Science.gov

Sample records for acid methyltransferase gene

  1. Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode

    USDA-ARS?s Scientific Manuscript database

    Salicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in s...

  2. Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode.

    PubMed

    Lin, Jingyu; Mazarei, Mitra; Zhao, Nan; Zhu, Junwei J; Zhuang, Xiaofeng; Liu, Wusheng; Pantalone, Vincent R; Arelli, Prakash R; Stewart, Charles N; Chen, Feng

    2013-12-01

    Salicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in soybean defence against soybean cyst nematode (Heterodera glycines Ichinohe, SCN). GmSAMT1 was identified as a candidate SCN defence-related gene in our previous analysis of soybean defence against SCN using GeneChip microarray experiments. The current study started with the isolation of the full-length cDNAs of GmSAMT1 from a SCN-resistant soybean line and from a SCN-susceptible soybean line. The two cDNAs encode proteins of identical sequences. The GmSAMT1 cDNA was expressed in Escherichia coli. Using in vitro enzyme assays, E. coli-expressed GmSAMT1 was confirmed to function as salicylic acid methyltransferase. The apparent Km value of GmSAMT1 for salicylic acid was approximately 46 μM. To determine the role of GmSAMT1 in soybean defence against SCN, transgenic hairy roots overexpressing GmSAMT1 were produced and tested for SCN resistance. Overexpression of GmSAMT1 in SCN-susceptible backgrounds significantly reduced the development of SCN, indicating that overexpression of GmSAMT1 in the transgenic hairy root system could confer resistance to SCN. Overexpression of GmSAMT1 in transgenic hairy roots was also found to affect the expression of selected genes involved in salicylic acid biosynthesis and salicylic acid signal transduction.

  3. Molecular and biochemical characterization of the jasmonic acid methyltransferase gene from black cottonwood (Populus trichocarpa)

    SciTech Connect

    Zhao, Nan; Yao, Jianzhuang; Chaiprasongsuk, Minta; Li, Guanglin; Guan, Ju; Tschaplinski, Timothy J; Guo, Hong; Chen, Feng

    2013-01-01

    Methyl jasmonate is a metabolite known to be produced by many plants and has roles in diverse biological processes. It is biosynthesized by the action of S-adenosyl-L-methionine:jasmonic acid carboxyl methyltransferase (JMT), which belongs to the SABATH family of methyltransferases. Herein is reported the isolation and biochemical characterization of a JMT gene from black cottonwood (Populus trichocarpa). The genome of P. trichocarpa contains 28 SABATH genes (PtSABATH1 to PtSABATH28). Recombinant PtSABATH3 expressed in Escherichia coli showed the highest level of activity with jasmonic acid (JA) among carboxylic acids tested. It was therefore renamed PtJMT1. PtJMT1 also displayed activity with benzoic acid (BA), with which the activity was about 22% of that with JA. PtSABATH2 and PtSABATH4 were most similar to PtJMT1 among all PtSABATHs. However, neither of them had activity with JA. The apparent Km values of PtJMT1 using JA and BA as substrate were 175 lM and 341 lM, respectively. Mutation of Ser-153 and Asn-361, two residues in the active site of PtJMT1, to Tyr and Ser respectively, led to higher specific activity with BA than with JA. Homology-based structural modeling indicated that substrate alignment, in which Asn-361 is involved, plays a role in determining the substrate specificity of PtJMT1. In the leaves of young seedlings of black cottonwood, the expression of PtJMT1 was induced by plant defense signal molecules methyl jasmonate and salicylic acid and a fungal elicitor alamethicin, suggesting that PtJMT1 may have a role in plant defense against biotic stresses. Phylogenetic analysis suggests that PtJMT1 shares a common ancestor with the Arabidopsis JMT, and functional divergence of these two apparent JMT orthologs has occurred since the split of poplar and Arabidopsis lineages.

  4. Phylogenetic, Molecular, and Biochemical Characterization of Caffeic Acid o-Methyltransferase Gene Family in Brachypodium distachyon

    PubMed Central

    Wu, Xianting; Wu, Jiajie; Luo, Yangfan; Bragg, Jennifer; Anderson, Olin; Vogel, John; Gu, Yong Q.

    2013-01-01

    Caffeic acid o-methyltransferase (COMT) is one of the important enzymes controlling lignin monomer production in plant cell wall synthesis. Analysis of the genome sequence of the new grass model Brachypodium distachyon identified four COMT gene homologs, designated as BdCOMT1, BdCOMT2, BdCOMT3, and BdCOMT4. Phylogenetic analysis suggested that they belong to the COMT gene family, whereas syntenic analysis through comparisons with rice and sorghum revealed that BdCOMT4 on Chromosome 3 is the orthologous copy of the COMT genes well characterized in other grass species. The other three COMT genes are unique to Brachypodium since orthologous copies are not found in the collinear regions of rice and sorghum genomes. Expression studies indicated that all four Brachypodium COMT genes are transcribed but with distinct patterns of tissue specificity. Full-length cDNAs were cloned in frame into the pQE-T7 expression vector for the purification of recombinant Brachypodium COMT proteins. Biochemical characterization of enzyme activity and substrate specificity showed that BdCOMT4 has significant effect on a broad range of substrates with the highest preference for caffeic acid. The other three COMTs had low or no effect on these substrates, suggesting that a diversified evolution occurred on these duplicate genes that not only impacted their pattern of expression, but also altered their biochemical properties. PMID:23431288

  5. Molecular and biochemical characterization of the jasmonic acid methyltransferase gene from black cottonwood (Populus trichocarpa).

    PubMed

    Zhao, Nan; Yao, Jianzhuang; Chaiprasongsuk, Minta; Li, Guanglin; Guan, Ju; Tschaplinski, Timothy J; Guo, Hong; Chen, Feng

    2013-10-01

    Methyl jasmonate is a metabolite known to be produced by many plants and has roles in diverse biological processes. It is biosynthesized by the action of S-adenosyl-l-methionine:jasmonic acid carboxyl methyltransferase (JMT), which belongs to the SABATH family of methyltransferases. Herein is reported the isolation and biochemical characterization of a JMT gene from black cottonwood (Populus trichocarpa). The genome of P. trichocarpa contains 28 SABATH genes (PtSABATH1 to PtSABATH28). Recombinant PtSABATH3 expressed in Escherichia coli showed the highest level of activity with jasmonic acid (JA) among carboxylic acids tested. It was therefore renamed PtJMT1. PtJMT1 also displayed activity with benzoic acid (BA), with which the activity was about 22% of that with JA. PtSABATH2 and PtSABATH4 were most similar to PtJMT1 among all PtSABATHs. However, neither of them had activity with JA. The apparent Km values of PtJMT1 using JA and BA as substrate were 175μM and 341μM, respectively. Mutation of Ser-153 and Asn-361, two residues in the active site of PtJMT1, to Tyr and Ser respectively, led to higher specific activity with BA than with JA. Homology-based structural modeling indicated that substrate alignment, in which Asn-361 is involved, plays a role in determining the substrate specificity of PtJMT1. In the leaves of young seedlings of black cottonwood, the expression of PtJMT1 was induced by plant defense signal molecules methyl jasmonate and salicylic acid and a fungal elicitor alamethicin, suggesting that PtJMT1 may have a role in plant defense against biotic stresses. Phylogenetic analysis suggests that PtJMT1 shares a common ancestor with the Arabidopsis JMT, and functional divergence of these two apparent JMT orthologs has occurred since the split of poplar and Arabidopsis lineages. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Down-regulation of the caffeic acid O-methyltransferase gene in switchgrass reveals a novel monolignol analog

    PubMed Central

    2012-01-01

    Background Down-regulation of the caffeic acid 3-O-methyltransferase EC 2.1.1.68 (COMT) gene in the lignin biosynthetic pathway of switchgrass (Panicum virgatum) resulted in cell walls of transgenic plants releasing more constituent sugars after pretreatment by dilute acid and treatment with glycosyl hydrolases from an added enzyme preparation and from Clostridium thermocellum. Fermentation of both wild-type and transgenic switchgrass after milder hot water pretreatment with no water washing showed that only the transgenic switchgrass inhibited C. thermocellum. Gas chromatography–mass spectrometry (GCMS)-based metabolomics were undertaken on cell wall aqueous extracts to determine the nature of the microbial inhibitors. Results GCMS confirmed the increased concentration of a number of phenolic acids and aldehydes that are known inhibitors of microbial fermentation. Metabolomic analyses of the transgenic biomass additionally revealed the presence of a novel monolignol-like metabolite, identified as trans-3, 4-dimethoxy-5-hydroxycinnamyl alcohol (iso-sinapyl alcohol) in both non-pretreated, as well as hot water pretreated samples. iso-Sinapyl alcohol and its glucoside were subsequently generated by organic synthesis and the identity of natural and synthetic materials were confirmed by mass spectrometric and NMR analyses. The additional novel presence of iso-sinapic acid, iso-sinapyl aldehyde, and iso-syringin suggest the increased activity of a para-methyltransferase, concomitant with the reduced COMT activity, a strict meta-methyltransferase. Quantum chemical calculations were used to predict the most likely homodimeric lignans generated from dehydration reactions, but these products were not evident in plant samples. Conclusions Down-regulation of COMT activity in switchgrass resulted in the accumulation of previously undetected metabolites resembling sinapyl alcohol and its related metabolites, but that are derived from para-methylation of 5-hydroxyconiferyl

  7. Cloning and characterization of a benzoic acid/salicylic acid carboxyl methyltransferase gene involved in floral scent production from lily (Lilium 'Yelloween').

    PubMed

    Wang, H; Sun, M; Li, L L; Xie, X H; Zhang, Q X

    2015-11-19

    In lily flowers, the volatile ester methyl benzoate is one of the major and abundant floral scent compounds; however, knowledge regarding the biosynthesis of methyl benzoate remains unknown for Lilium. In this study, we isolated a benzoic acid/salicylic acid carboxyl methyltransferase (BSMT) gene, LiBSMT, from petals of Lilium 'Yelloween'. The gene has an open reading frame of 1083 base pairs (bp) and encodes a protein of 41.05 kDa. Sequence alignment and phylogenetic analyses of LiBSMT revealed 40-50% similarity with other known benzenoid carboxyl methyltransferases in other plant species, and revealed homology to BSMT of Oryza sativa. Heterologous expression of this gene in Escherichia coli yielded an enzyme responsible for catalyzing benzoic acid and salicylic acid to methyl benzoate and methyl salicylate, respectively. Quantitative real-time polymerase chain reaction analysis showed that LiBSMT was preferentially expressed in petals. Moreover, the expression of LiBSMT in petals was developmentally regulated. These expression patterns correlate well with the emission of methyl benzoate. Our results indicate that LiBSMT plays an important role in floral scent methyl benzoate production and emission in lily flowers.

  8. Down-regulation of the Caffeic acid O-methyltransferase Gene in Switchgrass Reveals a Novel Monolignol Analog

    SciTech Connect

    Tschaplinski, Timothy J; Standaert, Robert F; Engle, Nancy L; Martin, Madhavi Z; Sangha, Amandeep K; Parks, Jerry M; Smith, Jeremy C; Samuel, Reichel; Pu, Yunqiao; Ragauskas, A J; Hamilton, Choo Yieng; Fu, Chunxiang; Wang, Zeng-Yu; Davison, Brian H; Dixon, Richard A; Mielenz, Jonathan R

    2012-01-01

    Down-regulation of the caffeic acid 3-O-methyltransferase (COMT) gene in the lignin biosynthetic pathway of switchgrass (Panicum virgatum) resulted in cell walls of transgenic plants releasing more constituent sugars after pretreatment by dilute acid and treatment with glycosyl hydrolases from an added enzyme preparation and from Clostridium thermocellum. Fermentation of both wild-type and transgenic switchgrass after milder hot water pretreatment with no water washing showed that only the transgenic switchgrass inhibited C. thermocellum. Gas chromatography-mass spectrometry-based metabolomics were undertaken on cell wall aqueous extracts to determine the nature of the microbial inhibitors, confirming the increased concentration of a number of phenolic acids and aldehydes that are known inhibitors of fermentation. Metabolomic analyses of the transgenic biomass additionally revealed the presence of a novel monolignol-like metabolite, identified as trans-3, 4-dimethoxy-5-hydroxycinnamyl alcohol (iso-sinapyl alcohol) in both non-pretreated, as well as hot water pretreated samples. Although there was no indication that iso-sinapyl alcohol was integrated into the cell wall, diversion of substrates from sinapyl alcohol to free iso-sinapyl alcohol, its glucoside, and associated upstream lignin pathway changes, including increased phenolic aldehydes and acids, are associated with more facile cell wall deconstruction, and to the observed inhibitory effect on microbial growth.

  9. Acid detergent lignin, lodging resistance index, and expression of the caffeic acid O-methyltransferase gene in brown midrib-12 sudangrass.

    PubMed

    Li, Yuan; Liu, Guibo; Li, Jun; You, Yongliang; Zhao, Haiming; Liang, Huan; Mao, Peisheng

    2015-09-01

    Understanding the relationship between acid detergent lignin (ADL) and lodging resistance index (LRI) is essential for breeding new varieties of brown midrib (bmr) sudangrass (Sorghum sudanense (Piper) Stapf.). In this study, bmr-12 near isogenic lines and their wild-types obtained by back cross breeding were used to compare relevant forage yield and quality traits, and to analyze expression of the caffeic acid O-methyltransferase (COMT) gene using quantitative real time-PCR. The research showed that the mean ADL content of bmr-12 mutants (20.94 g kg(-1)) was significantly (P < 0.05) lower than measured in N-12 lines (43.45 g kg(-1)), whereas the LRI of bmr-12 mutants (0.29) was significantly (P < 0.05) higher than in N-12 lines (0.22). There was no significant correlation between the two indexes in bmr-12 materials (r = -0.44, P > 0.05). Sequence comparison of the COMT gene revealed two point mutations present in bmr-12 but not in the wild-type, the second mutation changed amino acid 129 of the protein from Gln (CAG) to a stop codon (UAG). The relative expression level of COMT gene was significantly reduced, which likely led to the decreased ADL content observed in the bmr-12 mutant.

  10. Stress Responses in Alfalfa (XXI. Activation of Caffeic Acid 3-O-Methyltransferase and Caffeoyl Coenzyme A 3-O-Methyltransferase Genes Does Not Contribute to Changes in Metabolite Accumulation in Elicitor-Treated Cell-Suspension Cultures).

    PubMed Central

    Ni, W.; Sewalt, VJH.; Korth, K. L.; Blount, J. W.; Ballance, G. M.; Dixon, R. A.

    1996-01-01

    Transcription of genes encoding L-phenylalanine ammonia-lyase (PAL), the first enzyme of the phenylpropanoid pathway, and caffeic acid 3-O-methyltransferase (COMT) and caffeoyl CoA 3-O-methyltransferase (CCOMT), enzymes involved in the synthesis of lignin and wall-esterified phenolic compounds, was strongly activated in elicitor-treated cell-suspension cultures of alfalfa (Medicago sativa L.). However, consequent changes in the extractable activities of COMT and CCOMT were small to nonexistent compared with a 15- to 16-fold increase in PAL activity. Only low levels of COMT and CCOMT transcripts were reflected in the total and polysomal RNA fractions compared with PAL transcripts. Elicited cell cultures did not accumulate lignin or the products of COMT and CCOMT in the soluble and wall-esterified phenolic fractions. In one alfalfa cell line in which elicitation resulted in very high PAL activity and increased deposition of methoxyl groups in the insoluble wall fraction, there was still no change in COMT and CCOMT activities. Overall, these results indicate that the initial gene transcription events in elicited cells may be less selective than the subsequent metabolic changes, highlighting the importance of posttranscriptional events in the control of phenylpropanoid biosynthesis. PMID:12226420

  11. Functional Analyses of Caffeic Acid O-Methyltransferase and Cinnamoyl-CoA-Reductase Genes from Perennial Ryegrass (Lolium perenne)[W

    PubMed Central

    Tu, Yi; Rochfort, Simone; Liu, Zhiqian; Ran, Yidong; Griffith, Megan; Badenhorst, Pieter; Louie, Gordon V.; Bowman, Marianne E.; Smith, Kevin F.; Noel, Joseph P.; Mouradov, Aidyn; Spangenberg, German

    2010-01-01

    Cinnamoyl CoA-reductase (CCR) and caffeic acid O-methyltransferase (COMT) catalyze key steps in the biosynthesis of monolignols, which serve as building blocks in the formation of plant lignin. We identified candidate genes encoding these two enzymes in perennial ryegrass (Lolium perenne) and show that the spatio-temporal expression patterns of these genes in planta correlate well with the developmental profile of lignin deposition. Downregulation of CCR1 and caffeic acid O-methyltransferase 1 (OMT1) using an RNA interference–mediated silencing strategy caused dramatic changes in lignin level and composition in transgenic perennial ryegrass plants grown under both glasshouse and field conditions. In CCR1-deficient perennial ryegrass plants, metabolic profiling indicates the redirection of intermediates both within and beyond the core phenylpropanoid pathway. The combined results strongly support a key role for the OMT1 gene product in the biosynthesis of both syringyl- and guaiacyl-lignin subunits in perennial ryegrass. Both field-grown OMT1-deficient and CCR1-deficient perennial ryegrass plants showed enhanced digestibility without obvious detrimental effects on either plant fitness or biomass production. This highlights the potential of metabolic engineering not only to enhance the forage quality of grasses but also to produce optimal feedstock plants for biofuel production. PMID:20952635

  12. Nucleotide sequence of a Pseudomonas denitrificans 5.4-kilobase DNA fragment containing five cob genes and identification of structural genes encoding S-adenosyl-L-methionine: uroporphyrinogen III methyltransferase and cobyrinic acid a,c-diamide synthase.

    PubMed Central

    Crouzet, J; Cauchois, L; Blanche, F; Debussche, L; Thibaut, D; Rouyez, M C; Rigault, S; Mayaux, J F; Cameron, B

    1990-01-01

    A 5.4-kilobase DNA fragment carrying Pseudomonas denitrificans cob genes has been sequenced. The nucleotide sequence and genetic analysis revealed that this fragment carries five different cob genes (cobA to cobE). Four of these genes present the characteristics of translationally coupled genes. cobA has been identified as the structural gene of S-adenosyl-L-methionine:uroporphyrinogen III methyltransferase (SUMT) because the encoded protein has the same NH2 terminus and molecular weight as those determined for the purified SUMT. For the same reasons the cobB gene was shown to be the structural gene for cobyrinic acid a,c-diamide synthase. Genetic and biochemical data concerning cobC and cobD mutants suggest that the products of these genes are involved in the conversion of cobyric acid to cobinamide. PMID:2211520

  13. Comparative analysis of chemical compositions between non-transgenic soybean seeds and those from plants over-expressing AtJMT, the gene for jasmonic acid carboxyl methyltransferase.

    PubMed

    Nam, Kyong-Hee; Kim, Do Young; Pack, In-Soon; Park, Jung-Ho; Seo, Jun Sung; Choi, Yang Do; Cheong, Jong-Joo; Kim, Chung Ho; Kim, Chang-Gi

    2016-04-01

    Transgenic overexpression of the Arabidopsis gene for jasmonic acid carboxyl methyltransferase (AtJMT) is involved in regulating jasmonate-related plant responses. To examine its role in the compositional profile of soybean (Glycine max), we compared the seeds from field-grown plants that over-express AtJMT with those of the non-transgenic, wild-type (WT) counterpart. Our analysis of chemical compositions included proximates, amino acids, fatty acids, isoflavones, and antinutrients. Overexpression of AtJMT in the seeds resulted in decreased amounts of tryptophan, palmitic acid, linolenic acid, and stachyose, but increased levels of gadoleic acid and genistein. In particular, seeds from the transgenic soybeans contained 120.0-130.5% more genistein and 60.5-82.1% less stachyose than the WT. A separate evaluation of ingredient values showed that all were within the reference ranges reported for commercially available soybeans, thereby demonstrating the substantial equivalence of these transgenic and non-transgenic seeds. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. An Arabidopsis thaliana methyltransferase Capable of Methylating Farnesoic Acid

    SciTech Connect

    Yang,Y.; Yuan, J.; Ross, J.; Noel, J.; Pichersky, E.

    2006-01-01

    We previously reported the identification of a new family of plant methyltransferases (MTs), named the SABATH family, that use S-adenosyl-l-methionine (SAM) to methylate a carboxyl moiety or a nitrogen-containing functional group on a diverse array of plant compounds. The Arabidopsis genome alone contains 24 distinct SABATH genes. To identify the catalytic specificities of members of this protein family in Arabidopsis, we screened recombinantly expressed and purified enzymes with a large number of potential substrates. Here, we report that the Arabidopsis thaliana gene At3g44860 encodes a protein with high catalytic specificity towards farnesoic acid (FA). Under steady-state conditions, this farnesoic acid carboxyl methyltransferase (FAMT) exhibits K{sub M} values of 41 and 71 {mu}M for FA and SAM, respectively. A three-dimensional model of FAMT constructed based upon similarity to the experimentally determined structure of Clarkia breweri salicylic acid methyltransferase (SAMT) suggests a reasonable model for FA recognition in the FAMT active site. In plants, the mRNA levels of At3g44860 increase in response to the exogenous addition of several compounds previously shown to induce plant defense responses at the transcriptional level. Although methyl farnesoate (MeFA) has not yet been detected in Arabidopsis, the presence of a FA-specific carboxyl methyltransferase in Arabidopsis capable of producing MeFA, an insect juvenile hormone made by some plants as a presumed defense against insect herbivory, suggests that MeFA or chemically similar compounds are likely to serve as new specialized metabolites in Arabidopsis.

  15. Cloning and Phylogenetic Analysis of Brassica napus L. Caffeic Acid O-Methyltransferase 1 Gene Family and Its Expression Pattern under Drought Stress

    PubMed Central

    Lu, Kun; Yuan, Jianglian; Huang, Jieheng; Du, Hai; Li, Jiana

    2016-01-01

    For many plants, regulating lignin content and composition to improve lodging resistance is a crucial issue. Caffeic acid O-methyltransferase (COMT) is a lignin monomer-specific enzyme that controls S subunit synthesis in plant vascular cell walls. Here, we identified 12 BnCOMT1 gene homologues, namely BnCOMT1-1 to BnCOMT1-12. Ten of 12 genes were composed of four highly conserved exons and three weakly conserved introns. The length of intron I, in particular, showed enormous diversification. Intron I of homologous BnCOMT1 genes showed high identity with counterpart genes in Brassica rapa and Brassica oleracea, and intron I from positional close genes in the same chromosome were relatively highly conserved. A phylogenetic analysis suggested that COMT genes experience considerable diversification and conservation in Brassicaceae species, and some COMT1 genes are unique in the Brassica genus. Our expression studies indicated that BnCOMT1 genes were differentially expressed in different tissues, with BnCOMT1-4, BnCOMT1-5, BnCOMT1-8, and BnCOMT1-10 exhibiting stem specificity. These four BnCOMT1 genes were expressed at all developmental periods (the bud, early flowering, late flowering and mature stages) and their expression level peaked in the early flowering stage in the stem. Drought stress augmented and accelerated lignin accumulation in high-lignin plants but delayed it in low-lignin plants. The expression levels of BnCOMT1s were generally reduced in water deficit condition. The desynchrony of the accumulation processes of total lignin and BnCOMT1s transcripts in most growth stages indicated that BnCOMT1s could be responsible for the synthesis of a specific subunit of lignin or that they participate in other pathways such as the melatonin biosynthesis pathway. PMID:27832102

  16. Homocysteine homeostasis in the rat is maintained by compensatory changes in cystathionine β-synthase, betaine-homocysteine methyltransferase, and phosphatidylethanolamine N-methyltransferase gene transcription occurring in response to maternal protein and folic acid intake during pregnancy and fat intake after weaning.

    PubMed

    Chmurzynska, Agata; Malinowska, Anna M

    2011-07-01

    The reactions of the methionine/homocysteine pathway are mediated by several enzymes, including phosphatidylethanolamine N-methyltransferase, cystathionine β-synthase, and betaine-homocysteine methyltransferase. Homocysteine homeostasis is regulated by these enzymes. We hypothesized here that the protein and folic acid content in the maternal diet affects methionine/homocysteine metabolism in the progeny. To test this hypothesis, pregnant rats were fed a diet with normal protein and normal folic acid levels (a modified casein-based AIN-93G diet), a protein-restricted and normal folic acid diet, a protein-restricted and folic acid-supplemented diet, or a normal protein and folic acid-supplemented diet. The progeny were fed either the modified AIN-93G diet or a high-fat lard-based diet. Progeny were analyzed for expression of the phosphatidylethanolamine N-methyltransferase, cystathionine β-synthase, and betaine-homocysteine methyltransferase genes in the liver and for serum homocysteine concentration. Interactions between prenatal and postnatal nutrition were also determined. The progeny of the dams fed the diets supplemented with folic acid showed decreased expression of all 3 genes (P < .001). An interaction effect between the protein and folic acid content in the maternal diet contributed to this down-regulation (P < .001), and the postweaning diet modified these effects. Serum homocysteine concentrations were approximately 15% higher in the male rats (P < .01), but neither prenatal nutrition nor the postweaning diet affected it significantly. We conclude that maternal diet during gestation has an important effect on the transcription level of these 3 genes, but changes in gene expression were not associated with significant changes in progeny homocysteine concentrations.

  17. Retinoic acid inhibits histone methyltransferase Whsc1 during palatogenesis.

    PubMed

    Liu, Shiying; Higashihori, Norihisa; Yahiro, Kohei; Moriyama, Keiji

    2015-03-13

    Cleft lip with or without palate (CL/P) is a common congenital anomaly in humans and is thought to be caused by genetic and environmental factors. However, the epigenetic mechanisms underlying orofacial clefts are not fully understood. Here, we investigate how the overdose of retinoic acid (RA), which can induce cleft palate in mice and humans, regulates histone methyltransferase, Wolf-Hirschhorn syndrome candidate 1 (WHSC1) during palatal development in mice. We treated mouse embryonic fibroblasts (MEFs) with 1 μM all-trans RA and discovered that the global level of H3K36me3 was downregulated and that expression of the H3K36 methyltransferase gene, Whsc1, was reduced. The expression level of WHSC1 in embryonic palatal shelves was reduced during palatogenesis, following maternal administration of 100 mg/kg body weight of RA by gastric intubation. Furthermore, the expression of WHSC1 in palatal shelves was observed in epithelial and mesenchymal cells at all stages, suggesting an important role for palatal development. Our results suggest that the pathogenesis of cleft palate observed after excessive RA exposure is likely to be associated with a reduction in the histone methyltransferase, WHSC1. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Single amino acid substitution in the methyltransferase domain of Paprika mild mottle virus replicase proteins confers the ability to overcome the high temperature-dependent Hk gene-mediated resistance in Capsicum plants.

    PubMed

    Matsumoto, Katsutoshi; Johnishi, Kousuke; Hamada, Hiroyuki; Sawada, Hiromasa; Takeuchi, Shigeharu; Kobayashi, Kappei; Suzuki, Kazumi; Kiba, Akinori; Hikichi, Yasufumi

    2009-03-01

    Capsicum plants harboring the Hk gene (Hk) show resistance to Paprika mild mottle virus (PaMMV) at 32 degrees C but not 24 degrees C. To identify the viral elicitor that activates the Hk-mediated resistance, several chimeric viral genomes were constructed between PaMMV and Tobacco mosaic virus-L. Infection patterns of these chimeric viruses in Hk-harboring plants revealed responsibility of PaMMV replicase genes for activation of the Hk-mediated resistance. The comparison of nucleotide sequence of replicase genes between PaMMV and PaHk1, an Hk-resistance-breaking strain of PaMMV, revealed that the adenine-to-uracil substitution at the nucleotide position 721 causes an amino acid change from threonine to serine at the 241st residue in the methyltransferase domain. Introduction of the A721U mutation into the replicase genes of parental PaMMV overcame the Hk resistance at 32 degrees C. The results indicate that Hk-mediated resistance is induced by PaMMV replicase proteins and that methyltransferase domain has a role in this elicitation.

  19. Overexpression of salicylic acid carboxyl methyltransferase reduces salicylic acid-mediated pathogen resistance in Arabidopsis thaliana.

    PubMed

    Koo, Yeon Jong; Kim, Myeong Ae; Kim, Eun Hye; Song, Jong Tae; Jung, Choonkyun; Moon, Joon-Kwan; Kim, Jeong-Han; Seo, Hak Soo; Song, Sang Ik; Kim, Ju-Kon; Lee, Jong Seob; Cheong, Jong-Joo; Choi, Yang Do

    2007-05-01

    We cloned a salicylic acid/benzoic acid carboxyl methyltransferase gene, OsBSMT1, from Oryza sativa. A recombinant OsBSMT1 protein obtained by expressing the gene in Escherichia coli exhibited carboxyl methyltransferase activity in reactions with salicylic acid (SA), benzoic acid (BA), and de-S-methyl benzo(1,2,3)thiadiazole-7-carbothioic acid (dSM-BTH), producing methyl salicylate (MeSA), methyl benzoate (MeBA), and methyl dSM-BTH (MeBTH), respectively. Compared to wild-type plants, transgenic Arabidopsis overexpressing OsBSMT1 accumulated considerably higher levels of MeSA and MeBA, some of which were vaporized into the environment. Upon infection with the bacterial pathogen Pseudomonas syringae or the fungal pathogen Golovinomyces orontii, transgenic plants failed to accumulate SA and its glucoside (SAG), becoming more susceptible to disease than wild-type plants. OsBSMT1-overexpressing Arabidopsis showed little induction of PR-1 when treated with SA or G. orontii. Notably, incubation with the transgenic plant was sufficient to trigger PR-1 induction in neighboring wild-type plants. Together, our results indicate that in the absence of SA, MeSA alone cannot induce a defense response, yet it serves as an airborne signal for plant-to-plant communication. We also found that jasmonic acid (JA) induced AtBSMT1, which may contribute to an antagonistic effect on SA signaling pathways by depleting the SA pool in plants.

  20. Evolution of novel O-methyltransferases from the Vanilla planifolia caffeic acid O-methyltransferase.

    PubMed

    Li, Huaijun Michael; Rotter, David; Hartman, Thomas G; Pak, Fulya E; Havkin-Frenkel, Daphna; Belanger, Faith C

    2006-06-01

    The biosynthesis of many plant secondary compounds involves the methylation of one or more hydroxyl groups, catalyzed by O-methyltransferases (OMTs). Here, we report the characterization of two OMTs, Van OMT-2 and Van OMT-3, from the orchid Vanilla planifolia Andrews. These enzymes catalyze the methylation of a single outer hydroxyl group in substrates possessing a 1,2,3-trihydroxybenzene moiety, such as methyl gallate and myricetin. This is a substrate requirement not previously reported for any OMTs. Based on sequence analysis these enzymes are most similar to caffeic acid O-methyltransferases (COMTs), but they have negligible activity with typical COMT substrates. Seven of 12 conserved substrate-binding residues in COMTs are altered in Van OMT-2 and Van OMT-3. Phylogenetic analysis of the sequences suggests that Van OMT-2 and Van OMT-3 evolved from the V. planifolia COMT. These V. planifolia OMTs are new instances of COMT-like enzymes with novel substrate preferences.

  1. Functional characterization of KanP, a methyltransferase from the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus.

    PubMed

    Nepal, Keshav Kumar; Yoo, Jin Cheol; Sohng, Jae Kyung

    2010-09-20

    KanP, a putative methyltransferase, is located in the kanamycin biosynthetic gene cluster of Streptomyces kanamyceticus ATCC12853. Amino acid sequence analysis of KanP revealed the presence of S-adenosyl-L-methionine binding motifs, which are present in other O-methyltransferases. The kanP gene was expressed in Escherichia coli BL21 (DE3) to generate the E. coli KANP recombinant strain. The conversion of external quercetin to methylated quercetin in the culture extract of E. coli KANP proved the function of kanP as S-adenosyl-L-methionine-dependent methyltransferase. This is the first report concerning the identification of an O-methyltransferase gene from the kanamycin gene cluster. The resistant activity assay and RT-PCR analysis demonstrated the leeway for obtaining methylated kanamycin derivatives from the wild-type strain of kanamycin producer.

  2. Herbivore-Induced SABATH Methyltransferases of Maize That Methylate Anthranilic Acid Using S-Adenosyl-l-Methionine1[W

    PubMed Central

    Köllner, Tobias G.; Lenk, Claudia; Zhao, Nan; Seidl-Adams, Irmgard; Gershenzon, Jonathan; Chen, Feng; Degenhardt, Jörg

    2010-01-01

    Volatile methyl esters are common constituents of plant volatiles with important functions in plant defense. To study the biosynthesis of these compounds, especially methyl anthranilate and methyl salicylate, we identified a group of methyltransferases that are members of the SABATH enzyme family in maize (Zea mays). In vitro biochemical characterization after bacterial expression revealed three S-adenosyl-l-methionine-dependent methyltransferases with high specificity for anthranilic acid as a substrate. Of these three proteins, Anthranilic Acid Methyltransferase1 (AAMT1) appears to be responsible for most of the S-adenosyl-l-methionine-dependent methyltransferase activity and methyl anthranilate formation observed in maize after herbivore damage. The enzymes may also be involved in the formation of low amounts of methyl salicylate, which are emitted from herbivore-damaged maize. Homology-based structural modeling combined with site-directed mutagenesis identified two amino acid residues, designated tyrosine-246 and glutamine-167 in AAMT1, which are responsible for the high specificity of AAMTs toward anthranilic acid. These residues are conserved in each of the three main clades of the SABATH family, indicating that the carboxyl methyltransferases are functionally separated by these clades. In maize, this gene family has diversified especially toward benzenoid carboxyl methyltransferases that accept anthranilic acid and benzoic acid. PMID:20519632

  3. The Schizosaccharomyces pombe cho1+ gene encodes a phospholipid methyltransferase.

    PubMed Central

    Kanipes, M I; Hill, J E; Henry, S A

    1998-01-01

    The isolation of mutants of Schizosaccharomyces pombe defective in the synthesis of phosphatidylcholine via the methylation of phosphatidylethanolamine is reported. These mutants are choline auxotrophs and fall into two unlinked complementation groups, cho1 and cho2. We also report the analysis of the cho1+ gene, the first structural gene encoding a phospholipid biosynthetic enzyme from S. pombe to be cloned and characterized. The cho1+ gene disruption mutant (cho1Delta) is viable if choline is supplied and resembles the cho1 mutants isolated after mutagenesis. Sequence analysis of the cho1+ gene indicates that it encodes a protein closely related to phospholipid methyltransferases from Saccharomyces cerevisiae and rat. Phospholipid methyltransferases encoded by a rat liver cDNA and the S. cerevisiae OPI3 gene are both able to complement the choline auxotrophy of the S. pombe cho1 mutants. These results suggest that both the structure and function of the phospholipid N-methyltransferases are broadly conserved among eukaryotic organisms. PMID:9755189

  4. Plant isoflavone and isoflavanone O-methyltransferase genes

    DOEpatents

    Broeckling, Bettina E.; Liu, Chang-Jun; Dixon, Richard A.

    2014-08-19

    The invention provides enzymes that encode O-methyltransferases (OMTs) from Medicago truncatula that allow modification to plant (iso)flavonoid biosynthetic pathways. In certain aspects of the invention, the genes encoding these enzymes are provided. The invention therefore allows the modification of plants for isoflavonoid content. Transgenic plants comprising such enzymes are also provided, as well as methods for improving disease resistance in plants. Methods for producing food and nutraceuticals, and the resulting compositions, are also provided.

  5. Expression of cell wall related genes in basal and ear internodes of silking brown-midrib-3, caffeic acid O-methyltransferase (COMT) down-regulated, and normal maize plants

    PubMed Central

    Guillaumie, Sabine; Goffner, Deborah; Barbier, Odile; Martinant, Jean-Pierre; Pichon, Magalie; Barrière, Yves

    2008-01-01

    Background Silage maize is a major forage and energy resource for cattle feeding, and several studies have shown that lignin content and structure are the determining factors in forage maize feeding value. In maize, four natural brown-midrib mutants have modified lignin content, lignin structure and cell wall digestibility. The greatest lignin reduction and the highest cell wall digestibility were observed in the brown-midrib-3 (bm3) mutant, which is disrupted in the caffeic acid O-methyltransferase (COMT) gene. Results Expression of cell wall related genes was investigated in basal and ear internodes of normal, COMT antisens (AS225), and bm3 maize plants of the INRA F2 line. A cell wall macro-array was developed with 651 gene specific tags of genes specifically involved in cell wall biogenesis. When comparing basal (older lignifying) and ear (younger lignifying) internodes of the normal line, all genes known to be involved in constitutive monolignol biosynthesis had a higher expression in younger ear internodes. The expression of the COMT gene was heavily reduced, especially in the younger lignifying tissues of the ear internode. Despite the fact that AS225 transgene expression was driven only in sclerenchyma tissues, COMT expression was also heavily reduced in AS225 ear and basal internodes. COMT disruption or down-regulation led to differential expressions of a few lignin pathway genes, which were all over-expressed, except for a phenylalanine ammonia-lyase gene. More unexpectedly, several transcription factor genes, cell signaling genes, transport and detoxification genes, genes involved in cell wall carbohydrate metabolism and genes encoding cell wall proteins, were differentially expressed, and mostly over-expressed, in COMT-deficient plants. Conclusion Differential gene expressions in COMT-deficient plants highlighted a probable disturbance in cell wall assembly. In addition, the gene expressions suggested modified chronology of the different events leading

  6. Molecular cloning, characterization and expression of the caffeic acid O-methyltransferase (COMT) ortholog from kenaf (Hibiscus cannabinus)

    USDA-ARS?s Scientific Manuscript database

    We cloned the full-length of the gene putatively encoding caffeic acid O-methyltransferase (COMT) from kenaf (Hibiscus cannabinus L.) using degenerate primers and the RACE (rapid amplification of cDNA ends) method. Kenaf is an herbaceous and rapidly growing dicotyledonous plant with great potential ...

  7. Phylogenetic, molecular, and biochemical characterization of caffeic aicd O-methyltransferase (COMT) gene family in Brachypodium distachyon

    USDA-ARS?s Scientific Manuscript database

    Caffeic acid O-methyltransferase (COMT) is one of the important enzymes controlling lignin monomer production in plant cell wall synthesis. Analysis of the genome sequence of new grass model Brachypodium distachyon identified four COMT gene homologues, designated as BdCOMT1, BdCOMT2, BdCOMT3, and ...

  8. [Bioinformatics analysis and expressed level of histone methyltransferase genes in Lonicera japonica].

    PubMed

    Qi, Lin-jie; Yuan, Yuan; Huang, Lu-qi; Long, Ping; Zha, Liang-ping; Wang, Yao-long

    2015-06-01

    Twenty-three histone methyltransferase genes were obtained from transcriptome dataset of Lonicera japonica. The nucleotide and proteins characteristics, subcellular localization, senior structural domains and conservative forecasting were analyzed. The result of phylogenetic tree showed that 23 histone methyltransferases were mainly divided into two groups: lysine methyltransferase and arginine methyltransferases. The result of gene expression showed that 23 histone methyltransferases showed preference in terms of interspecies and organs. They were more expressed in buds of L. japonica than in L. japonica var. chinensis and lower in leaves of L. japonica than in L. japonica var. chinensis. Eight genes were specific expressed in flower. These results provided basis for further understanding the function of histone methyltransferase and epigenetic regulation of active ingredients of L. japonica.

  9. A novel methyltransferase from the intracellular pathogen Plasmodiophora brassicae methylates salicylic acid.

    PubMed

    Ludwig-Müller, Jutta; Jülke, Sabine; Geiß, Kathleen; Richter, Franziska; Mithöfer, Axel; Šola, Ivana; Rusak, Gordana; Keenan, Sandi; Bulman, Simon

    2015-05-01

    The obligate biotrophic pathogen Plasmodiophora brassicae causes clubroot disease in Arabidopsis thaliana, which is characterized by large root galls. Salicylic acid (SA) production is a defence response in plants, and its methyl ester is involved in systemic signalling. Plasmodiophora brassicae seems to suppress plant defence reactions, but information on how this is achieved is scarce. Here, we profile the changes in SA metabolism during Arabidopsis clubroot disease. The accumulation of SA and the emission of methylated SA (methyl salicylate, MeSA) were observed in P. brassicae-infected Arabidopsis 28 days after inoculation. There is evidence that MeSA is transported from infected roots to the upper plant. Analysis of the mutant Atbsmt1, deficient in the methylation of SA, indicated that the Arabidopsis SA methyltransferase was not responsible for alterations in clubroot symptoms. We found that P. brassicae possesses a methyltransferase (PbBSMT) with homology to plant methyltransferases. The PbBSMT gene is maximally transcribed when SA production is highest. By heterologous expression and enzymatic analyses, we showed that PbBSMT can methylate SA, benzoic and anthranilic acids.

  10. Sugarcane DIRIGENT and O-methyltransferase promoters confer stem-regulated gene expression in diverse monocots.

    PubMed

    Damaj, Mona B; Kumpatla, Siva P; Emani, Chandrakanth; Beremand, Phillip D; Reddy, Avutu S; Rathore, Keerti S; Buenrostro-Nava, Marco T; Curtis, Ian S; Thomas, Terry L; Mirkov, T Erik

    2010-05-01

    Transcription profiling analysis identified Saccharum hybrid DIRIGENT (SHDIR16) and Omicron-Methyltransferase (SHOMT), putative defense and fiber biosynthesis-related genes that are highly expressed in the stem of sugarcane, a major sucrose accumulator and biomass producer. Promoters (Pro) of these genes were isolated and fused to the beta-glucuronidase (GUS) reporter gene. Transient and stable transgene expression analyses showed that both Pro( DIR16 ):GUS and Pro( OMT ):GUS retain the expression characteristics of their respective endogenous genes in sugarcane and function in orthologous monocot species, including rice, maize and sorghum. Furthermore, both promoters conferred stem-regulated expression, which was further enhanced in the stem and induced in the leaf and root by salicylic acid, jasmonic acid and methyl jasmonate, key regulators of biotic and abiotic stresses. Pro( DIR16 ) and Pro( OMT ) will enable functional gene analysis in monocots, and will facilitate engineering monocots for improved carbon metabolism, enhanced stress tolerance and bioenergy production.

  11. The Trimethylamine Methyltransferase Gene and Multiple Dimethylamine Methyltransferase Genes of Methanosarcina barkeri Contain In-Frame and Read-Through Amber Codons†

    PubMed Central

    Paul, Ligi; Ferguson, Donald J.; Krzycki, Joseph A.

    2000-01-01

    Three different methyltransferases initiate methanogenesis from trimethylamine (TMA), dimethylamine (DMA) or monomethylamine (MMA) by methylating different cognate corrinoid proteins that are subsequently used to methylate coenzyme M (CoM). Here, genes encoding the DMA and TMA methyltransferases are characterized for the first time. A single copy of mttB, the TMA methyltransferase gene, was cotranscribed with a copy of the DMA methyltransferase gene, mtbB1. However, two other nearly identical copies of mtbB1, designated mtbB2 and mtbB3, were also found in the genome. A 6.8-kb transcript was detected with probes to mttB and mtbB1, as well as to mtbC and mttC, encoding the cognate corrinoid proteins for DMA:CoM and TMA:CoM methyl transfer, respectively, and with probes to mttP, encoding a putative membrane protein which might function as a methylamine permease. These results indicate that these genes, found on the chromosome in the order mtbC, mttB, mttC, mttP, and mtbB1, form a single transcriptional unit. A transcriptional start site was detected 303 or 304 bp upstream of the translational start of mtbC. The MMA, DMA, and TMA methyltransferases are not homologs; however, like the MMA methyltransferase gene, the genes encoding the DMA and TMA methyltransferases each contain a single in-frame amber codon. Each of the three DMA methyltransferase gene copies from Methanosarcina barkeri contained an amber codon at the same position, followed by a downstream UAA or UGA codon. The C-terminal residues of DMA methyltransferase purified from TMA-grown cells matched the residues predicted for the gene products of mtbB1, mtbB2, or mtbB3 if termination occurred at the UAA or UGA codon rather than the in-frame amber codon. The mttB gene from Methanosarcina thermophila contained a UAG codon at the same position as the M. barkeri mttB gene. The UAG codon is also present in mttB transcripts. Thus, the genes encoding the three types of methyltransferases that initiate methanogenesis

  12. Characterization of a Bvg-regulated fatty acid methyl-transferase in Bordetella pertussis

    PubMed Central

    Rivera-Millot, Alex; Lesne, Elodie; Solans, Luis; Coutte, Loic; Bertrand-Michel, Justine; Froguel, Philippe; Dhennin, Véronique; Hot, David; Locht, Camille; Antoine, Rudy

    2017-01-01

    The whooping cough agent Bordetella pertussis controls the expression of its large virulence regulon in a coordinated manner through the two-component signal transduction system BvgAS. In addition to the genes coding for bona fide virulence factors, the Bvg regulon comprises genes of unknown function. In this work, we characterized a new Bvg-activated gene called BP2936. Homologs of BP2936 are found in other pathogenic Bordetellae and in several other species, including plant pathogens and environmental bacteria. We showed that the gene product of BP2936 is a membrane-associated methyl-transferase of free fatty acids. We thus propose to name it FmtB, for fatty acid methyl-transferase of Bordetella. The role of this protein was tested in cellular and animal models of infection, but the loss of BP2936 did not appear to affect host-pathogen interactions in those assays. The high level of conservation of BP2936 among B. pertussis isolates nevertheless argues that it probably plays a role in the life cycle of this pathogen. PMID:28493897

  13. Characterization of DNA methyltransferase and demethylase genes in Fragaria vesca.

    PubMed

    Gu, Tingting; Ren, Shuai; Wang, Yuanhua; Han, Yuhui; Li, Yi

    2016-06-01

    DNA methylation is an epigenetic modification essential for gene regulations in plants, but understanding on how it is involved in fruit development, especially in non-climacteric fleshy fruit, is limited. The diploid woodland strawberry (Fragaria vesca) is an important model for non-climacteric fruit crops. In this study, we identified DNA methyltransferase genes and demethylase genes in Fragaria vesca and other angiosperm species. In accordance with previous studies, our phylogenetic analyses of those DNA methylation modifiers support the clustering of those genes into several classes. Our data indicate that whole-genome duplications and tandem duplications contributed to the expansion of those DNA methylation modifiers in angiosperms. We have further demonstrated that some DNA methylase and demethylase genes reach their highest expression levels in strawberry fleshy fruits when turning from white to red, suggesting that DNA methylation might undergo a dramatic change at the onset of fleshy fruit-ripening process. In addition, we have observed that expression of some DNA demethylase genes increases in response to various abiotic stresses including heat, cold, drought and salinity. Collectively, our study indicates a regulatory role of DNA methylation in the turning stage of non-climacteric fleshy fruit and responses to environment stimuli, and would facilitate functional studies of DNA methylation in the growth and development of non-climacteric fruits.

  14. Juvenile hormone acid methyltransferase: A key regulatory enzyme for insect metamorphosis

    PubMed Central

    Shinoda, Tetsuro; Itoyama, Kyo

    2003-01-01

    Juvenile hormone (JH) acid methyltransferase (JHAMT) is an enzyme that converts JH acids or inactive precursors of JHs to active JHs at the final step of JH biosynthesis pathway in insects. By fluorescent mRNA differential display, we have cloned a cDNA encoding JHAMT from the corpora allata (CA) of the silkworm, Bombyx mori (BmJHAMT). The BmJHAMT cDNA encodes an ORF of 278 aa with a calculated molecular mass of 32,544 Da. The predicted amino acid sequence contains a conserved S-adenosyl-l-methionine (SAM) binding motif found in the family of SAM-dependent methyltransferases. Purified N-terminal 6×His-tagged recombinant BmJHAMT protein expressed in Escherichia coli catalyzed conversion of farnesoic acid and JH acids I, II, and III to their cognate methyl esters in the presence of SAM, confirming that this cDNA encodes a functional JHAMT. Putative orthologs, DmJHAMT and AgJHAMT, were identified from the genome sequence of the fruit fly Drosophila melanogaster, and a malaria vector, Anopheles gambiae, respectively. Northern blot and quantitative RT-PCR analyses revealed that the BmJHAMT gene was expressed specifically in the CA throughout the third and fourth instar. At the beginning of the last (fifth) instar, the expression level of BmJHAMT declined rapidly and became undetectable by day 4 and remained so until pupation. Correlation of the BmJHAMT gene expression and the JH biosynthetic activity in the CA suggests that the transcriptional suppression of the BmJHAMT gene is crucial for the termination of JH biosynthesis in the CA, which is a prerequisite for the initiation of metamorphosis. PMID:14530389

  15. Transcriptional Profiling of Methyltransferase Genes during Growth of Methanosarcina mazei on Trimethylamine▿ †

    PubMed Central

    Krätzer, Christian; Carini, Paul; Hovey, Raymond; Deppenmeier, Uwe

    2009-01-01

    The genomic expression patterns of Methanosarcina mazei growing with trimethylamine were measured in comparison to those of cells grown with methanol. We identified a total of 72 genes with either an increased level (49 genes) or a decreased level (23 genes) of mRNA during growth on trimethylamine with methanol-grown cells as the control. Major differences in transcript levels were observed for the mta, mtb, mtt, and mtm genes, which encode enzymes involved in methane formation from methanol and trimethylamine, respectively. Other differences in mRNA abundance were found for genes encoding enzymes involved in isopentenyl pyrophosphate synthesis and in the formation of aromatic amino acids, as well as a number of proteins with unknown functions. The results were verified by in-depth analysis of methyltransferase genes using specific primers for real-time quantitative reverse transcription-PCR (RT-PCR). The monitored transcript levels of genes encoding corrinoid proteins involved in methyl group transfer from methylated C1 compounds (mtaC, mtbC, mttC, and mtmC) indicated increased amounts of mRNA from the mtaBC1, mtaBC2, and mtaBC3 operons in methanol-grown cells, whereas mRNA of the mtb1-mtt1 operon was found in high concentrations during trimethylamine consumption. The genes of the mtb1-mtt1 operon encode methyltransferases that are responsible for sequential demethylation of trimethylamine. The analysis of product formation of trimethylamine-grown cells at different optical densities revealed that large amounts of dimethylamine and monomethylamine were excreted into the medium. The intermediate compounds were consumed only in the very late exponential growth phase. RT-PCR analysis of key genes involved in methanogenesis led to the conclusion that M. mazei is able to adapt to changing trimethylamine concentrations and the consumption of intermediate compounds. Hence, we assume that the organism possesses a regulatory network for optimal substrate utilization. PMID

  16. Transcriptional profiling of methyltransferase genes during growth of Methanosarcina mazei on trimethylamine.

    PubMed

    Krätzer, Christian; Carini, Paul; Hovey, Raymond; Deppenmeier, Uwe

    2009-08-01

    The genomic expression patterns of Methanosarcina mazei growing with trimethylamine were measured in comparison to those of cells grown with methanol. We identified a total of 72 genes with either an increased level (49 genes) or a decreased level (23 genes) of mRNA during growth on trimethylamine with methanol-grown cells as the control. Major differences in transcript levels were observed for the mta, mtb, mtt, and mtm genes, which encode enzymes involved in methane formation from methanol and trimethylamine, respectively. Other differences in mRNA abundance were found for genes encoding enzymes involved in isopentenyl pyrophosphate synthesis and in the formation of aromatic amino acids, as well as a number of proteins with unknown functions. The results were verified by in-depth analysis of methyltransferase genes using specific primers for real-time quantitative reverse transcription-PCR (RT-PCR). The monitored transcript levels of genes encoding corrinoid proteins involved in methyl group transfer from methylated C(1) compounds (mtaC, mtbC, mttC, and mtmC) indicated increased amounts of mRNA from the mtaBC1, mtaBC2, and mtaBC3 operons in methanol-grown cells, whereas mRNA of the mtb1-mtt1 operon was found in high concentrations during trimethylamine consumption. The genes of the mtb1-mtt1 operon encode methyltransferases that are responsible for sequential demethylation of trimethylamine. The analysis of product formation of trimethylamine-grown cells at different optical densities revealed that large amounts of dimethylamine and monomethylamine were excreted into the medium. The intermediate compounds were consumed only in the very late exponential growth phase. RT-PCR analysis of key genes involved in methanogenesis led to the conclusion that M. mazei is able to adapt to changing trimethylamine concentrations and the consumption of intermediate compounds. Hence, we assume that the organism possesses a regulatory network for optimal substrate utilization.

  17. Molecular analysis of the dmpM gene encoding an O-demethyl puromycin O-methyltransferase from Streptomyces alboniger.

    PubMed

    Lacalle, R A; Ruiz, D; Jiménez, A

    1991-12-20

    The nucleotide (nt) sequence of a 1332-bp fragment of Streptomyces alboniger DNA containing the gene (dmpM), which encodes an O-demethyl puromycin O-methyltransferase (DMPM), has been determined. The dmpM gene contains a 1131-nt open reading frame which encodes a polypeptide of Mr 40,303; this is consistent with the 44 +/- 2.5- and 160-kDa sizes of the DMPM monomer and its native form, respectively. The ATG start codon of dmpM is 50 bp downstream from the coding sequence of the gene (pac), which determines a puromycin N-acetyltransferase. S1 mapping experiments indicate that pac and dmpM are transcribed on a single transcript, which ends at least 500 nt downstream from the dmpM stop codon. The deduced amino acid sequence of DMPM shows significant similarities to those of a hydroxyindole O-methyltransferase, which is involved in the biosynthesis of melatonin by bovine pineal glands [Ishida et al., J. Biol. Chem. 262 (1987) 2895-2899], a hydroxyneurosporene methyltransferase, which is involved in carotenoid biosynthesis in the purple nonsulfur bacterium, Rhodobacter capsulatus [Armstrong et al., Mol. Gen. Genet. 216 (1989) 254-268] and two O-methyltransferases of the tetracenomycin biosynthesis pathway from Streptomyces glaucescens.

  18. Clustered Genes Encoding the Methyltransferases of Methanogenesis from Monomethylamine

    PubMed Central

    Burke, Stephen A.; Lo, Sam L.; Krzycki, Joseph A.

    1998-01-01

    Coenzyme M (CoM) is methylated during methanogenesis from monomethyamine in a reaction catalyzed by three proteins. Using monomethylamine, a 52-kDa polypeptide termed monomethylamine methyltransferase (MMAMT) methylates the corrinoid cofactor bound to a second polypeptide, monomethylamine corrinoid protein (MMCP). Methylated MMCP then serves as a substrate for MT2-A, which methylates CoM. The genes for these proteins are clustered on 6.8 kb of DNA in Methanosarcina barkeri MS. The gene encoding MMCP (mtmC) is located directly upstream of the gene encoding MMAMT (mtmB). The gene encoding MT2-A (mtbA) was found 1.1 kb upstream of mtmC, but no obvious open reading frame was found in the intergenic region between mtbA and mtmC. A single monocistronic transcript was found for mtbA that initiated 76 bp from the translational start. Separate transcripts of 2.4 and 4.7 kb were detected, both of which carried mtmCB. The larger transcript also encoded mtmP, which is homologous to the APC family of cationic amine permeases and may therefore encode a methylamine permease. A single transcriptional start site was found 447 bp upstream of the translational start of mtmC. MtmC possesses the corrinoid binding motif found in corrinoid proteins involved in dimethylsulfide- and methanol-dependent methanogenesis, as well as in methionine synthase. The open reading frame of mtmB was interrupted by a single in-frame, midframe, UAG codon which was also found in mtmB from M. barkeri NIH. A mechanism that circumvents UAG-directed termination of translation must operate during expression of mtmB in this methanogen. PMID:9642198

  19. Clustered genes encoding the methyltransferases of methanogenesis from monomethylamine.

    PubMed

    Burke, S A; Lo, S L; Krzycki, J A

    1998-07-01

    Coenzyme M (CoM) is methylated during methanogenesis from monomethyamine in a reaction catalyzed by three proteins. Using monomethylamine, a 52-kDa polypeptide termed monomethylamine methyltransferase (MMAMT) methylates the corrinoid cofactor bound to a second polypeptide, monomethylamine corrinoid protein (MMCP). Methylated MMCP then serves as a substrate for MT2-A, which methylates CoM. The genes for these proteins are clustered on 6.8 kb of DNA in Methanosarcina barkeri MS. The gene encoding MMCP (mtmC) is located directly upstream of the gene encoding MMAMT (mtmB). The gene encoding MT2-A (mtbA) was found 1.1 kb upstream of mtmC, but no obvious open reading frame was found in the intergenic region between mtbA and mtmC. A single monocistronic transcript was found for mtbA that initiated 76 bp from the translational start. Separate transcripts of 2.4 and 4.7 kb were detected, both of which carried mtmCB. The larger transcript also encoded mtmP, which is homologous to the APC family of cationic amine permeases and may therefore encode a methylamine permease. A single transcriptional start site was found 447 bp upstream of the translational start of mtmC. MtmC possesses the corrinoid binding motif found in corrinoid proteins involved in dimethylsulfide- and methanol-dependent methanogenesis, as well as in methionine synthase. The open reading frame of mtmB was interrupted by a single in-frame, midframe, UAG codon which was also found in mtmB from M. barkeri NIH. A mechanism that circumvents UAG-directed termination of translation must operate during expression of mtmB in this methanogen.

  20. Functional characterization of MpaG', the O-methyltransferase involved in the biosynthesis of mycophenolic acid.

    PubMed

    Zhang, Wei; Cao, Shaona; Qiu, Li; Qi, Fengxia; Li, Zhong; Yang, Ying; Huang, Shaohua; Bai, Fali; Liu, Changning; Wan, Xiaobo; Li, Shengying

    2015-03-02

    Mycophenolic acid (MPA, 1) is a clinically important immunosuppressant. In this report, a gene cluster mpa' responsible for the biosynthesis of 1 was identified from Penicillium brevicompactum NRRL 864. The S-adenosyl-L-methionine-dependent (SAM-dependent) O-methyltransferase encoded by the mpaG' gene was functionally and kinetically characterized in vitro. MpaG' catalyzes the methylation of demethylmycophenolic acid (DMMPA, 6) to form 1. It also showed significant substrate flexibility by methylating two structural derivatives of 6 prepared by organic synthesis. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Downregulation of Caffeic Acid 3-O-Methyltransferase and Caffeoyl CoA 3-O-Methyltransferase in Transgenic Alfalfa

    PubMed Central

    Guo, Dianjing; Chen, Fang; Inoue, Kentaro; Blount, Jack W.; Dixon, Richard A.

    2001-01-01

    Transgenic alfalfa plants were generated harboring caffeic acid 3-O-methyltransferase (COMT) and caffeoyl CoA 3-O-methyltransferase (CCOMT) cDNA sequences under control of the bean phenylalanine ammonia-lyase PAL2 promoter. Strong downregulation of COMT resulted in decreased lignin content, a reduction in total guaiacyl (G) lignin units, a near total loss of syringyl (S) units in monomeric and dimeric lignin degradation products, and appearance of low levels of 5-hydroxy guaiacyl units and a novel dimer. No soluble monolignol precursors accumulated. In contrast, strong downregulation of CCOMT led to reduced lignin levels, a reduction in G units without reduction in S units, and increases in β-5 linked dimers of G units. Accumulation of soluble caffeic acid β-d-glucoside occurred only in CCOMT downregulated plants. The results suggest that CCOMT does not significantly contribute to the 3-O-methylation step in S lignin biosynthesis in alfalfa and that there is redundancy with respect to the 3-O-methylation reaction of G lignin biosynthesis. COMT is unlikely to catalyze the in vivo methylation of caffeic acid during lignin biosynthesis. PMID:11158530

  2. Activation and inactivation of methanol: 2-mercaptoethanesulfonic acid methyltransferase from Methanosarcina barkeri.

    PubMed Central

    van der Meijden, P; Heythuysen, H J; Sliepenbeek, H T; Houwen, F P; van der Drift, C; Vogels, G D

    1983-01-01

    Methanol is converted to methane by crude extracts of Methanosarcina barkeri. The first reaction involved in this process, is catalyzed by methanol:2-mercaptoethanesulfonic acid methyltransferase (EC 2.1.1.-). The methyltransferase has an optimum at pH 6.5 and is not inhibited by 2-bromoethanesulfonic acid. Pyridoxal-5'-phosphate acts as an inhibitor (Ki = 0.30 mM). The methyltransferase was tested in the presence of 2-bromoethanesulfonic acid, which inhibits the conversion of 2-(methylthio)ethanesulfonic acid to methane. The reaction is subject to activation and inactivation. Inactivation is brought about by the presence of oxygen, flavin mononucleotide, flavin adenine dinucleotide, and 2-(methylthio)ethanesulfonic acid, the product of the reaction. Activation of the system requires the presence of ATP and Mg2+ and of hydrogen. Hydrogen can be replaced by enzymatic systems, such as pyruvate dehydrogenase, which deliver free hydrogen. PMID:6294063

  3. SABATH methyltransferases from white spruce (Picea glauca): gene cloning, functional characterization and structural analysis.

    PubMed

    Zhao, Nan; Boyle, Brian; Duval, Isabelle; Ferrer, Jean-Luc; Lin, Hong; Seguin, Armand; MacKay, John; Chen, Feng

    2009-07-01

    Known members of the plant SABATH family of methyltransferases have important biological functions by methylating hormones, signalling molecules and other metabolites. While all previously characterized SABATH genes were isolated from angiosperms, in this article, we report on the isolation and functional characterization of SABATH genes from white spruce (Picea glauca [Moench] Voss), a gymnosperm. Through EST database search, three genes that encode proteins significantly homologous to known SABATH proteins were identified from white spruce. They were named PgSABATH1, PgSABATH2 and PgSABATH3, respectively. Full length cDNAs of these three genes were cloned and expressed in Escherichia coli. The E. coli-expressed recombinant proteins were tested for methyltransferase activity with a large number of compounds. While no activity was detected for PgSABATH2 and PgSABATH3, PgSABATH1 displayed the highest level of catalytic activity with indole-3-acetic acid (IAA). PgSABATH1 was, therefore, renamed PgIAMT1. Under steady-state conditions, PgIAMT1 exhibited apparent Km values of 18.2 microM for IAA. Homology-based structural modelling of PgIAMT1 revealed that the active site of PgIAMT1 is highly similar to other characterized IAMTs from angiosperms. PgIAMT1 showed expression in multiple tissues, with the highest level of expression detected in embryonic tissues. During somatic embryo maturation, a significant reduction in PgIAMT1 transcript levels was observed when developing cotyledons become apparent which is indicative of mature embryos. The biological roles of white spruce SABATH genes, especially those of PgIAMT1, and the evolution of the SABATH family are discussed.

  4. Cloning and expression analysis of an o-methyltransferase (OMT) gene from Chinese shrimp, Fenneropenaeus chinensis.

    PubMed

    Li, Dian-Xiang; Du, Xin-Jun; Zhao, Xiao-Fan; Wang, Jin-Xing

    2006-09-01

    O-methyltransferase (OMT) is ubiquitously present in diverse organisms and plays an important regulatory role in plant and animal growth, development, reproduction and defence and has also been implicated in human emotion and disease. A putative o-methyltransferase (OMT) gene has been cloned from the haemocytes of bacteria-infected Chinese shrimp (Fenneropenaeus chinensis) by suppression subtractive hybridisation (SSH) coupled with the SMART cDNA method. The isolated 944 bp full-length cDNA contains a single 666bp open reading frame (ORF) encoding a putative OMT protein of 221 amino acids. The predicted protein has a molecular weight of 24,572.06 Da and a pI of 5.27 as well as ten phosphorylation sites. Northern blot and in situ hybridisation analyses demonstrated that the OMT transcripts were constitutively expressed in tissue of shrimp challenged by bacterial infection and in unchallenged shrimp tissue. Constitutive OMT transcript was found in areas such as haemocytes, heart, hepatopancreas, stomach, gill, intestine and ovary. However, the OMT transcripts were upregulated in hepatopancreas and stomach in challenged shrimp.

  5. Identification of the XorII methyltransferase gene and a vsr homolog from Xanthomonas oryzae pv. oryzae.

    PubMed

    Choi, S H; Leach, J E

    1994-08-15

    The gene encoding the XorII methyltransferase (M.XorII) was cloned from Xanthomonas oryzae pv. oryzae and characterized in Escherichia coli. The M.XorII activity was localized to a 3.1 kb BamHI-BstXI fragment, which contained two open reading frames (ORFs) of 1272 nucleotides (424 amino acids) and 408 nucleotides (136 amino acids). Ten polypeptide domains conserved in other M5 cytosine methyltransferases (MTases) were identified in the deduced amino acid sequence of the 1272 ORF. E. coli Mrr+ strains were transformed poorly by plasmids containing the XorII MTase gene, indicating the presence of at least one MCG in the recognition sequence for M.XorII (CGATCG). The 408 nucleotide ORF was 36% identical at the amino acid level to sequences of the E. coli dem-vsr gene, which is required for very short patch repair. X. oryzae pv. oryzae genomic DNA that is resistant to digestion by PvuI and XorII hybridizes with a 7.0 kb fragment containing the XorII MTase gene and vsr homolog, whereas DNA from strains that lack M.XorII activity do not hybridize with the fragment.

  6. Conversion of nicotinic acid to trigonelline is catalyzed by N-methyltransferase belonged to motif B′ methyltransferase family in Coffea arabica

    SciTech Connect

    Mizuno, Kouichi; Matsuzaki, Masahiro; Kanazawa, Shiho; Tokiwano, Tetsuo; Yoshizawa, Yuko; Kato, Misako

    2014-10-03

    Graphical abstract: Trigonelline synthase catalyzes the conversion of nicotinic acid to trigonelline. We isolated and characterized trigonelline synthase gene(s) from Coffea arabica. - Highlights: • Trigonelline is a major compound in coffee been same as caffeine is. • We isolated and characterized trigonelline synthase gene. • Coffee trigonelline synthases are highly homologous with coffee caffeine synthases. • This study contributes the fully understanding of pyridine alkaloid metabolism. - Abstract: Trigonelline (N-methylnicotinate), a member of the pyridine alkaloids, accumulates in coffee beans along with caffeine. The biosynthetic pathway of trigonelline is not fully elucidated. While it is quite likely that the production of trigonelline from nicotinate is catalyzed by N-methyltransferase, as is caffeine synthase (CS), the enzyme(s) and gene(s) involved in N-methylation have not yet been characterized. It should be noted that, similar to caffeine, trigonelline accumulation is initiated during the development of coffee fruits. Interestingly, the expression profiles for two genes homologous to caffeine synthases were similar to the accumulation profile of trigonelline. We presumed that these two CS-homologous genes encoded trigonelline synthases. These genes were then expressed in Escherichiacoli, and the resulting recombinant enzymes that were obtained were characterized. Consequently, using the N-methyltransferase assay with S-adenosyl[methyl-{sup 14}C]methionine, it was confirmed that these recombinant enzymes catalyzed the conversion of nicotinate to trigonelline, coffee trigonelline synthases (termed CTgS1 and CTgS2) were highly identical (over 95% identity) to each other. The sequence homology between the CTgSs and coffee CCS1 was 82%. The pH-dependent activity curve of CTgS1 and CTgS2 revealed optimum activity at pH 7.5. Nicotinate was the specific methyl acceptor for CTgSs, and no activity was detected with any other nicotinate derivatives, or

  7. Developmental Expression and Substrate Specificities of Alfalfa Caffeic Acid 3-O-Methyltransferase and Caffeoyl Coenzyme A 3-O-Methyltransferase in Relation to Lignification1

    PubMed Central

    Inoue, Kentaro; Sewalt, Vincent J.H.; Murray Ballance, G.; Ni, Weiting; Stürzer, Cornelia; Dixon, Richard A.

    1998-01-01

    The biosynthesis of monolignols can potentially occur via two parallel pathways involving free acids or their coenzyme A (CoA) esters. Caffeic acid 3-O-methyltransferase (COMT) and caffeoyl CoA 3-O-methyltransferase (CCOMT) catalyze functionally identical reactions in these two pathways, resulting in the formation of mono- or dimethoxylated lignin precursors. The activities of the two enzymes increase from the first to the sixth internode in stems of alfalfa (Medicago sativa L.), preceding the deposition of lignin. Alfalfa CCOMT is highly similar at the amino acid sequence level to the CCOMT from parsley, although it contains a six-amino acid insertion near the N terminus. Transcripts encoding both COMT and CCOMT are primarily localized to vascular tissue in alfalfa stems. Alfalfa CCOMT expressed in Escherichia coli catalyzes O-methylation of caffeoyl and 5-hydroxyferuloyl CoA, with preference for caffeoyl CoA. It has low activity against the free acids. COMT expressed in E. coli is active against both caffeic and 5-hydroxyferulic acids, with preference for the latter compound. Surprisingly, very little extractable O-methyltransferase activity versus 5-hydroxyferuloyl CoA is present in alfalfa stem internodes, in which relative O-methyltransferase activity against 5-hy-droxyferulic acid increases with increasing maturity, correlating with increased lignin methoxyl content. PMID:9662519

  8. A Continuous, Quantitative Fluorescent Assay for Plant Caffeic acid O-Methyltransferases

    USDA-ARS?s Scientific Manuscript database

    Plant caffeic acid O-methyltransferases (COMTs) use s-adenosylmethionine (ado-met), as a methyl donor to transmethylate their preferred (phenolic) substrates in-vivo, and will generally utilize a range of phenolic compounds in-vitro. Collazo et al. (2005; Analytical Biochemistry 342: 86-92) have pu...

  9. Functional characterization of cinnamyl alcohol dehydrogenase and caffeic acid O-methyltransferase in Brachypodium distachyon.

    USDA-ARS?s Scientific Manuscript database

    Lignin is a significant recalcitrant in the conversion of plant biomass to bioethanol. Cinnamyl alcohol dehydrogenase (CAD) and caffeic acid O-methyltransferase (COMT) catalyze key steps in the pathway of lignin monomer biosynthesis. Brown midrib mutants in Zea mays and Sorghum bicolor with impaired...

  10. Folic Acid Inhibits Amyloid β-Peptide Production through Modulating DNA Methyltransferase Activity in N2a-APP Cells.

    PubMed

    Li, Wen; Jiang, Mingyue; Zhao, Shijing; Liu, Huan; Zhang, Xumei; Wilson, John X; Huang, Guowei

    2015-10-20

    Alzheimer's disease (AD) is a common neurodegenerative disease resulting in progressive dementia, and is a principal cause of dementia among older adults. Folate acts through one-carbon metabolism to support the methylation of multiple substrates. We hypothesized that folic acid supplementation modulates DNA methyltransferase (DNMT) activity and may alter amyloid β-peptide (Aβ) production in AD. Mouse Neuro-2a cells expressing human APP695 were incubated with folic acid (2.8-40 μmol/L), and with or without zebularine (the DNMT inhibitor). DNMT activity, cell viability, Aβ and DNMTs expression were then examined. The results showed that folic acid stimulated DNMT gene and protein expression, and DNMT activity. Furthermore, folic acid decreased Aβ protein production, whereas inhibition of DNMT activity by zebularine increased Aβ production. The results indicate that folic acid induces methylation potential-dependent DNMT enzymes, thereby attenuating Aβ production.

  11. Isolation of DNA-methyltransferase genes from strawberry (Fragaria x ananassa Duch.) and their expression in relation to micropropagation.

    PubMed

    Chang, Linlin; Zhang, Zhihong; Han, Baiming; Li, He; Dai, Hongyan; He, Ping; Tian, Hongzhe

    2009-09-01

    DNA methylation can control gene expression and may also play a role in plant development. Methylation of cytosine residues in DNA is enzymatically catalyzed by DNA methyltransferases. In this study, full-length genomic genes and cDNAs of methyltransferase (MET1) and domain-rearranged methyltransferase (DRM) were isolated from strawberry (Fragaria x ananassa Duch.). Two genomic clones (FaMET1a and FaMET1b) encoding MET1 had open-reading frame of 4,695 and 4,671 nucleotides with two introns, respectively. Amino acid sequence comparison indicated high similarity (98.72% identity) of strawberry MET1 protein to other plant MET1 sequences. The full-length cDNA of strawberry DRM genes (FaDRMa, FaDRMb and FaDRMc) were 2,273, 2,282 and 2,288 bp, respectively. Ten introns with different sizes were dispersed in FaDRM genes. Similarly, FaDRMa, FaDRMb and FaDRMc had high-sequence similarity overall. Expressions of strawberry MET1 and DRM genes were compared among in vitro-micropropagated plants, generations of micropropagated plants and conventionally propagated plants. The transcriptional expressions of both FaMET1 and FaDRM genes were downregulated in micropropagated plants, and they were recovered in the first and second runner generations of micropropagated plants. However, there was a slighter difference in global DNA methylation rates between micropropagated plants and conventionally propagated plants. Therefore, there was no positive relation between global DNA methylation rates and the expression levels of MET1 and DRM genes.

