

    The hepatic hormone hepcidin is a key regulator of systemic iron metabolism. Its expression is largely regulated by 2 signaling pathways: the “iron-regulated” bone morphogenetic protein (BMP) and the inflammatory JAK-STAT pathways. To obtain broader insights into cellular processes that modulate hepcidin transcription and to provide a resource to identify novel genetic modifiers of systemic iron homeostasis, we designed an RNA interference (RNAi) screen that monitors hepcidin promoter activity after the knockdown of 19 599 genes in hepatocarcinoma cells. Interestingly, many of the putative hepcidin activators play roles in signal transduction, inflammation, or transcription, and affect hepcidin transcription through BMP-responsive elements. Furthermore, our work sheds light on new components of the transcriptional machinery that maintain steady-state levels of hepcidin expression and its responses to the BMP- and interleukin-6–triggered signals. Notably, we discover hepcidin suppression mediated via components of Ras/RAF MAPK and mTOR signaling, linking hepcidin transcriptional control to the pathways that respond to mitogen stimulation and nutrient status. Thus using a combination of RNAi screening, reverse phase protein arrays, and small molecules testing, we identify links between the control of systemic iron homeostasis and critical liver processes such as regeneration, response to injury, carcinogenesis, and nutrient metabolism. PMID:24385536

  19. Optical imaging of RNAi-mediated silencing of cancer

    NASA Astrophysics Data System (ADS)

    Ochiya, Takahiro; Honma, Kimi; Takeshita, Fumitaka; Nagahara, Shunji

    2008-02-01

    RNAi has rapidly become a powerful tool for drug target discovery and validation in an in vitro culture system and, consequently, interest is rapidly growing for extension of its application to in vivo systems, such as animal disease models and human therapeutics. Cancer is one obvious application for RNAi therapeutics, because abnormal gene expression is thought to contribute to the pathogenesis and maintenance of the malignant phenotype of cancer and thereby many oncogenes and cell-signaling molecules present enticing drug target possibilities. RNAi, potent and specific, could silence tumor-related genes and would appear to be a rational approach to inhibit tumor growth. In subsequent in vivo studies, the appropriate cancer model must be developed for an evaluation of siRNA effects on tumors. How to evaluate the effect of siRNA in an in vivo therapeutic model is also important. Accelerating the analyses of these models and improving their predictive value through whole animal imaging methods, which provide cancer inhibition in real time and are sensitive to subtle changes, are crucial for rapid advancement of these approaches. Bioluminescent imaging is one of these optically based imaging methods that enable rapid in vivo analyses of a variety of cellular and molecular events with extreme sensitivity.

  20. Stc1: A Critical Link between RNAi and Chromatin Modification Required for Heterochromatin Integrity

    PubMed Central

    Bayne, Elizabeth H.; White, Sharon A.; Kagansky, Alexander; Bijos, Dominika A.; Sanchez-Pulido, Luis; Hoe, Kwang-Lae; Kim, Dong-Uk; Park, Han-Oh; Ponting, Chris P.; Rappsilber, Juri; Allshire, Robin C.

    2010-01-01

    Summary In fission yeast, RNAi directs heterochromatin formation at centromeres, telomeres, and the mating type locus. Noncoding RNAs transcribed from repeat elements generate siRNAs that are incorporated into the Argonaute-containing RITS complex and direct it to nascent homologous transcripts. This leads to recruitment of the CLRC complex, including the histone methyltransferase Clr4, promoting H3K9 methylation and heterochromatin formation. A key question is what mediates the recruitment of Clr4/CLRC to transcript-bound RITS. We have identified a LIM domain protein, Stc1, that is required for centromeric heterochromatin integrity. Our analyses show that Stc1 is specifically required to establish H3K9 methylation via RNAi, and interacts both with the RNAi effector Ago1, and with the chromatin-modifying CLRC complex. Moreover, tethering Stc1 to a euchromatic locus is sufficient to induce silencing and heterochromatin formation independently of RNAi. We conclude that Stc1 associates with RITS on centromeric transcripts and recruits CLRC, thereby coupling RNAi to chromatin modification. PMID:20211136

  1. Optimized Extraction Method To Remove Humic Acid Interferences from Soil Samples Prior to Microbial Proteome Measurements.

    PubMed

    Qian, Chen; Hettich, Robert L

    2017-07-07

    The microbial composition and their activities in soil environments play a critical role in organic matter transformation and nutrient cycling. Liquid chromatography coupled to high-performance mass spectrometry provides a powerful approach to characterize soil microbiomes; however, the limited microbial biomass and the presence of abundant interferences in soil samples present major challenges to proteome extraction and subsequent MS measurement. To this end, we have designed an experimental method to improve microbial proteome measurement by removing the soil-borne humic substances coextraction from soils. Our approach employs an in situ detergent-based microbial lysis/TCA precipitation coupled to an additional cleanup step involving acidified precipitation and filtering at the peptide level to remove most of the humic acid interferences prior to proteolytic peptide measurement. The novelty of this approach is an integration to exploit two different characteristics of humic acids: (1) Humic acids are insoluble in acidic solution but should not be removed at the protein level, as undesirable protein removal may also occur. Rather it is better to leave the humics acids in the samples until the peptide level, at which point the significant differential solubility of humic acids versus peptides at low pH can be exploited very efficiently. (2) Most of the humic acids have larger molecule weights than the peptides. Therefore, filtering a pH 2 to 3 peptide solution with a 10 kDa filter will remove most of the humic acids. This method is easily interfaced with normal proteolytic processing approaches and provides a reliable and straightforward protein extraction method that efficiently removes soil-borne humic substances without inducing proteome sample loss or biasing protein identification in mass spectrometry. In general, this humic acid removal step is universal and can be adopted by any workflow to effectively remove humic acids to avoid them negatively competing

  2. Limited Agreement of Independent RNAi Screens for Virus-Required Host Genes Owes More to False-Negative than False-Positive Factors

    PubMed Central

    Wang, Zhishi; Craven, Mark; Newton, Michael A.; Ahlquist, Paul

    2013-01-01

    Systematic, genome-wide RNA interference (RNAi) analysis is a powerful approach to identify gene functions that support or modulate selected biological processes. An emerging challenge shared with some other genome-wide approaches is that independent RNAi studies often show limited agreement in their lists of implicated genes. To better understand this, we analyzed four genome-wide RNAi studies that identified host genes involved in influenza virus replication. These studies collectively identified and validated the roles of 614 cell genes, but pair-wise overlap among the four gene lists was only 3% to 15% (average 6.7%). However, a number of functional categories were overrepresented in multiple studies. The pair-wise overlap of these enriched-category lists was high, ∼19%, implying more agreement among studies than apparent at the gene level. Probing this further, we found that the gene lists implicated by independent studies were highly connected in interacting networks by independent functional measures such as protein-protein interactions, at rates significantly higher than predicted by chance. We also developed a general, model-based approach to gauge the effects of false-positive and false-negative factors and to estimate, from a limited number of studies, the total number of genes involved in a process. For influenza virus replication, this novel statistical approach estimates the total number of cell genes involved to be ∼2,800. This and multiple other aspects of our experimental and computational results imply that, when following good quality control practices, the low overlap between studies is primarily due to false negatives rather than false-positive gene identifications. These results and methods have implications for and applications to multiple forms of genome-wide analysis. PMID:24068911

  3. Immune modulation through RNA interference-mediated silencing of CD40 in dendritic cells.

    PubMed

    Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Soheili, Zahra Soheila; Samiee, Shahram; Ataee, Zahra; Tabei, Seyyed Ziyaoddin; Moazzeni, Seyed Mohammad

    2009-01-01

    RNA interference (RNAi) is an exciting mechanism for knocking down any target gene in transcriptional level. It is now clear that small interfering RNA (siRNA), a 19-21nt long dsRNA, can trigger a degradation process (RNAi) that specifically silences the expression of a cognate mRNA. Our findings in this study showed that down regulation of CD40 gene expression in dendritic cells (DCs) by RNAi culminated to immune modulation. Effective delivery of siRNA into DCs would be a reasonable method for the blocking of CD40 gene expression at the cell surface without any effect on other genes and cell cytotoxicity. The effects of siRNA against CD40 mRNA on the function and phenotype of DCs were investigated. The DCs were separated from the mice spleen and then cultured in vitro. By the means of Lipofectamine2000, siRNA was delivered to the cells and the efficacy of transfection was estimated by flow cytometry. By Annexine V and Propidium Iodide staining, we could evaluate the transfected cells viability. Also, the mRNA expression and protein synthesis were assessed by real-time PCR and flow cytometry, respectively. Knocking down the CD40 gene in the DCs caused an increase in IL-4 production, decrease in IL-12 production and allostimulation activity. All together, these effects would stimulate Th2 cytokines production from allogenic T-cells in vitro.

  4. Defining the molecular profile of planarian pluripotent stem cells using a combinatorial RNA-seq, RNA interference and irradiation approach

    PubMed Central

    2012-01-01

    Background Planarian stem cells, or neoblasts, drive the almost unlimited regeneration capacities of freshwater planarians. Neoblasts are traditionally described by their morphological features and by the fact that they are the only proliferative cell type in asexual planarians. Therefore, they can be specifically eliminated by irradiation. Irradiation, however, is likely to induce transcriptome-wide changes in gene expression that are not associated with neoblast ablation. This has affected the accurate description of their specific transcriptomic profile. Results We introduce the use of Smed-histone-2B RNA interference (RNAi) for genetic ablation of neoblast cells in Schmidtea mediterranea as an alternative to irradiation. We characterize the rapid, neoblast-specific phenotype induced by Smed-histone-2B RNAi, resulting in neoblast ablation. We compare and triangulate RNA-seq data after using both irradiation and Smed-histone-2B RNAi over a time course as means of neoblast ablation. Our analyses show that Smed-histone-2B RNAi eliminates neoblast gene expression with high specificity and discrimination from gene expression in other cellular compartments. We compile a high confidence list of genes downregulated by both irradiation and Smed-histone-2B RNAi and validate their expression in neoblast cells. Lastly, we analyze the overall expression profile of neoblast cells. Conclusions Our list of neoblast genes parallels their morphological features and is highly enriched for nuclear components, chromatin remodeling factors, RNA splicing factors, RNA granule components and the machinery of cell division. Our data reveal that the regulation of planarian stem cells relies on posttranscriptional regulatory mechanisms and suggest that planarians are an ideal model for this understudied aspect of stem cell biology. PMID:22439894

  5. The IBO germination quantitative trait locus encodes a phosphatase 2C-related variant with a nonsynonymous amino acid change that interferes with abscisic acid signaling.

    PubMed

    Amiguet-Vercher, Amélia; Santuari, Luca; Gonzalez-Guzman, Miguel; Depuydt, Stephen; Rodriguez, Pedro L; Hardtke, Christian S

    2015-02-01

    Natural genetic variation is crucial for adaptability of plants to different environments. Seed dormancy prevents precocious germination in unsuitable conditions and is an adaptation to a major macro-environmental parameter, the seasonal variation in temperature and day length. Here we report the isolation of IBO, a quantitative trait locus (QTL) that governs c. 30% of germination rate variance in an Arabidopsis recombinant inbred line (RIL) population derived from the parental accessions Eilenburg-0 (Eil-0) and Loch Ness-0 (Lc-0). IBO encodes an uncharacterized phosphatase 2C-related protein, but neither the Eil-0 nor the Lc-0 variant, which differ in a single amino acid, have any appreciable phosphatase activity in in vitro assays. However, we found that the amino acid change in the Lc-0 variant of the IBO protein confers reduced germination rate. Moreover, unlike the Eil-0 variant of the protein, the Lc-0 variant can interfere with the activity of the phosphatase 2C ABSCISIC ACID INSENSITIVE 1 in vitro. This suggests that the Lc-0 variant possibly interferes with abscisic acid signaling, a notion that is supported by physiological assays. Thus, we isolated an example of a QTL allele with a nonsynonymous amino acid change that might mediate local adaptation of seed germination timing. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  6. The Sheffield RNAi Screening Facility (SRSF): portfolio growth and technology development.

    PubMed

    Brown, Stephen

    2014-05-01

    The Sheffield RNAi Screening Facility (SRSF) (www.rnai.group.shef.ac.uk) was established in 2008 with Wellcome Trust and University of Sheffield funding, with the task to provide the first UK RNAi screening resource for academic groups interested in identifying genes required in a diverse range of biological processes using Drosophila cell culture. The SRSF has carried out a wide range of screens varying in sizes from bespoke small-scale libraries, targeting a few hundred genes, to high-throughput, genome-wide studies. The SRSF has grown and improved with a dedicated partnership of its academic customers based mainly in the UK. We are part of the UK Academics Functional Genomics Network, participating in organizing an annual meeting in London and are part of the University of Sheffield's D3N (www.d3n.org.uk), connecting academics, biotech and pharmaceutical companies with a multidisciplinary network in Drug Discovery and Development. Recently, the SRSF has been funded by the Yorkshire Cancer Research Fund to perform genome-wide RNAi screens using human cells as part of a core facility for regional Yorkshire Universities and screens are now underway. Overall the SRSF has carried out more than 40 screens from Drosophila and human cell culture experiments.

  7. RNA interference-based resistance in transgenic tomato plants against Tomato yellow leaf curl virus-Oman (TYLCV-OM) and its associated betasatellite.

    PubMed

    Ammara, Um e; Mansoor, Shahid; Saeed, Muhammad; Amin, Imran; Briddon, Rob W; Al-Sadi, Abdullah Mohammed

    2015-03-04

    Tomato yellow leaf curl virus (TYLCV), a monopartite begomovirus (family Geminiviridae) is responsible for heavy yield losses for tomato production around the globe. In Oman at least five distinct begomoviruses cause disease in tomato, including TYLCV. Unusually, TYLCV infections in Oman are sometimes associated with a betasatellite (Tomato leaf curl betasatellite [ToLCB]; a symptom modulating satellite). RNA interference (RNAi) can be used to develop resistance against begomoviruses at either the transcriptional or post-transcriptional levels. A hairpin RNAi (hpRNAi) construct to express double-stranded RNA homologous to sequences of the intergenic region, coat protein gene, V2 gene and replication-associated gene of Tomato yellow leaf curl virus-Oman (TYLCV-OM) was produced. Initially, transient expression of the hpRNAi construct at the site of virus inoculation was shown to reduce the number of plants developing symptoms when inoculated with either TYLCV-OM or TYLCV-OM with ToLCB-OM to Nicotiana benthamiana or tomato. Solanum lycopersicum L. cv. Pusa Ruby was transformed with the hpRNAi construct and nine confirmed transgenic lines were obtained and challenged with TYLCV-OM and ToLCB-OM by Agrobacterium-mediated inoculation. For all but one line, for which all plants remained symptomless, inoculation with TYLCV-OM led to a proportion (≤25%) of tomato plants developing symptoms of infection. For inoculation with TYLCV-OM and ToLCB-OM all lines showed a proportion of plants (≤45%) symptomatic. However, for all infected transgenic plants the symptoms were milder and virus titre in plants was lower than in infected non-transgenic tomato plants. These results show that RNAi can be used to develop resistance against geminiviruses in tomato. The resistance in this case is not immunity but does reduce the severity of infections and virus titer. Also, the betasatellite may compromise resistance, increasing the proportion of plants which ultimately show symptoms.

  8. RNAi of selected candidate genes interrupts growth and development of Helicoverpa armigera.

    PubMed

    Chikate, Yojana R; Dawkar, Vishal V; Barbole, Ranjit S; Tilak, Priyadarshini V; Gupta, Vidya S; Giri, Ashok P

    2016-10-01

    Helicoverpa armigera is one of the major crop pests and is less amenable to current pest control approaches. RNA interference (RNAi) is emerging as a potent arsenal for the insect pest control over current methods. Here, we examined the effect on growth and development in H. armigera by targeting various enzymes/proteins such as proteases like trypsins (HaTry2, 3, 4 and 6), chymotrypsin (HaChy4) and cysteine protease like cathepsin (HaCATHL); glutathione S-transferases (HaGST1a, 6 and 8); esterases (HaAce4, HaJHE); catalase (HaCAT); super-oxide-dismutase (HaCu/ZnSOD); fatty acid binding protein (HaFabp) and chitin deacetylase (HaCda5b) through dsRNA approach. Significant downregulation of cognate mRNA expression and reduced activity of trypsin and GST-like enzyme were evident upon feeding candidate dsRNAs to the larvae. Among these, the highest mortality was observed in HaAce4 dsRNA fed larvae followed by HaJHE; HaCAT; HaCuZnSOD; HaFabp and HaTry3 whereas remaining ones showed relatively lower mortality. Furthermore, the dsRNA fed larvae showed significant reduction in the larval mass and abnormalities at the different stages of H. armigera development compared to their control diets. For example, malformed larvae, pupae and moth at a dose of 60μg/day were evident in high number of individual insects fed on dsRNA containing diets. Moreover, the growth and development of insects and moths were retarded in dsRNA fed larvae. These findings might provide potential new candidates for designing effective dsRNA as pesticide in crop protection. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Development of RNAi methods for Peregrinus maidis, the corn planthopper.