  12. Catechol-O-methyltransferase gene polymorphism and vulvar pain in women with vulvodynia.

    PubMed

    Patanwala, Insiyyah Y; Lamvu, Georgine; Ledger, William J; Witzeman, Kathryn; Marvel, Richard; Rapkin, Andrea; Bongiovanni, Ann Marie; Feranec, Jessica; Witkin, Steven S

    2017-04-01

    The underlying causes of vulvar pain in women with vulvodynia remain poorly understood. Catechol-O-methyltransferase, an enzyme that metabolizes catecholamines, is a neuromodulator that is involved with perception and sensitivity to pain. The catechol-O-methyltransferase gene is polymorphic, and a single nucleotide polymorphism is associated with low activity and heightened pain sensitivity. The variant allele that encodes this polymorphism commonly is called the "L allele" because of its low enzyme activity as opposed to the normal H (high activity) allele. The methionine-containing catechol-O-methyltransferase protein coded by the L allele results in elevated catecholamine levels, reduced inactivation of the dopaminergic and adrenergic systems, and increased sensitivity to pain. This polymorphism not only may decrease the pain threshold in response to acute pain but also may facilitate the development of chronic pain. Therefore, the objective of our study was to assess whether a variation in the catechol-O-methyltransferase genotype is involved in increased pain sensitivity in women with vulvodynia. We conducted a prospective cohort study. Buccal swabs were collected from 167 white women with vulvodynia and 107 control subjects; the DNA was tested for a single nucleotide polymorphism at position 158 (rs4680) in the catechol-O-methyltransferase gene. Women with vulvodynia had a marginally increased, yet not significant, prevalence of the catechol-O-methyltransferase genotype that is associated with high activity of the coded protein: 32.9% in the women with vulvodynia, as opposed to 21.5% in the control subjects (odds ratio, 1.80; 95% confidence interval, 1.02-3.15). Subgrouping the cases based on pain frequency revealed that the elevated occurrence of this catechol-O-methyltransferase genotype was present in 40.6% of the subset of women who experienced pain only with sexual intercourse vs only 21.5% of control subjects (odds ratio, 2.50; 95% confidence interval

  13. SABATH Methyltransferases from White Spruce (Picea glauca [Moench] Voss): Gene Cloning, Functional Characterization and Structural Analysis

    USDA-ARS?s Scientific Manuscript database

    Known members of the plant SABATH family of methyltransferases have important biological functions by methylating hormones, signaling molecules and other metabolites. While all previously characterized SABATH genes were isolated from angiosperms, in this article, we report on the isolation and funct...

  14. Accidental Amplification and Inactivation of a Methyltransferase Gene Eliminates Cytosine Methylation in Mycosphaerella Graminicola

    USDA-ARS?s Scientific Manuscript database

    A de novo search for repetitive elements in the genome sequence of the wheat pathogen Mycosphaerella graminicola identified a family of repeats containing a DNA methyltransferase sequence (MgDNMT), which is a homologue of the Neurospora crassa Dim-2 gene. A total of 28 MgDNMT sequences was identifie...

  15. Laccaic Acid A Is a Direct, DNA-competitive Inhibitor of DNA Methyltransferase 1*

    PubMed Central

    Fagan, Rebecca L.; Cryderman, Diane E.; Kopelovich, Levy; Wallrath, Lori L.; Brenner, Charles

    2013-01-01

    Methylation of cytosines in CpG dinucleotides is the predominant epigenetic mark on vertebrate DNA. DNA methylation is associated with transcriptional repression. The pattern of DNA methylation changes during development and with disease. Human DNA methyltransferase 1 (Dnmt1), a 1616-amino acid multidomain enzyme, is essential for maintenance of DNA methylation in proliferating cells and is considered an important cancer drug target. Using a fluorogenic, endonuclease-coupled DNA methylation assay with an activated form of Dnmt1 engineered to lack the replication foci targeting sequence domain, we discovered that laccaic acid A (LCA), a highly substituted anthraquinone natural product, is a direct inhibitor with a 310 nm Ki. LCA is competitive with the DNA substrate in in vitro methylation assays and alters the expression of methylated genes in MCF-7 breast cancer cells synergistically with 5-aza-2′-deoxycytidine. LCA represents a novel class of Dnmt-targeted molecular probes, with biochemical properties that allow it to distinguish between non DNA-bound and DNA-bound Dnmt1. PMID:23839987

  16. Jasmonic acid carboxyl methyltransferase regulates development and herbivory-induced defense response in rice.

    PubMed

    Qi, Jinfeng; Li, Jiancai; Han, Xiu; Li, Ran; Wu, Jianqiang; Yu, Haixin; Hu, Lingfei; Xiao, Yutao; Lu, Jing; Lou, Yonggen

    2016-06-01

    Jasmonic acid (JA) and related metabolites play a key role in plant defense and growth. JA carboxyl methyltransferase (JMT) may be involved in plant defense and development by methylating JA to methyl jasmonate (MeJA) and thus influencing the concentrations of JA and related metabolites. However, no JMT gene has been well characterized in monocotyledon defense and development at the molecular level. After we cloned a rice JMT gene, OsJMT1, whose encoding protein was localized in the cytosol, we found that the recombinant OsJMT1 protein catalyzed JA to MeJA. OsJMT1 is up-regulated in response to infestation with the brown planthopper (BPH; Nilaparvata lugens). Plants in which OsJMT1 had been overexpressed (oe-JMT plants) showed reduced height and yield. These oe-JMT plants also exhibited increased MeJA levels but reduced levels of herbivore-induced JA and jasmonoyl-isoleucine (JA-Ile). The oe-JMT plants were more attractive to BPH female adults but showed increased resistance to BPH nymphs, probably owing to the different responses of BPH female adults and nymphs to the changes in levels of H2 O2 and MeJA in oe-JMT plants. These results indicate that OsJMT1, by altering levels of JA and related metabolites, plays a role in regulating plant development and herbivore-induced defense responses in rice. © 2015 Institute of Botany, Chinese Academy of Sciences.

  17. Enzymatic, expression and structural divergences among carboxyl O-methyltransferases after gene duplication and speciation in Nicotiana.

    PubMed

    Hippauf, Frank; Michalsky, Elke; Huang, Ruiqi; Preissner, Robert; Barkman, Todd J; Piechulla, Birgit

    2010-02-01

    Methyl salicylate and methyl benzoate have important roles in a variety of processes including pollinator attraction and plant defence. These compounds are synthesized by salicylic acid, benzoic acid and benzoic acid/salicylic acid carboxyl methyltransferases (SAMT, BAMT and BSMT) which are members of the SABATH gene family. Both SAMT and BSMT were isolated from Nicotiana suaveolens, Nicotiana alata, and Nicotiana sylvestris allowing us to discern levels of enzyme divergence resulting from gene duplication in addition to species divergence. Phylogenetic analyses showed that Nicotiana SAMTs and BSMTs evolved in separate clades and the latter can be differentiated into the BSMT1 and the newly established BSMT2 branch. Although SAMT and BSMT orthologs showed minimal change coincident with species divergences, substantial evolutionary change of enzyme activity and expression patterns occurred following gene duplication. After duplication, the BSMT enzymes evolved higher preference for benzoic acid (BA) than salicylic acid (SA) whereas SAMTs maintained ancestral enzymatic preference for SA over BA. Expression patterns are largely complementary in that BSMT transcripts primarily accumulate in flowers, leaves and stems whereas SAMT is expressed mostly in roots. A novel enzyme, nicotinic acid carboxyl methyltransferase (NAMT), which displays a high degree of activity with nicotinic acid was discovered to have evolved in N. gossei from an ancestral BSMT. Furthermore a SAM-dependent synthesis of methyl anthranilate via BSMT2 is reported and contrasts with alternative biosynthetic routes previously proposed. While BSMT in flowers is clearly involved in methyl benzoate synthesis to attract pollinators, its function in other organs and tissues remains obscure.

  18. Lignification in Transgenic Poplars with Extremely Reduced Caffeic Acid O-Methyltransferase Activity1

    PubMed Central

    Jouanin, Lise; Goujon, Thomas; de Nadaï, Véronique; Martin, Marie-Thérèse; Mila, Isabelle; Vallet, Christelle; Pollet, Brigitte; Yoshinaga, Arata; Chabbert, Brigitte; Petit-Conil, Michel; Lapierre, Catherine

    2000-01-01

    Transgenic poplars (Populus tremula × Populus alba) were obtained by introduction of a sense homologous transgene encoding caffeic acid O-methyltransferase (COMT) under the control either of the cauliflower mosaic virus double 35S promoter or of the eucalyptus cinnamyl alcohol dehydrogenase promoter. Although these constructs conferred a moderate overexpression of COMT in some lines, a transgenic line with the double 35S promoter was found where COMT activity in woody tissues was close to zero due to a gene-silencing phenomenon. For the first time in COMT down-regulated trees, this alteration substantially reduced lignin level in 6-month-old trees (17% decrease). Lignin structure was found to be strongly altered, with a two times higher content in condensed bonds, an almost complete lack of syringyl units, and the incorporation of 5-hydroxyguaiacyl units to the most remarkable extent reported so far. Consistent with the higher cellulose content and with the higher condensation degree of the lignin, the impact of the transformation on the kraft-pulping performances of the poplar trees positively affected the pulp yield (10% relative increase), but made lignins less amenable to industrial degradations. PMID:10938354

  19. Genomic survey, gene expression analysis and structural modeling suggest diverse roles of DNA methyltransferases in legumes.

    PubMed

    Garg, Rohini; Kumari, Romika; Tiwari, Sneha; Goyal, Shweta

    2014-01-01

    DNA methylation plays a crucial role in development through inheritable gene silencing. Plants possess three types of DNA methyltransferases (MTases), namely Methyltransferase (MET), Chromomethylase (CMT) and Domains Rearranged Methyltransferase (DRM), which maintain methylation at CG, CHG and CHH sites. DNA MTases have not been studied in legumes so far. Here, we report the identification and analysis of putative DNA MTases in five legumes, including chickpea, soybean, pigeonpea, Medicago and Lotus. MTases in legumes could be classified in known MET, CMT, DRM and DNA nucleotide methyltransferases (DNMT2) subfamilies based on their domain organization. First three MTases represent DNA MTases, whereas DNMT2 represents a transfer RNA (tRNA) MTase. Structural comparison of all the MTases in plants with known MTases in mammalian and plant systems have been reported to assign structural features in context of biological functions of these proteins. The structure analysis clearly specified regions crucial for protein-protein interactions and regions important for nucleosome binding in various domains of CMT and MET proteins. In addition, structural model of DRM suggested that circular permutation of motifs does not have any effect on overall structure of DNA methyltransferase domain. These results provide valuable insights into role of various domains in molecular recognition and should facilitate mechanistic understanding of their function in mediating specific methylation patterns. Further, the comprehensive gene expression analyses of MTases in legumes provided evidence of their role in various developmental processes throughout the plant life cycle and response to various abiotic stresses. Overall, our study will be very helpful in establishing the specific functions of DNA MTases in legumes.

  20. Rice putative methyltransferase gene OsTSD2 is required for root development involving pectin modification

    PubMed Central

    Qu, Lianghuan; Wu, Chunyan; Zhang, Fei; Wu, Yangyang; Fang, Chuanying; Jin, Cheng; Liu, Xianqing; Luo, Jie

    2016-01-01

    Pectin synthesis and modification are vital for plant development, although the underlying mechanisms are still not well understood. Here, we report the functional characterization of the OsTSD2 gene, which encodes a putative methyltransferase in rice. All three independent T-DNA insertion lines of OsTSD2 displayed dwarf phenotypes and serial alterations in different zones of the root. These alterations included abnormal cellular adhesion and schizogenous aerenchyma formation in the meristematic zone, inhibited root elongation in the elongation zone, and higher lateral root density in the mature zone. Immunofluorescence (with LM19) and Ruthenium Red staining of the roots showed that unesterified homogalacturonan (HG) was increased in Ostsd2 mutants. Biochemical analysis of cell wall pectin polysaccharides revealed that both the monosaccharide composition and the uronic acid content were decreased in Ostsd2 mutants. Increased endogenous ABA content and opposite roles performed by ABA and IAA in regulating cellular adhesion in the Ostsd2 mutants suggested that OsTSD2 is required for root development in rice through a pathway involving pectin synthesis/modification. A hypothesis to explain the relationship among OsTSD2, pectin methylesterification, and root development is proposed, based on pectin’s function in regional cell extension/division in a zone-dependent manner. PMID:27497286

  1. Functional characterization of cinnamyl alcohol dehydrogenase and caffeic acid O-methyltransferase in Brachypodium distachyon

    PubMed Central

    2013-01-01

    Background Lignin is a significant barrier in the conversion of plant biomass to bioethanol. Cinnamyl alcohol dehydrogenase (CAD) and caffeic acid O-methyltransferase (COMT) catalyze key steps in the pathway of lignin monomer biosynthesis. Brown midrib mutants in Zea mays and Sorghum bicolor with impaired CAD or COMT activity have attracted considerable agronomic interest for their altered lignin composition and improved digestibility. Here, we identified and functionally characterized candidate genes encoding CAD and COMT enzymes in the grass model species Brachypodium distachyon with the aim of improving crops for efficient biofuel production. Results We developed transgenic plants overexpressing artificial microRNA designed to silence BdCAD1 or BdCOMT4. Both transgenes caused altered flowering time and increased stem count and weight. Downregulation of BdCAD1 caused a leaf brown midrib phenotype, the first time this phenotype has been observed in a C3 plant. While acetyl bromide soluble lignin measurements were equivalent in BdCAD1 downregulated and control plants, histochemical staining and thioacidolysis indicated a decrease in lignin syringyl units and reduced syringyl/guaiacyl ratio in the transgenic plants. BdCOMT4 downregulated plants exhibited a reduction in total lignin content and decreased Maule staining of syringyl units in stem. Ethanol yield by microbial fermentation was enhanced in amiR-cad1-8 plants. Conclusion These results have elucidated two key genes in the lignin biosynthetic pathway in B. distachyon that, when perturbed, may result in greater stem biomass yield and bioconversion efficiency. PMID:23902793

  2. Histone methyltransferases regulating rRNA gene dose and dosage control in Arabidopsis

    PubMed Central

    Pontvianne, Frédéric; Blevins, Todd; Chandrasekhara, Chinmayi; Feng, Wei; Stroud, Hume; Jacobsen, Steven E.; Michaels, Scott D.; Pikaard, Craig S.

    2012-01-01

    Eukaryotes have hundreds of nearly identical 45S ribosomal RNA (rRNA) genes, each encoding the 18S, 5.8S, and 25S catalytic rRNAs. Because cellular demands for ribosomes and protein synthesis vary during development, the number of active rRNA genes is subject to dosage control. In genetic hybrids, one manifestation of dosage control is nucleolar dominance, an epigenetic phenomenon in which the rRNA genes of one progenitor are repressed. For instance, in Arabidopsis suecica, the allotetraploid hybrid of Arabidopsis thaliana and Arabidopsis arenosa, the A. thaliana-derived rRNA genes are selectively silenced. An analogous phenomenon occurs in nonhybrid A. thaliana, in which specific classes of rRNA gene variants are inactivated. An RNA-mediated knockdown screen identified SUVR4 {SUPPRESSOR OF VARIEGATION 3-9 [SU(VAR)3-9]-RELATED 4} as a histone H3 Lys 9 (H3K9) methyltransferase required for nucleolar dominance in A. suecica. H3K9 methyltransferases are also required for variant-specific silencing in A. thaliana, but SUVH5 [SU(VAR)3-9 HOMOLOG 5] and SUVH6, rather than SUVR4, are the key activities in this genomic context. Mutations disrupting the H3K27 methyltransferases ATXR5 or ATXR6 affect which rRNA gene variants are expressed or silenced, and in atxr5 atxr6 double mutants, dominance relationships among variants are reversed relative to wild type. Interestingly, these changes in gene expression are accompanied by changes in the relative abundance of the rRNA gene variants at the DNA level, including overreplication of the normally silenced class and decreased abundance of the normally dominant class. Collectively, our results indicate that histone methylation can affect both the doses of different variants and their differential silencing through the choice mechanisms that achieve dosage control. PMID:22549957

  3. Melatonin production in Escherichia coli by dual expression of serotonin N-acetyltransferase and caffeic acid O-methyltransferase.

    PubMed

    Byeon, Yeong; Back, Kyoungwhan

    2016-08-01

    Melatonin is a well-known bioactive molecule produced in animals and plants and a well-studied natural compound. Two enzymatic steps are required for the biosynthesis of melatonin from serotonin. First, serotonin N-acetyltransferase (SNAT) catalyzes serotonin to N-acetylserotonin (NAS) followed by the action of N-acetylserotonin O-methyltransferase (ASMT), resulting in the synthesis of O-methylated NAS, also known as melatonin. Attempts to document melatonin production in Escherichia coli have been unsuccessful to date due to either low enzyme activity or inactive ASMT expression. Here, we employed caffeic acid O-methyltransferase (COMT) instead of ASMT, as COMT is a multifunctional enzyme that has ASMT activity as well. Among several combinations of dual expression cassettes, recombinant E. coli that expressed sheep SNAT with rice COMT produced a high quantity of melatonin, which was measured in a culture medium (1.46 mg/L in response to 1 mM serotonin). This level was several orders of magnitude higher than that produced in transgenic rice and tomato overexpressing sheep SNAT and ASMT, respectively. This heterologous expression system can be widely employed to screen various putative SNAT or ASMT genes from animals and plants as well as to overproduce melatonin in various useful microorganisms.

  4. Functional Analysis of an Acid Adaptive DNA Adenine Methyltransferase from Helicobacter pylori 26695

    PubMed Central

    Banerjee, Arun; Rao, Desirazu N.

    2011-01-01

    HP0593 DNA-(N6-adenine)-methyltransferase (HP0593 MTase) is a member of a Type III restriction-modification system in Helicobacter pylori strain 26695. HP0593 MTase has been cloned, overexpressed and purified heterologously in Escherichia coli. The recognition sequence of the purified MTase was determined as 5′-GCAG-3′and the site of methylation was found to be adenine. The activity of HP0593 MTase was found to be optimal at pH 5.5. This is a unique property in context of natural adaptation of H. pylori in its acidic niche. Dot-blot assay using antibodies that react specifically with DNA containing m6A modification confirmed that HP0593 MTase is an adenine-specific MTase. HP0593 MTase occurred as both monomer and dimer in solution as determined by gel-filtration chromatography and chemical-crosslinking studies. The nonlinear dependence of methylation activity on enzyme concentration indicated that more than one molecule of enzyme was required for its activity. Analysis of initial velocity with AdoMet as a substrate showed that two molecules of AdoMet bind to HP0593 MTase, which is the first example in case of Type III MTases. Interestingly, metal ion cofactors such as Co2+, Mn2+, and also Mg2+ stimulated the HP0593 MTase activity. Preincubation and isotope partitioning analyses clearly indicated that HP0593 MTase-DNA complex is catalytically competent, and suggested that DNA binds to the MTase first followed by AdoMet. HP0593 MTase shows a distributive mechanism of methylation on DNA having more than one recognition site. Considering the occurrence of GCAG sequence in the potential promoter regions of physiologically important genes in H. pylori, our results provide impetus for exploring the role of this DNA MTase in the cellular processes of H. pylori. PMID:21347417

  5. Cyclopiazonic acid biosynthesis gene cluster gene cpaM is required for speradine A biosynthesis.

    PubMed

    Tokuoka, Masafumi; Kikuchi, Tomoki; Shinohara, Yasutomo; Koyama, Akifumi; Iio, Shin-Ichiro; Kubota, Takaaki; Kobayashi, Jun'ichi; Koyama, Yasuji; Totsuka, Akira; Shindo, Hitoshi; Sato, Kazuo

    2015-01-01

    Speradine A is a derivative of cyclopiazonic acid (CPA) found in culture of an Aspergillus tamarii isolate. Heterologous expression of a predicted methyltransferase gene, cpaM, in the cpa biosynthesis gene cluster of A. tamarii resulted in the speradine A production in a 2-oxoCPA producing A. oryzae strain, indicating cpaM is involved in the speradine A biosynthesis.

  6. Direct methylation of FXR by Set7/9, a lysine methyltransferase, regulates the expression of FXR target genes

    PubMed Central

    Balasubramaniyan, Natarajan; Ananthanarayanan, Meena

    2012-01-01

    The farnesoid X receptor (FXR) is a ligand (bile acid)-dependent nuclear receptor that regulates target genes involved in every aspect of bile acid homeostasis. Upon binding of ligand, FXR recruits an array of coactivators and associated proteins, some of which have intrinsic enzymatic activity that modify histones or even components of the transcriptional complex. In this study, we show chromatin occupancy by the Set7/9 methyltransferase at the FXR response element (FXRE) and direct methylation of FXR in vivo and in vitro at lysine 206. siRNA depletion of Set7/9 in the Huh-7 liver cell line decreased endogenous mRNAs of the FXR target genes, the short heterodimer partner (SHP) and bile salt export pump (BSEP). Mutation of the methylation site at K206 of FXR to an arginine prevented methylation by Set7/9. A pan-methyllysine antibody recognized the wild-type FXR but not the K206R mutant form. An electromobility shift assay showed that methylation by Set7/9 enhanced binding of FXR/retinoic X receptor-α to the FXRE. Interaction between hinge domain of FXR (containing K206) and Set7/9 was confirmed by coimmunoprecipitation, GST pull down, and mammalian two-hybrid experiments. Set7/9 overexpression in Huh-7 cells significantly enhanced transactivation of the SHP and BSEP promoters in a ligand-dependent fashion by wild-type FXR but not the K206R mutant FXR. A Set7/9 mutant deficient in methyltransferase activity was also not effective in increasing transactivation of the BSEP promoter. These studies demonstrate that posttranslational methylation of FXR by Set7/9 contributes to the transcriptional activation of FXR-target genes. PMID:22345554

  7. Structure and regulation of the mDot1 gene, a mouse histone H3 methyltransferase.

    PubMed Central

    Zhang, Wenzheng; Hayashizaki, Yoshihide; Kone, Bruce C

    2004-01-01

    The nucleotide sequence data reported have been deposited in the DDBJ, EMBL, GenBank(R) and GSDB Nucleotide Sequence Databases under accession numbers AY196089, AY196090, AY376663, AY377920 and AY376664. Recently, a new class of histone methyltransferases that plays an indirect role in chromatin silencing by targeting a conserved lysine residue in the nucleosome core was described, namely the Dot1 (disruptor of telomeric silencing) family [Feng, Wang, Ng, Erdjument-Bromage, Tempst, Struhl and Zhang (2002) Curr. Biol. 12, 1052-1058; van Leeuwen, Gafken and Gottschling (2002) Cell (Cambridge, Mass.) 109, 745-756; Ng, Feng, Wang, Erdjument-Bromage, Tempst, Zhang and Struhl (2002) Genes Dev. 16, 1518-1527]. In the present study, we report the isolation, genomic organization and in vivo expression of a mouse Dot1 homologue (mDot1). Expressed sequence tag analysis identified five mDot1 mRNAs (mDot1a-mDot1e) derived from alternative splicing. mDot1a and mDot1b encode 1540 and 1114 amino acids respectively, whereas mDot1c-mDot1e are incomplete at the 5'-end. mDot1a is closest to its human counterpart (hDot1L), sharing 84% amino acid identity. mDot1b is truncated at its N- and C-termini and contains an internal deletion. The five mDot1 isoforms are encoded by 28 exons on chromosome 10qC1, with exons 24 and 28 further divided into two and four sections respectively. Alternative splicing occurs in exons 3, 4, 12, 24, 27 and 28. Northern-blot analysis with probes corresponding to the methyltransferase domain or the mDot1a-coding region detected 7.6 and 9.5 kb transcripts in multiple tissues, but only the 7.6 kb transcript was evident in mIMCD3-collecting duct cells. Transfection of mDot1a-EGFP constructs (where EGFP stands for enhanced green fluorescent protein) into human embryonic kidney (HEK)-293T or mIMCD3 cells increased the methylation of H3-K79 but not H3-K4, -K9 or -K36. Furthermore, DMSO induced mDot1 gene expression and methylation specifically at H3-K79 in mIMCD3

  8. The putative protein methyltransferase LAE1 controls cellulase gene expression in Trichoderma reesei.

    PubMed

    Seiboth, Bernhard; Karimi, Razieh Aghcheh; Phatale, Pallavi A; Linke, Rita; Hartl, Lukas; Sauer, Dominik G; Smith, Kristina M; Baker, Scott E; Freitag, Michael; Kubicek, Christian P

    2012-06-01

    Trichoderma reesei is an industrial producer of enzymes that degrade lignocellulosic polysaccharides to soluble monomers, which can be fermented to biofuels. Here we show that the expression of genes for lignocellulose degradation are controlled by the orthologous T. reesei protein methyltransferase LAE1. In a lae1 deletion mutant we observed a complete loss of expression of all seven cellulases, auxiliary factors for cellulose degradation, β-glucosidases and xylanases were no longer expressed. Conversely, enhanced expression of lae1 resulted in significantly increased cellulase gene transcription. Lae1-modulated cellulase gene expression was dependent on the function of the general cellulase regulator XYR1, but also xyr1 expression was LAE1-dependent. LAE1 was also essential for conidiation of T. reesei. Chromatin immunoprecipitation followed by high-throughput sequencing ('ChIP-seq') showed that lae1 expression was not obviously correlated with H3K4 di- or trimethylation (indicative of active transcription) or H3K9 trimethylation (typical for heterochromatin regions) in CAZyme coding regions, suggesting that LAE1 does not affect CAZyme gene expression by directly modulating H3K4 or H3K9 methylation. Our data demonstrate that the putative protein methyltransferase LAE1 is essential for cellulase gene expression in T. reesei through mechanisms that remain to be identified.

  9. The putative protein methyltransferase LAE1 controls cellulase gene expression in Trichoderma reesei

    PubMed Central

    Seiboth, Bernhard; Karimi, Razieh Aghcheh; Phatale, Pallavi A; Linke, Rita; Hartl, Lukas; Sauer, Dominik G; Smith, Kristina M; Baker, Scott E; Freitag, Michael; Kubicek, Christian P

    2012-01-01

    Summary Trichoderma reesei is an industrial producer of enzymes that degrade lignocellulosic polysaccharides to soluble monomers, which can be fermented to biofuels. Here we show that the expression of genes for lignocellulose degradation are controlled by the orthologous T. reesei protein methyltransferase LAE1. In a lae1 deletion mutant we observed a complete loss of expression of all seven cellulases, auxiliary factors for cellulose degradation, β-glucosidases and xylanases were no longer expressed. Conversely, enhanced expression of lae1 resulted in significantly increased cellulase gene transcription. Lae1-modulated cellulase gene expression was dependent on the function of the general cellulase regulator XYR1, but also xyr1 expression was LAE1-dependent. LAE1 was also essential for conidiation of T. reesei. Chromatin immunoprecipitation followed by high-throughput sequencing (‘ChIP-seq’) showed that lae1 expression was not obviously correlated with H3K4 di- or trimethylation (indicative of active transcription) or H3K9 trimethylation (typical for heterochromatin regions) in CAZyme coding regions, suggesting that LAE1 does not affect CAZyme gene expression by directly modulating H3K4 or H3K9 methylation. Our data demonstrate that the putative protein methyltransferase LAE1 is essential for cellulase gene expression in T. reesei through mechanisms that remain to be identified. PMID:22554051

  10. Molecular and biochemical characterization of the selenocysteine Se-methyltransferase gene and Se-methylselenocysteine synthesis in broccoli.

    PubMed

    Lyi, Sangbom M; Heller, Laurence I; Rutzke, Michael; Welch, Ross M; Kochian, Leon V; Li, Li

    2005-05-01

    Selenium (Se) plays an indispensable role in human nutrition and has been implicated to have important health benefits, including being a cancer preventative agent. While different forms of Se vary in their anticarcinogenic efficacy, Se-methylselenocysteine (SeMSC) has been demonstrated to be one of the most effective chemopreventative compounds. Broccoli (Brassica oleracea var. italica) is known for its ability to accumulate high levels of Se with the majority of the selenoamino acids in the form of Se-methylselenocysteine. Therefore, it serves as a good model to study the regulation of SeMSC accumulation in plants. A cDNA encoding selenocysteine Se-methyltransferase, the key enzyme responsible for SeMSC formation, was cloned from broccoli using a homocysteine S-methyltransferase gene probe from Arabidopsis (Arabidopsis thaliana). This clone, designated as BoSMT, was functionally expressed in Escherichia coli, and its identity was confirmed by its substrate specificity in the methylation of selenocysteine. The BoSMT gene represents a single copy sequence in the broccoli genome. Examination of BoSMT gene expression and SeMSC accumulation in response to selenate, selenite, and sulfate treatments showed that the BoSMT transcript and SeMSC synthesis were significantly up-regulated in plants exposed to selenate but were low in plants supplied with selenite. Simultaneous treatment of selenate with selenite significantly reduced SeMSC production. In addition, high levels of sulfate suppressed selenate uptake, resulting in a dramatic reduction of BoSMT mRNA level and SeMSC accumulation. Our results reveal that SeMSC accumulation closely correlated with the BoSMT gene expression and the total Se status in tissues and provide important information for maximizing the SeMSC production in this beneficial vegetable plant.

  11. Structural characterization of CalO1: a putative orsellinic acid methyltransferase in the calicheamicin-biosynthetic pathway

    SciTech Connect

    Chang, Aram; Singh, Shanteri; Bingman, Craig A.; Thorson, Jon S.; Phillips, Jr, George N.

    2011-11-07

    The X-ray structure determination at 2.4 {angstrom} resolution of the putative orsellinic acid C3 O-methyltransferase (CalO1) involved in calicheamicin biosynthesis is reported. Comparison of CalO1 with a homology model of the functionally related calicheamicin orsellinic acid C2 O-methyltransferase (CalO6) implicates several residues that are likely to contribute to the regiospecificity of alkylation. Consistent with the proposed requirement of an acyl-carrier-protein-bound substrate, this structural study also reveals structural determinants within CalO1 that are anticipated to accommodate an association with an acyl carrier protein.

  12. X-ray crystal structure of N-6 adenine deoxyribose nucleic acid methyltransferase from Streptococcus pneumoniae

    NASA Astrophysics Data System (ADS)

    Tran, Phidung Hong

    X-ray diffraction by using resonant anomalous scattering has become a popular tool for solving crystal structures in the last ten years with the expanded availability of tunable synchrotron radiation for protein crystallography. Mercury atoms were used for phasing. The crystal structure of N-6 deoxyribose nucleic acid methyltransferase from Streptoccocus pneumoniae (DpnM) was solved by using the Multiple Anomalous Diffraction technique. The crystal structure reveals the formation of mercaptide between the mercury ion and the thiol group on the cysteine amino acid in a hydrophobic environment. The crystal structure contains the bound ligand, S- adenosyl-l-methionine on the surface of the concave opening. The direction of the β-strands on the beta sheets are identical to other solved methyltransferases. The highly conserved motifs, DPPY and the FxGxG, are found to be important in ligand binding and possibly in methyl group transfer. The structure has a concave cleft with an opening on the order of 30 Å that can accommodate a DNA duplex. By molecular modelling coupled to sequence alignment, two other highly conserved residues Arg21 and Gly19 are found to be important in catalysis.

  13. Comparative Analysis of DNA Methyltransferase Gene Family in Fungi: A Focus on Basidiomycota.

    PubMed

    Huang, Ruirui; Ding, Qiangqiang; Xiang, Yanan; Gu, Tingting; Li, Yi

    2016-01-01

    DNA methylation plays a crucial role in the regulation of gene expression in eukaryotes. Mushrooms belonging to the phylum Basidiomycota are highly valued for both nutritional and pharmaceutical uses. A growing number of studies have demonstrated the significance of DNA methylation in the development of plants and animals. However, our understanding of DNA methylation in mushrooms is limited. In this study, we identified and conducted comprehensive analyses on DNA methyltransferases (DNMtases) in representative species from Basidiomycota and Ascomycota, and obtained new insights into their classification and characterization in fungi. Our results revealed that DNMtases in basidiomycetes can be divided into two classes, the Dnmt1 class and the newly defined Rad8 class. We also demonstrated that the fusion event between the characteristic domains of the DNMtases family and Snf2 family in the Rad8 class is fungi-specific, possibly indicating a functional novelty of Rad8 DNMtases in fungi. Additionally, expression profiles of DNMtases in the edible mushroom Pleurotus ostreatus revealed diverse expression patterns in various organs and developmental stages. For example, DNMtase genes displayed higher expression levels in dikaryons than in monokaryons. Consistent with the expression profiles, we found that dikaryons are more susceptible to the DNA methyltransferase inhibitor 5-azacytidine. Taken together, our findings pinpoint an important role of DNA methylation during the growth of mushrooms and provide a foundation for understanding of DNMtases in basidiomycetes.

  14. Comparative Analysis of DNA Methyltransferase Gene Family in Fungi: A Focus on Basidiomycota

    PubMed Central

    Huang, Ruirui; Ding, Qiangqiang; Xiang, Yanan; Gu, Tingting; Li, Yi

    2016-01-01

    DNA methylation plays a crucial role in the regulation of gene expression in eukaryotes. Mushrooms belonging to the phylum Basidiomycota are highly valued for both nutritional and pharmaceutical uses. A growing number of studies have demonstrated the significance of DNA methylation in the development of plants and animals. However, our understanding of DNA methylation in mushrooms is limited. In this study, we identified and conducted comprehensive analyses on DNA methyltransferases (DNMtases) in representative species from Basidiomycota and Ascomycota, and obtained new insights into their classification and characterization in fungi. Our results revealed that DNMtases in basidiomycetes can be divided into two classes, the Dnmt1 class and the newly defined Rad8 class. We also demonstrated that the fusion event between the characteristic domains of the DNMtases family and Snf2 family in the Rad8 class is fungi-specific, possibly indicating a functional novelty of Rad8 DNMtases in fungi. Additionally, expression profiles of DNMtases in the edible mushroom Pleurotus ostreatus revealed diverse expression patterns in various organs and developmental stages. For example, DNMtase genes displayed higher expression levels in dikaryons than in monokaryons. Consistent with the expression profiles, we found that dikaryons are more susceptible to the DNA methyltransferase inhibitor 5-azacytidine. Taken together, our findings pinpoint an important role of DNA methylation during the growth of mushrooms and provide a foundation for understanding of DNMtases in basidiomycetes. PMID:27818666

  15. Disruption of the methyltransferase-like 23 gene METTL23 causes mild autosomal recessive intellectual disability

    PubMed Central

    Bernkopf, Marie; Webersinke, Gerald; Tongsook, Chanakan; Koyani, Chintan N.; Rafiq, Muhammad A.; Ayaz, Muhammad; Müller, Doris; Enzinger, Christian; Aslam, Muhammad; Naeem, Farooq; Schmidt, Kurt; Gruber, Karl; Speicher, Michael R.; Malle, Ernst; Macheroux, Peter; Ayub, Muhammad; Vincent, John B.; Windpassinger, Christian; Duba, Hans-Christoph

    2014-01-01

    We describe the characterization of a gene for mild nonsyndromic autosomal recessive intellectual disability (ID) in two unrelated families, one from Austria, the other from Pakistan. Genome-wide single nucleotide polymorphism microarray analysis enabled us to define a region of homozygosity by descent on chromosome 17q25. Whole-exome sequencing and analysis of this region in an affected individual from the Austrian family identified a 5 bp frameshifting deletion in the METTL23 gene. By means of Sanger sequencing of METTL23, a nonsense mutation was detected in a consanguineous ID family from Pakistan for which homozygosity-by-descent mapping had identified a region on 17q25. Both changes lead to truncation of the putative METTL23 protein, which disrupts the predicted catalytic domain and alters the cellular localization. 3D-modelling of the protein indicates that METTL23 is strongly predicted to function as an S-adenosyl-methionine (SAM)-dependent methyltransferase. Expression analysis of METTL23 indicated a strong association with heat shock proteins, which suggests that these may act as a putative substrate for methylation by METTL23. A number of methyltransferases have been described recently in association with ID. Disruption of METTL23 presented here supports the importance of methylation processes for intact neuronal function and brain development. PMID:24626631

  16. Caffeine synthase and related methyltransferases in plants.

    PubMed

    Misako, Kato; Kouichi, Mizuno

    2004-05-01

    Caffeine (1,3,7-trimethylxanthine) is a purine alkaloid present in high concentrations in tea and coffee and it is also found in a number of beverages such as coca cola. It is necessary to elucidate the caffeine biosynthetic pathway and to clone the genes related to the production of caffeine not only to determine the metabolism of the purine alkaloid but also to control the content of caffeine in tea and coffee. The available data support the operation of a xanthosine-->7-methylxanthosine-->7-methylxanthine-->theobromine-->caffeine pathway as the major route to caffeine. Since the caffeine biosynthetic pathway contains three S-adenosyl-L-methionine (SAM) dependent methylation steps, N-methyltransferases play important roles. This review focuses on the enzymes and genes involved in the methylation of purine ring. Caffeine synthase, the SAM-dependent methyltransferase involved in the last two steps of caffeine biosynthesis, was originally purified from young tea leaves (Camellia sinensis). The isolated cDNA, termed TCS1, consists of 1,483 base pairs and encodes a protein of 369 amino acids. Subsequently, the homologous genes that encode caffeine biosynthetic enzymes from coffee (Coffea arabica) were isolated. The recombinant proteins are classified into the three types on the basis of their substrate specificity i.e. 7-methylxanthosine synthase, theobromine synthase and caffeine synthase. The predicted amino acid sequences of caffeine biosynthetic enzymes derived from C. arabica exhibit more than 80% homology with those of the clones and but show only 40% homology with TCS1 derived from C. sinensis. In addition, they share 40% homology with the amino acid sequences of salicylic carboxyl methyltransferase, benzoic acid carboxyl methyltransferase and jasmonic acid carboxyl methyltransferase which belong to a family of motif B' methyltransferases which are novel plant methyltransferases with motif B' instead of motif B as the conserved region.

  17. Mutations in the histone methyltransferase gene KMT2B cause complex early-onset dystonia.

    PubMed

    Meyer, Esther; Carss, Keren J; Rankin, Julia; Nichols, John M E; Grozeva, Detelina; Joseph, Agnel P; Mencacci, Niccolo E; Papandreou, Apostolos; Ng, Joanne; Barral, Serena; Ngoh, Adeline; Ben-Pazi, Hilla; Willemsen, Michel A; Arkadir, David; Barnicoat, Angela; Bergman, Hagai; Bhate, Sanjay; Boys, Amber; Darin, Niklas; Foulds, Nicola; Gutowski, Nicholas; Hills, Alison; Houlden, Henry; Hurst, Jane A; Israel, Zvi; Kaminska, Margaret; Limousin, Patricia; Lumsden, Daniel; McKee, Shane; Misra, Shibalik; Mohammed, Shekeeb S; Nakou, Vasiliki; Nicolai, Joost; Nilsson, Magnus; Pall, Hardev; Peall, Kathryn J; Peters, Gregory B; Prabhakar, Prab; Reuter, Miriam S; Rump, Patrick; Segel, Reeval; Sinnema, Margje; Smith, Martin; Turnpenny, Peter; White, Susan M; Wieczorek, Dagmar; Wiethoff, Sarah; Wilson, Brian T; Winter, Gidon; Wragg, Christopher; Pope, Simon; Heales, Simon J H; Morrogh, Deborah; Pittman, Alan; Carr, Lucinda J; Perez-Dueñas, Belen; Lin, Jean-Pierre; Reis, Andre; Gahl, William A; Toro, Camilo; Bhatia, Kailash P; Wood, Nicholas W; Kamsteeg, Erik-Jan; Chong, Wui K; Gissen, Paul; Topf, Maya; Dale, Russell C; Chubb, Jonathan R; Raymond, F Lucy; Kurian, Manju A

    2017-02-01

    Histone lysine methylation, mediated by mixed-lineage leukemia (MLL) proteins, is now known to be critical in the regulation of gene expression, genomic stability, cell cycle and nuclear architecture. Despite MLL proteins being postulated as essential for normal development, little is known about the specific functions of the different MLL lysine methyltransferases. Here we report heterozygous variants in the gene KMT2B (also known as MLL4) in 27 unrelated individuals with a complex progressive childhood-onset dystonia, often associated with a typical facial appearance and characteristic brain magnetic resonance imaging findings. Over time, the majority of affected individuals developed prominent cervical, cranial and laryngeal dystonia. Marked clinical benefit, including the restoration of independent ambulation in some cases, was observed following deep brain stimulation (DBS). These findings highlight a clinically recognizable and potentially treatable form of genetic dystonia, demonstrating the crucial role of KMT2B in the physiological control of voluntary movement.

  18. Identification of ribosomal RNA methyltransferase gene ermF in Riemerella anatipestifer.

    PubMed

    Luo, Hongyan; Liu, Mafeng; Wang, Lanying; Zhou, Wangshu; Wang, Mingshu; Cheng, Anchun; Jia, Renyong; Chen, Shun; Sun, Kunfeng; Yang, Qiao; Chen, Xiaoyue; Zhu, Dekang

    2015-01-01

    Riemerella anatipestifer is a major bacterial pathogen of waterfowl, globally responsible for avian septicaemic disease. As chemotherapy is the predominant method for the prevention and treatment of R. anatipestifer infection in poultry, the widespread use of antibiotics has favoured the emergence of antibiotic-resistant strains. However, little is known about R. anatipestifer susceptibility to macrolide antibiotics and its resistance mechanism. We report for the first time the identification of a macrolide resistance mechanism in R. anatipestifer that is mediated by the ribosomal RNA methyltransferase ermF. We identified the presence of the ermF gene in 64/206 (31%) R. anatipestifer isolates from different regions in China. An ermF deletion strain was constructed to investigate the function of the ermF gene on the resistance to high levels of macrolides. The ermF mutant strain showed significantly decreased resistance to macrolide and lincosamide, exhibiting 1024-, 1024-, 4- and >2048-fold reduction in the minimum inhibitory concentrations for erythromycin, azithromycin, tylosin and lincomycin, respectively. Furthermore, functional analysis of ermF expression in E. coli XL1-blue showed that the R. anatipestifer ermF gene was functional in E. coli XL1-blue and conferred resistance to high levels of erythromycin (100 µg/ml), supporting the hypothesis that the ermF gene is associated with high-level macrolide resistance. Our work suggests that ribosomal RNA modification mediated by the ermF methyltransferase is the predominant mechanism of resistance to erythromycin in R. anatipestifer isolates.

  19. Molecular characterization, phylogenetic analysis and expression patterns of five protein arginine methyltransferase genes of channel catfish, Ictalurus punctatus (Rafinesque).

    PubMed

    Yeh, Hung-Yueh; Klesius, Phillip H

    2012-08-01

    Protein arginine methylation, catalyzed by protein arginine methyltransferases (PRMT), has recently emerged as an important modification in the regulation of gene expression. In this communication, we identified and characterized the channel catfish orthologs to human PRMT 1, 3, 4 and 5, and PRMT4 like. Each PRMT nucleic acid sequence has an open reading frame (ORF) and 3'-untranslated regions. Each ORF appears to encode 361, 587 and 458 amino acid residues for PRMT1, PRMT4 and variant, respectively. The partial ORF of PRMT3 and PRMT5 encode 292 and 563 amino acids, respectively. By comparison with the human counterparts, each channel catfish PRMT also has conserved domains. For expression profile, the channel catfish PRMT1 transcript was detected by RT-PCR in spleens, anterior kidneys, livers, intestines, skin and gills of fish examined. Except in liver, the PRMT3 transcript was detected in all catfish tissues examined. However, the PRMT4 cDNA was detected in livers from all three catfish and gills from two fish, but not other tissues. This information will enable us to further elucidate PRMT functions in channel catfish.

  20. Molecular characterization, phylogenetic analysis and expression patterns of five protein arginine methyltransferase genes of channel catfish, Ictalurus punctatus (Rafinesque)

    USDA-ARS?s Scientific Manuscript database

    Protein arginine methylation, catalyzed by protein arginine methyltransferases (PRMT), has recently emerged as an important modification in the regulation of gene expression. In this communication, we identified and characterized the channel catfish orthologs to human PRMT 1, 3, 4 and 5, and PRMT4 ...

  1. Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms

    PubMed Central

    Jiang, Weili; Shang, Siyuan; Su, Yanjie

    2015-01-01

    People may experience an “aha” moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving. PMID:26528222

  2. Genetic influences on insight problem solving: the role of catechol-O-methyltransferase (COMT) gene polymorphisms.

    PubMed

    Jiang, Weili; Shang, Siyuan; Su, Yanjie

    2015-01-01

    People may experience an "aha" moment, when suddenly realizing a solution of a puzzling problem. This experience is called insight problem solving. Several findings suggest that catecholamine-related genes may contribute to insight problem solving, among which the catechol-O-methyltransferase (COMT) gene is the most promising candidate. The current study examined 753 healthy individuals to determine the associations between 7 candidate single nucleotide polymorphisms on the COMT gene and insight problem-solving performance, while considering gender differences. The results showed that individuals carrying A allele of rs4680 or T allele of rs4633 scored significantly higher on insight problem-solving tasks, and the COMT gene rs5993883 combined with gender interacted with correct solutions of insight problems, specifically showing that this gene only influenced insight problem-solving performance in males. This study presents the first investigation of the genetic impact on insight problem solving and provides evidence that highlights the role that the COMT gene plays in insight problem solving.

  3. Nicotinamide-N-Methyltransferase gene rs694539 variant and migraine risk.

    PubMed

    Sazci, Ali; Sazci, Gensay; Sazci, Bilgen; Ergul, Emel; Idrisoglu, Halil Atilla

    2016-12-01

    Migraine is a common neurovascular disorder affecting 10 to 20 % of the world population usually subdivided into migraine with auro (MA) and migraine without auro (MO). Homocysteine is involved in the pathophysiology of a number of neurological disorders. Elevated levels of homocysteine in the plasma is produced by the MTHFR gene rs 1801133 and rs 1801131 variants as well as the NNMT gene rs 694539 variant. With the polymerase chain reaction-restriction fragment length polymorphism method developed recently in our laboratory, we were able to show an association between the NNMT gene rs694539 variant and migraine for the first time. Here we report the association of the Nicotinamide-N-methyltransferase gene (NNMT) rs694539 variant with migraine in a case-control study of 433 patients with migraine and 229 healthy controls (χ2 = 6.076, P = 0.048). After stratification, we were able only to show an association between the NNMT gene rs694539 variant and female patients with migraine on the genotype and allelic levels. However there was no association in male patients with migraine (χ2 = 1.054, P = 0.590). Consequently our results clearly indicate that the NNMT gene rs694539 variant is a genetic risk factor for migraine.

  4. Chimeric DNA methyltransferases target DNA methylation to specific DNA sequences and repress expression of target genes

    PubMed Central

    Li, Fuyang; Papworth, Monika; Minczuk, Michal; Rohde, Christian; Zhang, Yingying; Ragozin, Sergei; Jeltsch, Albert

    2007-01-01

    Gene silencing by targeted DNA methylation has potential applications in basic research and therapy. To establish targeted methylation in human cell lines, the catalytic domains (CDs) of mouse Dnmt3a and Dnmt3b DNA methyltransferases (MTases) were fused to different DNA binding domains (DBD) of GAL4 and an engineered Cys2His2 zinc finger domain. We demonstrated that (i) Dense DNA methylation can be targeted to specific regions in gene promoters using chimeric DNA MTases. (ii) Site-specific methylation leads to repression of genes controlled by various cellular or viral promoters. (iii) Mutations affecting any of the DBD, MTase or target DNA sequences reduce targeted methylation and gene silencing. (iv) Targeted DNA methylation is effective in repressing Herpes Simplex Virus type 1 (HSV-1) infection in cell culture with the viral titer reduced by at least 18-fold in the presence of an MTase fused to an engineered zinc finger DBD, which binds a single site in the promoter of HSV-1 gene IE175k. In short, we show here that it is possible to direct DNA MTase activity to predetermined sites in DNA, achieve targeted gene silencing in mammalian cell lines and interfere with HSV-1 propagation. PMID:17151075

  5. The catechol-O-methyltransferase gene (COMT) and cognitive function from childhood through adolescence

    PubMed Central

    Gaysina, Darya; Xu, Man K.; Barnett, Jennifer H.; Croudace, Tim J.; Wong, Andrew; Richards, Marcus; Jones, Peter B.

    2013-01-01

    Genetic variation in the catechol-O-methyltransferase gene (COMT) can influence cognitive function, and this effect may depend on developmental stage. Using a large representative British birth cohort, we investigated the effect of COMT on cognitive function (verbal and non-verbal) at ages 8 and 15 years taking into account the possible modifying effect of pubertal stage. Five functional COMT polymorphisms, rs6269, rs4818, rs4680, rs737865 and rs165599 were analysed. Associations between COMT polymorphisms and cognition were tested using regression and latent variable structural equation modelling (SEM). Before correction for multiple testing, COMT rs737865 showed association with reading comprehension, verbal ability and global cognition at age 15 years in pubescent boys only. Although there was some evidence for age- and sex-specific effects of the COMT rs737865 none remained significant after correction for multiple testing. Further studies are necessary in order to make firmer conclusions. PMID:23178897

  6. The catechol-O-methyltransferase gene (COMT) and cognitive function from childhood through adolescence.

    PubMed

    Gaysina, Darya; Xu, Man K; Barnett, Jennifer H; Croudace, Tim J; Wong, Andrew; Richards, Marcus; Jones, Peter B

    2013-02-01

    Genetic variation in the catechol-O-methyltransferase gene (COMT) can influence cognitive function, and this effect may depend on developmental stage. Using a large representative British birth cohort, we investigated the effect of COMT on cognitive function (verbal and non-verbal) at ages 8 and 15 years taking into account the possible modifying effect of pubertal stage. Five functional COMT polymorphisms, rs6269, rs4818, rs4680, rs737865 and rs165599 were analysed. Associations between COMT polymorphisms and cognition were tested using regression and latent variable structural equation modelling (SEM). Before correction for multiple testing, COMT rs737865 showed association with reading comprehension, verbal ability and global cognition at age 15 years in pubescent boys only. Although there was some evidence for age- and sex-specific effects of the COMT rs737865 none remained significant after correction for multiple testing. Further studies are necessary in order to make firmer conclusions.

  7. Engineering Escherichia coli for biodiesel production utilizing a bacterial fatty acid methyltransferase.

    PubMed

    Nawabi, Parwez; Bauer, Stefan; Kyrpides, Nikos; Lykidis, Athanasios

    2011-11-01

    The production of low-cost biofuels in engineered microorganisms is of great interest due to the continual increase in the world's energy demands. Biodiesel is a renewable fuel that can potentially be produced in microbes cost-effectively. Fatty acid methyl esters (FAMEs) are a common component of biodiesel and can be synthesized from either triacylglycerol or free fatty acids (FFAs). Here we report the identification of a novel bacterial fatty acid methyltransferase (FAMT) that catalyzes the formation of FAMEs and 3-hydroxyl fatty acid methyl esters (3-OH-FAMEs) from the respective free acids and S-adenosylmethionine (AdoMet). FAMT exhibits a higher specificity toward 3-hydroxy free fatty acids (3-OH-FFAs) than FFAs, synthesizing 3-hydroxy fatty acid methyl esters (3-OH-FAMEs) in vivo. We have also identified bacterial members of the fatty acyl-acyl carrier protein (ACP) thioesterase (FAT) enzyme family with distinct acyl chain specificities. These bacterial FATs exhibit increased specificity toward 3-hydroxyacyl-ACP, generating 3-OH-FFAs, which can subsequently be utilized by FAMTs to produce 3-OH-FAMEs. PhaG (3-hydroxyacyl ACP:coenzyme A [CoA] transacylase) constitutes an alternative route to 3-OH-FFA synthesis; the coexpression of PhaG with FAMT led to the highest level of accumulation of 3-OH-FAMEs and FAMEs. The availability of AdoMet, the second substrate for FAMT, is an important factor regulating the amount of methyl esters produced by bacterial cells. Our results indicate that the deletion of the global methionine regulator metJ and the overexpression of methionine adenosyltransferase result in increased methyl ester synthesis.

  8. Gene amplification of the histone methyltransferase SETDB1 contributes to human lung tumorigenesis

    PubMed Central

    Rodriguez-Paredes, M; Martinez de Paz, A; Simó-Riudalbas, L; Sayols, S; Moutinho, C; Moran, S; Villanueva, A; Vázquez-Cedeira, M; Lazo, P A; Carneiro, F; Moura, C S; Vieira, J; Teixeira, M R; Esteller, M

    2014-01-01

    Disruption of the histone modification patterns is one of the most common features of human tumors. However, few genetic alterations in the histone modifier genes have been described in tumorigenesis. Herein we show that the histone methyltransferase SETDB1 undergoes gene amplification in non-small and small lung cancer cell lines and primary tumors. The existence of additional copies of the SETDB1 gene in these transformed cells is associated with higher levels of the corresponding mRNA and protein. From a functional standpoint, the depletion of SETDB1 expression in amplified cells reduces cancer growth in cell culture and nude mice models, whereas its overexpression increases the tumor invasiveness. The increased gene dosage of SETDB1 is also associated with enhanced sensitivity to the growth inhibitory effect mediated by the SETDB1-interfering drug mithramycin. Overall, the findings identify SETDB1 as a bona fide oncogene undergoing gene amplification-associated activation in lung cancer and suggest its potential for new therapeutic strategies. PMID:23770855

  9. Is catechol-o-methyltransferase gene polymorphism a risk factor in the development of premenstrual syndrome?

    PubMed Central

    Deveci, Esma Ozturk; Selek, Salih; Camuzcuoglu, Aysun; Hilali, Nese Gul; Camuzcuoglu, Hakan; Erdal, Mehmet Emin; Vural, Mehmet

    2014-01-01

    Objective The objective of this study was to investigate whether there was a correlation between catechol-o-methyltransferase (COMT) gene polymorphism, which is believed to play a role in the etiology of psychotic disorders, and premenstrual syndrome (PMS). Methods Fifty-three women with regular menstrual cycles, aged between 18 and 46 years and diagnosed with PMS according to the American Congress of Obstetrics and Gynecology criteria were included in this study as the study group, and 53 healthy women having no health problems were selected as the controls. Venous blood was collected from all patients included in the study and kept at -18℃ prior to analysis. Results There was no significant difference between the groups in terms of demographic features such as age, body mass index, number of pregnancies, parity, and number of children. No statistically significant difference was observed in terms of COMT gene polymorphism (p=0.61) between women in the PMS and the control groups. However, a significant difference was found between arthralgia, which is an indicator of PMS, and low-enzyme activity COMT gene (Met/Met) polymorphism (p=0.04). Conclusion These results suggested that there was no significant relationship between PMS and COMT gene polymorphism. Since we could not find a direct correlation between the COMT gene polymorphism and PMS, further studies including alternative neurotransmitter pathways are needed to find an effective treatment for this disease. PMID:25045629

  10. The choC gene encoding a putative phospholipid methyltransferase is essential for growth and development in Aspergillus nidulans.

    PubMed

    Tao, Li; Gao, Na; Chen, Sanfeng; Yu, Jae-Hyuk

    2010-06-01

    Phosphatidylcholines (PCs) are a class of major cell membrane phospholipids that participate in many physiological processes. Three genes, choA, choB and choC, have been proposed to function in the endogenous biosynthesis of PC in Aspergillus nidulans. In this study, we characterize the choC gene encoding a putative highly conserved phospholipid methyltransferase. The previously reported choC3 mutant allele results from a mutation leading to the E177K amino acid substitution. The transcript of choC accumulates at high levels during vegetative growth and early asexual developmental phases. The deletion of choC causes severe impairment of vegetative growth, swelling of hyphal tips and the lack of both asexual and sexual development, suggesting the requirement of ChoC and PC in growth and development. Noticeably, supplementation of the mutant with the penultimate precursor of PC N, N-dimethylaminoethanol leads to full recovery of vegetative growth, but incomplete progression of asexual and sexual development, implying differential roles of PC and its intermediates in fungal growth and development. Importantly, while the choC deletion mutant shows reduced vegetative growth and precocious cell death until day 4, it regains hyphal proliferation and cell viability from day 5, indicating the presence of an alternative route for cellular membrane function in A. nidulans.

  11. Down-regulation of lignin biosynthesis in transgenic Leucaena leucocephala harboring O-methyltransferase gene.

    PubMed

    Rastogi, Smita; Dwivedi, Upendra Nath

    2006-01-01

    In the present study, a 0.47 kb OMT gene construct from aspen, encoding for an enzyme O-methyltransferase (OMT, EC 2.1.1.6), in antisense orientation was used to down-regulate lignin biosynthesis in Leucaena leucocephala. The plants were transformed with Agrobacterium tumefaciens strain harboring the antisense gene, and the transformation was confirmed by PCR amplification of the npt II gene. The integration of a heterologous antisense OMT gene construct in transformed plants led to a maximum of 60% reduction in OMT activity relative to control. The evaluation of total lignin content by the Klason method revealed a maximum of 28% reduction. Histochemical analyses of stem sections depicted a reduction in lignin content and normal xylem development. The results also suggested a probable increase in aldehyde levels and a decrease in syringyl units. Lignin down-regulation was accompanied by an increase in methanol soluble phenolics to an extent that had no impact on wood discoloration, and the plants displayed a normal phenotype. Concomitantly, an increase of up to 9% in cellulose content was also observed. Upon alkali extraction, modified lignin was more extractable as evident from reduced Klason lignin in saponified residue and increased alkali soluble phenolics. The results together suggested that the extent of down-regulation of OMT activity achieved may lead to quality amelioration of Leucaena with respect to its applicability in pulp and paper manufacture as well as nutritive and easily digestible forage production.

  12. The histone methyltransferase DOT1L promotes neuroblastoma by regulating gene transcription.

    PubMed

    Wong, Matthew; Tee, Andrew El; Milazzo, Giorgio; Bell, Jessica L; Poulos, Rebecca C; Atmadibrata, Bernard; Sun, Yuting; Jing, Duohui; Ho, Nicholas; Ling, Dora; Liu, Pei Yan; Zhang, Xu Dong; Hüttelmaier, Stefan; Wong, Jason W H; Wang, Jenny; Polly, Patsie; Perini, Giovanni; Scarlett, Christopher J; Liu, Tao

    2017-02-16

    Myc oncoproteins exert tumorigenic effects by regulating expression of target oncogenes. Histone H3 lysine 79 (H3K79) methylation at Myc-responsive elements of target gene promoters is a strict prerequisite for Myc-induced transcriptional activation, and DOT1L is the only known histone methyltransferase that catalyses H3K79 methylation. Here we show that N-Myc upregulatsd DOT1L mRNA and protein expression by binding to the DOT1L gene promoter. shRNA-mediated depletion of DOT1L reduced mRNA and protein expression of N-Myc target genes ODC1 and E2F2. DOT1L bound to the Myc Box II domain of N-Myc protein, and knockdown of DOT1L reduced histone H3K79 methylation and N-Myc protein binding at the ODC1 and E2F2 gene promoters and reduced neuroblastoma cell proliferation. Treatment with the small molecule DOT1L inhibitor SGC0946 reduced H3K79 methylation and proliferation of MYCN gene-amplified neuroblastoma cells. In mice xenografts of neuroblastoma cells stably expressing doxycycline-inducible DOT1L shRNA, ablating DOT1L expression with doxycycline significantly reduced ODC1 and E2F2 expression, reduced tumor progression, and improved overall survival. Additionally, high levels of DOT1L gene expression in human neuroblastoma tissues correlated with high levels of MYCN, ODC1, and E2F2 gene expression and independently correlated with poor patient survival. Taken together, our results identify DOT1L as a novel co-factor in N-Myc-mediated transcriptional activation of target genes and neuroblastoma oncogenesis. Furthermore, they characterize DOT1L inhibitors as novel anticancer agents against MYCN-amplified neuroblastoma.

  13. ICF, An Immunodeficiency Syndrome: DNA Methyltransferase 3B Involvement, Chromosome Anomalies, and Gene Dysregulation

    PubMed Central

    Ehrlich, Melanie; Sanchez, Cecilia; Shao, Chunbo; Nishiyama, Rie; Kehrl, John; Kuick, Rork; Kubota, Takeo; Hanash, Samir M.

    2008-01-01

    The immunodeficiency, centromeric region instability, and facial anomalies syndrome (ICF) is the only disease known to result from a mutated DNA methyltransferase gene, namely, DNMT3B. Characteristic of this recessive disease are decreases in serum immunoglobulins despite the presence of B cells and, in the juxtacentromeric heterochromatin of chromosomes 1 and 16, chromatin decondensation, distinctive rearrangements, and satellite DNA hypomethylation. Although DNMT3B is involved in specific associations with histone deacetylases, HP1, other DNMTs, chromatin remodelling proteins, condensin, and other nuclear proteins, it is probably the partial loss of catalytic activity that is responsible for the disease. In microarray experiments and real-time RT-PCR assays, we observed significant differences in RNA levels from ICF vs. control lymphoblasts for pro- and anti-apoptotic genes (BCL2L10, CASP1, and PTPN13); nitrous oxide, carbon monoxide, NF-κB, and TNFa signalling pathway genes (PRKCH, GUCY1A3, GUCY1B3, MAPK13; HMOX1, and MAP4K4); and transcription control genes (NR2F2 and SMARCA2). This gene dysregulation could contribute to the immunodeficiency and other symptoms of ICF and might result from the limited losses of DNA methylation although ICF-related promoter hypomethylation was not observed for six of the above examined genes. We propose that hypomethylation of satellite 2at1qh and 16qh might provoke this dysregulation gene expression by trans effects from altered sequestration of transcription factors, changes in nuclear architecture, or expression of noncoding RNAs. PMID:18432406

  14. Expression of Atropa belladonna putrescine N-methyltransferase gene in root pericycle.

    PubMed

    Suzuki, K; Yamada, Y; Hashimoto, T

    1999-03-01

    The cDNAs encoding putrescine N-methyltransferase (PMT), which catalyzes the S-adenosylmethionine-dependent N-methylation of putrescine at the first committed step in the biosynthetic pathways of tropane alkaloids, were isolated from Atropa belladonna and Hyoscyamus niger. These PMTs, however, lacked the N-terminal tandem repeat arrays previously found in Nicotiana PMTs. AbPMT1 RNA was much more abundant in the root of A. belladonna than was AbPMT2 RNA. The 5'-flanking region of the AbPMT1 gene was fused to the beta-glucuronidase (GUS) reporter gene and transferred to A. belladonna. Histochemical analysis showed that GUS is expressed specifically in root pericycle cells and that the 0.3-kb 5'-upstream region was sufficient for pericycle-specific expression. Treatment of A. belladonna roots with methyl jasmonate did not up-regulate the expression of GUS or endogenous AbPMT genes. The regulation of tropane alkaloid biosynthesis is discussed and compared with that of nicotine biosynthesis.

  15. Insulators recruit histone methyltransferase dMes4 to regulate chromatin of flanking genes

    PubMed Central

    Lhoumaud, Priscillia; Hennion, Magali; Gamot, Adrien; Cuddapah, Suresh; Queille, Sophie; Liang, Jun; Micas, Gael; Morillon, Pauline; Urbach, Serge; Bouchez, Olivier; Severac, Dany; Emberly, Eldon; Zhao, Keji; Cuvier, Olivier

    2014-01-01

    Chromosomal domains in Drosophila are marked by the insulator-binding proteins (IBPs) dCTCF/Beaf32 and cofactors that participate in regulating long-range interactions. Chromosomal borders are further enriched in specific histone modifications, yet the role of histone modifiers and nucleosome dynamics in this context remains largely unknown. Here, we show that IBP depletion impairs nucleosome dynamics specifically at the promoters and coding sequence of genes flanked by IBP binding sites. Biochemical purification identifies the H3K36 histone methyltransferase NSD/dMes-4 as a novel IBP cofactor, which specifically co-regulates the chromatin accessibility of hundreds of genes flanked by dCTCF/Beaf32. NSD/dMes-4 presets chromatin before the recruitment of transcriptional activators including DREF that triggers Set2/Hypb-dependent H3K36 trimethylation, nucleosome positioning, and RNA splicing. Our results unveil a model for how IBPs regulate nucleosome dynamics and gene expression through NSD/dMes-4, which may regulate H3K27me3 spreading. Our data uncover how IBPs dynamically regulate chromatin organization depending on distinct cofactors. PMID:24916307

  16. Identification and Characterization of Two Novel Methyltransferase Genes That Determine the Serotype 12-Specific Structure of Glycopeptidolipids of Mycobacterium intracellulare▿

    PubMed Central

    Nakata, Noboru; Fujiwara, Nagatoshi; Naka, Takashi; Yano, Ikuya; Kobayashi, Kazuo; Maeda, Shinji

    2008-01-01

    The Mycobacterium avium complex is distributed ubiquitously in the environment. It is an important cause of pulmonary and extrapulmonary diseases in humans and animals. The species in this complex produce polar glycopeptidolipids (GPLs); of particular interest is their serotype-specific antigenicity. Several reports have described that GPL structure may play an important role in bacterial physiology and pathogenesis and in the host immune response. Recently, we determined the complete structure of the GPL derived from Mycobacterium intracellulare serotype 7 and characterized the serotype 7 GPL-specific gene cluster. The structure of serotype 7 GPL closely resembles that of serotype 12 GPL, except for O methylation. In the present study, we isolated and characterized the serotype 12-specific gene cluster involved in glycosylation of the GPL. Ten open reading frames (ORFs) and one pseudogene were observed in the cluster. The genetic organization of the serotype 12-specific gene cluster resembles that of the serotype 7-specific gene cluster, but two novel ORFs (orfA and orfB) encoding putative methyltransferases are present in the cluster. Functional analyses revealed that orfA and orfB encode methyltransferases that synthesize O-methyl groups at the C-4 position in the rhamnose residue next to the terminal hexose and at the C-3 position in the terminal hexose, respectively. Our results show that these two methyltransferase genes determine the structural difference of serotype 12-specific GPL from serotype 7-specific GPL. PMID:18024513

  17. Aberrant DNA methylation in 5' regions of DNA methyltransferase genes in aborted bovine clones.

    PubMed

    Liu, Jinghe; Liang, Xingwei; Zhu, Jiaqiao; Wei, Liang; Hou, Yi; Chen, Da-Yuan; Sun, Qing-Yuan

    2008-09-01

    High rate of abortion and developmental abnormalities is thought to be closely associated with inefficient epigenetic reprogramming of the transplanted nuclei during bovine cloning. It is known that one of the important mechanisms for epigenetic reprogramming is DNA methylation. DNA methylation is established and maintained by DNA methyltransferases (DNMTs), therefore, it is postulated that the inefficient epigenetic reprogramming of transplanted nuclei may be due to abnormal expression of DNMTs. Since DNA methylation can strongly inhibit gene expression, aberrant DNA methylation of DNMT genes may disturb gene expression. But presently, it is not clear whether the methylation abnormality of DNMT genes is related to developmental failure of somatic cell nuclear transfer embryos. In our study, we analyzed methylation patterns of the 5' regions of four DNMT genes including Dnmt3a, Dnmt3b, Dnmt1 and Dnmt2 in four aborted bovine clones. Using bisulfite sequencing method, we found that 3 out of 4 aborted bovine clones (AF1, AF2 and AF3) showed either hypermethylation or hypomethylation in the 5' regions of Dnmt3a and Dnmt3b, indicating that Dnmt3a and Dnmt3b genes are not properly reprogrammed. However, the individual AF4 exhibited similar methylation level and pattern to age-matched in vitro fertilized (IVF) fetuses. Besides, we found that the 5' regions of Dnmt1 and Dnmt2 were nearly completely unmethylated in all normal adults, IVF fetuses, sperm and aborted clones. Together, our results suggest that the aberrant methylation of Dnmt3a and Dnmt3b 5' regions is probably associated with the high abortion of bovine clones.

  18. Genome-wide identification and expression profiling of DNA methyltransferase gene family in maize.

    PubMed

    Qian, Yexiong; Xi, Yilong; Cheng, Beijiu; Zhu, Suwen

    2014-10-01

    In this study, we identified eight DNA MTase genes in maize and the diversity of expression patterns of them was presented by EST mining, microarray and semi-quantitative expression profile analyses. DNA methylation plays a pivotal role in promoting genomic stability through diverse biological processes including regulation of gene expression during development and chromatin organization. Although this important biological process is mainly regulated by several conserved Cytosine-5 DNA methyltransferases encoded by a smaller multigene family in plants, investigation of the plant C5-MTase-encoding gene family will serve to elucidate the epigenetic mechanism diversity in plants. Recently, genome-wide identification and evolutionary analyses of the C5-MTase-encoding gene family have been characterized in multiple plant species including Arabidopsis, rice, carrot and wheat. However, little is known regarding the C5-MTase-encoding genes in the entire maize genome. Here, genome-wide identification and expression profile analyses of maize C5-MTase-encoding genes (ZmMETs) were performed from the latest version of the maize (B73) genome. Phylogenetic analysis indicated that the orthologs from the three species (maize, Arabidopsis and rice) were categorized into four classes. Chromosomal location of these genes revealed that they are unevenly distributed on 6 of all 10 chromosomes with three chromosomal/segmental duplication events, suggesting that gene duplication played a key role in expansion of the maize C5-MTase-encoding gene family. Furthermore, EST expression data mining, microarray data and semi-quantitative expression profile analyses detected in the leaves by two different abiotic stress treatments have demonstrated that these genes had temporal and spatial expression pattern and exhibited different expression levels in stress treatments, suggesting that functional diversification of ZmMET genes family. Overall, our study will serve to present signification

  19. Cloning and sequencing of a gene encoding carminomycin 4-O-methyltransferase from Streptomyces peucetius and its expression in Escherichia coli.

    PubMed Central

    Madduri, K; Torti, F; Colombo, A L; Hutchinson, C R

    1993-01-01

    Sequence analysis of a portion of the Streptomyces peucetius daunorubicin biosynthetic gene cluster revealed a complete open reading frame (dnrK) that showed DNA and protein sequence homology to several O-methyltransferases. Expression of dnrK in Streptomyces lividans and Escherichia coli was done to show that this gene codes for carminomycin 4-O-methyltransferase. The deduced carminomycin 4-O-methyltransferase protein shows a conserved nucleotide binding site for its S-adenosyl-L-methionine cofactor. Images PMID:8509343

  20. The Cercospora nicotianae gene encoding dual O-methyltransferase and FAD-dependent monooxygenase domains mediates cercosporin toxin biosynthesis.

    PubMed

    Dekkers, Katherine L; You, Bang-Jau; Gowda, Vivek S; Liao, Hui-Ling; Lee, Miin-Huey; Bau, Huey-Jiunn; Ueng, Peter P; Chung, Kuang-Ren

    2007-05-01

    Cercosporin, a photo-activated, non-host-selective phytotoxin produced by many species of the plant pathogenic fungus Cercospora, causes peroxidation of plant cell membranes by generating reactive oxygen species and is an important virulence determinant. Here we report a new gene, CTB3 that is involved in cercosporin biosynthesis in Cercospora nicotianae. CTB3 is adjacent to a previously identified CTB1 encoding a polyketide synthase which is also required for cercosporin production. CTB3 contains a putative O-methyltransferase domain in the N-terminus and a putative flavin adenine dinucleotide (FAD)-dependent monooxygenase domain in the C-terminus. The N-terminal amino acid sequence also is similar to that of the transcription enhancer AFLS (formerly AFLJ) involved in aflatoxin biosynthesis. Expression of CTB3 was differentially regulated by light, medium, nitrogen and carbon sources and pH. Disruption of the N- or C-terminus of CTB3 yielded mutants that failed to accumulate the CTB3 transcript and cercosporin. The Deltactb3 disruptants produced a yellow pigment that is not toxic to tobacco suspension cells. Production of cercosporin in a Deltactb3 null mutant was fully restored when transformed with a functional CTB3 clone or when paired with a Deltactb1-null mutant (defective in polyketide synthase) by cross feeding of the biosynthetic intermediates. Pathogenicity assays using detached tobacco leaves revealed that the Deltactb3 disruptants drastically reduced lesion formation.

  1. A second protein L-isoaspartyl methyltransferase gene in Arabidopsis produces two transcripts whose products are sequestered in the nucleus.