    PubMed

    Yao, Jianxiu; Rotenberg, Dorith; Afsharifar, Alireza; Barandoc-Alviar, Karen; Whitfield, Anna E

    2013-01-01

    The corn planthopper, Peregrinus maidis, is a major pest of agronomically-important crops. Peregrinus maidis has a large geographical distribution and transmits Maize mosaic rhabdovirus (MMV) and Maize stripe tenuivirus (MSpV). The objective of this study was to develop effective RNAi methods for P. maidis. Vacuolar-ATPase (V-ATPase) is an essential enzyme for hydrolysis of ATP and for transport of protons out of cells thereby maintaining membrane ion balance, and it has been demonstrated to be an efficacious target for RNAi in other insects. In this study, two genes encoding subunits of P. maidis V-ATPase (V-ATPase B and V-ATPase D) were chosen as RNAi target genes. The open reading frames of V-ATPase B and D were generated and used for constructing dsRNA fragments. Experiments were conducted using oral delivery and microinjection of V-ATPase B and V-ATPase D dsRNA to investigate the effectiveness of RNAi in P. maidis. Real-time quantitative reverse transcriptase-PCR (qRT-PCR) analysis indicated that microinjection of V-ATPase dsRNA led to a minimum reduction of 27-fold in the normalized abundance of V-ATPase transcripts two days post injection, while ingestion of dsRNA resulted in a two-fold reduction after six days of feeding. While both methods of dsRNA delivery resulted in knockdown of target transcripts, the injection method was more rapid and effective. The reduction in V-ATPase transcript abundance resulted in observable phenotypes. Specifically, the development of nymphs injected with 200 ng of either V-ATPase B or D dsRNA was impaired, resulting in higher mortality and lower fecundity than control insects injected with GFP dsRNA. Microscopic examination of these insects revealed that female reproductive organs did not develop normally. The successful development of RNAi in P. maidis to target specific genes will enable the development of new insect control strategies and functional analysis of vital genes and genes associated with interactions between P

  10. Scavenger receptor mediates systemic RNA interference in ticks.

    PubMed

    Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Galay, Remil Linggatong; Tanaka, Tetsuya; Fujisaki, Kozo

    2011-01-01

    RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks.

  11. Scavenger Receptor Mediates Systemic RNA Interference in Ticks

    PubMed Central

    Aung, Kyaw Min; Boldbaatar, Damdinsuren; Umemiya-Shirafuji, Rika; Liao, Min; Xuenan, Xuan; Suzuki, Hiroshi; Linggatong Galay, Remil; Tanaka, Tetsuya; Fujisaki, Kozo

    2011-01-01

    RNA interference is an efficient method to silence gene and protein expressions. Here, the class B scavenger receptor CD36 (SRB) mediated the uptake of exogenous dsRNAs in the induction of the RNAi responses in ticks. Unfed female Haemaphysalis longicornis ticks were injected with a single or a combination of H. longicornis SRB (HlSRB) dsRNA, vitellogenin-1 (HlVg-1) dsRNA, and vitellogenin receptor (HlVgR) dsRNA. We found that specific and systemic silencing of the HlSRB, HlVg-1, and HlVgR genes was achieved in ticks injected with a single dsRNA of HlSRB, HlVg-1, and HlVgR. In ticks injected first with HlVg-1 or HlVgR dsRNA followed 96 hours later with HlSRB dsRNA (HlVg-1/HlSRB or HlVgR/HlSRB), gene silencing of HlSRB was achieved in addition to first knockdown in HlVg-1 or HlVgR, and prominent phenotypic changes were observed in engorgement, mortality, and hatchability, indicating that a systemic and specific double knockdown of target genes had been simultaneously attained in these ticks. However, in ticks injected with HlSRB dsRNA followed 96 hours later with HlVg-1 or HlVgR dsRNAs, silencing of HlSRB was achieved, but no subsequent knockdown in HlVgR or HlVg-1 was observed. The Westernblot and immunohistochemical examinations revealed that the endogenous HlSRB protein was fully abolished in midguts of ticks injected with HlSRB/HlVg-1 dsRNAs but HlVg-1 was normally expressed in midguts, suggesting that HlVg-1 dsRNA-mediated RNAi was fully inhibited by the first knockdown of HlSRB. Similarly, the abolished localization of HlSRB protein was recognized in ovaries of ticks injected with HlSRB/HlVgR, while normal localization of HlVgR was observed in ovaries, suggesting that the failure to knock-down HlVgR could be attributed to the first knockdown of HlSRB. In summary, we demonstrated for the first time that SRB may not only mediate the effective knock-down of gene expression by RNAi but also play essential roles for systemic RNAi of ticks. PMID:22145043

  12. Engineering CRISPR interference system in Klebsiella pneumoniae for attenuating lactic acid synthesis.

    PubMed

    Wang, Jingxuan; Zhao, Peng; Li, Ying; Xu, Lida; Tian, Pingfang

    2018-04-05

    Klebsiella pneumoniae is a promising industrial species for bioproduction of bulk chemicals such as 1,3-propanediol, 2,3-butanediol and 3-hydroxypropionic acid (3-HP). However, lactic acid is a troublesome by-product when optimizing for 3-HP production. Therefore, it is highly desirable to minimize lactic acid. Here, we show that lactic acid synthesis can be largely blocked by an engineered CRISPR interference (CRISPRi) system in K. pneumoniae. EGFP was recruited as a reporter of this CRISPRi system. Fluorescence assay of this CRISPRi system showed that enhanced green fluorescent protein (EGFP) expression level was repressed by 85-90%. To further test this CRISPRi system, guide RNAs were designed to individually or simultaneously target four lactate-producing enzyme genes. Results showed that all lactate-producing enzyme genes were significantly repressed. Notably, D-lactate dehydrogenase (ldhA) was shown to be the most influential enzyme for lactic acid formation in micro-aerobic conditions, as inhibiting ldhA alone led to lactic acid level similar to simultaneously repressing four genes. In shake flask cultivation, the strain coexpressing puuC (an aldehyde dehydrogenase catalyzing 3-hydroxypropionaldehyde to 3-HP) and dCas9-sgRNA inhibiting ldhA produced 1.37-fold 3-HP relative to the reference strain. Furthermore, in bioreactor cultivation, this CRISPRi strain inhibiting ldhA produced 36.7 g/L 3-HP, but only generated 1 g/L lactic acid. Clearly, this engineered CRISPRi system largely simplified downstream separation of 3-HP from its isomer lactic acid, an extreme challenge for 3-HP bioprocess. This study offers a deep understanding of lactic acid metabolism in diverse species, and we believe that this CRISPRi system will facilitate biomanufacturing and functional genome studies of K. pneumoniae or beyond.

  13. RNAi-based therapeutic nanostrategy: IL-8 gene silencing in pancreatic cancer cells using gold nanorods delivery vehicles

    NASA Astrophysics Data System (ADS)

    Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Yoon, Ho Sup; Swee Chuan, Tjin; Yong, Ken-Tye

    2015-09-01

    RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications.

  14. RNA Interference Directed against the Transglutaminase Gene Triggers Dysbiosis of Gut Microbiota in Drosophila*

    PubMed Central

    Sekihara, Sanae; Shibata, Toshio; Hyakkendani, Mai; Kawabata, Shun-ichiro

    2016-01-01

    We recently reported that transglutaminase (TG) suppresses immune deficiency pathway-controlled antimicrobial peptides (IMD-AMPs), thereby conferring immune tolerance to gut microbes, and that RNAi of the TG gene in flies decreases the lifespan compared with non-TG-RNAi flies. Here, analysis of the bacterial composition of the Drosophila gut by next-generation sequencing revealed that gut microbiota comprising one dominant genus of Acetobacter in non-TG-RNAi flies was shifted to that comprising two dominant genera of Acetobacter and Providencia in TG-RNAi flies. Four bacterial strains, including Acetobacter persici SK1 and Acetobacter indonesiensis SK2, Lactobacillus pentosus SK3, and Providencia rettgeri SK4, were isolated from the midgut of TG-RNAi flies. SK1 exhibited the highest resistance to the IMD-AMPs Cecropin A1 and Diptericin among the isolated bacteria. In contrast, SK4 exhibited considerably lower resistance against Cecropin A1, whereas SK4 exhibited high resistance to hypochlorous acid. The resistance of strains SK1–4 against IMD-AMPs in in vitro assays could not explain the shift of the microbiota in the gut of TG-RNAi flies. The lifespan was reduced in gnotobiotic flies that ingested both SK4 and SK1, concomitant with the production of reactive oxygen species and apoptosis in the midgut, whereas the survival rate was not altered in gnotobiotic flies that mono-ingested either SK4 or SK1. Interestingly, significant amounts of reactive oxygen species were detected in the midgut of gnotobiotic flies that ingested SK4 and SK2, concomitant with no significant apoptosis in the midgut. In gnotobiotic flies that co-ingested SK4 and SK1, an additional unknown factor(s) may be required to cause midgut apoptosis. PMID:27760824

  15. Reversal of multidrug resistance in MCF-7/Adr cells by codelivery of doxorubicin and BCL2 siRNA using a folic acid-conjugated polyethylenimine hydroxypropyl-β-cyclodextrin nanocarrier

    PubMed Central

    Li, Jin-Ming; Zhang, Wei; Su, Hua; Wang, Yuan-Yuan; Tan, Cai-Ping; Ji, Liang-Nian; Mao, Zong-Wan

    2015-01-01

    Systemic administration of chemotherapy for cancer often faces drug resistance, limiting its applications in cancer therapy. In this study, we developed a simple multifunctional nanocarrier based on polyethylenimine (PEI) to codeliver doxorubicin (DOX) and BCL2 small interfering RNA (siRNA) for overcoming multidrug resistance (MDR) and enhancing apoptosis in MCF-7/Adr cancer cells by combining chemotherapy and RNA interference (RNAi) therapy. The low-molecular-weight branch PEI was used to conjugate hydroxypropyl-β-cyclodextrin (HP-β-CD) and folic acid (FA), forming the codelivery nanocarrier (FA-HP-β-CD-PEI) to encapsulate DOX with the cavity HP-β-CD and bind siRNA with the positive charge of PEI for tumor-targeting codelivering drugs. The drug-loaded nanocomplexes (FA-HP-β-CD-PEI/DOX/siRNA) showed uniform size distribution, high cellular uptake, and significant gene suppression of BCL2, displaying the potential of overcoming MDR for enhancing the effect of anticancer drugs. Furthermore, the nanocomplexes achieved significant cell apoptosis through a mechanism of downregulating the antiapoptotic protein BCL2, resulted in improving therapeutic efficacy of the coadministered DOX by tumor targeting and RNA interference. Our study indicated that combined RNAi therapy and chemotherapy using our functional codelivery nanocarrier could overcome MDR and enhance apoptosis in MDR cancer cells for a potential application in treating MDR cancers. PMID:25960653

  16. RNA Interference of Gonadotropin-Inhibitory Hormone Gene Induces Arousal in Songbirds

    PubMed Central

    Ubuka, Takayoshi; Mukai, Motoko; Wolfe, Jordan; Beverly, Ryan; Clegg, Sarah; Wang, Ariel; Hsia, Serena; Li, Molly; Krause, Jesse S.; Mizuno, Takanobu; Fukuda, Yujiro; Tsutsui, Kazuyoshi; Bentley, George E.; Wingfield, John C.

    2012-01-01

    Gonadotropin-inhibitory hormone (GnIH) was originally identified in quail as a hypothalamic neuropeptide inhibitor of pituitary gonadotropin synthesis and release. However, GnIH neuronal fibers do not only terminate in the median eminence to control anterior pituitary function but also extend widely in the brain, suggesting it has multiple roles in the regulation of behavior. To identify the role of GnIH neurons in the regulation of behavior, we investigated the effect of RNA interference (RNAi) of the GnIH gene on the behavior of white-crowned sparrows, a highly social songbird species. Administration of small interfering RNA against GnIH precursor mRNA into the third ventricle of male and female birds reduced resting time, spontaneous production of complex vocalizations, and stimulated brief agonistic vocalizations. GnIH RNAi further enhanced song production of short duration in male birds when they were challenged by playbacks of novel male songs. These behaviors resembled those of breeding birds during territorial defense. The overall results suggest that GnIH gene silencing induces arousal. In addition, the activities of male and female birds were negatively correlated with GnIH mRNA expression in the paraventricular nucleus. Density of GnIH neuronal fibers in the ventral tegmental area was decreased by GnIH RNAi treatment in female birds, and the number of gonadotropin-releasing hormone neurons that received close appositions of GnIH neuronal fiber terminals was negatively correlated with the activity of male birds. In summary, GnIH may decrease arousal level resulting in the inhibition of specific motivated behavior such as in reproductive contexts. PMID:22279571

  17. The 5'-end heterogeneity of adenovirus virus-associated RNAI contributes to the asymmetric guide strand incorporation into the RNA-induced silencing complex.

    PubMed

    Xu, Ning; Gkountela, Sofia; Saeed, Khalid; Akusjärvi, Göran

    2009-11-01

    Human Adenovirus type 5 encodes two short RNA polymerase III transcripts, the virus-associated (VA) RNAI and VA RNAII, which can adopt stable hairpin structures that resemble micro-RNA precursors. The terminal stems of the VA RNAs are processed into small RNAs (mivaRNAs) that are incorporated into RISC. It has been reported that VA RNAI has two transcription initiation sites, which produce two VA RNAI species; a major species, VA RNAI(G), which accounts for 75% of the VA RNAI pool, and a minor species, VA RNAI(A), which initiates transcription three nucleotides upstream compared to VA RNAI(G). We show that this 5'-heterogeneity results in a dramatic difference in RISC assembly. Thus, both VA RNAI(G) and VA RNAI(A) are processed by Dicer at the same position in the terminal stem generating the same 3'-strand mivaRNA. This mivaRNA is incorporated into RISC with 200-fold higher efficiency compared to the 5'-strand of mivaRNAI. Of the small number of 5'-strands used in RISC assembly only VA RNAI(A) generated active RISC complexes. We also show that the 3'-strand of mivaRNAI, although being the preferred substrate for RISC assembly, generates unstable RISC complexes with a low in vitro cleavage activity, only around 2% compared to RISC assembled on the VA RNAI(A) 5'-strand.

  18. RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans.

    PubMed

    Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A

    2008-12-23

    In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans.

  19. RNA interference and retinoblastoma-related genes are required for repression of endogenous siRNA targets in Caenorhabditis elegans

    PubMed Central

    Grishok, Alla; Hoersch, Sebastian; Sharp, Phillip A.

    2008-01-01

    In Caenorhabditis elegans, a vast number of endogenous short RNAs corresponding to thousands of genes have been discovered recently. This finding suggests that these short interfering RNAs (siRNAs) may contribute to regulation of many developmental and other signaling pathways in addition to silencing viruses and transposons. Here, we present a microarray analysis of gene expression in RNA interference (RNAi)-related mutants rde-4, zfp-1, and alg-1 and the retinoblastoma (Rb) mutant lin-35. We found that a component of Dicer complex RDE-4 and a chromatin-related zinc finger protein ZFP-1, not implicated in endogenous RNAi, regulate overlapping sets of genes. Notably, genes a) up-regulated in the rde-4 and zfp-1 mutants and b) up-regulated in the lin-35(Rb) mutant, but not the down-regulated genes are highly represented in the set of genes with corresponding endogenous siRNAs (endo-siRNAs). Our study suggests that endogenous siRNAs cooperate with chromatin factors, either C. elegans ortholog of acute lymphoblastic leukemia-1 (ALL-1)-fused gene from chromosome 10 (AF10), ZFP-1, or tumor suppressor Rb, to regulate overlapping sets of genes and predicts a large role for RNAi-based chromatin silencing in control of gene expression in C. elegans. PMID:19073934

  20. Gene Network Polymorphism Illuminates Loss and Retention of Novel RNAi Silencing Components in the Cryptococcus Pathogenic Species Complex.

    PubMed

    Feretzaki, Marianna; Billmyre, R Blake; Clancey, Shelly Applen; Wang, Xuying; Heitman, Joseph

    2016-03-01

    RNAi is a ubiquitous pathway that serves central functions throughout eukaryotes, including maintenance of genome stability and repression of transposon expression and movement. However, a number of organisms have lost their RNAi pathways, including the model yeast Saccharomyces cerevisiae, the maize pathogen Ustilago maydis, the human pathogen Cryptococcus deuterogattii, and some human parasite pathogens, suggesting there may be adaptive benefits associated with both retention and loss of RNAi. By comparing the RNAi-deficient genome of the Pacific Northwest Outbreak C. deuterogattii strain R265 with the RNAi-proficient genomes of the Cryptococcus pathogenic species complex, we identified a set of conserved genes that were lost in R265 and all other C. deuterogattii isolates examined. Genetic and molecular analyses reveal several of these lost genes play roles in RNAi pathways. Four novel components were examined further. Znf3 (a zinc finger protein) and Qip1 (a homolog of N. crassa Qip) were found to be essential for RNAi, while Cpr2 (a constitutive pheromone receptor) and Fzc28 (a transcription factor) are involved in sex-induced but not mitosis-induced silencing. Our results demonstrate that the mitotic and sex-induced RNAi pathways rely on the same core components, but sex-induced silencing may be a more specific, highly induced variant that involves additional specialized or regulatory components. Our studies further illustrate how gene network polymorphisms involving known components of key cellular pathways can inform identification of novel elements and suggest that RNAi loss may have been a core event in the speciation of C. deuterogattii and possibly contributed to its pathogenic trajectory.

  1. Development of small RNA delivery systems for lung cancer therapy.

    PubMed

    Fujita, Yu; Kuwano, Kazuyoshi; Ochiya, Takahiro

    2015-03-06

    RNA interference (RNAi) has emerged as a powerful tool for studying target identification and holds promise for the development of therapeutic gene silencing. Recent advances in RNAi delivery and target selection provide remarkable opportunities for translational medical research. The induction of RNAi relies on small silencing RNAs, which affect specific messenger RNA (mRNA) degradation. Two types of small RNA molecules, small interfering RNAs (siRNAs) and microRNAs (miRNAs), have a central function in RNAi technology. The success of RNAi-based therapeutic delivery may be dependent upon uncovering a delivery route, sophisticated delivery carriers, and nucleic acid modifications. Lung cancer is still the leading cause of cancer death worldwide, for which novel therapeutic strategies are critically needed. Recently, we have reported a novel platform (PnkRNA™ and nkRNA®) to promote naked RNAi approaches through inhalation without delivery vehicles in lung cancer xenograft models. We suggest that a new class of RNAi therapeutic agent and local drug delivery system could also offer a promising RNAi-based strategy for clinical applications in cancer therapy. In this article, we show recent strategies for an RNAi delivery system and suggest the possible clinical usefulness of RNAi-based therapeutics for lung cancer treatment.

  2. The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging.

    PubMed

    Zhang, Nan; Membreno, Edward; Raj, Susan; Zhang, Hongjie; Khan, Liakot A; Gobel, Verena

    2017-10-03

    The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended intracellular endotubes that build and stabilize the lumen with a membrane and submembraneous cytoskeleton of apical character. The excretory cell expands its length approximately 2,000 times to generate these canals, making this model unique for the in vivo assessment of de novo polarized membrane biogenesis, intracellular lumen morphogenesis and unicellular tubulogenesis. The protocol presented here shows how to combine standard labeling, gain- and loss-of-function genetic or RNA interference (RNAi)-, and microscopic approaches to use this model to visually dissect and functionally analyze these processes on a molecular level. As an example of a labeling approach, the protocol outlines the generation of transgenic animals with fluorescent fusion proteins for live analysis of tubulogenesis. As an example of a genetic approach, it highlights key points of a visual RNAi-based interaction screen designed to modify a gain-of-function cystic canal phenotype. The specific methods described are how to: label and visualize the canals by expressing fluorescent proteins; construct a targeted RNAi library and strategize RNAi screening for the molecular analysis of canal morphogenesis; visually assess modifications of canal phenotypes; score them by dissecting fluorescence microscopy; characterize subcellular canal components at higher resolution by confocal microscopy; and quantify visual parameters. The approach is useful for the investigator who is interested in taking advantage of the C. elegans excretory canal for identifying and characterizing genes involved in the phylogenetically conserved processes of intracellular lumen and unicellular tube morphogenesis.

  3. Discrimination of dipicolinic acid and its interferents by femtosecond coherent Raman spectroscopy

    NASA Astrophysics Data System (ADS)

    Huang, Yu; Dogariu, Arthur; Avitzour, Yoav; Murawski, Robert K.; Pestov, Dmitry; Zhi, Miaochan; Sokolov, Alexei V.; Scully, Marlan O.

    2006-12-01

    Measurements of the beat frequencies between vibrational modes of dipicolinic acid (DPA) and a series of other molecules (interferents) are presented. The results were obtained from femtosecond time-resolved coherent Raman scattering, and the vibrational level spacings were determined from a Fourier transform of the signal versus probe pulse delay. The entire spectrum of the generated signal is recorded in order to demonstrate multimode excitation and to explain the variety of qualitatively different traces that can be obtained for the same molecule. Since the spectral signature of DPA is unique enough to be used for identification purposes, this technique has the potential to detect hazardous bacterial species, such as anthrax spores.

  4. Steric restrictions of RISC in RNA interference identified with size-expanded RNA nucleobases.

    PubMed

    Hernández, Armando R; Peterson, Larryn W; Kool, Eric T

    2012-08-17

    Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC), the key protein complex of RNA interference (RNAi), is of great importance to the development of siRNAs with improved biological and potentially therapeutic function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to -5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3'-end increased activity over that of wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation.

  5. RNAiFold: a web server for RNA inverse folding and molecular design.

    PubMed

    Garcia-Martin, Juan Antonio; Clote, Peter; Dotu, Ivan

    2013-07-01

    Synthetic biology and nanotechnology are poised to make revolutionary contributions to the 21st century. In this article, we describe a new web server to support in silico RNA molecular design. Given an input target RNA secondary structure, together with optional constraints, such as requiring GC-content to lie within a certain range, requiring the number of strong (GC), weak (AU) and wobble (GU) base pairs to lie in a certain range, the RNAiFold web server determines one or more RNA sequences, whose minimum free-energy secondary structure is the target structure. RNAiFold provides access to two servers: RNA-CPdesign, which applies constraint programming, and RNA-LNSdesign, which applies the large neighborhood search heuristic; hence, it is suitable for larger input structures. Both servers can also solve the RNA inverse hybridization problem, i.e. given a representation of the desired hybridization structure, RNAiFold returns two sequences, whose minimum free-energy hybridization is the input target structure. The web server is publicly accessible at http://bioinformatics.bc.edu/clotelab/RNAiFold, which provides access to two specialized servers: RNA-CPdesign and RNA-LNSdesign. Source code for the underlying algorithms, implemented in COMET and supported on linux, can be downloaded at the server website.

  6. Evaluation and control of miRNA-like off-target repression for RNA interference.

    PubMed

    Seok, Heeyoung; Lee, Haejeong; Jang, Eun-Sook; Chi, Sung Wook

    2018-03-01

    RNA interference (RNAi) has been widely adopted to repress specific gene expression and is easily achieved by designing small interfering RNAs (siRNAs) with perfect sequence complementarity to the intended target mRNAs. Although siRNAs direct Argonaute (Ago), a core component of the RNA-induced silencing complex (RISC), to recognize and silence target mRNAs, they also inevitably function as microRNAs (miRNAs) and suppress hundreds of off-targets. Such miRNA-like off-target repression is potentially detrimental, resulting in unwanted toxicity and phenotypes. Despite early recognition of the severity of miRNA-like off-target repression, this effect has often been overlooked because of difficulties in recognizing and avoiding off-targets. However, recent advances in genome-wide methods and knowledge of Ago-miRNA target interactions have set the stage for properly evaluating and controlling miRNA-like off-target repression. Here, we describe the intrinsic problems of miRNA-like off-target effects caused by canonical and noncanonical interactions. We particularly focus on various genome-wide approaches and chemical modifications for the evaluation and prevention of off-target repression to facilitate the use of RNAi with secured specificity.

  7. Fluorescence Reporter-Based Genome-Wide RNA Interference Screening to Identify Alternative Splicing Regulators.

    PubMed

    Misra, Ashish; Green, Michael R

    2017-01-01

    Alternative splicing is a regulated process that leads to inclusion or exclusion of particular exons in a pre-mRNA transcript, resulting in multiple protein isoforms being encoded by a single gene. With more than 90 % of human genes known to undergo alternative splicing, it represents a major source for biological diversity inside cells. Although in vitro splicing assays have revealed insights into the mechanisms regulating individual alternative splicing events, our global understanding of alternative splicing regulation is still evolving. In recent years, genome-wide RNA interference (RNAi) screening has transformed biological research by enabling genome-scale loss-of-function screens in cultured cells and model organisms. In addition to resulting in the identification of new cellular pathways and potential drug targets, these screens have also uncovered many previously unknown mechanisms regulating alternative splicing. Here, we describe a method for the identification of alternative splicing regulators using genome-wide RNAi screening, as well as assays for further validation of the identified candidates. With modifications, this method can also be adapted to study the splicing regulation of pre-mRNAs that contain two or more splice isoforms.

  8. The CSR-1 endogenous RNAi pathway ensures accurate transcriptional reprogramming during the oocyte-to-embryo transition in Caenorhabditis elegans.

    PubMed

    Fassnacht, Christina; Tocchini, Cristina; Kumari, Pooja; Gaidatzis, Dimos; Stadler, Michael B; Ciosk, Rafal

    2018-03-01

    Endogenous RNAi (endoRNAi) is a conserved mechanism for fine-tuning gene expression. In the nematode Caenorhabditis elegans, several endoRNAi pathways are required for the successful development of reproductive cells. The CSR-1 endoRNAi pathway promotes germ cell development, primarily by facilitating the expression of germline genes. In this study, we report a novel function for the CSR-1 pathway in preventing premature activation of embryonic transcription in the developing oocytes, which is accompanied by a general Pol II activation. This CSR-1 function requires its RNase activity, suggesting that, by controlling the levels of maternal mRNAs, CSR-1-dependent endoRNAi contributes to an orderly reprogramming of transcription during the oocyte-to-embryo transition.

  9. DNA-RNA hybrid formation mediates RNAi-directed heterochromatin formation.

    PubMed

    Nakama, Mina; Kawakami, Kei; Kajitani, Takuya; Urano, Takeshi; Murakami, Yota

    2012-03-01

    Certain noncoding RNAs (ncRNAs) implicated in the regulation of chromatin structure associate with chromatin. During the formation of RNAi-directed heterochromatin in fission yeast, ncRNAs transcribed from heterochromatin are thought to recruit the RNAi machinery to chromatin for the formation of heterochromatin; however, the molecular details of this association are not clear. Here, using RNA immunoprecipitation assay, we showed that the heterochromatic ncRNA was associated with chromatin via the formation of a DNA-RNA hybrid and bound to the RNA-induced transcriptional silencing (RITS) complex. The presence of DNA-RNA hybrid in the cell was also confirmed by immunofluorescence analysis using anti-DNA-RNA hybrid antibody. Over-expression and depletion of RNase H in vivo decreased and increased the amount of DNA-RNA hybrid formed, respectively, and both disturbed heterochromatin. Moreover, DNA-RNA hybrid was formed on, and over-expression of RNase H inhibited the formation of, artificial heterochromatin induced by tethering of RITS to mRNA. These results indicate that heterochromatic ncRNAs are retained on chromatin via the formation of DNA-RNA hybrids and provide a platform for the RNAi-directed heterochromatin assembly and suggest that DNA-RNA hybrid formation plays a role in chromatic ncRNA function. © 2012 The Authors. Journal compilation © 2012 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  10. RNAi Functions in Adaptive Reprogramming of the Genome | Center for Cancer Research

    Cancer.gov

    The regulation of transcribing DNA into RNA, including the production, processing, and degradation of RNA transcripts, affects the expression and the regulation of the genome in ways that are just beginning to be unraveled. A surprising discovery in recent years is that the vast majority of the genome is transcribed to yield an abundance of RNA transcripts. Many transcripts are regulated by the exosome, a multi-protein complex that degrades RNAs, and may also be targeted, under certain conditions, by the RNA interference (RNAi) pathway. These RNA degrading activities can recruit factors to silence certain regions of the genome by condensing the DNA into tightly-packed heterochromatin. For some chromosomal regions, such as centromeres and telomeres, which lie at the center and ends of chromosomes, respectively, silencing must be stably enforced through each cell generation. For other regions, silencing mechanisms must be easily reversible to activate gene expression in response to changing environmental or developmental conditions. Thus, the regulation of gene silencing is key to maintaining the integrity of the genome and proper cellular expression patterns, which, when disrupted can underlie many diseases, including cancer.

  11. Chemical Ligation Reactions of Oligonucleotides for Biological and Medicinal Applications.

    PubMed

    Abe, Hiroshi; Kimura, Yasuaki

    2018-01-01

    Chemical ligation of oligonucleotides (ONs) is the key reaction for various ON-based technologies. We have tried to solve the problems of RNA interference (RNAi) technology by applying ON chemical ligation to RNAi. We designed a new RNAi system, called intracellular buildup RNAi (IBR-RNAi), where the RNA fragments are built up into active small-interference RNA (siRNA) in cells through a chemical ligation reaction. Using the phosphorothioate and iodoacetyl groups as reactive functional groups for the ligation, we achieved RNAi effects without inducing immune responses. Additionally, we developed a new chemical ligation for IBR-RNAi, which affords a more native-like structure in the ligated product. The new ligation method should be useful not only for IBR-RNAi but also for the chemical synthesis of biofunctional ONs.

  12. The CSR-1 endogenous RNAi pathway ensures accurate transcriptional reprogramming during the oocyte-to-embryo transition in Caenorhabditis elegans

    PubMed Central

    Tocchini, Cristina; Kumari, Pooja; Gaidatzis, Dimos

    2018-01-01

    Endogenous RNAi (endoRNAi) is a conserved mechanism for fine-tuning gene expression. In the nematode Caenorhabditis elegans, several endoRNAi pathways are required for the successful development of reproductive cells. The CSR-1 endoRNAi pathway promotes germ cell development, primarily by facilitating the expression of germline genes. In this study, we report a novel function for the CSR-1 pathway in preventing premature activation of embryonic transcription in the developing oocytes, which is accompanied by a general Pol II activation. This CSR-1 function requires its RNase activity, suggesting that, by controlling the levels of maternal mRNAs, CSR-1-dependent endoRNAi contributes to an orderly reprogramming of transcription during the oocyte-to-embryo transition. PMID:29579041

  13. Preventing bee mortality with RNA interference

    USDA-ARS?s Scientific Manuscript database

    We present a real world example of the successful use of an RNAi product for disease control. RNAi increased bee health in the presence of the bee viral pathogen, IAPV. The importance of honey bees to the world economy far surpasses their contribution in terms of honey production; they are responsib...

  14. An interactive web-based application for Comprehensive Analysis of RNAi-screen Data.

    PubMed

    Dutta, Bhaskar; Azhir, Alaleh; Merino, Louis-Henri; Guo, Yongjian; Revanur, Swetha; Madhamshettiwar, Piyush B; Germain, Ronald N; Smith, Jennifer A; Simpson, Kaylene J; Martin, Scott E; Buehler, Eugen; Beuhler, Eugen; Fraser, Iain D C

    2016-02-23

    RNAi screens are widely used in functional genomics. Although the screen data can be susceptible to a number of experimental biases, many of these can be corrected by computational analysis. For this purpose, here we have developed a web-based platform for integrated analysis and visualization of RNAi screen data named CARD (for Comprehensive Analysis of RNAi Data; available at https://card.niaid.nih.gov). CARD allows the user to seamlessly carry out sequential steps in a rigorous data analysis workflow, including normalization, off-target analysis, integration of gene expression data, optimal thresholds for hit selection and network/pathway analysis. To evaluate the utility of CARD, we describe analysis of three genome-scale siRNA screens and demonstrate: (i) a significant increase both in selection of subsequently validated hits and in rejection of false positives, (ii) an increased overlap of hits from independent screens of the same biology and (iii) insight to microRNA (miRNA) activity based on siRNA seed enrichment.

  15. An interactive web-based application for Comprehensive Analysis of RNAi-screen Data

    PubMed Central

    Dutta, Bhaskar; Azhir, Alaleh; Merino, Louis-Henri; Guo, Yongjian; Revanur, Swetha; Madhamshettiwar, Piyush B.; Germain, Ronald N.; Smith, Jennifer A.; Simpson, Kaylene J.; Martin, Scott E.; Beuhler, Eugen; Fraser, Iain D. C.

    2016-01-01

    RNAi screens are widely used in functional genomics. Although the screen data can be susceptible to a number of experimental biases, many of these can be corrected by computational analysis. For this purpose, here we have developed a web-based platform for integrated analysis and visualization of RNAi screen data named CARD (for Comprehensive Analysis of RNAi Data; available at https://card.niaid.nih.gov). CARD allows the user to seamlessly carry out sequential steps in a rigorous data analysis workflow, including normalization, off-target analysis, integration of gene expression data, optimal thresholds for hit selection and network/pathway analysis. To evaluate the utility of CARD, we describe analysis of three genome-scale siRNA screens and demonstrate: (i) a significant increase both in selection of subsequently validated hits and in rejection of false positives, (ii) an increased overlap of hits from independent screens of the same biology and (iii) insight to microRNA (miRNA) activity based on siRNA seed enrichment. PMID:26902267

  16. Retinoic acid, hemin and hexamethylen bisacetamide interference with "in vitro" differentiation of chick embryo chondrocytes.

    PubMed

    Manduca, P; Abelmoschi, M L

    1992-01-01

    We have investigated the effect of all-trans Retinoic acid, and of substances (Hemine and Hexamethylene bisacetamide) which interfere with "in vitro" differentiation of mesenchyme derived cell lineages on the expression of specific markers of hyperthrophy in "in vitro" differentiating chick embryo chondrocytes. (Castagnola P., et al., 1986). Continuous treatment of chondrogenic cells in conditions allowing differentiation "in vitro" with Retinoic acid resulted in persistence of type I collagen synthesis and in lack of type X collagen and Ch 21 protein expression. Hemin treated cells secreted a reduced amount of type X collagen. HMBA treatment inhibited type X collagen expression and caused reduction of the ratio between type II collagen and Ch 21 synthesized. The data indicate an independent regulation of these markers during chondrocyte differentiation.

  17. Steric Restrictions of RISC in RNA Interference Identified with Size-Expanded RNA Nucleobases

    PubMed Central

    Hernández, Armando R.; Peterson, Larryn W.; Kool, Eric T.

    2012-01-01

    Understanding the interactions between small interfering RNAs (siRNAs) and the RNA-induced silencing complex (RISC) – the key protein complex of RNA interference (RNAi) – is of great importance to the development of siRNAs with improved biological, and potentially therapeutic, function. Although various chemically modified siRNAs have been reported, relatively few studies with modified nucleobases exist. Here we describe the synthesis and hybridization properties of siRNAs bearing size-expanded RNA (xRNA) nucleobases, and their use as a novel and systematic set of steric probes in RNAi. xRNA nucleobases are expanded by 2.4 Å using benzo-homologation and retain canonical Watson-Crick base-pairing groups. Our data show that the modified siRNA duplexes display small changes in melting temperature (+1.4 to −5.0 °C); substitutions near the center are somewhat destabilizing to the RNA duplex, while substitutions near the ends are stabilizing. RNAi studies in a dual-reporter luciferase assay in HeLa cells revealed that xRNA nucleobases in the antisense strand reduce activity at some central positions near the seed region, but are generally well tolerated near the ends. Most importantly, we observed that xRNA substitutions near the 3′-end increased activity over wild-type siRNAs. The data are analyzed in terms of site-dependent steric effects in RISC. Circular dichroism experiments show that single xRNA substitutions do not significantly distort the native A-form helical structure of the siRNA duplex, and serum stability studies demonstrated that xRNA substitutions protect siRNAs against nuclease degradation. PMID:22646660

  18. Selection of Reference Genes for RT-qPCR Analysis in Coccinella septempunctata to Assess Un-intended Effects of RNAi Transgenic Plants.