    PubMed

    Xu, Qilong; Belcastro, Marisa P; Villa, Sarah T; Dinkins, Randy D; Clarke, Steven G; Downie, A Bruce

    2004-09-01

    The spontaneous and deleterious conversion of l-asparaginyl and l-aspartyl protein residues to l-iso-Asp or d-Asp occurs as proteins age and is accelerated under stressful conditions. Arabidopsis (Arabidopsis L. Heynh.) contains two genes (At3g48330 and At5g50240) encoding protein-l-isoaspartate methyltransferase (EC 2.1.1.77; PIMT), an enzyme capable of correcting this damage. The gene located on chromosome 5 (PIMT2) produces two proteins differing by three amino acids through alternative 3' splice site selection in the first intron. Recombinant protein from both splicing variants has PIMT activity. Subcellular localization using cell fractionation followed by immunoblot detection, as well as confocal visualization of PIMT:GFP fusions, demonstrated that PIMT1 is cytosolic while a canonical nuclear localization signal, present in PIMT2psi and the shorter PIMT2omega, is functional. Multiplex reverse transcription-PCR was used to establish PIMT1 and PIMT2 transcript presence and abundance, relative to beta-TUBULIN, in various tissues and under a variety of stresses imposed on seeds and seedlings. PIMT1 transcript is constitutively present but can increase, along with PIMT2, in developing seeds presumably in response to increasing endogenous abscisic acid (ABA). Transcript from PIMT2 also increases in establishing seedlings due to exogenous ABA and applied stress presumably through an ABA-dependent pathway. Furthermore, cleaved amplified polymorphic sequences from PIMT2 amplicons determined that ABA preferentially enhances the production of PIMT2omega transcript in leaves and possibly in tissues other than germinating seeds.

  2. Green tea proanthocyanidins cause impairment of hormone-regulated larval development and reproductive fitness via repression of juvenile hormone acid methyltransferase, insulin-like peptide and cytochrome P450 genes in Anopheles gambiae sensu stricto.

    PubMed

    Muema, Jackson M; Nyanjom, Steven G; Mutunga, James M; Njeru, Sospeter N; Bargul, Joel L

    2017-01-01

    Successful optimization of plant-derived compounds into control of nuisance insects would benefit from scientifically validated targets. However, the close association between the genotypic responses and physiological toxicity effects mediated by these compounds remains underexplored. In this study, we evaluated the sublethal dose effects of proanthocyanidins (PAs) sourced from green tea (Camellia sinensis) on life history traits of Anopheles gambiae (sensu stricto) mosquitoes with an aim to unravel the probable molecular targets. Based on the induced phenotypic effects, genes selected for study targeted juvenile hormone (JH) biosynthesis, signal transduction, oxidative stress response and xenobiotic detoxification in addition to vitellogenesis in females. Our findings suggest that chronic exposure of larval stages (L3/L4) to sublethal dose of 5 ppm dramatically extended larval developmental period for up to 12 days, slowed down pupation rates, induced abnormal larval-pupal intermediates and caused 100% inhibition of adult emergence. Further, females exhibited significant interference of fecundity and egg hatchability relative to controls (p < 0.001). Using reverse transcription quantitative polymerase chain reaction (RT-qPCR), our findings show that PA-treated larvae exhibited significant repression of AgamJHAMT (p < 0.001), AgamILP1 (p < 0.001) and AgamCYP6M2 (p < 0.001) with up-regulation of Hsp70 (p < 0.001). Females exposed as larvae demonstrated down-regulation of AgamVg (p = 0.03), AgamILP1 (p = 0.009), AgamCYP6M2 (p = 0.05) and AgamJHAMT (p = 0.02). Our findings support that C. sinensis proanthocyanidins affect important vectorial capacity components such as mosquito survival rates and reproductive fitness thus could be potentially used for controlling populations of malaria vectors.

  3. Green tea proanthocyanidins cause impairment of hormone-regulated larval development and reproductive fitness via repression of juvenile hormone acid methyltransferase, insulin-like peptide and cytochrome P450 genes in Anopheles gambiae sensu stricto

    PubMed Central

    Nyanjom, Steven G.; Mutunga, James M.; Njeru, Sospeter N.; Bargul, Joel L.

    2017-01-01

    Successful optimization of plant-derived compounds into control of nuisance insects would benefit from scientifically validated targets. However, the close association between the genotypic responses and physiological toxicity effects mediated by these compounds remains underexplored. In this study, we evaluated the sublethal dose effects of proanthocyanidins (PAs) sourced from green tea (Camellia sinensis) on life history traits of Anopheles gambiae (sensu stricto) mosquitoes with an aim to unravel the probable molecular targets. Based on the induced phenotypic effects, genes selected for study targeted juvenile hormone (JH) biosynthesis, signal transduction, oxidative stress response and xenobiotic detoxification in addition to vitellogenesis in females. Our findings suggest that chronic exposure of larval stages (L3/L4) to sublethal dose of 5 ppm dramatically extended larval developmental period for up to 12 days, slowed down pupation rates, induced abnormal larval-pupal intermediates and caused 100% inhibition of adult emergence. Further, females exhibited significant interference of fecundity and egg hatchability relative to controls (p < 0.001). Using reverse transcription quantitative polymerase chain reaction (RT-qPCR), our findings show that PA-treated larvae exhibited significant repression of AgamJHAMT (p < 0.001), AgamILP1 (p < 0.001) and AgamCYP6M2 (p < 0.001) with up-regulation of Hsp70 (p < 0.001). Females exposed as larvae demonstrated down-regulation of AgamVg (p = 0.03), AgamILP1 (p = 0.009), AgamCYP6M2 (p = 0.05) and AgamJHAMT (p = 0.02). Our findings support that C. sinensis proanthocyanidins affect important vectorial capacity components such as mosquito survival rates and reproductive fitness thus could be potentially used for controlling populations of malaria vectors. PMID:28301607

  4. High Expression of the DNA Methyltransferase Gene Characterizes Human Neoplastic Cells and Progression Stages of Colon Cancer

    NASA Astrophysics Data System (ADS)

    El-Deiry, Wafik S.; Nelkin, Barry D.; Celano, Paul; Chiu Yen, Ray-Whay; Falco, Joseph P.; Hamilton, Stanley R.; Baylin, Stephen B.

    1991-04-01

    DNA methylation abnormalities occur consistently in human neoplasia including widespread hypomethylation and more recently recognized local increases in DNA methylation that hold potential for gene inactivation events. To study this imbalance further, we have cloned and localized to chromosome 19 a portion of the human DNA methyltransferase gene that codes for the enzyme catalyzing DNA methylation. Expression of this gene is low in normal human cells, significantly increased (30- to 50-fold by PCR analysis) in virally transformed cells, and strikingly elevated in human cancer cells (several hundredfold). In comparison to colon mucosa from patients without neoplasia, median levels of DNA methyltransferase transcripts are 15-fold increased in histologically normal mucosa from patients with cancers or the benign polyps that can precede cancers, 60-fold increased in the premalignant polyps, and >200-fold increased in the cancers. Thus, increases in DNA methyltransferase gene expression precede development of colonic neoplasia and continue during progression of colonic neoplasms. These increases may play a role in the genetic instability of cancer and mark early events in cell transformation.

  5. Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence

    PubMed Central

    James, Allison E.; Rogovskyy, Artem S.; Crowley, Michael A.; Bankhead, Troy

    2016-01-01

    DNA methyltransferases have been implicated in the regulation of virulence genes in a number of pathogens. Relapsing fever Borrelia species harbor a conserved, putative DNA methyltransferase gene on their chromosome, while no such ortholog can be found in the annotated genome of the Lyme disease agent, Borrelia burgdorferi. In the relapsing fever species Borrelia hermsii, the locus bh0463A encodes this putative DNA adenine methyltransferase (dam). To verify the function of the BH0463A protein product as a Dam, the gene was cloned into a Dam-deficient strain of Escherichia coli. Restriction fragment analysis subsequently demonstrated that complementation of this E. coli mutant with bh0463A restored adenine methylation, verifying bh0463A as a Dam. The requirement of bh0463A for B. hermsii viability, infectivity, and persistence was then investigated by genetically disrupting the gene. The dam- mutant was capable of infecting immunocompetent mice, and the mean level of spirochetemia in immunocompetent mice was not significantly different from wild type B. hermsii. Collectively, the data indicate that dam is dispensable for B. hermsii viability, infectivity, and persistence. PMID:27195796

  6. High expression of the DNA methyltransferase gene characterizes human neoplastic cells and progression stages of colon cancer

    SciTech Connect

    El-Deiry, W.S.; Nelkin, B.D.; Celano, P.; Ray-Whay Chiu Yen; Falco, J.P.; Hamilton, S.R.; Baylin, S.B. )

    1991-04-15

    DNA methylation abnormalities occur consistently in human neoplasia including widespread hypomethylation and more recently recognized local increases in DNA methylation that hold potential for gene inactivation events. To study this imbalance further, the authors have localized to chromosome 19 a portion of the human DNA methyltransferase gene that codes for the enzyme catalyzing DNA methylation. Expression of this gene is low in normal human cells, significantly increased (30- to 50-fold by PCR analysis) in virally transformed cells, and strikingly elevated in human cancer cells (several hundredfold). In comparison to colon mucosa from patients without neoplasia, median levels of DNA methyltransferase transcripts are 15-fold increased in histologically normal mucosa from patients with cancers or the benign polyps that can precede cancers, 60-fold increased in the premalignant polyps, and >200-fold increased in the cancers. Thus, increases in DNA methyltransferase gene expression precede development of colonic neoplasia and continue during progression of colonic neoplasms. These increases may play a role in the genetic instability of cancer and mark early events in cell transformation.

  7. Imprinting of the MEA Polycomb gene is controlled by antagonism between MET1 methyltransferase and DME glycosylase.

    PubMed

    Xiao, Wenyan; Gehring, Mary; Choi, Yeonhee; Margossian, Linda; Pu, Hong; Harada, John J; Goldberg, Robert B; Pennell, Roger I; Fischer, Robert L

    2003-12-01

    The MEA Polycomb gene is imprinted in the Arabidopsis endosperm. DME DNA glycosylase activates maternal MEA allele expression in the central cell of the female gametophyte, the progenitor of the endosperm. Maternal mutant dme or mea alleles result in seed abortion. We identified mutations that suppress dme seed abortion and found that they reside in the MET1 methyltransferase gene, which maintains cytosine methylation. Seeds with maternal dme and met1 alleles survive, indicating that suppression occurs in the female gametophyte. Suppression requires a maternal wild-type MEA allele, suggesting that MET1 functions upstream of, or at, MEA. DME activates whereas MET1 suppresses maternal MEA::GFP allele expression in the central cell. MET1 is required for DNA methylation of three regions in the MEA promoter in seeds. Our data suggest that imprinting is controlled in the female gametophyte by antagonism between the two DNA-modifying enzymes, MET1 methyltransferase and DME DNA glycosylase.

  8. Liganded Thyroid Hormone Receptors Transactivate the DNA Methyltransferase 3a Gene in Mouse Neuronal Cells

    PubMed Central

    Kyono, Yasuhiro; Subramani, Arasakumar; Ramadoss, Preeti; Hollenberg, Anthony N.; Bonett, Ronald M.

    2016-01-01

    Thyroid hormone (T3) is essential for proper neurological development. The hormone, bound to its receptors, regulates gene transcription in part by modulating posttranslational modifications of histones. Methylation of DNA, which is established by the de novo DNA methyltransferase (DNMT)3a and DNMT3b, and maintained by DNMT1 is another epigenetic modification influencing gene transcription. The expression of Dnmt3a, but not other Dnmt genes, increases in mouse brain in parallel with the postnatal rise in plasma [T3]. We found that treatment of the mouse neuroblastoma cell line Neuro2a[TRβ1] with T3 caused rapid induction of Dnmt3a mRNA, which was resistant to protein synthesis inhibition, supporting that it is a direct T3-response gene. Injection of T3 into postnatal day 6 mice increased Dnmt3a mRNA in the brain by 1 hour. Analysis of two chromatin immunoprecipitation-sequencing datasets, and targeted analyses using chromatin immunoprecipitation, transfection-reporter assays, and in vitro DNA binding identified 2 functional T3-response elements (TREs) at the mouse Dnmt3a locus located +30.3 and +49.3 kb from the transcription start site. Thyroid hormone receptors associated with both of these regions in mouse brain chromatin, but with only 1 (+30.3 kb) in Neuro2a[TRβ1] cells. Deletion of the +30.3-kb TRE using CRISPR/Cas9 genome editing eliminated or strongly reduced the Dnmt3a mRNA response to T3. Bioinformatics analysis showed that both TREs are highly conserved among eutherian mammals. Thyroid regulation of Dnmt3a may be an evolutionarily conserved mechanism for modulating global changes in DNA methylation during postnatal neurological development. PMID:27387481

  9. Influence of catechol-O-methyltransferase (COMT) gene polymorphisms in pain sensibility of Brazilian fibromialgia patients.

    PubMed

    Barbosa, Flávia Regina; Matsuda, Josie Budag; Mazucato, Mendelson; de Castro França, Suzelei; Zingaretti, Sônia Marli; da Silva, Lucienir Maria; Martinez-Rossi, Nilce Maria; Júnior, Milton Faria; Marins, Mozart; Fachin, Ana Lúcia

    2012-02-01

    Fibromyalgia syndrome (FS) is a rheumatic syndrome affecting to 2-3% of individuals of productive age, mainly women. Neuroendocrine and genetic factors may play a significant role in development of the disease which is characterized by diffuse chronic pain and presence of tender points. Several studies have suggested an association between FS, especially pain sensitivity, and polymorphism of the catechol-O-methyltransferase (COMT) gene. The aim of the present study was to characterize the SNPs rs4680 and rs4818 of the COMT gene and assess its influence in pain sensitivity of patients with fibromyalgia screened by the Fibromyalgia Impact Questionnaire (FIQ). DNA was extracted from peripheral blood of 112 patients with fibromyalgia and 110 healthy individuals and was used as template in PCR for amplification of a 185-bp fragment of the COMT gene. The amplified fragment was sequenced for analyses of the SNPs rs4680 and rs4818. The frequency of mutant genotype AA of SNP rs6860 was 77.67% in patients with FS and 28.18% for the control group. For the SNP rs4818, the frequency of mutant genotype CC was 73.21 and 39.09% for patients with FS and controls, respectively. Moreover, the FIQ score was higher in patients with the homozygous mutant genotype for SNPs rs4680 (87.92 points) and rs4818 (86.14 points). These results suggest that SNPs rs4680 and rs4818 of the COMT gene may be associated with fibromyalgia and pain sensitivity in FS Brazilian patients.

  10. Polymorphisms of the thiopurine S-methyltransferase gene among the Libyan population

    PubMed Central

    Zeglam, Hamza Ben; Benhamer, Abdrazak; Aboud, Adel; Rtemi, Haitem; Mattardi, Meftah; Saleh, Saleh Suleiman; Bashein, Abdullah; Enattah, Nabil

    2015-01-01

    Background Thiopurine S-methyltransferase (TPMT) is a cytosolic enzyme that catalyses the S-methylation of 6-mercaptopurine and azathioprine. Low activity phenotypes are correlated with polymorphism in the TPMT gene. Patients with low or undetectable TMPT activity could develop severe myelosuppression when they are treated with standard doses of thiopurine drugs. Since ethnic differences in the TPMT gene polymorphism have been demonstrated worldwide, assessing it in the Libyan population is worthwhile. Methods We investigated TPMT gene polymorphism in a total of 246 Libyan healthy adult blood donors from three different Libyan regions (Tripoli, Yefren, and Tawargha) and 50 children with acute lymphoblastic leukaemia (ALL). We used polymerase chain reaction restriction length polymorphism (PCR-RFLP) and allele-specific PCR-based assays to analyse the TPMT gene for the variants *2 c.238 G>C, *3A (c.460 G>A and c.719 A>G), *3B (c.460 G>A), and *3C (c.719 A>G). Results Our results show that the TPMT variants associated with low enzymatic activity were detected in 3.25% (8 in 246) of adult Libyan individuals and the frequency of total mutant alleles was 1.63%. Heterozygous genotypes were TPMT*3A in three subjects (0.61%) and TPMT*3C in five subjects (1.02%). No TPMT*2 and TPMT*3B allelic variants and no homozygous or compound heterozygous mutant alleles were detected. The normal allele (wild-type) was found in 98.4% of the adult individuals studied. No mutant alleles were detected among the 50 children who had ALL. Conclusions We report on the presence of the TPMT*3C and *3A mutant alleles in the Libyan population. Therefore, monitoring the patients to be treated with doses of thiopurine drugs for TPMT variants is worthwhile to avoid the development of severe myelosuppression. PMID:25819542

  11. Chloroplast overexpression of rice caffeic acid O-methyltransferase increases melatonin production in chloroplasts via the 5-methoxytryptamine pathway in transgenic rice plants.

    PubMed

    Choi, Geun-Hee; Lee, Hyoung Yool; Back, Kyoungwhan

    2017-08-01

    Recent analyses of the enzymatic features of various melatonin biosynthetic genes from bacteria, animals, and plants have led to the hypothesis that melatonin could be synthesized via the 5-methoxytryptamine (5-MT) pathway. 5-MT is known to be synthesized in vitro from serotonin by the enzymatic action of O-methyltransferases, including N-acetylserotonin methyltransferase (ASMT) and caffeic acid O-methyltransferase (COMT), leading to melatonin synthesis by the subsequent enzymatic reaction with serotonin N-acetyltransferase (SNAT). Here, we show that 5-MT was produced and served as a precursor for melatonin synthesis in plants. When rice seedlings were challenged with senescence treatment, 5-MT levels and melatonin production were increased in transgenic rice seedlings overexpressing the rice COMT in chloroplasts, while no such increases were observed in wild-type or transgenic seedlings overexpressing the rice COMT in the cytosol, suggesting a 5-MT transport limitation from the cytosol to chloroplasts. In contrast, cadmium treatment led to results different from those in senescence. The enhanced melatonin production was not observed in the chloroplast COMT lines relative over the cytosol COMT lines although 5-MT levels were equally induced in all genotypes upon cadmium treatment. The transgenic seedlings with enhanced melatonin in their chloroplasts exhibited improved seedling growth vs the wild type under continuous light conditions. This is the first report describing enhanced melatonin production in chloroplasts via the 5-MT pathway with the ectopic overexpression of COMT in chloroplasts in plants. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  12. Function of DNA methyltransferase 3a in lead (Pb(2+) )-Induced Cyclooxygenase-2 gene.

    PubMed

    Tsai, Yao-Ting; Chang, Che-Mai; Wang, Jaw-Yuan; Hou, Ming-Feng; Wang, Ju-Ming; Shiurba, Robert; Chang, Wen-Chang; Chang, Wei-Chiao

    2015-09-01

    Lead ions (Pb(2+) ) are toxic industrial pollutants associated with chronic inflammatory diseases in humans and animals. Previously, we found that Pb(2+) ions induce COX-2 gene expression via the EGF receptor/nuclear factor-κB signal transduction pathway in epidermoid carcinoma cell line A431. In this study, to see whether Pb(2+) ions affect COX-2 expression by epigenetic mechanisms, we looked at the mRNAs of DNA methyltransferases (DNMTs) using real-time PCR of total RNA from these cells. Cells exposed to Pb(2+) had low levels of DNMT3a mRNA, whereas the levels of DNMT1 and DNMT3b mRNAs remained unchanged. Pretreatment of cells with DNMT inhibitor 5-aza-2'-deoxycytidine (5 μM) followed by Pb(2+) (1 μM) significantly increased levels of COX-2 mRNA compared with cells treated with Pb(2+) alone. Overexpression of tumor suppressor gene Rb correlated with an increase in COX-2 mRNA and a decrease in DNMT3a mRNA. Conversely, overexpression of transcription factor E2F1 correlated with a decrease in COX-2 mRNA and an increase in DMNT3a mRNA. Pretreatment with EGFR inhibitors AG1478 and PD153035 significantly limited Pb(2+) -induced reduction in DNMT3a mRNA. In addition, gene knockdown of DNMT3a with short hairpin RNA correlated with increased COX-2 mRNA induced by Pb(2+) . Our findings suggest Pb(2+) ions induce COX-2 expression indirectly by reducing DNMT3a methylation of the COX-2 promoter via transcription factors Rb and E2F1.

  13. Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia

    PubMed Central

    Vargas-Alarcón, Gilberto; Fragoso, José-Manuel; Cruz-Robles, David; Vargas, Angélica; Vargas, Alfonso; Lao-Villadóniga, José-Ignacio; García-Fructuoso, Ferrán; Ramos-Kuri, Manuel; Hernández, Fernando; Springall, Rashidi; Bojalil, Rafael; Vallejo, Maite; Martínez-Lavín, Manuel

    2007-01-01

    Autonomic dysfunction is frequent in patients with fibromyalgia (FM). Heart rate variability analyses have demonstrated signs of ongoing sympathetic hyperactivity. Catecholamines are sympathetic neurotransmitters. Catechol-O-methyltransferase (COMT), an enzyme, is the major catecholamine-clearing pathway. There are several single-nucleotide polymorphisms (SNPs) in the COMT gene associated with the different catecholamine-clearing abilities of the COMT enzyme. These SNPs are in linkage disequilibrium and segregate as 'haplotypes'. Healthy females with a particular COMT gene haplotype (ACCG) producing a defective enzyme are more sensitive to painful stimuli. The objective of our study was to define whether women with FM, from two different countries (Mexico and Spain), have the COMT gene haplotypes that have been previously associated with greater sensitivity to pain. All the individuals in the study were female. Fifty-seven Mexican patients and 78 Spanish patients were compared with their respective healthy control groups. All participants filled out the Fibromyalgia Impact Questionnaire (FIQ). Six COMT SNPs (rs2097903, rs6269, rs4633, rs4818, rs4680, and rs165599) were genotyped from peripheral blood DNA. In Spanish patients, there was a significant association between three SNPs (rs6269, rs4818, and rs4680) and the presence of FM when compared with healthy controls. Moreover, in Spanish patients with the 'high pain sensitivity' haplotype (ACCG), the disease, as assessed by the FIQ, was more severe. By contrast, Mexican patients displayed only a weak association between rs6269 and rs165599, and some FIQ subscales. In our group of Spanish patients, there was an association between FM and the COMT haplotype previously associated with high pain sensitivity. This association was not observed in Mexican patients. Studies with a larger sample size are needed in order to verify or amend these preliminary results. PMID:17961261

  14. Genomewide identification of target genes of histone methyltransferase dG9a during Drosophila embryogenesis.

    PubMed

    Shimaji, Kouhei; Konishi, Takahiro; Tanaka, Shintaro; Yoshida, Hideki; Kato, Yasuko; Ohkawa, Yasuyuki; Sato, Tetsuya; Suyama, Mikita; Kimura, Hiroshi; Yamaguchi, Masamitsu

    2015-11-01

    Post-translational modification of the histone plays important roles in epigenetic regulation of various biological processes. Among the identified histone methyltransferases (HMTases), G9a is a histone H3 Lys 9 (H3K9)-specific example active in euchromatic regions. Drosophila G9a (dG9a) has been reported to feature H3K9 dimethylation activity in vivo. Here, we show that the time required for hatching of a homozygous dG9a null mutant and heteroallelic combination of dG9a null mutants is delayed, suggesting that dG9a is at least partially responsible for progression of embryogenesis. Immunocytochemical analyses of the wild-type and the dG9a null mutant flies indicated that dG9a localizes in cytoplasm up to nuclear division cycle 7 where it is likely responsible for di-methylation of nucleosome-free H3K9. From cycles 8-11, dG9a moves into the nucleus and is responsible for di-methylating H3K9 in nucleosomes. RNA-sequence analysis utilizing early wild-type and dG9a mutant embryos showed that dG9a down-regulates expression of genes responsible for embryogenesis. RNA fluorescent in situ hybridization analysis further showed temporal and spatial expression patterns of these mRNAs did not significantly change in the dG9a mutant. These results indicate that dG9a controls transcription levels of some zygotic genes without changing temporal and spatial expression patterns of the transcripts of these genes.

  15. The HPV E6 oncoprotein targets histone methyltransferases for modulating specific gene transcription

    PubMed Central

    Hsu, C-H; Peng, K-L; Jhang, H-C; Lin, C-H; Wu, S-Y; Chiang, C-M; Lee, S-C; Yu, W C Y; Juan, L-J

    2012-01-01

    Expression of viral proteins causes important epigenetic changes leading to abnormal cell growth. Whether viral proteins directly target histone methyltransferases (HMTs), a key family enzyme for epigenetic regulation, and modulate their enzymatic activities remains elusive. Here we show that the E6 proteins of both low-risk and high-risk human papillomavirus (HPV) interact with three coactivator HMTs, CARM1, PRMT1 and SET7, and downregulate their enzymatic activities in vitro and in HPV-transformed HeLa cells. Furthermore, these three HMTs are required for E6 to attenuate p53 transactivation function. Mechanistically, E6 hampers CARM1- and PRMT1-catalyzed histone methylation at p53-responsive promoters, and suppresses the binding of p53 to chromatinized DNA independently of E6-mediated p53 degradation. p53 pre-methylated at lysine-372 (p53K372 mono-methylation) by SET7 protects p53 from E6-induced degradation. Consistently, E6 downregulates p53K372 mono-methylation and thus reduces p53 protein stability. As a result of the E6-mediated inhibition of HMT activity, expression of p53 downstream genes is suppressed. Together, our results not only reveal a clever approach for the virus to interfere with p53 function, but also demonstrate the modulation of HMT activity as a novel mechanism of epigenetic regulation by a viral oncoprotein. PMID:21963854

  16. The HPV E6 oncoprotein targets histone methyltransferases for modulating specific gene transcription.

    PubMed

    Hsu, C-H; Peng, K-L; Jhang, H-C; Lin, C-H; Wu, S-Y; Chiang, C-M; Lee, S-C; Yu, W C Y; Juan, L-J

    2012-05-03

    Expression of viral proteins causes important epigenetic changes leading to abnormal cell growth. Whether viral proteins directly target histone methyltransferases (HMTs), a key family enzyme for epigenetic regulation, and modulate their enzymatic activities remains elusive. Here we show that the E6 proteins of both low-risk and high-risk human papillomavirus (HPV) interact with three coactivator HMTs, CARM1, PRMT1 and SET7, and downregulate their enzymatic activities in vitro and in HPV-transformed HeLa cells. Furthermore, these three HMTs are required for E6 to attenuate p53 transactivation function. Mechanistically, E6 hampers CARM1- and PRMT1-catalyzed histone methylation at p53-responsive promoters, and suppresses the binding of p53 to chromatinized DNA independently of E6-mediated p53 degradation. p53 pre-methylated at lysine-372 (p53K372 mono-methylation) by SET7 protects p53 from E6-induced degradation. Consistently, E6 downregulates p53K372 mono-methylation and thus reduces p53 protein stability. As a result of the E6-mediated inhibition of HMT activity, expression of p53 downstream genes is suppressed. Together, our results not only reveal a clever approach for the virus to interfere with p53 function, but also demonstrate the modulation of HMT activity as a novel mechanism of epigenetic regulation by a viral oncoprotein.

  17. Catechol-O-Methyltransferase Gene Polymorphisms in Specific Obsessive-Compulsive Disorder Patients' Subgroups.

    PubMed

    Melo-Felippe, Fernanda Brito; de Salles Andrade, Juliana Braga; Giori, Isabele Gomes; Vieira-Fonseca, Tamiris; Fontenelle, Leonardo Franklin; Kohlrausch, Fabiana Barzotti

    2016-01-01

    Pharmacological data and animal models support the hypothesis that the dopaminergic (DA) system is implicated in obsessive-compulsive disorder (OCD). Therefore, this case-control study assessed whether genetics variations in catechol-O-methyltransferase gene (COMT) could influence susceptibility to OCD and OCD features in a Brazilian sample. A sample of 199 patients with OCD and 200 healthy individuals was genotyped for -287A > G (rs2075507) and Val158Met (rs4680) single nucleotide polymorphisms (SNPs) by TaqMan(®) or restriction mapping. We observed a statistically significant predominance of the Met low-activity allele in the male patient group as compared to the male healthy control group. The -287A > G polymorphism's genotypes and alleles were significantly overrepresented among male individuals with ordering and female subjects with washing symptoms. We also found female hoarders to exhibit a significant higher frequency of the low activity Met/Met genotype of Val158Met polymorphism compared to female patients who did not express this dimension. Our data suggest an influence of COMT polymorphisms on OCD and OCD patients' features, such as gender, and ordering, washing, and hoarding symptom dimensions. Further studies to confirm the clinical importance of COMT SNPs in OCD are warranted.

  18. 5-Methyltetrahydrofolate-homocysteine methyltransferase gene polymorphism (MTR) and risk of head and neck cancer.

    PubMed

    Galbiatti, A L S; Ruiz, M T; Biselli-Chicote, P M; Chicote-Biselli, P M; Raposo, L S; Maniglia, J V; Pavarino-Bertelli, E C; Goloni-Bertollo, E M

    2010-05-01

    The functional effect of the A>G transition at position 2756 on the MTR gene (5-methyltetrahydrofolate-homocysteine methyltransferase), involved in folate metabolism, may be a risk factor for head and neck squamous cell carcinoma (HNSCC). The frequency of MTR A2756G (rs1805087) polymorphism was compared between HNSCC patients and individuals without history of neoplasias. The association of this polymorphism with clinical histopathological parameters was evaluated. A total of 705 individuals were included in the study. The polymerase chain reaction-restriction fragment length polymorphism technique was used to genotype the polymorphism. For statistical analysis, the chi-square test (univariate analysis) was used for comparisons between groups and multiple logistic regression (multivariate analysis) was used for interactions between the polymorphism and risk factors and clinical histopathological parameters. Using univariate analysis, the results did not show significant differences in allelic or genotypic distributions. Multivariable analysis showed that tobacco and alcohol consumption (P < 0.05), AG genotype (P = 0.019) and G allele (P = 0.028) may be predictors of the disease and a higher frequency of the G polymorphic allele was detected in men with HNSCC compared to male controls (P = 0.008). The analysis of polymorphism regarding clinical histopathological parameters did not show any association with the primary site, aggressiveness, lymph node involvement or extension of the tumor. In conclusion, our data provide evidence that supports an association between the polymorphism and the risk of HNSCC.

  19. Analysis of catechol-O-methyltransferase gene mutation and identification of new pathogenic gene for paroxysmal kinesigenic dyskinesia.

    PubMed

    Gu, Chengzhi; Li, Jia; Zhu, Lianhai; Lu, Zhenhui; Huang, Huaiyu

    2016-03-01

    We aimed to analyze the mutation site and frequency of catechol-O-methyltransferase (COMT) gene, to explore the relationship between COMT genotype and phenotype, and to find new pathogenic genes for paroxysmal kinesigenic dyskinesia (PKD). PKD patients who were treated from December 2011 to January 2014 were selected and subjected to genetic testing in the exon region of COMT. Two patients and one intrafamilial healthy control were subjected to exome sequencing using whole exome capture in combination with high-throughput sequencing to find candidate pathogenic gene sites. The results were verified by Sanger sequencing. A total of 11 familial PKD patients from 4 families and 9 sporadic patients without family history were included. Pathogenic c.634dupC(p.P220fsX7) mutation of COMT gene was found in 7 familial PKD patients and3 sporadic patients. Mutated COMT gene carriers suffered from PKD earlier (average age of onset: 11.61 ± 2.33 vs 16.21 ± 2.58, P = 0.001) with symmetric symptoms in most cases, while the mutation-negative group only showed unilateral symptoms (P = 0.001). The mutation-positive group also had more daily attacks (P = 0.038). Carbamazepine worked for all mutation-positive patients (10/10, 100%), but only for a part of mutation-negative patients (3/10, 30.0%). About 90000 single nucleotide polymorphisms and 2000 insertion-deletion polymorphisms were detected in each of the three samples. c.737C → T(p.T246 M) mutation of POC1B gene was a new pathogenic site for a selected family. COMT gene mutation, which was the pathogenesis of most familial PKD patients and a part of sporadic patients, predicted the response to carbamazepine. POC1B may be a novel pathogenic gene for PKD.

  20. Structural, Biochemical, and Phylogenetic Analyses Suggest That Indole-3-Acetic Acid Methyltransferase Is an Evolutionarily Ancient Member of the SABATH Family

    SciTech Connect

    Zhao,N.; Ferrer, J.; Ross, J.; Guan, J.; Yang, Y.; Pichersky, E.; Noel, J.; Chen, F.

    2008-01-01

    The plant SABATH protein family encompasses a group of related small-molecule methyltransferases (MTs) that catalyze the S-adenosyl-L-methionine-dependent methylation of natural chemicals encompassing widely divergent structures. Indole-3-acetic acid (IAA) methyltransferase (IAMT) is a member of the SABATH family that modulates IAA homeostasis in plant tissues through methylation of IAA's free carboxyl group. The crystal structure of Arabidopsis (Arabidopsis thaliana) IAMT (AtIAMT1) was determined and refined to 2.75 Angstroms resolution. The overall tertiary and quaternary structures closely resemble the two-domain bilobed monomer and the dimeric arrangement, respectively, previously observed for the related salicylic acid carboxyl methyltransferase from Clarkia breweri (CbSAMT). To further our understanding of the biological function and evolution of SABATHs, especially of IAMT, we analyzed the SABATH gene family in the rice (Oryza sativa) genome. Forty-one OsSABATH genes were identified. Expression analysis showed that more than one-half of the OsSABATH genes were transcribed in one or multiple organs. The OsSABATH gene most similar to AtIAMT1 is OsSABATH4. Escherichia coli-expressed OsSABATH4 protein displayed the highest level of catalytic activity toward IAA and was therefore named OsIAMT1. OsIAMT1 exhibited kinetic properties similar to AtIAMT1 and poplar IAMT (PtIAMT1). Structural modeling of OsIAMT1 and PtIAMT1 using the experimentally determined structure of AtIAMT1 reported here as a template revealed conserved structural features of IAMTs within the active-site cavity that are divergent from functionally distinct members of the SABATH family, such as CbSAMT. Phylogenetic analysis revealed that IAMTs from Arabidopsis, rice, and poplar (Populus spp.) form a monophyletic group. Thus, structural, biochemical, and phylogenetic evidence supports the hypothesis that IAMT is an evolutionarily ancient member of the SABATH family likely to play a critical role in

  1. Isolation and identification by sequence homology of a putative cytosine methyltransferase from Arabidopsis thaliana.

    PubMed Central

    Finnegan, E J; Dennis, E S

    1993-01-01

    A plant cytosine methyltransferase cDNA was isolated using degenerate oligonucleotides, based on homology between prokaryote and mouse methyltransferases, and PCR to amplify a short fragment of a methyltransferase gene. A fragment of the predicted size was amplified from genomic DNA from Arabidopsis thaliana. Overlapping cDNA clones, some with homology to the PCR amplified fragment, were identified and sequenced. The assembled nucleic acid sequence is 4720 bp and encodes a protein of 1534 amino acids which has significant homology to prokaryote and mammalian cytosine methyltransferases. Like mammalian methylases, this enzyme has a C terminal methyltransferase domain linked to a second larger domain. The Arabidopsis methylase has eight of the ten conserved sequence motifs found in prokaryote cytosine-5 methyltransferases and shows 50% homology to the murine enzyme in the methyltransferase domain. The amino terminal domain is only 24% homologous to the murine enzyme and lacks the zinc binding region that has been found in methyltransferases from both mouse and man. In contrast to mouse where a single methyltransferase gene has been identified, a small multigene family with homology to the region amplified in PCR has been identified in Arabidopsis thaliana. Images PMID:8389441

  2. Genetic Analysis of the Methanol- and Methylamine-Specific Methyltransferase 2 Genes of Methanosarcina acetivorans C2A▿

    PubMed Central

    Bose, Arpita; Pritchett, Matthew A.; Metcalf, William W.

    2008-01-01

    The entry of methanol into the methylotrophic pathway of methanogenesis is mediated by the concerted effort of two methyltransferases, namely, methyltransferase 1 (MT1) and methyltransferase 2 (MT2). The mtaA1, mtaA2, and mtbA genes of Methanosarcina acetivorans C2A encode putative methanol- or methylamine-specific MT2 enzymes. To address the in vivo roles of these genes in growth and methanogenesis from known substrates, we constructed and characterized mutants with deletions of each of these genes. The mtaA1 gene is required for growth on methanol, whereas mtaA2 was dispensable. However, the mtaA2 mutant had a reduced rate of methane production from methanol. Surprisingly, deletion of mtaA1 in combination with deletions of the genes encoding three methanol-specific MT1 isozymes led to lack of growth on acetate, suggesting that MT1 and MT2 enzymes might play an important role during growth on this substrate. The mtbA gene was required for dimethylamine and monomethylamine (MMA) utilization and was important, but not required, for trimethylamine utilization. Analysis of reporter gene fusions revealed that both mtaA1 and mtbA were expressed on all methanogenic substrates tested. However, mtaA1 expression was induced on methanol, while mtbA expression was down-regulated on MMA and acetate. mtaA2 was expressed at very low levels on all substrates. The mtaA1 transcript had a large 5′ untranslated region (UTR) (275 bp), while the 5′ UTR of the mtbA transcript was only 28 bp long. PMID:18375552

  3. Aberrant expression and localization of deoxyribonucleic acid methyltransferase 3B in endometriotic stromal cells.

    PubMed

    Dyson, Matthew T; Kakinuma, Toshiyuki; Pavone, Mary Ellen; Monsivais, Diana; Navarro, Antonia; Malpani, Saurabh S; Ono, Masanori; Bulun, Serdar E

    2015-10-01

    To define the expression and function of DNA methyltransferases (DNMTs) in response to decidualizing stimuli in endometriotic cells compared with healthy endometrial stroma. Basic science. University research center. Premenopausal women with or without endometriosis. Primary cultures of stromal cells from healthy endometrium (E-IUM) or endometriomas (E-OSIS) were subjected to in vitro decidualization (IVD) using 1 μM medroxyprogesterone acetate, 35 nM 17β-estradiol, and 0.05 mM 8-Br-cAMP. Expression of DNMT1, DNMT3A, and DNMT3B in E-IUM and E-OSIS were assessed by quantitative real-time polymerase chain reaction and immunoblotting. Recruitment of DNMT3B to the promoters of steroidogenic factor 1 (SF-1) and estrogen receptor α (ESR1) was examined by chromatin immunoprecipitation. IVD treatment reduced DNMT3B messenger RNA (74%) and protein levels (81%) only in E-IUM; DNMT1 and DNMT3A were unchanged in both cell types. Significantly more DNMT3B bound to the SF-1 promoter in E-IUM compared with E-OSIS, and IVD treatment reduced binding in E-IUM to levels similar to those in E-OSIS. Enrichment of DNMT3B across 3 ESR1 promoters was reduced in E-IUM after IVD, although the more-distal promoter showed increased DNMT3B enrichment in E-OSIS after IVD. The inability to downregulate DNMT3B expression in E-OSIS may contribute to an aberrant epigenetic fingerprint that misdirects gene expression in endometriosis and contributes to its altered response to steroid hormones. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  4. Identification of DNA Methyltransferase Genes in Human Pathogenic Bacteria by Comparative Genomics.

    PubMed

    Brambila-Tapia, Aniel Jessica Leticia; Poot-Hernández, Augusto Cesar; Perez-Rueda, Ernesto; Rodríguez-Vázquez, Katya

    2016-06-01

    DNA methylation plays an important role in gene expression and virulence in some pathogenic bacteria. In this report, we describe DNA methyltransferases (MTases) present in human pathogenic bacteria and compared them with related species, which are not pathogenic or less pathogenic, based in comparative genomics. We performed a search in the KEGG database of the KEGG database orthology groups associated with adenine and cytosine DNA MTase activities (EC: 2.1.1.37, EC: 2.1.1.113 and EC: 2.1.1.72) in 37 human pathogenic species and 18 non/less pathogenic relatives and performed comparisons of the number of these MTases sequences according to their genome size, the DNA MTase type and with their non-less pathogenic relatives. We observed that Helicobacter pylori and Neisseria spp. presented the highest number of MTases while ten different species did not present a predicted DNA MTase. We also detected a significant increase of adenine MTases over cytosine MTases (2.19 vs. 1.06, respectively, p < 0.001). Adenine MTases were the only MTases associated with restriction modification systems and DNA MTases associated with type I restriction modification systems were more numerous than those associated with type III restriction modification systems (0.84 vs. 0.17, p < 0.001); additionally, there was no correlation with the genome size and the total number of DNA MTases, indicating that the number of DNA MTases is related to the particular evolution and lifestyle of specific species, regulating the expression of virulence genes in some pathogenic bacteria.

  5. Peperomin E reactivates silenced tumor suppressor genes in lung cancer cells by inhibition of DNA methyltransferase.

    PubMed

    Wang, Xin-Zhi; Cheng, Ying; Wang, Kui-Long; Liu, Rui; Yang, Xiao-Lin; Wen, Hong-Mei; Chai, Chuan; Liang, Jing-Yu; Wu, Hao

    2016-10-01

    Advanced lung cancer has poor prognosis owing to its low sensitivity to current chemotherapy agents. Therefore, discovery of new therapeutic agents is urgently needed. In this study, we investigated the antitumor effects of peperomin E, a secolignan isolated from Peperomia dindygulensis, a frequently used Chinese folk medicine for lung cancer treatment. The results indicate that peperomin E has antiproliferative effects, promoting apoptosis and cell cycle arrest in non-small-cell lung cancer (NSCLC) cell lines in a dose-dependent manner, while showing lower toxicity against normal human lung epidermal cells. Peperomin E inhibited tumor growth in A549 xenograft BALB/c nude mice without significant secondary adverse effects, indicating that it may be safely used to treat NSCLC. Furthermore, the mechanisms underlying the anticancer effects of peperomin E have been investigated. Using an in silico target fishing method, we observed that peperomin E directly interacts with the active domain of DNA methyltransferase 1 (DNMT1), potentially affecting its genome methylation activity. Subsequent experiments verified that peperomin E decreased DNMT1 activity and expression, thereby decreasing global methylation and reactivating the epigenetically silenced tumor suppressor genes including RASSF1A, APC, RUNX3, and p16INK4, which in turn activates their mediated pro-apoptotic and cell cycle regulatory signaling pathways in lung cancer cells. The observations herein report for the first time that peperomin E is a potential chemotherapeutic agent for NSCLC. The anticancer effects of peperomin E may be partly attributable to its ability to demethylate and reactivate methylation-silenced tumor suppressor genes through direct inhibition of the activity and expression of DNMT1.

  6. Deoxyribonucleic acid (DNA) methyltransferase contributes to p16 promoter CpG island methylation in lung adenocarcinoma with smoking.

    PubMed

    Sun, Rongju; Liu, Jiahong; Wang, Bo; Ma, Lingyun; Quan, Xiaojiao; Chu, Zhixiang; Li, Tanshi

    2015-01-01

    In this study, the relationship between CpG island methylation and smoking and DNA methyltransferase in the occurrence and development of lung adenocarcinoma was explored by detecting p16 promoter methylation status. Protein and mRNA levels of p16 were detected by immunohistochemistry and in situ hybridization assays. p16 gene promoter and exon 1 CpG island locus Hap II sites methylation status was analyzed with the methylation-specific PCR. Only 4 of 40 p16-positive cases were detected to methylate on CpG islands with 10% methylating rate whereas 18 of p16-negative cases were methylated up to 36.73% of methylating rate. The methylating rates of both p16-positive and p16-negative groups were significantly different. 17 of 50 cases with smoking from total 89 lung adenocarcinoma cases were detected to methylate on CpG islands while only 5 of the remaining 39 non-smokers to methylate. The difference of the methylating rates in both smokers and non-smokers was significant to suggest the closely association of CpG island methylation of p16 with smoking. Furthermore, p16 promoter CpG islands were detected to methylate in 15 of 35 cases with higher DNA methyltransferase activity whereas only 7 detected to methylate in the remaining 54 cases with lower DNA methyltransferase activity. p16 promoter CpG island methylation likely made p16 expressing silence thus contributed to the tumorigenesis of lung adenocarcinoma. Smoking is likely to promote p16 CpG island methylation or by its effect of the activity and metabolism of DNA methyltransferase 1 (DNMT) on CpG island methylation status.

  7. ZNF274 Recruits the Histone Methyltransferase SETDB1 to the 3′ Ends of ZNF Genes

    PubMed Central

    Frietze, Seth; O'Geen, Henriette; Blahnik, Kimberly R.; Jin, Victor X.; Farnham, Peggy J.

    2010-01-01

    Only a small percentage of human transcription factors (e.g. those associated with a specific differentiation program) are expressed in a given cell type. Thus, cell fate is mainly determined by cell type-specific silencing of transcription factors that drive different cellular lineages. Several histone modifications have been associated with gene silencing, including H3K27me3 and H3K9me3. We have previously shown that genes for the two largest classes of mammalian transcription factors are marked by distinct histone modifications; homeobox genes are marked by H3K27me3 and zinc finger genes are marked by H3K9me3. Several histone methyltransferases (e.g. G9a and SETDB1) may be involved in mediating the H3K9me3 silencing mark. We have used ChIP-chip and ChIP-seq to demonstrate that SETDB1, but not G9a, is associated with regions of the genome enriched for H3K9me3. One current model is that SETDB1 is recruited to specific genomic locations via interaction with the corepressor TRIM28 (KAP1), which is in turn recruited to the genome via interaction with zinc finger transcription factors that contain a Kruppel-associated box (KRAB) domain. However, specific KRAB-ZNFs that recruit TRIM28 (KAP1) and SETDB1 to the genome have not been identified. We now show that ZNF274 (a KRAB-ZNF that contains 5 C2H2 zinc finger domains), can interact with KAP1 both in vivo and in vitro and, using ChIP-seq, we show that ZNF274 binding sites co-localize with SETDB1, KAP1, and H3K9me3 at the 3′ ends of zinc finger genes. Knockdown of ZNF274 with siRNAs reduced the levels of KAP1 and SETDB1 recruitment to the binding sites. These studies provide the first identification of a KRAB domain-containing ZNF that is involved in recruitment of the KAP1 and SETDB1 to specific regions of the human genome. PMID:21170338

  8. Cloning and characterization of two tandemly arranged DNA methyltransferase genes of Neisseria lactamica: an adenine-specific M.NlaIII and a cytosine-type methylase.

    PubMed

    Labbé, D; Höltke, H J; Lau, P C

    1990-10-01

    The gene encoding the Neisseria lactamica III DNA methyltransferase (M.NlaIII) which recognizes the sequence CATG has been cloned and expressed in Escherichia coli. DNA sequencing of a 3.125 kb EcoRI-PstI fragment localizes the M. NlaIII gene to a 334 codon open reading frame (ORF) and identifies, 468 bp downstream, a second ORF of 313 amino acids, which is referred to as M.NlaX. Both proteins are detectable in the E. coli coupled in vitro transcription-translation system; they are apparently expressed from separate N. lactamica promoters. The N-terminal half of the previously characterized M.FokI, which methylates adenine in one of the DNA strands with its asymmetric recognition sequence (GGATG), is found to have 41% sequence identity and a further 11.7% sequence similarity with M.NlaIII. Among the conserved amino acids is the wellknown DPPY sequence motif. With one exception, analysis of the nucleotides coding for the DP dipeptide in all known DPPY sequences shows the presence of an inherent DNA adenine methylation (dam) recognition site of GATC. A low level of expression of M.NlaX in E. coli prevents the elucidation of its sequence recognition specificity. Sequence analysis of M.NlaX shows that it is closely related to the group of monospecific 5-methylcytosine DNA methyltransferases (M.EcoRII, Dcm, M.HpaII and M.HhaI) which all have a modified cytosine at the second position of the recognition sequences. Both M.EcoRII and Dcm amino acid sequences are about 50% identical with M.NlaX; a considerable degree of sequence identity is found in the so-called variable region which is believed to be responsible for sequence recognition specificity. M.NlaX is probably the counterpart to the E. coli Dcm in N. lactamica.

  9. Cloning, sequencing, and expression of the uroporphyrinogen III methyltransferase cobA gene of Propionibacterium freudenreichii (shermanii).

    PubMed

    Sattler, I; Roessner, C A; Stolowich, N J; Hardin, S H; Harris-Haller, L W; Yokubaitis, N T; Murooka, Y; Hashimoto, Y; Scott, A I

    1995-03-01

    We cloned, sequenced, and overexpressed cobA, the gene encoding uroporphyrinogen III methyltransferase in Propionibacterium freudenreichii, and examined the catalytic properties of the enzyme. The methyltransferase is similar in mass (27 kDa) and homologous to the one isolated from Pseudomonas denitrificans. In contrast to the much larger isoenzyme encoded by the cysG gene of Escherichia coli (52 kDa), the P. freudenreichii enzyme does not contain the additional 22-kDa peptide moiety at its N-terminal end bearing the oxidase-ferrochelatase activity responsible for the conversion of dihydrosirohydrochlorin (precorrin-2) to siroheme. Since it does not contain this moiety, it is not a likely candidate for synthesis of a cobalt-containing early intermediate that has been proposed for the vitamin B12 biosynthetic pathway in P. freudenreichii. Uroporphyrinogen III methyltransferase of P. freudenreichii not only catalyzes the addition of two methyl groups to uroporphyrinogen III to afford the early vitamin B12 intermediate, precorrin-2, but also has an overmethylation property that catalyzes the synthesis of several tri- and tetra-methylated compounds that are not part of the vitamin B12 pathway. The enzyme catalyzes the addition of three methyl groups to uroporphyrinogen I to form trimethylpyrrocorphin, the intermediate necessary for biosynthesis of the natural products, factors S1 and S3, previously isolated from this organism. A second gene found upstream from the cobA gene encodes a protein homologous to CbiO of Salmonella typhimurium, a membrane-bound, ATP-dependent transport protein thought to be part of the cobalt transport system involved in vitamin B12 synthesis. These two genes do not appear to constitute part of an extensive cobalamin operon.

  10. MoSET1 (Histone H3K4 Methyltransferase in Magnaporthe oryzae) Regulates Global Gene Expression during Infection-Related Morphogenesis

    PubMed Central

    Pham, Kieu Thi Minh; Inoue, Yoshihiro; Vu, Ba Van; Nguyen, Hanh Hieu; Nakayashiki, Toru; Ikeda, Ken-ichi; Nakayashiki, Hitoshi

    2015-01-01

    Here we report the genetic analyses of histone lysine methyltransferase (KMT) genes in the phytopathogenic fungus Magnaporthe oryzae. Eight putative M. oryzae KMT genes were targeted for gene disruption by homologous recombination. Phenotypic assays revealed that the eight KMTs were involved in various infection processes at varying degrees. Moset1 disruptants (Δmoset1) impaired in histone H3 lysine 4 methylation (H3K4me) showed the most severe defects in infection-related morphogenesis, including conidiation and appressorium formation. Consequently, Δmoset1 lost pathogenicity on wheat host plants, thus indicating that H3K4me is an important epigenetic mark for infection-related gene expression in M. oryzae. Interestingly, appressorium formation was greatly restored in the Δmoset1 mutants by exogenous addition of cAMP or of the cutin monomer, 16-hydroxypalmitic acid. The Δmoset1 mutants were still infectious on the super-susceptible barley cultivar Nigrate. These results suggested that MoSET1 plays roles in various aspects of infection, including signal perception and overcoming host-specific resistance. However, since Δmoset1 was also impaired in vegetative growth, the impact of MoSET1 on gene regulation was not infection specific. ChIP-seq analysis of H3K4 di- and tri-methylation (H3K4me2/me3) and MoSET1 protein during infection-related morphogenesis, together with RNA-seq analysis of the Δmoset1 mutant, led to the following conclusions: 1) Approximately 5% of M. oryzae genes showed significant changes in H3K4-me2 or -me3 abundance during infection-related morphogenesis. 2) In general, H3K4-me2 and -me3 abundance was positively associated with active transcription. 3) Lack of MoSET1 methyltransferase, however, resulted in up-regulation of a significant portion of the M. oryzae genes in the vegetative mycelia (1,491 genes), and during infection-related morphogenesis (1,385 genes), indicating that MoSET1 has a role in gene repression either directly or more

  11. Recruitment of Histone Methyltransferase G9a Mediates Transcriptional Repression of Fgf21 Gene by E4BP4 Protein*

    PubMed Central

    Tong, Xin; Zhang, Deqiang; Buelow, Katie; Guha, Anirvan; Arthurs, Blake; Brady, Hugh J. M.; Yin, Lei

    2013-01-01

    The liver responds to fasting-refeeding cycles by reprogramming expression of metabolic genes. Fasting potently induces one of the key hepatic hormones, fibroblast growth factor 21 (FGF21), to promote lipolysis, fatty acid oxidation, and ketogenesis, whereas refeeding suppresses its expression. We previously reported that the basic leucine zipper transcription factor E4BP4 (E4 binding protein 4) represses Fgf21 expression and disrupts its circadian oscillations in cultured hepatocytes. However, the epigenetic mechanism for E4BP4-dependent suppression of Fgf21 has not yet been addressed. Here we present evidence that histone methyltransferase G9a mediates E4BP4-dependent repression of Fgf21 during refeeding by promoting repressive histone modification. We find that Fgf21 expression is up-regulated in E4bp4 knock-out mouse liver. We demonstrate that the G9a-specific inhibitor BIX01294 abolishes suppression of the Fgf21 promoter activity by E4BP4, whereas overexpression of E4bp4 leads to increased levels of dimethylation of histone 3 lysine 9 (H3K9me2) around the Fgf21 promoter region. Furthermore, we also show that E4BP4 interacts with G9a, and knockdown of G9a blocks repression of Fgf21 promoter activity and expression in cells overexpressing E4bp4. A G9a mutant lacking catalytic activity, due to deletion of the SET domain, fails to inhibit the Fgf21 promoter activity. Importantly, acute hepatic knockdown by adenoviral shRNA targeting G9a abolishes Fgf21 repression by refeeding, concomitant with decreased levels of H3K9me2 around the Fgf21 promoter region. In summary, we show that G9a mediates E4BP4-dependent suppression of hepatic Fgf21 by enhancing histone methylation (H3K9me2) of the Fgf21 promoter. PMID:23283977

  12. The histone methyltransferases Set5 and Set1 have overlapping functions in gene silencing and telomere maintenance.

    PubMed

    Jezek, Meagan; Gast, Alison; Choi, Grace; Kulkarni, Rushmie; Quijote, Jeremiah; Graham-Yooll, Andrew; Park, DoHwan; Green, Erin M

    2017-02-01

    Genes adjacent to telomeres are subject to transcriptional repression mediated by an integrated set of chromatin modifying and remodeling factors. The telomeres of Saccharomyces cerevisiae have served as a model for dissecting the function of diverse chromatin proteins in gene silencing, and their study has revealed overlapping roles for many chromatin proteins in either promoting or antagonizing gene repression. The H3K4 methyltransferase Set1, which is commonly linked to transcriptional activation, has been implicated in telomere silencing. Set5 is an H4 K5, K8, and K12 methyltransferase that functions with Set1 to promote repression at telomeres. Here, we analyzed the combined role for Set1 and Set5 in gene expression control at native yeast telomeres. Our data reveal that Set1 and Set5 promote a Sir protein-independent mechanism of repression that may primarily rely on regulation of H4K5ac and H4K8ac at telomeric regions. Furthermore, cells lacking both Set1 and Set5 have highly correlated transcriptomes to mutants in telomere maintenance pathways and display defects in telomere stability, linking their roles in silencing to protection of telomeres. Our data therefore provide insight into and clarify potential mechanisms by which Set1 contributes to telomere silencing and shed light on the function of Set5 at telomeres.

  13. Glycine N-methyltransferase tumor susceptibility gene in the benzo(a)pyrene-detoxification pathway.

    PubMed

    Chen, Shih-Yin; Lin, Jane-Ru Vivan; Darbha, Ramalakshmi; Lin, Pinpin; Liu, Tsung-Yun; Chen, Yi-Ming Arthur

    2004-05-15

    Glycine N-methyltransferase (GNMT) affects genetic stability by (a) regulating the ratio of S-adenosylmethionine to S-adenosylhomocystine and (b) binding to folate. Based on the identification of GNMT as a 4 S polyaromatic hydrocarbon-binding protein, we used liver cancer cell lines that expressed GNMT either transiently or stably in cDNA transfections to analyze the role of GNMT in the benzo(a)pyrene (BaP) detoxification pathway. Results from an indirect immunofluorescent antibody assay showed that GNMT was expressed in cell cytoplasm before BaP treatment and translocated to cell nuclei after BaP treatment. Compared with cells transfected with the vector plasmid, the number of BaP-7,8-diol 9,10-epoxide-DNA adducts that formed in GNMT-expressing cells was significantly reduced. Furthermore, the dose-dependent inhibition of BaP-7,8-diol 9,10-epoxide-DNA adduct formation by GNMT was observed in HepG2 cells infected with different multiplicities of infection of recombinant adenoviruses carrying GNMT cDNA. According to an aryl hydrocarbon hydroxylase enzyme activity assay, GNMT inhibited BaP-induced cytochrome P450 1A1 enzyme activity. Automated BaP docking using a Lamarckian genetic algorithm with GNMT X-ray crystallography revealed a BaP preference for the S-adenosylmethionine-binding domain of the dimeric form of GNMT, a novel finding of a cellular defense against potentially damaging exposures. In addition to GNMT, results from docking experiments showed that BaP binds readily with other DNA methyltransferases, including HhaI, HaeIII, PvuII methyltransferases and human DNA methyltransferase 2. We therefore hypothesized that BaP-DNA methyltransferase and BaP-GNMT interactions may contribute to carcinogenesis.

  14. The Histone Methyltransferase Gene Absent, Small, or Homeotic Discs-1 Like Is Required for Normal Hox Gene Expression and Fertility in Mice.

    PubMed

    Brinkmeier, Michelle L; Geister, Krista A; Jones, Morgan; Waqas, Meriam; Maillard, Ivan; Camper, Sally A

    2015-11-01

    Chromatin remodeling influences gene expression in developing and adult organisms. Active and repressive marks of histone methylation dictate the embryonic expression boundaries of developmentally regulated genes, including the Hox gene cluster. Drosophila ash1 (absent, small or homeotic discs 1) gene encodes a histone methyltransferase essential for regulation of Hox gene expression that interacts genetically with other members of the trithorax group (TrxG). While mammalian members of the mixed lineage leukemia (Mll) family of TrxG genes have roles in regulation of Hox gene expression, little is known about the expression and function of the mammalian ortholog of the Drosophila ash1 gene, Ash1-like (Ash1l). Here we report the expression of mouse Ash1l gene in specific structures within various organs and provide evidence that reduced Ash1l expression has tissue-specific effects on mammalian development and adult homeostasis. Mutants exhibit partially penetrant postnatal lethality and failure to thrive. Surviving mutants have growth insufficiency, skeletal transformations, and infertility associated with developmental defects in both male and female reproductive organs. Specifically, expression of Hoxa11 and Hoxd10 are altered in the epididymis of Ash1l mutant males and Hoxa10 is reduced in the uterus of Ash1l mutant females. In summary, we show that the histone methyltransferase Ash1l is important for the development and function of several tissues and for proper expression of homeotic genes in mammals. © 2015 by the Society for the Study of Reproduction, Inc.

  15. The Histone Methyltransferase Gene Absent, Small, or Homeotic Discs-1 Like Is Required for Normal Hox Gene Expression and Fertility in Mice1

    PubMed Central

    Brinkmeier, Michelle L.; Geister, Krista A.; Jones, Morgan; Waqas, Meriam; Maillard, Ivan; Camper, Sally A.

    2015-01-01

    Chromatin remodeling influences gene expression in developing and adult organisms. Active and repressive marks of histone methylation dictate the embryonic expression boundaries of developmentally regulated genes, including the Hox gene cluster. Drosophila ash1 (absent, small or homeotic discs 1) gene encodes a histone methyltransferase essential for regulation of Hox gene expression that interacts genetically with other members of the trithorax group (TrxG). While mammalian members of the mixed lineage leukemia (Mll) family of TrxG genes have roles in regulation of Hox gene expression, little is known about the expression and function of the mammalian ortholog of the Drosophila ash1 gene, Ash1-like (Ash1l). Here we report the expression of mouse Ash1l gene in specific structures within various organs and provide evidence that reduced Ash1l expression has tissue-specific effects on mammalian development and adult homeostasis. Mutants exhibit partially penetrant postnatal lethality and failure to thrive. Surviving mutants have growth insufficiency, skeletal transformations, and infertility associated with developmental defects in both male and female reproductive organs. Specifically, expression of Hoxa11 and Hoxd10 are altered in the epididymis of Ash1l mutant males and Hoxa10 is reduced in the uterus of Ash1l mutant females. In summary, we show that the histone methyltransferase Ash1l is important for the development and function of several tissues and for proper expression of homeotic genes in mammals. PMID:26333994

  16. Ribosomal protein methylation in Escherichia coli: the gene prmA, encoding the ribosomal protein L11 methyltransferase, is dispensable.

    PubMed

    Vanet, A; Plumbridge, J A; Guérin, M F; Alix, J H

    1994-12-01

    The prmA gene, located at 72 min on the Escherichia coli chromosome, is the genetic determinant of ribosomal protein L11-methyltransferase activity. Mutations at this locus, prmA1 and prmA3, result in a severely undermethylated form of L11. No effect, other than the lack of methyl groups on L11, has been ascribed to these mutations. DNA sequence analysis of the mutant alleles prmA1 and prmA3 detected point mutations near the C-terminus of the protein and plasmids overproducing the wild-type and the two mutant proteins have been constructed. The wild-type PrmA protein could be crosslinked to its radiolabelled substrate, S-adenosyl-L-methionine (SAM), by u.v. irradiation indicating that it is the gene for the methyltransferase rather than a regulatory protein. One of the mutant proteins, PrmA3, was also weakly crosslinked to SAM. Both mutant enzymes when expressed from the overproducing plasmids were capable of catalysing the incorporation of 3H-labelled methyl groups from SAM to L11 in vitro. This confirmed the observation that the mutant proteins possess significant residual activity which could account for their lack of growth phenotype. However, a strain carrying an in vitro-constructed null mutation of the prmA gene, transferred to the E. coli chromosome by homologous recombination, was perfectly viable.

  17. Mutation in Brachypodium caffeic acid O-methyltransferase 6 alters stem and grain lignins and improves straw saccharification without deteriorating grain quality

    PubMed Central

    Ho-Yue-Kuang, Séverine; Alvarado, Camille; Antelme, Sébastien; Bouchet, Brigitte; Cézard, Laurent; Le Bris, Philippe; Legée, Frédéric; Maia-Grondard, Alessandra; Yoshinaga, Arata; Saulnier, Luc; Guillon, Fabienne; Sibout, Richard; Lapierre, Catherine; Chateigner-Boutin, Anne-Laure

    2016-01-01

    Cereal crop by-products are a promising source of renewable raw material for the production of biofuel from lignocellulose. However, their enzymatic conversion to fermentable sugars is detrimentally affected by lignins. Here the characterization of the Brachypodium Bd5139 mutant provided with a single nucleotide mutation in the caffeic acid O-methyltransferase BdCOMT6 gene is reported. This BdCOMT6-deficient mutant displayed a moderately altered lignification in mature stems. The lignin-related BdCOMT6 gene was also found to be expressed in grains, and the alterations of Bd5139 grain lignins were found to mirror nicely those evidenced in stem lignins. The Bd5139 grains displayed similar size and composition to the control. Complementation experiments carried out by introducing the mutated gene into the AtCOMT1-deficient Arabidopsis mutant demonstrated that the mutated BdCOMT6 protein was still functional. Such a moderate down-regulation of lignin-related COMT enzyme reduced the straw recalcitrance to saccharification, without compromising the vegetative or reproductive development of the plant. PMID:26433202

  18. Determination of the structure and catalytic mechanism of Sorghum bicolor caffeic acid O-methyltransferase and the structural impact of three brown midrib12 mutations

    USDA-ARS?s Scientific Manuscript database

    With S-adenosylmethionine (SAM) acting as the methyl donor, caffeic acid O-methyltransferase from Sorghum bicolor (SbCOMT) methylates the 5-hydroxyl group of its preferred substrate, 5-hydroxyconiferaldehyde, to form sinapaldehyde. In order to determine the mechanism of SbCOMT and understand the red...

  19. Arabidopsis histone methyltransferase SET DOMAIN GROUP8 mediates induction of the jasmonate/ethylene pathway genes in plant defense response to necrotrophic fungi.

    PubMed

    Berr, Alexandre; McCallum, Emily J; Alioua, Abdelmalek; Heintz, Dimitri; Heitz, Thierry; Shen, Wen-Hui

    2010-11-01

    As sessile organisms, plants have to endure a wide variety of biotic and abiotic stresses, and accordingly they have evolved intricate and rapidly inducible defense strategies associated with the activation of a battery of genes. Among other mechanisms, changes in chromatin structure are thought to provide a flexible, global, and stable means for the regulation of gene transcription. In support of this idea, we demonstrate here that the Arabidopsis (Arabidopsis thaliana) histone methyltransferase SET DOMAIN GROUP8 (SDG8) plays a crucial role in plant defense against fungal pathogens by regulating a subset of genes within the jasmonic acid (JA) and/or ethylene signaling pathway. We show that the loss-of-function mutant sdg8-1 displays reduced resistance to the necrotrophic fungal pathogens Alternaria brassicicola and Botrytis cinerea. While levels of JA, a primary phytohormone involved in plant defense, and camalexin, a major phytoalexin against fungal pathogens, remain unchanged or even above normal in sdg8-1, induction of several defense genes within the JA/ethylene signaling pathway is severely compromised in response to fungal infection or JA treatment in mutant plants. Both downstream genes and, remarkably, also upstream mitogen-activated protein kinase kinase genes MKK3 and MKK5 are misregulated in sdg8-1. Accordingly, chromatin immunoprecipitation analysis shows that sdg8-1 impairs dynamic changes of histone H3 lysine 36 methylation at defense marker genes as well as at MKK3 and MKK5, which normally occurs upon infection with fungal pathogens or methyl JA treatment in wild-type plants. Our data indicate that SDG8-mediated histone H3 lysine 36 methylation may serve as a memory of permissive transcription for a subset of defense genes, allowing rapid establishment of transcriptional induction.

  20. Effects of topiramate on ethanol-cocaine interactions and DNA methyltransferase gene expression in the rat prefrontal cortex

    PubMed Central

    Echeverry-Alzate, V; Giné, E; Bühler, K M; Calleja-Conde, J; Olmos, P; Gorriti, M A; Nadal, R; Rodríguez de Fonseca, F; López-Moreno, J A

    2014-01-01

    BACKGROUND AND PURPOSE Recent and ongoing clinical studies have indicated that topiramate (Topamax®) could be effective in treating ethanol or cocaine abuse. However, the effects of topiramate on the co-administration of ethanol and cocaine remain largely unknown. EXPERIMENTAL APPROACH We studied the effects of topiramate, in Wistar rats, on operant ethanol self-administration with the co-administration of cocaine (i.p.). The psychomotor effects of topiramate were examined before ethanol self-administration and cocaine exposure. Blood samples were collected to analyse ethanol and cocaine metabolism (blood ethanol levels and benzoylecgonine). Quantitative real-time PCR was used to characterize the gene expression in the prefrontal cortex. KEY RESULTS Topiramate prevented the cocaine-induced increased response to ethanol in a dose-dependent manner without causing any motor impairment by itself. This effect was observed when topiramate was administered before ethanol access, but not when topiramate was administered before the cocaine injection. Topiramate did not block cocaine-induced psychomotor stimulation. Topiramate reduced blood ethanol levels but did not affect cocaine metabolism. Ethanol increased the gene expression of DNA methyltransferases (Dnmt1 and Dnmt3a), the corepressor Dnmt1-associated protein 1 (Dmap1), and the RNA methyltransferase Trdmt1. These effects were prevented by topiramate or cocaine. Gene expression of histone deacetylase-2 and glutamate receptor kainate-1 were only increased by cocaine treatment. Topiramate and cocaine co-administration caused an up-regulation of dopamine (Drd1, Th) and opioid (Oprm1) receptor genes. Topiramate showed a tendency to alter episodic-like memory. CONCLUSIONS AND IMPLICATIONS Topiramate is an effective inhibitor of the cocaine-induced increase in operant ethanol self-administration. PMID:24527678

  1. Association of codon 108/158 catechol-O-methyltransferase gene polymorphism with the psychiatric manifestations of velo-cardio-facial syndrome

    SciTech Connect

    Lachman, H.M.; Papolos, D.F.; Veit, S.

    1996-09-20

    Velo-cardio-facial-syndrome (VCFS) is a common congenital disorder associated with typical facial appearance, cleft palate, cardiac defects, and learning disabilities. The majority of patients have an interstitial deletion on chromosome 22q11. In addition to physical abnormalities, a variety of psychiatric illnesses have been reported in patients with VCFS, including schizophrenia, bipolar disorder, and attention deficit hyperactivity disorder. The psychiatric manifestations of VCFS could be due to haploinsufficiency of a gene(s) within 22q11. One candidate that has been mapped to this region is catechol-O-methyltransferase (COMT). We recently identified a polymorphism in the COMT gene that leads to a valine{r_arrow}methionine substitution at amino acid 158 of the membrane-bound form of the enzyme. Homozygosity for COMT158{sup met} leads to a 3- to 4-fold reduction in enzymatic activity, compared with homozygotes for COMT158{sup met}. We now report that in a population of patients with VCFS, there is an apparent association between the low-activity allele, COMT158{sup met}, and the development of bipolar spectrum disorder, and in particular, a rapid-cycling form. 33 refs., 3 tabs.

  2. Cellular and subcellular localization of S-adenosyl-L-methionine:benzoic acid carboxyl methyltransferase, the enzyme responsible for biosynthesis of the volatile ester methylbenzoate in snapdragon flowers.

    PubMed

    Kolosova, N; Sherman, D; Karlson, D; Dudareva, N

    2001-07-01

    The benzenoid ester, methylbenzoate is one of the most abundant scent compounds detected in the majority of snapdragon (Antirrhinum majus) varieties. It is produced in upper and lower lobes of petals by enzymatic methylation of benzoic acid in the reaction catalyzed by S-adenosyl-L-methionine:benzoic acid carboxyl methyltransferase (BAMT). To identify the location of methylbenzoate biosynthesis, we conducted an extensive immunolocalization study by light and electron microscopy at cellular and subcellular levels using antibodies against BAMT protein. BAMT was immunolocalized predominantly in the conical cells of the inner epidermal layer and, to a much lesser extent, in the cells of the outer epidermis of snapdragon flower petal lobes. It was also located in the inner epidermis of the corolla tube with little BAMT protein detected in the outer epidermis and in the yellow hairs within the tube on the bee's way to the nectar. These results strongly suggest that scent biosynthetic genes are expressed almost exclusively in the epidermal cells of floral organs. Immunogold labeling studies reveal that BAMT is a cytosolic enzyme, suggesting cytosolic location of methylbenzoate biosynthesis. The concentration of scent production on flower surfaces that face the pollinators during landing may increase pollination efficiency and also help to minimize the biosynthetic cost of advertising for pollinators.

  3. An intact SAM-dependent methyltransferase fold is encoded by the human endothelin-converting enzyme-2 gene

    SciTech Connect

    Tempel, W.; Wu, H.; Dombrovsky, L.; Zeng, H.; Loppnau, P.; Zhu, H.; Plotnikov, A.N.; Bochkarev, A.

    2010-08-17

    A recent survey of protein expression patterns in patients with Alzheimer's disease (AD) has identified ece2 (chromosome: 3; Locations: 3q27.1) as the most significantly downregulated gene within the tested group. ece2 encodes endothelin-converting enzyme ECE2, a metalloprotease with a role in neuropeptide processing. Deficiency in the highly homologous ECE1 has earlier been linked to increased levels of AD-related {beta}-amyloid peptide in mice, consistent with a role for ECE in the degradation of that peptide. Initially, ECE2 was presumed to resemble ECE1, in that it comprises a single transmembrane region of {approx}20 residues flanked by a small amino-terminal cytosolic segment and a carboxy-terminal lumenar peptidase domain. The carboxy-terminal domain has significant sequence similarity to both neutral endopeptidase, for which an X-ray structure has been determined, and Kell blood group protein. After their initial discovery, multiple isoforms of ECE1 and ECE2 were discovered, generated by alternative splicing of multiple exons. The originally described ece2 transcript, RefSeq NM{_}174046, contains the amino-terminal cytosolic portion followed by the transmembrane region and peptidase domain (Fig. 1, isoform B). Another ece2 transcript, available from the Mammalian Gene Collection under MGC2408 (Fig. 1, isoform C), RefSeq accession NM{_}032331, is predicted to be translated into a 255 residue peptide with low but detectable sequence similarity to known S-adenosyl-L-methionine (SAM)-dependent methyltransferases (SAM-MTs), such as the hypothetical protein TT1324 from Thermus thermophilis, PDB code 2GS9, which shares 30% amino acid sequence identity with ECE2 over 138 residues of the sequence. Intriguingly, another 'elongated' ece2 transcript (Fig. 1, isoform A) (RefSeq NM{_}014693) contains an amino-terminal portion of the putative SAM-MT domain, the transmembrane domain, and the protease domain. This suggests the possibility for coexistence of the putative SAM

  4. Protein L-isoaspartyl methyltransferase: developmentally regulated gene expression and protein localization in the central nervous system of aged rat.

    PubMed

    Shirasawa, T; Endoh, R; Zeng, Y X; Sakamoto, K; Mori, H

    1995-03-16

    We have cloned a cDNA encoding protein L-isoaspartyl methyltransferase (PIMT) and characterized gene expression in the development, maturation, and the aging process of the central nervous system by RNA blot analysis, western blot analysis, and immunohistochemistry. PIMT transcript was detected in rat embryonic brain and showed a linear up-regulation during the maturation of the brain and maintained its level in aged rat brain. Immunoblot analysis also supported a linear increase in the amount of PIMT in the maturation process of rat brains. An immunohistochemical study showed that PIMT is strongly expressed in neurons and weakly but definitively in glial cells and oligodendrocytes. These immunoreactivities significantly increased in some neurons of the hippocampus, cerebral cortex, and the brain stem of aged rat brain. The present results suggest that the expression of PIMT is associated with the amount of racemized/isomerized proteins accumulated during the developmental and aging process of the central nervous system.

  5. The histone lysine methyltransferase KMT2D sustains a gene expression program that represses B cell lymphoma development

    PubMed Central

    Ortega-Molina, Ana; Boss, Isaac W.; Canela, Andres; Pan, Heng; Jiang, Yanwen; Zhao, Chunying; Jiang, Man; Hu, Deqing; Agirre, Xabier; Niesvizky, Itamar; Lee, Ji-Eun; Chen, Hua-Tang; Ennishi, Daisuke; Scott, David W.; Mottok, Anja; Hother, Christoffer; Liu, Shichong; Cao, Xing-Jun; Tam, Wayne; Shaknovich, Rita; Garcia, Benjamin A.; Gascoyne, Randy D.; Ge, Kai; Shilatifard, Ali; Elemento, Olivier; Nussenzweig, Andre; Melnick, Ari M.; Wendel, Hans-Guido

    2015-01-01

    The lysine-specific histone methyltransferase KMT2D has emerged as one of the most frequently mutated genes in follicular lymphoma (FL) and diffuse large B cell lymphoma (DLBCL). However, the biological consequences of KMT2D mutations on lymphoma development are not known. Here we show that KMT2D functions as a bona fide tumor suppressor and that its genetic ablation in B cells promotes lymphoma development in mice. KMT2D deficiency also delays germinal center (GC) involution, impedes B cell differentiation and class switch recombination (CSR). Integrative genomic analyses indicate that KMT2D affects H3K4 methylation and expression of a specific set of genes including those in the CD40, JAK-STAT, Toll-like receptor, and B cell receptor pathways. Notably, other KMT2D target genes include frequently mutated tumor suppressor genes such as TNFAIP3, SOCS3, and TNFRSF14. Therefore, KMT2D mutations may promote malignant outgrowth by perturbing the expression of tumor suppressor genes that control B cell activating pathways. PMID:26366710

  6. [Phenylhexyl isothiocyanate induces gene p15 demethylation by down-regulating DNA methyltransferases in Molt-4 cells].

    PubMed

    Jiang, Shao-hong; Ma, Xu-dong; Huang, Yi-qun; Xu, Yun-lu; Zheng, Rui-ji

    2009-04-01

    This study is to investigate the effect of phenylhexyl isothiocyanate (PHI), which has been proved to be a novel histone deacetylase inhibitor (HDACi) recently, on gene p15 de novo expression in acute leukemia cell line Molt-4, and to further study its potential mechanism. Modified methylation specific PCR (MSP) was used to screen p15-M and p15-U mRNA. DNA methyltransferasel (DNMT1), 3A (DNMT3A), 3B (DNMT3B) and p15 mRNA were measured by RT-PCR. P15 protein was detected by Western blotting. Hypermethylation of gene p15 was reversed and activation transcription of gene p15 in Molt-4 was de novo after 5 days exposure to PHI in a concentration dependent manner. DNMT1 and DNMT3B were inhibited by exposure to PHI for 5 days (P < 0.05). Alteration of DNMT3A was not significant. It is showed that PHI could reverse hypermethylation of gene p15 and transcriptional activation of gene p15 is de novo by PHI. It may result from down-regulating DNA methyltransferases, DNMT1 and DNMT3B, or up-regulating the histone acetylation that allows chromatin unfolding and the accessibility of regulators for transcriptional activation in the p15 promoter.

  7. Polymorphisms in O-methyltransferase genes are associated with stover cell wall digestibility in European maize (Zea mays L.).

    PubMed

    Brenner, Everton A; Zein, Imad; Chen, Yongsheng; Andersen, Jeppe R; Wenzel, Gerhard; Ouzunova, Milena; Eder, Joachim; Darnhofer, Birte; Frei, Uschi; Barrière, Yves; Lübberstedt, Thomas

    2010-02-12

    OMT (O-methyltransferase) genes are involved in lignin biosynthesis, which relates to stover cell wall digestibility. Reduced lignin content is an important determinant of both forage quality and ethanol conversion efficiency of maize stover. Variation in genomic sequences coding for COMT, CCoAOMT1, and CCoAOMT2 was analyzed in relation to stover cell wall digestibility for a panel of 40 European forage maize inbred lines, and re-analyzed for a panel of 34 lines from a published French study. Different methodologies for association analysis were performed and compared. Across association methodologies, a total number of 25, 12, 1, 6 COMT polymorphic sites were significantly associated with DNDF, OMD, NDF, and WSC, respectively. Association analysis for CCoAOMT1 and CCoAOMT2 identified substantially fewer polymorphic sites (3 and 2, respectively) associated with the investigated traits. Our re-analysis on the 34 lines from a published French dataset identified 14 polymorphic sites significantly associated with cell wall digestibility, two of them were consistent with our study. Promising polymorphisms putatively causally associated with variability of cell wall digestibility were inferred from the total number of significantly associated SNPs/Indels. Several polymorphic sites for three O-methyltransferase loci were associated with stover cell wall digestibility. All three tested genes seem to be involved in controlling DNDF, in particular COMT. Thus, considerable variation among Bm3 wildtype alleles can be exploited for improving cell-wall digestibility. Target sites for functional markers were identified enabling development of efficient marker-based selection strategies.

  8. Polymorphisms in O-methyltransferase genes are associated with stover cell wall digestibility in European maize (Zea mays L.)

    PubMed Central

    2010-01-01

    Background OMT (O-methyltransferase) genes are involved in lignin biosynthesis, which relates to stover cell wall digestibility. Reduced lignin content is an important determinant of both forage quality and ethanol conversion efficiency of maize stover. Results Variation in genomic sequences coding for COMT, CCoAOMT1, and CCoAOMT2 was analyzed in relation to stover cell wall digestibility for a panel of 40 European forage maize inbred lines, and re-analyzed for a panel of 34 lines from a published French study. Different methodologies for association analysis were performed and compared. Across association methodologies, a total number of 25, 12, 1, 6 COMT polymorphic sites were significantly associated with DNDF, OMD, NDF, and WSC, respectively. Association analysis for CCoAOMT1 and CCoAOMT2 identified substantially fewer polymorphic sites (3 and 2, respectively) associated with the investigated traits. Our re-analysis on the 34 lines from a published French dataset identified 14 polymorphic sites significantly associated with cell wall digestibility, two of them were consistent with our study. Promising polymorphisms putatively causally associated with variability of cell wall digestibility were inferred from the total number of significantly associated SNPs/Indels. Conclusions Several polymorphic sites for three O-methyltransferase loci were associated with stover cell wall digestibility. All three tested genes seem to be involved in controlling DNDF, in particular COMT. Thus, considerable variation among Bm3 wildtype alleles can be exploited for improving cell-wall digestibility. Target sites for functional markers were identified enabling development of efficient marker-based selection strategies. PMID:20152036

  9. Molecular cloning, characterization and expression analysis of the protein arginine N-methyltransferase 1 gene (As-PRMT1) from Artemia sinica.

    PubMed

    Jiang, Xue; Yao, Feng; Li, Xuejie; Jia, Baolin; Zhong, Guangying; Zhang, Jianfeng; Zou, Xiangyang; Hou, Lin

    2015-07-01

    Protein arginine N-methyltransferase 1 (PRMT1) is an important epigenetic regulation factor in eukaryotic genomes. PRMT1 is involved in histone arginine loci methylation modification, changes in eukaryotic genomes' chromatin structure, and gene expression regulation. In the present paper, the full-length 1201-bp cDNA sequence of the PRMT1 homolog of Artemia sinica (As-PRMT1) was cloned for the first time. The putative As-PRMT1 protein comprises 346 amino acids with a SAM domain and a PRMT5 domain. Multiple sequence alignments revealed that the putative sequence of As-PRMT1 protein was relatively conserved across species, especially in the SAM domain. As-PRMT1 is widely expressed during embryo development of A. sinica. This is followed by a dramatic upregulation after diapause termination and then downregulation from the nauplius stage. Furthermore, As-PRMT1 transcripts are highly upregulated under conditions of high salinity and low temperature stress. These findings suggested that As-PRMT1 is a stress-related factor that might promote or inhibit the expression of certain genes, play a critical role in embryonic development and in resistance to low temperature and high salinity stress. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Investigating the Potential Role of Genetic and Epigenetic Variation of DNA Methyltransferase Genes in Hyperplastic Polyposis Syndrome

    PubMed Central

    Drini, Musa; Wong, Nicholas C.; Scott, Hamish S.; Craig, Jeffrey M.; Dobrovic, Alexander; Hewitt, Chelsee A.; Dow, Christofer; Young, Joanne P.; Jenkins, Mark A.; Saffery, Richard; Macrae, Finlay A.

    2011-01-01

    Background Hyperplastic Polyposis Syndrome (HPS) is a condition associated with multiple serrated polyps, and an increased risk of colorectal cancer (CRC). At least half of CRCs arising in HPS show a CpG island methylator phenotype (CIMP), potentially linked to aberrant DNA methyltransferase (DNMT) activity. CIMP is associated with methylation of tumor suppressor genes including regulators of DNA mismatch repair (such as MLH1, MGMT), and negative regulators of Wnt signaling (such as WIF1). In this study, we investigated the potential for interaction of genetic and epigenetic variation in DNMT genes, in the aetiology of HPS. Methods We utilized high resolution melting (HRM) analysis to screen 45 cases with HPS for novel sequence variants in DNMT1, DNMT3A, DNMT3B, and DNMT3L. 21 polyps from 13 patients were screened for BRAF and KRAS mutations, with assessment of promoter methylation in the DNMT1, DNMT3A, DNMT3B, DNMT3L MLH1, MGMT, and WIF1 gene promoters. Results No pathologic germline mutations were observed in any DNA-methyltransferase gene. However, the T allele of rs62106244 (intron 10 of DNMT1 gene) was over-represented in cases with HPS (p<0.01) compared with population controls. The DNMT1, DNMT3A and DNMT3B promoters were unmethylated in all instances. Interestingly, the DNMT3L promoter showed low levels of methylation in polyps and normal colonic mucosa relative to matched disease free cells with methylation level negatively correlated to expression level in normal colonic tissue. DNMT3L promoter hypomethylation was more often found in polyps harbouring KRAS mutations (p = 0.0053). BRAF mutations were common (11 out of 21 polyps), whilst KRAS mutations were identified in 4 of 21 polyps. Conclusions Genetic or epigenetic alterations in DNMT genes do not appear to be associated with HPS, but further investigation of genetic variation at rs62106244 is justified given the high frequency of the minor allele in this case series. PMID:21347319

  11. Piwil1 causes epigenetic alteration of PTEN gene via upregulation of DNA methyltransferase in type I endometrial cancer.

    PubMed

    Chen, Zheng; Che, Qi; Jiang, Fei-Zhou; Wang, Hui-Hui; Wang, Fang-Yuan; Liao, Yun; Wan, Xiao-Ping

    2015-08-07

    Piwil1, a member of the Piwi family, has been well demonstrated to mediate tumorigenesis associated with DNA hypermethylation. It has been reported that Piwil1 is overexpressed in various types of cancer, including endometrial cancer. However, the underlying mechanism of Piwil1 in endometrial cancer remains largely unclear. PTEN exerts an important tumor suppressor role in endometrial carcinogenesis. The present study aimed to investigate whether Piwil1 could regulate the expression of PTEN. Herein, we found that Piwil1 could promote the loss of PTEN expression and increase aberrant hypermethylation of PTEN gene promoter in Ishikawa cells. We also found that Piwil1 could regulate the expression of DNA methyltransferase 1 (DNMT1). Silencing DNMT1 gene could upregulate the PTEN gene expression and change the methylation status of PTEN gene promoter in Ishikawa cells. These results suggested that Piwil1 caused the loss of PTEN expression through DNMT1-mediated PTEN hypermethylation. Taken together, these data provide a novel regulatory mechanism of Piwil1 in endometrial cancer. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Association of catechol-O-methyltransferase gene polymorphisms with schizophrenia and negative symptoms in a Chinese population

    PubMed Central

    Li, Wen Jun; Kou, Chang Gui; Yu, Yaqin; Sun, Shilong; Zhang, Xuan; Kosten, Thomas R; Zhang, Xiang Yang

    2014-01-01

    The gene encoding Catechol O-methyltransferase (COMT), a dopamine catabolic enzyme, has been associated inconsistently with schizophrenia in spite of consistent evidence for dopaminergic dysfunction in the prefrontal cortex (PFC) of schizophrenia. Since one contribution to this inconsistency might be genetic heterogeneity, this study investigated whether the COMT gene was associated with the development and symptoms of schizophrenia in relatively genetically homogeneous Chinese schizophrenic patients. We analyzed two polymorphisms (rs740603 and rs4818) of the COMT gene in a case–control study of 604 Han Chinese (284 patients and 320 controls). The patients’ psychopathology was assessed using the Positive and Negative Syndrome Scale (PANSS). We found no significant differences in the rs740603 and rs4818 genotype and allele distributions between the patient and control groups. Quantitative trait analysis by the UNPHASED program showed that the rs740603 and rs740603(G)-rs4818(G) haplotypes were associated with negative symptoms in the schizophrenic patients, particularly among female patients. Thus, the COMT gene polymorphisms may not contribute to the susceptibility to schizophrenia, but may contribute to the negative symptoms of schizophrenia among Han Chinese. PMID:22354729

  13. The last rRNA methyltransferase of E. coli revealed: The yhiR gene encodes adenine-N6 methyltransferase specific for modification of A2030 of 23S ribosomal RNA

    PubMed Central

    Golovina, Anna Y.; Dzama, Margarita M.; Osterman, Ilya A.; Sergiev, Petr V.; Serebryakova, Marina V.; Bogdanov, Alexey A.; Dontsova, Olga A.

    2012-01-01

    The ribosomal RNA (rRNA) of Escherichia coli contains 24 methylated residues. A set of 22 methyltransferases responsible for modification of 23 residues has been described previously. Herein we report the identification of the yhiR gene as encoding the enzyme that modifies the 23S rRNA nucleotide A2030, the last methylated rRNA nucleotide whose modification enzyme was not known. YhiR prefers protein-free 23S rRNA to ribonucleoprotein particles containing only part of the 50S subunit proteins and does not methylate the assembled 50S subunit. We suggest renaming the yhiR gene to rlmJ according to the rRNA methyltransferase nomenclature. The phenotype of yhiR knockout gene is very mild under various growth conditions and at the stationary phase, except for a small growth advantage at anaerobic conditions. Only minor changes in the total E. coli proteome could be observed in a cell devoid of the 23S rRNA nucleotide A2030 methylation. PMID:22847818

  14. Evolutionary Analyses and Natural Selection of Betaine-Homocysteine S-Methyltransferase (BHMT) and BHMT2 Genes.

    PubMed

    Ganu, Radhika S; Ishida, Yasuko; Koutmos, Markos; Kolokotronis, Sergios-Orestis; Roca, Alfred L; Garrow, Timothy A; Schook, Lawrence B

    2015-01-01

    Betaine-homocysteine S-methyltransferase (BHMT) and BHMT2 convert homocysteine to methionine using betaine and S-methylmethionine, respectively, as methyl donor substrates. Increased levels of homocysteine in blood are associated with cardiovascular disease. Given their role in human health and nutrition, we identified BHMT and BHMT2 genes and proteins from 38 species of deuterostomes including human and non-human primates. We aligned the genes to look for signatures of selection, to infer evolutionary rates and events across lineages, and to identify the evolutionary timing of a gene duplication event that gave rise to two genes, BHMT and BHMT2. We found that BHMT was present in the genomes of the sea urchin, amphibians, reptiles, birds and mammals; BHMT2 was present only across mammals. BHMT and BHMT2 were present in tandem in the genomes of all monotreme, marsupial and placental species examined. Evolutionary rates were accelerated for BHMT2 relative to BHMT. Selective pressure varied across lineages, with the highest dN/dS ratios for BHMT and BHMT2 occurring immediately following the gene duplication event, as determined using GA Branch analysis. Nine codons were found to display signatures suggestive of positive selection; these contribute to the enzymatic or oligomerization domains, suggesting involvement in enzyme function. Gene duplication likely occurred after the divergence of mammals from other vertebrates but prior to the divergence of extant mammalian subclasses, followed by two deletions in BHMT2 that affect oligomerization and methyl donor specificity. The faster evolutionary rate of BHMT2 overall suggests that selective constraints were reduced relative to BHMT. The dN/dS ratios in both BHMT and BHMT2 was highest following the gene duplication, suggesting that purifying selection played a lesser role as the two paralogs diverged in function.

  15. Down-Regulation of Caffeic Acid O-Methyltransferase in Maize Revisited Using a Transgenic Approach1

    PubMed Central

    Piquemal, Joel; Chamayou, Simon; Nadaud, Isabelle; Beckert, Michel; Barrière, Yves; Mila, Isabelle; Lapierre, Catherine; Rigau, Joan; Puigdomenech, Pere; Jauneau, Alain; Digonnet, Catherine; Boudet, Alain-Michel; Goffner, Deborah; Pichon, Magalie

    2002-01-01

    Transgenic maize (Zea mays) plants were generated with a construct harboring a maize caffeic acid O-methyltransferase (COMT) cDNA in the antisense (AS) orientation under the control of the maize Adh1 (alcohol dehydrogenase) promoter. Adh1-driven β-glucuronidase expression was localized in vascular tissues and lignifying sclerenchyma, indicating its suitability in transgenic experiments aimed at modifying lignin content and composition. One line of AS plants, COMT-AS, displayed a significant reduction in COMT activity (15%–30% residual activity) and barely detectable amounts of COMT protein as determined by western-blot analysis. In this line, transgenes were shown to be stably integrated in the genome and transmitted to the progeny. Biochemical analysis of COMT-AS showed: (a) a strong decrease in Klason lignin content at the flowering stage, (b) a decrease in syringyl units, (c) a lower p-coumaric acid content, and (d) the occurrence of unusual 5-OH guaiacyl units. These results are reminiscent of some characteristics already observed for the maize bm3 (brown-midrib3) mutant, as well as for COMT down-regulated dicots. However, as compared with bm3, COMT down-regulation in the COMT-AS line is less severe in that it is restricted to sclerenchyma cells. To our knowledge, this is the first time that an AS strategy has been applied to modify lignin biosynthesis in a grass species. PMID:12481050

  16. FSHD muscular dystrophy region gene 1 binds Suv4-20h1 histone methyltransferase and impairs myogenesis.

    PubMed

    Neguembor, Maria Victoria; Xynos, Alexandros; Onorati, Maria Cristina; Caccia, Roberta; Bortolanza, Sergia; Godio, Cristina; Pistoni, Mariaelena; Corona, Davide F; Schotta, Gunnar; Gabellini, Davide

    2013-10-01

    Facioscapulohumeral muscular dystrophy (FSHD) is an autosomal dominant myopathy with a strong epigenetic component. It is associated with deletion of a macrosatellite repeat leading to over-expression of the nearby genes. Among them, we focused on FSHD region gene 1 (FRG1) since its over-expression in mice, Xenopus laevis and Caenorhabditis elegans, leads to muscular dystrophy-like defects, suggesting that FRG1 plays a relevant role in muscle biology. Here we show that, when over-expressed, FRG1 binds and interferes with the activity of the histone methyltransferase Suv4-20h1 both in mammals and Drosophila. Accordingly, FRG1 over-expression or Suv4-20h1 knockdown inhibits myogenesis. Moreover, Suv4-20h KO mice develop muscular dystrophy signs. Finally, we identify the FRG1/Suv4-20h1 target Eid3 as a novel myogenic inhibitor that contributes to the muscle differentiation defects. Our study suggests a novel role of FRG1 as epigenetic regulator of muscle differentiation and indicates that Suv4-20h1 has a gene-specific function in myogenesis.

  17. A two allele DNA polymorphism of the human phenylethanolamine N-methyltransferase (hPNMT) gene identified by HGIA I

    SciTech Connect

    Hoehe, M.R.; Berrettini, W.H. ); Baetge, E.E. )

    1989-01-25

    An 8 kb DNA fragment (Eco RI) of the human phenylethanolamine N-methyltransferase gene (hPNMT), selected from a 14 kb Eco RI fragment isolated from a lambda Charon 3A human lymphocyte genomic library and subcloned into pUC18, was used as a probe. This human genomic fragment contained the first 1,923 bp of 5{prime} flanking DNA, the hPNMT structural gene spanning 2,070 bp in total (composed of three exons (225, 208, 524 bp) and two introns (1,000 and 113 bp)), and 3.8 kb of 3{prime} flanking DNA (1). Hybridization of human genomic DNA digested with HgiA I identifies a two allele polymorphism with bands at 3.0 kb (A) and 2.5 kb (B). The hPNMT gene has been assigned to chromosome 17. Co-dominant segregation in two families with two generations was observed. The number of meioses scorred was 18.

  18. Determination of the Structure and Catalytic Mechanism of Sorghum bicolor Caffeic Acid O-Methyltransferase and the Structural Impact of Three brown midrib12 Mutations1[W

    PubMed Central

    Green, Abigail R.; Lewis, Kevin M.; Barr, John T.; Jones, Jeffrey P.; Lu, Fachuang; Ralph, John; Vermerris, Wilfred; Sattler, Scott E.; Kang, ChulHee

    2014-01-01

    Using S-adenosyl-methionine as the methyl donor, caffeic acid O-methyltransferase from sorghum (Sorghum bicolor; SbCOMT) methylates the 5-hydroxyl group of its preferred substrate, 5-hydroxyconiferaldehyde. In order to determine the mechanism of SbCOMT and understand the observed reduction in the lignin syringyl-to-guaiacyl ratio of three brown midrib12 mutants that carry COMT gene missense mutations, we determined the apo-form and S-adenosyl-methionine binary complex SbCOMT crystal structures and established the ternary complex structure with 5-hydroxyconiferaldehyde by molecular modeling. These structures revealed many features shared with monocot ryegrass (Lolium perenne) and dicot alfalfa (Medicago sativa) COMTs. SbCOMT steady-state kinetic and calorimetric data suggest a random bi-bi mechanism. Based on our structural, kinetic, and thermodynamic results, we propose that the observed reactivity hierarchy among 4,5-dihydroxy-3-methoxycinnamyl (and 3,4-dihydroxycinnamyl) aldehyde, alcohol, and acid substrates arises from the ability of the aldehyde to stabilize the anionic intermediate that results from deprotonation of the 5-hydroxyl group by histidine-267. Additionally, despite the presence of other phenylpropanoid substrates in vivo, sinapaldehyde is the preferential product, as demonstrated by its low Km for 5-hydroxyconiferaldehyde. Unlike its acid and alcohol substrates, the aldehydes exhibit product inhibition, and we propose that this is due to nonproductive binding of the S-cis-form of the aldehydes inhibiting productive binding of the S-trans-form. The S-cis-aldehydes most likely act only as inhibitors, because the high rotational energy barrier around the 2-propenyl bond prevents S-trans-conversion, unlike alcohol substrates, whose low 2-propenyl bond rotational energy barrier enables rapid S-cis/S-trans-interconversion. PMID:24948836

  19. Catechol-O-methyltransferase (COMT) gene modulates private self-consciousness and self-flexibility.

    PubMed

    Wang, Bei; Ru, Wenzhao; Yang, Xing; Yang, Lu; Fang, Pengpeng; Zhu, Xu; Shen, Guomin; Gao, Xiaocai; Gong, Pingyuan

    2016-08-01

    Dopamine levels in the brain influence human consciousness. Inspired by the role of Catechol-O-methyltransferase (COMT) in inactivating dopamine in the brain, we investigated to what extent COMT could modulate individual's self-consciousness dispositions and self-consistency by genotyping the COMT Val158Met (rs4680) polymorphism and measuring self-consciousness and self-consistency and congruence in a college student population. The results indicated that COMT Val158Met polymorphism significantly modulated the private self-consciousness. The individuals with Val/Val genotype, corresponding to lower dopamine levels in the brain, were more likely to be aware of their feelings and beliefs. The results also indicated that this polymorphism modulated one's self-flexibility. The individuals with Val/Val genotype showed higher levels of stereotype in self-concept compared with those with Met/Met genotype. These findings suggest that COMT is a predictor of the individual differences in self-consciousness and self-flexibility.

  20. Physiological Study on Association between Nicotinamide N-Methyltransferase Gene Polymorphisms and Hyperlipidemia

    PubMed Central

    Zhu, Xiao-Juan; Lin, Ya-Jun; Chen, Wei; Wang, Ya-Hui; Qiu, Li-Qiang; Cai, Can-Xin; Xiong, Qun; Chen, Fei; Chen, Li-Hui; Zhou, Qiong

    2016-01-01

    Nicotinamide N-methyltransferase (NNMT) catalyzes the methylation of nicotinamide. Our previous works indicate that NNMT is involved in the body mass index and energy metabolism, and recently the association between a SNP (rs694539) of NNMT and a variety of cardiovascular diseases was reported. At present, more than 200 NNMT single nucleotide polymorphisms (SNPs) have been identified in the databases of the human genome projects; however, the association between rs694539 variation and hyperlipidemia has not been reported yet, and whether there are any SNPs in NNMT significantly associated with hyperlipidemia is still unclear. In this paper, we selected 19 SNPs in NNMT as the tagSNPs using Haploview software (Haploview 4.2) first and then performed a case-control study to observe the association between these tagSNPs and hyperlipidemia and finally applied physiological approaches to explore the possible mechanisms through which the NNMT polymorphism induces hyperlipidemia. The results show that a SNP (rs1941404) in NNMT is significantly associated with hyperlipidemia, and the influence of rs1941404 variation on the resting energy expenditure may be the possible mechanism for rs1941404 variation to induce hyperlipidemia. PMID:27999813

  1. The Fusarium graminearum Histone H3 K27 Methyltransferase KMT6 Regulates Development and Expression of Secondary Metabolite Gene Clusters

    PubMed Central

    Freitag, Michael

    2013-01-01

    The cereal pathogen Fusarium graminearum produces secondary metabolites toxic to humans and animals, yet coordinated transcriptional regulation of gene clusters remains largely a mystery. By chromatin immunoprecipitation and high-throughput DNA sequencing (ChIP-seq) we found that regions with secondary metabolite clusters are enriched for trimethylated histone H3 lysine 27 (H3K27me3), a histone modification associated with gene silencing. H3K27me3 was found predominantly in regions that lack synteny with other Fusarium species, generally subtelomeric regions. Di- or trimethylated H3K4 (H3K4me2/3), two modifications associated with gene activity, and H3K27me3 are predominantly found in mutually exclusive regions of the genome. To find functions for H3K27me3, we deleted the gene for the putative H3K27 methyltransferase, KMT6, a homolog of Drosophila Enhancer of zeste, E(z). The kmt6 mutant lacks H3K27me3, as shown by western blot and ChIP-seq, displays growth defects, is sterile, and constitutively expresses genes for mycotoxins, pigments and other secondary metabolites. Transcriptome analyses showed that 75% of 4,449 silent genes are enriched for H3K27me3. A subset of genes that were enriched for H3K27me3 in WT gained H3K4me2/3 in kmt6. A largely overlapping set of genes showed increased expression in kmt6. Almost 95% of the remaining 2,720 annotated silent genes showed no enrichment for either H3K27me3 or H3K4me2/3 in kmt6. In these cases mere absence of H3K27me3 was insufficient for expression, which suggests that additional changes are required to activate genes. Taken together, we show that absence of H3K27me3 allowed expression of an additional 14% of the genome, resulting in derepression of genes predominantly involved in secondary metabolite pathways and other species-specific functions, including putative secreted pathogenicity factors. Results from this study provide the framework for novel targeted strategies to control the “cryptic genome

  2. A C-methyltransferase involved in both ubiquinone and menaquinone biosynthesis: isolation and identification of the Escherichia coli ubiE gene.

    PubMed

    Lee, P T; Hsu, A Y; Ha, H T; Clarke, C F

    1997-03-01

    Strains of Escherichia coli with mutations in the ubiE gene are not able to catalyze the carbon methylation reaction in the biosynthesis of ubiquinone (coenzyme Q) and menaquinone (vitamin K2), essential isoprenoid quinone components of the respiratory electron transport chain. This gene has been mapped to 86 min on the chromosome, a region where the nucleic acid sequence has recently been determined. To identify the ubiE gene, we evaluated the amino acid sequences encoded by open reading frames located in this region for the presence of sequence motifs common to a wide variety of S-adenosyl-L-methionine-dependent methyltransferases. One open reading frame in this region (o251) was found to encode these motifs, and several lines of evidence that confirm the identity of the o251 product as UbiE are presented. The transformation of a strain harboring the ubiE401 mutation with o251 on an expression plasmid restored both the growth of this strain on succinate and its ability to synthesize both ubiquinone and menaquinone. Disruption of o251 in a wild-type parental strain produced a mutant with defects in growth on succinate and in both ubiquinone and menaquinone synthesis. DNA sequence analysis of the ubiE401 allele identified a missense mutation resulting in the amino acid substitution of Asp for Gly142. E. coli strains containing either the disruption or the point mutation in ubiE accumulated 2-octaprenyl-6-methoxy-1,4-benzoquinone and demethylmenaquinone as predominant intermediates. A search of the gene databases identified ubiE homologs in Saccharomyces cerevisiae, Caenorhabditis elegans, Leishmania donovani, Lactococcus lactis, and Bacillus subtilis. In B. subtilis the ubiE homolog is likely to be required for menaquinone biosynthesis and is located within the gerC gene cluster, known to be involved in spore germination and normal vegetative growth. The data presented identify the E. coli UbiE polypeptide and provide evidence that it is required for the C

  3. The histone H3K36 methyltransferase MES-4 acts epigenetically to transmit the memory of germline gene expression to progeny.

    PubMed

    Rechtsteiner, Andreas; Ercan, Sevinc; Takasaki, Teruaki; Phippen, Taryn M; Egelhofer, Thea A; Wang, Wenchao; Kimura, Hiroshi; Lieb, Jason D; Strome, Susan

    2010-09-02

    Methylation of histone H3K36 in higher eukaryotes is mediated by multiple methyltransferases. Set2-related H3K36 methyltransferases are targeted to genes by association with RNA Polymerase II and are involved in preventing aberrant transcription initiation within the body of genes. The targeting and roles of the NSD family of mammalian H3K36 methyltransferases, known to be involved in human developmental disorders and oncogenesis, are not known. We used genome-wide chromatin immunoprecipitation (ChIP) to investigate the targeting and roles of the Caenorhabditis elegans NSD homolog MES-4, which is maternally provided to progeny and is required for the survival of nascent germ cells. ChIP analysis in early C. elegans embryos revealed that, consistent with immunostaining results, MES-4 binding sites are concentrated on the autosomes and the leftmost approximately 2% (300 kb) of the X chromosome. MES-4 overlies the coding regions of approximately 5,000 genes, with a modest elevation in the 5' regions of gene bodies. Although MES-4 is generally found over Pol II-bound genes, analysis of gene sets with different temporal-spatial patterns of expression revealed that Pol II association with genes is neither necessary nor sufficient to recruit MES-4. In early embryos, MES-4 associates with genes that were previously expressed in the maternal germ line, an interaction that does not require continued association of Pol II with those loci. Conversely, Pol II association with genes newly expressed in embryos does not lead to recruitment of MES-4 to those genes. These and other findings suggest that MES-4, and perhaps the related mammalian NSD proteins, provide an epigenetic function for H3K36 methylation that is novel and likely to be unrelated to ongoing transcription. We propose that MES-4 transmits the memory of gene expression in the parental germ line to offspring and that this memory role is critical for the PGCs to execute a proper germline program.

  4. DNA methylation and targeted sequencing of methyltransferases family genes in canine acute myeloid leukaemia, modelling human myeloid leukaemia.

    PubMed

    Bronzini, I; Aresu, L; Paganin, M; Marchioretto, L; Comazzi, S; Cian, F; Riondato, F; Marconato, L; Martini, V; Te Kronnie, G

    2017-09-01

    Tumours shows aberrant DNA methylation patterns, being hypermethylated or hypomethylated compared with normal tissues. In human acute myeloid leukaemia (hAML) mutations in DNA methyltransferase (DNMT3A) are associated to a more aggressive tumour behaviour. As AML is lethal in dogs, we defined global DNA methylation content, and screened the C-terminal domain of DNMT3 family of genes for sequence variants in 39 canine acute myeloid leukaemia (cAML) cases. A heterogeneous pattern of DNA methylation was found among cAML samples, with subsets of cases being hypermethylated or hypomethylated compared with healthy controls; four recurrent single nucleotide variations (SNVs) were found in DNMT3L gene. Although SNVs were not directly correlated to whole genome DNA methylation levels, all hypomethylated cAML cases were homozygous for the deleterious mutation at p.Arg222Trp. This study contributes to understand genetic modifications of cAML, leading up to studies that will elucidate the role of methylome alterations in the pathogenesis of AML in dogs. © 2016 John Wiley & Sons Ltd.

  5. Association between catechol-O-methyltransferase gene polymorphism and attention-deficit hyperactivity disorder in Korean population.

    PubMed

    Song, En Young; Paik, Ki Chung; Kim, Hyun Woo; Lim, Myung Ho

    2009-04-01

    Recently, the relationship between allele frequency distribution and attention-deficit hyperactivity disorder (ADHD) has been actively studied. In Korea, the relationship between the genetic type and alleles for catechol-O-methyltransferase (COMT) gene has been studied in ADHD patients. ADHD was diagnosed in 60 patients according to the Diagnostic and Statistical Manual of Mental Disorders Version IV (DSM-IV) diagnostic criteria and Schedule for Affective Disorders and Schizophrenia for School-Age Children--Present and Lifetime Version (K-SADS-PL), and they were selected for the study. For the control group, normal volunteers were chosen. Blood samples were taken from the 160 subjects. DNA was extracted from blood lymphocytes, and PCR was performed for COMT NlaIII VNTR polymorphism. For the case-control analyses, allele and genotype frequencies were compared using the chi(2) method. When the ADHD group and the normal control group were compared, significant difference was seen on the COMT genetic type, but was not seen on the allele distribution. As a result, it is viewed that there is no relationship between ADHD and the COMT gene, but final decision is indefinite.

  6. Reduction of indole-3-acetic acid methyltransferase activity compensates for high-temperature male sterility in Arabidopsis.

    PubMed

    Abbas, Mohamad; Hernández-García, Jorge; Blanco-Touriñán, Noel; Aliaga, Norma; Minguet, Eugenio G; Alabadí, David; Blázquez, Miguel A

    2017-06-02

    High temperature is a general stress factor that causes a decrease in crop yield. It has been shown that auxin application reduces the male sterility caused by exposure to higher temperatures. However, widespread application of a hormone with vast effects on plant physiology may be discouraged in many cases. Therefore, the generation of new plant varieties that locally enhance auxin in reproductive organs may represent an alternative strategy. We have explored the possibility of increasing indole-3-acetic acid (IAA) in ovaries by reducing IAA methyltransferase1 (IAMT1) activity in Arabidopsis thaliana. The iamt1 mutant showed increased auxin signalling in funiculi, which correlated with a higher growth rate of wild-type pollen in contact with mutant ovaries and premature ovule fertilization. While the production of seeds per fruit was similar in the wild type and the mutant at 20 °C, exposure to 29 °C caused a more severe decrease in fertility in the wild type than in the mutant. Loss of IAMT1 activity was also associated with the production of more nodes after flowering and higher tolerance of the shoot apical meristem to higher temperatures. As a consequence, the productivity of the iamt1 mutant under higher temperatures was more than double of that of the wild type, with almost no apparent trade-off. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  7. Sequencing around 5-Hydroxyconiferyl Alcohol-Derived Units in Caffeic Acid O-Methyltransferase-Deficient Poplar Lignins1[OA

    PubMed Central

    Lu, Fachuang; Marita, Jane M.; Lapierre, Catherine; Jouanin, Lise; Morreel, Kris; Boerjan, Wout; Ralph, John

    2010-01-01

    Caffeic acid O-methyltransferase (COMT) is a bifunctional enzyme that methylates the 5- and 3-hydroxyl positions on the aromatic ring of monolignol precursors, with a preference for 5-hydroxyconiferaldehyde, on the way to producing sinapyl alcohol. Lignins in COMT-deficient plants contain benzodioxane substructures due to the incorporation of 5-hydroxyconiferyl alcohol (5-OH-CA), as a monomer, into the lignin polymer. The derivatization followed by reductive cleavage method can be used to detect and determine benzodioxane structures because of their total survival under this degradation method. Moreover, partial sequencing information for 5-OH-CA incorporation into lignin can be derived from detection or isolation and structural analysis of the resulting benzodioxane products. Results from a modified derivatization followed by reductive cleavage analysis of COMT-deficient lignins provide evidence that 5-OH-CA cross couples (at its β-position) with syringyl and guaiacyl units (at their O-4-positions) in the growing lignin polymer and then either coniferyl or sinapyl alcohol, or another 5-hydroxyconiferyl monomer, adds to the resulting 5-hydroxyguaiacyl terminus, producing the benzodioxane. This new terminus may also become etherified by coupling with further monolignols, incorporating the 5-OH-CA integrally into the lignin structure. PMID:20427467

  8. Prostaglandin E2 increases fibroblast gene-specific and global DNA methylation via increased DNA methyltransferase expression

    PubMed Central

    Huang, Steven K.; Scruggs, Anne M.; Donaghy, Jake; McEachin, Richard C.; Fisher, Aaron S.; Richardson, Bruce C.; Peters-Golden, Marc

    2012-01-01

    Although alterations in DNA methylation patterns have been associated with specific diseases and environmental exposures, the mediators and signaling pathways that direct these changes remain understudied. The bioactive lipid mediator prostaglandin E2 (PGE2) has been shown to exert a myriad of effects on cell survival, proliferation, and differentiation. Here, we report that PGE2 also signals to increase global DNA methylation and DNA methylation machinery in fibroblasts. HumanMethylation27 BeadChip array analysis of primary fetal (IMR-90) and adult lung fibroblasts identified multiple genes that were hypermethylated in response to PGE2. PGE2, compared with nontreated controls, increased expression and activity (EC50∼107 M) of one specific isoform of DNA methyltransferase, DNMT3a. Silencing of DNMT3a negated the ability of PGE2 to increase DNMT activity. The increase in DNMT3a expression was mediated by PGE2 signaling via its E prostanoid 2 receptor and the second messenger cAMP. PGE2, compared with the untreated control, increased the expression and activity of Sp1 and Sp3 (EC50∼3×107 M), transcription factors known to increase DNMT3a expression, and inhibition of these transcription factors abrogated the PGE2 increase of DNMT3a expression. These findings were specific to fibroblasts, as PGE2 decreased DNMT1 and DNMT3a expression in RAW macrophages. Taken together, these findings establish that DNA methylation is regulated by a ubiquitous bioactive endogenous mediator. Given that PGE2 biosynthesis is modulated by environmental toxins, various disease states, and commonly used pharmacological agents, these findings uncover a novel mechanism by which alterations in DNA methylation patterns may arise in association with disease and certain environmental exposures.—Huang, S. K., Scruggs, A. M., Donaghy, J., McEachin, R. C., Fisher, A. S., Richardson, B. C., Peters-Golden, M. Prostaglandin E2 increases fibroblast gene-specific and global DNA methylation via

  9. Cloning and expressing a highly functional and substrate specific farnesoic acid o-methyltransferase from the Asian citrus psyllid (Diaphorina citri Kuwayama)

    PubMed Central

    Van Ekert, Evelien; Shatters, Robert G.; Rougé, Pierre; Powell, Charles A.; Smagghe, Guy; Borovsky, Dov

    2015-01-01

    The Asian citrus psyllid, Diaphorina citri, transmits a phloem-limited bacterium, Candidatus ‘Liberibacter’ asiaticus that causes citrus greening disease. Because juvenile hormone (JH) plays an important role in adult and nymphal development, we studied the final steps in JH biosynthesis in D. citri. A putative JH acid methyltransferase ortholog gene (jmtD) and its cognate cDNA were identified by searching D. citri genome database. Expression analysis shows expression in all life stages. In adults, it is expressed in the head-thorax, (containing the corpora allata), and the abdomen (containing ovaries and male accessory glands). A 3D protein model identified the catalytic groove with catalytically active amino acids and the S-adenosyl methionine (SAM)-binding loop. The cDNA was expressed in Escherichia coli cells and the purified enzyme showed high preference for farnesoic acid (FA) and homoFA (kcat of 0.752 × 10−3 and 0.217 × 10−3 s−1, respectively) as compared to JH acid I (JHA I) (cis/trans/cis; 2Z, 6E, 10cis), JHA III (2E, 6E, 10cis), and JHA I (trans/cis/cis; 2E, 2Z, 10cis) (kcat of 0.081 × 10−3, 0.013 × 10−3, and 0.003 × 10−3 s−1, respectively). This suggests that this ortholog is a DcFA-o-methyl transferase gene (fmtD), not a jmtD, and that JH biosynthesis in D. citri proceeds from FA to JH III through methyl farnesoate (MF). DcFA-o-MT does not require Ca2+, Mg2+ or Zn2+, however, Zn2+ (1 mM) completely inhibits the enzyme probably by binding H115 at the active groove. This represents the first purified FA-o-MT from Hemiptera with preferred biological activity for FA and not JHA. PMID:25893162

  10. Mutations in the histamine N-methyltransferase gene, HNMT, are associated with nonsyndromic autosomal recessive intellectual disability.

    PubMed

    Heidari, Abolfazl; Tongsook, Chanakan; Najafipour, Reza; Musante, Luciana; Vasli, Nasim; Garshasbi, Masoud; Hu, Hao; Mittal, Kirti; McNaughton, Amy J M; Sritharan, Kumudesh; Hudson, Melissa; Stehr, Henning; Talebi, Saeid; Moradi, Mohammad; Darvish, Hossein; Arshad Rafiq, Muhammad; Mozhdehipanah, Hossein; Rashidinejad, Ali; Samiei, Shahram; Ghadami, Mohsen; Windpassinger, Christian; Gillessen-Kaesbach, Gabriele; Tzschach, Andreas; Ahmed, Iltaf; Mikhailov, Anna; Stavropoulos, D James; Carter, Melissa T; Keshavarz, Soraya; Ayub, Muhammad; Najmabadi, Hossein; Liu, Xudong; Ropers, Hans Hilger; Macheroux, Peter; Vincent, John B

    2015-10-15

    Histamine (HA) acts as a neurotransmitter in the brain, which participates in the regulation of many biological processes including inflammation, gastric acid secretion and neuromodulation. The enzyme histamine N-methyltransferase (HNMT) inactivates HA by transferring a methyl group from S-adenosyl-l-methionine to HA, and is the only well-known pathway for termination of neurotransmission actions of HA in mammalian central nervous system. We performed autozygosity mapping followed by targeted exome sequencing and identified two homozygous HNMT alterations, p.Gly60Asp and p.Leu208Pro, in patients affected with nonsyndromic autosomal recessive intellectual disability from two unrelated consanguineous families of Turkish and Kurdish ancestry, respectively. We verified the complete absence of a functional HNMT in patients using in vitro toxicology assay. Using mutant and wild-type DNA constructs as well as in silico protein modeling, we confirmed that p.Gly60Asp disrupts the enzymatic activity of the protein, and that p.Leu208Pro results in reduced protein stability, resulting in decreased HA inactivation. Our results highlight the importance of inclusion of HNMT for genetic testing of individuals presenting with intellectual disability.

  11. Genetic variants in the catechol-o-methyltransferase gene are associated with impulsivity and executive function: relevance for major depression.

    PubMed

    Pap, Dorottya; Gonda, Xenia; Molnar, Eszter; Lazary, Judit; Benko, Anita; Downey, Darragh; Thomas, Emma; Chase, Diana; Toth, Zoltan G; Mekli, Krisztina; Platt, Hazel; Payton, Antony; Elliott, Rebecca; Anderson, Ian M; Deakin, J F William; Bagdy, Gyorgy; Juhasz, Gabriella

    2012-12-01

    The catechol-o-methyltransferase (COMT) gene has been extensively investigated in depression with somewhat contradictory results but the role of impulsivity, as a possible intermediate phenotype in this disorder, has not been considered yet. In our study, four tagging SNPs in the COMT gene (rs933271, rs740603, rs4680, rs4646316) were genotyped in two independent population cohorts: Manchester (n = 1267) and Budapest (n = 942). First, we investigated the association between COMT genotypes, impulsivity, neuroticism and depression using haplotype trend regression, and constructed a model using structural equation modeling to investigate the interaction between these factors. Secondly, we tested the effect of executive function on this model in a smaller interviewed sample (n = 207). Our results demonstrated that COMT haplotypes were significantly associated with impulsivity in the combined cohort, showing the same direction of effects in both populations. The COMT effect on depressive symptoms (in subjects without history of depression) and on executive function (interviewed sample) showed the opposite pattern to impulsivity. Structural equation models demonstrated that COMT and impulsivity acted, both together (through neuroticism) and independently, to increase the risk of depression. In addition, better executive function also operated as a risk factor for depression, possibly though reduced ability to flexibly disengage negative emotions. In conclusion, variations in the COMT gene exert complex effects on susceptibility to depression involving various intermediate phenotypes, such as impulsivity and executive function. These findings emphasise that modeling of disease pathways at phenotypic level are valuable for identifying genetic risk factors. Copyright © 2012 Wiley Periodicals, Inc.

  12. Human intelligence and polymorphisms in the DNA methyltransferase genes involved in epigenetic marking.

    PubMed

    Haggarty, Paul; Hoad, Gwen; Harris, Sarah E; Starr, John M; Fox, Helen C; Deary, Ian J; Whalley, Lawrence J

    2010-06-25

    Epigenetic mechanisms have been implicated in syndromes associated with mental impairment but little is known about the role of epigenetics in determining the normal variation in human intelligence. We measured polymorphisms in four DNA methyltransferases (DNMT1, DNMT3A, DNMT3B and DNMT3L) involved in epigenetic marking and related these to childhood and adult general intelligence in a population (n = 1542) consisting of two Scottish cohorts born in 1936 and residing in Lothian (n = 1075) or Aberdeen (n = 467). All subjects had taken the same test of intelligence at age 11yrs. The Lothian cohort took the test again at age 70yrs. The minor T allele of DNMT3L SNP 11330C>T (rs7354779) allele was associated with a higher standardised childhood intelligence score; greatest effect in the dominant analysis but also significant in the additive model (coefficient = 1.40(additive); 95%CI 0.22,2.59; p = 0.020 and 1.99(dominant); 95%CI 0.55,3.43; p = 0.007). The DNMT3L C allele was associated with an increased risk of being below average intelligence (OR 1.25(additive); 95%CI 1.05,1.51; p = 0.011 and OR 1.37(dominant); 95%CI 1.11,1.68; p = 0.003), and being in the lowest 40(th) (p(additive) = 0.009; p(dominant) = 0.002) and lowest 30(th) (p(additive) = 0.004; p(dominant) = 0.002) centiles for intelligence. After Bonferroni correction for the number variants tested the link between DNMT3L 11330C>T and childhood intelligence remained significant by linear regression and centile analysis; only the additive regression model was borderline significant. Adult intelligence was similarly linked to the DNMT3L variant but this analysis was limited by the numbers studied and nature of the test and the association was not significant after Bonferroni correction. We believe that the role of epigenetics in the normal variation in human intelligence merits further study and that this novel finding should be tested in other cohorts.

  13. P16-specific DNA methylation by engineered zinc finger methyltransferase inactivates gene transcription and promotes cancer metastasis.

    PubMed

    Cui, Chenghua; Gan, Ying; Gu, Liankun; Wilson, James; Liu, Zhaojun; Zhang, Baozhen; Deng, Dajun

    2015-11-23

    P16 DNA methylation is well known to be the most frequent event in cancer development. It has been reported that genetic inactivation of P16 drives cancer growth and metastasis, however, whether P16 DNA methylation is truly a driver in cancer metastasis remains unknown. A P16-specific DNA methyltransferase (P16-dnmt) expression vector is designed using a P16 promoter-specific engineered zinc finger protein fused with the catalytic domain of dnmt3a. P16-dnmt transfection significantly decreases P16 promoter activity, induces complete methylation of P16 CpG islands, and inactivates P16 transcription in the HEK293T cell line. The P16-Dnmt coding fragment is integrated into an expression controllable vector and used to induce P16-specific DNA methylation in GES-1 and BGC823 cell lines. Transwell assays show enhanced migration and invasion of these cancer cells following P16-specific DNA methylation. Such effects are not observed in the P16 mutant A549 cell line. These results are confirmed using an experimental mouse pneumonic metastasis model. Moreover, enforced overexpression of P16 in these cells reverses the migration phenotype. Increased levels of RB phosphorylation and NFκB subunit P65 expression are also seen following P16-specific methylation and might further contribute to cancer metastasis. P16 methylation could directly inactivate gene transcription and drive cancer metastasis.

  14. Interaction of catechol O-methyltransferase and serotonin transporter genes modulates effective connectivity in a facial emotion-processing circuitry.

    PubMed

    Surguladze, S A; Radua, J; El-Hage, W; Gohier, B; Sato, J R; Kronhaus, D M; Proitsi, P; Powell, J; Phillips, M L

    2012-01-17

    Imaging genetic studies showed exaggerated blood oxygenation level-dependent response in limbic structures in carriers of low activity alleles of serotonin transporter-linked promoter region (5-HTTLPR) as well as catechol O-methyltransferase (COMT) genes. This was suggested to underlie the vulnerability to mood disorders. To better understand the mechanisms of vulnerability, it is important to investigate the genetic modulation of frontal-limbic connectivity that underlies emotional regulation and control. In this study, we have examined the interaction of 5-HTTLPR and COMT genetic markers on effective connectivity within neural circuitry for emotional facial expressions. A total of 91 healthy Caucasian adults underwent functional magnetic resonance imaging experiments with a task presenting dynamic emotional facial expressions of fear, sadness, happiness and anger. The effective connectivity within the facial processing circuitry was assessed with Granger causality method. We have demonstrated that in fear processing condition, an interaction between 5-HTTLPR (S) and COMT (met) low activity alleles was associated with reduced reciprocal connectivity within the circuitry including bilateral fusiform/inferior occipital regions, right superior temporal gyrus/superior temporal sulcus, bilateral inferior/middle prefrontal cortex and right amygdala. We suggest that the epistatic effect of reduced effective connectivity may underlie an inefficient emotion regulation that places these individuals at greater risk for depressive disorders.

  15. Catechol-o-methyltransferase gene polymorphism modifies the effect of coffee intake on incidence of acute coronary events.

    PubMed

    Happonen, Pertti; Voutilainen, Sari; Tuomainen, Tomi-Pekka; Salonen, Jukka T

    2006-12-27

    The role of coffee intake as a risk factor for coronary heart disease (CHD) has been debated for decades. We examined whether the relationship between coffee intake and incidence of CHD events is dependent on the metabolism of circulating catecholamines, as determined by functional polymorphism of the catechol-O-methyltransferase (COMT) gene. In a cohort of 773 men who were 42 to 60 years old and free of symptomatic CHD at baseline in 1984-89, 78 participants experienced an acute coronary event during an average follow-up of 13 years. In logistic regression adjusting for age, smoking, family history of CHD, vitamin C deficiency, blood pressure, plasma cholesterol concentration, and diabetes, the odds ratio (90% confidence interval) comparing heavy coffee drinkers with the low activity COMT genotype with those with the high activity or heterozygotic genotypes was 3.2 (1.2-8.4). Urinary adrenaline excretion increased with increasing coffee intake, being over two-fold in heavy drinkers compared with nondrinkers (p = 0.008 for trend). Heavy coffee consumption increases the incidence of acute coronary events in men with low but not high COMT activity. Further studies are required to determine to which extent circulating catecholamines mediate the relationship between coffee intake and CHD.

  16. Associations of nicotinamide N-methyltransferase gene single nucleotide polymorphisms with sport performance and relative maximal oxygen uptake.

    PubMed

    Li, Jiang-Hua; Chen, Wei; Zhu, Xiao-Juan; Lin, Ya-Jun; Qiu, Li-Qiang; Cai, Can-Xin; Wang, Ya-Hui; Xiong, Qun; Chen, Fei; Chen, Li-Hui

    2016-11-30

    To observe the associations between single nucleotide polymorphisms (SNPs) of nicotinamide N-methyltransferase (NNMT) gene and sport performance and to analyse genotype associations of the associated SNPs with sport performance and relative maximal oxygen uptake ([Formula: see text]). Participants were selected from 685 Chinese Han male college students. The completion times of a 1000-m run and a 50-m run were used to reflect sport performance, respectively. Nineteen tagSNPs were genotyped with Polymerase chain reaction-ligase detection reaction. Relative [Formula: see text] was directly determined with a cardiopulmonary function analyser. A significant association was found between rs2256292 and 1000-m run performance, but no significant association was found between any tagSNPs and 50-m run performance. The genotype associations of rs2256292 with 1000-m run performance and with relative [Formula: see text] were both significant under the recessive model (CC vs. CG + GG). No tagSNP in NNMT is significantly associated with 50-m run performance but rs2256292 is significantly associated with 1000-m run performance. The genotype associations of rs2256292 with sport performance are significant under recessive model, and a higher relative [Formula: see text] may be the physiological reason for minor homozygote CC carriers being of the better 1000-m runners.

  17. A mouse speciation gene encodes a meiotic histone H3 methyltransferase.

    PubMed

    Mihola, Ondrej; Trachtulec, Zdenek; Vlcek, Cestmir; Schimenti, John C; Forejt, Jiri

    2009-01-16

    Speciation genes restrict gene flow between the incipient species and related taxa. Three decades ago, we mapped a mammalian speciation gene, hybrid sterility 1 (Hst1), in the intersubspecific hybrids of house mouse. Here, we identify this gene as Prdm9, encoding a histone H3 lysine 4 trimethyltransferase. We rescued infertility in male hybrids with bacterial artificial chromosomes carrying Prdm9 from a strain with the "fertility" Hst1(f) allele. Sterile hybrids display down-regulated microrchidia 2B (Morc2b) and fail to compartmentalize gammaH2AX into the pachynema sex (XY) body. These defects, seen also in Prdm9-null mutants, are rescued by the Prdm9 transgene. Identification of a vertebrate hybrid sterility gene reveals a role for epigenetics in speciation and opens a window to a hybrid sterility gene network.

  18. Arginine methylation of HSP70 regulates retinoid acid-mediated RARβ2 gene activation

    PubMed Central

    Gao, Wei-wei; Xiao, Rong-quan; Peng, Bing-ling; Xu, Huan-teng; Shen, Hai-feng; Huang, Ming-feng; Shi, Tao-tao; Yi, Jia; Zhang, Wen-juan; Wu, Xiao-nan; Gao, Xiang; Lin, Xiang-zhi; Dorrestein, Pieter C.; Rosenfeld, Michael G.; Liu, Wen

    2015-01-01

    Although “histone” methyltransferases and demethylases are well established to regulate transcriptional programs and to use nonhistone proteins as substrates, their possible roles in regulation of heat-shock proteins in the nucleus have not been investigated. Here, we report that a highly conserved arginine residue, R469, in HSP70 (heat-shock protein of 70 kDa) proteins, an evolutionarily conserved protein family of ATP-dependent molecular chaperone, was monomethylated (me1), at least partially, by coactivator-associated arginine methyltransferase 1/protein arginine methyltransferase 4 (CARM1/PRMT4) and demethylated by jumonji-domain–containing 6 (JMJD6), both in vitro and in cultured cells. Functional studies revealed that HSP70 could directly regulate retinoid acid (RA)-induced retinoid acid receptor β2 (RARβ2) gene transcription through its binding to chromatin, with R469me1 being essential in this process. HSP70’s function in gene transcriptional regulation appears to be distinct from its protein chaperon activity. R469me1 was shown to mediate the interaction between HSP70 and TFIIH, which involves in RNA polymerase II phosphorylation and thus transcriptional initiation. Our findings expand the repertoire of nonhistone substrates targeted by PRMT4 and JMJD6, and reveal a new function of HSP70 proteins in gene transcription at the chromatin level aside from its classic role in protein folding and quality control. PMID:26080448

  19. The O-methyltransferase gene MdoOMT1 is required for biosynthesis of methylated phenylpropenes in ripe apple fruit.

    PubMed

    Yauk, Yar-Khing; Chagné, David; Tomes, Sumathi; Matich, Adam J; Wang, Mindy Y; Chen, Xiuyin; Maddumage, Ratnasiri; Hunt, Martin B; Rowan, Daryl D; Atkinson, Ross G

    2015-06-01

    Phenylpropenes, such as eugenol and trans-anethole, are important aromatic compounds that determine flavour and aroma in many herbs and spices. Some apple varieties produce fruit with a highly desirable spicy/aromatic flavour that has been attributed to the production of estragole, a methylated phenylpropene. To elucidate the molecular basis for estragole production and its contribution to ripe apple flavour and aroma we characterised a segregating population from a Royal Gala (RG, estragole producer) × Granny Smith (GS, non-producer) apple cross. Two quantitative trait loci (QTLs; accounting for 9.2 and 24.8% of the variation) on linkage group (LG) 1 and LG2 were identified that co-located with seven candidate genes for phenylpropene O-methyltransferases (MdoOMT1-7). Of these genes, only expression of MdoOMT1 on LG1 increased strongly with ethylene and could be correlated with increasing estragole production in ripening RG fruit. Transient over-expression in tobacco showed that MdoOMT1 utilised a range of phenylpropene substrates and catalysed the conversion of chavicol to estragole. Royal Gala carried two alleles (MdoOMT1a, MdoOMT1b) whilst GS appeared to be homozygous for MdoOMT1b. MdoOMT1a showed a higher affinity and catalytic efficiency towards chavicol than MdoOMT1b, which could account for the phenotypic variation at the LG1 QTL. Multiple transgenic RG lines with reduced MdoOMT1 expression produced lower levels of methylated phenylpropenes, including estragole and methyleugenol. Differences in fruit aroma could be perceived in these fruit, compared with controls, by sensory analysis. Together these results indicate that MdoOMT1 is required for the production of methylated phenylpropenes in apple and that phenylpropenes including estragole may contribute to ripe apple fruit aroma.

  20. QM/MM Free Energy Simulations of Salicylic Acid Methyltransferase: Effects of Stabilization of TS-like Structures on Substrate Specificity

    SciTech Connect

    Yao, Jianzhuang; Xu, Qin; Chen, Feng; Guo, Hong

    2010-01-01

    Salicylic acid methyltransferases (SAMTs) synthesize methyl salicylate (MeSA) using salicylate as the substrate. MeSA synthesized in plants may function as an airborne signal to activate the expression of defense-related genes and could also be a critical mobile signaling molecule that travels from the site of plant infection to establish systemic immunity in the induction of disease resistance. Here the results of QM/MM free energy simulations for the methyl transfer process in Clarkia breweri SAMT (CbSAMT) are reported to determine the origin of the substrate specificity of SAMTs. The free energy barrier for the methyl transfer from S-adenosyl-l-methionine (AdoMet) to 4-hydroxybenzoate in CbSAMT is found to be about 5 kcal/mol higher than that from AdoMet to salicylate, consistent with the experimental observations. It is suggested that the relatively high efficiency for the methylation of salicylate compared to 4-hydroxybenzoate is due, at least in part, to the reason that a part of the stabilization of the transition state (TS) configuration is already reflected in the reactant complex, presumably, through the binding. The results seem to indicate that the creation of the substrate complex (e.g., through mutagenesis and substrate modifications) with its structure closely resembling TS might be fruitful for improving the catalytic efficiency for some enzymes. The results show that the computer simulations may provide important insights into the origin of the substrate specificity for the SABATH family and could be used to help experimental efforts in generating engineered enzymes with altered substrate specificity.

  1. Genetic polymorphisms of estrogen receptor alpha and catechol-O-methyltransferase genes in Turkish patients with familial prostate carcinoma

    PubMed Central

    Pazarbasi, Ayfer; Yilmaz, M. Bertan; Alptekin, Davut; Luleyap, Umit; Tansug, Zuhtu; Ozpak, Lutfiye; Izmirli, Muzeyyen; Onatoglu-Arikan, Dilge; Kocaturk-Sel, Sabriye; Erkoc, Mehmet Ali; Turgut, Ozgur; Bereketoglu, Ceyhun; Tunc, Erdal; Akbal, Eylul

    2013-01-01

    OBJECTIVES: Estrogen is one of the most crucial hormones participating in the proliferation and carcinogenesis of the prostate glands. Genetic polymorphisms in the estrogen metabolism pathway might be involved in the risk of prostate carcinoma development. We evaluated the association between genetic polymorphisms in estrogen receptor alpha (ESR1) and catechol-O-methyltransferase (COMT) genes and the risk of developing familial prostate carcinoma. MATERIALS AND METHODS: In this study, 34 cases with prostate carcinoma whose first-degree relatives had prostate carcinoma and 30 healthy age-matched male controls were enrolled. The genotypes of ESR1 and COMT genes were analyzed employing polymerase chain reaction-restriction fragment length polymorphism method. 34 cases with prostate carcinoma, whose first degree relatives had prostate carcinoma and 14 age-matched male controls were enrolled to analyze the genotype of these two genes. RESULTS: Among control patients, the ESR1 PvuII genotypes of C/C, C/T and T/T were observed in 37%, 26% and 37%, respectively, whereas the C/C, C/T and T/T genotypes were observed in 18%, 41% and 41% of case patients, respectively. Among controls, the ESR1 PvuII allele frequencies of C and T were equally observed, whereas the C and T allele frequencies were observed in 38% and 62% of patients, respectively. Among ESR1 PvuII genotypes there were not any significant difference in terms of genotype (P = 0.199) and allele (P = 0.181) frequencies. Among controls, the ESR1 XbaI genotypes of G/G, G/A and A/A were observed in 33%, 37% and 33%, respectively, whereas the G/G, G/A and A/A genotypes were observed in 12%, 47% and 41% of patients, respectively. Among controls, the ESR1 XbaI allele frequencies of A and G were observed equally, respectively, whereas the A and G frequencies were observed in 65% and 35% of patients, respectively. Among ESR1 Χ baI, there was not any significant difference in terms of genotype (P = 0.111) and allele (P = 0

  2. A novel arsenic methyltransferase gene of Westerdykella aurantiaca isolated from arsenic contaminated soil: phylogenetic, physiological, and biochemical studies and its role in arsenic bioremediation.

    PubMed

    Verma, Shikha; Verma, Pankaj Kumar; Meher, Alok Kumar; Dwivedi, Sanjay; Bansiwal, Amit Kumar; Pande, Veena; Srivastava, Pankaj Kumar; Verma, Praveen Chandra; Tripathi, Rudra Deo; Chakrabarty, Debasis

    2016-03-01

    Elevated arsenic concentration in the environment and agricultural soil is a serious concern to crop production and human health. Among different detoxification mechanisms, the methylation of arsenic is a widespread phenomenon in nature. A number of microorganisms are able to methylate arsenic, but less is known about the arsenic metabolism in fungi. We identified a novel arsenic methyltransferase (WaarsM) gene from a soil fungus, Westerdykella aurantiaca. WaarsM showed sequence homology with all known arsenic methyltransferases having three conserved SAM binding motifs. The expression of WaarsM enhanced arsenic resistance in E. coli (Δars) and S. cerevisiae (Δacr2) strains by biomethylation and required endogenous reductants, preferably GSH, for methyltransferase activity. The purified WaarsM catalyzes the production of methylated arsenicals from both AsIII and AsV, and also displays AsV reductase activity. It displayed higher methyltransferase activity and lower KM 0.1945 ± 0.021 mM and KM 0.4034 ± 0.078 mM for AsIII and AsV, respectively. S. cerevisiae (Δacr2) cells expressing WaarsM produced 2.2 ppm volatile arsenic and 0.64 ppm DMA(v) with 0.58 ppm volatile arsenicals when exposed to 20 ppm AsV and 2 ppm AsIII, respectively. Arsenic tolerance in rice after co-culture with genetically engineered yeast suggested its potential role in arsenic bioremediation. Thus, characterization of WaarsM provides a potential strategy to reduce arsenic concentration in soil with reduced arsenic accumulation in crops grown in arsenic contaminated areas, and thereby alleviating human health risks.

  3. Insertional inactivation of the methionine s-methyltransferase gene eliminates the s-methylmethionine cycle and increases the methylation ratio.

    PubMed

    Kocsis, Michael G; Ranocha, Philippe; Gage, Douglas A; Simon, Eric S; Rhodes, David; Peel, Gregory J; Mellema, Stefan; Saito, Kazuki; Awazuhara, Motoko; Li, Changjiang; Meeley, Robert B; Tarczynski, Mitchell C; Wagner, Conrad; Hanson, Andrew D

    2003-04-01

    Methionine (Met) S-methyltransferase (MMT) catalyzes the synthesis of S-methyl-Met (SMM) from Met and S-adenosyl-Met (Ado-Met). SMM can be reconverted to Met by donating a methyl group to homocysteine (homo-Cys), and concurrent operation of this reaction and that mediated by MMT sets up the SMM cycle. SMM has been hypothesized to be essential as a methyl donor or as a transport form of sulfur, and the SMM cycle has been hypothesized to guard against depletion of the free Met pool by excess Ado-Met synthesis or to regulate Ado-Met level and hence the Ado-Met to S-adenosylhomo-Cys ratio (the methylation ratio). To test these hypotheses, we isolated insertional mmt mutants of Arabidopsis and maize (Zea mays). Both mutants lacked the capacity to produce SMM and thus had no SMM cycle. They nevertheless grew and reproduced normally, and the seeds of the Arabidopsis mutant had normal sulfur contents. These findings rule out an indispensable role for SMM as a methyl donor or in sulfur transport. The Arabidopsis mutant had significantly higher Ado-Met and lower S-adenosylhomo-Cys levels than the wild type and consequently had a higher methylation ratio (13.8 versus 9.5). Free Met and thiol pools were unaltered in this mutant, although there were moderate decreases (of 30%-60%) in free serine, threonine, proline, and other amino acids. These data indicate that the SMM cycle contributes to regulation of Ado-Met levels rather than preventing depletion of free Met.

  4. Isolation and expression analysis of genes encoding MET, CMT, and DRM methyltransferases in oil palm (Elaeis guineensis Jacq.) in relation to the 'mantled' somaclonal variation.

    PubMed

    Rival, Alain; Jaligot, Estelle; Beulé, Thierry; Finnegan, E Jean

    2008-01-01

    In oil palm (Elaeis guineensis Jacq.), approximately 5% of somatic embryo-derived regenerants show homeotic changes during floral development, involving an apparent feminization of male parts in flowers of both sexes, called the 'mantled' phenotype. This variant phenotype is associated with a reduction in the level of global DNA methylation. To explore possible relationships between DNA methylation level and accumulation of DNA-(cytosine-5) methyltransferase (DNMT) transcripts, the full-length coding sequences corresponding to three different DNMT families in oil palm, namely the MET, CMT, and DRM classes, have been isolated and characterized. The corresponding genes were designated as EgMET1, EgCMT1, and EgDRM1, and encode predicted polypeptides of 1543, 925, and 591 amino acid residues, respectively. Expression of oil palm DNMTs was compared between normal and variant calli and inflorescence tissues using quantitative reverse-transcription PCR. A consistent increase in transcript levels of EgMET1 and EgCMT1 was found in variant fast-growing calli relative to nodular-compact calli. Nodular-compact calli give rise to about 5% of abnormal regenerants whereas fast-growing calli generate 95% of 'mantled' palms in their clonal offspring and were previously demonstrated as having markedly hypomethylated DNA. In immature abnormal inflorescences only EgMET1 transcript levels were increased, while no changes in relative abundance of the EgCMT1 or EgDRM1 transcripts were observed. Therefore, the genome-wide hypomethylation previously described in 'mantled' material cannot be explained by a decrease in expression levels of the de novo or maintenance DNMTs, a paradox which has been previously reported in tumour cells, where there is evidence for global hypomethylation of DNA.

  5. Thr105Ile (rs11558538) polymorphism in the histamine N-methyltransferase (HNMT) gene and risk for Parkinson disease

    PubMed Central

    Jiménez-Jiménez, Félix Javier; Alonso-Navarro, Hortensia; García-Martín, Elena; Agúndez, José A.G.

    2016-01-01

    Abstract Background/aims: Several neuropathological, biochemical, and pharmacological data suggested a possible role of histamine in the etiopathogenesis of Parkinson disease (PD). The single nucleotide polymorphism (SNP) rs11558538 in the histamine N-methyltransferase (HNMT) gene has been associated with the risk of developing PD by several studies but not by some others. We carried out a systematic review that included all the studies published on PD risk related to the rs11558538 SNP, and we conducted a meta-analysis following Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. Methods: We used several databases to perform the systematic review, the software Meta-DiSc 1.1.1 to perform the meta-analysis of the eligible studies, and the Q-statistic to test heterogeneity between studies. Results: The meta-analysis included 4 eligible case–control association studies for the HNMT rs11558538 SNP and the risk for PD (2108 patients, 2158 controls). The frequency of the minor allele positivity showed a statistically significant association with a decreased risk for PD, both in the total series and in Caucasians. Although homozygosity for the minor allele did not reach statistical significance, the test for trend indicates the occurrence of a gene–dose effect. Global diagnostic odds ratios (95% confidence intervals) for rs11558538T were 0.61 (0.46–0.81) for the total group, and 0.63 (0.45–0.88) for Caucasian patients. Conclusion: The present meta-analysis confirms published evidence suggesting that the HNMT rs11558538 minor allele is related to a reduced risk of developing PD. PMID:27399132

  6. Protein arginine methyltransferase 5 (Prmt5) promotes gene expression of peroxisome proliferator-activated receptor γ2 (PPARγ2) and its target genes during adipogenesis.

    PubMed

    LeBlanc, Scott E; Konda, Silvana; Wu, Qiong; Hu, Yu-Jie; Oslowski, Christine M; Sif, Saïd; Imbalzano, Anthony N

    2012-04-01

    Regulation of adipose tissue formation by adipogenic-regulatory proteins has long been a topic of interest given the ever-increasing health concerns of obesity and type 2 diabetes in the general population. Differentiation of precursor cells into adipocytes involves a complex network of cofactors that facilitate the functions of transcriptional regulators from the CCATT/enhancer binding protein, and the peroxisome proliferator-activated receptor (PPAR) families. Many of these cofactors are enzymes that modulate the structure of chromatin by altering histone-DNA contacts in an ATP-dependent manner or by posttranslationally modifying the histone proteins. Here we report that inhibition of protein arginine methyltransferase 5 (Prmt5) expression in multiple cell culture models for adipogenesis prevented the activation of adipogenic genes. In contrast, overexpression of Prmt5 enhanced adipogenic gene expression and differentiation. Chromatin immunoprecipitation experiments indicated that Prmt5 binds to and dimethylates histones at adipogenic promoters. Furthermore, the presence of Prmt5 promoted the binding of ATP-dependent chromatin-remodeling enzymes and was required for the binding of PPARγ2 at PPARγ2-regulated promoters. The data indicate that Prmt5 acts as a coactivator for the activation of adipogenic gene expression and promotes adipogenic differentiation.

  7. Systematic analysis of O-methyltransferase gene family and identification of potential members involved in the formation of O-methylated flavonoids in Citrus.