    PubMed

    Yang, Chunxiao; Preisser, Evan L; Zhang, Hongjun; Liu, Yong; Dai, Liangying; Pan, Huipeng; Zhou, Xuguo

    2016-01-01

    The development of genetically engineered plants that employ RNA interference (RNAi) to suppress invertebrate pests opens up new avenues for insect control. While this biotechnology shows tremendous promise, the potential for both non-target and off-target impacts, which likely manifest via altered mRNA expression in the exposed organisms, remains a major concern. One powerful tool for the analysis of these un-intended effects is reverse transcriptase-quantitative polymerase chain reaction, a technique for quantifying gene expression using a suite of reference genes for normalization. The seven-spotted ladybeetle Coccinella septempunctata , a commonly used predator in both classical and augmentative biological controls, is a model surrogate species used in the environmental risk assessment (ERA) of plant incorporated protectants (PIPs). Here, we assessed the suitability of eight reference gene candidates for the normalization and analysis of C. septempunctata v-ATPase A gene expression under both biotic and abiotic conditions. Five computational tools with distinct algorisms, geNorm, Normfinder, BestKeeper , the Δ C t method, and RefFinder , were used to evaluate the stability of these candidates. As a result, unique sets of reference genes were recommended, respectively, for experiments involving different developmental stages, tissues, and ingested dsRNAs. By providing a foundation for standardized RT-qPCR analysis in C. septempunctata , our work improves the accuracy and replicability of the ERA of PIPs involving RNAi transgenic plants.

  19. RNAi as a tool to control the sex ratio of mouse offspring by interrupting Zfx/Zfy genes in the testis.

    PubMed

    Zhang, YongSheng; Xi, JiFeng; Jia, Bin; Wang, XiangZu; Wang, XuHai; Li, ChaoCheng; Li, YaQiang; Zeng, XianCun; Ying, RuiWen; Li, Xin; Jiang, Song; Yuan, FangYuan

    2017-04-01

    (p < 0.01). In conclusion, our findings show that RNAi-mediated disruption of Zfx/Zfy in mouse testis affected X/Y spermatogenesis. Additionally, results suggest that the paralogous genes Zfx/Zfy play an important role in the process of X and Y sperm development. The individual interference of Zfx/Zfy may predict the outcome of X and Y haploid sperms. Presented herein is an advanced method developed to control mouse X/Y spermatogenesis and sex ratio of offspring.

  20. Knockdown of RNA interference pathway genes in western corn rootworm, Diabrotica virgifera virgifera, identifies no fitness costs associated with Argonaute 2 or Dicer-2.

    PubMed

    Camargo, Carolina; Wu, Ke; Fishilevich, Elane; Narva, Kenneth E; Siegfried, Blair D

    2018-06-01

    The use of transgenic crops that induce silencing of essential genes using double-stranded RNA (dsRNA) through RNA interference (RNAi) in western corn rootworm, Diabrotica virgifera virgifera, is likely to be an important component of new technologies for the control of this important corn pest. Previous studies have demonstrated that the dsRNA response in D. v. virgifera depends on the presence of RNAi pathway genes including Dicer-2 and Argonaute 2, and that downregulation of these genes limits the lethality of environmental dsRNA. A potential resistance mechanism to lethal dsRNA may involve loss of function of RNAi pathway genes. Howver, the potential for resistance to evolve may depend on whether these pathway genes have essential functions such that the loss of function of core proteins in the RNAi pathway will have fitness costs in D. v. virgifera. Fitness costs associated with potential resistance mechanisms have a central role in determining how resistance can evolve to RNAi technologies in western corn rootworm. We evaluated the effect of dsRNA and microRNA pathway gene knockdown on the development of D. v. virgifera larvae through short-term and long-term exposures to dsRNA for Dicer and Argonaute genes. Downregulation of Argonaute 2, Dicer-2, Dicer-1 did not significantly affect larval survivorship or development through short and long-term exposure to dsRNA. However, downregulation of Argonaute 1 reduced larval survivorship and delayed development. The implications of these results as they relate to D. v. virgifera resistance to lethal dsRNA are discussed. Copyright © 2018 Elsevier Inc. All rights reserved.

  1. RNA interference tools for the western flower thrips, Frankliniella occidentalis.

    PubMed

    Badillo-Vargas, Ismael E; Rotenberg, Dorith; Schneweis, Brandi A; Whitfield, Anna E

    2015-05-01

    The insect order Thysanoptera is exclusively comprised of small insects commonly known as thrips. The western flower thrips, Frankliniella occidentalis, is an economically important pest amongst thysanopterans due to extensive feeding damage and tospovirus transmission to hundreds of plant species worldwide. Geographically-distinct populations of F. occidentalis have developed resistance against many types of traditional chemical insecticides, and as such, management of thrips and tospoviruses are a persistent challenge in agriculture. Molecular methods for defining the role(s) of specific genes in thrips-tospovirus interactions and for assessing their potential as gene targets in thrips management strategies is currently lacking. The goal of this work was to develop an RNA interference (RNAi) tool that enables functional genomic assays and to evaluate RNAi for its potential as a biologically-based approach for controlling F. occidentalis. Using a microinjection system, we delivered double-stranded RNA (dsRNA) directly to the hemocoel of female thrips to target the vacuolar ATP synthase subunit B (V-ATPase-B) gene of F. occidentalis. Gene expression analysis using real-time quantitative reverse transcriptase-PCR (qRT-PCR) revealed significant reductions of V-ATPase-B transcripts at 2 and 3 days post-injection (dpi) with dsRNA of V-ATPase-B compared to injection with dsRNA of GFP. Furthermore, the effect of knockdown of the V-ATPase-B gene in females at these two time points was mirrored by the decreased abundance of V-ATPase-B protein as determined by quantitative analysis of Western blots. Reduction in V-ATPase-B expression in thrips resulted in increased female mortality and reduced fertility, i.e., number of viable offspring produced. Survivorship decreased significantly by six dpi compared to the dsRNA-GFP control group, which continued decreasing significantly until the end of the bioassay. Surviving female thrips injected with dsRNA-V-ATPase-B produced

  2. A RNA nanotechnology platform for a simultaneous two-in-one siRNA delivery and its application in synergistic RNAi therapy

    PubMed Central

    Jang, Mihue; Han, Hee Dong; Ahn, Hyung Jun

    2016-01-01

    Incorporating multiple copies of two RNAi molecules into a single nanostructure in a precisely controlled manner can provide an efficient delivery tool to regulate multiple gene pathways in the relation of mutual dependence. Here, we show a RNA nanotechnology platform for a two-in-one RNAi delivery system to contain polymeric two RNAi molecules within the same RNA nanoparticles, without the aid of polyelectrolyte condensation reagents. As our RNA nanoparticles lead to the simultaneous silencing of two targeted mRNAs, of which biological functions are highly interdependent, combination therapy for multi-drug resistance cancer cells, which was studied as a specific application of our two-in-one RNAi delivery system, demonstrates the efficient synergistic effects for cancer therapy. Therefore, this RNA nanoparticles approach has an efficient tool for a simultaneous co-delivery of RNAi molecules in the RNAi-based biomedical applications, and our current studies present an efficient strategy to overcome multi-drug resistance caused by malfunction of genes in chemotherapy. PMID:27562435

  3. Viral RNAi suppressor reversibly binds siRNA to outcompete Dicer and RISC via multiple-turnover

    PubMed Central

    Rawlings, Renata A.; Krishnan, Vishalakshi; Walter, Nils G.

    2011-01-01

    RNA interference (RNAi) is a conserved gene regulatory mechanism employed by most eukaryotes as a key component of their innate immune response against viruses and retrotransposons. During viral infection, the RNase III-type endonuclease Dicer cleaves viral double-stranded RNA into small interfering RNAs (siRNAs), 21–24 nucleotides in length, and helps load them into the RNA-induced silencing complex (RISC) to guide cleavage of complementary viral RNA. As a countermeasure, many viruses have evolved viral RNA silencing suppressor (RSS) proteins that tightly, and presumably quantitatively, bind siRNAs to thwart RNAi-mediated degradation. Viral RSS proteins also act across kingdoms as potential immunosuppressors in gene therapeutic applications. Here we report fluorescence quenching and electrophoretic mobility shift assays that probe siRNA binding by the dimeric RSS p19 from Carnation Italian Ringspot Virus (CIRV), as well as by human Dicer and RISC assembly complexes. We find that the siRNA:p19 interaction is readily reversible, characterized by rapid binding ((1.69 ± 0.07)×108 M−1s−1) and marked dissociation (koff = 0.062 ± 0.002 s−1). We also observe that p19 efficiently competes with recombinant Dicer and inhibits formation of RISC-related assembly complexes found in human cell extract. Computational modeling based on these results provides evidence for the transient formation of a ternary complex between siRNA, human Dicer, and p19. An expanded model of RNA silencing indicates that multiple-turnover by reversible binding of siRNAs potentiates the efficiency of the suppressor protein. Our predictive model is expected to be applicable to the dosing of p19 as a silencing suppressor in viral gene therapy. PMID:21354178

  4. PsOr1, a potential target for RNA interference-based pest management.

    PubMed

    Zhao, Y Y; Liu, F; Yang, G; You, M S

    2011-02-01

    Insect pests cause billions of dollars in agricultural losses, and attempts to kill them have resulted in growing threats from insecticide resistance, dietary pesticide pollution and environmental destruction. New approaches to control refractory insect pests are therefore needed. The host-plant preferences of insect pests rely on olfaction and are mediated via a seven transmembrane-domain odorant receptor (Or) family. The present study reports the cloning and characterization of PsOr1, the first candidate member of the Or gene family from Phyllotreta striolata, a devastating beetle pest that causes damage worldwide. PsOr1 is remarkably well conserved with respect to other insect orthologues, including DmOr83b from Drosophila melanogaster. These insect orthologues form an essential non-conventional Or sub-family and may play an important and generalized role in insect olfaction. We designed double-stranded (ds) RNA directly against the PsOr1 gene and exploited RNA interference (RNAi) to control P. striolata. The chemotactic behavioural measurements showed that adult beetles were unable to sense the attractant or repellent odour stimulus after microinjection of dsRNA against PsOr1. Reverse Transcription (RT)-PCR analysis showed specific down-regulation of mRNA transcript levels for this gene. Furthermore, host-plant preference experiments confirmed that silencing PsOr1 by RNAi treatment impaired the host-plant preferences of P. striolata for cruciferous vegetables. These results demonstrate that this insect control approach of using RNAi to target PsOr1 and its orthologues might be effective in blocking host-plant-seeking behaviours in diverse insect pests. The results also support the theory that this unique receptor type plays an essential general role in insect olfaction. © 2010 Fujian Agriculture and Forestry University. Insect Molecular Biology © 2010 The Royal Entomological Society.

  5. Choosing the Right Tool for the Job: RNAi, TALEN or CRISPR

    PubMed Central

    Boettcher, Michael; McManus, Michael T.

    2015-01-01

    The most widely used approach for defining a genes’ function is to reduce or completely disrupt its normal expression. For over a decade, RNAi has ruled the lab, offering a magic bullet to disrupt gene expression in many organisms. However, new biotechnological tools - specifically CRISPR-based technologies - have become available and are squeezing out RNAi dominance in mammalian cell studies. These seemingly competing technologies leave research investigators with the question: ‘Which technology should I use in my experiment?’ This review offers a practical resource to compare and contrast these technologies, guiding the investigator when and where to use this fantastic array of powerful tools. PMID:26000843

  6. Nanoparticle-mediated RNA interference of angiotensinogen decreases blood pressure and improves myocardial remodeling in spontaneously hypertensive rats.

    PubMed

    Yuan, Li-Fen; Sheng, Jing; Lu, Ping; Wang, Yu-Qiang; Jin, Tuo; Du, Qin

    2015-09-01

    Angiotensinogen (AGT) has been shown to have a role in cardiac hypertrophy, while depletion of the AGT gene in spontaneously hypertensive rats (SHR) has not been investigated. The present study investigated the effect of AGT knockdown on cardiac hypertrophy in SHR. For this, small hairpin (sh)RNAs were intravenously injected into SHRs, using a nanoparticle‑mediated transfection system. The experimental rats were divided into the following groups: a) Blank control with water treatment only, b) negative control with biscarbamate‑crosslinked Gal‑polyethylene glycol polyethylenimine nanoparticles (GPE)/negative shRNA, c) AGT‑RNA interference (RNAi) group with GPE/AGT‑shRNA, and 4) normotensive control using Wistar‑Kyoto rats (WKY) with water treatment. Three and five days following the first injection, the levels of hepatic AGT mRNA and AGT protein as well as plasma levels of AGT were markedly decreased in the AGT‑RNAi group (P<0.05). Furthermore, a significant decrease in systolic blood pressure (SBP), left ventricular weight to body weight ratio and heart weight to body weight ratio were observed in the AGT‑RNAi group compared with those in the control groups. The depletion of AGT in SHR led to a reduction in SBP by 30±4 mmHg, which was retained for >10 days. Cardiac hypertrophy was also significantly improved in AGT‑knockdown rats. In conclusion, the present study showed that AGT‑silencing had a significant inhibitory effect on hypertension and hypertensive‑induced cardiac hypertrophy in SHRs.

  7. Evidence for a Role of Connexin 43 in Trigeminal Pain Using RNA Interference In Vivo

    PubMed Central

    Ohara, Peter T.; Vit, Jean-Philippe; Bhargava, Aditi; Jasmin, Luc

    2008-01-01

    The importance of glial cells in the generation and maintenance of neuropathic pain is becoming widely accepted. We examined the role of glial-specific gap junctions in nociception in the rat trigeminal ganglion in nerve-injured and -uninjured states. The connexin 43 (Cx43) gap-junction subunit was found to be confined to the satellite glial cells (SGCs) that tightly envelop primary sensory neurons in the trigeminal ganglion and we therefore used Cx43 RNA interference (RNAi) to alter gap-junction function in SGCs. Using behavioral evaluation, together with immunocytochemical and Western blot monitoring, we show that Cx43 increased in the trigeminal ganglion in rats with a chronic constriction injury (CCI) of the infraorbital nerve. Reducing Cx43 expression using RNAi in CCI rats reduced painlike behavior, whereas in non-CCI rats, reducing Cx43 expression increased painlike behavior. The degree of painlike behavior in CCI rats and intact, Cx43-silenced rats was similar. Our results support previous suggestions that increases in glial gap junctions after nerve injury increases nociceptive behavior but paradoxically the reduction of gap junctions in normal ganglia also increases nociceptive behavior, possibly a reflection of the multiple functions performed by glia. PMID:18715894

  8. RNA interference: new mechanistic and biochemical insights with application in oral cancer therapy.

    PubMed

    Buduru, Smaranda; Zimta, Alina-Andreea; Ciocan, Cristina; Braicu, Cornelia; Dudea, Diana; Irimie, Alexandra Iulia; Berindan-Neagoe, Ioana

    2018-01-01

    Over the last few decades, the incidence of oral cancer has gradually increased, due to the negative influence of environmental factors and also abnormalities within the genome. The main issues in oral cancer treatment consist in surpassing resistance and recurrence. However, continuous discovery of altered signaling pathways in these tumors provides valuable information for the identification of novel gene candidates targeted in personalized therapy. RNA interference (RNAi) is a natural mechanism that involves small interfering RNA (siRNA); this can be exploited in biomedical research by using natural or synthetic constructs for activation of the mechanism. Synthetic siRNA transcripts were developed as a versatile class of molecular tools that have a diverse range of programmable roles, being involved in the regulation of several biological processes, thereby providing the perspective of an alternative option to classical treatment. In this review, we summarize the latest information related to the application of siRNA in oral malignancy together with molecular aspects of the technology and also the perspective upon the delivery system. Also, the emergence of newer technologies such as clustered regularly interspaced short palindromic repeats/Cas9 or transcription activator-like effector nucleases in comparison with the RNAi approach is discussed in this paper.

  9. Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams.

    PubMed

    Centanni, Tracy Michelle; Booker, Anne B; Chen, Fuyi; Sloan, Andrew M; Carraway, Ryan S; Rennaker, Robert L; LoTurco, Joseph J; Kilgard, Michael P

    2016-04-27

    Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC-) before any behavioral training. A separate group of 8 rats (3 DC-) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of rapid stimulus processing

  10. Knockdown of Dyslexia-Gene Dcdc2 Interferes with Speech Sound Discrimination in Continuous Streams

    PubMed Central

    Booker, Anne B.; Chen, Fuyi; Sloan, Andrew M.; Carraway, Ryan S.; Rennaker, Robert L.; LoTurco, Joseph J.; Kilgard, Michael P.

    2016-01-01

    Dyslexia is the most common developmental language disorder and is marked by deficits in reading and phonological awareness. One theory of dyslexia suggests that the phonological awareness deficit is due to abnormal auditory processing of speech sounds. Variants in DCDC2 and several other neural migration genes are associated with dyslexia and may contribute to auditory processing deficits. In the current study, we tested the hypothesis that RNAi suppression of Dcdc2 in rats causes abnormal cortical responses to sound and impaired speech sound discrimination. In the current study, rats were subjected in utero to RNA interference targeting of the gene Dcdc2 or a scrambled sequence. Primary auditory cortex (A1) responses were acquired from 11 rats (5 with Dcdc2 RNAi; DC−) before any behavioral training. A separate group of 8 rats (3 DC−) were trained on a variety of speech sound discrimination tasks, and auditory cortex responses were acquired following training. Dcdc2 RNAi nearly eliminated the ability of rats to identify specific speech sounds from a continuous train of speech sounds but did not impair performance during discrimination of isolated speech sounds. The neural responses to speech sounds in A1 were not degraded as a function of presentation rate before training. These results suggest that A1 is not directly involved in the impaired speech discrimination caused by Dcdc2 RNAi. This result contrasts earlier results using Kiaa0319 RNAi and suggests that different dyslexia genes may cause different deficits in the speech processing circuitry, which may explain differential responses to therapy. SIGNIFICANCE STATEMENT Although dyslexia is diagnosed through reading difficulty, there is a great deal of variation in the phenotypes of these individuals. The underlying neural and genetic mechanisms causing these differences are still widely debated. In the current study, we demonstrate that suppression of a candidate-dyslexia gene causes deficits on tasks of

  11. Loss-of-function analyses of the fragile X-related and dopamine receptor genes by RNA interference in the cricket Gryllus bimaculatus.