    PubMed

    Liu, Xiaogang; Luo, Yan; Wu, Hongkun; Xi, Wanpeng; Yu, Jie; Zhang, Qiuyun; Zhou, Zhiqin

    2016-01-10

    The O-methylation of various secondary metabolites is mainly catalyzed by S-adenosyl-l-methionine (SAM)-dependent O-methyltransferase (OMT) proteins that are encoded by the O-methyltransferase gene family. Citrus fruits are a rich source of O-methylated flavonoids that have a broad spectrum of biological activities, including anti-inflammatory, anticarcinogenic, and antiatherogenic properties. However, little is known about this gene family and its members that are involved in the O-methylation of flavonoids and their regulation in Citrus. In this study, 58 OMT genes were identified from the entire Citrus sinensis genome and compared with those from 3 other representative dicot plants. A comprehensive analysis was performed, including functional/substrate predictions, identification of chromosomal locations, phylogenetic relationships, gene structures, and conserved motifs. Distribution mapping revealed that the 58 OMT genes were unevenly distributed on the 9 citrus chromosomes. Phylogenetic analysis of 164 OMT proteins from C.sinensis, Arabidopsis thaliana, Populus trichocarpa, and Vitis vinifera showed that these proteins were categorized into group I (COMT subfamily) and group II (CCoAOMT subfamily), which were further divided into 10 and 2 subgroups, respectively. Finally, digital gene expression and quantitative real-time polymerase chain reaction analyses revealed that citrus OMT genes had distinct temporal and spatial expression patterns in different tissues and developmental stages. Interestingly, 18 and 11 of the 27 genes predicted to be involved in O-methylation of flavonoids had higher expression in the peel and pulp during fruit development, respectively. The citrus OMT gene family identified in this study might help in the selection of appropriate candidate genes and facilitate functional studies in Citrus.

  8. Arsenic Methylation in Arabidopsis thaliana Expressing an Algal Arsenite Methyltransferase Gene Increases Arsenic Phytotoxicity

    PubMed Central

    Tang, Zhong; Lv, Yanling; Chen, Fei; Zhang, Wenwen; Rosen, Barry P.; Zhao, Fang-Jie

    2016-01-01

    Arsenic (As) contamination in soil can lead to elevated transfer of As to the food chain. One potential mitigation strategy is to genetically engineer plants to enable them to transform inorganic As to methylated and volatile As species. In this study, we genetically engineered two ecotypes of Arabidopsis thaliana with the arsenite (As(III)) S-adenosylmethyltransferase (arsM) gene from the eukaryotic alga Chlamydomonas reinhardtii. The transgenic A. thaliana plants gained a strong ability to methylate As, converting most of the inorganic As into dimethylarsenate [DMA(V)] in the shoots. Small amounts of volatile As were detected from the transgenic plants. However, the transgenic plants became more sensitive to As(III) in the medium, suggesting that DMA(V) is more phytotoxic than inorganic As. The study demonstrates a negative consequence of engineered As methylation in plants and points to a need for arsM genes with a strong ability to methylate As to volatile species. PMID:26998776

  9. The Histone H3K36 Methyltransferase MES-4 Acts Epigenetically to Transmit the Memory of Germline Gene Expression to Progeny

    PubMed Central

    Phippen, Taryn M.; Egelhofer, Thea A.; Wang, Wenchao; Kimura, Hiroshi; Lieb, Jason D.; Strome, Susan

    2010-01-01

    Methylation of histone H3K36 in higher eukaryotes is mediated by multiple methyltransferases. Set2-related H3K36 methyltransferases are targeted to genes by association with RNA Polymerase II and are involved in preventing aberrant transcription initiation within the body of genes. The targeting and roles of the NSD family of mammalian H3K36 methyltransferases, known to be involved in human developmental disorders and oncogenesis, are not known. We used genome-wide chromatin immunoprecipitation (ChIP) to investigate the targeting and roles of the Caenorhabditis elegans NSD homolog MES-4, which is maternally provided to progeny and is required for the survival of nascent germ cells. ChIP analysis in early C. elegans embryos revealed that, consistent with immunostaining results, MES-4 binding sites are concentrated on the autosomes and the leftmost ∼2% (300 kb) of the X chromosome. MES-4 overlies the coding regions of approximately 5,000 genes, with a modest elevation in the 5′ regions of gene bodies. Although MES-4 is generally found over Pol II-bound genes, analysis of gene sets with different temporal-spatial patterns of expression revealed that Pol II association with genes is neither necessary nor sufficient to recruit MES-4. In early embryos, MES-4 associates with genes that were previously expressed in the maternal germ line, an interaction that does not require continued association of Pol II with those loci. Conversely, Pol II association with genes newly expressed in embryos does not lead to recruitment of MES-4 to those genes. These and other findings suggest that MES-4, and perhaps the related mammalian NSD proteins, provide an epigenetic function for H3K36 methylation that is novel and likely to be unrelated to ongoing transcription. We propose that MES-4 transmits the memory of gene expression in the parental germ line to offspring and that this memory role is critical for the PGCs to execute a proper germline program. PMID:20824077

  10. The Role of the Catechol-O-Methyltransferase (COMT) Gene in Personality and Related Psychopathological Disorders

    PubMed Central

    Montag, Christian; Jurkiewicz, Magdalena; Reuter, Martin

    2015-01-01

    This review provides a short overview of the most significant biologically oriented theories of human personality. Personality concepts of Eysenck, Gray and McNaughton, Cloninger and Panksepp will be introduced and the focal evidence for the heritability of personality will be summarized. In this context, a synopsis of a large number of COMT genetic association studies (with a focus on the COMT Val158Met polymorphism) in the framework of the introduced biologically oriented personality theories will be given. In line with the theory of a continuum model between healthy anxious behavior and related psychopathological behavior, the role of the COMT gene in anxiety disorders will be discussed. A final outlook considers new research strategies such as genetic imaging and epigenetics for a better understanding of human personality. PMID:22483293

  11. The role of the catechol-O-methyltransferase (COMT) gene in personality and related psychopathological disorders.

    PubMed

    Montag, Christian; Jurkiewicz, Magdalena; Reuter, Martin

    2012-05-01

    This review provides a short overview of the most significant biologically oriented theories of human personality. Personality concepts of Eysenck, Gray and McNaughton, Cloninger and Panksepp will be introduced and the focal evidence for the heritability of personality will be summarized. In this context, a synopsis of a large number of COMT genetic association studies (with a focus on the COMT Val158Met polymorphism) in the framework of the introduced biologically oriented personality theories will be given. In line with the theory of a continuum model between healthy anxious behavior and related psychopathological behavior, the role of the COMT gene in anxiety disorders will be discussed. A final outlook considers new research strategies such as genetic imaging and epigenetics for a better understanding of human personality.

  12. Protein arginine methyltransferase 1 may be involved in pregnane x receptor-activated overexpression of multidrug resistance 1 gene during acquired multidrug resistant

    PubMed Central

    Li, Tingting; Kong, Ah-Ng Tony; Ma, Zhiqiang; Liu, Haiyan; Liu, Pinghua; Xiao, Yu; Jiang, Xuehua; Wang, Ling

    2016-01-01

    Purpose Pregnane x receptor (PXR) - activated overexpression of the multidrug resistance 1 (MDR1) gene is an important way for tumor cells to acquire drug resistance. However, the detailed mechanism still remains unclear. In the present study, we aimed to investigate whether protein arginine methyl transferase 1(PRMT1) is involved in PXR - activated overexpression of MDR1 during acquired multidrug resistant. Experimental Design Arginine methyltransferase inhibitor 1 (AMI-1) was used to pharmacologically block PRMT1 in resistant breast cancer cells (MCF7/adr). The mRNA and protein levels of MDR1 were detected by real-time PCR and western blotting analysis. Immunofluorescence microscopy and co-immunoprecipitation were used to investigate the physical interaction between PXR and PRMT1. Then, 136 candidate compounds were screened for PRMT1 inhibitors. Lastly, luciferase reporter gene and nude mice bearing resistant breast cancer xenografts were adopted to investigate the anti-tumor effect of PRMT1 inhibitors when combined with adriamycin. Results AMI-1 significantly suppressed the expression of MDR1 in MCF7/adr cells and increased cells sensitivity of MCF7/adr to adriamycin. Physical interaction between PRMT1 and PXR exists in MCF7/adr cells, which could be disrupted by AMI-1. Those results suggest that PRMT1 may be involved in PXR-activated overexpression of MDR1 in resistant breast cancer cells, and AMI-1 may suppress MDR1 by disrupting the interaction between PRMT1 and PXR. Then, five compounds including rutin, isoquercitrin, salvianolic acid A, naproxen, and felodipline were identified to be PRMT1 inhibitors. Finally, those PRMT1 inhibitors were observed to significantly decrease MDR1 promoter activity in vitro and enhance the antitumor effect of adriamycin in nude mice that bearing resistant breast cancer xenografts. Conclusions PRMT1 may be an important co-activator of PXR in activating MDR1 gene during acquired resistance, and PRMT1 inhibitor combined with

  13. X-linked mental retardation gene CUL4B targets ubiquitylation of H3K4 methyltransferase component WDR5 and regulates neuronal gene expression.

    PubMed

    Nakagawa, Tadashi; Xiong, Yue

    2011-08-05

    CUL4B, encoding a scaffold protein for the assembly of Cullin4B-Ring ubiquitin ligase (CRL4B) complexes, is frequently mutated in X-linked mental retardation (XLMR) patients. Here, we show that CUL4B, but not its paralog, CUL4A, targets WDR5, a core subunit of histone H3 lysine 4 (H3K4) methyltransferase complexes, for ubiquitylation and degradation in the nucleus. Knocking down CUL4B increases WDR5 and trimethylated H3K4 (H3K4me3) on the neuronal gene promoters and induces their expression. Furthermore, CUL4B depletion suppresses neurite outgrowth of PC12 neuroendocrine cells, which can be rescued by codepletion of WDR5. XLMR-linked mutations destabilize CUL4B and impair its ability to support neurite outgrowth of PC12 cells. Our results identify WDR5 as a critical substrate of CUL4B in regulating neuronal gene expression and suggest epigenetic change as a common pathogenic mechanism for CUL4B-associated XLMR. Copyright © 2011 Elsevier Inc. All rights reserved.

  14. Function Analysis of Caffeoyl-CoA O-Methyltransferase for Biosynthesis of Lignin and Phenolic Acid in Salvia miltiorrhiza.

    PubMed

    Wang, Zhengjun; Ge, Qian; Chen, Chen; Jin, Xinxin; Cao, Xiaoyan; Wang, Zhezhi

    2017-02-01

    In this study, we cloned a full-length cDNA and the genomic DNA sequence of SmCCoAOMT (GenBank ID JQ007585) from Salvia miltiorrhiza. The 744-bp open-reading frame encodes a protein of 247 amino acids that shares 95 % similarity with one in Vitis vinifera. Real-time quantitative PCR analysis revealed that SmCCoAOMT is most highly expressed in the stems and can be induced by methyl jasmonate (MeJA) and XC-1 treatment. To evaluate its function in vivo, we generated RNA interference transgenic plants through Agrobacterium tumefaciens-mediated gene transfer. Compared with untransformed control plants, the transgenics had significantly less lignin and the expression of lignin-biosynthetic genes SmCCR and SmCOMT was depressed. In 90-day-old roots from plants of transgenic line M5, accumulations of rosmarinic acid and salvianolic acid B (Sal B) were greatly reduced by 0.89- and 0.69-fold, respectively. This low-Sal B phenotype was stable in the roots, with the level of accumulation being approximately 43.58 mg g(-1) dry weight, which was 52 % of the amount measured in the untransformed control. Our results suggest that SmCCoAOMT is involved in lignin biosynthesis and affects the accumulation of phenolic acids. This study also provides potential guidance for using lignin-related genes to genetically engineer Salvia miltiorrhiza.

  15. An integrated epigenetic and genetic analysis of DNA methyltransferase genes (DNMTs) in tumor resistant and susceptible chicken lines

    USDA-ARS?s Scientific Manuscript database

    Both epigenetic alterations and genetic variations play essential roles in tumorigenesis. The epigenetic modification of DNA methylation is catalyzed and maintained by the DNA methyltransferases (DNMT3a, DNMT3b and DNMT1). DNA mutations and DNA methylation profiles of DNMTs themselves and their rela...

  16. The Role of the Catechol-o-methyltransferase (COMT) Gene Val158Met in Aggressive Behavior, A Review of Genetic Studies

    PubMed Central

    Qayyum, Arqam; Zai, Clement C.; Hirata, Yuko; Tiwari, Arun K.; Cheema, Sheraz; Nowrouzi, Behdin; Beitchman, Joseph H.; Kennedy, James L.

    2015-01-01

    Aggressive behaviors have become a major public health problem, and early-onset aggression can lead to outcomes such as substance abuse, antisocial personality disorder among other issues. In recent years, there has been an increase in research in the molecular and genetic underpinnings of aggressive behavior, and one of the candidate genes codes for the catechol-O-methyltransferase (COMT). COMT is involved in catabolizing catecholamines such as dopamine. These neurotransmitters appear to be involved in regulating mood which can contribute to aggression. The most common gene variant studied in the COMT gene is the Valine (Val) to Methionine (Met) substitution at codon 158. We will be reviewing the current literature on this gene variant in aggressive behavior. PMID:26630958

  17. Selective Inhibitors of Protein Methyltransferases

    PubMed Central

    2015-01-01

    Mounting evidence suggests that protein methyltransferases (PMTs), which catalyze methylation of histone and nonhistone proteins, play a crucial role in diverse biological processes and human diseases. In particular, PMTs have been recognized as major players in regulating gene expression and chromatin state. PMTs are divided into two categories: protein lysine methyltransferases (PKMTs) and protein arginine methyltransferases (PRMTs). There has been a steadily growing interest in these enzymes as potential therapeutic targets and therefore discovery of PMT inhibitors has also been pursued increasingly over the past decade. Here, we present a perspective on selective, small-molecule inhibitors of PMTs with an emphasis on their discovery, characterization, and applicability as chemical tools for deciphering the target PMTs’ physiological functions and involvement in human diseases. We highlight the current state of PMT inhibitors and discuss future directions and opportunities for PMT inhibitor discovery. PMID:25406853

  18. Transcriptional regulation of the human ferritin gene by coordinated regulation of Nrf2 and protein arginine methyltransferases PRMT1 and PRMT4

    PubMed Central

    Huang, Bo-Wen; Ray, Paul D.; Iwasaki, Kenta; Tsuji, Yoshiaki

    2013-01-01

    Antioxidant genes such as ferritin are transcriptionally activated in oxidative stress via the antioxidant responsive element (ARE), to which nuclear factor-E2-related factor 2 (Nrf2) binds and activates transcription. Histone modification plays a cooperative and essential role in transcriptional regulation; however, its role in antioxidant gene transcription remains elusive. Arsenic exposure activated ferritin transcription via the ARE concomitant with increased methylation of histones H4Arg3 (H4R3) and H3Arg17 (H3R17). To test our hypothesis that histone H4R3 and H3R17 methylation regulates ferritin transcription, H4R3 and H3R17 protein arginine (R) methyltransferases 1 and 4 (PRMT1 and PRMT4) were investigated. Arsenic exposure of human HaCaT keratinocytes induced nuclear accumulation of PRMT1 and PRMT4, histone H4R3 and H3R17 methylation proximal to the ARE, but not to the non-ARE regions of ferritin genes. PRMT1 or PRMT4 knockdown did not block Nrf2 nuclear accumulation but inhibited Nrf2 binding to the AREs by ∼40% (P<0.05), thus diminishing ferritin transcription in HaCaT and human primary keratinocytes and fibroblasts, causing enhanced cellular susceptibility to arsenic toxicity as evidenced by 2-fold caspase 3 activation. Focused microarray further characterized several oxidative stress response genes are subject to PRMT1 or PRMT4 regulation. Collectively, PRMT1 and PRMT4 regulate the ARE and cellular antioxidant response to arsenic.—Huang, B.-W., Ray, P. D., Iwasaki, K., Tsuji, Y. Transcriptional regulation of the human ferritin gene by coordinated regulation of Nrf2 and protein arginine methyltransferases PRMT1 and PRMT4. PMID:23699174

  19. Cloning of the BssHII restriction-modification system in Escherichia coli : BssHII methyltransferase contains circularly permuted cytosine-5 methyltransferase motifs.

    PubMed Central

    Xu, S; Xiao, J; Posfai, J; Maunus, R; Benner, J

    1997-01-01

    BssHII restriction endonuclease cleaves 5'-GCGCGC-3' on double-stranded DNA between the first and second bases to generate a four base 5'overhang. BssHII restriction endonuclease was purified from the native Bacillus stearothermophilus H3 cells and its N-terminal amino acid sequence was determined. Degenerate PCR primers were used to amplify the first 20 codons of the BssHII restriction endonuclease gene. The BssHII restriction endonuclease gene (bssHIIR) and the cognate BssHII methyltransferase gene (bssHIIM) were cloned in Escherichia coli by amplification of Bacillus stearothermophilus genomic DNA using PCR and inverse PCR. BssHII methyltransferase (M.BssHII) contains all 10 conserved cytosine-5 methyltransferase motifs, but motifs IX and X precede motifs I-VIII. Thus, the conserved motifs of M. BssHII are circularly permuted relative to the motif organizations of other cytosine-5 methyltransferases. M.BssHII and the non-cognate multi-specific phiBssHII methyltransferase, M.phiBss HII [Schumann,J. et al . (1995) Gene, 157, 103-104] share 34% identity in amino acid sequences from motifs I-VIII, and 40% identity in motifs IX-X. A conserved arginine is located upstream of a TV dipeptide in the N-terminus of M.BssHII that may be responsible for the recognition of the guanine 5' of the target cytosine. The BssHII restriction endonuclease gene was expressed in E.coli via a T7 expression vector. PMID:9321648

  20. mraW, an essential gene at the dcw cluster of Escherichia coli codes for a cytoplasmic protein with methyltransferase activity.

    PubMed

    Carrión, M; Gómez, M J; Merchante-Schubert, R; Dongarrá, S; Ayala, J A

    1999-01-01

    Three new open reading frames, mraZ, mraW and mraR (also called ftsL), were revealed by DNA sequencing immediately upstream of gene pbpB in the dcw cluster of Escherichia coli. We have found that mraW and mraZ are active genes, coding for two proteins with relative molecular masses of 34 800 and 17 300, respectively. MraW is a cytoplasmic protein that under overproduction condition is also loosely bound to the membrane. Soluble MraW was purified up to 90% by a single high performance electrophoresis (HPEC) step from an extract of an overproducing strain. The protein exhibits a S-adenosyl-dependent methyltransferase activity on membrane-located substrates.

  1. Endoplasmic reticulum protein 29 (ERp29) confers radioresistance through the DNA repair gene, O6-methylguanine DNA-methyltransferase, in breast cancer cells

    PubMed Central

    Chen, Shaohua; Zhang, Yu; Zhang, Daohai

    2015-01-01

    Resistance of cancer cells to radiotherapy is a major clinical problem in cancer treatment. Therefore, understanding the molecular basis of cellular resistance to radiotherapy and identification of novel targets are essential for improving treatment efficacy for cancer patients. Our previous studies have demonstrated a significant role of ERp29 in breast cancer cell survival against doxorubicin-induced genotoxic stress. We here reported that ERp29 expression in the triple negative MDA-MB-231 breast cancer cells significantly increased cell survival against ionizing radiation. Methylation PCR array analysis identified that ERp29 expression increased promoter hypomethylation of the DNA repair gene, O6-methylguanine DNA-methyltransferase (MGMT), by downregulating DNA methyltransferase 1. Knockdown of MGMT in the ERp29-transfected cancer cells increased radiosensitivity, leading to a decreased post-irradiation survival. In addition, radiation treatment in the MGMT-knockdown cells elevated phosphorylation of γ-H2AX and cleavage of caspase 3, indicating that depletion of MGMT facilitates DNA double strands breaks and increases cell apoptosis. Hence, our studies prove a novel function of ERp29\\MGMT in cancer cell survival against radiation. Targeting ERp29\\MGMT axis may be useful for providing better treatment efficacy in combination with radiotherapy in breast cancer. PMID:26420420

  2. Putative methyltransferase LaeA and transcription factor CreA are necessary for proper asexual development and controlling secondary metabolic gene cluster expression.

    PubMed

    Zhang, Xiujun; Zhu, Yingying; Bao, Longfei; Gao, Liwei; Yao, Guangshan; Li, Yanan; Yang, Zhifeng; Li, Zhonghai; Zhong, Yaohua; Li, Fuli; Yin, Heng; Qu, Yinbo; Qin, Yuqi

    2016-09-01

    The morphological development of fungi is a complex process and is often coupled with secondary metabolite production. In this study, we assessed the function of putative methyltransferase LaeA and transcription factor CreA in controlling asexual development and secondary metabolic gene cluster expression in Penicillium oxalicum. The deletion of laeA (ΔlaeA) impaired the conidiation in P. oxalicum, with a downregulated expression of brlA. Overexpression of P. oxalicum brlA in ΔlaeA could upregulate brlA and abaA remarkably, but could not rescue the conidiation defect; therefore, brlA and abaA expression were necessary but not sufficient for conidiation. Deletion of creA in ΔlaeA background (ΔlaeAΔcreA) blocked conidiation with a white fluffy phenotype. Nutrient-rich medium could not rescue developmental defects in ΔlaeAΔcreA mutant but could rescue defects in ΔlaeA. Expression of 10 genes, namely, albA/wA, abrB/yA, arpA, aygA, arpA-like, arpB, arpB-like, rodA, rodA-like, and rodB, for pigmentation and spore wall protein genes was silenced in ΔlaeAΔcreA, whereas only six of them were downregulated in ΔlaeA. Among the 28 secondary metabolism gene clusters in P. oxalicum, four secondary metabolism gene clusters were silenced in ΔlaeA and two were also silenced in ΔbrlA mutant. A total of 10 physically linked and coregulated genes were distributed over five chromosomes in ΔlaeA. Six of these genes were located in subtelomeric regions, thus demonstrating a positional bias for LaeA-regulated clusters toward subtelomeric regions. All of silenced clusters located in subtelomeric regions were derepressed in ΔlaeAΔcreA, hence showing that lack of CreA could remediate the repression of gene clusters in ΔlaeA background. Results show that both putative methyltransferase LaeA and transcription factor CreA are necessary for proper asexual development and controlling secondary metabolic gene cluster expression.

  3. Expression of salicylic acid-related genes in Brassica oleracea var. capitata during Plasmodiophora brassicae infection.

    PubMed

    Manoharan, Ranjith Kumar; Shanmugam, Ashokraj; Hwang, Indeok; Park, Jong-In; Nou, Ill-Sup

    2016-06-01

    Brassica oleracea var. capitata (cabbage) is an important vegetable crop in Asian countries such as Korea, China, and Japan. Cabbage production is severely affected by clubroot disease caused by the soil-borne plant pathogen Plasmodiophora brassicae. During clubroot development, methyl salicylate (MeSA) is biosynthesized from salicylic acid (SA) by methyltransferase. In addition, methyl salicylate esterase (MES) plays a major role in the conversion of MeSA back into free SA. The interrelationship between MES and methytransferases during clubroot development has not been fully explored. To begin to examine these relationships, we investigated the expression of MES genes in disease-susceptible and disease-resistant plants during clubroot development. We identified three MES-encoding genes potentially involved in the defense against pathogen attack. We found that SS1 was upregulated in both the leaves and roots of B. oleracea during P. brassicae infection. These results support the conclusion that SA biosynthesis is suppressed during pathogen infection in resistant plants. We also characterized the expression of a B. oleracea BSMT gene, which appears to be involved in glycosylation rather than MeSA biosynthesis. Our results provide insight into the functions and interactions of genes for MES and methyltransferase during infection. Taken together, our findings indicate that MES genes are important candidates for use to control clubroot diseases.

  4. Investigating the genetic basis of theory of mind (ToM): the role of catechol-O-methyltransferase (COMT) gene polymorphisms.

    PubMed

    Xia, Haiwei; Wu, Nan; Su, Yanjie

    2012-01-01

    The ability to deduce other persons' mental states and emotions which has been termed 'theory of mind (ToM)' is highly heritable. First molecular genetic studies focused on some dopamine-related genes, while the genetic basis underlying different components of ToM (affective ToM and cognitive ToM) remain unknown. The current study tested 7 candidate polymorphisms (rs4680, rs4633, rs2020917, rs2239393, rs737865, rs174699 and rs59938883) on the catechol-O-methyltransferase (COMT) gene. We investigated how these polymorphisms relate to different components of ToM. 101 adults participated in our study; all were genetically unrelated, non-clinical and healthy Chinese subjects. Different ToM tasks were applied to detect their theory of mind ability. The results showed that the COMT gene rs2020917 and rs737865 SNPs were associated with cognitive ToM performance, while the COMT gene rs5993883 SNP was related to affective ToM, in which a significant gender-genotype interaction was found (p = 0.039). Our results highlighted the contribution of DA-related COMT gene on ToM performance. Moreover, we found out that the different SNP at the same gene relates to the discriminative aspect of ToM. Our research provides some preliminary evidence to the genetic basis of theory of mind which still awaits further studies.

  5. Upregulation of DNA methyltransferase-mediated gene silencing, anchorage-independent growth, and migration of colon cancer cells by interleukin-6.

    PubMed

    Foran, Eilis; Garrity-Park, Megan M; Mureau, Coralie; Newell, John; Smyrk, Thomas C; Limburg, Paul J; Egan, Laurence J

    2010-04-01

    Inflammatory bowel disease is characterized by chronic inflammation which predisposes to colorectal cancer. The mechanisms by which inflammation promotes tumorigenesis are not fully known. We aimed to investigate the links between colonic inflammation and tumorigenesis via epigenetic gene silencing. Colon cancer specimens were assessed for the expression of DNA methyltransferase-1 (DNMT-1) using immunohistochemistry. Colorectal carcinoma cell lines were assessed for DNMT1 expression, methylcytosine content, promoter methylation, gene expression, and tumorigenesis in response to interleukin (IL)-6. DNMT1 was expressed at higher levels in both the peritumoral stroma and tumor in inflammatory bowel disease-associated cancers compared with sporadic colon cancers. IL-6 treatment of colon cancer cells resulted in an increase in DNMT1 expression, independent of de novo gene expression. IL-6 increased the methylation of promoter regions of genes associated with tumor suppression, adhesion, and apoptosis resistance. Expression of a subset of these genes was downregulated by IL-6, an effect that was prevented by preincubation with 5-azadeoxycytidine, a DNMT1 inhibitor. Anchorage-independent growth and migration of colon cancer cells was also increased by IL-6 in a 5-azadeoxycytidine-sensitive manner. Our results indicate that DNMT-mediated gene silencing may play a role in inflammation-associated colon tumorigenesis.

  6. Promoter methylation status of tumor suppressor genes and inhibition of expression of DNA methyltransferase 1 in non-small cell lung cancer

    PubMed Central

    Liu, Bangqing; Song, Jianfei; Luan, Jiaqiang; Sun, Xiaolin; Bai, Jian; Wang, Haiyong; Li, Angui; Zhang, Lifei; Feng, Xiaoyan

    2016-01-01

    DNA methylation is an epigenetic DNA modification catalyzed by DNA methyltransferase 1 (DNMT1). The purpose of this study was to investigate DNMT1 gene and protein expression and the effects of methylation status on tumor suppressor genes in human non-small cell lung cancer (NSCLC) cell lines grown in vitro and in vivo. Human lung adenocarcinoma cell lines, A549 and H838, were grown in vitro and inoculated subcutaneously into nude mice to form tumors and were then treated with the DNA methylation inhibitor, 5-aza-2′-deoxycytidine, with and without treatment with the benzamide histone deacetylase inhibitor, entinostat (MS-275). DNMT1 protein expression was quantified by Western blot. Promoter methylation status of tumor suppressor genes (RASSF1A, ASC, APC, MGMT, CDH13, DAPK, ECAD, P16, and GATA4) was evaluated by methylation-specific polymerase chain reaction. Methylation status of the tumor suppressor genes was regulated by the DNMT1 gene, with the decrease of DNMT1 expression following DNA methylation treatment. Demethylation of tumor suppressor genes (APC, ASC, and RASSF1A) restored tumor growth in nude mice. The results of this study support a role for methylation of DNA as a potential epigenetic clinical biomarker of prognosis or response to therapy and for DNMT1 as a potential therapeutic target in NSCLC. PMID:27190263

  7. The hemK gene in Escherichia coli encodes the N5-glutamine methyltransferase that modifies peptide release factors

    PubMed Central

    Heurgué-Hamard, Valérie; Champ, Stéphanie; Engström, Åke; Ehrenberg, Måns; Buckingham, Richard H.

    2002-01-01

    Class 1 peptide release factors (RFs) in Escherichia coli are N5-methylated on the glutamine residue of the universally conserved GGQ motif. One other protein alone has been shown to contain N5-methylglutamine: E.coli ribosomal protein L3. We identify the L3 methyltransferase as YfcB and show that it methylates ribosomes from a yfcB strain in vitro, but not RF1 or RF2. HemK, a close orthologue of YfcB, is shown to methylate RF1 and RF2 in vitro. hemK is immediately downstream of and co-expressed with prfA. Its deletion in E.coli K12 leads to very poor growth on rich media and abolishes methylation of RF1. The activity of unmethylated RF2 from K12 strains is extremely low due to the cumulative effects of threonine at position 246, in place of alanine or serine present in all other bacterial RFs, and the lack of N5-methylation of Gln252. Fast-growing spontaneous revertants in hemK K12 strains contain the mutations Thr246Ala or Thr246Ser in RF2. HemK and YfcB are the first identified methyltransferases modifying glutamine, and are widely distributed in nature. PMID:11847124

  8. Complete Sequences of Multidrug Resistance Plasmids Bearing rmtD1 and rmtD2 16S rRNA Methyltransferase Genes

    PubMed Central

    Bueno, Maria Fernanda C.; Francisco, Gabriela R.; de Oliveira Garcia, Doroti

    2016-01-01

    Complete nucleotide sequences were determined for two plasmids bearing rmtD group 16S rRNA methyltransferase genes. pKp64/11 was 78 kb in size, belonged to the IncL/M group, and harbored blaTEM-1b, sul1, qacEΔ1, dfrA22, and rmtD1 across two multidrug resistance regions (MRRs). pKp368/10 was 170 kb in size, belonged to the IncA/C group, and harbored acrB, sul1, qacEΔ1, ant(3″)-Ia, aac(6′)-Ib, cat, rmtD2, and blaCTX-M-8 across three MRRs. The rmtD-containing regions shared a conserved motif, suggesting a common origin for the two rmtD alleles. PMID:26729503

  9. Floral Benzenoid Carboxyl Methyltransferases: From in Vitro to in Planta Function

    SciTech Connect

    Effmert,U.; Saschenbrecker, S.; Ross, J.; Negre, F.; Fraser, C.; Noel, J.; Dudareva, N.; Piechulla, B.

    2005-01-01

    Benzenoid carboxyl methyltransferases synthesize methyl esters (e.g., methyl benzoate and methyl salicylate), which are constituents of aromas and scents of many plant species and play important roles in plant communication with the surrounding environment. Within the past five years, eleven such carboxyl methyltransferases were isolated and most of them were comprehensively investigated at the biochemical, molecular and structural level. Two types of enzymes can be distinguished according to their substrate preferences: the SAMT-type enzymes isolated from Clarkia breweri, Stephanotis floribunda, Antirrhinum majus, Hoya carnosa, and Petunia hybrida, which have a higher catalytic efficiency and preference for salicylic acid, while BAMT-type enzymes from A. majus, Arabidopsis thaliana, Arabidopsis lyrata, and Nicotiana suaveolens prefer benzoic acid. The elucidation of C. breweri SAMT's three-dimensional structure allowed a detailed modelling of the active sites of the carboxyl methyltransferases and revealed that the SAM binding pocket is highly conserved among these enzymes while the methyl acceptor binding site exhibits some variability, allowing a classification into SAMT-type and BAMT-type enzymes. The analysis of expression patterns coupled with biochemical characterization showed that these carboxyl methyltransferases are involved either in floral scent biosynthesis or in plant defense responses. While the latter can be induced by biotic or abiotic stress, the genes responsible for floral scent synthesis exhibit developmental and rhythmic expression pattern. The nature of the product and efficiency of its formation in plants depend on the availability of substrates, the catalytic efficiency of the enzyme toward benzoic acid and/or salicylic acid, and the transcriptional, translational, and post-translational regulation at the enzyme level. The biochemical properties of benzenoid carboxyl methyltransferases suggest that the genes involved in plant defenses

  10. Floral benzenoid carboxyl methyltransferases: From in vitro to in planta function

    PubMed Central

    Effmert, Uta; Saschenbrecker, Sandra; Ross, Jeannine; Negre, Florence; Fraser, Chris M.; Noel, Joseph P.; Dudareva, Natalia; Piechulla, Birgit

    2010-01-01

    Benzenoid carboxyl methyltransferases synthesize methyl esters (e.g., methyl benzoate and methyl salicylate), which are constituents of aromas and scents of many plant species and play important roles in plant communication with the surrounding environment. Within the past five years, eleven such carboxyl methyltransferases were isolated and most of them were comprehensively investigated at the biochemical, molecular and structural level. Two types of enzymes can be distinguished according to their substrate preferences: the SAMT-type enzymes isolated from Clarkia breweri, Stephanotis floribunda, Antirrhinum majus, Hoya carnosa, and Petunia hybrida, which have a higher catalytic efficiency and preference for salicylic acid, while BAMT-type enzymes from A. majus, Arabidopsis thaliana, Arabidopsis lyrata, and Nicotiana suaveolens prefer benzoic acid. The elucidation of C. breweri SAMT’s three-dimensional structure allowed a detailed modelling of the active sites of the carboxyl methyltransferases and revealed that the SAM binding pocket is highly conserved among these enzymes while the methyl acceptor binding site exhibits some variability, allowing a classification into SAMT-type and BAMT-type enzymes. The analysis of expression patterns coupled with biochemical characterization showed that these carboxyl methyltransferases are involved either in floral scent biosynthesis or in plant defense responses. While the latter can be induced by biotic or abiotic stress, the genes responsible for floral scent synthesis exhibit developmental and rhythmic expression pattern. The nature of the product and efficiency of its formation in planta depend on the availability of substrates, the catalytic efficiency of the enzyme toward benzoic acid and/or salicylic acid, and the transcriptional, translational, and post-translational regulation at the enzyme level. The biochemical properties of benzenoid carboxyl methyltransferases suggest that the genes involved in plant defenses

  11. The Kruppel-like zinc finger protein ZNF224 recruits the arginine methyltransferase PRMT5 on the transcriptional repressor complex of the aldolase A gene.

    PubMed

    Cesaro, Elena; De Cegli, Rossella; Medugno, Lina; Florio, Francesca; Grosso, Michela; Lupo, Angelo; Izzo, Paola; Costanzo, Paola

    2009-11-20

    Gene transcription in eukaryotes is modulated by the coordinated recruitment of specific transcription factors and chromatin-modulating proteins. Indeed, gene activation and/or repression is/are regulated by histone methylation status at specific arginine or lysine residues. In this work, by co-immunoprecipitation experiments, we demonstrate that PRMT5, a type II protein arginine methyltransferase that monomethylates and symmetrically dimethylates arginine residues, is physically associated with the Kruppel-like associated box-zinc finger protein ZNF224, the aldolase A gene repressor. Moreover, chromatin immunoprecipitation assays show that PRMT5 is recruited to the L-type aldolase A promoter and that methylation of the nucleosomes that surround the L-type promoter region occurs in vivo on the arginine 3 of histone H4. Consistent with its association to the ZNF224 repressor complex, the decrease of PRMT5 expression produced by RNA interference positively affects L-type aldolase A promoter transcription. Finally, the alternating occupancy of the L-type aldolase A promoter by the ZNF224-PRMT5 repression complex in proliferating and growth-arrested cells suggests that these regulatory proteins play a significant role during the cell cycle modulation of human aldolase A gene expression. Our data represent the first experimental evidence that protein arginine methylation plays a role in ZNF224-mediated transcriptional repression and provide novel insight into the chromatin modifications required for repression of gene transcription by Kruppel-like associated box-zinc finger proteins.

  12. Weaver Syndrome‐Associated EZH2 Protein Variants Show Impaired Histone Methyltransferase Function In Vitro

    PubMed Central

    Yap, Damian B.; Lewis, M.E. Suzanne; Chijiwa, Chieko; Ramos‐Arroyo, Maria A.; Tkachenko, Natália; Milano, Valentina; Fradin, Mélanie; McKinnon, Margaret L.; Townsend, Katelin N.; Xu, Jieqing; Van Allen, M.I.; Ross, Colin J.D.; Dobyns, William B.; Weaver, David D.; Gibson, William T.

    2016-01-01

    ABSTRACT Weaver syndrome (WS) is a rare congenital disorder characterized by generalized overgrowth, macrocephaly, specific facial features, accelerated bone age, intellectual disability, and susceptibility to cancers. De novo mutations in the enhancer of zeste homolog 2 (EZH2) have been shown to cause WS. EZH2 is a histone methyltransferase that acts as the catalytic agent of the polycomb‐repressive complex 2 (PRC2) to maintain gene repression via methylation of lysine 27 on histone H3 (H3K27). Functional studies investigating histone methyltransferase activity of mutant EZH2 from various cancers have been reported, whereas WS‐associated mutations remain poorly characterized. To investigate the role of EZH2 in WS, we performed functional studies using artificially assembled PRC2 complexes containing mutagenized human EZH2 that reflected the codon changes predicted from patients with WS. We found that WS‐associated amino acid alterations reduce the histone methyltransferase function of EZH2 in this in vitro assay. Our results support the hypothesis that WS is caused by constitutional mutations in EZH2 that alter the histone methyltransferase function of PRC2. However, histone methyltransferase activities of different EZH2 variants do not appear to correlate directly with the phenotypic variability between WS patients and individuals with a common c.553G>C (p.Asp185His) polymorphism in EZH2. PMID:26694085

  13. Left-Right Axis Differentiation and Functional Lateralization: a Haplotype in the Methyltransferase Encoding Gene SETDB2 Might Mediate Handedness in Healthy Adults.

    PubMed

    Ocklenburg, Sebastian; Arning, Larissa; Gerding, Wanda M; Hengstler, Jan G; Epplen, Jörg T; Güntürkün, Onur; Beste, Christian; Akkad, Denis A

    2016-11-01

    Handedness is a multifactorial trait, and genes contributing to the differentiation of the left-right axis during embryogenesis have been identified as a major gene group associated with this trait. The methyltransferase SETDB2 (SET domain, bifurcated 2) has been shown to regulate structural left-right asymmetry in the vertebrate central nervous system by suppressing fgf8 expression. Here, we investigated the relation of genetic variation in SETDB2-and its paralogue SETDB1-with different handedness phenotypes in 950 healthy adult participants. We identified a haplotype on SETDB2 for which homozygous individuals showed a significantly lower lateralization quotient for handedness than the rest of the cohort after correction for multiple comparisons. Moreover, direction of handedness was significantly associated with genetic variation in this haplotype. This effect was mainly, but not exclusively, driven by the sequence variation rs4942830, as individuals homozygous for the A allele of this single nucleotide polymorphism had a significantly lower lateralization quotient than individuals with at least one T allele. These findings further confirm a role of genetic pathways relevant for structural left-right axis differentiation for functional lateralization. Moreover, as the protein encoded by SETDB2 regulates gene expression epigenetically by histone H3 methylation, our findings highlight the importance of investigating the role of epigenetic modulations of gene expression in relation to handedness.

  14. Association of aggressive behavior in Korean male schizophrenic patients with polymorphisms in the serotonin transporter promoter and catecholamine-O-methyltransferase genes.

    PubMed

    Han, Doug Hyun; Park, Doo Byung; Na, Chul; Kee, Baik Seok; Lee, Young Sik

    2004-11-30

    The incidence of aggressive behavior in patients with schizophrenia is higher than in the general population. Among particular gene polymorphisms posited to be involved in psychiatric disorders, the catecholamine-O-methyltransferase (COMT) and serotonin transporter (5-HTTPR) genes have been the focus of recent research on aggression. In this study, we hypothesized that both the COMT and the 5-HTTPR genotypes may be dependent on and related to aggression in Korean patients with schizophrenia. The subjects were 168 unrelated male schizophrenic patients diagnosed according to DSM-IV. Among two psychiatric hospital staff and medical university students, 158 unrelated male subjects with no lifetime history of psychiatric disorders were recruited to establish the COMT and 5-HTTPR genotype distribution in the general population. All episodes of aggression from the last discharge to readmission were rated. The Total Overt Aggression Scale (OAS) score (sum of the scores of all episodes of aggression), highest OAS score (highest individual episode score, 0-16), OAS category, and OAS category score (mean score within each category) were recorded. There were statistically significant effects of COMT genotype on the mean OAS 4 (physical aggression against other people) score and the highest OAS score. The most predictive was the OAS 4 score. There was a statistically significant effect of 5-HTTPR genotype on mean total score. Thus, the COMT gene is associated with the severity of aggression and with physical aggression against other people, whereas the 5-HTTPR gene is associated with the summary score of all episodes of aggression.

  15. T26248G-transversion mutation in exon7 of the putative methyltransferase Nsun7 gene causes a change in protein folding associated with reduced sperm motility in asthenospermic men.

    PubMed

    Khosronezhad, Nahid; Colagar, Abasalt Hosseinzadeh; Jorsarayi, Syed Golam Ali

    2015-03-01

    The NOP2/Sun domain family, member 7 (Nsun7) gene, which encodes putative methyltransferase Nsun7, has a role in sperm motility in mice. In humans, this gene is located on chromosome 4 with 12 exons. The aim of the present study was to investigate mutations of exon 7 in the normospermic and asthenospermic men. Semen samples were collected from the Fatemezahra IVF centre (Babol, Iran) and analysed on the basis of World Health Organization (WHO) guidelines using general phenol-chloroform DNA extraction methods. Exon 7 was amplified using Sun7-F and Sun7-R primers. Bands on samples from asthenospermic men that exhibited different patterns of movement on single-strand conformation polymorphism gels compared with normal samples were identified and subjected to sequencing for further identification of possible mutations. Direct sequencing of polymerase chain reaction (PCR) products, along with their analysis, confirmed C26232T-transition and T26248G-transversion mutations in asthenospermic men. Comparison of normal and mutant protein structures of Nsun7 indicated that the amino acid serine was converted to alanine, the structure of the helix, coil and strand was changed, and the protein folding and ligand binding sites were changed in samples from asthenospermic men with a transversion mutation in exon 7, indicating impairment of protein function. Because Nsun7 gene products have a role in sperm motility, if an impairment occurs in exon 7 of this gene, it may lead to infertility. The transversion mutation in exon 7 of the Nsun7 gene can be used as an infertility marker in asthenospermic men.

  16. Characterization and functional analysis of eugenol O-methyltransferase gene reveal metabolite shifts, chemotype specific differential expression and developmental regulation in Ocimum tenuiflorum L.

    PubMed

    Renu, Indu Kumari; Haque, Inamul; Kumar, Manish; Poddar, Raju; Bandopadhyay, Rajib; Rai, Amit; Mukhopadhyay, Kunal

    2014-03-01

    Eugenol-O-methyltransferase (EOMT) catalyzes the conversion of eugenol to methyleugenol in one of the final steps of phenylpropanoid pathway. There are no comprehensive reports on comparative EOMT gene expression and developmental stage specific accumulation of phenylpropenes in Ocimum tenuiflorum. Seven chemotypes, rich in eugenol and methyleugenol, were selected by assessment of volatile metabolites through multivariate data analysis. Isoeugenol accumulated in higher levels during juvenile stage (36.86 ng g(-1)), but reduced sharply during preflowering (8.04 ng g(-1)), flowering (2.29 ng g(-1)) and postflowering stages (0.17 ng g(-1)), whereas methyleugenol content gradually increased from juvenile (12.25 ng g(-1)) up to preflowering (16.35 ng g(-1)) and then decreased at flowering (7.13 ng g(-1)) and post flowering (5.95 ng g(-1)) from fresh tissue. Extreme variations of free intracellular and alkali hydrolysable cell wall released phenylpropanoid compounds were observed at different developmental stages. Analyses of EOMT genomic and cDNA sequences revealed a 843 bp open reading frame and the presence of a 90 bp intron. The translated proteins had eight catalytic domains, the major two being dimerisation superfamily and methyltransferase_2 superfamily. A validated 3D structure of EOMT protein was also determined. The chemotype Ot7 had a reduced reading frame that lacked both dimerisation domains and one of the two protein-kinase-phosphorylation sites; this was also reflected in reduced accumulation of methyleugenol compared to other chemotypes. EOMT transcripts showed enhanced expression in juvenile stage that increased further during preflowering but decreased at flowering and further at postflowering. The expression patterns may possibly be compared and correlated to the amounts of eugenol/isoeugenol and methyleugenol in different developmental stages of all chemotypes.

  17. Juvenile Hormone Synthesis: “esterify then epoxidize” or “epoxidize then esterify”? Insights from the Structural Characterization of Juvenile Hormone Acid Methyltransferase

    PubMed Central

    Defelipe, L.A; Dolghih, E.; Roitberg, A.E.; Nouzova, M.; Mayoral, J.G; Noriega, F.G.; Turjanski, A.G.

    2011-01-01

    Juvenile hormones (JHs) play key roles in regulating metamorphosis and reproduction in insects. The last two steps of JH synthesis diverge depending on the insect order. In Lepidoptera, epoxidation by a P450 monooxygenase precedes esterification by a juvenile hormone acid methyltransferase (JHAMT). In Orthoptera, Dictyoptera, Coleoptera and Diptera epoxidation follows methylation. The aim of our study was to gain insight into the structural basis of JHAMT’s substrate recognition as a means to understand the divergence of these pathways. Homology modeling was used to build the structure of Aedes aegypti JHAMT. The substrate binding site was identified, as well as the residues that interact with the methyl donor (S-adenosylmethionine) and the carboxylic acid of the substrate methyl acceptors, farnesoic acid (FA) and juvenile hormone acid (JHA). To gain further insight we generated the structures of Anopheles gambiae, Bombyx mori, Drosophila melanogaster and Tribolium castaneum JHAMTs. The modeling results were compared with previous experimental studies using recombinant proteins, whole insects, corpora allata or tissue extracts. The computational study helps explain the selectivity towards the (10R)-JHA isomer and the reduced activity for palmitic and lauric acids. The analysis of our results supports the hypothesis that all insect JHAMTs are able to recognize both FA and JHA as substrates. Therefore, the order of the methylation/epoxidation reactions may be primarily imposed by the epoxidase’s substrate specificity. In Lepidoptera, epoxidase might have higher affinity than JHAMT for FA, so epoxidation precedes methylation, while in most other insects there is no epoxidation of FA, but esterification of FA to form MF, followed by epoxidation to JH III. PMID:21195763

  18. Structure-Function Analyses of a Caffeic Acid O-Methyltransferase from Perennial Ryegrass Reveal the Molecular Basis for Substrate Preference[W][OA

    PubMed Central

    Louie, Gordon V.; Bowman, Marianne E.; Tu, Yi; Mouradov, Aidyn; Spangenberg, German; Noel, Joseph P.

    2010-01-01

    Lignin forms from the polymerization of phenylpropanoid-derived building blocks (the monolignols), whose modification through hydroxylation and O-methylation modulates the chemical and physical properties of the lignin polymer. The enzyme caffeic acid O-methyltransferase (COMT) is central to lignin biosynthesis. It is often targeted in attempts to engineer the lignin composition of transgenic plants for improved forage digestibility, pulping efficiency, or utility in biofuel production. Despite intensive investigation, the structural determinants of the regiospecificity and substrate selectivity of COMT remain poorly defined. Reported here are x-ray crystallographic structures of perennial ryegrass (Lolium perenne) COMT (Lp OMT1) in open conformational state, apo- and holoenzyme forms and, most significantly, in a closed conformational state complexed with the products S-adenosyl-l-homocysteine and sinapaldehyde. The product-bound complex reveals the post-methyl-transfer organization of COMT’s catalytic groups with reactant molecules and the fully formed phenolic-ligand binding site. The core scaffold of the phenolic ligand forges a hydrogen-bonding network involving the 4-hydroxy group that anchors the aromatic ring and thereby permits only metahydroxyl groups to be positioned for transmethylation. While distal from the site of transmethylation, the propanoid tail substituent governs the kinetic preference of ryegrass COMT for aldehydes over alcohols and acids due to a single hydrogen bond donor for the C9 oxygenated moiety dictating the preference for an aldehyde. PMID:21177481

  19. The nitrosated bile acid DNA lesion O6-carboxymethylguanine is a substrate for the human DNA repair protein O6-methylguanine-DNA methyltransferase

    PubMed Central

    Senthong, Pattama; Millington, Christopher L.; Wilkinson, Oliver J.; Marriott, Andrew S.; Watson, Amanda J.; Reamtong, Onrapak; Eyers, Claire E.; Williams, David M.; Margison, Geoffrey P.; Povey, Andrew C.

    2013-01-01

    The consumption of red meat is a risk factor in human colorectal cancer (CRC). One hypothesis is that red meat facilitates the nitrosation of bile acid conjugates and amino acids, which rapidly convert to DNA-damaging carcinogens. Indeed, the toxic and mutagenic DNA adduct O6-carboxymethylguanine (O6-CMG) is frequently present in human DNA, increases in abundance in people with high levels of dietary red meat and may therefore be a causative factor in CRC. Previous reports suggested that O6-CMG is not a substrate for the human version of the DNA damage reversal protein O6-methylguanine-DNA methyltransferase (MGMT), which protects against the genotoxic effects of other O6-alkylguanine lesions by removing alkyl groups from the O6-position. We now show that synthetic oligodeoxyribonucleotides containing the known MGMT substrate O6-methylguanine (O6-MeG) or O6-CMG effectively inactivate MGMT in vitro (IC50 0.93 and 1.8 nM, respectively). Inactivation involves the removal of the O6-alkyl group and its transfer to the active-site cysteine residue of MGMT. O6-CMG is therefore an MGMT substrate, and hence MGMT is likely to be a protective factor in CRC under conditions where O6-CMG is a potential causative agent. PMID:23335782

  20. Distribution of the type III DNA methyltransferases modA, modB and modD among Neisseria meningitidis genotypes: implications for gene regulation and virulence.

    PubMed

    Tan, Aimee; Hill, Dorothea M C; Harrison, Odile B; Srikhanta, Yogitha N; Jennings, Michael P; Maiden, Martin C J; Seib, Kate L

    2016-02-12

    Neisseria meningitidis is a human-specific bacterium that varies in invasive potential. All meningococci are carried in the nasopharynx, and most genotypes are very infrequently associated with invasive meningococcal disease; however, those belonging to the 'hyperinvasive lineages' are more frequently associated with sepsis or meningitis. Genome content is highly conserved between carriage and disease isolates, and differential gene expression has been proposed as a major determinant of the hyperinvasive phenotype. Three phase variable DNA methyltransferases (ModA, ModB and ModD), which mediate epigenetic regulation of distinct phase variable regulons (phasevarions), have been identified in N. meningitidis. Each mod gene has distinct alleles, defined by their Mod DNA recognition domain, and these target and methylate different DNA sequences, thereby regulating distinct gene sets. Here 211 meningococcal carriage and >1,400 disease isolates were surveyed for the distribution of meningococcal mod alleles. While modA11-12 and modB1-2 were found in most isolates, rarer alleles (e.g., modA15, modB4, modD1-6) were specific to particular genotypes as defined by clonal complex. This suggests that phase variable Mod proteins may be associated with distinct phenotypes and hence invasive potential of N. meningitidis strains.

  1. Distribution of the type III DNA methyltransferases modA, modB and modD among Neisseria meningitidis genotypes: implications for gene regulation and virulence

    PubMed Central

    Tan, Aimee; Hill, Dorothea M. C.; Harrison, Odile B.; Srikhanta, Yogitha N.; Jennings, Michael P.; Maiden, Martin C. J.; Seib, Kate L.

    2016-01-01

    Neisseria meningitidis is a human-specific bacterium that varies in invasive potential. All meningococci are carried in the nasopharynx, and most genotypes are very infrequently associated with invasive meningococcal disease; however, those belonging to the ‘hyperinvasive lineages’ are more frequently associated with sepsis or meningitis. Genome content is highly conserved between carriage and disease isolates, and differential gene expression has been proposed as a major determinant of the hyperinvasive phenotype. Three phase variable DNA methyltransferases (ModA, ModB and ModD), which mediate epigenetic regulation of distinct phase variable regulons (phasevarions), have been identified in N. meningitidis. Each mod gene has distinct alleles, defined by their Mod DNA recognition domain, and these target and methylate different DNA sequences, thereby regulating distinct gene sets. Here 211 meningococcal carriage and >1,400 disease isolates were surveyed for the distribution of meningococcal mod alleles. While modA11-12 and modB1-2 were found in most isolates, rarer alleles (e.g., modA15, modB4, modD1-6) were specific to particular genotypes as defined by clonal complex. This suggests that phase variable Mod proteins may be associated with distinct phenotypes and hence invasive potential of N. meningitidis strains. PMID:26867950

  2. Fidelity Index Determination of DNA Methyltransferases

    PubMed Central

    Borgaro, Janine G.; Benner, Nicole; Zhu, Zhenyu

    2013-01-01

    DNA methylation is the most frequent form of epigenetic modification in the cell, which involves gene regulation in eukaryotes and protection against restriction enzymes in prokaryotes. Even though many methyltransferases exclusively modify their cognate sites, there have been reports of those that exhibit promiscuity. Previous experimental approaches used to characterize these methyltransferases do not provide the exact concentration at which off-target methylation occurs. Here, we present the first reported fidelity index (FI) for a number of DNA methyltransferases. We define the FI as the ratio of the highest amount of methyltransferase that exhibits no star activity (off-target effects) to the lowest amount that exhibits complete modification of the cognate site. Of the methyltransferases assayed, M.MspI and M.AluI exhibited the highest fidelity of ≥250 and ≥500, respectively, and do not show star activity even at very high concentrations. In contrast, M.HaeIII, M.EcoKDam and M.BamHI have the lowest fidelity of 4, 4 and 2, respectively, and exhibit star activity at concentrations close to complete methylation of the cognate site. The fidelity indexes provide vital information on the usage of methyltransferases and are especially important in applications where site specific methylation is required. PMID:23671703

  3. (Accumulation of methyl-deficient rat liver messenger ribonucleic acid on ethionine administration). Progress report. [Methyltransferase activity in Ehrlich ascites tumor cells and effects of phorbol ester on methyltransferase activity

    SciTech Connect

    Borek, E.

    1980-01-01

    Enzyme fractions were isolated from Ehrlich ascites cells which introduced methyl groups into methyl deficient rat liver mRNA and unmethylated vaccinia mRNA. The methyl groups were incorporated at the 5' end into cap 1 structures by the viral enzyme, whereas both cap 0 and cap 1 structures were formed by the Ehrlich ascites cell enzymes. Preliminary results indicate the presence of adenine N/sup 6/-methyltransferase activity in Ehrlich ascites cells. These results indicate that mRNA deficient in 5'-cap methylation and in internal methylation of adenine accumulated in rats on exposure to ethionine. The methyl-deficient mRNA isolated from the liver of ethionine-fed rats differed in its translational properties from mRNA isolated from control animals. Preliminary experiments indicate that single topical application of 17n moles of TPA to mouse skin altered tRNA methyltransferases. The extent of methylation was increased over 2-fold in mouse skin treated with TPA for 48 hours. These changes have been observed as early as 12 hours following TPA treatment. In contrast, the application of initiating dose of DMBA had no effect on these enzymes. It should be emphasized that the changes in tRNA methyltransferases produced by TPA are not merely an increase of the concentration of the enzyme, rather that they represent alterations of specificity of a battery of enzymes. In turn the change in enzyme specificity can produce alterations in the structure of tRNA. (ERB)

  4. Aberrant silencing of the CpG island-containing human O6-methylguanine DNA methyltransferase gene is associated with the loss of nucleosome-like positioning.

    PubMed Central

    Patel, S A; Graunke, D M; Pieper, R O

    1997-01-01

    Tumor-associated aberrant silencing of CpG island-containing genes has been correlated with increased cytosine methylation, a "closed" chromatin structure, and exclusion of transcription factor binding in the CpG island/promoter regions of affected genes. Given the lack of understanding of what constitutes a closed chromatin structure in CpG islands, however, it has been difficult to assess the relationship among cytosine methylation, chromatin structure, and inappropriate gene silencing. In this study, nuclease accessibility analysis was used to more clearly define the chromatin structure in the CpG island of the human O6-methylguanine DNA methyltransferase (MGMT) gene. Chromatin structure was then related to in vivo DNA-protein interactions and cytosine methylation status of the MGMT CpG island in human glioma cells varying in MGMT expression. The results of these studies indicated that the "open" chromatin structure associated with the MGMT CpG island in MGMT+ cells consisted of an approximately 250-bp transcription factor-binding, nuclease-accessible, nucleosome-free region of DNA, whose formation was associated with at least four flanking, precisely positioned nucleosome-like structures. In MGMT- cells, this precise nucleosomal array was lost and was replaced by randomly positioned nucleosomes (i.e., the closed chromatin structure), regardless of whether methylation of the CpG island was spread over the entire island or limited to regions outside the transcription factor binding region. These results suggest that CpG islands facilitate the expression of housekeeping genes by facilitating nucleosomal positioning and that the conditions that alter the formation of this array (such as perhaps methylation) may indirectly affect CpG island-containing gene expression. PMID:9315639

  5. Association between cerebrospinal fluid dopamine concentrations and catechol-O-methyltransferase gene polymorphisms in forensic autopsy cases of methamphetamine abusers.

    PubMed

    Matsusue, Aya; Ishikawa, Takaki; Michiue, Tomomi; Waters, Brian; Hara, Kenji; Kashiwagi, Masayuki; Takayama, Mio; Ikematsu, Natsuki; Kubo, Shin-Ichi

    2017-01-01

    Methamphetamine (MA) is an illicit psychostimulant that stimulates the release of catecholamines from sympathetic nerve terminals and is widely abused worldwide. Since catechol-O-methyltransferase (COMT) metabolizes catecholamines and mediates adrenergic, noradrenergic, and dopaminergic signaling responses, we investigated the effects of the COMT polymorphisms rs4633 and rs4680 on cerebrospinal fluid (CSF) catecholamine concentrations in autopsies of subjects who died of drug intoxication. 28 MA abusers and 22 fatal psychotropic drug intoxication cases were evaluated. No correlations were identified between rs4633 or rs4680 polymorphisms and CSF concentrations of adrenaline (Adr), noradrenaline (Nad), or dopamine (DA) in fatal psychotropic cases. However, among MA abusers, DA concentrations in the CSF were significantly higher in those with the T allele (CT and TT) of rs4633 than in CC genotype carriers (p=0.004). Moreover, among MA abusers, DA concentrations were significantly higher in those with the A allele (GA and AA) of rs4680 than in GG genotype carriers (p=0.017). In subsequent haplotype analyses of MA abusers, a strong correlation was identified between two COMT haplotypes and CSF DA concentrations (p=0.002). However, the CSF concentrations of Adr and Nad were not associated with COMT genotypes or haplotypes. The present results indicate that rs4633 and rs4680 polymorphisms influence CSF DA concentrations and MA toxicity in MA abusers.

  6. Amino acid regulation of gene expression.

    PubMed Central

    Fafournoux, P; Bruhat, A; Jousse, C

    2000-01-01

    The impact of nutrients on gene expression in mammals has become an important area of research. Nevertheless, the current understanding of the amino acid-dependent control of gene expression is limited. Because amino acids have multiple and important functions, their homoeostasis has to be finely maintained. However, amino-acidaemia can be affected by certain nutritional conditions or various forms of stress. It follows that mammals have to adjust several of their physiological functions involved in the adaptation to amino acid availability by regulating the expression of numerous genes. The aim of the present review is to examine the role of amino acids in regulating mammalian gene expression and protein turnover. It has been reported that some genes involved in the control of growth or amino acid metabolism are regulated by amino acid availability. For instance, limitation of several amino acids greatly increases the expression of the genes encoding insulin-like growth factor binding protein-1, CHOP (C/EBP homologous protein, where C/EBP is CCAAT/enhancer binding protein) and asparagine synthetase. Elevated mRNA levels result from both an increase in the rate of transcription and an increase in mRNA stability. Several observations suggest that the amino acid regulation of gene expression observed in mammalian cells and the general control process described in yeast share common features. Moreover, amino acid response elements have been characterized in the promoters of the CHOP and asparagine synthetase genes. Taken together, the results discussed in the present review demonstrate that amino acids, by themselves, can, in concert with hormones, play an important role in the control of gene expression. PMID:10998343

  7. Characterization of European forage maize lines for stover composition and associations with polymorphisms within O-methyltransferase genes.

    PubMed

    Brenner, Everton A; Salazar, Andre M; Zabotina, Olga A; Lübberstedt, Thomas

    2012-04-01

    Cell wall components, such as lignin, cellulose, and hemicelluloses, play an important role in the conversion efficiency of corn stover into ethanol. Understanding the molecular basis of cell wall formation is fundamental for marker assisted selection to develop lines more suitable for ethanol production. In this study, we evaluated a set of 40 European forage maize lines for cellulose, lignin, total hemicellulose, glucuronoarabinoxylan (GAX), and monosaccharides, such as arabinose (ara), xylose (xyl), and glucuronic acid (GlcA). The most significant correlations were observed between hemicelluloses and GAX (0.9), and hemicelluloses and cellulose (-0.81). Cell wall digestibility (CWD, estimated by digestible neutral detergent fiber, DNDF) was negatively correlated with Xyl (-0.34). The association analysis between the evaluated traits and polymorphisms within ten "lignin" genes revealed significant associations between polymorphisms within CCoAOMT1, CCoAOMT2, 4CL2 and C4H, and cellulose/xyl, cellulose, cellulose, and GclA, respectively. None of the QTPs identified in this study corresponded to previously reported CWD QTPs. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  8. Association of the functional polymorphism in the catechol-O-methyltransferase gene with schizophrenia in the three ethnic groups of the Malaysian population.

    PubMed

    Wan, Ching-Lee; Zainal, Nor Zuraida; Lian, Lay-Hoong; Mohamed, Zahurin

    2011-08-30

    The catechol-O-methyltransferase (COMT) gene is a candidate gene for schizophrenia as its encoded enzyme is involved in the metabolic inactivation of dopamine and noradrenaline. Several molecular genetic studies thus far have demonstrated that the COMT functional polymorphism of Val158Met is susceptible with schizophrenia. Hence, the present study aims to determine this genetic association of this SNP in the three major ethnic groups of the Malaysian population. A total of 317 patients (79 Malays, 154 Chinese and 84 Indians) meeting DSM-IV criteria for schizophrenia and 417 healthy subjects (160 Malays, 164 Chinese and 93 Indians) were recruited. A PCR-RFLP method was used to determine the genotypes and alleles present. We found a significant association of genotypes within the total pooled samples, as well as in the female subgroup, with a higher frequency of heterozygotes in schizophrenia subjects. However, there were no significant differences in allele and genotype frequency between the schizophrenic patients and normal controls in all three ethnic groups. Our current findings suggest that the Val158Met polymorphism has a weak association with schizophrenia in the Malaysian population and does not play a major role in conferring susceptibility to the schizophrenia in any of the three major local ethnicities.

  9. DNA methyltransferases and stress-related genes expression in zebrafish larvae after exposure to heat and copper during reprogramming of DNA methylation

    PubMed Central

    Dorts, Jennifer; Falisse, Elodie; Schoofs, Emilie; Flamion, Enora; Kestemont, Patrick; Silvestre, Frédéric

    2016-01-01

    DNA methylation, a well-studied epigenetic mark, is important for gene regulation in adulthood and for development. Using genetic and epigenetic approaches, the present study aimed at evaluating the effects of heat stress and copper exposure during zebrafish early embryogenesis when patterns of DNA methylation are being established, a process called reprogramming. Embryos were exposed to 325 μg Cu/L from fertilization (<1 h post fertilization - hpf) to 4 hpf at either 26.5 °C or 34 °C, followed by incubation in clean water at 26.5 °C till 96 hpf. Significant increased mortality rates and delayed hatching were observed following exposure to combined high temperature and Cu. Secondly, both stressors, alone or in combination, significantly upregulated the expression of de novo DNA methyltransferase genes (dnmt3) along with no differences in global cytosine methylation level. Finally, Cu exposure significantly increased the expression of metallothionein (mt2) and heat shock protein (hsp70), the latter being also increased following exposure to high temperature. These results highlighted the sensitivity of early embryogenesis and more precisely of the reprogramming period to environmental challenges, in a realistic situation of combined stressors. PMID:27731414

  10. Quantitative analysis of DNA methylation in the promoter region of the methylguanine-O(6) -DNA-methyltransferase gene by COBRA and subsequent native capillary gel electrophoresis.

    PubMed

    Goedecke, Simon; Mühlisch, Jörg; Hempel, Georg; Frühwald, Michael C; Wünsch, Bernhard

    2015-12-01

    Along with histone modifications, RNA interference and delayed replication timing, DNA methylation belongs to the key processes in epigenetic regulation of gene expression. Therefore, reliable information about the methylation level of particular DNA fragments is of major interest. Herein the methylation level at two positions of the promoter region of the gene methylguanine-O(6) -DNA-Methyltransferase (MGMT) was investigated. Previously, it was demonstrated that the epigenetic status of this DNA region correlates with response to alkylating anticancer agents. An automated CGE method with LIF detection was established to separate the six DNA fragments resulting from combined bisulfite restriction analysis of the methylated and non-methylated MGMT promoter. In COBRA, the DNA was treated with bisulfite converting cytosine into uracil. During PCR uracil pairs with adenine, which changes the original recognition site of the restriction enzyme Taql. Artificial probes generated by mixing appropriate amounts of DNA after bisulfite treatment and PCR amplification were used for validation of the method. The methylation levels of these samples could be determined with high accuracy and precision. DNA samples prepared by mixing the corresponding clones first and then performing PCR amplification led to non-linear correlation between the corrected peak areas and the methylation levels. This effect is explained by slightly different PCR amplification of DNA with different sequences present in the mixture. The superiority of CGE over PAGE was clearly demonstrated. Finally, the established method was used to analyze the methylation levels of human brain tumor tissue samples.

  11. Abiotic stresses differentially affect the expression of O-methyltransferase genes related to methoxypyrazine biosynthesis in seeded and parthenocarpic fruits of Vitis vinifera (L.).

    PubMed

    Vallarino, José G; Gainza-Cortés, Felipe; Verdugo-Alegría, Claudio; González, Enrique; Moreno, Yerko M

    2014-07-01

    MPs (3-alkyl-2-methoxypyrazines) are grape-derived aroma compounds that are associated with detrimental herbaceous flavours in some wines. It is well known that several viticultural and environmental parameters can modulate MP concentrations in grapes, although comprehensive molecular studies have not been conducted in this field. Although the biosynthesis pathway of MPs has not been fully elucidated, four Vitis vinifera O-methyltransferase genes (VvOMT1-4) have been related to be involved in MP biosynthesis. We assessed whether different abiotic stresses induction have an impact on MP levels in grapes and wines from seeded and parthenocarpic fruits. Our results show that the timing of VvOMT3 expression is associated with the period of MPs accumulation in seeded fruits during both abiotic stresses, whereas no association was found in parthenocarpic fruits. These results are discussed in the context of how different viticultural practices can modulate VvOMT gene expression, which has a direct impact on MPs levels in wines. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. The de novo methyltransferases DNMT3a and DNMT3b target the murine gammaherpesvirus immediate-early gene 50 promoter during establishment of latency.

    PubMed

    Gray, Kathleen S; Forrest, J Craig; Speck, Samuel H

    2010-05-01

    The role of epigenetic modifications in the regulation of gammaherpesvirus latency has been a subject of active study for more than 20 years. DNA methylation, associated with transcriptional silencing in mammalian genomes, has been shown to be an important mechanism in the transcriptional control of several key gammaherpesvirus genes. In particular, DNA methylation of the functionally conserved immediate-early replication and transcription activator (RTA) has been shown to regulate Epstein-Barr virus and Kaposi's sarcoma-associated herpesvirus Rta expression. Here we demonstrate that the murine gammaherpesvirus (MHV68) homolog, encoded by gene 50, is also subject to direct repression by DNA methylation, both in vitro and in vivo. We observed that the treatment of latently MHV68-infected B-cell lines with a methyltransferase inhibitor induced virus reactivation. In addition, we show that the methylation of the recently characterized distal gene 50 promoter represses activity in a murine macrophage cell line. To evaluate the role of de novo methyltransferases (DNMTs) in the establishment of these methylation marks, we infected mice in which conditional DNMT3a and DNMT3b alleles were selectively deleted in B lymphocytes. DNMT3a/DNMT3b-deficient B cells were phenotypically normal, displaying no obvious compromise in cell surface marker expression or antibody production either in naïve mice or in the context of nonviral and viral immunogens. However, mice lacking functional DNMT3a and DNMT3b in B cells exhibited hallmarks of deregulated MHV68 lytic replication, including increased splenomegaly and the presence of infectious virus in the spleen at day 18 following infection. In addition, total gene 50 transcript levels were elevated in the spleens of these mice at day 18, which correlated with the hypomethylation of the distal gene 50 promoter. However, by day 42 postinfection, aberrant virus replication was resolved, and we observed wild-type frequencies of viral

  13. Mandatory fortification with folic acid in the United States is associated with increased expression of DNA methyltransferase-1 in the cervix.

    PubMed

    Piyathilake, Chandrika J; Celedonio, Jorge E; Macaluso, Maurizio; Bell, Walter C; Azrad, Maria; Grizzle, William E

    2008-01-01

    The objective of this study was to evaluate whether mandatory fortification of grain products with folic acid in the United States is associated with changes in DNA methyltransferase-1 (Dnmt-1) expression in cells involved in cervical carcinogenesis. Archived specimens of cervical intraepithelial neoplasia (CIN) diagnosed before (1990-1992) and after (2000-2002) mandatory folic acid fortification were used to examine the expression of Dnmt-1 in specific lesions involved in cervical carcinogenesis by immunohistochemistry. The total number of lesions examined was 101 in the prefortification period and 96 in the postfortification period. Immunohistochemical staining for Dnmt-1, its assessment, and data entry were blinded with regard to the fortification status. Age- and race-adjusted mean percentage of cells positive for Dnmt-1 or the Dnmt-1 score was significantly higher in all lesion types (i.e., normal cervical epithelium, reactive cervical epithelium, metaplastic cervical epithelium, CIN, or carcinoma in situ) detected in the postfortification period compared with the prefortification period (P < 0.05, all comparisons). The degree of Dnmt-1 was significantly higher (P < 0.0001) in CIN > or = 2 lesions compared with CIN < or = 1 lesions, regardless of the fortification group. These results suggest that mandatory fortification with folic acid in the United States seems to have resulted in a change in the degree of expression of Dnmt-1 in cells involved in cervical carcinogenesis. Because the approach we have taken to demonstrate these differences have limitations inherent to a study of this nature and this is the first study to report a folate fortification associated change in Dnmt-1, validating these results in other study populations and/or with other techniques of assessing Dnmt-1 will increase the scientific credibility of these findings.

  14. Co-induction of methyltransferase Rv0560c by naphthoquinones and fibric acids suggests attenuation of isoprenoid quinone action in Mycobacterium tuberculosis.

    PubMed

    Garbe, Thomas R

    2004-10-01

    The superoxide generator menadione was previously demonstrated as an inducer of growth stage dependent protein patterns in Mycobacterium tuberculosis. The present study refines this observation by characterizing a novel 27-kDa protein that had not been observed in previous studies relying on younger cultures. A very similar response, based on two-dimensional gel electrophoretic analyses, was induced by the closely related naphthoquinone plumbagin. The 27-kDa protein was also induced by the pro-oxidant peroxisome proliferator gemfibrozil and to a lesser extent by the structurally related compounds fenofibrate and clofibrate. N-terminal sequence data of proteolytic fragments from the 27-kDa protein demonstrated its identity with protein Rv0560c, previously demonstrated to be inducible by salicylate, which also possesses peroxisome proliferating properties. Protein Rv0560c bears three conserved motifs characteristic of S-adenosylmethionine-dependent methyltransferases. Further sequence similarities suggest a function in the bio syn thesis of isoprenoid compounds, e.g., tocopherol, ubiquinone, and sterols. Such involvement is supported by the recognized yet unexplained widespread interference of menadione, salicylate, and fibrates with the isoprenoid quinones ubiquinone, menaquinone, and vitamin K. Induction of Rv0560c by fibrates, salicylate, and naphthoquinones is thus suggested to be caused by action on the plasma membrane, reminiscent of cytochrome P450BM-3 induction by fibrates in Bacillus megaterium, which catalyzes the hydroxylation of fatty acids and thus modulates membrane properties.