    PubMed

    Hamada, Aska; Miyawaki, Katsuyuki; Honda-sumi, Eri; Tomioka, Kenji; Mito, Taro; Ohuchi, Hideyo; Noji, Sumihare

    2009-08-01

    In order to explore a possibility that the cricket Gryllus bimaculatus would be a useful model to unveil molecular mechanisms of human diseases, we performed loss-of-function analyses of Gryllus genes homologous to human genes that are responsible for human disorders, fragile X mental retardation 1 (fmr1) and Dopamine receptor (DopR). We cloned cDNAs of their Gryllus homologues, Gb'fmr1, Gb'DopRI, and Gb'DopRII, and analyzed their functions with use of nymphal RNA interference (RNAi). For Gb'fmr1, three major phenotypes were observed: (1) abnormal wing postures, (2) abnormal calling song, and (3) loss of the circadian locomotor rhythm, while for Gb'DopRI, defects of wing posture and morphology were found. These results indicate that the cricket has the potential to become a novel model system to explore human neuronal pathogenic mechanisms and to screen therapeutic drugs by RNAi. Copyright (c) 2009 Wiley-Liss, Inc.

  12. Large scale RNAi screen in Tribolium reveals novel target genes for pest control and the proteasome as prime target.

    PubMed

    Ulrich, Julia; Dao, Van Anh; Majumdar, Upalparna; Schmitt-Engel, Christian; Schwirz, Jonas; Schultheis, Dorothea; Ströhlein, Nadi; Troelenberg, Nicole; Grossmann, Daniela; Richter, Tobias; Dönitz, Jürgen; Gerischer, Lizzy; Leboulle, Gérard; Vilcinskas, Andreas; Stanke, Mario; Bucher, Gregor

    2015-09-03

    Insect pest control is challenged by insecticide resistance and negative impact on ecology and health. One promising pest specific alternative is the generation of transgenic plants, which express double stranded RNAs targeting essential genes of a pest species. Upon feeding, the dsRNA induces gene silencing in the pest resulting in its death. However, the identification of efficient RNAi target genes remains a major challenge as genomic tools and breeding capacity is limited in most pest insects impeding whole-animal-high-throughput-screening. We use the red flour beetle Tribolium castaneum as a screening platform in order to identify the most efficient RNAi target genes. From about 5,000 randomly screened genes of the iBeetle RNAi screen we identify 11 novel and highly efficient RNAi targets. Our data allowed us to determine GO term combinations that are predictive for efficient RNAi target genes with proteasomal genes being most predictive. Finally, we show that RNAi target genes do not appear to act synergistically and that protein sequence conservation does not correlate with the number of potential off target sites. Our results will aid the identification of RNAi target genes in many pest species by providing a manageable number of excellent candidate genes to be tested and the proteasome as prime target. Further, the identified GO term combinations will help to identify efficient target genes from organ specific transcriptomes. Our off target analysis is relevant for the sequence selection used in transgenic plants.

  13. Backbone and sidechain methyl Ile (δ1), Leu and Val chemical shift assignments of RDE-4 (1-243), an RNA interference initiation protein in C. elegans.

    PubMed

    Chiliveri, Sai Chaitanya; Kumar, Sonu; Marelli, Udaya Kiran; Deshmukh, Mandar V

    2012-10-01

    The RNAi pathway of several organisms requires presence of double stranded RNA binding proteins for functioning of Dicer in gene regulation. In C. elegans, a double stranded RNA binding protein, RDE-4 (385 aa, 44 kDa) recognizes long exogenous dsRNA and initiates the RNAi pathway. We have achieved complete backbone and stereospecific methyl sidechain Ile (δ1), Leu and Val chemical shifts of first 243 amino acids of RDE-4, namely RDE-4ΔC.

  14. Inhibition of HBV replication in vivo using helper-dependent adenovirus vectors to deliver antiviral RNA interference expression cassettes.

    PubMed

    Crowther, Carol; Mowa, Mohube B; Ely, Abdullah; Arbuthnot, Patrick B

    2014-01-01

    HBV is hyperendemic to southern Africa and parts of Asia, but licensed antivirals have little effect on limiting life-threatening complications of the infection. Although RNA interference (RNAi)-based gene silencing has shown therapeutic potential, difficulties with delivery of anti-HBV RNAi effectors remain an obstacle to their clinical use. To address concerns about the transient nature of transgene expression and toxicity resulting from immunostimulation by recombinant adenovirus vectors (Ads), utility of RNAi-activating anti-HBV helper-dependent (HD) Ads were assessed in this study. Following intravenous administration of 5×10(9) unmodified or pegylated HD Ad infectious particles to HBV transgenic mice, HBV viral loads and serum HBV surface antigen levels were monitored for 12 weeks. Immunostimulation of HD Ads was assessed by measuring inflammatory cytokines, hepatic function and immune response to the co-delivered LacZ reporter gene. Unmodified and pegylated HD Ads transduced 80-90% of hepatocytes and expressed short hairpin RNAs (shRNAs) were processed to generate intended HBV-targeting guides. Markers of HBV replication were decreased by approximately 95% and silencing was sustained for 8 weeks. Unmodified HD Ads induced release of proinflammatory cytokines and there was evidence of an adaptive immune response to β-galactosidase. However the HD Ad-induced innate immune response was minimal in preparations that were enriched with infectious particles. HD Ads have potential utility for delivery of therapeutic HBV-silencing sequences and alterations of these vectors to attenuate their immune responses may further improve their efficacy.

  15. Argonaute proteins are key determinants of RNAi efficacy, toxicity, and persistence in the adult mouse liver.

    PubMed

    Grimm, Dirk; Wang, Lora; Lee, Joyce S; Schürmann, Nina; Gu, Shuo; Börner, Kathleen; Storm, Theresa A; Kay, Mark A

    2010-09-01

    shRNA overexpression from viral gene therapy vectors can trigger cytotoxicity leading to organ failure and lethality in mice and rats. This process likely involves saturation of endogenous cellular RNAi factors including exportin-5 (Xpo-5). Here, we have shown that Xpo-5 overexpression enhanced shRNA efficiency in the liver of adult mice but increased hepatotoxicity. We identified the 4 members of the human Argonaute (Ago) protein family as downstream factors involved in saturation of endogenous cellular RNAi, all of which were able to interact with shRNAs in cells and mice. In Ago/shRNA coexpression studies, Ago-2 (Slicer) was the primary rate-limiting determinant of both in vitro and in vivo RNAi efficacy, toxicity, and persistence. In adult mice, vector-based Ago-2/Xpo-5 coexpression enhanced U6-driven shRNA silencing of exogenous and endogenous hepatic targets, reduced hepatotoxicity, and extended RNAi stability by more than 3 months. Use of weaker RNA polymerase III promoters to minimize shRNA expression likewise alleviated in vivo toxicity and permitted greater than 95% persistent knockdown of hepatitis B virus and other transgenes in mouse liver for more than 1 year. Our studies substantiate that abundant small RNAs can overload the endogenous RNAi pathway and reveal possible strategies for reducing hepatotoxicity of short- and long-term clinical gene silencing in humans.

  16. RNAi and heterochromatin repress centromeric meiotic recombination

    PubMed Central

    Ellermeier, Chad; Higuchi, Emily C.; Phadnis, Naina; Holm, Laerke; Geelhood, Jennifer L.; Thon, Genevieve; Smith, Gerald R.

    2010-01-01

    During meiosis, the formation of viable haploid gametes from diploid precursors requires that each homologous chromosome pair be properly segregated to produce an exact haploid set of chromosomes. Genetic recombination, which provides a physical connection between homologous chromosomes, is essential in most species for proper homologue segregation. Nevertheless, recombination is repressed specifically in and around the centromeres of chromosomes, apparently because rare centromeric (or pericentromeric) recombination events, when they do occur, can disrupt proper segregation and lead to genetic disabilities, including birth defects. The basis by which centromeric meiotic recombination is repressed has been largely unknown. We report here that, in fission yeast, RNAi functions and Clr4-Rik1 (histone H3 lysine 9 methyltransferase) are required for repression of centromeric recombination. Surprisingly, one mutant derepressed for recombination in the heterochromatic mating-type region during meiosis and several mutants derepressed for centromeric gene expression during mitotic growth are not derepressed for centromeric recombination during meiosis. These results reveal a complex relation between types of repression by heterochromatin. Our results also reveal a previously undemonstrated role for RNAi and heterochromatin in the repression of meiotic centromeric recombination and, potentially, in the prevention of birth defects by maintenance of proper chromosome segregation during meiosis. PMID:20421495

  17. Selective gene silencing by viral delivery of short hairpin RNA

    PubMed Central

    2010-01-01

    RNA interference (RNAi) technology has not only become a powerful tool for functional genomics, but also allows rapid drug target discovery and in vitro validation of these targets in cell culture. Furthermore, RNAi represents a promising novel therapeutic option for treating human diseases, in particular cancer. Selective gene silencing by RNAi can be achieved essentially by two nucleic acid based methods: i) cytoplasmic delivery of short double-stranded (ds) interfering RNA oligonucleotides (siRNA), where the gene silencing effect is only transient in nature, and possibly not suitable for all applications; or ii) nuclear delivery of gene expression cassettes that express short hairpin RNA (shRNA), which are processed like endogenous interfering RNA and lead to stable gene down-regulation. Both processes involve the use of nucleic acid based drugs, which are highly charged and do not cross cell membranes by free diffusion. Therefore, in vivo delivery of RNAi therapeutics must use technology that enables the RNAi therapeutic to traverse biological membrane barriers in vivo. Viruses and the vectors derived from them carry out precisely this task and have become a major delivery system for shRNA. Here, we summarize and compare different currently used viral delivery systems, give examples of in vivo applications, and indicate trends for new developments, such as replicating viruses for shRNA delivery to cancer cells. PMID:20858246

  18. Germline Defects Caused by Smed-boule RNA-Interference Reveal That Egg Capsule Deposition Occurs Independently of Fertilization, Ovulation, Mating, or the Presence of Gametes in Planarian Flatworms.

    PubMed

    Steiner, Jessica Kathryne; Tasaki, Junichi; Rouhana, Labib

    2016-05-01

    Few animals are known to lay eggs in the absence of ovulation or copulation, as it is presumably energetically wasteful and subjected to negative selection. Characterization of Smed-boule, a member of the DAZ family of germline RNA-binding proteins, revealed that egg capsule (or capsule) production and deposition occurs independently of the presence of gametes in the planarian flatworm Schmidtea mediterranea. Reduction of Smed-boule expression by RNA-interference (RNAi) causes ablation of spermatogonial stem cells and the inability of ovarian germline stem cells to undergo oogenesis. Although animals subjected to Smed-boule RNAi lose their gametes and become sterile, they continue to lay egg capsules. Production of sterile capsules is even observed in virgin Smed-boule(RNAi) and control planarians maintained in complete isolation, demonstrating that egg production in S. mediterranea occurs independently of ovulation, fertilization, or mating. Evidence suggests that this is a conserved feature amongst Platyhelminthes, and therefore relevant to the pathology and dissemination of parasitic flatworms. These findings demonstrate that Smed-boule functions at different stages during male and female germline stem cell development, and also demonstrate that egg capsule production by planarian flatworms occurs independently of signals produced by mating or ova.

  19. Long-term absorption of beta-tricalcium phosphate poly-L-lactic acid interference screws.

    PubMed

    Barber, F Alan; Dockery, William D

    2008-04-01

    The purpose of this study was to evaluate the long-term in vivo degradation of biodegradable interference screws made of poly-L-lactic acid (PLLA) and beta-tricalcium phosphate (beta-TCP). Twenty patients undergoing patellar tendon autograft anterior cruciate ligament reconstruction fixed at both the femur and tibia with beta-TCP-PLLA screws at least 44 months earlier were evaluated by physical, radiographic, and computed tomography (CT) evaluations. This study was approved by the institutional review board. Lysholm, Tegner, Cincinnati, and International Knee Documentation Committee scores were also obtained. CT data were measured in Hounsfield units. We evaluated 13 male and 7 female patients at a mean of 50 months after surgery (range, 44 to 56 months). CT scans and radiographs showed the bone plug fused to the tunnel wall with no beta-TCP-PLLA screw remaining. The screws were replaced with clearly calcified non-trabecular material, denser than soft tissue. Osteoconductivity was present in 75% of the tunnels and complete in 10%. No positive pivot-shift tests were found. Lysholm, Tegner, and Cincinnati scores improved from 60.4, 3.7, and 53.3, respectively, preoperatively to 90.8, 5.8, and 86.4, respectively, at follow-up. The mean side-to-side difference determined by use of the KT arthrometer (MEDmetric, San Diego, CA) was 0.4 mm. The beta-TCP-PLLA interference screw (Bilok; ArthroCare, Sunnyvale, CA) completely degraded, and no remnant was present 4 years after insertion. Osteoconductivity was confirmed by CT scans at 75% of the screw sites and completely filled the site in 10%. The addition of beta-TCP to PLLA results in a biocomposite interference screw that is osteoconductive. Level IV, therapeutic case series.

  20. RNAi-Dependent and Independent Control of LINE1 Accumulation and Mobility in Mouse Embryonic Stem Cells

    PubMed Central

    Ciaudo, Constance; Jay, Florence; Okamoto, Ikuhiro; Chen, Chong-Jian; Sarazin, Alexis; Servant, Nicolas; Barillot, Emmanuel; Heard, Edith; Voinnet, Olivier

    2013-01-01

    In most mouse tissues, long-interspersed elements-1 (L1s) are silenced via methylation of their 5′-untranslated regions (5′-UTR). A gradual loss-of-methylation in pre-implantation embryos coincides with L1 retrotransposition in blastocysts, generating potentially harmful mutations. Here, we show that Dicer- and Ago2-dependent RNAi restricts L1 accumulation and retrotransposition in undifferentiated mouse embryonic stem cells (mESCs), derived from blastocysts. RNAi correlates with production of Dicer-dependent 22-nt small RNAs mapping to overlapping sense/antisense transcripts produced from the L1 5′-UTR. However, RNA-surveillance pathways simultaneously degrade these transcripts and, consequently, confound the anti-L1 RNAi response. In Dicer−/− mESC complementation experiments involving ectopic Dicer expression, L1 silencing was rescued in cells in which microRNAs remained strongly depleted. Furthermore, these cells proliferated and differentiated normally, unlike their non-complemented counterparts. These results shed new light on L1 biology, uncover defensive, in addition to regulatory roles for RNAi, and raise questions on the differentiation defects of Dicer−/− mESCs. PMID:24244175

  1. RNAi drives nonreciprocal translocations at eroding chromosome ends to establish telomere-free linear chromosomes.

    PubMed

    Begnis, Martina; Apte, Manasi S; Masuda, Hirohisa; Jain, Devanshi; Wheeler, David Lee; Cooper, Julia Promisel

    2018-04-01

    The identification of telomerase-negative HAATI (heterochromatin amplification-mediated and telomerase-independent) cells, in which telomeres are superseded by nontelomeric heterochromatin tracts, challenged the idea that canonical telomeres are essential for chromosome linearity and raised crucial questions as to how such tracts translocate to eroding chromosome ends and confer end protection. Here we show that HAATI arises when telomere loss triggers a newly recognized illegitimate translocation pathway that requires RNAi factors. While RNAi is necessary for the translocation events that mobilize ribosomal DNA (rDNA) tracts to all chromosome ends (forming "HAATI rDNA " chromosomes), it is dispensable for HAATI rDNA maintenance. Surprisingly, Dicer (Dcr1) plays a separate, RNAi-independent role in preventing formation of the rare HAATI subtype in which a different repetitive element (the subtelomeric element) replaces telomeres. Using genetics and fusions between shelterin components and rDNA-binding proteins, we mapped the mechanism by which rDNA loci engage crucial end protection factors-despite the absence of telomere repeats-and secure end protection. Sequence analysis of HAATI rDNA genomes allowed us to propose RNA and DNA polymerase template-switching models for the mechanism of RNAi-triggered rDNA translocations. Collectively, our results reveal unforeseen roles for noncoding RNAs (ncRNAs) in assembling a telomere-free chromosome end protection device. © 2018 Begnis et al.; Published by Cold Spring Harbor Laboratory Press.

  2. Genetically Modifying the Insect Gut Microbiota to Control Chagas Disease Vectors through Systemic RNAi

    PubMed Central

    Taracena, Mabel L.; Oliveira, Pedro L.; Almendares, Olivia; Umaña, Claudia; Lowenberger, Carl; Dotson, Ellen M.; Paiva-Silva, Gabriela O.; Pennington, Pamela M.

    2015-01-01

    Technologies based on RNA interference may be used for insect control. Sustainable strategies are needed to control vectors of Chagas disease such as Rhodnius prolixus. The insect microbiota can be modified to deliver molecules to the gut. Here, Escherichia coli HT115(DE3) expressing dsRNA for the Rhodnius heme-binding protein (RHBP) and for catalase (CAT) were fed to nymphs and adult triatomine stages. RHBP is an egg protein and CAT is an antioxidant enzyme expressed in all tissues by all developmental stages. The RNA interference effect was systemic and temporal. Concentrations of E. coli HT115(DE3) above 3.35 × 107 CFU/mL produced a significant RHBP and CAT gene knockdown in nymphs and adults. RHBP expression in the fat body was reduced by 99% three days after feeding, returning to normal levels 10 days after feeding. CAT expression was reduced by 99% and 96% in the ovary and the posterior midgut, respectively, five days after ingestion. Mortality rates increased by 24-30% in first instars fed RHBP and CAT bacteria. Molting rates were reduced by 100% in first instars and 80% in third instars fed bacteria producing RHBP or CAT dsRNA. Oviposition was reduced by 43% (RHBP) and 84% (CAT). Embryogenesis was arrested in 16% (RHBP) and 20% (CAT) of laid eggs. Feeding females 105 CFU/mL of the natural symbiont, Rhodococcus rhodnii, transformed to express RHBP-specific hairpin RNA reduced RHBP expression by 89% and reduced oviposition. Modifying the insect microbiota to induce systemic RNAi in R. prolixus may result in a paratransgenic strategy for sustainable vector control. PMID:25675102

  3. Differential Contribution of RNA Interference Components in Response to Distinct Fusarium graminearum Virus Infections.

    PubMed

    Yu, Jisuk; Lee, Kyung-Mi; Cho, Won Kyong; Park, Ju Yeon; Kim, Kook-Hyung

    2018-05-01

    The mechanisms of RNA interference (RNAi) as a defense response against viruses remain unclear in many plant-pathogenic fungi. In this study, we used reverse genetics and virus-derived small RNA profiling to investigate the contributions of RNAi components to the antiviral response against Fusarium graminearum viruses 1 to 3 (FgV1, -2, and -3). Real-time reverse transcription-quantitative PCR (qRT-PCR) indicated that infection of Fusarium graminearum by FgV1, -2, or -3 differentially induces the gene expression of RNAi components in F. graminearum Transcripts of the DICER-2 and AGO-1 genes of F. graminearum ( FgDICER-2 and FgAGO-1 ) accumulated at lower levels following FgV1 infection than following FgV2 or FgV3 infection. We constructed gene disruption and overexpression mutants for each of the Argonaute and dicer genes and for two RNA-dependent RNA polymerase (RdRP) genes and generated virus-infected strains of each mutant. Interestingly, mycelial growth was significantly faster for the FgV1-infected FgAGO-1 overexpression mutant than for the FgV1-infected wild type, while neither FgV2 nor FgV3 infection altered the colony morphology of the gene deletion and overexpression mutants. FgV1 RNA accumulation was significantly decreased in the FgAGO-1 overexpression mutant. Furthermore, the levels of induction of FgAGO-1 , FgDICER-2 , and some of the FgRdRP genes caused by FgV2 and FgV3 infection were similar to those caused by hairpin RNA-induced gene silencing. Using small RNA sequencing analysis, we documented different patterns of virus-derived small interfering RNA (vsiRNA) production in strains infected with FgV1, -2, and -3. Our results suggest that the Argonaute protein encoded by FgAGO-1 is required for RNAi in F. graminearum , that FgAGO-1 induction differs in response to FgV1, -2, and -3, and that FgAGO-1 might contribute to the accumulation of vsiRNAs in FgV1-infected F. graminearum IMPORTANCE To increase our understanding of how RNAi components in Fusarium

  4. RNAi at work: Targeting invertebrate pests and beneficial organisms' diseases

    USDA-ARS?s Scientific Manuscript database

    Invertebrates present two types of large scale RNAi application opportunities: pest control and beneficial insect health. The former involves the introduction of sustainable applications to keep pest populations low, and the latter represents the challenge of keeping beneficial organisms healthy. RN...

  5. Gene silencing in Tribolium castaneum as a tool for the targeted identification of candidate RNAi targets in crop pests.

    PubMed

    Knorr, Eileen; Fishilevich, Elane; Tenbusch, Linda; Frey, Meghan L F; Rangasamy, Murugesan; Billion, Andre; Worden, Sarah E; Gandra, Premchand; Arora, Kanika; Lo, Wendy; Schulenberg, Greg; Valverde-Garcia, Pablo; Vilcinskas, Andreas; Narva, Kenneth E

    2018-02-01

    RNAi shows potential as an agricultural technology for insect control, yet, a relatively low number of robust lethal RNAi targets have been demonstrated to control insects of agricultural interest. In the current study, a selection of lethal RNAi target genes from the iBeetle (Tribolium castaneum) screen were used to demonstrate efficacy of orthologous targets in the economically important coleopteran pests Diabrotica virgifera virgifera and Meligethes aeneus. Transcript orthologs of 50 selected genes were analyzed in D. v. virgifera diet-based RNAi bioassays; 21 of these RNAi targets showed mortality and 36 showed growth inhibition. Low dose injection- and diet-based dsRNA assays in T. castaneum and D. v. virgifera, respectively, enabled the identification of the four highly potent RNAi target genes: Rop, dre4, ncm, and RpII140. Maize was genetically engineered to express dsRNA directed against these prioritized candidate target genes. T 0 plants expressing Rop, dre4, or RpII140 RNA hairpins showed protection from D. v. virgifera larval feeding damage. dsRNA targeting Rop, dre4, ncm, and RpII140 in M. aeneus also caused high levels of mortality both by injection and feeding. In summary, high throughput systems for model organisms can be successfully used to identify potent RNA targets for difficult-to-work with agricultural insect pests.

  6. Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes.

    PubMed

    Matsa, Elena; Dixon, James E; Medway, Christopher; Georgiou, Orestis; Patel, Minal J; Morgan, Kevin; Kemp, Paul J; Staniforth, Andrew; Mellor, Ian; Denning, Chris

    2014-04-01

    Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K(+) currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart.

  7. Allele-specific RNA interference rescues the long-QT syndrome phenotype in human-induced pluripotency stem cell cardiomyocytes

    PubMed Central

    Matsa, Elena; Dixon, James E.; Medway, Christopher; Georgiou, Orestis; Patel, Minal J.; Morgan, Kevin; Kemp, Paul J.; Staniforth, Andrew; Mellor, Ian; Denning, Chris

    2014-01-01

    Aims Long-QT syndromes (LQTS) are mostly autosomal-dominant congenital disorders associated with a 1:1000 mutation frequency, cardiac arrest, and sudden death. We sought to use cardiomyocytes derived from human-induced pluripotency stem cells (hiPSCs) as an in vitro model to develop and evaluate gene-based therapeutics for the treatment of LQTS. Methods and results We produced LQTS-type 2 (LQT2) hiPSC cardiomyocytes carrying a KCNH2 c.G1681A mutation in a IKr ion-channel pore, which caused impaired glycosylation and channel transport to cell surface. Allele-specific RNA interference (RNAi) directed towards the mutated KCNH2 mRNA caused knockdown, while leaving the wild-type mRNA unaffected. Electrophysiological analysis of patient-derived LQT2 hiPSC cardiomyocytes treated with mutation-specific siRNAs showed normalized action potential durations (APDs) and K+ currents with the concurrent rescue of spontaneous and drug-induced arrhythmias (presented as early-afterdepolarizations). Conclusions These findings provide in vitro evidence that allele-specific RNAi can rescue diseased phenotype in LQTS cardiomyocytes. This is a potentially novel route for the treatment of many autosomal-dominant-negative disorders, including those of the heart. PMID:23470493

  8. Comparative proteomic analysis provides insight into 10-hydroxy-2-decenoic acid biosynthesis in honey bee workers.

    PubMed

    Yang, Xiao-Hui; Yang, Shi-Fa; Wang, Rui-Ming

    2017-07-01

    10-Hydroxy-2-decenoic acid (10-HDA) is the major compound produced from the mandibular glands (MGs) of honey bee workers. However, little information is available on the molecular mechanisms of 10-HDA biosynthesis. In our study, based on investigating the 10-HDA secretion pattern and the morphological characteristics of MGs from honey bee workers of different ages, a comparative proteomic analysis was performed in the MGs of workers with different 10-HDA production. In total, 59 up-regulated protein species representing 45 unique proteins were identified in high 10-HDA-producing workers by 2-DE-MALDI-TOF/TOF MS. These proteins were involved in carbohydrate/energy metabolism, fatty acid metabolism, protein metabolism and folding, antioxidation, cytoskeleton, development and cell signaling. Proteins related to fatty acid metabolism, including fatty acid synthase and β-oxidation enzymes, are potentially crucial proteins involved in 10-HDA biosynthesis pathway. And RNA interference (RNAi) results demonstrated that knockdown of electron transfer flavoprotein subunit beta (ETF-β), one of the protein related to fatty acid metabolism, decreased 10-HDA production of worker bees, suggesting that ETF-β was necessary for 10-HDA biosynthesis. This study reveals the characteristics of MGs of worker bees at different developmental stages and proteins associated with 10-HDA biosynthesis, which provides the first insight into the molecular mechanism of 10-HDA biosynthesis.

  9. Transcriptome analysis in cotton boll weevil (Anthonomus grandis) and RNA interference in insect pests.

    PubMed

    Firmino, Alexandre Augusto Pereira; Fonseca, Fernando Campos de Assis; de Macedo, Leonardo Lima Pepino; Coelho, Roberta Ramos; Antonino de Souza, José Dijair; Togawa, Roberto Coiti; Silva-Junior, Orzenil Bonfim; Pappas, Georgios Joannis; da Silva, Maria Cristina Mattar; Engler, Gilbert; Grossi-de-Sa, Maria Fatima

    2013-01-01

    Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi) as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families' data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects.

  10. Transcriptome Analysis in Cotton Boll Weevil (Anthonomus grandis) and RNA Interference in Insect Pests

    PubMed Central

    Coelho, Roberta Ramos; Antonino de Souza Jr, José Dijair; Togawa, Roberto Coiti; Silva-Junior, Orzenil Bonfim; Pappas-Jr, Georgios Joannis; da Silva, Maria Cristina Mattar; Engler, Gilbert; Grossi-de-Sa, Maria Fatima

    2013-01-01

    Cotton plants are subjected to the attack of several insect pests. In Brazil, the cotton boll weevil, Anthonomus grandis, is the most important cotton pest. The use of insecticidal proteins and gene silencing by interference RNA (RNAi) as techniques for insect control are promising strategies, which has been applied in the last few years. For this insect, there are not much available molecular information on databases. Using 454-pyrosequencing methodology, the transcriptome of all developmental stages of the insect pest, A. grandis, was analyzed. The A. grandis transcriptome analysis resulted in more than 500.000 reads and a data set of high quality 20,841 contigs. After sequence assembly and annotation, around 10,600 contigs had at least one BLAST hit against NCBI non-redundant protein database and 65.7% was similar to Tribolium castaneum sequences. A comparison of A. grandis, Drosophila melanogaster and Bombyx mori protein families’ data showed higher similarity to dipteran than to lepidopteran sequences. Several contigs of genes encoding proteins involved in RNAi mechanism were found. PAZ Domains sequences extracted from the transcriptome showed high similarity and conservation for the most important functional and structural motifs when compared to PAZ Domains from 5 species. Two SID-like contigs were phylogenetically analyzed and grouped with T. castaneum SID-like proteins. No RdRP gene was found. A contig matching chitin synthase 1 was mined from the transcriptome. dsRNA microinjection of a chitin synthase gene to A. grandis female adults resulted in normal oviposition of unviable eggs and malformed alive larvae that were unable to develop in artificial diet. This is the first study that characterizes the transcriptome of the coleopteran, A. grandis. A new and representative transcriptome database for this insect pest is now available. All data support the state of the art of RNAi mechanism in insects. PMID:24386449

  11. The Influence of Endocrine Disrupting Chemicals on the Proliferation of ERα Knockdown-Human Breast Cancer Cell Line MCF-7; New Attempts by RNAi Technology

    PubMed Central

    Miyakoshi, Takashi; Miyajima, Katsuhiro; Takekoshi, Susumu; Osamura, Robert Yoshiyuki

    2009-01-01

    Bisphenol A (BPA) is a monomer use in manufacturing a wide range of chemical products which include epoxy resins and polycarbonate. It has been reported that BPA increases the cell proliferation activity of human breast cancer MCF-7 cells as well as 17-β estradiol (E2) and diethylstilbestrol (DES). However, BPA induces target genes through ER-dependent and ER-independent manners which are different from the actions induced by E2. Therefore, BPA may be unique in estrogen-dependent cell proliferation compared to other endocrine disrupting chemicals (EDCs). In the present study, to test whether ERα is essential to the BPA-induced proliferation on MCF-7 cells, we suppressed the ERα expression of MCF-7 cells by RNA interference (RNAi). Proliferation effects in the presence of E2, DES and BPA were not observed in ERα-knockdown MCF-7 cells in comparison with control MCF-7. In addition, a marker of proliferative potential, MIB-1 labeling index (LI), showed no change in BPA-treated groups compared with vehicle-treated groups on ERα-knockdown MCF-7 cells. In conclusion, we demonstrated that ERα has a role in BPA-induced cell proliferation as well as E2 and DES. Moreover, this study indicated that the direct knockdown of ERα using RNAi serves as an additional tool to evaluate, in parallel with MCF-7 cell proliferation assay, for potential EDCs. PMID:19492024

  12. Optimized Extraction Method To Remove Humic Acid Interferences from Soil Samples Prior to Microbial Proteome Measurements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qian, Chen; Hettich, Robert L.

    The microbial composition and their activities in soil environments play a critical role in organic matter transformation and nutrient cycling, perhaps most specifically with respect to impact on plant growth but also more broadly to global impact on carbon and nitrogen-cycling. Liquid chromatography coupled to high performance mass spectrometry provides a powerful approach to characterize soil microbiomes; however, the limited microbial biomass and the presence of abundant interferences in soil samples present major challenges to soil proteome extraction and subsequent MS measurement. To address some of the major issues, we have designed and optimized an experimental method to enhance microbialmore » proteome extraction concomitant with minimizing the soil-borne humic substances co-extraction from soils. Among the range of interferences, humic substances are often the worst in terms of adversely impacting proteome extraction and mass spectrometry measurement. Our approach employs an in-situ detergent-based microbial lysis / TCA precipitation coupled with an additional acidification precipitation step at the peptide level which efficiently removes humic acids. By combing filtration and pH adjustment of the final peptide solution, the remaining humic acids can be differentially precipitated and removed with a membrane filter, thereby leaving much cleaner proteolytic peptide samples for MS measurement. As a result, this modified method is a reliable and straight-forward protein extraction method that efficiently removes soil-borne humic substances without inducing proteome sample loss or reducing or biasing protein identification in mass spectrometry.« less

  13. Optimized Extraction Method To Remove Humic Acid Interferences from Soil Samples Prior to Microbial Proteome Measurements

    DOE PAGES

    Qian, Chen; Hettich, Robert L.

    2017-05-24

    The microbial composition and their activities in soil environments play a critical role in organic matter transformation and nutrient cycling, perhaps most specifically with respect to impact on plant growth but also more broadly to global impact on carbon and nitrogen-cycling. Liquid chromatography coupled to high performance mass spectrometry provides a powerful approach to characterize soil microbiomes; however, the limited microbial biomass and the presence of abundant interferences in soil samples present major challenges to soil proteome extraction and subsequent MS measurement. To address some of the major issues, we have designed and optimized an experimental method to enhance microbialmore » proteome extraction concomitant with minimizing the soil-borne humic substances co-extraction from soils. Among the range of interferences, humic substances are often the worst in terms of adversely impacting proteome extraction and mass spectrometry measurement. Our approach employs an in-situ detergent-based microbial lysis / TCA precipitation coupled with an additional acidification precipitation step at the peptide level which efficiently removes humic acids. By combing filtration and pH adjustment of the final peptide solution, the remaining humic acids can be differentially precipitated and removed with a membrane filter, thereby leaving much cleaner proteolytic peptide samples for MS measurement. As a result, this modified method is a reliable and straight-forward protein extraction method that efficiently removes soil-borne humic substances without inducing proteome sample loss or reducing or biasing protein identification in mass spectrometry.« less

  14. Genetic Tools for Self-Organizing Culture of Mouse Embryonic Stem Cells via Small Regulatory RNA-Mediated Technologies, CRISPR/Cas9, and Inducible RNAi.

    PubMed

    Takata, Nozomu; Sakakura, Eriko; Sakuma, Tetsushi; Yamamoto, Takashi

    2017-01-01

    Approaches to investigate gene functions in experimental biology are becoming more diverse and reliable. Furthermore, several kinds of tissues and organs that possess their original identities can be generated in petri dishes from stem cells including embryonic, adult and induced pluripotent stem cells. Researchers now have several choices of experimental methods and their combinations to analyze gene functions in various biological systems. Here, as an example we describe one of the better protocols, which combines three-dimensional embryonic stem cell culture with small regulatory RNA-mediated technologies, clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9), and inducible RNA interference (RNAi). This protocol allows investigation of genes of interest to better understand gene functions in target tissues (or organs) during in vitro development.

  15. RNA interference of insulin-related peptide and neuroparsins affects vitellogenesis in the desert locust Schistocerca gregaria.