  15. Cell-free production of integral membrane aspartic acid proteases reveals zinc-dependent methyltransferase activity of the Pseudomonas aeruginosa prepilin peptidase PilD

    PubMed Central

    Aly, Khaled A; Beebe, Emily T; Chan, Chi H; Goren, Michael A; Sepúlveda, Carolina; Makino, Shin-ichi; Fox, Brian G; Forest, Katrina T

    2013-01-01

    Integral membrane aspartic acid proteases are receiving growing recognition for their fundamental roles in cellular physiology of eukaryotes and prokaryotes, and may be medically important pharmaceutical targets. The Gram-negative Pseudomonas aeruginosa PilD and the archaeal Methanococcus voltae FlaK were synthesized in the presence of unilamellar liposomes in a cell-free translation system. Cosynthesis of PilD with its full-length substrate, PilA, or of FlaK with its full-length substrate, FlaB2, led to complete cleavage of the substrate signal peptides. Scaled-up synthesis of PilD, followed by solubilization in dodecyl-β-d-maltoside and chromatography, led to a pure enzyme that retained both of its known biochemical activities: cleavage of the PilA signal peptide and S-adenosyl methionine-dependent methylation of the mature pilin. X-ray fluorescence scans show for the first time that PilD is a zinc-binding protein. Zinc is required for the N-terminal methylation of the mature pilin, but not for signal peptide cleavage. Taken together, our work identifies the P. aeruginosa prepilin peptidase PilD as a zinc-dependent N-methyltransferase and provides a new platform for large-scale synthesis of PilD and other integral membrane proteases important for basic microbial physiology and virulence. PMID:23255525

  16. Cloning of Arabidopsis serotonin N-acetyltransferase and its role with caffeic acid O-methyltransferase in the biosynthesis of melatonin in vitro despite their different subcellular localizations.

    PubMed

    Lee, Hyoung Yool; Byeon, Yeong; Lee, Kyungjin; Lee, Hye-Jung; Back, Kyoungwhan

    2014-11-01

    Serotonin N-acetyltransferase (SNAT) is the penultimate enzyme in melatonin biosynthesis. We cloned SNAT from Arabidopsis thaliana (AtSNAT) and functionally characterized this enzyme for the first time from dicotyledonous plants. Similar to rice SNAT, AtSNAT was found to localize to chloroplasts with peak enzyme activity at 45 °C (Km , 309 μm; Vmax , 1400 pmol/min/mg protein). AtSNAT also catalyzed 5-methoxytryptamine (5-MT) into melatonin with high catalytic activity (Km , 51 μm; Vmax , 5300 pmol/min/mg protein). In contrast, Arabidopsis caffeic acid O-methyltransferase (AtCOMT) localized to the cytoplasm. Interestingly, AtCOMT can methylate serotonin into 5-MT with low catalytic activity (Km , 3.396 mm; Vmax , 528 pmol/min/mg protein). These data suggest that serotonin can be converted into either N-acetylserotonin by SNAT or into 5-MT by COMT, after which it is metabolized into melatonin by COMT or SNAT, respectively. To support this hypothesis, serotonin was incubated in the presence of both AtSNAT and AtCOMT enzymes. In addition to melatonin production, the production of major intermediates depended on incubation temperatures; N-acetylserotonin was predominantly produced at high temperatures (45 °C), while low temperatures (37 °C) favored the production of 5-MT. Our results provide biochemical evidence for the presence of a serotonin O-methylation pathway in plant melatonin biosynthesis.

  17. Designs for the self-assembly of open and closed macromolecular structures and a molecular switch using DNA methyltransferases to order proteins on nucleic acid scaffolds

    NASA Astrophysics Data System (ADS)

    Smith, Steven S.

    2002-06-01

    The methyltransferase-directed addressing of fusion proteins to DNA scaffolds offers an approach to the construction of protein/nucleic acid biostructures with potential in a variety of applications. The technology is currently only limited by the yield of high occupancy structures. However, current evidence shows that DNA scaffolds that contain three or four targeted proteins can be reliably constructed. This permits a variety of macromolecular designs, several of which are given in this paper. Designs for open and closed two-dimensional and three-dimensional assemblies and a design for a molecular switch are discussed. The closed two-dimensional assembly takes the form of a square, and could find application as a component of other systems including a macromolecular rotaxane. The closed three-dimensional system takes the form of a trigonal bipyramid and could find application as a macromolecular carcerand. The molecular switch could find application as a peptide biosensor. Guidelines for the construction and structural verification of these designs are reported.

  18. Polymorphisms in Methionine Synthase Reductase and Betaine-Homocysteine S-Methyltransferase Genes: Risk of Placental Abruption

    PubMed Central

    Ananth, Cande V.; Elsasser, Denise; Kinzler, Wendy L.; Peltier, Morgan R.; Getahun, Darios; Leclerc, Daniel; Rozen, Rima R.

    2007-01-01

    Objective Methionine Synthase Reductase (MTRR) and Betaine-Homocysteine S-Methyltransferase (BHMT) are 2 enzymes that regulate homocysteine metabolism. Elevated homocysteine (hyperhomocysteinemia) is associated with adverse pregnancy outcomes and vascular disease. We assessed whether polymorphisms in MTRR (66A→G; I22M) and BHMT (742G→A; R239Q) were associated with abruption. We further evaluated whether homocysteine levels differed between cases and controls for MTRR and BHMT genotypes. Methods Data were derived from the New Jersey Placental Abruption Study (NJ-PAS)—an ongoing, multicenter, case-control study since August 2002. Women with a clinical diagnosis of abruption were recruited as incident cases (n=196), and controls (n=191) were matched to cases based on maternal race/ethnicity and parity. Total plasma homocysteine concentrations were evaluated in a subset of 136 cases and 136 controls. DNA was genotyped for the MTRR and BHMT polymorphisms. Results Frequencies of the minor allele of MTRR were 40.8% and 42.2% in cases and controls, respectively (adjusted OR 0.79, 95% CI 0.45, 1.40). The corresponding rates for BHMT were 33.9% and 31.7%, respectively (adjusted OR 1.93, 95% CI 0.99, 4.09). Distributions for the homozygous mutant form of MTRR were similar between cases and controls (OR 1.18, 95% CI 0.62, 2.24). The rate of homozygous mutant BHMT genotype was 2.8-fold (OR 2.82, 95% CI 1.84, 4.97) higher in cases than controls. Stratification of analyses based on maternal race did not reveal any patterns in association. Conclusions In this population, there was an association between the homozygous mutant form of BHMT (742G→A) polymorphism and increased risk for placental abruption. PMID:17376725

  19. Glucocorticoid-dependent expression of O(6)-methylguanine-DNA methyltransferase gene modulates dacarbazine-induced hepatotoxicity in mice.

    PubMed

    Horiguchi, Michiko; Kim, Jahye; Matsunaga, Naoya; Kaji, Hiroaki; Egawa, Takashi; Makino, Kazutaka; Koyanagi, Satoru; Ohdo, Shigehiro

    2010-06-01

    O(6)-methylguanine-DNA methyltransferase (MGMT) plays a crucial role in the defense against the alkylating agent-induced cytotoxic lesion O(6)-alkylguanine in DNA. Although a significant circadian variation in MGMT activity has been found in the liver of mice, the exact mechanism of the variation remains poorly understood. In this study, we present evidence that glucocorticoids were required for the 24-h oscillation of MGMT expression in mouse liver. The exposure of mouse hepatic cells (Hepa1-6) to dexamethasone (DEX) significantly increased the mRNA levels of MGMT in a dose-dependent manner. The DEX-induced increase in MGMT expression was reversed by concomitant treatment with RU486 [11beta-[p-(dimethylamino) phenyl]-17beta-hydroxy-17-(1-propynyl)estra-4,9-dien-3-one], a glucocorticoid receptor antagonist. The mRNA levels of MGMT and its enzymatic activity in the liver of mice showed significant 24-h oscillations, which were not observed in adrenalectomized mice. A single administration of DEX to adrenalectomized mice significantly increased the mRNA levels of MGMT in the liver. These findings suggest that the 24-h oscillation in the hepatic expression of MGMT is caused by the endogenous rhythm of glucocorticoid secretion. Dacarbazine (DTIC), a potent O(6)-guanine-alkylating agent, causes serious hepatotoxicity accompanied by hepatocellular necrosis and hepatic vein thrombosis. DTIC-induced hepatotoxicity in mice was attenuated by administering the drug at the time of day when MGMT expression was abundant. The present findings suggest that glucocorticoid-regulated oscillation in the hepatic MGMT expression is the underlying cause of dosing time-dependent changes in DTIC-induced hepatotoxicity.

  20. Characterization of the Staphylococcus aureus rRNA methyltransferase encoded by orfX, the gene containing the staphylococcal chromosome Cassette mec (SCCmec) insertion site.

    PubMed

    Boundy, Sam; Safo, Martin K; Wang, Lei; Musayev, Faik N; O'Farrell, Heather C; Rife, Jason P; Archer, Gordon L

    2013-01-04

    The gene orfX is conserved among all staphylococci, and its complete sequence is maintained upon insertion of the staphylococcal chromosome cassette mec (SCCmec) genomic island, containing the gene encoding resistance to β-lactam antibiotics (mecA), into its C terminus. The function of OrfX has not been determined. We show that OrfX was constitutively produced during growth, that orfX could be inactivated without altering bacterial growth, and that insertion of SCCmec did not alter gene expression. We solved the crystal structure of OrfX at 1.7 Å and found that it belongs to the S-adenosyl-L-methionine (AdoMet)-dependent α/β-knot superfamily of SPOUT methyltransferases (MTases), with a high structural homology to YbeA, the gene product of the Escherichia coli 70 S ribosomal MTase RlmH. MTase activity was confirmed by demonstrating the OrfX-dependent methylation of the Staphylococcus aureus 70 S ribosome. When OrfX was crystallized in the presence of its AdoMet substrate, we found that each monomer of the homodimeric structure bound AdoMet in its active site. Solution studies using isothermal titration calorimetry confirmed that each monomer bound AdoMet but with different binding affinities (K(d) = 52 ± 0.4 and 606 ± 2 μm). In addition, the structure shows that the AdoMet-binding pocket, formed by a deep trefoil knot, contains a bound phosphate molecule, which is the likely nucleotide methylation site. This study represents the first characterization of a staphylococcal ribosomal MTase and provides the first crystal structure of a member of the α/β-knot superfamily of SPOUT MTases in the RlmH or COG1576 family with bound AdoMet.

  1. Regulation of the DNA Damage Response and Gene Expression by the Dot1L Histone Methyltransferase and the 53Bp1 Tumour Suppressor

    PubMed Central

    FitzGerald, Jennifer; Moureau, Sylvie; Drogaris, Paul; O'Connell, Enda; Abshiru, Nebiyu; Verreault, Alain; Thibault, Pierre; Grenon, Muriel; Lowndes, Noel F.

    2011-01-01

    Background Dot1L, a histone methyltransferase that targets histone H3 lysine 79 (H3K79), has been implicated in gene regulation and the DNA damage response although its functions in these processes remain poorly defined. Methodology/Principal Findings Using the chicken DT40 model system, we generated cells in which the Dot1L gene is disrupted to examine the function and focal recruitment of the 53Bp1 DNA damage response protein. Detailed kinetic and dose response assays demonstrate that, despite the absence of H3K79 methylation demonstrated by mass spectrometry, 53Bp1 focal recruitment is not compromised in these cells. We also describe, for the first time, the phenotypes of a cell line lacking both Dot1L and 53Bp1. Dot1L−/− and wild type cells are equally resistant to ionising radiation, whereas 53Bp1−/−/Dot1L−/− cells display a striking DNA damage resistance phenotype. Dot1L and 53Bp1 also affect the expression of many genes. Loss of Dot1L activity dramatically alters the mRNA levels of over 1200 genes involved in diverse biological functions. These results, combined with the previously reported list of differentially expressed genes in mouse ES cells knocked down for Dot1L, demonstrates surprising cell type and species conservation of Dot1L-dependent gene expression. In 53Bp1−/− cells, over 300 genes, many with functions in immune responses and apoptosis, were differentially expressed. To date, this is the first global analysis of gene expression in a 53Bp1-deficient cell line. Conclusions/Significance Taken together, our results uncover a negative role for Dot1L and H3K79 methylation in the DNA damage response in the absence of 53Bp1. They also enlighten the roles of Dot1L and 53Bp1 in gene expression and the control of DNA double-strand repair pathways in the context of chromatin. PMID:21383990

  2. Obstructive heart defects associated with candidate genes, maternal obesity, and folic acid supplementation.

    PubMed

    Tang, Xinyu; Cleves, Mario A; Nick, Todd G; Li, Ming; MacLeod, Stewart L; Erickson, Stephen W; Li, Jingyun; Shaw, Gary M; Mosley, Bridget S; Hobbs, Charlotte A

    2015-06-01

    Right-sided and left-sided obstructive heart defects (OHDs) are subtypes of congenital heart defects, in which the heart valves, arteries, or veins are abnormally narrow or blocked. Previous studies have suggested that the development of OHDs involved a complex interplay between genetic variants and maternal factors. Using the data from 569 OHD case families and 1,644 control families enrolled in the National Birth Defects Prevention Study (NBDPS) between 1997 and 2008, we conducted an analysis to investigate the genetic effects of 877 single nucleotide polymorphisms (SNPs) in 60 candidate genes for association with the risk of OHDs, and their interactions with maternal use of folic acid supplements, and pre-pregnancy obesity. Applying log-linear models based on the hybrid design, we identified a SNP in methylenetetrahydrofolate reductase (MTHFR) gene (C677T polymorphism) with a main genetic effect on the occurrence of OHDs. In addition, multiple SNPs in betaine-homocysteine methyltransferase (BHMT and BHMT2) were also identified to be associated with the occurrence of OHDs through significant main infant genetic effects and interaction effects with maternal use of folic acid supplements. We also identified multiple SNPs in glutamate-cysteine ligase, catalytic subunit (GCLC) and DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B) that were associated with elevated risk of OHDs among obese women. Our findings suggested that the risk of OHDs was closely related to a combined effect of variations in genes in the folate, homocysteine, or glutathione/transsulfuration pathways, maternal use of folic acid supplements and pre-pregnancy obesity. © 2015 Wiley Periodicals, Inc.

  3. Lipoic acid inhibits the DNA repair protein O 6-methylguanine-DNA methyltransferase (MGMT) and triggers its depletion in colorectal cancer cells with concomitant autophagy induction.

    PubMed

    Göder, Anja; Nagel, Georg; Kraus, Alexander; Dörsam, Bastian; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg

    2015-08-01

    Alkylating agents are present in food and tobacco smoke, but are also used in cancer chemotherapy, inducing the DNA lesion O (6)-methylguanine. This critical adduct is repaired by O (6)-methylguanine-DNA methyltransferase (MGMT), resulting in MGMT inactivation and degradation. In the present study, we analyzed the effects of the natural disulfide compound lipoic acid (LA) on MGMT in vitro and in colorectal cancer cells. We show that LA, but not its reduced form dihydrolipoic acid, potently inhibits the activity of recombinant MGMT by interfering with its catalytic Cys-145 residue, which was partially reversible by N-acetyl cysteine. Incubation of HCT116 colorectal cancer cells with LA altered their glutathione pool and caused a decline in MGMT activity. This was mirrored by LA-induced depletion of MGMT protein, which was not attributable to changes in MGMT messenger RNA levels. Loss of MGMT protein coincided with LA-induced autophagy, a process resulting in lysosomal degradation of proteins, including presumably MGMT. LA-stimulated autophagy in a p53-independent manner as revealed by the response of isogenic HCT116 cell lines. Knockdown of the crucial autophagy component beclin-1 and chemical inhibitors blocked LA-induced autophagy, but did not abrogate LA-triggered MGMT degradation. Concomitant with MGMT depletion, LA pretreatment resulted in enhanced O (6)-methylguanine levels in DNA. It also increased the cytotoxicity of the alkylating anticancer drug temozolomide in temozolomide-resistant colorectal cancer cells. Taken together, our study showed that the natural compound LA inhibits MGMT and induces autophagy. Furthermore, LA enhanced the cytotoxic effects of temozolomide, which makes it a candidate for a supplement in cancer therapy.

  4. A New Class of Quinoline-Based DNA Hypomethylating Agents Reactivates Tumor Suppressor Genes by Blocking DNA Methyltransferase 1 Activity and Inducing Its Degradation

    PubMed Central

    Datta, Jharna; Ghoshal, Kalpana; Denny, William A.; Gamage, Swarna A.; Brooke, Darby G.; Phiasivongsa, Pasit; Redkar, Sanjeev; Jacob, Samson T.

    2010-01-01

    Reactivation of silenced tumor suppressor genes by 5-azacytidine (Vidaza) and its congener 5-aza-2′-deoxycytidine (decitabine) has provided an alternate approach to cancer therapy. We have shown previously that these drugs selectively and rapidly induce degradation of the maintenance DNA methyltransferase (DNMT) 1 by a proteasomal pathway. Because the toxicity of these compounds is largely due to their incorporation into DNA, it is critical to explore novel, nonnucleoside compounds that can effectively reactivate the silenced genes. Here, we report that a quinoline-based compound, designated SGI-1027, inhibits the activity of DNMT1, DNMT3A, and DNMT3B as well M. SssI with comparable IC50 (6–13 µ mol/L) by competing with S-adenosylmethionine in the methylation reaction. Treatment of different cancer cell lines with SGI-1027 resulted in selective degradation of DNMT1 with minimal or no effects on DNMT3A and DNMT3B. At a concentration of 2.5 to 5 µmol/L (similar to that of decitabine), complete degradation of DNMT1 protein was achieved within 24 h without significantly affecting its mRNA level. MG132 blocked SGI-1027–induced depletion of DNMT1, indicating the involvement of proteasomal pathway. Prolonged treatment of RKO cells with SGI-1027 led to demethylation and reexpression of the silenced tumor suppressor genes P16, MLH1, and TIMP3. Further, this compound did not exhibit significant toxicity in a rat hepatoma (H4IIE) cell line. This study provides a novel class of DNA hypomethylating agents that have the potential for use in epigenetic cancer therapy. PMID:19417133

  5. Methoxypyrazine Accumulation and O-Methyltransferase Gene Expression in Sauvignon blanc Grapes: The Role of Leaf Removal, Light Exposure, and Berry Development.

    PubMed

    Gregan, Scott M; Jordan, Brian

    2016-03-23

    Methoxypyrazines are present in the grapes of certain Vitis vinifera varieties including Sauvignon blanc and contribute herbaceous/green aromas to wine. Environmental factors such as light exposure and temperature can influence methoxypyrazine levels, and viticultural interventions such as canopy manipulation have the ability to reduce methoxypyrazine accumulation in grapes. We assessed methoxypyrazine levels and showed that leaf removal significantly reduces accumulation in Sauvignon blanc grapes. The main effect of reducing methoxypyrazines was preveraison, as postveraison treatments had no effect on concentrations at harvest. Methoxypyrazine concentrations in controls peaked preveraison and decreased through harvest. Dilution due to an increase in berry weight was found to be the major driver of decreasing concentrations, as methoxypyrazine levels on a per berry basis were found to increase through development in two of three seasons. In the one year of our study that showed contrasting results, analyses of weather data indicate that warmer than average temperatures appear to be the principal factor affecting the berries' ability to accumulate and retain methoxypyrazines. We also explored the expression of potential biosynthetic O-methyltransferase genes VvOMT1, VvOMT2, and VvOMT3; no significant differences were observed with respect to effect of leaf removal and light exposure.

  6. Novel single nucleotide polymorphisms of the bovine methyltransferase 3b gene and their association with meat quality traits in beef cattle.

    PubMed

    Liu, X; Guo, X Y; Xu, X Z; Wu, M; Zhang, X; Li, Q; Ma, P P; Zhang, Y; Wang, C Y; Geng, F J; Qin, C H; Liu, L; Shi, W H; Wang, Y C; Yu, Y

    2012-08-16

    DNA methylation is essential for adipose deposition in mammals. We screened SNPs of the bovine DNA methyltransferase 3b (DNMT3b) gene in Snow Dragon beef, a commercial beef cattle population in China. Nine SNPs were found in the population and three of six novel SNPs were chosen for genotyping and analyzing a possible association with 16 meat quality traits. The frequencies of the alleles and genotypes of the three SNPs in Snow Dragon beef were similar to those in their terminal-paternal breed, Wagyu. Association analysis disclosed that SNP1 was not associated with any of the traits; SNP2 was significantly associated with lean meat color score and chuck short rib score, and SNP3 had a significant effect on dressing percentage and back-fat thickness in the beef population. The individuals with genotype GG for SNP2 had a 25.7% increase in lean meat color score and a 146% increase in chuck short rib score, compared with genotype AA. The cattle with genotype AG for SNP3 had 35.7 and 24% increases in dressing percentage and 28.8 and 29.2% increases in back-fat thickness, compared with genotypes GG and AA, respectively. Genotypic combination analysis revealed significant interactions between SNP1 and SNP2 and between SNP2 and SNP3 for the traits rib-eye area and live weight. We conclude that there is considerable evidence that DNMT3b is a determiner of beef quality traits.

  7. Transfer and targeted overexpression of γ-tocopherol methyltransferase (γ-TMT) gene using seed-specific promoter improves tocopherol composition in Indian soybean cultivars.

    PubMed

    Arun, Muthukrishnan; Subramanyam, Kondeti; Theboral, Jeevaraj; Sivanandhan, Ganeshan; Rajesh, Manoharan; Kapil Dev, Gnanajothi; Jaganath, Balusamy; Manickavasagam, Markandan; Girija, Shanmugam; Ganapathi, Andy

    2014-02-01

    Soybean oil contains high levels of tocopherols which are an important source of vitamin E in human diet. The conversion of γ- to α-tocopherol catalyzed by γ-tocopherol methyltransferase (γ-TMT) is found to be the rate limiting factor in soybean which influences the tocopherol composition. Using Agrobacterium-mediated transformation, we overexpressed the γ-TMT gene of Perilla frutescens under the control of the seed-specific promoter vicillin in cultivar Pusa 16. Transgene integration and expression was confirmed in five independently transformed GUS positive soybean plants by polymerase chain reaction (PCR), Southern hybridization, and reverse transcriptase-PCR (RT-PCR). High-performance liquid chromatography (HPLC) analysis showed that overexpression of Pf-γ-TMT resulted in efficient conversion of γ-tocopherol to α-tocopherol and concomitant increase in seed α-tocopherol content in RT-PCR positive plants. The protocol was successfully applied to three more cultivars PK 416, Gujarat soybean 1, and VL soya 1 in which seeds of transformed plants showed elevated level of α-tocopherol than wild-type seeds.

  8. Polymorphisms in catechol-O-methyltransferase and cytochrome p450 subfamily 19 genes predispose towards Madurella mycetomatis-induced mycetoma susceptibility.

    PubMed

    van de Sande, Wendy W J; Fahal, Ahmed; Tavakol, Mehri; van Belkum, Alex

    2010-11-01

    Mycetoma caused by Madurella mycetomatis is a devastating and neglected disease which primarily affects males. Since this predominance cannot be easily explained by behaviour differences between men and women, other factors, including sex hormones, could be the cause. To monitor for possible deficiencies in hormone synthesis among mycetoma patients, we investigated the types and allele frequencies of the genes encoding for catechol-O-methyltransferase (COMT), cytochrome p450 subfamily 1 (CYP1B1), cytochrome p450 subfamily 17 (CYP17), cytochrome p450 subfamily 19 (CYP19) and hydroxysteroid dehydrogenase 3B (HSD3B). Significant differences in allele distribution were demonstrated for CYP19 (P=0.004) and COMT (P=0.005), as well as gender dimorphism for both CYP19 and COMT polymorphisms. The COMT polymorphism was associated with lesion size. The genotypes obtained for COMT and CYP19 were connected with higher 17β-estradiol production, which was confirmed by significantly elevated serum levels of 17β-estradiol in male patients. In contrast, lowered levels of dehydroepiandrosteron (DHEA) were found in mycetoma patients. The in vitro growth of M. mycetomatis was not influenced by 17β-estradiol, progesterone, DHEA and testosterone. The differences in hormone levels we noted between mycetoma patients and healthy controls did not directly affect the fungus itself. Indirect effects on the patients' hormone regulated immune states are the more likely explanations for mycetoma susceptibility.

  9. Protein arginine Methyltransferase 8 gene is expressed in pluripotent stem cells and its expression is modulated by the transcription factor Sox2.

    PubMed

    Solari, Claudia; Echegaray, Camila Vázquez; Luzzani, Carlos; Cosentino, María Soledad; Waisman, Ariel; Petrone, María Victoria; Francia, Marcos; Sassone, Alina; Canizo, Jésica; Sevlever, Gustavo; Barañao, Lino; Miriuka, Santiago; Guberman, Alejandra

    2016-04-22

    Addition of methyl groups to arginine residues is catalyzed by a group of enzymes called Protein Arginine Methyltransferases (Prmt). Although Prmt1 is essential in development, its paralogue Prmt8 has been poorly studied. This gene was reported to be expressed in nervous system and involved in neurogenesis. In this work, we found that Prmt8 is expressed in mouse embryonic stem cells (ESC) and in induced pluripotent stem cells, and modulated along differentiation to neural precursor cells. We found that Prmt8 promoter activity is induced by the pluripotency transcription factors Oct4, Sox2 and Nanog. Moreover, endogenous Prmt8 mRNA levels were reduced in ESC transfected with Sox2 shRNA vector. As a whole, our results indicate that Prmt8 is expressed in pluripotent stem cells and its transcription is modulated by pluripotency transcription factors. These findings suggest that besides its known function in nervous system, Prmt8 could play a role in pluripotent stem cells. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Synthesis of Lysine Methyltransferase Inhibitors

    NASA Astrophysics Data System (ADS)

    Ye, Tao; Hui, Chunngai

    2015-07-01

    Lysine methyltransferase which catalyze methylation of histone and nonhistone proteins, play a crucial role in diverse biological processes and has emerged as a promising target for the development of various human diseases, including cancer, inflammation, and psychiatric disorders. However, inhibiting Lysine methyltransferases selectively has presented many challenges to medicinal chemists. During the past decade, lysine methyltransferase inhibitors covering many different structural classes have been designed and developed. In this review, we describe the development of selective, small-molecule inhibitors of lysine methyltransferases with an emphasis on their discovery and chemical synthesis. We highlight the current state of lysine methyltransferase inhibitors and discuss future directions and opportunities for lysine methyltransferase inhibitor discovery.

  11. Cloning and Characterization of a Norbelladine 4′-O-Methyltransferase Involved in the Biosynthesis of the Alzheimer’s Drug Galanthamine in Narcissus sp. aff. pseudonarcissus

    PubMed Central

    Kilgore, Matthew B.; Augustin, Megan M.; Starks, Courtney M.; O’Neil-Johnson, Mark; May, Gregory D.; Crow, John A.; Kutchan, Toni M.

    2014-01-01

    Galanthamine is an Amaryllidaceae alkaloid used to treat the symptoms of Alzheimer’s disease. This compound is primarily isolated from daffodil (Narcissus spp.), snowdrop (Galanthus spp.), and summer snowflake (Leucojum aestivum). Despite its importance as a medicine, no genes involved in the biosynthetic pathway of galanthamine have been identified. This absence of genetic information on biosynthetic pathways is a limiting factor in the development of synthetic biology platforms for many important botanical medicines. The paucity of information is largely due to the limitations of traditional methods for finding biochemical pathway enzymes and genes in non-model organisms. A new bioinformatic approach using several recent technological improvements was applied to search for genes in the proposed galanthamine biosynthetic pathway, first targeting methyltransferases due to strong signature amino acid sequences in the proteins. Using Illumina sequencing, a de novo transcriptome assembly was constructed for daffodil. BLAST was used to identify sequences that contain signatures for plant O-methyltransferases in this transcriptome. The program HAYSTACK was then used to identify methyltransferases that fit a model for galanthamine biosynthesis in leaf, bulb and inflorescence tissues. One candidate gene for the methylation of norbelladine to 4′-O-methylnorbelladine in the proposed galanthamine biosynthetic pathway was identified. This methyltransferase cDNA was expressed in E. coli and the protein purified by affinity chromatography. The resulting protein was found to be a norbelladine 4′-O-methyltransferase (NpN4OMT) of the proposed galanthamine biosynthetic pathway. PMID:25061748

  12. Cloning and characterization of a norbelladine 4'-O-methyltransferase involved in the biosynthesis of the Alzheimer's drug galanthamine in Narcissus sp. aff. pseudonarcissus.

    PubMed

    Kilgore, Matthew B; Augustin, Megan M; Starks, Courtney M; O'Neil-Johnson, Mark; May, Gregory D; Crow, John A; Kutchan, Toni M

    2014-01-01

    Galanthamine is an Amaryllidaceae alkaloid used to treat the symptoms of Alzheimer's disease. This compound is primarily isolated from daffodil (Narcissus spp.), snowdrop (Galanthus spp.), and summer snowflake (Leucojum aestivum). Despite its importance as a medicine, no genes involved in the biosynthetic pathway of galanthamine have been identified. This absence of genetic information on biosynthetic pathways is a limiting factor in the development of synthetic biology platforms for many important botanical medicines. The paucity of information is largely due to the limitations of traditional methods for finding biochemical pathway enzymes and genes in non-model organisms. A new bioinformatic approach using several recent technological improvements was applied to search for genes in the proposed galanthamine biosynthetic pathway, first targeting methyltransferases due to strong signature amino acid sequences in the proteins. Using Illumina sequencing, a de novo transcriptome assembly was constructed for daffodil. BLAST was used to identify sequences that contain signatures for plant O-methyltransferases in this transcriptome. The program HAYSTACK was then used to identify methyltransferases that fit a model for galanthamine biosynthesis in leaf, bulb and inflorescence tissues. One candidate gene for the methylation of norbelladine to 4'-O-methylnorbelladine in the proposed galanthamine biosynthetic pathway was identified. This methyltransferase cDNA was expressed in E. coli and the protein purified by affinity chromatography. The resulting protein was found to be a norbelladine 4'-O-methyltransferase (NpN4OMT) of the proposed galanthamine biosynthetic pathway.

  13. Chemical Probes of Histone Lysine Methyltransferases

    PubMed Central

    2015-01-01

    Growing evidence suggests that histone methyltransferases (HMTs, also known as protein methyltransferases (PMTs)) play an important role in diverse biological processes and human diseases by regulating gene expression and the chromatin state. Therefore, HMTs have been increasingly recognized by the biomedical community as a class of potential therapeutic targets. High quality chemical probes of HMTs, as tools for deciphering their physiological functions and roles in human diseases and testing therapeutic hypotheses, are critical for advancing this promising field. In this review, we focus on the discovery, characterization, and biological applications of chemical probes for HMTs. PMID:25423077

  14. Chemical probes of histone lysine methyltransferases.

    PubMed

    Kaniskan, H Ümit; Jin, Jian

    2015-01-16

    Growing evidence suggests that histone methyltransferases (HMTs, also known as protein methyltransferases (PMTs)) play an important role in diverse biological processes and human diseases by regulating gene expression and the chromatin state. Therefore, HMTs have been increasingly recognized by the biomedical community as a class of potential therapeutic targets. High quality chemical probes of HMTs, as tools for deciphering their physiological functions and roles in human diseases and testing therapeutic hypotheses, are critical for advancing this promising field. In this review, we focus on the discovery, characterization, and biological applications of chemical probes for HMTs.

  15. A Tetrahydrofolate-Dependent Methyltransferase Catalyzing the Demethylation of Dicamba in Sphingomonas sp. Strain Ndbn-20

    PubMed Central

    Yao, Li; Yu, Lin-Lu; Zhang, Jun-Jie; Xie, Xiang-Ting; Tao, Qing; Yan, Xin; Hong, Qing; Qiu, Ji-Guo

    2016-01-01

    ABSTRACT Sphingomonas sp. strain Ndbn-20 degrades and utilizes the herbicide dicamba as its sole carbon and energy source. In the present study, a tetrahydrofolate (THF)-dependent dicamba methyltransferase gene, dmt, was cloned from the strain, and three other genes, metF, dhc, and purU, which are involved in THF metabolism, were found to be located downstream of dmt. A transcriptional study revealed that the four genes constituted one transcriptional unit that was constitutively transcribed. Lysates of cells grown with glucose or dicamba exhibited almost the same activities, which further suggested that the dmt gene is constitutively expressed in the strain. Dmt shared 46% and 45% identities with the methyltransferases DesA and LigM from Sphingomonas paucimobilis SYK-6, respectively. The purified Dmt catalyzed the transfer of methyl from dicamba to THF to form the herbicidally inactive metabolite 3,6-dichlorosalicylic acid (DCSA) and 5-methyl-THF. The activity of Dmt was inhibited by 5-methyl-THF but not by DCSA. The introduction of a codon-optimized dmt gene into Arabidopsis thaliana enhanced resistance against dicamba. In conclusion, this study identified a THF-dependent dicamba methyltransferase, Dmt, with potential applications for the genetic engineering of dicamba-resistant crops. IMPORTANCE Dicamba is a very important herbicide that is widely used to control more than 200 types of broadleaf weeds and is a suitable target herbicide for the engineering of herbicide-resistant transgenic crops. A study of the mechanism of dicamba metabolism by soil microorganisms will benefit studies of its dissipation, transformation, and migration in the environment. This study identified a THF-dependent methyltransferase, Dmt, capable of catalyzing dicamba demethylation in Sphingomonas sp. Ndbn-20, and a preliminary study of its enzymatic characteristics was performed. Introduction of a codon-optimized dmt gene into Arabidopsis thaliana enhanced resistance against dicamba

  16. Catechol-O-methyltransferase gene variants may associate with negative symptom response and plasma concentrations of prolactin in schizophrenia after amisulpride treatment.

    PubMed

    Chen, Chun-Yen; Yeh, Yi-Wei; Kuo, Shin-Chang; Ho, Pei-Shen; Liang, Chih-Sung; Yen, Che-Hung; Lu, Ru-Band; Huang, San-Yuan

    2016-03-01

    Catechol-O-methyltransferase (COMT) enzyme is involved in the pathogenesis of psychotic symptoms and may be associated with a therapeutic response to antipsychotic drugs. The aim of this study was to examine the relationship between COMT variants, plasma prolactin level, and the therapeutic effectiveness of amisulpride treatment in patients with schizophrenia. A 12-week naturalistic study of amisulpride treatment was carried out in 185 Han Chinese patients with schizophrenia. The patients were screened for 14 single-nucleotide polymorphisms of the COMT gene. The Positive and Negative Syndrome Scale (PANSS) was used to assess the improvement of psychopathological symptoms from the baseline to the end point in each subject. For better presentation of time-course changes in response status, a mixed model for repeated-measures (MMRM) analysis of symptom improvement during the 12-week treatment period was conducted. The change in plasma prolactin level after amisulpride treatment was also examined (n=51). No significant differences in the genotype frequencies of the COMT variants investigated were observed between responders and non-responders. Moreover, an MMRM analysis of psychopathological symptom improvement during the 12-week treatment course showed that it depended significantly on COMT variants (rs4680, rs4633, and rs6267), particularly regarding changes in negative symptoms. The increase in plasma prolactin levels observed was influenced by the COMT rs4680 variant and was positively correlated with a reduction in PANSS negative scores. Our results suggest that variation of the COMT gene is associated with treatment response regarding negative symptoms and prolactin changes after amisulpride treatment in patients with schizophrenia.

  17. Effect of Catechol-O-methyltransferase-gene (COMT) Variants on Experimental and Acute Postoperative Pain in 1,000 Women undergoing Surgery for Breast Cancer

    PubMed Central

    Kambur, Oleg; Kaunisto, Mari A.; Tikkanen, Emmi; Leal, Suzanne M.; Ripatti, Samuli; Kalso, Eija A.

    2016-01-01

    Background Catechol-O-methyltransferase (COMT) metabolizes catecholamines in different tissues. Polymorphisms in COMT gene can attenuate COMT activity and increase sensitivity to pain. Human studies exploring the effect of COMT polymorphisms on pain sensitivity have mostly included small, heterogeneous samples and have ignored several important single nucleotide polymorphisms (SNPs). This study examines the effect of COMT polymorphisms on experimental and postoperative pain phenotypes in a large ethnically homogeneous female patient cohort. Methods Intensity of cold (+2–4°C) and heat (+48°C) pain and tolerance to cold pain were assessed in 1,000 patients scheduled for breast cancer surgery. Acute postoperative pain and oxycodone requirements were recorded. Twenty-two COMT SNPs were genotyped and their association with six pain phenotypes analyzed with linear regression. Results There was no association between any of the tested pain phenotypes and SNP rs4680. The strongest association signals were seen between rs165774 and heat pain intensity as well as rs887200 and cold pain intensity. In both cases, minor allele carriers reported less pain. Neither of these results remained significant after strict multiple testing corrections. When analyzed further, the effect of rs887200 was, however, shown to be significant and consistent throughout the cold pressure test. No evidence of association between the SNPs and postoperative oxycodone consumption was found. Conclusions SNPs rs887200 and rs165774 located in the untranslated regions of the gene had the strongest effects on pain sensitivity. Their effect on pain is described here for the first time. These results should be confirmed in further studies and the potential functional mechanisms of the variants studied. PMID:24343288

  18. How to consistently link extraversion and intelligence to the catechol-O-methyltransferase (COMT) gene: on defining and measuring psychological phenotypes in neurogenetic research.

    PubMed

    Wacker, Jan; Mueller, Erik M; Hennig, Jürgen; Stemmler, Gerhard

    2012-02-01

    The evidence for associations between genetic polymorphisms and complex behavioral/psychological phenotypes (traits) has thus far been weak and inconsistent. Using the well-studied Val158Met polymorphism of the catechol-O-methyltransferase (COMT) gene as an example, we demonstrate that using theoretical models to guide phenotype definition and measuring the phenotypes of interest with a high degree of specificity reveals strong gene-behavior associations that are consistent with prior work and that would have otherwise gone unnoticed. Only after statistically controlling for irrelevant portions of phenotype variance did we observe strong (Cohen's d = 0.33-0.70) and significant associations between COMT Val158Met and both cognitive and affective traits in a healthy male sample (N = 201) in Study 1: Carriers of the Met allele scored higher in fluid intelligence (reasoning) but lower in both crystallized intelligence (general knowledge) and the agency facet of extraversion. In Study 2, we conceptually replicated the association of COMT Val158Met with the agency facet of extraversion after partialing irrelevant phenotype variance in a female sample (N = 565). Finally, through reanalysis of a large published data set we showed that Met allele carriers also scored higher in indicators of fluid intelligence after partialing verbal fluency. Because the Met allele codes for a less efficient variant of the enzyme COMT, resulting in higher levels of extrasynaptic prefrontal dopamine, these observations provide further support for a role for dopamine in both intelligence and extraversion. More importantly, the present findings have important implications for the definition of psychological phenotypes in neurogenetic research.

  19. TALEN mediated targeted mutagenesis of the caffeic acid O-methyltransferase in highly polyploid sugarcane improves cell wall composition for production of bioethanol.

    PubMed

    Jung, Je Hyeong; Altpeter, Fredy

    2016-09-01

    Sugarcane (Saccharum spp. hybrids) is a prime crop for commercial biofuel production. Advanced conversion technology utilizes both, sucrose accumulating in sugarcane stems as well as cell wall bound sugars for commercial ethanol production. Reduction of lignin content significantly improves the conversion of lignocellulosic biomass into ethanol. Conventional mutagenesis is not expected to confer reduction in lignin content in sugarcane due to its high polyploidy (x = 10-13) and functional redundancy among homo(eo)logs. Here we deploy transcription activator-like effector nuclease (TALEN) to induce mutations in a highly conserved region of the caffeic acid O-methyltransferase (COMT) of sugarcane. Capillary electrophoresis (CE) was validated by pyrosequencing as reliable and inexpensive high throughput method for identification and quantitative characterization of TALEN mediated mutations. Targeted COMT mutations were identified by CE in up to 74 % of the lines. In different events 8-99 % of the wild type COMT were converted to mutant COMT as revealed by pyrosequencing. Mutation frequencies among mutant lines were positively correlated to lignin reduction. Events with a mutation frequency of 99 % displayed a 29-32 % reduction of the lignin content compared to non-transgenic controls along with significantly reduced S subunit content and elevated hemicellulose content. CE analysis displayed similar peak patterns between primary COMT mutants and their vegetative progenies suggesting that TALEN mediated mutations were faithfully transmitted to vegetative progenies. This is the first report on genome editing in sugarcane. The findings demonstrate that targeted mutagenesis can improve cell wall characteristics for production of lignocellulosic ethanol in crops with highly complex genomes.

  20. Catechol-O-methyltransferase Val158Met genotype and the clinical responses to duloxetine treatment or plasma levels of 3-methoxy-4-hydroxyphenylglycol and homovanillic acid in Japanese patients with major depressive disorder

    PubMed Central

    Atake, Kiyokazu; Yoshimura, Reiji; Hori, Hikaru; Katsuki, Asuka; Nakamura, Jun

    2015-01-01

    Purpose This study investigated the relationships among the plasma levels of catecholamine metabolites, the clinical response to duloxetine treatment, and Val158Met polymorphism of the catechol-O-methyltransferase (COMT) gene. Subjects and methods Sixty-four patients and 30 healthy control subjects were recruited. Major depressive episodes were diagnosed using the Structured Clinical Interview for the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, Text Revision criteria. The severity of depression was evaluated using the 17-item Hamilton Rating Scale for Depression (HAMD17). Patients whose HAMD17 scores were 15 or greater were enrolled in the study. Blood sampling and clinical evaluation were performed at week 0 and week 8. The levels of plasma catecholamine metabolites were measured using high-performance liquid chromatography with electrochemical detection. Genotyping was performed using direct sequencing. Results Thirty of 45 patients (67%) responded to duloxetine treatment during the 8 weeks of treatment. The baseline plasma levels of 3-methoxy-4-hydroxyphenylglycol (MHPG), but not homovanillic acid (HVA), were lower in patients with major depressive disorder (MDD) who had the Val/Val genotype than in patients who were Met-carriers. Patients with MDD and the Val/Val genotype, but not Met carriers, had increased plasma levels of MHPG after 8 weeks of duloxetine treatment. The baseline plasma MHPG levels in healthy control subjects with the Val/Val genotype were significantly higher than those in patients with MDD. Among the subjects in the MDD group with the Val/Val genotype, the plasma MHPG levels increased to the same degree as in the healthy control subjects with the Val/Val genotype after 8 weeks of duloxetine treatment. Conclusion The relationship among the COMT Val158Met polymorphism, plasma levels of catecholamine metabolites, and responses to duloxetine is complex. Nevertheless, our results suggest that patients with MDD and the

  1. DNA Methyltransferases Inhibitors from Natural Sources.

    PubMed

    Zwergel, Clemens; Valente, Sergio; Mai, Antonello

    2016-01-01

    DNA methyltransferases (DNMTs) catalyze the methylation at cytosine-C5 mainly in a CpG dinucleotide context. Although DNA methylation is essential for fundamental processes like embryonic development or differentiation, aberrant expression and/or activities of DNMTs are involved in several pathologies, from neurodegeneration to cancer. DNMTs inhibition can arrest tumor growth, cells invasiveness and induce differentiation, whereas their increased expression is shown in numerous cancer types. Moreover, hypermethylated promoters of tumor suppressor genes lead to their silencing. Hence, the use of specific inhibitors of DNMT might reactivate those genes and stop or even reverse the aberrant cell processes. To date, the only approved DNMTs inhibitors for therapy belong to the nucleoside-based family of drugs, but they display relevant side effects as well as high chemical instability. Thus, there is a keen interest actually exists to develop novel, potent and safe inhibitors possessing a nonnucleoside structure. Increasing literature evidence is highlighting that natural sources could help the researchers to achieve this goal. Indeed, several polyphenols, flavonoids, antraquinones, and others are described able to inhibit DNMTs activity and/or expression, thus decreasing the methylation/silencing of different genes involved in tumorigenesis. These events can lead to re-expression of such genes and to cell death in diverse cancer cell lines. Epigallocatechin-3-gallate (1) and laccaic acid A (11) resulted the most effective DNMT1 inhibitors with submicromolar IC50 values, acting as competitive inhibitors. Compound 1 and 11 both displayed gene demethylation and re-activation in several cancers. However, all of the natural compounds described in this review showed important results, from gene reactivation to cell growth inhibition. Moreover, some of them displayed interesting activity even in rodent cancer models and very recently entered clinical trials.

  2. DNA methyltransferase 1 mediated aberrant methylation and silencing of SHP-1 gene in chronic myelogenous leukemia cells.

    PubMed

    Li, Yinghua; Liu, Xuedong; Guo, Xiufeng; Liu, Xiao; Luo, Jianmin

    2017-07-01

    Extensive studies on SHP-1 protein and SHP-1 mRNA revealed that the diminishment or abolishment of the expression of SHP-1 in leukemias/lymphomas was due to aberrant promoter methylation. Thus far, the mechanism of epigenetic silencing of the SHP-1 tyrosine phosphatase gene that occurs in chronic myelogenous leukemia cells remains poorly understood. The expressions of the target molecules were determined by quantitative real time PCR and western blot, respectively. Bisulfite sequencing PCR was used to detect methylation status of DNA CpG. The lentiviral vectors were applied to modify gene expression. In the present study, we found that the promoter 2 of SHP-1 gene is located between positions from -577bp to +300bp, and 22 CpG sites contained in positions -353bp∼+182bp are aberrantly methylated in K562 cells. In vitro, we demonstrated that DNMT1 silencing induced demethylation of the 22 CpG sites located in the SHP-1 promoter and re-expression of SHP-1 gene in K562 cells. Moreover, we proved that the expression levels of DNMT1 and SHP-1 mRNA and protein were negatively correlated in K562 cells and BM aspirates mononuclear cells from CML patients. Collectively, these results indicate that DNMT1 mediates aberrant methylation and silencing of SHP-1 gene in chronic myelogenous leukemia cells, and provide a novel therapeutic target for CML. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. The Ether-Cleaving Methyltransferase System of the Strict Anaerobe Acetobacterium dehalogenans: Analysis and Expression of the Encoding Genes▿

    PubMed Central

    Schilhabel, Anke; Studenik, Sandra; Vödisch, Martin; Kreher, Sandra; Schlott, Bernhard; Pierik, Antonio Y.; Diekert, Gabriele

    2009-01-01

    Anaerobic O-demethylases are inducible multicomponent enzymes which mediate the cleavage of the ether bond of phenyl methyl ethers and the transfer of the methyl group to tetrahydrofolate. The genes of all components (methyltransferases I and II, CP, and activating enzyme [AE]) of the vanillate- and veratrol-O-demethylases of Acetobacterium dehalogenans were sequenced and analyzed. In A. dehalogenans, the genes for methyltransferase I, CP, and methyltransferase II of both O-demethylases are clustered. The single-copy gene for AE is not included in the O-demethylase gene clusters. It was found that AE grouped with COG3894 proteins, the function of which was unknown so far. Genes encoding COG3894 proteins with 20 to 41% amino acid sequence identity with AE are present in numerous genomes of anaerobic microorganisms. Inspection of the domain structure and genetic context of these orthologs predicts that these are also reductive activases for corrinoid enzymes (RACEs), such as carbon monoxide dehydrogenase/acetyl coenzyme A synthases or anaerobic methyltransferases. The genes encoding the O-demethylase components were heterologously expressed with a C-terminal Strep-tag in Escherichia coli, and the recombinant proteins methyltransferase I, CP, and AE were characterized. Gel shift experiments showed that the AE comigrated with the CP. The formation of other protein complexes with the O-demethylase components was not observed under the conditions used. The results point to a strong interaction of the AE with the CP. This is the first report on the functional heterologous expression of acetogenic phenyl methyl ether-cleaving O-demethylases. PMID:19011025

  4. Human histamine N-methyltransferase pharmacogenetics: gene resequencing, promoter characterization, and functional studies of a common 5'-flanking region single nucleotide polymorphism (SNP).

    PubMed

    Wang, Liewei; Thomae, Bianca; Eckloff, Bruce; Wieben, Eric; Weinshilboum, Richard

    2002-08-15

    Histamine N-methyltransferase (HNMT) catalyzes one of two major metabolic pathways for histamine. The levels of HNMT activity and immunoreactive protein in human tissues are regulated primarily by inheritance. Previous studies of HNMT identified two common single nucleotide polymorphisms (SNPs), including a functionally significant nonsynonymous coding SNP (cSNP), (C314T, Thr105Ile), but that polymorphism did not explain all of the phenotypic variation. In the present study, a genotype-to-phenotype strategy was used to search for additional genetic factors that might contribute to the regulation of human HNMT activity. Specifically, we began by resequencing the human HNMT gene using 90 ethnically anonymous DNA samples from the Coriell Cell Repository and identified a total of eight SNPs, including the two that had been reported previously. No new nonsynonymous cSNPs were observed, but three of the six novel SNPs were located in the 5'-flanking region (5'-FR) of the gene-including a third common polymorphism with a frequency of 0.367 (36.7%). That observation directed our attention to possible genetic effects on HNMT transcription. As a first step in testing that possibility, we created and studied a series of reporter gene constructs for the initial 1kb of the HNMT 5'-FR. The core promoter and possible regulatory regions were identified and verified by electrophoresis mobility shift assays. We then studied the possible functional implications of the new common HNMT 5'-FR SNP. However, on the basis of reporter gene studies, that SNP appeared to have little effect on transcription. Phenotype-genotype correlation analysis performed with 112 human kidney biopsy samples that had been phenotyped for their level of HNMT activity confirmed that the common 5'-FR SNP was not associated with the level of HNMT activity in vivo. In summary, this series of experiments resulted in the identification of several novel HNMT polymorphisms, identification of the HNMT core promoter

  5. Insertional Inactivation of the Methionine S-Methyltransferase Gene Eliminates the S-Methylmethionine Cycle and Increases the Methylation Ratio1

    PubMed Central

    Kocsis, Michael G.; Ranocha, Philippe; Gage, Douglas A.; Simon, Eric S.; Rhodes, David; Peel, Gregory J.; Mellema, Stefan; Saito, Kazuki; Awazuhara, Motoko; Li, Changjiang; Meeley, Robert B.; Tarczynski, Mitchell C.; Wagner, Conrad; Hanson, Andrew D.

    2003-01-01

    Methionine (Met) S-methyltransferase (MMT) catalyzes the synthesis of S-methyl-Met (SMM) from Met and S-adenosyl-Met (Ado-Met). SMM can be reconverted to Met by donating a methyl group to homocysteine (homo-Cys), and concurrent operation of this reaction and that mediated by MMT sets up the SMM cycle. SMM has been hypothesized to be essential as a methyl donor or as a transport form of sulfur, and the SMM cycle has been hypothesized to guard against depletion of the free Met pool by excess Ado-Met synthesis or to regulate Ado-Met level and hence the Ado-Met to S-adenosylhomo-Cys ratio (the methylation ratio). To test these hypotheses, we isolated insertional mmt mutants of Arabidopsis and maize (Zea mays). Both mutants lacked the capacity to produce SMM and thus had no SMM cycle. They nevertheless grew and reproduced normally, and the seeds of the Arabidopsis mutant had normal sulfur contents. These findings rule out an indispensable role for SMM as a methyl donor or in sulfur transport. The Arabidopsis mutant had significantly higher Ado-Met and lower S-adenosylhomo-Cys levels than the wild type and consequently had a higher methylation ratio (13.8 versus 9.5). Free Met and thiol pools were unaltered in this mutant, although there were moderate decreases (of 30%–60%) in free serine, threonine, proline, and other amino acids. These data indicate that the SMM cycle contributes to regulation of Ado-Met levels rather than preventing depletion of free Met. PMID:12692340

  6. Genotype status of the dopamine-related catechol-O-methyltransferase (COMT) gene corresponds with desirability of “unhealthy” foods

    PubMed Central

    Wallace, Deanna L.; Aarts, Esther; Uquillas, Federico d’Oleire; Dang, Linh C.; Greer, Stephanie M.; Jagust, William J.; D’Esposito, Mark

    2015-01-01

    The role of dopamine is extensively documented in weight regulation and food intake in both animal models and humans. Yet the role of dopamine has not been well studied in individual differences for food desirability. Genotype status of the dopamine-related catechol-O-methyltransferase (COMT) gene has been shown to influence dopamine levels, with greater COMT enzymatic activity in val/val individuals corresponding to greater degradation of dopamine. Decreased dopamine has been associated with poorer cognitive control and diminished goal-directed behavior in various behavioral paradigms. Additionally, dopaminergic-rich regions such as the frontal cortex and dorsal striatum have been shown to be important for supporting food-related decision-making. However, the role of dopamine, as assessed by COMT genotype status, in food desirability has not been fully explored. Therefore, we utilized an individual’s COMT genotype status (n=61) and investigated food desirability based on self-rated “healthy” and “unhealthy” food perceptions. Here we found val/val individuals (n=19) have greater desirability for self-rated “unhealthy” food items, but not self-rated “healthy” food items, as compared to val/met (n=24) and met/met (n=18) individuals (p<0.005). Utilizing an objective health measure for the food items, we also found val/val and val/met individuals have greater desirability for objectively defined “unhealthy” food items, as compared to met/met individuals (p<0.01). This work further substantiates a role of dopamine in food-related behaviors and more specifically in relationship to food desirability for “unhealthy” food items. PMID:25963102

  7. Ethnic differences in five intronic polymorphisms associated with arsenic metabolism within human arsenic (+ 3 oxidation state) methyltransferase (AS3MT) gene

    SciTech Connect

    Fujihara, Junko; Fujii, Yoshimi; Agusa, Tetsuro; Kunito, Takashi; Yasuda, Toshihiro; Moritani, Tamami; Takeshita, Haruo

    2009-01-01

    Human arsenic (+ 3 oxidation state) methyltransferase (AS3MT) is known to catalyze the methylation of arsenite, and intronic single-nucleotide polymorphisms (SNPs: G7395A, G12390C, T14215C, T35587C, and G35991A) in the AS3MT gene were shown to be related to inter-individual variation in the arsenic metabolism. In the present study, the genotyping for these SNPs was developed using the polymerase chain reaction and restriction fragment length polymorphism technique. Applying this method, the genotype distribution among the Ovambo, Turkish, Mongolian, Korean, and Japanese populations was investigated, and our results were compared with those from other studies. G7395, G12390, T35587, and A35991 were predominant among the five populations in our study. However, a previous study in Argentina, C12390 and G35991 showed the highest allele frequency among the eight populations studied in other studies. The dominant allele of T14215C differed among populations: the T14215 allele was predominant in Argentina, the allele frequency of C14215 was higher than that of T14215 among Turks, Mongolians, Europeans, and American ancestry. In Korea and Japan, similar allele frequencies were observed in T14215 and C14215. Higher allele frequencies were observed in haplotype G7395/G12390/C14215/T35587 with frequencies of 0.40 (Turks), 0.28 (Mongolians), and 0.23 (Koreans). On the other hand, the allele frequency for G7395/G14215/T35587/A35991 was the highest among the Ovambos (0.32), and the frequency for G7395/G12390/C35587/G35991 was the highest among the Japanese (0.27). It is noteworthy that the Japanese haplotype differs from that of the Koreans and Mongolians, which indicates the importance of investigating other intronic polymorphisms in AS3MT, especially in Asians.

  8. DNA Methyltransferase Gene Polymorphisms for Prediction of Radiation-Induced Skin Fibrosis after Treatment of Breast Cancer: A Multifactorial Genetic Approach.

    PubMed

    Terrazzino, Salvatore; Deantonio, Letizia; Cargnin, Sarah; Donis, Laura; Pisani, Carla; Masini, Laura; Gambaro, Giuseppina; Canonico, Pier Luigi; Genazzani, Armando A; Krengli, Marco

    2017-04-01

    This study was conducted to investigate the role of four polymorphic variants of DNA methyltransferase genes as risk factors for radiation-induced fibrosis in breast cancer patients. We also assessed their ability to improve prediction accuracy when combined with mitochondrial haplogroup H, which we previously found to be independently associated with a lower hazard of radiation-induced fibrosis. DNMT1 rs2228611,DNMT3A rs1550117,DNMT3A rs7581217, and DNMT3B rs2424908 were genotyped by real-time polymerase chain reaction in 286 Italian breast cancer patients who received radiotherapy after breast conserving surgery. Subcutaneous fibrosis was scored according to the Late Effects of Normal Tissue-Subjective Objective Management Analytical (LENT-SOMA) scale. The discriminative accuracy of genetic models was assessed by the area under the receiver operating characteristic curves (AUC). Kaplan-Meier curves showed significant differences among DNMT1 rs2228611 genotypes in the cumulative incidence of grade ≥ 2 subcutaneous fibrosis (log-rank test p-value= 0.018). Multivariate Cox regression analysis revealed DNMT1 rs2228611 as an independent protective factor for moderate to severe radiation-induced fibrosis (GG vs. AA; hazard ratio, 0.26; 95% confidence interval [CI], 0.10 to 0.71; p=0.009). Adding DNMT1 rs2228611 to haplogroup H increased the discrimination accuracy (AUC) of the model from 0.595 (95% CI, 0.536 to 0.653) to 0.655 (95% CI, 0.597 to 0.710). DNMT1 rs2228611 may represent a determinant of radiation-induced fibrosis in breast cancer patients with promise for clinical usefulness in genetic-based predictive models.

  9. Activation of nicotinamide N-methyltransferase gene promoter by hepatocyte nuclear factor-1beta in human papillary thyroid cancer cells.

    PubMed

    Xu, Jimin; Capezzone, Marco; Xu, Xiao; Hershman, Jerome M

    2005-02-01

    We previously demonstrated that the human nicotinamide N-methytransferase (NNMT) gene was highly expressed in many papillary thyroid cancers and cell lines. The expression in other papillary and follicular cancers or cell lines and normal thyroid cells was low or undetectable. To gain an understanding of the molecular mechanism of this cell-specific expression, the NNMT promoter was cloned and studied by luciferase reporter gene assay. The promoter construct was expressed highly in papillary cancer cell lines, including those with higher (e.g. BHP 2-7) and lower (e.g. BHP 14-9) NNMT gene expression, and expressed weakly in follicular thyroid cancer cell lines. Further study with 5'-deletion promoter construct suggested that the NNMT promoter was regulated differently in BHP 2-7 and BHP 14-9 cells. In BHP 2-7 cells, promoter activity was dependent on an upstream sequence. In BHP 14-9 cells, sequence in the basal promoter region contributed notably to the overall promoter activity. RT-PCR or Western blot analysis indicated that hepatocyte nuclear factor-1beta (HNF-1beta) was expressed in only papillary cancer cell lines with high NNMT gene expression. HNF-1beta was not expressed or expressed very weakly in other papillary, follicular, and Hurthle cancer cell lines and primary cultures of normal thyroid cells and benign thyroid conditions. A HNF-1 binding site was identified in the NNMT basal promoter region. Mutations in this site decreased NNMT promoter activity in the HNF-1beta-positive BHP 2-7 cells, but not in the HNF-1beta-negative BHP 14-9 cells. HNF-1beta bound to the HNF-1 site specifically as a homodimer as determined by gel retardation assays with HNF-1beta-specific antibody. Cotransfection of a HNF-1beta expression plasmid increased NNMT promoter activity significantly in both HNF-1beta-positive and -negative thyroid cancer cell lines and Hep G2 liver cancer cells. Furthermore, transient expression of HNF-1beta in BHP 14-9 cells increased endogenous NNMT

  10. Identification of pseudouridine methyltransferase in Escherichia coli

    PubMed Central

    Ero, Rya; Peil, Lauri; Liiv, Aivar; Remme, Jaanus

    2008-01-01

    In ribosomal RNA, modified nucleosides are found in functionally important regions, but their function is obscure. Stem–loop 69 of Escherichia coli 23S rRNA contains three modified nucleosides: pseudouridines at positions 1911 and 1917, and N3 methyl-pseudouridine (m3Ψ) at position 1915. The gene for pseudouridine methyltransferase was previously not known. We identified E. coli protein YbeA as the methyltransferase methylating Ψ1915 in 23S rRNA. The E. coli ybeA gene deletion strain lacks the N3 methylation at position 1915 of 23S rRNA as revealed by primer extension and nucleoside analysis by HPLC. Methylation at position 1915 is restored in the ybeA deletion strain when recombinant YbeA protein is expressed from a plasmid. In addition, we show that purified YbeA protein is able to methylate pseudouridine in vitro using 70S ribosomes but not 50S subunits from the ybeA deletion strain as substrate. Pseudouridine is the preferred substrate as revealed by the inability of YbeA to methylate uridine at position 1915. This shows that YbeA is acting at the final stage during ribosome assembly, probably during translation initiation. Hereby, we propose to rename the YbeA protein to RlmH according to uniform nomenclature of RNA methyltransferases. RlmH belongs to the SPOUT superfamily of methyltransferases. RlmH was found to be well conserved in bacteria, and the gene is present in plant and in several archaeal genomes. RlmH is the first pseudouridine specific methyltransferase identified so far and is likely to be the only one existing in bacteria, as m3Ψ1915 is the only methylated pseudouridine in bacteria described to date. PMID:18755836

  11. Identification of pseudouridine methyltransferase in Escherichia coli.

    PubMed

    Ero, Rya; Peil, Lauri; Liiv, Aivar; Remme, Jaanus

    2008-10-01

    In ribosomal RNA, modified nucleosides are found in functionally important regions, but their function is obscure. Stem-loop 69 of Escherichia coli 23S rRNA contains three modified nucleosides: pseudouridines at positions 1911 and 1917, and N3 methyl-pseudouridine (m(3)Psi) at position 1915. The gene for pseudouridine methyltransferase was previously not known. We identified E. coli protein YbeA as the methyltransferase methylating Psi1915 in 23S rRNA. The E. coli ybeA gene deletion strain lacks the N3 methylation at position 1915 of 23S rRNA as revealed by primer extension and nucleoside analysis by HPLC. Methylation at position 1915 is restored in the ybeA deletion strain when recombinant YbeA protein is expressed from a plasmid. In addition, we show that purified YbeA protein is able to methylate pseudouridine in vitro using 70S ribosomes but not 50S subunits from the ybeA deletion strain as substrate. Pseudouridine is the preferred substrate as revealed by the inability of YbeA to methylate uridine at position 1915. This shows that YbeA is acting at the final stage during ribosome assembly, probably during translation initiation. Hereby, we propose to rename the YbeA protein to RlmH according to uniform nomenclature of RNA methyltransferases. RlmH belongs to the SPOUT superfamily of methyltransferases. RlmH was found to be well conserved in bacteria, and the gene is present in plant and in several archaeal genomes. RlmH is the first pseudouridine specific methyltransferase identified so far and is likely to be the only one existing in bacteria, as m(3)Psi1915 is the only methylated pseudouridine in bacteria described to date.

  12. Euchromatic histone methyltransferase 2 inhibitor, BIX-01294, sensitizes human promyelocytic leukemia HL-60 and NB4 cells to growth inhibition and differentiation.

    PubMed

    Savickiene, Jurate; Treigyte, Grazina; Stirblyte, Ieva; Valiuliene, Giedre; Navakauskiene, Ruta

    2014-07-01

    The involvement of histone lysine methyltransferases (HMT) in carcinogenesis is not well understood. Here, we describe a dose-dependent growth and survival inhibitory effects of BIX-01294, a specific inhibitor of euchromatic HMT2, in promyelocytic leukemia HL-60 and NB4 cells. BIX-01294 combined with all-trans retinoic acid or together with histone deacetylase and DNA methyltransferase inhibitors enhanced cell differentiation to granulocytes and induced cell line-specific changes in the expression of cell cycle-, survival- and differentiation regulating genes and proteins in association with histone modification state. Our results suggest that targeting EHMT2 may be of therapeutical benefits in myeloid leukemia.

  13. Genotypic and phenotypic analysis of the polymorphic thiopurine S-methyltransferase gene (TPMT) in a European population

    PubMed Central

    Spire-Vayron de la Moureyre, Catherine; Debuysere, Hervé; Mastain, Bruno; Vinner, Elizabeth; Marez, Delphine; Lo Guidice, Jean-Marc; Chevalier, Dany; Brique, Serge; Motte, Kokou; Colombel, Jean-Frédéric; Turck, Dominique; Noel, Christian; Flipo, René-Marc; Pol, Annie; Lhermitte, Michel; Lafitte, Jean-Jacques; Libersa, Christian; Broly, Franck

    1998-01-01

    Characterization of allelic variants of the TPMT gene (TPMT) responsible for changes in TPMT activity, and elucidation of the mechanism by which these alleles act, are required because of the clinical importance of this polymorphism for patients receiving thiopurine drugs.We defined the mutational and allelic spectrum of TPMT in a group of 191 Europeans. Using PCR–SSCP, we screened for mutation the entire coding sequence, the exon-intron boundaries, the promoter region and the 3′-flanking region of the gene. Six mutations were detected throughout the ten exons and seven TPMT alleles were characterized. Four of them, TPMT*2, *3A, *3C and *7, harbouring the known mutations, G238C, G460A, A719G or T681G, were nonfunctional and accounted for 0.5, 5.7, 0.8 and 0.3% of the allele totality, respectively.Within the promoter region, six alleles corresponding to a variable number of tandem repeats (VNTR), were identified. VNTR*V4 and *V5a which harbour four or five repeats of a 17–18 bp unit, were the most frequent (55% and 34%, respectively). The other VNTR alleles, having from five to eight repeats, were rarer.The TPMT phenotype was correctly predicted by genotyping for 87% of individuals. A clear negative correlation between the total number of repeats from both alleles and the TPMT activity level was observed, indicating that VNTRs contribute to interindividual variations of TPMT activity. Therefore, additional analysis of the promoter region of TPMT can improve the phenotype prediction rate by genotyping. PMID:9831928

  14. Evaluation of MiR-34 Family and DNA Methyltransferases 1, 3A, 3B Gene Expression Levels in Hepatocellular Carcinoma Following Treatment with Dendrosomal Nanocurcumin.

    PubMed

    Chamani, Fatemeh; Sadeghizadeh, Majid; Masoumi, Mahbobeh; Babashah, Sadegh

    2016-01-01

    Hepatocellular carcinoma (HCC) is the most common primary malignancy of the liver making up more than 80 percent of cases. It is known to be the sixth most prevalent cancer and the third most frequent cause of cancer related death worldwide. Epigenetic regulation constitutes an important mechanism by which dietary components can selectively activate or inactivate target gene expression. The miR-34 family members including mir-34a, mir-34b and mir-34c are tumor suppressor micro RNAs, which are expressed in the majority of normal tissues. Several studies have indicated silencing of miR-34 expression via DNA methylation in multiple types of cancers. Bioactive nutrients like curcumin (Cur) have excellent anticarcinogenic activity and minimal toxic manifestations in biological systems. This compound has recently been determined to induce epigenetic changes. However, Cur is lipophilic and has a poor systemic bioavailability and poor absorption. Its bioavailability is increased through employing dendrosome nanoparticles. The aim of the current study was to investigate the effect of dendrosomal nanocurcumin (DNC) on expression of mir-34 family members in two HCC cell lines, HepG2 and Huh7. We performed the MTT assay to evaluate DNC and dendrosome effects on cell viability. The ability of DNC to alter expression of the mir-34 family and DNA methyltransferases (DNMT1, DNMT3A and 3B) was evaluated using semi-quantitative and quantitative PCR. We observed the entrance of DNC into HepG2 and Huh7 cells. Gene expression assays indicated that DNC treatment upregulated mir34a, mir34b and mir34c expression (P<0.05) as well as downregulated DNMT1, DNMT3A and DNMT3B expression (P<0.05) in both HepG2 and Huh7 cell lines. DNC also reduced viability of Huh7 and HepG2 cells through restoration of miR-34s expression. We showed that DNC could awaken the epigenetically silenced miR-34 family by downregulation of DNMTs. Our findings suggest that DNC has potential in epigenetic therapy of HCC.

  15. Stalling of DNA methyltransferase in chromosome stability and chromosome remodelling (Review).

    PubMed

    Smith, S S

    1998-01-01

    As a consequence of their mechanism of action, DNA (cytosine-5) methyltransferases from both prokaryotes and eukaryotes necessarily recognize mispaired bases in unusual DNA structures as catalytic transition-state analogs. A review of the available data suggests that the enzymes are designed to stall at these sites because they are unable to release substrates or products that are fixed in a conformation resembling the transition state. The enzymes can operate by a two-step process in which they first methylate extrahelical cytosines satisfying their recognition requirements and subsequently stall at the site of methylation. On RNA and DNA RNA hybrids they may operate by a similar one-step process in which they stall at transition-state analogs without methylating cytosine moieties. These natural capacities suggest that the enzymes may physically participate in stable nucleoprotein assemblies formed as components of normal chromatin structure or as intermediates in the repair of unusual structures. The methyltransferases, themselves, may physically participate in chromosome remodelling as part of a mechanism of inactivation or imprinting by stabilizing RNA DNA hybrids or RNA RNA secondary structure involving cis-acting untranslated RNAs like the product of the Xist gene. Methyl-transferase may physically participate in the repair of certain unusual structures by serving as a nucleation point. The affinity for secondary structure in nucleic acids may account for the spreading of DNA methylation patterns. Titration of host methyltransferase by RNA DNA hybrids and RNA secondary structure formed during retroviral replication in certain tumorigenic retroviruses, like MMTV, may account for global hypomethylation observed in retrovirally transformed cells. In a similar fashion, titration of methyltransferase by secondary structures associated with chromosome instability may account for global hypomethylation observed in association with local hypermethylation in

  16. Synthesis of lysine methyltransferase inhibitors

    PubMed Central

    Hui, Chunngai; Ye, Tao

    2015-01-01

    Lysine methyltransferase which catalyze methylation of histone and non-histone proteins, play a crucial role in diverse biological processes and has emerged as a promising target for the development of various human diseases, including cancer, inflammation, and psychiatric disorders. However, inhibiting lysine methyltransferases selectively has presented many challenges to medicinal chemists. During the past decade, lysine methyltransferase inhibitors covering many different structural classes have been designed and developed. In this review, we describe the development of selective, small-molecule inhibitors of lysine methyltransferases with an emphasis on their discovery and chemical synthesis. We highlight the current state of lysine methyltransferase inhibitors and discuss future directions and opportunities for lysine methyltransferase inhibitor discovery. PMID:26258118

  17. Glycolic Acid Silences Inflammasome Complex Genes, NLRC4 and ASC, by Inducing DNA Methylation in HaCaT Cells.

    PubMed

    Tang, Sheau-Chung; Yeh, Jih-I; Hung, Sung-Jen; Hsiao, Yu-Ping; Liu, Fu-Tong; Yang, Jen-Hung

    2016-03-01

    AHAs (α-hydroxy acids), including glycolic acid (GA), have been widely used in cosmetic products and superficial chemical peels. Inflammasome complex has been shown to play critical roles in inflammatory pathways in human keratinocytes. However, the anti-inflammatory mechanism of GA is still unknown. The aim of this study is to investigate the relationship between the expression of the inflammasome complex and epigenetic modification to elucidate the molecular mechanism of the anti-inflammatory effect of GA in HaCaT cells. We evaluated NLRP3, NLRC4, AIM2, and ASC inflammasome complex gene expression on real-time polymerase chain reaction (PCR). Methylation changes were detected in these genes following treatment with DNA methyltransferase (DNMT) inhibitor 5-aza-2'-deoxycytidine (5-Aza) with or without the addition of GA using methylation-specific PCR (MSP). GA inhibited the expressions of these inflammasome complex genes, and the decreases in the expressions of mRNA were reversed by 5-Aza treatment. Methylation was detected in NLRC4 and ASC on MSP, but not in NLRP3 or AIM2. GA decreased NLRC4 and ASC gene expression by increasing not only DNA methyltransferase 3B (DNMT-3B) protein level, but also total DNMT activity. Furthermore, silencing of DNMT-3B (shDNMT-3B) increased the expressions of NLRC4 and ASC. Our data demonstrated that GA treatment induces hypermethylation of promoters of NLRC4 and ASC genes, which may subsequently lead to the hindering of the assembly of the inflammasome complex in HaCaT cells. These results highlight the anti-inflammatory potential of GA-containing cosmetic agents in human skin cells and demonstrate for the first time the role of aberrant hypermethylation in this process.