    PubMed

    Badisco, Liesbeth; Marchal, Elisabeth; Van Wielendaele, Pieter; Verlinden, Heleen; Vleugels, Rut; Vanden Broeck, Jozef

    2011-03-01

    The 'classic' insect hormones, juvenile hormone and 20-hydroxyecdysone, can stimulate vitellogenesis and/or ovarian development in adult females of several insect species. Accumulating evidence also indicates a crucial role in female reproductive physiology for peptide hormones, such as insulin-related peptides (IRPs) and neuroparsins (NPs). Especially in dipteran species, IRP signaling has been shown to regulate female reproductive events. The first NP was originally identified from the migratory locust (Locusta migratoria) as an antigonadotropic factor that delayed vitellogenesis. Moreover, NP family members display sequence similarities with the N-terminal domain of vertebrate insulin-like growth factor binding proteins (IGFBPs). In the current study, RNA interference (RNAi) was employed to investigate the possible involvement of IRP and NPs in the control of the female desert locust (Schistocerca gregaria) reproductive system. The cDNAs encoding an IRP (Scg-IRP) and four NPs (Scg-NPs) had previously been cloned from S. gregaria. An RNAi-mediated knock-down of either Scg-NP or Scg-IRP transcript levels was induced in adult female desert locusts and the subsequent effects were analyzed. Knock-down of the Scg-NPs or Scg-IRP affected vitellogenin transcript levels and oocyte growth in a positive and negative way, respectively. The current findings are indicative for a role of Scg-NPs and Scg-IRP in the control of vitellogenin synthesis. A plausible hypothesis is that Scg-IRP may act as a sensor of the nutritional and metabolic status that determines whether vitellogenesis can occur. That the same processes were affected in opposite ways in both RNAi experiments offers an extra argument for antagonizing roles of Scg-NPs and Scg-IRP. Copyright © 2010 Elsevier Inc. All rights reserved.

  16. Usefulness of multiple chalk-based food colorings for inducing better gene silencing by feeding RNA interference in planarians.

    PubMed

    Hattori, Miki; Miyamoto, Mai; Hosoda, Kazutaka; Umesono, Yoshihiko

    2018-01-01

    Planarians have become widely recognized as one of the major animal models for regeneration studies in invertebrates. To induce RNA interference (RNAi) by feeding in planarians, the widely accepted protocol is one in which animals undergo two or three feedings of food containing double-stranded RNA (dsRNA) plus visible food coloring (e.g., blood) for confirmation of feeding by individual animals. However, one possible problem is that incorporated food coloring is often retained within the gut for several days, which makes it difficult to confirm the success of each round of dsRNA feeding based on the difference of the color density within the gut before and after feeding. As a consequence, the difference of appetite levels among individuals undergoing dsRNA feeding leads to phenotypic variability among them due to insufficient knockdown. In our attempts to overcome this problem, we have developed a novel method for achieving robust confirmation of the success of dsRNA feeding in individuals fed multiple times by means of including a combination of three different colored chalks (pink, yellow and blue) as food coloring. Notably, we found that this method is superior to the conventional method for positively marking individuals that actively consumed the dsRNA-containing food during four times of once-daily feeding. Using these selected animals, we obtained stable and sufficiently strong RNAi-induced phenotypes. We termed this improved multi-colored chalk-spiked method of feeding RNAi "Candi" and propose its benefits for gene function analysis in planarians. © 2017 Japanese Society of Developmental Biologists.

  17. RNAi phenotype profiling of kinases identifies potential therapeutic targets in Ewing's sarcoma.

    PubMed

    Arora, Shilpi; Gonzales, Irma M; Hagelstrom, R Tanner; Beaudry, Christian; Choudhary, Ashish; Sima, Chao; Tibes, Raoul; Mousses, Spyro; Azorsa, David O

    2010-08-18

    Ewing's sarcomas are aggressive musculoskeletal tumors occurring most frequently in the long and flat bones as a solitary lesion mostly during the teen-age years of life. With current treatments, significant number of patients relapse and survival is poor for those with metastatic disease. As part of novel target discovery in Ewing's sarcoma, we applied RNAi mediated phenotypic profiling to identify kinase targets involved in growth and survival of Ewing's sarcoma cells. Four Ewing's sarcoma cell lines TC-32, TC-71, SK-ES-1 and RD-ES were tested in high throughput-RNAi screens using a siRNA library targeting 572 kinases. Knockdown of 25 siRNAs reduced the growth of all four Ewing's sarcoma cell lines in replicate screens. Of these, 16 siRNA were specific and reduced proliferation of Ewing's sarcoma cells as compared to normal fibroblasts. Secondary validation and preliminary mechanistic studies highlighted the kinases STK10 and TNK2 as having important roles in growth and survival of Ewing's sarcoma cells. Furthermore, knockdown of STK10 and TNK2 by siRNA showed increased apoptosis. In summary, RNAi-based phenotypic profiling proved to be a powerful gene target discovery strategy, leading to successful identification and validation of STK10 and TNK2 as two novel potential therapeutic targets for Ewing's sarcoma.

  18. Blood interference in fiber-optical based fluorescence guided resection of glioma using 5-aminolevulinic acid

    NASA Astrophysics Data System (ADS)

    Haj-Hosseini, Neda; Lowndes, Shannely; Salerud, Göran; Wårdell, Karin

    2011-03-01

    Fluorescence guidance in brain tumor resection is performed intra-operatively where bleeding is included. When using fiber-optical probes, the transmission of light to and from the tissue is totally or partially blocked if a small amount of blood appears in front of the probe. Sometimes even after rinsing with saline, the remnant blood cells on the optical probe head, disturb the measurements. In such a case, the corresponding spectrum cannot be reliably quantified and is therefore discarded. The optimal case would be to calculate and take out the blood effect systematically from the collected signals. However, the first step is to study the pattern of blood interference in the fluorescence spectrum. In this study, a fiber-optical based fluorescence spectroscopy system with a laser excitation light of 405 nm (1.4 J/cm2) was used during fluorescence guided brain tumor resection using 5-aminolevulinic acid (5-ALA). The blood interference pattern in the fluorescence spectrum collected from the brain was studied in two patients. The operation situation was modeled in the laboratory by placing blood drops from the finger tip on the skin of forearm and the data was compared to the brain in vivo measurements. Additionally, a theoretical model was developed to simulate the blood interference pattern on the skin autofluorescence. The blood affects the collected fluorescence intensity and leaves traces of oxy and deoxy-hemoglobin absorption peaks. According to the developed theoretical model, the autofluorescence signal is considered to be totally blocked by an approximately 500 μm thick blood layer.

  19. The RDE-10/RDE-11 complex triggers RNAi-induced mRNA degradation by association with target mRNA in C. elegans

    PubMed Central

    Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hau; Florens, Laurence; Mak, Ho Yi

    2012-01-01

    The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans. PMID:22508728

  20. The RDE-10/RDE-11 complex triggers RNAi-induced mRNA degradation by association with target mRNA in C. elegans.

    PubMed

    Yang, Huan; Zhang, Ying; Vallandingham, Jim; Li, Hua; Li, Hau; Florens, Laurence; Mak, Ho Yi

    2012-04-15

    The molecular mechanisms for target mRNA degradation in Caenorhabditis elegans undergoing RNAi are not fully understood. Using a combination of genetic, proteomic, and biochemical approaches, we report a divergent RDE-10/RDE-11 complex that is required for RNAi in C. elegans. Genetic analysis indicates that the RDE-10/RDE-11 complex acts in parallel to nuclear RNAi. Association of the complex with target mRNA is dependent on RDE-1 but not RRF-1, suggesting that target mRNA recognition depends on primary but not secondary siRNA. Furthermore, RDE-11 is required for mRNA degradation subsequent to target engagement. Deep sequencing reveals a fivefold decrease in secondary siRNA abundance in rde-10 and rde-11 mutant animals, while primary siRNA and microRNA biogenesis is normal. Therefore, the RDE-10/RDE-11 complex is critical for amplifying the exogenous RNAi response. Our work uncovers an essential output of the RNAi pathway in C. elegans.

  1. Transcriptional and phenotypic comparisons of Ppara knockout and siRNA knockdown mice

    PubMed Central

    De Souza, Angus T.; Dai, Xudong; Spencer, Andrew G.; Reppen, Tom; Menzie, Ann; Roesch, Paula L.; He, Yudong; Caguyong, Michelle J.; Bloomer, Sherri; Herweijer, Hans; Wolff, Jon A.; Hagstrom, James E.; Lewis, David L.; Linsley, Peter S.; Ulrich, Roger G.

    2006-01-01

    RNA interference (RNAi) has great potential as a tool for studying gene function in mammals. However, the specificity and magnitude of the in vivo response to RNAi remains to be fully characterized. A molecular and phenotypic comparison of a genetic knockout mouse and the corresponding knockdown version would help clarify the utility of the RNAi approach. Here, we used hydrodynamic delivery of small interfering RNA (siRNA) to knockdown peroxisome proliferator activated receptor alpha (Ppara), a gene that is central to the regulation of fatty acid metabolism. We found that Ppara knockdown in the liver results in a transcript profile and metabolic phenotype that is comparable to those of Ppara−/− mice. Combining the profiles from mice treated with the PPARα agonist fenofibrate, we confirmed the specificity of the RNAi response and identified candidate genes proximal to PPARα regulation. Ppara knockdown animals developed hypoglycemia and hypertriglyceridemia, phenotypes observed in Ppara−/− mice. In contrast to Ppara−/− mice, fasting was not required to uncover these phenotypes. Together, these data validate the utility of the RNAi approach and suggest that siRNA can be used as a complement to classical knockout technology in gene function studies. PMID:16945951

  2. D-lactic acid interferes with the effects of platelet activating factor on bovine neutrophils.

    PubMed

    Alarcón, P; Conejeros, I; Carretta, M D; Concha, C; Jara, E; Tadich, N; Hidalgo, M A; Burgos, R A

    2011-11-15

    D-lactic acidosis occurs in ruminants, such as cattle, with acute ruminal acidosis caused by ingestion of excessive amounts of highly fermentable carbohydrates. Affected animals show clinical signs similar to those of septic shock, as well as acute laminitis and liver abscesses. It has been proposed that the inflammatory response and susceptibility to infection could both be caused by the inhibition of phagocytic mechanisms. To determine the effects of d-lactic acid on bovine neutrophil functions, we pretreated cells with different concentrations of D-lactic acid and measured intracellular pH using 2',7'-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) and calcium flux using FLUO-3 AM-loaded neutrophils. Reactive oxygen species (ROS) production was measured using a luminol chemiluminescence assay, and MMP-9/gelatinase-B granule release was measured by zymography. CD11b and CD62L/l-selectin expression, changes in cell shape, superoxide anion production, phagocytosis of Escherichia coli-Texas red bioparticles, and apoptosis were all measured using flow cytometry. Our results demonstrated that D-lactic acid reduced ROS production, CD11b upregulation and MMP-9 release in bovine neutrophils treated with 100 nM platelet-activating factor (PAF). D-lactic acid induced MMP-9 release and, at higher concentrations, upregulated CD11b expression, decrease L-selectin expression, and induces late apoptosis. We concluded that D-lactic acid can interfere with neutrophil functions induced by PAF, leading to reduced innate immune responses during bacterial infections. Moreover, the increase of MMP-9 release and CD11b expression induced by 10mM D-lactic acid could promote an nonspecific neutrophil-dependent inflammatory reaction in cattle with acute ruminal acidosis. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Transmission bottlenecks and RNAi collectively influence tick-borne flavivirus evolution.

    PubMed

    Grubaugh, Nathan D; Rückert, Claudia; Armstrong, Philip M; Bransfield, Angela; Anderson, John F; Ebel, Gregory D; Brackney, Doug E

    2016-07-01

    Arthropod-borne RNA viruses exist within hosts as heterogeneous populations of viral variants and, as a result, possess great genetic plasticity. Understanding the micro-evolutionary forces shaping these viruses can provide insights into how they emerge, adapt, and persist in new and changing ecological niches. While considerable attention has been directed toward studying the population dynamics of mosquito-borne viruses, little is known about tick-borne virus populations. Therefore, using a mouse and Ixodes scapularis tick transmission model, we examined Powassan virus (POWV; Flaviviridae, Flavivirus ) populations in and between both the vertebrate host and arthropod vector. We found that genetic bottlenecks, RNAi-mediated diversification, and selective constraints collectively influence POWV evolution. Together, our data provide a mechanistic explanation for the slow, long-term evolutionary trends of POWV, and suggest that all arthropod-borne viruses encounter similar selective pressures at the molecular level (i.e. RNAi), yet evolve much differently due to their unique rates and modes of transmission.

  4. Lentivirus-mediated RNA interference of vascular endothelial growth factor in monkey eyes with iris neovascularization.

    PubMed

    Yuan, Meng-Ke; Tao, Yong; Yu, Wen-Zhen; Kai, Wang; Jiang, Yan-Rong

    2010-08-25

    To explore the in vivo anti-angiogenesis effects resulting from lentivirus-mediated RNAi of vascular endothelial growth factor (VEGF) in monkeys with iris neovascularization (INV). Five specific recombinant lentiviral vectors for RNA interference, targeting Macaca mulatta VEGFA, were designed and the one with best knock down efficacy (LV-GFP-VEGFi1) in H1299 cells and RF/6A cells was selected by real-time PCR for in vivo use. A laser-induced retinal vein occlusion model was established in one eye of seven cynomolgus monkeys. In monkeys number 1, 3, and 5 (Group 1), the virus (1x10(8) particles) was intravitreally injected into the preretinal space of the animal's eye immediately after laser coagulation; and in monkeys number 2, 4, and 6 (Group 2), the virus (1x10(8) particles) was injected at 10 days after laser coagulation. In monkey number 7, a blank control injection was performed. In monkeys number 1 and 2, virus without RNAi sequence was used; in monkeys number 3 and 4, virus with nonspecific RNAi sequence was used; and in monkeys 5 and 6, LV-GFP-VEGFi1 was used. In monkey number 5, at 23 days after laser treatment, no obvious INV was observed, while fluorescein angiography of the iris revealed high fluorescence at the margin of pupil and point posterior synechiae. At 50 days after laser treatment, only a slight ectropion uvea was found. However, in the other eyes, obvious INV or hyphema was observed. The densities of new iridic vessels all significantly varied: between monkey number 5 and number 3 (36.01+/-4.49/mm(2) versus 48.68+/-9.30/mm(2), p=0.025), between monkey number 3 and monkey number 7 (48.68+/-9.30/mm(2) versus 74.38+/-9.23/mm(2), p=0.002), and between monkey number 5 and number 7 (36.01+/-4.49/mm(2) versus 74.38+/-9.23/mm(2), p<0.001). Lentivirus-mediated RNAi of VEGF may be a new strategy to treat iris neovascularization, while further studies are needed to investigate the long-term effect.

  5. RNAi-directed downregulation of betaine aldehyde dehydrogenase 1 (OsBADH1) results in decreased stress tolerance and increased oxidative markers without affecting glycine betaine biosynthesis in rice (Oryza sativa).

    PubMed

    Tang, Wei; Sun, Jiaqi; Liu, Jia; Liu, Fangfang; Yan, Jun; Gou, Xiaojun; Lu, Bao-Rong; Liu, Yongsheng

    2014-11-01

    As an important osmoprotectant, glycine betaine (GB) plays an essential role in resistance to abiotic stress in a variety of organisms, including rice (Oryza sativa L.). However, GB content is too low to be detectable in rice, although rice genome possesses several orthologs coding for betaine aldehyde dehydrogenase (BADH) involved in plant GB biosynthesis. Rice BADH1 (OsBADH1) has been shown to be targeted to peroxisome and its overexpression resulted in increased GB biosynthesis and tolerance to abiotic stress. In this study, we demonstrated a pivotal role of OsBADH1 in stress tolerance without altering GB biosynthesis capacity, using the RNA interference (RNAi) technique. OsBADH1 was ubiquitously expressed in different organs, including roots, stems, leaves and flowers. Transgenic rice lines downregulating OsBADH1 exhibited remarkably reduced tolerance to NaCl, drought and cold stresses. The decrease of stress tolerance occurring in the OsBADH1-RNAi repression lines was associated with an elevated level of malondialdehyde content and hydrogen peroxidation. No GB accumulation was detected in transgene-positive and transgene-negative lines derived from heterozygous transgenic T0 plants. Moreover, transgenic OsBADH1-RNAi repression lines showed significantly reduced seed set and yield. In conclusion, the downregulation of OsBADH1, even though not causing any change of GB content, was accounted for the reduction of ability to dehydrogenate the accumulating metabolism-derived aldehydes and subsequently resulted in decreased stress tolerance and crop productivity. These results suggest that OsBADH1 possesses an enzyme activity to catalyze other aldehydes in addition to betaine aldehyde (the precursor of GB) and thus alleviate their toxic effects under abiotic stresses.

  6. RNAi-mediated down-regulation of SHATTERPROOF gene in transgenic oilseed rape.

    PubMed

    Kord, Hadis; Shakib, Ali Mohammad; Daneshvar, Mohammad Hossein; Azadi, Pejman; Bayat, Vahid; Mashayekhi, Mohsen; Zarea, Mahboobeh; Seifi, Alireza; Ahmad-Raji, Mana

    2015-06-01

    Oilseed rape is one of the important oil plants. Pod shattering is one of the problems in oilseed rape production especially in regions with dry conditions. One of the important genes in Brassica pod opening is SHATTERPROOF1 (SHP1). Down-regulation of BnSHP1 expression by RNAi can increase resistance to pod shattering. A 470 bp of the BnSHP1 cDNA sequence constructed in an RNAi-silencing vector was transferred to oilseed rape cv. SLM046. Molecular analysis of T2 transgenic plants by RT-PCR and Real-time PCR showed that expression of the BnSHP alleles was highly decreased in comparison with control plants. Morphologically, transgenic plants were normal and produced seeds at greenhouse conditions. At ripening, stage pods failed to shatter, and a finger pressure was needed for pod opening.