  18. DNA methyltransferases as targets for cancer therapy.

    PubMed

    Ghoshal, Kalpana; Bai, Shoumei

    2007-06-01

    Methylation of DNA at 5-position of cytosine, catalyzed by DNA methyltransferases, is the predominant epigenetic modification in mammals. Aberrations in methylation play a causal role in a variety of diseases, including cancer. Recent studies have established that like mutation, methylation-mediated gene silencing often leads to tumorigenesis. Paradoxically, genome-wide DNA hypomethylation may also play a causal role in carcinogenesis by inducing chromosomal instability and spurious gene expression. Since methylation does not alter DNA base sequence, much attention has been focused recently on developing small molecule inhibitors of DNA methyltransferases that can potentially be used as anticancer agents. Vidaza (5-azacytidine), marketed by Pharmion (Boulder, CO, USA), was the first DNA methyltransferase inhibitor approved by the U.S. Food and Drug Administration (FDA) for chemotherapy against myelodysplastic syndrome (MDS), a heterogeneous bone marrow disorder. Recently MGI Pharma Inc. (Bloomington, MN, USA) got FDA approval to market Dacogen (5-aza-2'-deoxycytidine, or decitabine) for treating MDS patients. These drugs were used earlier against certain anemias to induce expression of fetal globin genes. Interest in clinical trials of these drugs as anticancer agents has been renewed only recently because of reversal of methylation-mediated silencing of critical genes in cancer. Clinical trials have shown that both drugs have therapeutic potential against leukemia such as MDS, acute myeloid leukemia, chronic myelogenous leukemia and chronic myelomonocytic leukemia. In contrast, their effectiveness with solid tumors appears to be less promising, which challenges researchers to develop inhibitors with more efficacy and less toxicity. The major hindrance of their usage as anticancer agents is their instability in vivo as well as the toxicity secondary to their excessive incorporation into DNA, which causes cell cycle arrest. Gene expression profiling in cancer cells

  19. Mapping of glutamic acid decarboxylase (GAD) genes

    SciTech Connect

    Edelhoff, S.; Adler, D.A.; Disteche, C.M.; Grubin, C.E.; Karlsen, A.E.; Lernmark, A.; Foster, D. )

    1993-07-01

    Glutamic acid decarboxylase (GAD) catalyzes the synthesis of [gamma]-aminobutyric acid (GABA), which is known as a major inhibitory neurotransmitter in the central nervous system (CNS), but is also present outside the CNS. Recent studies showed that GAD is the major target of autoantibodies associated with the development of insulin-dependent diabetes mellitus and of the rare stiff man syndrome. Studies of GAD expression have demonstrated multiple transcripts, suggesting several isoforms of GAD. In this study, three different genes were mapped by in situ hybridization to both human and mouse chromosomes. The GAD1 gene was mapped to human chromosome 2q31 and to mouse chromosome 2D in a known region of conservation between human and mouse. GAD2, previously mapped to human chromosome 10p11.2-p12, was mapped to mouse chromosome 2A2-B, which identifies a new region of conservation between human and mouse chromosomes. A potential GAD3 transcript was mapped to human chromosome 22q13 and to mouse chromosome 15E in a known region of conservation between human and mouse. It is concluded that the GAD genes may form a family with as many as three related members. 30 refs., 5 figs.

  20. Assessment of the phenolic profile, antimicrobial activity and oxidative stability of transgenic Perilla frutescens L.overexpressing tocopherol methyltransferase (γ-tmt) gene.

    PubMed

    Ghimire, Bimal Kumar; Yu, Chang Yeon; Chung, Ill-Min

    2017-09-01

    This study evaluated the effects of enhanced concentrations of α-tocopherol and phenolic compounds on the resistance and stability of Perilla oil in transgenic Perilla frutescens plants against various tested pathogenic bacteria by over-expressing the γ-tmt gene. The concentration of phenolic compounds in the non-transgenic samples was 9313.198 ± 18.887 μg g(-1) dry weight (DW), whereas the total concentration of the transgenic samples ranged from 9118.015 ± 18.822 to 10527.612 ± 20.411 μg g(-1) DW. The largest increases in phenolic compounds in the transgenic plants in comparison with the control plants were observed in gallic acid, pyrogallol, 5-sulfosalicylic acid, catechin, chlorogenic acid, vanillin, syringic acid, naringenin, salicylic acid, quercetin, o-coumaric acid, kaempferol, and hesperetin. o-coumaric and benzoic acid acid were the most abundant phenolic acids found in the transgenic plants. Gram-negative bacteria (Salmonella typhimurium) were the most susceptible microorganism against transgenic ethyl acetate extracts with lower measurement of minimum inhibitory concentration (MICs) (0.25 ± 0.03 mg/ml) at an extract concentration of 2 mg/ml in dried plant material. The same extracts were more effective against gram-positive bacteria (Bacillus subtilis) when compared to control plants with MICs values of 0.52 ± 0.02 mg/ml. The suplementation of 20 μg of α-tocopherol (1000 ppm) in combination with ethyl acetate extracts enhanced the antimicrobial activity against S. typhimurium and B. subtilis, compared to the non-transgenic plants. The acid value of transgenic Perilla oil improved by 91.2% and 35.54% relative to the non-transgenic control oil and commercial Perilla oil, respectively. The low acid value suggests that the oil will be less susceptible to lipase action, and more economically viable and thus, may also improve the oil quality for industrial purposes. In addition, extracts obtained from transgenic plants could

  1. Knock-down of the methyltransferase Kmt6 relieves H3K27me3 and results in induction of cryptic and otherwise silent secondary metabolite gene clusters in Fusarium fujikuroi.

    PubMed

    Studt, Lena; Rösler, Sarah M; Burkhardt, Immo; Arndt, Birgit; Freitag, Michael; Humpf, Hans-Ulrich; Dickschat, Jeroen S; Tudzynski, Bettina

    2016-11-01

    Filamentous fungi produce a vast array of secondary metabolites (SMs) and some play a role in agriculture or pharmacology. Sequencing of the rice pathogen Fusarium fujikuroi revealed the presence of far more SM-encoding genes than known products. SM production is energy-consuming and thus tightly regulated, leaving the majority of SM gene clusters silent under laboratory conditions. One important regulatory layer in SM biosynthesis involves histone modifications that render the underlying genes either silent or poised for transcription. Here, we show that the majority of the putative SM gene clusters in F. fujikuroi are located within facultative heterochromatin marked by trimethylated lysine 27 on histone 3 (H3K27me3). Kmt6, the methyltransferase responsible for establishing this histone mark, appears to be essential in this fungus, and knock-down of Kmt6 in the KMT6(kd) strain shows a drastic phenotype affecting fungal growth and development. Transcription of four so far cryptic and otherwise silent putative SM gene clusters was induced in the KMT6(kd) strain, in which decreased expression of KMT6 is accompanied by reduced H3K27me3 levels at the respective gene loci and accumulation of novel metabolites. One of the four putative SM gene clusters, named STC5, was analysed in more detail thereby revealing a novel sesquiterpene. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  2. Overlapping gene expression profiles of cell migration and tumor invasion in human bladder cancer identify metallothionein E1 and nicotinamide N-methyltransferase as novel regulators of cell migration

    PubMed Central

    Wu, Y.; Siadaty, M. S.; Berens, M.E.; Hampton, G. M.

    2017-01-01

    Cell migration is essential to cancer invasion and metastasis and is spatially and temporally integrated through transcriptionally dependent and independent mechanisms. Since cell migration is studied in vitro, it is important to identify genes that both drive cell migration and are biologically relevant in promoting invasion and metastasis in patients with cancer. Here, gene expression profiling and a high throughput cell migration system answers this question in human bladder cancer. In vitro migration rates of 40 microarray profiled human bladder cancer cell lines were measured by radial migration assay (RMA). Genes whose expression was either directly or inversely associated with cell migration rate were identified and subsequently evaluated for their association with cancer stage in 61 patients. This analysis identified genes known to be associated with cell invasion such as versican, and novel ones, including metallothionein E1 (MTE1) and nicotinamide N-methyltransferase (NNMT), whose expression correlated positively with cancer cell migration and tumor stage. Using loss of function analysis, we show that MTE1 and NNMT are necessary for cancer cell migration. These studies provide a general approach to identify the clinically relevant genes in cancer cell migration and mechanistically implicate two novel genes in this process in human bladder cancer. PMID:18724390

  3. Catechol O-methyltransferase and monoamine oxidase A genotypes, and plasma catecholamine metabolites in bipolar and schizophrenic patients.

    PubMed

    Zumárraga, Mercedes; Dávila, Ricardo; Basterreche, Nieves; Arrue, Aurora; Goienetxea, Biotza; Zamalloa, María I; Erkoreka, Leire; Bustamante, Sonia; Inchausti, Lucía; González-Torres, Miguel A; Guimón, José

    2010-01-01

    Metabolites of dopamine and norepinephrine measured in the plasma have long been associated with symptomatic severity and response to treatment in schizophrenic, bipolar and other psychiatric patients. Plasma concentrations of catecholamine metabolites are genetically regulated. The genes encoding enzymes that are involved in the synthesis and degradation of these monoamines are candidate targets for this genetic regulation. We have studied the relationship between the Val158Met polymorphism in catechol O-methyltransferase gene, variable tandem repeat polymorphisms in the monoamine oxidase A gene promoter, and plasma concentrations of 3-methoxy-4-hydroxyphenylglycol, 3,4-dihydroxyphenylacetic acid and homovanillic acid in healthy control subjects as well as in untreated schizophrenic and bipolar patients. We found that the Val158Met substitution in catechol O-methyltransferase gene influences the plasma concentrations of homovanillic and 3,4-dihydroxyphenylacetic acids. Although higher concentrations of plasma homovanillic acid were found in the high-activity ValVal genotype, this mutation did not affect the plasma concentration of 3-methoxy-4-hydroxyphenylglycol. 3,4-dihydroxyphenylacetic acid concentrations were higher in the low-activity MetMet genotype. Interestingly, plasma values 3-methoxy-4-hydroxyphenylglycol were greater in schizophrenic patients and in bipolar patients than in healthy controls. Our results are compatible with the previously reported effect of the Val158Met polymorphism on catechol O-methyltransferase enzymatic activity. Thus, our results suggest that this polymorphism, alone or associated with other polymorphisms, could have an important role in the genetic control of monoamine concentration and its metabolites.

  4. Characterization of selenocysteine methyltransferases from Astragalus species with contrasting selenium accumulation capacity.

    PubMed

    Sors, Thomas G; Martin, Catherine P; Salt, David E

    2009-07-01

    A group of selenium (Se)-hyperaccumulating species belonging to the genus Astragalus are known for their capacity to accumulate up to 0.6% of their foliar dry weight as Se, with most of this Se being in the form of Se-methylselenocysteine (MeSeCys). Here, we report the isolation and molecular characterization of the gene that encodes a putative selenocysteine methyltransferase (SMT) enzyme from the non-accumulator Astragalus drummondii and biochemically compare it with an authentic SMT enzyme from the Se-hyperaccumulator Astragalus bisulcatus, a related species that lives within the same native habitat. The non-accumulator enzyme (AdSMT) shows a high degree of homology with the accumulator enzyme (AbSMT) but lacks the selenocysteine methyltransferase activity in vitro, explaining why little or no detectable levels of MeSeCys accumulation are observed in the non-accumulator plant. The insertion of mutations on the coding region of the non-accumulator AdSMT enzyme to better resemble enzymes that originate from Se accumulator species results in increased selenocysteine methyltransferase activity, but these mutations were not sufficient to fully gain the activity observed in the AbSMT accumulator enzyme. We demonstrate that SMT is localized predominantly within the chloroplast in Astragalus, the principal site of Se assimilation in plants. By using a site-directed mutagenesis approach, we show that an Ala to Thr amino acid mutation at the predicted active site of AbSMT results in a new enzymatic capacity to methylate homocysteine. The mutated AbSMT enzyme exhibited a sixfold higher capacity to methylate selenocysteine, thereby establishing the evolutionary relationship of SMT and homocysteine methyltransferase enzymes in plants.

  5. Mouse Vk gene classification by nucleic acid sequence similarity.

    PubMed

    Strohal, R; Helmberg, A; Kroemer, G; Kofler, R

    1989-01-01

    Analyses of immunoglobulin (Ig) variable (V) region gene usage in the immune response, estimates of V gene germline complexity, and other nucleic acid hybridization-based studies depend on the extent to which such genes are related (i.e., sequence similarity) and their organization in gene families. While mouse Igh heavy chain V region (VH) gene families are relatively well-established, a corresponding systematic classification of Igk light chain V region (Vk) genes has not been reported. The present analysis, in the course of which we reviewed the known extent of the Vk germline gene repertoire and Vk gene usage in a variety of responses to foreign and self antigens, provides a classification of mouse Vk genes in gene families composed of members with greater than 80% overall nucleic acid sequence similarity. This classification differed in several aspects from that of VH genes: only some Vk gene families were as clearly separated (by greater than 25% sequence dissimilarity) as typical VH gene families; most Vk gene families were closely related and, in several instances, members from different families were very similar (greater than 80%) over large sequence portions; frequently, classification by nucleic acid sequence similarity diverged from existing classifications based on amino-terminal protein sequence similarity. Our data have implications for Vk gene analyses by nucleic acid hybridization and describe potentially important differences in sequence organization between VH and Vk genes.

  6. Microdialysis with radiometric monitoring of L-[β-11C]DOPA to assess dopaminergic metabolism: effect of inhibitors of L-amino acid decarboxylase, monoamine oxidase, and catechol-O-methyltransferase on rat striatal dialysate.

    PubMed

    Okada, Maki; Nakao, Ryuji; Hosoi, Rie; Zhang, Ming-Rong; Fukumura, Toshimitsu; Suzuki, Kazutoshi; Inoue, Osamu

    2011-01-01

    The catecholamine, dopamine (DA), is synthesized from 3,4-dihydroxy-L-phenylalanine (L-DOPA) by aromatic L-amino acid decarboxylase (AADC). Dopamine metabolism is regulated by monoamine oxidase (MAO) and catechol-O-methyltransferase (COMT). To measure dopaminergic metabolism, we used microdialysis with radiometric detection to monitor L-[β-(11)C]DOPA metabolites in the extracellular space of the rat striatum. We also evaluated the effects of AADC, MAO, and COMT inhibitors on metabolite profiles. The major early species measured after administration of L-[β-(11)C]DOPA were [(11)C]3,4-dihydroxyphenylacetic acid ([(11)C]DOPAC) and [(11)C]homovanillic acid ([(11)C]HVA) in a 1:1 ratio, which shifted toward [(11)C]HVA with time. An AADC inhibitor increased the uptake of L-[β-(11)C]DOPA and L-3-O-methyl-[(11)C]DOPA and delayed the accumulation of [(11)C]DOPAC and [(11)C]HVA. The MAO and COMT inhibitors increased the production of [(11)C]3-methoxytyramine and [(11)C]DOPAC, respectively. These results reflect the L-DOPA metabolic pathway, suggesting that this method may be useful for assessing dopaminergic metabolism.

  7. Monoamine Oxidase A (MAOA) and Catechol-O-Methyltransferase (COMT) Gene Polymorphisms Interact with Maternal Parenting in Association with Adolescent Reactive Aggression but not Proactive Aggression: Evidence of Differential Susceptibility.

    PubMed

    Zhang, Wenxin; Cao, Cong; Wang, Meiping; Ji, Linqin; Cao, Yanmiao

    2016-04-01

    To date, whether and how gene-environment (G × E) interactions operate differently across distinct subtypes of aggression remains untested. More recently, in contrast with the diathesis-stress hypothesis, an alternative hypothesis of differential susceptibility proposes that individuals could be differentially susceptible to environments depending on their genotypes in a "for better and for worse" manner. The current study examined interactions between monoamine oxidase A (MAOA) T941G and catechol-O-methyltransferase (COMT) Val158Met polymorphisms with maternal parenting on two types of aggression: reactive and proactive. Moreover, whether these potential G × E interactions would be consistent with the diathesis-stress versus the differential susceptibility hypothesis was tested. Within the sample of 1399 Chinese Han adolescents (47.2 % girls, M age = 12.32 years, SD = 0.50), MAOA and COMT genes both interacted with positive parenting in their associations with reactive but not proactive aggression. Adolescents with T alleles/TT homozygotes of MAOA gene or Met alleles of COMT gene exhibited more reactive aggression when exposed to low positive parenting, but less reactive aggression when exposed to high positive parenting. These findings provide the first evidence for distinct G × E interaction effects on reactive versus proactive aggression and lend further support for the differential susceptibility hypothesis.

  8. Loss of LSD1 (lysine-specific demethylase 1) suppresses growth and alters gene expression of human colon cancer cells in a p53- and DNMT1(DNA methyltransferase 1)-independent manner

    PubMed Central

    Jin, Lihua; Hanigan, Christin L.; Wu, Yu; Wang, Wei; Park, Ben Ho; Woster, Patrick M.; Casero, Robert A.

    2012-01-01

    Epigenetic silencing of gene expression is important in cancer. Aberrant DNA CpG island hypermethylation and histone modifications are involved in the aberrant silencing of tumour-suppressor genes. LSD1 (lysine-specific demethylase 1) is a H3K4 (histone H3 Lys4) demethylase associated with gene repression and is overexpressed in multiple cancer types. LSD1 has also been implicated in targeting p53 and DNMT1 (DNA methyltransferase 1), with data suggesting that the demethylating activity of LSD1 on these proteins is necessary for their stabilization. To examine the role of LSD1 we generated LSD1 heterozygous (LSD1+/−) and homozygous (LSD1−/−) knockouts in the human colorectal cancer cell line HCT116. The deletion of LSD1 led to a reduced cell proliferation both in vitro and in vivo. Surprisingly, the knockout of LSD1 in HCT116 cells did not result in global increases in its histone substrate H3K4me2 (dimethyl-H3K4) or changes in the stability or function of p53 or DNMT1. However, there was a significant difference in gene expression between cells containing LSD1 and those null for LSD1. The results of the present study suggested that LSD1 is critical in the regulation of cell proliferation, but also indicated that LSD1 is not an absolute requirement for the stabilization of either p53 or DNMT1. PMID:23072722

  9. Loss of LSD1 (lysine-specific demethylase 1) suppresses growth and alters gene expression of human colon cancer cells in a p53- and DNMT1(DNA methyltransferase 1)-independent manner.

    PubMed

    Jin, Lihua; Hanigan, Christin L; Wu, Yu; Wang, Wei; Park, Ben Ho; Woster, Patrick M; Casero, Robert A

    2013-01-15

    Epigenetic silencing of gene expression is important in cancer. Aberrant DNA CpG island hypermethylation and histone modifications are involved in the aberrant silencing of tumour-suppressor genes. LSD1 (lysine-specific demethylase 1) is a H3K4 (histone H3 Lys4) demethylase associated with gene repression and is overexpressed in multiple cancer types. LSD1 has also been implicated in targeting p53 and DNMT1 (DNA methyltransferase 1), with data suggesting that the demethylating activity of LSD1 on these proteins is necessary for their stabilization. To examine the role of LSD1 we generated LSD1 heterozygous (LSD1+/-) and homozygous (LSD1-/-) knockouts in the human colorectal cancer cell line HCT116. The deletion of LSD1 led to a reduced cell proliferation both in vitro and in vivo. Surprisingly, the knockout of LSD1 in HCT116 cells did not result in global increases in its histone substrate H3K4me2 (dimethyl-H3K4) or changes in the stability or function of p53 or DNMT1. However, there was a significant difference in gene expression between cells containing LSD1 and those null for LSD1. The results of the present study suggested that LSD1 is critical in the regulation of cell proliferation, but also indicated that LSD1 is not an absolute requirement for the stabilization of either p53 or DNMT1.

  10. Involvement of S-adenosylmethionine-dependent halide/thiol methyltransferase (HTMT) in methyl halide emissions from agricultural plants: isolation and characterization of an HTMT-coding gene from Raphanus sativus (daikon radish)

    PubMed Central

    Itoh, Nobuya; Toda, Hiroshi; Matsuda, Michiko; Negishi, Takashi; Taniguchi, Tomokazu; Ohsawa, Noboru

    2009-01-01

    Background Biogenic emissions of methyl halides (CH3Cl, CH3Br and CH3I) are the major source of these compounds in the atmosphere; however, there are few reports about the halide profiles and strengths of these emissions. Halide ion methyltransferase (HMT) and halide/thiol methyltransferase (HTMT) enzymes concerning these emissions have been purified and characterized from several organisms including marine algae, fungi, and higher plants; however, the correlation between emission profiles of methyl halides and the enzymatic properties of HMT/HTMT, and their role in vivo remains unclear. Results Thirty-five higher plant species were screened, and high CH3I emissions and HMT/HTMT activities were found in higher plants belonging to the Poaceae family, including wheat (Triticum aestivum L.) and paddy rice (Oryza sativa L.), as well as the Brassicaceae family, including daikon radish (Raphanus sativus). The in vivo emission of CH3I clearly correlated with HMT/HTMT activity. The emission of CH3I from the sprouting leaves of R. sativus, T. aestivum and O. sativa grown hydroponically increased with increasing concentrations of supplied iodide. A gene encoding an S-adenosylmethionine halide/thiol methyltransferase (HTMT) was cloned from R. sativus and expressed in Escherichia coli as a soluble protein. The recombinant R. sativus HTMT (RsHTMT) was revealed to possess high specificity for iodide (I-), bisulfide ([SH]-), and thiocyanate ([SCN]-) ions. Conclusion The present findings suggest that HMT/HTMT activity is present in several families of higher plants including Poaceae and Brassicaceae, and is involved in the formation of methyl halides. Moreover, it was found that the emission of methyl iodide from plants was affected by the iodide concentration in the cultures. The recombinant RsHTMT demonstrated enzymatic properties similar to those of Brassica oleracea HTMT, especially in terms of its high specificity for iodide, bisulfide, and thiocyanate ions. A survey of

  11. Involvement of S-adenosylmethionine-dependent halide/thiol methyltransferase (HTMT) in methyl halide emissions from agricultural plants: isolation and characterization of an HTMT-coding gene from Raphanus sativus (daikon radish).

    PubMed

    Itoh, Nobuya; Toda, Hiroshi; Matsuda, Michiko; Negishi, Takashi; Taniguchi, Tomokazu; Ohsawa, Noboru

    2009-09-01

    Biogenic emissions of methyl halides (CH3Cl, CH3Br and CH3I) are the major source of these compounds in the atmosphere; however, there are few reports about the halide profiles and strengths of these emissions. Halide ion methyltransferase (HMT) and halide/thiol methyltransferase (HTMT) enzymes concerning these emissions have been purified and characterized from several organisms including marine algae, fungi, and higher plants; however, the correlation between emission profiles of methyl halides and the enzymatic properties of HMT/HTMT, and their role in vivo remains unclear. Thirty-five higher plant species were screened, and high CH3I emissions and HMT/HTMT activities were found in higher plants belonging to the Poaceae family, including wheat (Triticum aestivum L.) and paddy rice (Oryza sativa L.), as well as the Brassicaceae family, including daikon radish (Raphanus sativus). The in vivo emission of CH3I clearly correlated with HMT/HTMT activity. The emission of CH3I from the sprouting leaves of R. sativus, T. aestivum and O. sativa grown hydroponically increased with increasing concentrations of supplied iodide. A gene encoding an S-adenosylmethionine halide/thiol methyltransferase (HTMT) was cloned from R. sativus and expressed in Escherichia coli as a soluble protein. The recombinant R. sativus HTMT (RsHTMT) was revealed to possess high specificity for iodide (I-), bisulfide ([SH]-), and thiocyanate ([SCN]-) ions. The present findings suggest that HMT/HTMT activity is present in several families of higher plants including Poaceae and Brassicaceae, and is involved in the formation of methyl halides. Moreover, it was found that the emission of methyl iodide from plants was affected by the iodide concentration in the cultures. The recombinant RsHTMT demonstrated enzymatic properties similar to those of Brassica oleracea HTMT, especially in terms of its high specificity for iodide, bisulfide, and thiocyanate ions. A survey of biogenic emissions of methyl

  12. Protein Arginine Methyltransferase 7 Regulates Cellular Response to DNA Damage by Methylating Promoter Histones H2A and H4 of the Polymerase δ Catalytic Subunit Gene, POLD1*

    PubMed Central

    Karkhanis, Vrajesh; Wang, Li; Tae, Sookil; Hu, Yu-Jie; Imbalzano, Anthony N.; Sif, Saïd

    2012-01-01

    Covalent modification of histones by protein arginine methyltransferases (PRMTs) impacts genome organization and gene expression. In this report, we show that PRMT7 interacts with the BRG1-based hSWI/SNF chromatin remodeling complex and specifically methylates histone H2A Arg-3 (H2AR3) and histone H4 Arg-3 (H4R3). To elucidate the biological function of PRMT7, we knocked down its expression in NIH 3T3 cells and analyzed global gene expression. Our findings show that PRMT7 negatively regulates expression of genes involved in DNA repair, including ALKBH5, APEX2, POLD1, and POLD2. Chromatin immunoprecipitation (ChIP) revealed that PRMT7 and dimethylated H2AR3 and H4R3 are enriched at target DNA repair genes in parental cells, whereas PRMT7 knockdown caused a significant decrease in PRMT7 recruitment and H2AR3/H4R3 methylation. Decreased PRMT7 expression also resulted in derepression of target DNA repair genes and enhanced cell resistance to DNA-damaging agents. Furthermore, we show that BRG1 co-localizes with PRMT7 on target promoters and that expression of a catalytically inactive form of BRG1 results in derepression of PRMT7 target DNA repair genes. Remarkably, reducing expression of individual PRMT7 target DNA repair genes showed that only the catalytic subunit of DNA polymerase, POLD1, was able to resensitize PRMT7 knock-down cells to DNA-damaging agents. These results provide evidence for the important role played by PRMT7 in epigenetic regulation of DNA repair genes and cellular response to DNA damage. PMID:22761421

  13. Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland.

    PubMed

    Rusin, M; Samojedny, A; Harris, C C; Chorazy, M

    1999-09-19

    Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance. Copyright 1999 Wiley-Liss, Inc.

  14. Evolution of Cinnamate/p-Coumarate Carboxyl Methyltransferases and Their Role in the Biosynthesis of Methylcinnamate[W

    PubMed Central

    Kapteyn, Jeremy; Qualley, Anthony V.; Xie, Zhengzhi; Fridman, Eyal; Dudareva, Natalia; Gang, David R.

    2007-01-01

    Methylcinnamate, which is widely distributed throughout the plant kingdom, is a significant component of many floral scents and an important signaling molecule between plants and insects. Comparison of an EST database obtained from the glandular trichomes of a basil (Ocimum basilicum) variety that produces high levels of methylcinnamate (line MC) with other varieties producing little or no methylcinnamate identified several very closely related genes belonging to the SABATH family of carboxyl methyltransferases that are highly and almost exclusively expressed in line MC. Biochemical characterization of the corresponding recombinant proteins showed that cinnamate and p-coumarate are their best substrates for methylation, thus designating these enzymes as cinnamate/p-coumarate carboxyl methyltransferases (CCMTs). Gene expression, enzyme activity, protein profiling, and metabolite content analyses demonstrated that CCMTs are responsible for the formation of methylcinnamate in sweet basil. A phylogenetic analysis of the entire SABATH family placed these CCMTs into a clade that includes indole-3-acetic acid carboxyl methyltransferases and a large number of uncharacterized carboxyl methyltransferase–like proteins from monocots and lower plants. Structural modeling and ligand docking suggested active site residues that appear to contribute to the substrate preference of CCMTs relative to other members of the SABATH family. Site-directed mutagenesis of specific residues confirmed these findings. PMID:17951447

  15. Trypanosoma brucei prenylated-protein carboxyl methyltransferase prefers farnesylated substrates.

    PubMed Central

    Buckner, Frederick S; Kateete, David P; Lubega, George W; Van Voorhis, Wesley C; Yokoyama, Kohei

    2002-01-01

    Carboxyl methylation of the C-terminal prenylated cysteine, which occurs in most farnesylated and geranylgeranylated proteins, is a reversible step and is implicated in the regulation of membrane binding and cellular functions of prenylated proteins such as GTPases. The gene coding for prenylated-protein carboxyl methyltransferase (PPMT) of the protozoan parasite Trypanosoma brucei has been cloned and expressed in the baculovirus/Sf9 cell system. The protein of 245 amino acids has 24-28% sequence identity to the orthologues from other species including human and Saccharomyces cerevisiae. Methyltransferase activity was detected in the membrane fraction from Sf9 cells infected with the recombinant baculovirus using N -acetyl- S -farnesylcysteine (AFC) and S -adenosyl[ methyl -(3)H]methionine ([(3)H]AdoMet) as substrates. Recombinant T. brucei PPMT prefers AFC to N -acetyl- S -geranylgeranylcysteine (AGGC) by 10-50-fold based on the V (max)/ K (m) values. Native PPMT activity detected in the membrane fraction from T. brucei procyclics displays similar substrate specificity ( approximately 40-fold preference for AFC over AGGC). In contrast, mouse liver PPMT utilizes both AFC and AGGC as substrates with similar catalytic efficiencies. Several cellular proteins of the T. brucei bloodstream form were shown to be carboxyl methylated in a cell-free system. Incorporation of [(3)H]methyl group from [(3)H]AdoMet into most of the proteins was significantly inhibited by AFC but not AGGC at 20 microM, suggesting that T. brucei PPMT acts on farnesylated proteins in the cell. Cells of the T. brucei bloodstream form show higher sensitivity to AFC and AGGC (EC(50)=70-80 microM) compared with mouse 3T3 cells (EC(50)>150 microM). PMID:12141948

  16. IDENTIFYING CRITICAL CYSTEINE RESIDUES IN ARSENIC (+3 OXIDATION STATE) METHYLTRANSFERASE

    EPA Science Inventory

    Arsenic (+3 oxidation state) methyltransferase (AS3MT) catalyzes methylation of inorganic arsenic to mono, di, and trimethylated arsenicals. Orthologous AS3MT genes in genomes ranging from simple echinoderm to human predict a protein with five conserved cysteine (C) residues. In ...

  17. IDENTIFYING CRITICAL CYSTEINE RESIDUES IN ARSENIC (+3 OXIDATION STATE) METHYLTRANSFERASE

    EPA Science Inventory

    Arsenic (+3 oxidation state) methyltransferase (AS3MT) catalyzes methylation of inorganic arsenic to mono, di, and trimethylated arsenicals. Orthologous AS3MT genes in genomes ranging from simple echinoderm to human predict a protein with five conserved cysteine (C) residues. In ...

  18. The Cj0588 protein is a Campylobacter jejuni RNA methyltransferase.

    PubMed

    Sałamaszyńska-Guz, Agnieszka; Taciak, Bartłomiej; Kwiatek, Agnieszka; Klimuszko, Danuta

    2014-06-06

    TlyA proteins belong to 2'-O-methyltransferases. Methylation is a common posttranscriptional RNA modification. The Campylobacter jejuni Cj0588 protein belongs to the TlyA(I) protein family and is a rRNA methyltransferase. Methylation of ribosomal RNA catalyzed by Cj0588 appears to have an impact on the biology of the cell. Presence of the cj0588 gene in bacteria appears to be important for ribosome stability and virulence properties. Absence of the Cj0588 protein causes accumulation of the 50S ribosomal subunits, reduction in the amount of functional 70S ribosomes and confers increase resistance to capreomycin.

  19. Multiple lysine methylation of PCAF by Set9 methyltransferase

    SciTech Connect

    Masatsugu, Toshihiro; Yamamoto, Ken

    2009-03-27

    The molecular functions of several non-histone proteins are regulated through lysine modification by histone methyltransferases. The p300/CBP-associated factor (PCAF) is an acetyltransferase that has been implicated in many cellular processes. Here, we report that PCAF is a novel substrate of Set9 methyltransferase. In vitro mapping experiments revealed six lysine residues could be methylated by Set9. A comparison of amino acid sequences of target sites revealed the novel consensus motif which differs from previously identified Set9-consensus sequence. Further methyltransferase assays focusing on the six lysine residues showed that K78 and K89 are preferentially methylated in full-length PCAF in vitro. Using specific antibodies recognizing mono-methylated K89, in vivo PCAF methylation and its nuclear localization were demonstrated. Our data may lead to a new insight into PCAF functions and provide additional information to identify unknown targets of Set9.

  20. Overexpression of Selenocysteine Methyltransferase in Arabidopsis and Indian Mustard Increases Selenium Tolerance and Accumulation1

    PubMed Central

    LeDuc, Danika L.; Tarun, Alice S.; Montes-Bayon, Maria; Meija, Juris; Malit, Michele F.; Wu, Carol P.; AbdelSamie, Manal; Chiang, Chih-Yuan; Tagmount, Abderrhamane; deSouza, Mark; Neuhierl, Bernhard; Böck, August; Caruso, Joseph; Terry, Norman

    2004-01-01

    A major goal of phytoremediation is to transform fast-growing plants with genes from plant species that hyperaccumulate toxic trace elements. We overexpressed the gene encoding selenocysteine methyltransferase (SMT) from the selenium (Se) hyperaccumulator Astragalus bisulcatus in Arabidopsis and Indian mustard (Brassica juncea). SMT detoxifies selenocysteine by methylating it to methylselenocysteine, a nonprotein amino acid, thereby diminishing the toxic misincorporation of Se into protein. Our Indian mustard transgenic plants accumulated more Se in the form of methylselenocysteine than the wild type. SMT transgenic seedlings tolerated Se, particularly selenite, significantly better than the wild type, producing 3- to 7-fold greater biomass and 3-fold longer root lengths. Moreover, SMT plants had significantly increased Se accumulation and volatilization. This is the first study, to our knowledge, in which a fast-growing plant was genetically engineered to overexpress a gene from a hyperaccumulator in order to increase phytoremediation potential. PMID:14671009

  1. DNA adenine methyltransferase (Dam) controls the expression of the cytotoxic enterotoxin (act) gene of Aeromonas hydrophila via tRNA modifying enzyme-glucose-inhibited division protein (GidA).

    PubMed

    Erova, Tatiana E; Kosykh, Valeri G; Sha, Jian; Chopra, Ashok K

    2012-05-01

    Aeromonas hydrophila is both a human and animal pathogen, and the cytotoxic enterotoxin (Act) is a crucial virulence factor of this bacterium because of its associated hemolytic, cytotoxic, and enterotoxic activities. Previously, to define the role of some regulatory genes in modulating Act production, we showed that deletion of a glucose-inhibited division gene (gidA) encoding tRNA methylase reduced Act levels, while overproduction of DNA adenine methyltransferase (Dam) led to a concomitant increase in Act-associated biological activities of a diarrheal isolate SSU of A. hydrophila. Importantly, there are multiple GATC binding sites for Dam within an upstream sequence of the gidA gene and one such target site in the act gene upstream region. We showed the dam gene to be essential for the viability of A. hydrophila SSU, and, therefore, to better understand the interaction of the encoding genes, Dam and GidA, in act gene regulation, we constructed a gidA in-frame deletion mutant of Escherichia coli GM28 (dam(+)) and GM33 (∆dam) strains. We then tested the expressional activity of the act and gidA genes by using a promoterless pGlow-TOPO vector containing a reporter green fluorescent protein (GFP). Our data indicated that in GidA(+) strains of E. coli, constitutive methylation of the GATC site(s) by Dam negatively regulated act and gidA gene expression as measured by GFP production. However, in the ∆gidA strains, irrespective of the presence or absence of constitutively active Dam, we did not observe any alteration in the expression of the act gene signifying the role of GidA in positively regulating Act production. To determine the exact mechanism of how Dam and GidA influence Act, a real-time quantitative PCR (RT-qPCR) assay was performed. The analysis indicated an increase in gidA and act gene expression in the A. hydrophila Dam-overproducing strain, and these data matched with Act production in the E. coli GM28 strain. Thus, the extent of DNA methylation

  2. Structure-Activity Relationships of Diverse Oxazolidinones for Linezolid-Resistant Staphylococcus aureus Strains Possessing the cfr Methyltransferase Gene or Ribosomal Mutations▿

    PubMed Central

    Locke, Jeffrey B.; Finn, John; Hilgers, Mark; Morales, Gracia; Rahawi, Shahad; G. C., Kedar; Picazo, Juan José; Im, Weonbin; Shaw, Karen Joy; Stein, Jeffrey L.

    2010-01-01

    Staphylococcal resistance to linezolid (LZD) is mediated through ribosomal mutations (23S rRNA or ribosomal proteins L3 and L4) or through methylation of 23S rRNA by the horizontally transferred Cfr methyltransferase. To investigate the structural basis for oxazolidinone activity against LZD-resistant (LZDr) strains, we compared structurally diverse, clinically relevant oxazolidinones, including LZD, radezolid (RX-1741), TR-700 (torezolid), and a set of TR-700 analogs (including novel CD-rings and various A-ring C-5 substituents), against a panel of laboratory-derived and clinical LZDr Staphylococcus aureus strains possessing a variety of resistance mechanisms. Potency against all strains was correlated with optimization of C- and D-rings, which interact with more highly conserved regions of the peptidyl transferase center binding site. Activity against cfr strains was retained with either hydroxymethyl or 1,2,3-triazole C-5 groups but was reduced by 2- to 8-fold in compounds with acetamide substituents. LZD, which possesses a C-5 acetamide group and lacks a D-ring substituent, demonstrated the lowest potency against all strains tested, particularly against cfr strains. These data reveal key features contributing to oxazolidinone activity and highlight structural tradeoffs between potency against susceptible strains and potency against strains with various resistance mechanisms. PMID:20837751

  3. Age-Dependent Effects of Catechol-O-Methyltransferase (COMT) Gene Val158Met Polymorphism on Language Function in Developing Children.

    PubMed

    Sugiura, Lisa; Toyota, Tomoko; Matsuba-Kurita, Hiroko; Iwayama, Yoshimi; Mazuka, Reiko; Yoshikawa, Takeo; Hagiwara, Hiroko

    2016-11-30

    The genetic basis controlling language development remains elusive. Previous studies of the catechol-O-methyltransferase (COMT) Val(158)Met genotype and cognition have focused on prefrontally guided executive functions involving dopamine. However, COMT may further influence posterior cortical regions implicated in language perception. We investigated whether COMT influences language ability and cortical language processing involving the posterior language regions in 246 children aged 6-10 years. We assessed language ability using a language test and cortical responses recorded during language processing using a word repetition task and functional near-infrared spectroscopy. The COMT genotype had significant effects on language performance and processing. Importantly, Met carriers outperformed Val homozygotes in language ability during the early elementary school years (6-8 years), whereas Val homozygotes exhibited significant language development during the later elementary school years. Both genotype groups exhibited equal language performance at approximately 10 years of age. Val homozygotes exhibited significantly less cortical activation compared with Met carriers during word processing, particularly at older ages. These findings regarding dopamine transmission efficacy may be explained by a hypothetical inverted U-shaped curve. Our findings indicate that the effects of the COMT genotype on language ability and cortical language processing may change in a narrow age window of 6-10 years.

  4. Structure-activity relationships of diverse oxazolidinones for linezolid-resistant Staphylococcus aureus strains possessing the cfr methyltransferase gene or ribosomal mutations.

    PubMed

    Locke, Jeffrey B; Finn, John; Hilgers, Mark; Morales, Gracia; Rahawi, Shahad; G C, Kedar; Picazo, Juan José; Im, Weonbin; Shaw, Karen Joy; Stein, Jeffrey L

    2010-12-01

    Staphylococcal resistance to linezolid (LZD) is mediated through ribosomal mutations (23S rRNA or ribosomal proteins L3 and L4) or through methylation of 23S rRNA by the horizontally transferred Cfr methyltransferase. To investigate the structural basis for oxazolidinone activity against LZD-resistant (LZD(r)) strains, we compared structurally diverse, clinically relevant oxazolidinones, including LZD, radezolid (RX-1741), TR-700 (torezolid), and a set of TR-700 analogs (including novel CD-rings and various A-ring C-5 substituents), against a panel of laboratory-derived and clinical LZD(r) Staphylococcus aureus strains possessing a variety of resistance mechanisms. Potency against all strains was correlated with optimization of C- and D-rings, which interact with more highly conserved regions of the peptidyl transferase center binding site. Activity against cfr strains was retained with either hydroxymethyl or 1,2,3-triazole C-5 groups but was reduced by 2- to 8-fold in compounds with acetamide substituents. LZD, which possesses a C-5 acetamide group and lacks a D-ring substituent, demonstrated the lowest potency against all strains tested, particularly against cfr strains. These data reveal key features contributing to oxazolidinone activity and highlight structural tradeoffs between potency against susceptible strains and potency against strains with various resistance mechanisms.

  5. Recent advances in methyltransferase biocatalysis.

    PubMed

    Bennett, Matthew R; Shepherd, Sarah A; Cronin, Victoria A; Micklefield, Jason

    2017-04-01

    S-adenosyl-L-methionine-dependent methyltransferses are ubiquitous in nature, methylating a vast range of small molecule metabolites, as well as biopolymers. This review covers the recent advances in the development of methyltransferase enzymes for synthetic applications, focusing on the methyltransferase catalyzed transformations with S-adenosyl methionine analogs, as well as non-native substrates. We discuss how metabolic engineering approaches have been used to enhance S-adenosyl methionine production in vivo. Enzymatic approaches that enable the more efficient generation of S-adenosyl methionine analogs, including more stable analogs, will also be described; this has expanded the biocatalytic repertoire of methyltransferases from methylation to a broader range of alkylation reactions. The review also examines how the selectivity of the methyltransferase enzymes can be improved through structure guided mutagenesis approaches. Finally, we will discuss how methyltransferases can be deployed in multi-enzyme cascade reactions and suggest future challenges and avenues for further investigation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Aberrant methylation accounts for cell adhesion-related gene silencing during 3-methylcholanthrene and diethylnitrosamine induced multistep rat lung carcinogenesis associated with overexpression of DNA methyltransferases 1 and 3a

    SciTech Connect

    Liu Wenbin; Cui Zhihong; Ao Lin; Zhou Ziyuan; Zhou Yanhong; Yuan Xiaoyan; Xiang Yunlong; Liu Jinyi Cao Jia

    2011-02-15

    To evaluate the significance of alterations in cell adhesion-related genes methylation during lung multistep carcinogenesis induced by the genotoxic carcinogens 3-methylcholanthrene (MCA) and diethylnitrosamine (DEN), tissue samples microdissected from MCA/DEN-induced rat lung carcinogenesis model were subjected to methylation-specific PCR to evaluate the DNA methylation status of CADM1, TIMP3, E-cadherin and N-cadherin. Immunohistochemistry was used to determine protein expression of CADM1, TIMP3, N-cadherin and the DNA methyltransferases (DNMTs) 1, 3a and 3b. E-cadherin hypermethylation was not detected in any tissue. CADM1, TIMP3 and N-cadherin hypermethylation was correlated with the loss of their protein expression during the progression of pathologic lesions. The prevalence of DNA methylation of at least one gene and the average number of methylated genes increased with the histological progression. DNMT1 and DNMT3a protein expression increased progressively during the stages of lung carcinogenesis, whereas DNMT3b overexpression was only found in several samples. Furthermore, DNMT1 protein expression levels were correlated with CADM1 methylation, and DNMT3a protein expression levels were correlated with CADM1, TIMP3 and N-cadherin methylation. The average number of methylated genes during carcinogenesis was significantly correlated with DNMT1 and DNMT3a protein expression levels. Moreover, mRNA expression of CADM1 significantly increased after treatment with DNMT inhibitor 5-aza-2'-deoxycytidine in CADM1-methylated primary tumor cell lines. Our findings suggest that an accumulation of hypermethylation accounts for cell adhesion-related gene silencing is associated with dynamic changes in the progression of MCA/DEN-induced rat lung carcinogenesis. We suggest that DNMT1 and DNMT3a protein overexpression may be responsible for this aberrant DNA methylation.

  7. Segregation and linkage studies of plasma dopamine-beta-hydroxylase (DBH), erythrocyte catechol-O-methyltransferase (COMT), and platelet monoamine oxidase (MAO): possible linkage between the ABO locus and a gene controlling DBH activity.

    PubMed Central

    Goldin, L R; Gershon, E S; Lake, C R; Murphy, D L; McGinniss, M; Sparkes, R S

    1982-01-01

    Measurements of dopamine-beta-hydroxylase (DBH), catechol-O-methyltransferase (COMT), and monoamine oxidase (MAO) along with 27 polymorphic marker phenotypes were available for 162 patients with major affective disorders and 1,125 of their relatives. Levels of enzymes were previously found not to be associated with illness. Pedigree analysis methods for quantitative traits are used to test single-gene hypotheses for segregation of DBH in 32 families with 411 individuals. COMT in 30 families with 351 individuals, and MAO in 50 families with 309 individuals. The familial distribution of both DBH and COMT are consistent with two codominant alleles at the same locus that account for 56% and 59% of the total variance, respectively. MAO activity cannot be shown to be segregating as a single major gene, but a purely nongenetic hypothesis is also rejected. A possible linkage of a locus for DBH to the ABO locus is indicated by a maximum lod score of 1.82 at 0% and 10% recombination fractions for males and females, respectively. A lod score of 0.61 at 0% recombination for a similar analysis in a single large pedigree was reported by Elston et al., making the combined lod score for the two studies equal to 2.32 at 0% recombination. PMID:6951409

  8. Gene Expressions for Signal Transduction under Acidic Conditions

    PubMed Central

    Fukamachi, Toshihiko; Ikeda, Syunsuke; Wang, Xin; Saito, Hiromi; Tagawa, Masatoshi; Kobayashi, Hiroshi

    2013-01-01

    Although it is now well known that some diseased areas, such as cancer nests, inflammation loci, and infarction areas, are acidified, little is known about cellular signal transduction, gene expression, and cellular functions under acidic conditions. Our group showed that different signal proteins were activated under acidic conditions compared with those observed in a typical medium of around pH 7.4 that has been used until now. Investigations of gene expression under acidic conditions may be crucial to our understanding of signal transduction in acidic diseased areas. In this study, we investigated gene expression in mesothelioma cells cultured at an acidic pH using a DNA microarray technique. After 24 h culture at pH 6.7, expressions of 379 genes were increased more than twofold compared with those in cells cultured at pH 7.5. Genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors numbered 35, 32, and 17 among the 379 genes, respectively. Since the functions of 78 genes are unknown, it can be argued that cells may have other genes for signaling under acidic conditions. The expressions of 37 of the 379 genes were observed to increase after as little as 2 h. After 24 h culture at pH 6.7, expressions of 412 genes were repressed more than twofold compared with those in cells cultured at pH 7.5, and the 412 genes contained 35, 76, and 7 genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors, respectively. These results suggest that the signal pathways in acidic diseased areas are different, at least in part, from those examined with cells cultured at a pH of around 7.4. PMID:24705103

  9. Endogenous reductants support the catalytic function of recombinant rat cyt19, an arsenic methyltransferase.

    PubMed

    Waters, Stephen B; Devesa, Vicenta; Del Razo, Luz Maria; Styblo, Miroslav; Thomas, David J

    2004-03-01

    The postulated scheme for the metabolism of inorganic As involves alternating steps of oxidative methylation and of reduction of As from the pentavalent to the trivalent oxidation state, producing methylated compounds containing AsIII that are highly reactive and toxic. S-Adenosyl-L-methionine:AsIII methyltransferase purified from rat liver catalyzes production of methyl and dimethyl arsenicals from inorganic As. This protein is encoded by the cyt19 gene orthologous with cyt19 genes in mouse and human. The reductants dithiothreitol or tris(2-carboxylethyl)phosphine support catalysis by recombinant rat cyt19 (rrcyt19). Coupled systems containing an endogenous reductant (thioredoxin/thioredoxin reductase/NADPH, glutaredoxin/glutathione/glutathione reductase/NADPH, or lipoic acid/thioredoxin reductase/NADPH) support inorganic As methylation by rrcyt19. Although glutathione alone does not support rrcyt19's catalytic function, its addition to reaction mixtures containing other reductants increases the rate of As methylation. Aurothioglucose, an inhibitor of thioredoxin reductase, reduces the rate of As methylation by rrcyt19 in thioredoxin-supported reactions. Addition of guinea pig liver cytosol, a poor source of endogenous As methyltransferase activity, to reaction mixtures containing rrcyt19 shows that endogenous reductants in cytosol support the enzyme's activity. Methylated compounds containing either AsIII or AsV are detected in reaction mixtures containing rrcyt19, suggesting that cycling of As between oxidation states is a component of the pathway producing methylated arsenicals. This enzyme may use endogenous reductants to reduce pentavalent arsenicals to trivalency as a prerequisite for utilization as substrates for methylation reactions. Thus, cyt19 appears to possess both AsIII methyltransferase and AsV reductase activities.

  10. A nonpyrrolysine member of the widely distributed trimethylamine methyltransferase family is a glycine betaine methyltransferase

    DOE PAGES

    Ticak, Tomislav; Kountz, D. J.; Girosky, K. E.; ...

    2014-10-13

    COG5598 comprises a large number of proteins related to MttB, the trimethylamine:corrinoid methyltransferase. MttB has a genetically encoded pyrrolysine residue proposed essential for catalysis. MttB is the only known trimethylamine methyltransferase, yet the great majority of members of COG5598 lack pyrrolysine, leaving the activity of these proteins an open question. Here, we describe the function of one of the nonpyrrolysine members of this large protein family. Three nonpyrrolysine MttB homologs are encoded in Desulfitobacterium hafniense, a Gram-positive strict anaerobe present in both the environment and human intestine. D. hafniense was found capable of growth on glycine betaine with electron acceptorsmore » such as nitrate or fumarate, producing dimethylglycine and CO2 as products. Examination of the genome revealed genes for tetrahydrofolate-linked oxidation of a methyl group originating from a methylated corrinoid protein, but no obvious means to carry out corrinoid methylation with glycine betaine. DSY3156, encoding one of the nonpyrrolysine MttB homologs, was up-regulated during growth on glycine betaine. The recombinant DSY3156 protein converts glycine betaine and cob(I)alamin to dimethylglycine and methylcobalamin. To our knowledge, DSY3156 is the first glycine betaine:corrinoid methyltransferase described, and a designation of MtgB is proposed. Additionally, DSY3157, an adjacently encoded protein, was shown to be a methylcobalamin:tetrahydrofolate methyltransferase and is designated MtgA. Homologs of MtgB are widely distributed, especially in marine bacterioplankton and nitrogen-fixing plant symbionts. Lastly, they are also found in multiple members of the human microbiome, and may play a beneficial role in trimethylamine homeostasis, which in recent years has been directly tied to human cardiovascular health.« less

  11. A nonpyrrolysine member of the widely distributed trimethylamine methyltransferase family is a glycine betaine methyltransferase

    SciTech Connect

    Ticak, Tomislav; Kountz, D. J.; Girosky, K. E.; Krzycki, J. A.; Ferguson, D. J.

    2014-10-13

    COG5598 comprises a large number of proteins related to MttB, the trimethylamine:corrinoid methyltransferase. MttB has a genetically encoded pyrrolysine residue proposed essential for catalysis. MttB is the only known trimethylamine methyltransferase, yet the great majority of members of COG5598 lack pyrrolysine, leaving the activity of these proteins an open question. Here, we describe the function of one of the nonpyrrolysine members of this large protein family. Three nonpyrrolysine MttB homologs are encoded in Desulfitobacterium hafniense, a Gram-positive strict anaerobe present in both the environment and human intestine. D. hafniense was found capable of growth on glycine betaine with electron acceptors such as nitrate or fumarate, producing dimethylglycine and CO2 as products. Examination of the genome revealed genes for tetrahydrofolate-linked oxidation of a methyl group originating from a methylated corrinoid protein, but no obvious means to carry out corrinoid methylation with glycine betaine. DSY3156, encoding one of the nonpyrrolysine MttB homologs, was up-regulated during growth on glycine betaine. The recombinant DSY3156 protein converts glycine betaine and cob(I)alamin to dimethylglycine and methylcobalamin. To our knowledge, DSY3156 is the first glycine betaine:corrinoid methyltransferase described, and a designation of MtgB is proposed. Additionally, DSY3157, an adjacently encoded protein, was shown to be a methylcobalamin:tetrahydrofolate methyltransferase and is designated MtgA. Homologs of MtgB are widely distributed, especially in marine bacterioplankton and nitrogen-fixing plant symbionts. Lastly, they are also found in multiple members of the human microbiome, and may play a beneficial role in trimethylamine homeostasis, which in recent years has been directly tied to human cardiovascular health.

  12. A nonpyrrolysine member of the widely distributed trimethylamine methyltransferase family is a glycine betaine methyltransferase.

    PubMed

    Ticak, Tomislav; Kountz, Duncan J; Girosky, Kimberly E; Krzycki, Joseph A; Ferguson, Donald J

    2014-10-28

    COG5598 comprises a large number of proteins related to MttB, the trimethylamine:corrinoid methyltransferase. MttB has a genetically encoded pyrrolysine residue proposed essential for catalysis. MttB is the only known trimethylamine methyltransferase, yet the great majority of members of COG5598 lack pyrrolysine, leaving the activity of these proteins an open question. Here, we describe the function of one of the nonpyrrolysine members of this large protein family. Three nonpyrrolysine MttB homologs are encoded in Desulfitobacterium hafniense, a Gram-positive strict anaerobe present in both the environment and human intestine. D. hafniense was found capable of growth on glycine betaine with electron acceptors such as nitrate or fumarate, producing dimethylglycine and CO2 as products. Examination of the genome revealed genes for tetrahydrofolate-linked oxidation of a methyl group originating from a methylated corrinoid protein, but no obvious means to carry out corrinoid methylation with glycine betaine. DSY3156, encoding one of the nonpyrrolysine MttB homologs, was up-regulated during growth on glycine betaine. The recombinant DSY3156 protein converts glycine betaine and cob(I)alamin to dimethylglycine and methylcobalamin. To our knowledge, DSY3156 is the first glycine betaine:corrinoid methyltransferase described, and a designation of MtgB is proposed. In addition, DSY3157, an adjacently encoded protein, was shown to be a methylcobalamin:tetrahydrofolate methyltransferase and is designated MtgA. Homologs of MtgB are widely distributed, especially in marine bacterioplankton and nitrogen-fixing plant symbionts. They are also found in multiple members of the human microbiome, and may play a beneficial role in trimethylamine homeostasis, which in recent years has been directly tied to human cardiovascular health.

  13. Involvement of methyltransferase-activating protein and methyltransferase 2 isoenzyme II in methylamine:coenzyme M methyltransferase reactions in Methanosarcina barkeri Fusaro.

    PubMed Central

    Wassenaar, R W; Daas, P J; Geerts, W J; Keltjens, J T; van der Drift, C

    1996-01-01

    The enzyme systems involved in the methyl group transfer from methanol and from tri- and dimethylamine to 2-mercaptoethanesulfonic acid (coenzyme M) were resolved from cell extracts of Methanosarcina barkeri Fusaro grown on methanol and trimethylamine, respectively. Resolution was accomplished by ammonium sulfate fractionation, anion-exchange chromatography, and fast protein liquid chromatography. The methyl group transfer reactions from tri- and dimethylamine, as well as the monomethylamine:coenzyme M methyltransferase reaction, were strictly dependent on catalytic amounts of ATP and on a protein present in the 65% ammonium sulfate supernatant. The latter could be replaced by methyltransferase-activating protein isolated from methanol-grown cells of the organism. In addition, the tri- and dimethylamine:coenzyme M methyltransferase reactions required the presence of a methylcobalamin:coenzyme M methyltransferase (MT2), which is different from the analogous enzyme from methanol-grown M. barkeri. In this work, it is shown that the various methylamine:coenzyme M methyltransfer steps proceed in a fashion which is mechanistically similar to the methanol:coenzyme M methyl transfer, yet with the participation of specific corrinoid enzymes and a specific MT2 isoenzyme. PMID:8955317

  14. Association of Single Nucleotide Polymorphisms in Catechol-O-Methyltransferase and Serine-Threonine Protein Kinase Genes in the Pakistani Schizophrenic Population: A Study with Special Emphasis on Cannabis and Smokeless Tobacco.

    PubMed

    Nawaz, Rukhsana; Siddiqui, Sonia

    2015-01-01

    Schizophrenia is a neuropsychiatric disorder in which abnormalities in the prefrontal cortex lead to impaired synthesis of dopamine. It is associated with hallucination, psychosis and hearing impairments. Many susceptible genes have been identified in schizophrenia such as catechol-O-methyltransferase (COMT) and serine/threonine kinase (AKT1). Single nucleotide polymorphisms (SNPs) in these genes have not been identified in Pakistan. Therefore, we investigated the allelic and genotypic frequencies in COMT and AKT1 genes in the Pakistani population. Polymerase chain reactionrestriction fragment length polymorphism (PCR-RFLP) and DNA sequencing were used to identify SNPs in the genes. The present study shows that COMT Val and COMT Met allelic frequencies for the controls were p=0.52, q=0.48 and for the schizophrenic cases they were p=0.34, q=0.66 respectively. The distribution of polymorphism in COMT Val158Met genotype by Hardy-Weinberg equilibrium (HWE) was P=0.61 for controls and P=0.005 for cases. The data reveal that SNP rs1130214 T allele mutation was found neither in patients nor in controls in the 5' untranslated region (UTR). This proves that no association of AKT1 and positive association of COMT with schizophrenia exist in the population of Pakistan. Moreover, a study based on a single family showed COMT Met allele inheritance in schizophrenic offspring. This suggested that COMT allele alteration influences susceptibility to at least some forms of psychosis in the Pakistani population. Interestingly, according to our socio-economical survey, COMT genotype has no association with cannabis but it is strongly associated with tobacco. The Pakistani population with Val158Met SNP showed more susceptibility towards developing schizophrenia. This study highlights the genetic differences between Pakistani and other Caucasian populations.

  15. A second DNA methyltransferase repair enzyme in Escherichia coli.

    PubMed Central

    Rebeck, G W; Coons, S; Carroll, P; Samson, L

    1988-01-01

    The Escherichia coli ada-alkB operon encodes a 39-kDa protein (Ada) that is a DNA-repair methyltransferase and a 27-kDa protein (AlkB) of unknown function. By DNA blot hybridization analysis we show that the alkylation-sensitive E. coli mutant BS23 [Sedgwick, B. & Lindahl, T. (1982) J. Mol. Biol. 154, 169-175] is a deletion mutant lacking the entire ada-alkB operon. Despite the absence of the ada gene and its product, the cells contain detectable levels of a DNA-repair methyltransferase activity. We conclude that the methyltransferase in BS23 cells is the product of a gene other than ada. A similar activity was detected in extracts of an ada-10::Tn10 insertion mutant of E. coli AB1157. This DNA methyltransferase has a molecular mass of about 19 kDa and transfers the methyl groups from O6-methylguanine and O4-methylthymine in DNA, but not those from methyl phosphotriester lesions. This enzyme was not induced by low doses of alkylating agent and is expressed at low levels in ada+ and a number of ada- E. coli strains. Images PMID:3283737

  16. Epigenetic drug discovery: targeting DNA methyltransferases.

    PubMed

    Foulks, Jason M; Parnell, K Mark; Nix, Rebecca N; Chau, Suzanna; Swierczek, Krzysztof; Saunders, Michael; Wright, Kevin; Hendrickson, Thomas F; Ho, Koc-Kan; McCullar, Michael V; Kanner, Steven B

    2012-01-01

    Epigenetic modification of DNA leads to changes in gene expression. DNA methyltransferases (DNMTs) comprise a family of nuclear enzymes that catalyze the methylation of CpG dinucleotides, resulting in an epigenetic methylome distinguished between normal cells and those in disease states such as cancer. Disrupting gene expression patterns through promoter methylation has been implicated in many malignancies and supports DNMTs as attractive therapeutic targets. This review focuses on the rationale of targeting DNMTs in cancer, the historical approach to DNMT inhibition, and current marketed hypomethylating therapeutics azacytidine and decitabine. In addition, we address novel DNMT inhibitory agents emerging in development, including CP-4200 and SGI-110, analogs of azacytidine and decitabine, respectively; the oligonucleotides MG98 and miR29a; and a number of reversible inhibitors, some of which appear to be selective against particular DNMT isoforms. Finally, we discuss future opportunities and challenges for next-generation therapeutics.

  17. Comparison of Bacillus monooxygenase genes for unique fatty acid production

    USDA-ARS?s Scientific Manuscript database

    This paper reviews Bacillus genes encoding monooxygenase enzymes producing unique fatty acid metabolites. Specifically, it examines standard monooxygenase electron transfer schemes and related domain structures of these fused domain enzymes on route to understanding the observed oxygenase activiti...

  18. Arabidopsis MET1 cytosine methyltransferase mutants.

    PubMed Central

    Kankel, Mark W; Ramsey, Douglas E; Stokes, Trevor L; Flowers, Susan K; Haag, Jeremy R; Jeddeloh, Jeffrey A; Riddle, Nicole C; Verbsky, Michelle L; Richards, Eric J

    2003-01-01

    We describe the isolation and characterization of two missense mutations in the cytosine-DNA-methyltransferase gene, MET1, from the flowering plant Arabidopsis thaliana. Both missense mutations, which affect the catalytic domain of the protein, led to a global reduction of cytosine methylation throughout the genome. Surprisingly, the met1-2 allele, with the weaker DNA hypomethylation phenotype, alters a well-conserved residue in methyltransferase signature motif I. The stronger met1-1 allele caused late flowering and a heterochronic delay in the juvenile-to-adult rosette leaf transition. The distribution of late-flowering phenotypes in a mapping population segregating met1-1 indicates that the flowering-time phenotype is caused by the accumulation of inherited defects at loci unlinked to the met1 mutation. The delay in flowering time is due in part to the formation and inheritance of hypomethylated fwa epialleles, but inherited defects at other loci are likely to contribute as well. Centromeric repeat arrays hypomethylated in met1-1 mutants are partially remethylated when introduced into a wild-type background, in contrast to genomic sequences hypomethylated in ddm1 mutants. ddm1 met1 double mutants were constructed to further our understanding of the mechanism of DDM1 action and the interaction between two major genetic loci affecting global cytosine methylation levels in Arabidopsis. PMID:12663548

  19. Histone lysine methyltransferases as anti-cancer targets for drug discovery

    PubMed Central

    Liu, Qing; Wang, Ming-wei

    2016-01-01

    Post-translational epigenetic modification of histones is controlled by a number of histone-modifying enzymes. Such modification regulates the accessibility of DNA and the subsequent expression or silencing of a gene. Human histone methyltransferases (HMTs)constitute a large family that includes histone lysine methyltransferases (HKMTs) and histone/protein arginine methyltransferases (PRMTs). There is increasing evidence showing a correlation between HKMTs and cancer pathogenesis. Here, we present an overview of representative HKMTs, including their biological and biochemical properties as well as the profiles of small molecule inhibitors for a comprehensive understanding of HKMTs in drug discovery. PMID:27397541

  20. Dopamine receptor D2 (DRD2), dopamine transporter solute carrier family C6, member 4 (SLC6A3), and catechol-O-methyltransferase (COMT) genes as moderators of the relation between maternal history of maltreatment and infant emotion regulation.

    PubMed

    Villani, Vanessa; Ludmer, Jaclyn; Gonzalez, Andrea; Levitan, Robert; Kennedy, James; Masellis, Mario; Basile, Vincenzo S; Wekerle, Christine; Atkinson, Leslie

    2017-08-14

    Although infants less than 18 months old are capable of engaging in self-regulatory behavior (e.g., avoidance, withdrawal, and orienting to other aspects of their environment), the use of self-regulatory strategies at this age (as opposed to relying on caregivers) is associated with elevated behavioral and physiological distress. This study investigated infant dopamine-related genotypes (dopamine receptor D2 [DRD2], dopamine transporter solute carrier family C6, member 4 [SLC6A3], and catechol-O-methyltransferase [COMT]) as they interact with maternal self-reported history of maltreatment to predict observed infant independent emotion regulation behavior. A community sample (N = 193) of mother-infant dyads participated in a toy frustration challenge at infant age 15 months, and infant emotion regulation behavior was coded. Buccal cells were collected for genotyping. Maternal maltreatment history significantly interacted with infant SLC6A3 and COMT genotypes, such that infants with more 10-repeat and valine alleles of SLC6A3 and COMT, respectively, relative to infants with fewer or no 10-repeat and valine alleles, utilized more independent (i.e., maladaptive) regulatory behavior if mother reported a more extensive maltreatment history, as opposed to less. The findings indicate that child genetic factors moderate the intergenerational impact of maternal maltreatment history. The results are discussed in terms of potential mechanism of Gene × Environment interaction.

  1. Staphylococcus aureus Promotes Smed-PGRP-2/Smed-setd8-1 Methyltransferase Signalling in Planarian Neoblasts to Sensitize Anti-bacterial Gene Responses During Re-infection.

    PubMed

    Torre, Cedric; Abnave, Prasad; Tsoumtsa, Landry Laure; Mottola, Giovanna; Lepolard, Catherine; Trouplin, Virginie; Gimenez, Gregory; Desrousseaux, Julie; Gempp, Stephanie; Levasseur, Anthony; Padovani, Laetitia; Lemichez, Emmanuel; Ghigo, Eric

    2017-06-01

    Little is known about how organisms exposed to recurrent infections adapt their innate immune responses. Here, we report that planarians display a form of instructed immunity to primo-infection by Staphylococcus aureus that consists of a transient state of heightened resistance to re-infection that persists for approximately 30days after primo-infection. We established the involvement of stem cell-like neoblasts in this instructed immunity using the complementary approaches of RNA-interference-mediated cell depletion and tissue grafting-mediated gain of function. Mechanistically, primo-infection leads to expression of the peptidoglycan receptor Smed-PGRP-2, which in turn promotes Smed-setd8-1 histone methyltransferase expression and increases levels of lysine methylation in neoblasts. Depletion of neoblasts did not affect S. aureus clearance in primo-infection but, in re-infection, abrogated the heightened elimination of bacteria and reduced Smed-PGRP-2 and Smed-setd8-1 expression. Smed-PGRP-2 and Smed-setd8-1 sensitize animals to heightened expression of Smed-p38 MAPK and Smed-morn2, which are downstream components of anti-bacterial responses. Our study reveals a central role of neoblasts in innate immunity against S. aureus to establish a resistance state facilitating Smed-sted8-1-dependent expression of anti-bacterial genes during re-infection. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Functional expression of plant-derived O-methyltransferase, flavanone 3-hydroxylase, and flavonol synthase in Corynebacterium glutamicum for production of pterostilbene, kaempferol, and quercetin.

    PubMed

    Kallscheuer, Nicolai; Vogt, Michael; Bott, Michael; Marienhagen, Jan

    2017-09-20

    Plant polyphenols receive significant attention due to their anti-oxidative and health-promoting properties, and several microorganisms are currently engineered towards producing these valuable compounds. Previously, Corynebacterium glutamicum has been engineered for synthesizing polyphenol core structures such as the stilbene resveratrol and the (2S)-flavanone naringenin. Decoration of these compounds by O-methylation or hydroxylation would provide access to polyphenols of even higher commercial interest. In this study, introduction of a heterologous O-methyltransferase into a resveratrol-producing C. glutamicum strain allowed synthesis of 42mg/L (0.16mM) of the di-O-methylated pterostilbene from p-coumaric acid. A prerequisite for reaching this product titer was a fusion of O-methyltransferase with the maltose-binding protein of Escherichia coli lacking its signal peptide, thereby increasing the solubility of the O-methyltransferase. Furthermore, expression of heterologous dioxygenase genes in (2S)-flavanone-producing C. glutamicum strains enabled the production of flavanonols and flavonols starting from the phenylpropanoids p-coumaric acid and caffeic acid. For the flavonols kaempferol and quercetin, maximum product titers of 23mg/L (0.08mM) and 10mg/L (0.03mM) could be achieved, respectively. The obtained results demonstrate that C. glutamicum is a suitable host organism for the production of more complex plant polyphenols. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Fatty acids regulation of inflammatory and metabolic genes.

    PubMed

    Masi, Laureane N; Rodrigues, Alice C; Curi, Rui

    2013-07-01

    Fatty acids influence human health and diseases in various ways. In recent years, much work has been carried out to elucidate the mechanisms by which dietary fatty acids control short-term and long-term cellular functions. We have reviewed herein the most recent studies on modulation of gene expression by fatty acids. A number of genes respond to transcription factors and present a transcription factor response element in their promoter regions. Fatty acids may exert their effects on metabolism by regulating gene transcription via transcription factors. Understanding how fatty acids control expression of metabolic genes is a promising strategy to be investigated by aiming to treat metabolic diseases such as insulin resistance, obesity, and type 2 diabetes mellitus. Fatty acids exert many of their biological effects through the modulation of the activity of transcription factors, such as sterol regulatory element-binding proteins, peroxisome proliferator-activated receptors, and liver X receptors. Fatty acid action through transcription factors controls the expression of several inflammatory and metabolic genes.

  4. DNA methyltransferase-1 inhibitors as epigenetic therapy for cancer.

    PubMed

    Singh, Varinder; Sharma, Prince; Capalash, Neena

    2013-05-01

    DNA methylation is an epigenetic modification involved in gene expression regulation. In cancer, the DNA methylation pattern becomes aberrant, causing an array of tumor suppressor genes to undergo promoter hypermethylation and become transcriptionally silent. Reexpression of methylation silenced tumor suppressor genes by inhibiting the DNA methyltransferases (DNMT1, DNMT3A, and DNMT3B) has emerged as an effective strategy against cancer. The expression of DNA methyltransferase 1 (DNMT1) being high in S-phase of cell cycle makes it a specific target for methylation inhibition in rapidly dividing cells as in cancer. This review discusses nucleoside analogues (azacytidine, decitabine, zebularine, SGI-110, CP-4200), non-nucleoside ihibitors both synthetic (hydralazine, RG108, procaine, procainamide, IM25, disulfiram) and natural compounds (curcumin, genistein, EGCG, resveratrol, equol, parthenolide) which act through different mechanisms to inhibit DNMTs. The issues of bioavailability, toxicity, side effects, hypomethylation resistance and combinatorial therapies have also been highlighted.

  5. Cloning and functional characterization of the Arabidopsis N-acetylserotonin O-methyltransferase responsible for melatonin synthesis.

    PubMed

    Byeon, Yeong; Lee, Hye-Jung; Lee, Hyoung Yool; Back, Kyoungwhan

    2016-01-01

    The N-acetylserotonin O-methyltransferase (ASMT) gene encodes the enzyme that catalyzes the conversion of N-acetylserotonin to melatonin as the last step in melatonin biosynthesis. The first plant ASMT gene to be cloned was from rice. An orthologous gene encoding a protein with ASMT activity and only 39.7% amino acid sequence identity to the rice ASMT protein was recently isolated from apple (Malus zumi). The low homology of the apple ASMT sequence prompted us to screen the Arabidopsis genome for a homologous ASMT gene. The At4g35160 gene exhibited the highest sequence identity (31%) to the rice ASMT gene, followed by the At1g76790 gene with 29% sequence identity. We purified recombinant proteins expressed from the two Arabidopsis genes. The At4g35160 recombinant protein exhibited ASMT enzyme activity, but the At1g76790 recombinant protein did not; thus, we designated At4g35160 as an Arabidopsis thaliana ASMT (AtASMT) gene. The AtASMT protein catalyzed the conversion of N-acetylserotonin to melatonin and serotonin to 5-methoxytryptamine with Vmax values of 0.11 and 0.29 pkat/mg protein, respectively. However, AtASMT exhibited no caffeic acid O-methyltransferase activity, suggesting that its function was highly specific to melatonin synthesis. AtASMT transcripts were induced by cadmium treatment in Arabidopsis followed by increased melatonin synthesis. Similar to other ASMT proteins, AtASMT was localized in the cytoplasm and its ectopic overexpression in rice resulted in increased ASMT enzyme activity and melatonin production, indicating the involvement of AtASMT in melatonin synthesis.

  6. Molecular identification of carnosine N-methyltransferase as chicken histamine N-methyltransferase-like protein (hnmt-like).

    PubMed

    Drozak, Jakub; Chrobok, Lukasz; Poleszak, Olga; Jagielski, Adam K; Derlacz, Rafal

    2013-01-01

    Anserine (beta-alanyl-N(Pi)-methyl-L-histidine), a naturally occurring derivative of carnosine (beta-alanyl-L-histidine), is an abundant constituent of skeletal muscles and brain of many vertebrates. Although it has long been proposed to serve as a proton buffer, radicals scavenger and transglycating agent, its physiological function remains obscure. The formation of anserine is catalyzed by carnosine N-methyltransferase which exhibits unknown molecular identity. In the present investigation, we have purified carnosine N-methyltransferase from chicken pectoral muscle about 640-fold until three major polypeptides of about 23, 26 and 37 kDa coeluting with the enzyme were identified in the preparation. Mass spectrometry analysis of these polypeptides resulted in an identification of histamine N-methyltransferase-like (HNMT-like) protein as the only meaningful candidate. Analysis of GenBank database records indicated that the hnmt-like gene might be a paralogue of histamine N-methyltransferase gene, while comparison of their protein sequences suggested that HNMT-like protein might have acquired a new activity. Chicken HNMT-like protein was expressed in COS-7 cells, purified to homogeneity, and shown to catalyze the formation of anserine as confirmed by both chromatographic and mass spectrometry analysis. Both specificity and kinetic studies carried out on the native and recombinant enzyme were in agreement with published data. Particularly, several compounds structurally related to carnosine, including histamine and L-histidine, were tested as potential substrates for the enzyme, and carnosine was the only methyl group acceptor. The identification of the gene encoding carnosine N-methyltransferase might be beneficial for estimation of the biological functions of anserine.