  7. Germline Defects Caused by Smed-boule RNA-Interference Reveal That Egg Capsule Deposition Occurs Independently of Fertilization, Ovulation, Mating, or the Presence of Gametes in Planarian Flatworms

    PubMed Central

    Steiner, Jessica Kathryne; Tasaki, Junichi; Rouhana, Labib

    2016-01-01

    Few animals are known to lay eggs in the absence of ovulation or copulation, as it is presumably energetically wasteful and subjected to negative selection. Characterization of Smed-boule, a member of the DAZ family of germline RNA-binding proteins, revealed that egg capsule (or capsule) production and deposition occurs independently of the presence of gametes in the planarian flatworm Schmidtea mediterranea. Reduction of Smed-boule expression by RNA-interference (RNAi) causes ablation of spermatogonial stem cells and the inability of ovarian germline stem cells to undergo oogenesis. Although animals subjected to Smed-boule RNAi lose their gametes and become sterile, they continue to lay egg capsules. Production of sterile capsules is even observed in virgin Smed-boule(RNAi) and control planarians maintained in complete isolation, demonstrating that egg production in S. mediterranea occurs independently of ovulation, fertilization, or mating. Evidence suggests that this is a conserved feature amongst Platyhelminthes, and therefore relevant to the pathology and dissemination of parasitic flatworms. These findings demonstrate that Smed-boule functions at different stages during male and female germline stem cell development, and also demonstrate that egg capsule production by planarian flatworms occurs independently of signals produced by mating or ova. PMID:27149082

  8. RNAi-mediated resistance against Cotton leaf curl disease in elite Indian cotton (Gossypium hirsutum) cultivar Narasimha.

    PubMed

    Khatoon, Sameena; Kumar, Abhinav; Sarin, Neera B; Khan, Jawaid A

    2016-08-01

    Cotton leaf curl disease (CLCuD) is caused by several distinct begomovirus species in association with disease-specific betasatellite essential for induction of disease symptoms. CLCuD is a serious threat for the cultivation of cotton (Gossypium sp.) and several species in the family Malvaceae. In this study, RNAi-based approach was applied to generate transgenic cotton (Gossypium hirsutum) plants resistant to Cotton leaf curl Rajasthan virus (CLCuRV). An intron hairpin (ihp) RNAi construct capable of expressing dsRNA homologous to the intergenic region (IR) of CLCuRV was designed and developed. Following Agrobacterium tumefaciens-mediated transformation of cotton (G. hirsutum cv. Narasimha) plants with the designed ihpRNAi construct, a total of 9 independent lines of transformed cotton were obtained. The presence of the potential stretch of IR in the transformed cotton was confirmed by PCR coupled with Southern hybridization. Upon inoculation with viruliferous whiteflies, the transgenic plants showed high degree of resistance. None of them displayed any CLCuD symptoms even after 90 days post inoculation. The transformed cotton plants showed the presence of siRNAs. The present study demonstrated that ihp dsRNA-mediated resistance strategy of RNAi is an effective means to combat the CLCuD infection in cotton.

  9. Knockdown of OY-TES-1 by RNAi causes cell cycle arrest and migration decrease in bone marrow-derived mesenchymal stem cells.

    PubMed

    Cen, Yan-Hui; Guo, Wen-Wen; Luo, Bin; Lin, Yong-Da; Zhang, Qing-Mei; Zhou, Su-Fang; Luo, Guo-Rong; Xiao, Shao-Wen; Xie, Xiao-Xun

    2012-10-01

    OY-TES-1 is a member of the CTA (cancer-testis antigen) group expressed in a variety of cancer and restrictedly expressed in adult normal tissues, except for testis. To determine whether MSCs (mesenchymal stem cells) express OY-TES-1 and its possible roles on MSCs, OY-TES-1 expression in MSCs isolated from human bone marrow was tested with RT (reverse transcription)-PCR, immunocytochemistry and Western blot. Using RNAi (RNA interference) technology, OY-TES-1 expression was knocked down followed by analysing cell viability, cell cycle, apoptosis and migration ability. MSCs expressed OY-TES-1 at both mRNA and protein levels. The down-regulation of OY-TES-1 expression in these MSCs caused cell growth inhibition, cell cycle arrest, apoptosis induction and migration ability attenuation. Through these primary results it was suggested that OY-TES-1 may influence the biological behaviour of MSCs.

  10. Specific knockdown of Oct4 and beta2-microglobulin expression by RNA interference in human embryonic stem cells and embryonic carcinoma cells.

    PubMed

    Matin, Maryam M; Walsh, James R; Gokhale, Paul J; Draper, Jonathan S; Bahrami, Ahmad R; Morton, Ian; Moore, Harry D; Andrews, Peter W

    2004-01-01

    We have used RNA interference (RNAi) to downregulate beta2-microglobulin and Oct4 in human embryonal carcinoma (hEC) cells and embryonic stem (hES) cells, demonstrating that RNAi is an effective tool for regulating specific gene activity in these human stem cells. The knockdown of Oct4 but not beta2-microglobulin expression in both EC and ES cells resulted in their differentiation, as indicated by a marked change in morphology, growth rate, and surface antigen phenotype, with respect to SSEA1, SSEA3, and TRA-1-60 expression. Expression of hCG and Gcm1 was also induced following knockdown of Oct4 expression, in both 2102Ep hEC cells and in H7 and H14 hES cells, consistent with the conclusion that, as in the mouse, Oct4 is required to maintain the undifferentiated stem cell state, and that differentiation to trophectoderm occurs in its absence. NTERA2 hEC cells also differentiated, but not to trophectoderm, suggesting their equivalence to a later stage of embryogenesis than other hEC and hES cells.

  11. Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

    PubMed

    Chen, Y; Redinbaugh, M G; Michel, A P

    2015-06-01

    Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control. © 2015 The Royal Entomological Society.

  12. In vivo RNAi in the Drosophila Follicular Epithelium: Analysis of Stem Cell Maintenance, Proliferation, and Differentiation.

    PubMed

    Riechmann, Veit

    2017-01-01

    In vivo RNAi in Drosophila facilitates simple and rapid analysis of gene functions in a cell- or tissue-specific manner. The versatility of the UAS-GAL4 system allows to control exactly where and when during development the function of a gene is depleted. The epithelium of the ovary is a particularly good model to study in a living animal how stem cells are maintained and how their descendants proliferate and differentiate. Here I provide basic information about the publicly available reagents for in vivo RNAi, and I describe how the oogenesis system can be applied to analyze stem cells and epithelial development at a histological level. Moreover, I give helpful hints to optimize the use of the UAS-GAL4 system for RNAi induction in the follicular epithelium. Finally, I provide detailed step-by-step protocols for ovary dissection, antibody stainings, and ovary mounting for microscopic analysis.

  13. Comparison of Dengue Virus Type 2-Specific Small RNAs from RNA Interference-Competent and –Incompetent Mosquito Cells

    PubMed Central

    Scott, Jaclyn C.; Brackney, Doug E.; Campbell, Corey L.; Bondu-Hawkins, Virginie; Hjelle, Brian; Ebel, Greg D.; Olson, Ken E.; Blair, Carol D.

    2010-01-01

    The exogenous RNA interference (RNAi) pathway is an important antiviral defense against arboviruses in mosquitoes, and virus-specific small interfering (si)RNAs are key components of this pathway. Understanding the biogenesis of siRNAs in mosquitoes could have important ramifications in using RNAi to control arbovirus transmission. Using deep sequencing technology, we characterized dengue virus type 2 (DENV2)-specific small RNAs produced during infection of Aedes aegypti mosquitoes and A. aegypti Aag2 cell cultures and compared them to those produced in the C6/36 Aedes albopictus cell line. We show that the size and mixed polarity of virus-specific small RNAs from DENV-infected A. aegypti cells indicate that they are products of Dicer-2 (Dcr2) cleavage of long dsRNA, whereas C6/36 cells generate DENV2-specific small RNAs that are longer and predominantly positive polarity, suggesting that they originate from a different small RNA pathway. Examination of virus-specific small RNAs after infection of the two mosquito cell lines with the insect-only flavivirus cell fusing agent virus (CFAV) corroborated these findings. An in vitro assay also showed that Aag2 A. aegypti cells are capable of siRNA production, while C6/36 A. albopictus cells exhibit inefficient Dcr2 cleavage of long dsRNA. Defective expression or function of Dcr2, the key initiator of the RNAi pathway, might explain the comparatively robust growth of arthropod-borne viruses in the C6/36 cell line, which has been used frequently as a surrogate for studying molecular interactions between arboviruses and cells of their mosquito hosts. PMID:21049014

  14. RNAi knockdown of the focal adhesion protein TES reveals its role in actin stress fibre organisation.

    PubMed

    Griffith, Elen; Coutts, Amanda S; Black, Donald M

    2005-03-01

    TES was originally identified as a candidate tumour suppressor gene and has subsequently been found to encode a novel focal adhesion protein. As well as localising to cell-matrix adhesions, TES localises to cell-cell contacts and to actin stress fibres. TES interacts with a variety of cytoskeletal proteins including zyxin, mena, VASP, talin and actin. There is evidence that TES may function in actin-dependent processes as overexpression of TES results in increased cell spreading and decreased cell motility. Together with TES's interacting partners, these data suggest that TES might be involved in regulation of the actin cytoskeleton. Here, for the first time, we have used RNAi to successfully knockdown TES in HeLa cells and we demonstrate that loss of TES from focal adhesions results in loss of actin stress fibres. Similarly, and as previously reported, RNAi-mediated knockdown of zyxin results in loss of actin stress fibres. TES siRNA treated cells show reduced RhoA activity, suggesting that the Rho GTPase pathway may be involved in the TES RNAi-induced loss of stress fibres. We have also used RNAi to examine the requirement of TES and zyxin for each other's localisation at focal adhesions, and we propose a hierarchy of recruitment, with zyxin being first, followed by VASP and then TES. Cell Motil. Copyright 2005 Wiley-Liss, Inc.

  15. Double-stranded RNA Oral Delivery Methods to Induce RNA Interference in Phloem and Plant-sap-feeding Hemipteran Insects.

    PubMed

    Ghosh, Saikat Kumar B; Hunter, Wayne B; Park, Alexis L; Gundersen-Rindal, Dawn E

    2018-05-04

    Phloem and plant sap feeding insects invade the integrity of crops and fruits to retrieve nutrients, in the process damaging food crops. Hemipteran insects account for a number of economically substantial pests of plants that cause damage to crops by feeding on phloem sap. The brown marmorated stink bug (BMSB), Halyomorpha halys (Heteroptera: Pentatomidae) and the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Liviidae) are hemipteran insect pests introduced in North America, where they are an invasive agricultural pest of high-value specialty, row, and staple crops and citrus fruits, as well as a nuisance pest when they aggregate indoors. Insecticide resistance in many species has led to the development of alternate methods of pest management strategies. Double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) is a gene silencing mechanism for functional genomic studies that has potential applications as a tool for the management of insect pests. Exogenously synthesized dsRNA or small interfering RNA (siRNA) can trigger highly efficient gene silencing through the degradation of endogenous RNA, which is homologous to that presented. Effective and environmental use of RNAi as molecular biopesticides for biocontrol of hemipteran insects requires the in vivo delivery of dsRNAs through feeding. Here we demonstrate methods for delivery of dsRNA to insects: loading of dsRNA into green beans by immersion, and absorbing of gene-specific dsRNA with oral delivery through ingestion. We have also outlined non-transgenic plant delivery approaches using foliar sprays, root drench, trunk injections as well as clay granules, all of which may be essential for sustained release of dsRNA. Efficient delivery by orally ingested dsRNA was confirmed as an effective dosage to induce a significant decrease in expression of targeted genes, such as juvenile hormone acid O-methyltransferase (JHAMT) and vitellogenin (Vg). These innovative methods represent strategies for

  16. Dissociation of Paramyxovirus Interferon Evasion Activities: Universal and Virus-Specific Requirements for Conserved V Protein Amino Acids in MDA5 Interference

    PubMed Central

    Ramachandran, Aparna; Horvath, Curt M.

    2010-01-01

    The V protein of the paramyxovirus subfamily Paramyxovirinae is an important virulence factor that can interfere with host innate immunity by inactivating the cytosolic pathogen recognition receptor MDA5. This interference is a result of a protein-protein interaction between the highly conserved carboxyl-terminal domain of the V protein and the helicase domain of MDA5. The V protein C-terminal domain (CTD) is an evolutionarily conserved 49- to 68-amino-acid region that coordinates two zinc atoms per protein chain. Site-directed mutagenesis of conserved residues in the V protein CTD has revealed both universal and virus-specific requirements for zinc coordination in MDA5 engagement and has also identified other conserved residues as critical for MDA5 interaction and interference. Mutation of these residues produces V proteins that are specifically defective for MDA5 interference and not impaired in targeting STAT1 for proteasomal degradation via the VDC ubiquitin ligase complex. Results demonstrate that mutation of conserved charged residues in the V proteins of Nipah virus, measles virus, and mumps virus also abolishes MDA5 interaction. These findings clearly define molecular determinants for MDA5 inhibition by the paramyxovirus V proteins. PMID:20719949

  17. Natural and Unanticipated Modifiers of RNAi Activity in Caenorhabditis elegans

    PubMed Central

    Asad, Nadeem; Aw, Wen Yih; Timmons, Lisa

    2012-01-01

    Organisms used as model genomics systems are maintained as isogenic strains, yet evidence of sequence differences between independently maintained wild-type stocks has been substantiated by whole-genome resequencing data and strain-specific phenotypes. Sequence differences may arise from replication errors, transposon mobilization, meiotic gene conversion, or environmental or chemical assault on the genome. Low frequency alleles or mutations with modest effects on phenotypes can contribute to natural variation, and it has proven possible for such sequences to become fixed by adapted evolutionary enrichment and identified by resequencing. Our objective was to identify and analyze single locus genetic defects leading to RNAi resistance in isogenic strains of Caenorhabditis elegans. In so doing, we uncovered a mutation that arose de novo in an existing strain, which initially frustrated our phenotypic analysis. We also report experimental, environmental, and genetic conditions that can complicate phenotypic analysis of RNAi pathway defects. These observations highlight the potential for unanticipated mutations, coupled with genetic and environmental phenomena, to enhance or suppress the effects of known mutations and cause variation between wild-type strains. PMID:23209671

  18. Pre-clinical Safety and Off-Target Studies to Support Translation of AAV-Mediated RNAi Therapy for FSHD.

    PubMed

    Wallace, Lindsay M; Saad, Nizar Y; Pyne, Nettie K; Fowler, Allison M; Eidahl, Jocelyn O; Domire, Jacqueline S; Griffin, Danielle A; Herman, Adam C; Sahenk, Zarife; Rodino-Klapac, Louise R; Harper, Scott Q

    2018-03-16

    RNAi emerged as a prospective molecular therapy nearly 15 years ago. Since then, two major RNAi platforms have been under development: oligonucleotides and gene therapy. Oligonucleotide-based approaches have seen more advancement, with some promising therapies that may soon reach market. In contrast, vector-based approaches for RNAi therapy have remained largely in the pre-clinical realm, with limited clinical safety and efficacy data to date. We are developing a gene therapy approach to treat the autosomal-dominant disorder facioscapulohumeral muscular dystrophy. Our strategy involves silencing the myotoxic gene DUX4 using adeno-associated viral vectors to deliver targeted microRNA expression cassettes (miDUX4s). We previously demonstrated proof of concept for this approach in mice, and we are now taking additional steps here to assess safety issues related to miDUX4 overexpression and sequence-specific off-target silencing. In this study, we describe improvements in vector design and expansion of our miDUX4 sequence repertoire and report differential toxicity elicited by two miDUX4 sequences, of which one was toxic and the other was not. This study provides important data to help advance our goal of translating RNAi gene therapy for facioscapulohumeral muscular dystrophy.

  19. Neuron-specific feeding RNAi in C. elegans and its use in a screen for essential genes required for GABA neuron function.

    PubMed

    Firnhaber, Christopher; Hammarlund, Marc

    2013-11-01

    Forward genetic screens are important tools for exploring the genetic requirements for neuronal function. However, conventional forward screens often have difficulty identifying genes whose relevant functions are masked by pleiotropy. In particular, if loss of gene function results in sterility, lethality, or other severe pleiotropy, neuronal-specific functions cannot be readily analyzed. Here we describe a method in C. elegans for generating cell-specific knockdown in neurons using feeding RNAi and its application in a screen for the role of essential genes in GABAergic neurons. We combine manipulations that increase the sensitivity of select neurons to RNAi with manipulations that block RNAi in other cells. We produce animal strains in which feeding RNAi results in restricted gene knockdown in either GABA-, acetylcholine-, dopamine-, or glutamate-releasing neurons. In these strains, we observe neuron cell-type specific behavioral changes when we knock down genes required for these neurons to function, including genes encoding the basal neurotransmission machinery. These reagents enable high-throughput, cell-specific knockdown in the nervous system, facilitating rapid dissection of the site of gene action and screening for neuronal functions of essential genes. Using the GABA-specific RNAi strain, we screened 1,320 RNAi clones targeting essential genes on chromosomes I, II, and III for their effect on GABA neuron function. We identified 48 genes whose GABA cell-specific knockdown resulted in reduced GABA motor output. This screen extends our understanding of the genetic requirements for continued neuronal function in a mature organism.

  20. DISE: A Seed-Dependent RNAi Off-Target Effect That Kills Cancer Cells.

    PubMed

    Putzbach, William; Gao, Quan Q; Patel, Monal; Haluck-Kangas, Ashley; Murmann, Andrea E; Peter, Marcus E

    2018-01-01

    Off-target effects (OTEs) represent a significant caveat for RNAi caused by substantial complementarity between siRNAs and unintended mRNAs. We now discuss the existence of three types of seed-dependent OTEs (sOTEs). Type I involves unintended targeting through the guide strand seed of an siRNA. Type II is caused by the activity of the seed on the designated siRNA passenger strand when loaded into the RNA-induced silencing complex (RISC). Both type I and II sOTEs will elicit unpredictable cellular responses. By contrast, in sOTE type III the guide strand seed preferentially targets essential survival genes resulting in death induced by survival gene elimination (DISE). In this Opinion article, we discuss DISE as a consequence of RNAi that may preferentially affect cancer cells. Copyright © 2017 Elsevier Inc. All rights reserved.