  7. Molecular Identification of Carnosine N-Methyltransferase as Chicken Histamine N-Methyltransferase-Like Protein (HNMT-Like)

    PubMed Central

    Drozak, Jakub; Chrobok, Lukasz; Poleszak, Olga; Jagielski, Adam K.; Derlacz, Rafal

    2013-01-01

    Anserine (beta-alanyl-N(Pi)-methyl-L-histidine), a naturally occurring derivative of carnosine (beta-alanyl-L-histidine), is an abundant constituent of skeletal muscles and brain of many vertebrates. Although it has long been proposed to serve as a proton buffer, radicals scavenger and transglycating agent, its physiological function remains obscure. The formation of anserine is catalyzed by carnosine N-methyltransferase which exhibits unknown molecular identity. In the present investigation, we have purified carnosine N-methyltransferase from chicken pectoral muscle about 640-fold until three major polypeptides of about 23, 26 and 37 kDa coeluting with the enzyme were identified in the preparation. Mass spectrometry analysis of these polypeptides resulted in an identification of histamine N-methyltransferase-like (HNMT-like) protein as the only meaningful candidate. Analysis of GenBank database records indicated that the hnmt-like gene might be a paralogue of histamine N-methyltransferase gene, while comparison of their protein sequences suggested that HNMT-like protein might have acquired a new activity. Chicken HNMT-like protein was expressed in COS-7 cells, purified to homogeneity, and shown to catalyze the formation of anserine as confirmed by both chromatographic and mass spectrometry analysis. Both specificity and kinetic studies carried out on the native and recombinant enzyme were in agreement with published data. Particularly, several compounds structurally related to carnosine, including histamine and L-histidine, were tested as potential substrates for the enzyme, and carnosine was the only methyl group acceptor. The identification of the gene encoding carnosine N-methyltransferase might be beneficial for estimation of the biological functions of anserine. PMID:23705015

  8. Gene quantification by the NanoGene assay is resistant to inhibition by humic acids.

    PubMed

    Kim, Gha-Young; Wang, Xiaofang; Ahn, Hosang; Son, Ahjeong

    2011-10-15

    NanoGene assay is a magnetic bead and quantum dot nanoparticles based gene quantification assay. It relies on a set of probe and signaling probe DNAs to capture the target DNA via hybridization. We have demonstrated the inhibition resistance of the NanoGene assay using humic acids laden genomic DNA (gDNA). At 1 μg of humic acid per mL, quantitiative PCR (qPCR) was inhibited to 0% of its quantification capability whereas NanoGene assay was able to maintain more than 60% of its quantification capability. To further increase the inhibition resistance of NanoGene assay at high concentration of humic acids, we have identified the specific mechanisms that are responsible for the inhibition. We examined five potential mechanisms with which the humic acids can partially inhibit our NanoGene assay. The mechanisms examined were (1) adsorption of humic acids on the particle surface; (2) particle aggregation induced by humic acids; (3) fluorescence quenching of quantum dots by humic acids during hybridization; (4) humic acids mimicking of target DNA; and (5) nonspecific binding between humic acids and target gDNA. The investigation showed that no adsorption of humic acids onto the particles' surface was observed for the humic acids' concentration. Particle aggregation and fluorescence quenching were also negligible. Humic acids also did not mimic the target gDNA except 1000 μg of humic acids per mL and hence should not contribute to the partial inhibition. Four of the above mechanisms were not related to the inhibition effect of humic acids particularly at the environmentally relevant concentrations (<100 μg/mL). However, a substantial amount of nonspecific binding was observed between the humic acids and target gDNA. This possibly results in lesser amount of target gDNA being captured by the probe and signaling DNA.

  9. Engineering Monolignol 4-O-Methyltransferases to Modulate Lignin Biosynthesis

    SciTech Connect

    Bhuiya, M.W.; Liu, C.

    2010-01-01

    Lignin is a complex polymer derived from the oxidative coupling of three classical monolignols. Lignin precursors are methylated exclusively at the meta-positions (i.e. 3/5-OH) of their phenyl rings by native O-methyltransferases, and are precluded from substitution of the para-hydroxyl (4-OH) position. Ostensibly, the para-hydroxyls of phenolics are critically important for oxidative coupling of phenoxy radicals to form polymers. Therefore, creating a 4-O-methyltransferase to substitute the para-hydroxyl of monolignols might well interfere with the synthesis of lignin. The phylogeny of plant phenolic O-methyltransferases points to the existence of a batch of evolutionarily 'plastic' amino acid residues. Following one amino acid at a time path of directed evolution, and using the strategy of structure-based iterative site-saturation mutagenesis, we created a novel monolignol 4-O-methyltransferase from the enzyme responsible for methylating phenylpropenes. We show that two plastic residues in the active site of the parental enzyme are vital in dominating substrate discrimination. Mutations at either one of these separate the evolutionarily tightly linked properties of substrate specificity and regioselective methylation of native O-methyltransferase, thereby conferring the ability for para-methylation of the lignin monomeric precursors, primarily monolignols. Beneficial mutations at both sites have an additive effect. By further optimizing enzyme activity, we generated a triple mutant variant that may structurally constitute a novel phenolic substrate binding pocket, leading to its high binding affinity and catalytic efficiency on monolignols. The 4-O-methoxylation of monolignol efficiently impairs oxidative radical coupling in vitro, highlighting the potential for applying this novel enzyme in managing lignin polymerization in planta.

  10. Betaine Homocysteine Methyltransferase Is Active in the Mouse Blastocyst and Promotes Inner Cell Mass Development*

    PubMed Central

    Lee, Martin B.; Kooistra, Megan; Zhang, Baohua; Slow, Sandy; Fortier, Amanda L.; Garrow, Timothy A.; Lever, Michael; Trasler, Jacquetta M.; Baltz, Jay M.

    2012-01-01

    Methyltransferases are an important group of enzymes with diverse roles that include epigenetic gene regulation. The universal donor of methyl groups for methyltransferases is S-adenosylmethionine (AdoMet), which in most cells is synthesized using methyl groups carried by a derivative of folic acid. Another mechanism for AdoMet synthesis uses betaine as the methyl donor via the enzyme betaine-homocysteine methyltransferase (BHMT, EC 2.1.1.5), but it has been considered to be significant only in liver. Here, we show that mouse preimplantation embryos contain endogenous betaine; Bhmt mRNA is first expressed at the morula stage; BHMT is abundant at the blastocyst stage but not other preimplantation stages, and BHMT activity is similarly detectable in blastocyst homogenates but not those of two-cell or morula stage embryos. Knockdown of BHMT protein levels and reduction of enzyme activity using Bhmt-specific antisense morpholinos or a selective BHMT inhibitor resulted in decreased development of embryos to the blastocyst stage in vitro and a reduction in inner cell mass cell number in blastocysts. The detrimental effects of BHMT knockdown were fully rescued by the immediate methyl-carrying product of BHMT, methionine. A physiological role for betaine and BHMT in blastocyst viability was further indicated by increased fetal resorption following embryo transfer of BHMT knockdown blastocysts versus control. Thus, mouse blastocysts are unusual in being able to generate AdoMet not only by the ubiquitous folate-dependent mechanism but also from betaine metabolized by BHMT, likely a significant pool of methyl groups in blastocysts. PMID:22847001

  11. N2,N2-dimethylguanosine-specific tRNA methyltransferase contains both nuclear and mitochondrial targeting signals in Saccharomyces cerevisiae

    PubMed Central

    1989-01-01

    The TRM1 gene of Saccharomyces cerevisiae encodes a tRNA modification enzyme, N2,N2-dimethylguanosine-specific tRNA methyltransferase, which modifies both mitochondrial and cytoplasmic tRNAs. The enzyme is targeted to mitochondria for the modification of mitochondrial tRNAs. Cellular fractionation and indirect immunofluorescence studies reported here demonstrate that this enzyme is also localized to the nucleus. Further, immunofluorescence experiments using strains that overproduce the enzyme show a staining at the periphery of the nucleus suggesting that the enzyme is found in a subnuclear destination near or at the nuclear membrane. There is no obvious cytoplasmic staining in these overproducing strains. Fusion protein technology was used to begin to localize sequences involved in the nuclear targeting of this enzyme. Indirect immunofluorescence studies indicate that sequences between the first 70 and 213 NH2-terminal amino acids of the methyltransferase are sufficient to target Escherichia coli beta-galactosidase to nuclei. PMID:2677019

  12. Novel acid resistance genes from the metagenome of the Tinto River, an extremely acidic environment.

    PubMed

    Guazzaroni, María-Eugenia; Morgante, Verónica; Mirete, Salvador; González-Pastor, José E

    2013-04-01

    Microorganisms that thrive in acidic environments are endowed with specialized molecular mechanisms to survive under this extremely harsh condition. In this work, we performed functional screening of six metagenomic libraries from planktonic and rhizosphere microbial communities of the Tinto River, an extremely acidic environment, to identify genes involved in acid resistance. This approach has revealed 15 different genes conferring acid resistance to Escherichia coli, most of which encoding putative proteins of unknown function or previously described proteins not known to be related to acid resistance. Moreover, we were able to assign function to one unknown and three hypothetical proteins. Among the recovered genes were the ClpXP protease, the transcriptional repressor LexA and nucleic acid-binding proteins such as an RNA-binding protein, HU and Dps. Furthermore, nine of the retrieved genes were cloned and expressed in Pseudomonas putida and Bacillus subtilis and, remarkably, most of them were able to expand the capability of these bacteria to survive under severe acid stress. From this set of genes, four presented a broad-host range as they enhance the acid resistance of the three different organisms tested. These results expand our knowledge about the different strategies used by microorganisms to survive under extremely acid conditions.

  13. Thr105Ile (rs11558538) polymorphism in the histamine N-methyltransferase (HNMT) gene and risk for Parkinson disease: A PRISMA-compliant systematic review and meta-analysis.

    PubMed

    Jiménez-Jiménez, Félix Javier; Alonso-Navarro, Hortensia; García-Martín, Elena; Agúndez, José A G

    2016-07-01

    Several neuropathological, biochemical, and pharmacological data suggested a possible role of histamine in the etiopathogenesis of Parkinson disease (PD). The single nucleotide polymorphism (SNP) rs11558538 in the histamine N-methyltransferase (HNMT) gene has been associated with the risk of developing PD by several studies but not by some others. We carried out a systematic review that included all the studies published on PD risk related to the rs11558538 SNP, and we conducted a meta-analysis following Preferred Reporting Items for Systematic Reviews and Meta-Analyses guidelines. We used several databases to perform the systematic review, the software Meta-DiSc 1.1.1 to perform the meta-analysis of the eligible studies, and the Q-statistic to test heterogeneity between studies. The meta-analysis included 4 eligible case-control association studies for the HNMT rs11558538 SNP and the risk for PD (2108 patients, 2158 controls). The frequency of the minor allele positivity showed a statistically significant association with a decreased risk for PD, both in the total series and in Caucasians. Although homozygosity for the minor allele did not reach statistical significance, the test for trend indicates the occurrence of a gene-dose effect. Global diagnostic odds ratios (95% confidence intervals) for rs11558538T were 0.61 (0.46-0.81) for the total group, and 0.63 (0.45-0.88) for Caucasian patients. The present meta-analysis confirms published evidence suggesting that the HNMT rs11558538 minor allele is related to a reduced risk of developing PD.

  14. Neural crest specification and migration independently require NSD3-related lysine methyltransferase activity

    PubMed Central

    Jacques-Fricke, Bridget T.; Gammill, Laura S.

    2014-01-01

    Neural crest precursors express genes that cause them to become migratory, multipotent cells, distinguishing them from adjacent stationary neural progenitors in the neurepithelium. Histone methylation spatiotemporally regulates neural crest gene expression; however, the protein methyltransferases active in neural crest precursors are unknown. Moreover, the regulation of methylation during the dynamic process of neural crest migration is unclear. Here we show that the lysine methyltransferase NSD3 is abundantly and specifically expressed in premigratory and migratory neural crest cells. NSD3 expression commences before up-regulation of neural crest genes, and NSD3 is necessary for expression of the neural plate border gene Msx1, as well as the key neural crest transcription factors Sox10, Snail2, Sox9, and FoxD3, but not gene expression generally. Nevertheless, only Sox10 histone H3 lysine 36 dimethylation requires NSD3, revealing unexpected complexity in NSD3-dependent neural crest gene regulation. In addition, by temporally limiting expression of a dominant negative to migratory stages, we identify a novel, direct requirement for NSD3-related methyltransferase activity in neural crest migration. These results identify NSD3 as the first protein methyltransferase essential for neural crest gene expression during specification and show that NSD3-related methyltransferase activity independently regulates migration. PMID:25318671

  15. Prediction of binding modes between protein L-isoaspartyl (D-aspartyl) O-methyltransferase and peptide substrates including isomerized aspartic acid residues using in silico analytic methods for the substrate screening.

    PubMed

    Oda, Akifumi; Noji, Ikuhiko; Fukuyoshi, Shuichi; Takahashi, Ohgi

    2015-12-10

    Because the aspartic acid (Asp) residues in proteins are occasionally isomerized in the human body, not only l-α-Asp but also l-β-Asp, D-α-Asp and D-β-Asp are found in human proteins. In these isomerized aspartic acids, the proportion of D-β-Asp is the largest and the proportions of l-β-Asp and D-α-Asp found in human proteins are comparatively small. To explain the proportions of aspartic acid isomers, the possibility of an enzyme able to repair l-β-Asp and D-α-Asp is frequently considered. The protein L-isoaspartyl (D-aspartyl) O-methyltransferase (PIMT) is considered one of the possible repair enzymes for l-β-Asp and D-α-Asp. Human PIMT is an enzyme that recognizes both l-β-Asp and D-α-Asp, and catalyzes the methylation of their side chains. In this study, the binding modes between PIMT and peptide substrates containing l-β-Asp or D-α-Asp residues were investigated using computational protein-ligand docking and molecular dynamics simulations. The results indicate that carboxyl groups of both l-β-Asp and D-α-Asp were recognized in similar modes by PIMT and that the C-terminal regions of substrate peptides were located in similar positions on PIMT for both the l-β-Asp and D-α-Asp peptides. In contrast, for peptides containing l-α-Asp or D-β-Asp residues, which are not substrates of PIMT, the computationally constructed binding modes between PIMT and peptides greatly differed from those between PIMT and substrates. In the nonsubstrate peptides, not inter- but intra-molecular hydrogen bonds were observed, and the conformations of peptides were more rigid than those of substrates. Thus, the in silico analytical methods were able to distinguish substrates from nonsubstrates and the computational methods are expected to complement experimental analytical methods.

  16. Production of γ-linolenic acid and stearidonic acid by Synechococcus sp. PCC7002 containing cyanobacterial fatty acid desaturase genes

    NASA Astrophysics Data System (ADS)

    Dong, Xuewei; He, Qingfang; Peng, Zhenying; Yu, Jinhui; Bian, Fei; Li, Youzhi; Bi, Yuping

    2016-07-01

    Genetic modification is useful for improving the nutritional qualities of cyanobacteria. To increase the total unsaturated fatty acid content, along with the ratio of ω-3/ω-6 fatty acids, genetic engineering can be used to modify fatty acid metabolism. Synechococcus sp. PCC7002, a fast-growing cyanobacterium, does not contain a Δ6 desaturase gene and is therefore unable to synthesize γ-linolenic acid (GLA) and stearidonic acid (SDA), which are important in human health. In this work, we constructed recombinant vectors Syd6D, Syd15D and Syd6Dd15D to express the Δ15 desaturase and Δ6 desaturase genes from Synechocystis PCC6803 in Synechococcus sp. PCC7002, with the aim of expressing polyunsaturated fatty acids. Overexpression of the Δ15 desaturase gene in Synechococcus resulted in 5.4 times greater accumulation of α-linolenic acid compared with the wild-type while Δ6 desaturase gene expression produced both GLA and SDA. Co-expression of the two genes resulted in low-level accumulation of GLA but much larger amounts of SDA, accounting for as much to 11.64% of the total fatty acid content.

  17. Perinatal Risk Factors Interacting with Catechol O-Methyltransferase and the Serotonin Transporter Gene Predict ASD Symptoms in Children with ADHD

    ERIC Educational Resources Information Center

    Nijmeijer, Judith S.; Hartman, Catharina A.; Rommelse, Nanda N. J.; Altink, Marieke E.; Buschgens, Cathelijne J. M.; Fliers, Ellen A.; Franke, Barbara; Minderaa, Ruud B.; Ormel, Johan; Sergeant, Joseph A.; Verhulst, Frank C.; Buitelaar, Jan K.; Hoekstra, Pieter J.

    2010-01-01

    Background: Symptoms of autism spectrum disorder (ASD) and attention-deficit/hyperactivity disorder (ADHD) often co-occur. Given the previously found familiality of ASD symptoms in children with ADHD, addressing these symptoms may be useful for genetic association studies, especially for candidate gene findings that have not been consistently…

  18. Perinatal Risk Factors Interacting with Catechol O-Methyltransferase and the Serotonin Transporter Gene Predict ASD Symptoms in Children with ADHD

    ERIC Educational Resources Information Center

    Nijmeijer, Judith S.; Hartman, Catharina A.; Rommelse, Nanda N. J.; Altink, Marieke E.; Buschgens, Cathelijne J. M.; Fliers, Ellen A.; Franke, Barbara; Minderaa, Ruud B.; Ormel, Johan; Sergeant, Joseph A.; Verhulst, Frank C.; Buitelaar, Jan K.; Hoekstra, Pieter J.

    2010-01-01

    Background: Symptoms of autism spectrum disorder (ASD) and attention-deficit/hyperactivity disorder (ADHD) often co-occur. Given the previously found familiality of ASD symptoms in children with ADHD, addressing these symptoms may be useful for genetic association studies, especially for candidate gene findings that have not been consistently…

  19. Pseudomonas aeruginosa EftM Is a Thermoregulated Methyltransferase*

    PubMed Central

    Owings, Joshua P.; Kuiper, Emily G.; Prezioso, Samantha M.; Meisner, Jeffrey; Varga, John J.; Zelinskaya, Natalia; Dammer, Eric B.; Duong, Duc M.; Seyfried, Nicholas T.; Albertí, Sebastián; Conn, Graeme L.; Goldberg, Joanna B.

    2016-01-01

    Pseudomonas aeruginosa is a Gram-negative opportunistic pathogen that trimethylates elongation factor-thermo-unstable (EF-Tu) on lysine 5. Lysine 5 methylation occurs in a temperature-dependent manner and is generally only seen when P. aeruginosa is grown at temperatures close to ambient (25 °C) but not at higher temperatures (37 °C). We have previously identified the gene, eftM (for EF-Tu-modifying enzyme), responsible for this modification and shown its activity to be associated with increased bacterial adhesion to and invasion of respiratory epithelial cells. Bioinformatic analyses predicted EftM to be a Class I S-adenosyl-l-methionine (SAM)-dependent methyltransferase. An in vitro methyltransferase assay was employed to show that, in the presence of SAM, EftM directly trimethylates EF-Tu. A natural variant of EftM, with a glycine to arginine substitution at position 50 in the predicted SAM-binding domain, lacks both SAM binding and enzyme activity. Mass spectrometry analysis of the in vitro methyltransferase reaction products revealed that EftM exclusively methylates at lysine 5 of EF-Tu in a distributive manner. Consistent with the in vivo temperature dependence of methylation of EF-Tu, preincubation of EftM at 37 °C abolished methyltransferase activity, whereas this activity was retained when EftM was preincubated at 25 °C. Irreversible protein unfolding at 37 °C was observed, and we propose that this instability is the molecular basis for the temperature dependence of EftM activity. Collectively, our results show that EftM is a thermolabile, SAM-dependent methyltransferase that directly trimethylates lysine 5 of EF-Tu in P. aeruginosa. PMID:26677219

  20. Mechanisms of Gene Regulation by Fatty Acids12

    PubMed Central

    Georgiadi, Anastasia; Kersten, Sander

    2012-01-01

    Consumption of specific dietary fatty acids has been shown to influence risk and progression of several chronic diseases, such as cardiovascular disease, obesity, cancer, and arthritis. In recent years, insights into the mechanisms underlying the biological effects of fatty acids have improved considerably and have provided the foundation for the emerging concept of fatty acid sensing, which can be interpreted as the property of fatty acids to influence biological processes by serving as signaling molecules. An important mechanism of fatty acid sensing is via stimulation or inhibition of DNA transcription. Here, we focus on fatty acid sensing via regulation of gene transcription and address the role of peroxisome proliferator–activated receptors, sterol regulatory element binding protein 1, Toll-like receptor 4, G protein–coupled receptors, and other putative mediators. PMID:22516720

  1. Identification of white campion (Silene latifolia) guaiacol O-methyltransferase involved in the biosynthesis of veratrole, a key volatile for pollinator attraction

    PubMed Central

    2012-01-01

    Background Silene latifolia and its pollinator, the noctuid moth Hadena bicruris, represent an open nursery pollination system wherein floral volatiles, especially veratrole (1, 2-dimethoxybenzene), lilac aldehydes, and phenylacetaldehyde are of key importance for floral signaling. Despite the important role of floral scent in ensuring reproductive success in S. latifolia, the molecular basis of scent biosynthesis in this species has not yet been investigated. Results We isolated two full-length cDNAs from S. latifolia that show similarity to rose orcinol O-methyltransferase. Biochemical analysis showed that both S. latifolia guaiacol O-methyltransferase1 (SlGOMT1) &S. latifolia guaiacol O-methyltransferase2 (SlGOMT2) encode proteins that catalyze the methylation of guaiacol to form veratrole. A large Km value difference between SlGOMT1 (~10 μM) and SlGOMT2 (~501 μM) resulted that SlGOMT1 is 31-fold more catalytically efficient than SlGOMT2. qRT-PCR expression analysis showed that the SlGOMT genes are specifically expressed in flowers and male S. latifolia flowers had 3- to 4-folds higher level of GOMT gene transcripts than female flower tissues. Two related cDNAs, S. dioica O-methyltransferase1 (SdOMT1) and S. dioica O-methyltransferase2 (SdOMT2), were also obtained from the sister species Silene dioica, but the proteins they encode did not methylate guaiacol, consistent with the lack of veratrole emission in the flowers of this species. Our evolutionary analysis uncovered that SlGOMT1 and SlGOMT2 genes evolved under positive selection, whereas SdOMT1 and SdOMT2 genes show no evidence for selection. Conclusions Altogether, we report the identification and functional characterization of the gene, SlGOMT1 that efficiently catalyzes veratrole formation, whereas another copy of this gene with only one amino acid difference, SlGOMT2 was found to be less efficient for veratrole synthesis in S. latifolia. PMID:22937972

  2. Identification of white campion (Silene latifolia) guaiacol O-methyltransferase involved in the biosynthesis of veratrole, a key volatile for pollinator attraction.

    PubMed

    Gupta, Alok K; Akhtar, Tariq A; Widmer, Alex; Pichersky, Eran; Schiestl, Florian P

    2012-08-31

    Silene latifolia and its pollinator, the noctuid moth Hadena bicruris, represent an open nursery pollination system wherein floral volatiles, especially veratrole (1, 2-dimethoxybenzene), lilac aldehydes, and phenylacetaldehyde are of key importance for floral signaling. Despite the important role of floral scent in ensuring reproductive success in S. latifolia, the molecular basis of scent biosynthesis in this species has not yet been investigated. We isolated two full-length cDNAs from S. latifolia that show similarity to rose orcinol O-methyltransferase. Biochemical analysis showed that both S. latifolia guaiacol O-methyltransferase1 (SlGOMT1) &S. latifolia guaiacol O-methyltransferase2 (SlGOMT2) encode proteins that catalyze the methylation of guaiacol to form veratrole. A large Km value difference between SlGOMT1 (~10 μM) and SlGOMT2 (~501 μM) resulted that SlGOMT1 is 31-fold more catalytically efficient than SlGOMT2. qRT-PCR expression analysis showed that the SlGOMT genes are specifically expressed in flowers and male S. latifolia flowers had 3- to 4-folds higher level of GOMT gene transcripts than female flower tissues. Two related cDNAs, S. dioica O-methyltransferase1 (SdOMT1) and S. dioica O-methyltransferase2 (SdOMT2), were also obtained from the sister species Silene dioica, but the proteins they encode did not methylate guaiacol, consistent with the lack of veratrole emission in the flowers of this species. Our evolutionary analysis uncovered that SlGOMT1 and SlGOMT2 genes evolved under positive selection, whereas SdOMT1 and SdOMT2 genes show no evidence for selection. Altogether, we report the identification and functional characterization of the gene, SlGOMT1 that efficiently catalyzes veratrole formation, whereas another copy of this gene with only one amino acid difference, SlGOMT2 was found to be less efficient for veratrole synthesis in S. latifolia.

  3. Effects of oral eicosapentaenoic acid versus docosahexaenoic acid on human peripheral blood mononuclear cell gene expression

    USDA-ARS?s Scientific Manuscript database

    Objective: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have beneficial effects on inflammation and cardiovascular disease (CVD). Our aim was to assess the effect of a six-week supplementation with either olive oil, EPA, or DHA on gene expression in peripheral blood mononuclear cells (...

  4. Expression of genes encoding enzymes involved in the one carbon cycle in rat placenta is determined by maternal micronutrients (folic acid, vitamin B12) and omega-3 fatty acids.

    PubMed

    Khot, Vinita; Kale, Anvita; Joshi, Asmita; Chavan-Gautam, Preeti; Joshi, Sadhana

    2014-01-01

    We have reported that folic acid, vitamin B12, and omega-3 fatty acids are interlinked in the one carbon cycle and have implications for fetal programming. Our earlier studies demonstrate that an imbalance in maternal micronutrients influence long chain polyunsaturated fatty acid metabolism and global methylation in rat placenta. We hypothesize that these changes are mediated through micronutrient dependent regulation of enzymes in one carbon cycle. Pregnant dams were assigned to six dietary groups with varying folic acid and vitamin B12 levels. Vitamin B12 deficient groups were supplemented with omega-3 fatty acid. Placental mRNA levels of enzymes, levels of phospholipids, and glutathione were determined. Results suggest that maternal micronutrient imbalance (excess folic acid with vitamin B12 deficiency) leads to lower mRNA levels of methylene tetrahydrofolate reductase (MTHFR) and methionine synthase , but higher cystathionine b-synthase (CBS) and Phosphatidylethanolamine-N-methyltransferase (PEMT) as compared to control. Omega-3 supplementation normalized CBS and MTHFR mRNA levels. Increased placental phosphatidylethanolamine (PE), phosphatidylcholine (PC), in the same group was also observed. Our data suggests that adverse effects of a maternal micronutrient imbalanced diet may be due to differential regulation of key genes encoding enzymes in one carbon cycle and omega-3 supplementation may ameliorate most of these changes.

  5. Drosophila arginine methyltransferase 1 (DART1) is an ecdysone receptor co-repressor

    SciTech Connect

    Kimura, Shuhei; Sawatsubashi, Shun; Ito, Saya; Kouzmenko, Alexander; Suzuki, Eriko; Zhao, Yue; Yamagata, Kaoru; Tanabe, Masahiko; Ueda, Takashi; Fujiyama, Sari; Murata, Takuya; Matsukawa, Hiroyuki; Takeyama, Ken-ichi; Yaegashi, Nobuo

    2008-07-11

    Histone arginine methylation is an epigenetic marker that regulates gene expression by defining the chromatin state. Arginine methyltransferases, therefore, serve as transcriptional co-regulators. However, unlike other transcriptional co-regulators, the physiological roles of arginine methyltransferases are poorly understood. Drosophila arginine methyltransferase 1 (DART1), the mammalian PRMT1 homologue, methylates the arginine residue of histone H4 (H4R3me2). Disruption of DART1 in Drosophila by imprecise P-element excision resulted in low viability during metamorphosis in the pupal stages. In the pupal stage, an ecdysone hormone signal is critical for developmental progression. DART1 interacted with the nuclear ecdysone receptor (EcR) in a ligand-dependent manner, and co-repressed EcR in intact flies. These findings suggest that DART1, a histone arginine methyltransferase, is a co-repressor of EcR that is indispensable for normal pupal development in the intact fly.

  6. Functional variants of the 5-methyltetrahydrofolate-homocysteine methyltransferase gene significantly increase susceptibility to prostate cancer: Results from an ethnic Han Chinese population

    PubMed Central

    Qu, Yuan-Yuan; Zhou, Shu-Xian; Zhang, Xuan; Zhao, Rui; Gu, Cheng-Yuan; Chang, Kun; Yang, Xiao-Qun; Gan, Hua-Lei; Dai, Bo; Zhang, Hai-Liang; Shi, Guo-Hai; Zhu, Yao; Ye, Ding-Wei; Zhao, Jian-Yuan

    2016-01-01

    Aberrant DNA methylation has been implicated in prostate carcinogenesis. The one-carbon metabolism pathway and related metabolites determine cellular DNA methylation and thus is thought to play a pivotal role in PCa occurrence. This study aimed to investigate the contribution of genetic variants in one-carbon metabolism genes to prostate cancer (PCa) risk and the underlying biological mechanisms. In this hospital-based case-control study of 1817 PCa cases and 2026 cancer-free controls, we genotyped six polymorphisms in three one-carbon metabolism genes and assessed their association with the risk of PCa. We found two noncoding MTR variants, rs28372871 T > G and rs1131450 G > A, were independently associated with a significantly increased risk of PCa. The rs28372871 GG genotype (adjusted OR = 1.40, P = 0.004) and rs1131450 AA genotype (adjusted OR = 1.64, P = 0.007) exhibited 1.40-fold and 1.64-fold higher risk of PCa, respectively, compared with their respective homozygous wild-type genotypes. Further functional analyses revealed these two variants contribute to reducing MTR expression, elevating homocysteine and SAH levels, reducing methionine and SAM levels, increasing SAH/SAM ratio, and promoting the invasion of PCa cells in vitro. Collectively, our data suggest regulatory variants of the MTR gene significantly increase the PCa risk via decreasing methylation potential. These findings provide a novel molecular mechanism for the prostate carcinogenesis. PMID:27808252

  7. Genomic organization of the human lysosomal acid lipase gene (LIPA)

    SciTech Connect

    Aslandis, C.; Klima, H.; Lackner, K.J.; Schmitz, G. )

    1994-03-15

    Defects in the human lysosomal acid lipase gene are responsible for cholesteryl ester storage disease (CESD) and Wolman disease. Exon skipping as the cause for CESD has been demonstrated. The authors present here a summary of the exon structure of the entire human lysosomal acid lipase gene consisting of 10 exons, together with the sizes of genomic EcoRI and SacI fragments hybridizing to each exon. In addition, the DNA sequence of the putative promoter region is presented. The EMBL accession numbers for adjacent intron sequences are given. 7 refs., 2 figs., 1 tab.

  8. Methyl farnesoate synthesis in the lobster mandibular organ: The roles of HMG-CoA reductase and farnesoic acid-O-methyltransferase

    PubMed Central

    Li, Sheng; Friesen, Jon A.; Holford, Kenneth C.; Borst, David W.

    2009-01-01

    Eyestalk ablation (ESA) increases crustacean production of methyl farnesoate (MF), a juvenile hormone-like compound, but the biochemical steps involved are not completely understood. We measured the activity of 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMGR) and farnesoic acid-O-methyl transferase (FAOMeT), an early step and the last step in MF synthesis. ESA elevated hemolymph levels of MF in male lobsters. Enzyme activity suggested that increased MF production on day one was due largely to elevated HMGR activity while changes in FAOMeT activity closely paralleled changes in MF levels on day 14. Transcript levels for HMGR and FAOMeT changed little on day one, but both increased substantially on day 14. We treated ESA males with a partially purified mandibular organ inhibiting hormone (MOIH) and observed a significant decline in MF levels, FAOMeT activity, and FAOMeT-mRNA levels after 5 hours. However, no effect was observed on HMGR activity or its mRNA indicating that they must be regulated by a separate sinus gland peptide. We confirmed that lobster HMGR was not a phosphoprotein and was not regulated by reversible phosphorylation, an important mechanism for regulating other HMGRs. Nevertheless, molecular modeling indicated that the catalytic mechanisms of lobster and mammalian HMGR were similar. PMID:19778626

  9. Control of mammalian gene expression by amino acids, especially glutamine.

    PubMed

    Brasse-Lagnel, Carole; Lavoinne, Alain; Husson, Annie

    2009-04-01

    Molecular data rapidly accumulating on the regulation of gene expression by amino acids in mammalian cells highlight the large variety of mechanisms that are involved. Transcription factors, such as the basic-leucine zipper factors, activating transcription factors and CCAAT/enhancer-binding protein, as well as specific regulatory sequences, such as amino acid response element and nutrient-sensing response element, have been shown to mediate the inhibitory effect of some amino acids. Moreover, amino acids exert a wide range of effects via the activation of different signalling pathways and various transcription factors, and a number of cis elements distinct from amino acid response element/nutrient-sensing response element sequences were shown to respond to changes in amino acid concentration. Particular attention has been paid to the effects of glutamine, the most abundant amino acid, which at appropriate concentrations enhances a great number of cell functions via the activation of various transcription factors. The glutamine-responsive genes and the transcription factors involved correspond tightly to the specific effects of the amino acid in the inflammatory response, cell proliferation, differentiation and survival, and metabolic functions. Indeed, in addition to the major role played by nuclear factor-kappaB in the anti-inflammatory action of glutamine, the stimulatory role of activating protein-1 and the inhibitory role of C/EBP homology binding protein in growth-promotion, and the role of c-myc in cell survival, many other transcription factors are also involved in the action of glutamine to regulate apoptosis and intermediary metabolism in different cell types and tissues. The signalling pathways leading to the activation of transcription factors suggest that several kinases are involved, particularly mitogen-activated protein kinases. In most cases, however, the precise pathways from the entrance of the amino acid into the cell to the activation of gene

  10. Volatilization of Arsenic from Polluted Soil by Pseudomonas putida Engineered for Expression of the arsM Arsenic(III) S-Adenosine Methyltransferase Gene

    PubMed Central

    2015-01-01

    Even though arsenic is one of the most widespread environmental carcinogens, methods of remediation are still limited. In this report we demonstrate that a strain of Pseudomonas putida KT2440 endowed with chromosomal expression of the arsM gene encoding the As(III) S-adenosylmethionine (SAM) methyltransfase from Rhodopseudomonas palustris to remove arsenic from contaminated soil. We genetically engineered the P. putida KT2440 with stable expression of an arsM-gfp fusion gene (GE P. putida), which was inserted into the bacterial chromosome. GE P. putida showed high arsenic methylation and volatilization activity. When exposed to 25 μM arsenite or arsenate overnight, most inorganic arsenic was methylated to the less toxic methylated arsenicals methylarsenate (MAs(V)), dimethylarsenate (DMAs(V)) and trimethylarsine oxide (TMAs(V)O). Of total added arsenic, the species were about 62 ± 2.2% DMAs(V), 25 ± 1.4% MAs(V) and 10 ± 1.2% TMAs(V)O. Volatilized arsenicals were trapped, and the predominant species were dimethylarsine (Me2AsH) (21 ± 1.0%) and trimethylarsine (TMAs(III)) (10 ± 1.2%). At later times, more DMAs(V) and volatile species were produced. Volatilization of Me2AsH and TMAs(III) from contaminated soil is thus possible with this genetically engineered bacterium and could be instrumental as an agent for reducing the inorganic arsenic content of soil and agricultural products. PMID:25122054

  11. Volatilization of arsenic from polluted soil by Pseudomonas putida engineered for expression of the arsM Arsenic(III) S-adenosine methyltransferase gene.

    PubMed

    Chen, Jian; Sun, Guo-Xin; Wang, Xiao-Xue; Lorenzo, Víctor de; Rosen, Barry P; Zhu, Yong-Guan

    2014-09-02

    Even though arsenic is one of the most widespread environmental carcinogens, methods of remediation are still limited. In this report we demonstrate that a strain of Pseudomonas putida KT2440 endowed with chromosomal expression of the arsM gene encoding the As(III) S-adenosylmethionine (SAM) methyltransfase from Rhodopseudomonas palustris to remove arsenic from contaminated soil. We genetically engineered the P. putida KT2440 with stable expression of an arsM-gfp fusion gene (GE P. putida), which was inserted into the bacterial chromosome. GE P. putida showed high arsenic methylation and volatilization activity. When exposed to 25 μM arsenite or arsenate overnight, most inorganic arsenic was methylated to the less toxic methylated arsenicals methylarsenate (MAs(V)), dimethylarsenate (DMAs(V)) and trimethylarsine oxide (TMAs(V)O). Of total added arsenic, the species were about 62 ± 2.2% DMAs(V), 25 ± 1.4% MAs(V) and 10 ± 1.2% TMAs(V)O. Volatilized arsenicals were trapped, and the predominant species were dimethylarsine (Me2AsH) (21 ± 1.0%) and trimethylarsine (TMAs(III)) (10 ± 1.2%). At later times, more DMAs(V) and volatile species were produced. Volatilization of Me2AsH and TMAs(III) from contaminated soil is thus possible with this genetically engineered bacterium and could be instrumental as an agent for reducing the inorganic arsenic content of soil and agricultural products.

  12. Cadmium Induces Retinoic Acid Signaling by Regulating Retinoic Acid Metabolic Gene Expression*

    PubMed Central

    Cui, Yuxia; Freedman, Jonathan H.

    2009-01-01

    The transition metal cadmium is an environmental teratogen. In addition, cadmium and retinoic acid can act synergistically to induce forelimb malformations. The molecular mechanism underlying the teratogenicity of cadmium and the synergistic effect with retinoic acid has not been addressed. An evolutionarily conserved gene, β,β-carotene 15,15′-monooxygenase (BCMO), which is involved in retinoic acid biosynthesis, was studied in both Caenorhabditis elegans and murine Hepa 1–6 cells. In C. elegans, bcmo-1 was expressed in the intestine and was cadmium inducible. Similarly, in Hepa 1–6 cells, Bcmo1 was induced by cadmium. Retinoic acid-mediated signaling increased after 24-h exposures to 5 and 10 μm cadmium in Hepa 1–6 cells. Examination of gene expression demonstrated that the induction of retinoic acid signaling by cadmium may be mediated by overexpression of Bcmo1. Furthermore, cadmium inhibited the expression of Cyp26a1 and Cyp26b1, which are involved in retinoic acid degradation. These results indicate that cadmium-induced teratogenicity may be due to the ability of the metal to increase the levels of retinoic acid by disrupting the expression of retinoic acid-metabolizing genes. PMID:19556237

  13. Thr105Ile (rs11558538) polymorphism in the histamine-1-methyl-transferase (HNMT) gene and risk for restless legs syndrome.

    PubMed

    Jiménez-Jiménez, Félix Javier; García-Martín, Elena; Alonso-Navarro, Hortensia; Martínez, Carmen; Zurdo, Martín; Turpín-Fenoll, Laura; Millán-Pascual, Jorge; Adeva-Bartolomé, Teresa; Cubo, Esther; Navacerrada, Francisco; Rojo-Sebastián, Ana; Rubio, Lluisa; Ortega-Cubero, Sara; Pastor, Pau; Calleja, Marisol; Plaza-Nieto, José Francisco; Pilo-de-la-Fuente, Belén; Arroyo-Solera, Margarita; García-Albea, Esteban; Agúndez, José A G

    2017-03-01

    A recent meta-analysis suggests an association between the rs11558538 single nucleotide polymorphism in the histamine-N-methyl-transferase (HNMT) gene and the risk for Parkinson's disease. Based on the possible relationship between PD and restless legs syndrome (RLS), we tried to establish whether rs11558538 SNP is associated with the risk for RLS. We studied the genotype and allelic variant frequencies of HNMT rs11558538 SNP 205 RLS patients and 410 healthy controls using a TaqMan assay. The frequencies of the HNMT rs11558538 genotypes allelic variants were similar between RLS patients and controls, and were not influenced by gender, family history of RLS, or RLS severity. RLS patients carrying the genotype rs11558538TT had an earlier age at onset, but this finding was based on three subjects only. These results suggest a lack of major association between HNMT rs11558538 SNP and the risk for RLS.

  14. Identification of Nitrogen-Fixing Genes and Gene Clusters from Metagenomic Library of Acid Mine Drainage

    PubMed Central

    Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

    2014-01-01

    Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community. PMID:24498417

  15. Identification of nitrogen-fixing genes and gene clusters from metagenomic library of acid mine drainage.

    PubMed

    Dai, Zhimin; Guo, Xue; Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

    2014-01-01

    Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community.

  16. Enzymology of Mammalian DNA Methyltransferases.

    PubMed

    Jurkowska, Renata Z; Jeltsch, Albert

    2016-01-01

    DNA methylation is currently one of the hottest topics in basic and biomedical research. Despite tremendous progress in understanding the structures and biochemical properties of the mammalian DNA nucleotide methyltransferases (DNMTs), principles of their regulation in cells have only begun to be uncovered. In mammals, DNA methylation is introduced by the DNMT1, DNMT3A, and DNMT3B enzymes, which are all large multi-domain proteins. These enzymes contain a catalytic C-terminal domain with a characteristic cytosine-C5 methyltransferase fold and an N-terminal part with different domains that interacts with other proteins and chromatin and is involved in targeting and regulation of the DNMTs. The subnuclear localization of the DNMT enzymes plays an important role in their biological function: DNMT1 is localized to replicating DNA via interaction with PCNA and UHRF1. DNMT3 enzymes bind to heterochromatin via protein multimerization and are targeted to chromatin by their ADD and PWWP domains. Recently, a novel regulatory mechanism has been discovered in DNMTs, as latest structural and functional data demonstrated that the catalytic activities of all three enzymes are under tight allosteric control of their N-terminal domains having autoinhibitory functions. This mechanism provides numerous possibilities for the precise regulation of the methyltransferases via controlling the binding and release of autoinhibitory domains by protein factors, noncoding RNAs, or by posttranslational modifications of the DNMTs. In this chapter, we summarize key enzymatic properties of DNMTs, including their specificity and processivity, and afterward we focus on the regulation of their activity and targeting via allosteric processes, protein interactors, and posttranslational modifications.

  17. DNA Labeling Using DNA Methyltransferases.

    PubMed

    Tomkuvienė, Miglė; Kriukienė, Edita; Klimašauskas, Saulius

    2016-01-01

    DNA methyltransferases (MTases) uniquely combine the ability to recognize and covalently modify specific target sequences in DNA using the ubiquitous cofactor S-adenosyl-L-methionine (AdoMet). Although DNA methylation plays important roles in biological signaling, the transferred methyl group is a poor reporter and is highly inert to further biocompatible derivatization. To unlock the biotechnological power of these enzymes, two major types of cofactor AdoMet analogs were developed that permit targeted MTase-directed attachment of larger moieties containing functional or reporter groups onto DNA. One such approach (named sequence-specific methyltransferase-induced labeling, SMILing) uses reactive aziridine or N-mustard mimics of the cofactor AdoMet, which render targeted coupling of a whole cofactor molecule to the target DNA. The second approach (methyltransferase-directed transfer of activated groups, mTAG) uses AdoMet analogs with a sulfonium-bound extended side chain replacing the methyl group, which permits MTase-directed covalent transfer of the activated side chain alone. As the enlarged cofactors are not always compatible with the active sites of native MTases, steric engineering of the active site has been employed to optimize their alkyltransferase activity. In addition to the described cofactor analogs, recently discovered atypical reactions of DNA cytosine-5 MTases involving non-cofactor-like compounds can also be exploited for targeted derivatization and labeling of DNA. Altogether, these approaches offer new powerful tools for sequence-specific covalent DNA labeling, which not only pave the way to developing a variety of useful techniques in DNA research, diagnostics, and nanotechnologies but have already proven practical utility for optical DNA mapping and epigenome studies.

  18. Trinucleotide repeat variants in the promoter of the thiopurine S-methyltransferase gene of patients exhibiting ultra-high enzyme activity.

    PubMed

    Roberts, Rebecca L; Gearry, Richard B; Bland, Michael V; Sies, Christiaan W; George, Peter M; Burt, Michael; Marinaki, Anthony M; Arenas, Monica; Barclay, Murray L; Kennedy, Martin A

    2008-05-01

    Thiopurine S-methyl transferase (TPMT) is a cytosolic enzyme that catalyses the S-methylation of the thiopurine immunosuppressants. To date, 22 variants have been identified that are predictive of decreased TPMT activity. In contrast, no molecular explanation has been found for the 1-2% of Caucasians who exhibit ultra-high TPMT activity. Here, we report the characterization of polymorphisms within a trinucleotide (GCC) repeat element of the TPMT promoter in two patients with inflammatory bowel disease exhibiting the highest TPMT activity from two testing centres. The first patient was heterozygous for a variant allele carrying seven GCC repeats [(GCC)7], whereas the second patient was heterozygous for a variant allele containing five GCC repeats [(GCC)5]. Fifty patients with inflammatory bowel disease with normal TPMT activity were all homozygous for six GCC repeats [(GCC)6]. Of 200 healthy controls, five were found to be heterozygous for the (GCC)7 variant. Within in vitro reporter gene assays, the mean luciferase activities of the (GCC)6, (GCC)7, and (GCC)5 constructs were 8.0+/-0.26, 13.2+/-0.10 and 12.3+/-0.12, respectively. The significant increase in activity observed for (GCC)5 and (GCC)7 compared with (GCC)6 (P-value

  19. Human nutrigenomics of gene regulation by dietary fatty acids.

    PubMed

    Afman, Lydia A; Müller, Michael

    2012-01-01

    Nutrigenomics employs high-throughput genomics technologies to unravel how nutrients modulate gene and protein expression and ultimately influence cellular and organism metabolism. The most often-applied genomics technique so far is transcriptomics, which allows quantifying genome-wide changes in gene expression of thousands of genes at the same time in one sample. The performance of gene expression quantification requires sufficient high-quality homogenous cellular material, therefore research in healthy volunteers is restricted to biopsies from easy accessible tissues such as subcutaneous adipose tissue, skeletal muscle and intestinal biopsies or even more easily accessible cells such as peripheral blood mononuclear cells from blood. There is now significant evidence that fatty acids, in particular unsaturated fatty acids, exert many of their effects through modulation of gene transcription by regulating the activity of numerous transcription factors, including nuclear receptors such as peroxisome proliferator activated receptors, liver X receptor and sterol regulatory binding proteins. This review evaluates the human nutrigenomics studies performed on dietary fat since the initiation of nutrigenomics research around 10 years ago. Although the number of studies is still limited, all studies clearly suggest that changes in dietary fatty acids intake and composition can have a significant impact on cellular adaptive response capacity by gene transcription changes in humans. This adds important knowledge to our understanding of the strong effects that various fatty acids can have on numerous metabolic and inflammatory pathways, signaling routes and homeostatic control in the cell and ultimately on whole body health. It is important to use and integrate nutrigenomics in all future nutrition studies to build up the necessary framework for evidence-based nutrition in near future. Copyright © 2011 Elsevier Ltd. All rights reserved.

  20. Ribosomal protein methyltransferases in the yeast Saccharomyces cerevisiae: Roles in ribosome biogenesis and translation.

    PubMed

    Al-Hadid, Qais; White, Jonelle; Clarke, Steven

    2016-02-12

    A significant percentage of the methyltransferasome in Saccharomyces cerevisiae and higher eukaryotes is devoted to methylation of the translational machinery. Methylation of the RNA components of the translational machinery has been studied extensively and is important for structure stability, ribosome biogenesis, and translational fidelity. However, the functional effects of ribosomal protein methylation by their cognate methyltransferases are still largely unknown. Previous work has shown that the ribosomal protein Rpl3 methyltransferase, histidine protein methyltransferase 1 (Hpm1), is important for ribosome biogenesis and translation elongation fidelity. In this study, yeast strains deficient in each of the ten ribosomal protein methyltransferases in S. cerevisiae were examined for potential defects in ribosome biogenesis and translation. Like Hpm1-deficient cells, loss of four of the nine other ribosomal protein methyltransferases resulted in defects in ribosomal subunit synthesis. All of the mutant strains exhibited resistance to the ribosome inhibitors anisomycin and/or cycloheximide in plate assays, but not in liquid culture. Translational fidelity assays measuring stop codon readthrough, amino acid misincorporation, and programmed -1 ribosomal frameshifting, revealed that eight of the ten enzymes are important for translation elongation fidelity and the remaining two are necessary for translation termination efficiency. Altogether, these results demonstrate that ribosomal protein methyltransferases in S. cerevisiae play important roles in ribosome biogenesis and translation.

  1. Structural and functional insight into an unexpectedly selective N-methyltransferase involved in plantazolicin biosynthesis

    PubMed Central

    Lee, Jaeheon; Hao, Yue; Blair, Patricia M.; Melby, Joel O.; Agarwal, Vinayak; Burkhart, Brandon J.; Nair, Satish K.; Mitchell, Douglas A.

    2013-01-01

    Plantazolicin (PZN), a polyheterocyclic, Nα,Nα-dimethylarginine–containing antibiotic, harbors remarkably specific bactericidal activity toward strains of Bacillus anthracis, the causative agent of anthrax. Previous studies demonstrated that genetic deletion of the S-adenosyl-l-methionine–dependent methyltransferase from the PZN biosynthetic gene cluster results in the formation of desmethylPZN, which is devoid of antibiotic activity. Here we describe the in vitro reconstitution, mutational analysis, and X-ray crystallographic structure of the PZN methyltransferase. Unlike all other known small molecule methyltransferases, which act upon diverse substrates in vitro, the PZN methyltransferase is uncharacteristically limited in substrate scope and functions only on desmethylPZN and close derivatives. The crystal structures of two related PZN methyltransferases, solved to 1.75 Å (Bacillus amyloliquefaciens) and 2.0 Å (Bacillus pumilus), reveal a deep, narrow cavity, putatively functioning as the binding site for desmethylPZN. The narrowness of this cavity provides a framework for understanding the molecular basis of the extreme substrate selectivity. Analysis of a panel of point mutations to the methyltransferase from B. amyloliquefaciens allowed the identification of residues of structural and catalytic importance. These findings further our understanding of one set of orthologous enzymes involved in thiazole/oxazole-modified microcin biosynthesis, a rapidly growing sector of natural products research. PMID:23878226

  2. Tomato ABSCISIC ACID STRESS RIPENING (ASR) gene family revisited.

    PubMed

    Golan, Ido; Dominguez, Pia Guadalupe; Konrad, Zvia; Shkolnik-Inbar, Doron; Carrari, Fernando; Bar-Zvi, Dudy

    2014-01-01

    Tomato ABSCISIC ACID RIPENING 1 (ASR1) was the first cloned plant ASR gene. ASR orthologs were then cloned from a large number of monocot, dicot and gymnosperm plants, where they are mostly involved in response to abiotic (drought and salinity) stress and fruit ripening. The tomato genome encodes five ASR genes: ASR1, 2, 3 and 5 encode low-molecular-weight proteins (ca. 110 amino acid residues each), whereas ASR4 encodes a 297-residue polypeptide. Information on the expression of the tomato ASR gene family is scarce. We used quantitative RT-PCR to assay the expression of this gene family in plant development and in response to salt and osmotic stresses. ASR1 and ASR4 were the main expressed genes in all tested organs and conditions, whereas ASR2 and ASR3/5 expression was two to three orders of magnitude lower (with the exception of cotyledons). ASR1 is expressed in all plant tissues tested whereas ASR4 expression is limited to photosynthetic organs and stamens. Essentially, ASR1 accounted for most of ASR gene expression in roots, stems and fruits at all developmental stages, whereas ASR4 was the major gene expressed in cotyledons and young and fully developed leaves. Both ASR1 and ASR4 were expressed in flower organs, with ASR1 expression dominating in stamens and pistils, ASR4 in sepals and petals. Steady-state levels of ASR1 and ASR4 were upregulated in plant vegetative organs following exposure to salt stress, osmotic stress or the plant abiotic stress hormone abscisic acid (ABA). Tomato plants overexpressing ASR1 displayed enhanced survival rates under conditions of water stress, whereas ASR1-antisense plants displayed marginal hypersensitivity to water withholding.

  3. Molecular and Enzymatic Profiles of Mammalian DNA Methyltransferases: Structures and Targets for Drugs

    PubMed Central

    Xu, F.; Mao, C.; Ding, Y.; Rui, C.; Wu, L.; Shi, A.; Zhang, H.; Zhang, L.; Xu, Z.

    2010-01-01

    DNA methylation is an epigenetic event involved in a variety array of processes that may be the foundation of genetic phenomena and diseases. DNA methyltransferase is a key enzyme for cytosine methylation in DNA, and can be divided into two functional families (Dnmt1 and Dnmt3) in mammals. All mammalian DNA methyltransferases are encoded by their own single gene, and consisted of catalytic and regulatory regions (except Dnmt2). Via interactions between functional domains in the regulatory or catalytic regions and other adaptors or cofactors, DNA methyltransferases can be localized at selective areas (specific DNA/nucleotide sequence) and linked to specific chromosome status (euchromatin/heterochromatin, various histone modification status). With assistance from UHRF1 and Dnmt3L or other factors in Dnmt1 and Dnmt3a/Dnmt3b, mammalian DNA methyltransferases can be recruited, and then specifically bind to hemimethylated and unmethylated double-stranded DNA sequence to maintain and de novo setup patterns for DNA methylation. Complicated enzymatic steps catalyzed by DNA methyltransferases include methyl group transferred from cofactor Ado-Met to C5 position of the flipped-out cytosine in targeted DNA duplex. In the light of the fact that different DNA methyltransferases are divergent in both structures and functions, and use unique reprogrammed or distorted routines in development of diseases, design of new drugs targeting specific mammalian DNA methyltransferases or their adaptors in the control of key steps in either maintenance or de novo DNA methylation processes will contribute to individually treating diseases related to DNA methyltransferases. PMID:20939822

  4. Daphnetin methylation by a novel O-methyltransferase is associated with cold acclimation and photosystem II excitation pressure in rye.

    PubMed

    NDong, Christian; Anzellotti, Dominique; Ibrahim, Ragai K; Huner, Norman P A; Sarhan, Fathey

    2003-02-28

    In plants, O-methylation of phenolic compounds plays an important role in such processes as lignin synthesis, flower pigmentation, chemical defense, and signaling. However, apart from phenylpropanoids and flavonoids, very few enzymes involved in coumarin biosynthesis have been identified. We report here the molecular and biochemical characterization of a gene encoding a novel O-methyltransferase that catalyzes the methylation of 7,8-dihydroxycoumarin, daphnetin. The recombinant protein displayed an exclusive methylation of position 8 of daphnetin. The identity of the methylated product was unambiguously identified as 7-hydroxy-8-methoxycoumarin by co-chromatography on cellulose TLC and coelution from high performance liquid chromatography, with authentic synthetic samples, as well as by UV, mass spectroscopy, (1)H NMR spectral analysis, and NOE correlation signals of the relevant protons. Northern blot analysis and enzyme activity assays revealed that the transcript and corresponding enzyme activity are up-regulated by both low temperature and photosystem II excitation pressure. Using various phenylpropanoid and flavonoid substrates, we demonstrate that cold acclimation of rye leaves increases O-methyltransferase activity not only for daphnetin but also for the lignin precursors, caffeic acid, and 5-hydroxyferulic acid. The significance of this novel enzyme and daphnetin O-methylation is discussed in relation to its putative role in modulating cold acclimation and photosystem II excitation pressure.

  5. Repeats in transforming acidic coiled-coil (TACC) genes.

    PubMed

    Trivedi, Seema

    2013-06-01

    Transforming acidic coiled-coil proteins (TACC1, 2, and 3) are essential proteins associated with the assembly of spindle microtubules and maintenance of bipolarity. Dysregulation of TACCs is associated with tumorigenesis, but studies of microsatellite instability in TACC genes have not been extensive. Microsatellite or simple sequence repeat instability is known to cause many types of cancer. The present in silico analysis of SSRs in human TACC gene sequences shows the presence of mono- to hexa-nucleotide repeats, with the highest densities found for mono- and di-nucleotide repeats. Density of repeats is higher in introns than in exons. Some of the repeats are present in regulatory regions and retained introns. Human TACC genes show conservation of many repeat classes. Microsatellites in TACC genes could be valuable markers for monitoring numerical chromosomal aberrations and or cancer.

  6. Methylation mediated by an anthocyanin, O-methyltransferase, is involved in purple flower coloration in Paeonia

    PubMed Central

    Du, Hui; Wu, Jie; Ji, Kui-Xian; Zeng, Qing-Yin; Bhuiya, Mohammad-Wadud; Su, Shang; Shu, Qing-Yan; Ren, Hong-Xu; Liu, Zheng-An; Wang, Liang-Sheng

    2015-01-01

    Anthocyanins are major pigments in plants. Methylation plays a role in the diversity and stability of anthocyanins. However, the contribution of anthocyanin methylation to flower coloration is still unclear. We identified two homologous anthocyanin O-methyltransferase (AOMT) genes from purple-flowered (PsAOMT) and red-flowered (PtAOMT) Paeonia plants, and we performed functional analyses of the two genes in vitro and in vivo. The critical amino acids for AOMT catalytic activity were studied by site-directed mutagenesis. We showed that the recombinant proteins, PsAOMT and PtAOMT, had identical substrate preferences towards anthocyanins. The methylation activity of PsAOMT was 60 times higher than that of PtAOMT in vitro. Interestingly, this vast difference in catalytic activity appeared to result from a single amino acid residue substitution at position 87 (arginine to leucine). There were significant differences between the 35S::PsAOMT transgenic tobacco and control flowers in relation to their chromatic parameters, which further confirmed the function of PsAOMT in vivo. The expression levels of the two homologous AOMT genes were consistent with anthocyanin accumulation in petals. We conclude that AOMTs are responsible for the methylation of cyanidin glycosides in Paeonia plants and play an important role in purple coloration in Paeonia spp. PMID:26208646

  7. A SABATH Methyltransferase from the moss Physcomitrella patens catalyzes

    SciTech Connect

    Zhao, Nan; Ferrer, Jean-Luc; Moon, Hong S; Kapteyn, Jeremy; Zhuang, Xiaofeng; Hasebe, Mitsuyasu; Stewart, Neal C.; Gang, David R.; Chen, Feng

    2012-01-01

    Known SABATH methyltransferases, all of which were identified from seed plants, catalyze methylation of either the carboxyl group of a variety of low molecular weight metabolites or the nitrogen moiety of precursors of caffeine. In this study, the SABATH family from the bryophyte Physcomitrella patens was identified and characterized. Four SABATH-like sequences (PpSABATH1, PpSABATH2, PpSABATH3, and PpSABATH4) were identified from the P. patens genome. Only PpSABATH1 and PpSABATH2 showed expression in the leafy gametophyte of P. patens. Full-length cDNAs of PpSABATH1 and PpSABATH2 were cloned and expressed in soluble form in Escherichia coli. Recombinant PpSABATH1 and PpSABATH2 were tested for methyltransferase activity with a total of 75 compounds. While showing no activity with carboxylic acids or nitrogen-containing compounds, PpSABATH1 displayed methyltransferase activity with a number of thiols. PpSABATH2 did not show activity with any of the compounds tested. Among the thiols analyzed, PpSABATH1 showed the highest level of activity with thiobenzoic acid with an apparent Km value of 95.5 lM, which is comparable to those of known SABATHs. Using thiobenzoic acid as substrate, GC MS analysis indicated that the methylation catalyzed by PpSABATH1 is on the sulfur atom. The mechanism for S-methylation of thiols catalyzed by PpSABATH1 was partially revealed by homology-based structural modeling. The expression of PpSABATH1 was induced by the treatment of thiobenzoic acid. Further transgenic studies showed that tobacco plants overexpressing PpSABATH1 exhibited enhanced tolerance to thiobenzoic acid, suggesting that PpSABATH1 have a role in the detoxification of xenobiotic thiols.

  8. Genomic characterization of ribitol teichoic acid synthesis in Staphylococcus aureus: genes, genomic organization and gene duplication.

    PubMed

    Qian, Ziliang; Yin, Yanbin; Zhang, Yong; Lu, Lingyi; Li, Yixue; Jiang, Ying

    2006-04-05

    Staphylococcus aureus or MRSA (Methicillin Resistant S. aureus), is an acquired pathogen and the primary cause of nosocomial infections worldwide. In S. aureus, teichoic acid is an essential component of the cell wall, and its biosynthesis is not yet well characterized. Studies in Bacillus subtilis have discovered two different pathways of teichoic acid biosynthesis, in two strains W23 and 168 respectively, namely teichoic acid ribitol (tar) and teichoic acid glycerol (tag). The genes involved in these two pathways are also characterized, tarA, tarB, tarD, tarI, tarJ, tarK, tarL for the tar pathway, and tagA, tagB, tagD, tagE, tagF for the tag pathway. With the genome sequences of several MRSA strains: Mu50, MW2, N315, MRSA252, COL as well as methicillin susceptible strain MSSA476 available, a comparative genomic analysis was performed to characterize teichoic acid biosynthesis in these S. aureus strains. We identified all S. aureus tar and tag gene orthologs in the selected S. aureus strains which would contribute to teichoic acids sythesis. Based on our identification of genes orthologous to tarI, tarJ, tarL, which are specific to tar pathway in B. subtilis W23, we also concluded that tar is the major teichoic acid biogenesis pathway in S. aureus. Further analyses indicated that the S. aureus tar genes, different from the divergon organization in B. subtilis, are organized into several clusters in cis. Most interesting, compared with genes in B. subtilis tar pathway, the S. aureus tar specific genes (tarI,J,L) are duplicated in all six S. aureus genomes. In the S. aureus strains we analyzed, tar (teichoic acid ribitol) is the main teichoic acid biogenesis pathway. The tar genes are organized into several genomic groups in cis and the genes specific to tar (relative to tag): tarI, tarJ, tarL are duplicated. The genomic organization of the S. aureus tar pathway suggests their regulations are different when compared to B. subtilis tar or tag pathway, which are

  9. DNA Methyltransferase Activity Assays: Advances and Challenges.

    PubMed

    Poh, Wan Jun; Wee, Cayden Pang Pee; Gao, Zhiqiang

    2016-01-01

    DNA methyltransferases (MTases), a family of enzymes that catalyse the methylation of DNA, have a profound effect on gene regulation. A large body of evidence has indicated that DNA MTase is potentially a predictive biomarker closely associated with genetic disorders and genetic diseases like cancer. Given the attention bestowed onto DNA MTases in molecular biology and medicine, highly sensitive detection of DNA MTase activity is essential in determining gene regulation, epigenetic modification, clinical diagnosis and therapeutics. Conventional techniques such as isotope labelling are effective, but they often require laborious sample preparation, isotope labelling, sophisticated equipment and large amounts of DNA, rendering them unsuitable for uses at point-of-care. Simple, portable, highly sensitive and low-cost assays are urgently needed for DNA MTase activity screening. In most recent technological advances, many alternative DNA MTase activity assays such as fluorescent, electrochemical, colorimetric and chemiluminescent assays have been proposed. In addition, many of them are coupled with nanomaterials and/or enzymes to significantly enhance their sensitivity. Herein we review the progress in the development of DNA MTase activity assays with an emphasis on assay mechanism and performance with some discussion on challenges and perspectives. It is hoped that this article will provide a broad coverage of DNA MTase activity assays and their latest developments and open new perspectives toward the development of DNA MTase activity assays with much improved performance for uses in molecular biology and clinical practice.

  10. DNA Methyltransferase Activity Assays: Advances and Challenges

    PubMed Central

    Poh, Wan Jun; Wee, Cayden Pang Pee; Gao, Zhiqiang

    2016-01-01

    DNA methyltransferases (MTases), a family of enzymes that catalyse the methylation of DNA, have a profound effect on gene regulation. A large body of evidence has indicated that DNA MTase is potentially a predictive biomarker closely associated with genetic disorders and genetic diseases like cancer. Given the attention bestowed onto DNA MTases in molecular biology and medicine, highly sensitive detection of DNA MTase activity is essential in determining gene regulation, epigenetic modification, clinical diagnosis and therapeutics. Conventional techniques such as isotope labelling are effective, but they often require laborious sample preparation, isotope labelling, sophisticated equipment and large amounts of DNA, rendering them unsuitable for uses at point-of-care. Simple, portable, highly sensitive and low-cost assays are urgently needed for DNA MTase activity screening. In most recent technological advances, many alternative DNA MTase activity assays such as fluorescent, electrochemical, colorimetric and chemiluminescent assays have been proposed. In addition, many of them are coupled with nanomaterials and/or enzymes to significantly enhance their sensitivity. Herein we review the progress in the development of DNA MTase activity assays with an emphasis on assay mechanism and performance with some discussion on challenges and perspectives. It is hoped that this article will provide a broad coverage of DNA MTase activity assays and their latest developments and open new perspectives toward the development of DNA MTase activity assays with much improved performance for uses in molecular biology and clinical practice. PMID:26909112

  11. Genes Required for Vacuolar Acidity in Saccharomyces Cerevisiae

    PubMed Central

    Preston, R. A.; Reinagel, P. S.; Jones, E. W.

    1992-01-01

    Mutations that cause loss of acidity in the vacuole (lysosome) of Saccharomyces cerevisiae were identified by screening colonies labeled with the fluorescent, pH-sensitive, vacuolar labeling agent, 6-carboxyfluorescein. Thirty nine vacuolar pH (Vph(-)) mutants were identified. Four of these contained mutant alleles of the previously described PEP3, PEP5, PEP6 and PEP7 genes. The remaining mutants defined eight complementation groups of vph mutations. No alleles of the VAT2 or TFP1 genes (known to encode subunits of the vacuolar H(+)-ATPase) were identified in the Vph(-) screen. Strains bearing mutations in any of six of the VPH genes failed to grow on medium buffered at neutral pH; otherwise, none of the vph mutations caused notable growth inhibition on standard yeast media. Expression of the vacuolar protease, carboxypeptidase Y, was defective in strains bearing vph4 mutations but was apparently normal in strains bearing any of the other vph mutations. Defects in vacuolar morphology at the light microscope level were evident in all Vph(-) mutants. Strains that contained representative mutant alleles of the 17 previously described PEP genes were assayed for vacuolar pH; mutations in seven of the PEP genes (including PEP3, PEP5, PEP6 and PEP7) caused loss of vacuolar acidity. PMID:1628805

  12. Abscisic acid represses the transcription of chloroplast genes*

    PubMed Central

    Yamburenko, Maria V.; Zubo, Yan O.; Börner, Thomas

    2013-01-01

    Numerous studies have shown effects of abscisic acid (ABA) on nuclear genes encoding chloroplast-localized proteins. ABA effects on the transcription of chloroplast genes, however, have not been investigated yet thoroughly. This work, therefore, studied the effects of ABA (75 μM) on transcription and steady-state levels of transcripts in chloroplasts of basal and apical segments of primary leaves of barley (Hordeum vulgare L.). Basal segments consist of young cells with developing chloroplasts, while apical segments contain the oldest cells with mature chloroplasts. Exogenous ABA reduced the chlorophyll content and caused changes of the endogenous concentrations not only of ABA but also of cytokinins to different extents in the basal and apical segments. It repressed transcription by the chloroplast phage-type and bacteria-type RNA polymerases and lowered transcript levels of most investigated chloroplast genes drastically. ABA did not repress the transcription of psbD and a few other genes and even increased psbD mRNA levels under certain conditions. The ABA effects on chloroplast transcription were more pronounced in basal vs. apical leaf segments and enhanced by light. Simultaneous application of cytokinin (22 μM 6-benzyladenine) minimized the ABA effects on chloroplast gene expression. These data demonstrate that ABA affects the expression of chloroplast genes differentially and points to a role of ABA in the regulation and coordination of the activities of nuclear and chloroplast genes coding for proteins with functions in photosynthesis. PMID:24078671

  13. Abscisic acid represses the transcription of chloroplast genes.

    PubMed

    Yamburenko, Maria V; Zubo, Yan O; Vanková, Radomíra; Kusnetsov, Victor V; Kulaeva, Olga N; Börner, Thomas

    2013-11-01

    Numerous studies have shown effects of abscisic acid (ABA) on nuclear genes encoding chloroplast-localized proteins. ABA effects on the transcription of chloroplast genes, however, have not been investigated yet thoroughly. This work, therefore, studied the effects of ABA (75 μM) on transcription and steady-state levels of transcripts in chloroplasts of basal and apical segments of primary leaves of barley (Hordeum vulgare L.). Basal segments consist of young cells with developing chloroplasts, while apical segments contain the oldest cells with mature chloroplasts. Exogenous ABA reduced the chlorophyll content and caused changes of the endogenous concentrations not only of ABA but also of cytokinins to different extents in the basal and apical segments. It repressed transcription by the chloroplast phage-type and bacteria-type RNA polymerases and lowered transcript levels of most investigated chloroplast genes drastically. ABA did not repress the transcription of psbD and a few other genes and even increased psbD mRNA levels under certain conditions. The ABA effects on chloroplast transcription were more pronounced in basal vs. apical leaf segments and enhanced by light. Simultaneous application of cytokinin (22 μM 6-benzyladenine) minimized the ABA effects on chloroplast gene expression. These data demonstrate that ABA affects the expression of chloroplast genes differentially and points to a role of ABA in the regulation and coordination of the activities of nuclear and chloroplast genes coding for proteins with functions in photosynthesis.

  14. Purification of Arsenic (+3 Oxidation State) Methyltransferase from Rat Liver Cytosol

    PubMed Central

    Drobna, Zuzana; Styblo, Miroslav; Thomas, David J.

    2015-01-01

    Demonstrating the enzymatic basis of arsenic methylation is critical to further studies of the pathway for the conversion of inorganic arsenic into a variety of methylated metabolites. This protocol describes a procedure for the purification of an arsenic methyltransferase from rat liver cytosol. Purification of this enzyme and subsequent cloning of its gene has permitted studies of enzyme structure and function and has lead to the identification of orthologous genes in genomes of organisms ranging in complexity from sea urchins to humans. These proteins are referred to as arsenic (+3 oxidation state) methyltransferases. PMID:20949431

  15. Structural characterization of the mitomycin 7-O-methyltransferase

    SciTech Connect

    Singh, Shanteri; Chang, Aram; Goff, Randal D.; Bingman, Craig A.; Grüschow, Sabine; Sherman, David H.; Phillips, Jr., George N.; Thorson, Jon S.

    2014-10-02

    Mitomycins are quinone-containing antibiotics, widely used as antitumor drugs in chemotherapy. Mitomycin-7-O-methyltransferase (MmcR), a key tailoring enzyme involved in the biosynthesis of mitomycin in Streptomyces lavendulae, catalyzes the 7-O-methylation of both C9{beta}- and C9{alpha}-configured 7-hydroxymitomycins. We have determined the crystal structures of the MmcR-S-adenosylhomocysteine (SAH) binary complex and MmcR-SAH-mitomycin A (MMA) ternary complex at resolutions of 1.9 and 2.3 {angstrom}, respectively. The study revealed MmcR to adopt a common S-adenosyl-L-methionine-dependent O-methyltransferase fold and the presence of a structurally conserved active site general acid-base pair is consistent with a proton-assisted methyltransfer common to most methyltransferases. Given the importance of C7 alkylation to modulate mitomycin redox potential, this study may also present a template toward the future engineering of catalysts to generate uniquely bioactive mitomycins.

  16. Functional characterization of a plastidal cation-dependent O-methyltransferase from the liverwort Plagiochasma appendiculatum.

    PubMed

    Xu, Rui-Xue; Zhao, Yu; Gao, Shuai; Zhang, Yu-Ying; Li, Dan-Dan; Lou, Hong-Xiang; Cheng, Ai-Xia

    2015-10-01

    Caffeoyl CoA O-methyltransferases (CCoAOMTs), known to be involved in phenylpropanoid metabolism and lignin synthesis, have been characterized from several higher plant species, which also harbor CCoAOMT-like enzymes responsible for methylation of a variety of flavonoids, anthocyanins, coumarins and phenylpropanoids. Here, a gene encoding a CCoAOMT (PaOMT1) was isolated from a sequenced cDNA library of the liverwort species Plagiochasma appendiculatum, a species belonging to the Family Aytoniaceae. The full-length cDNA sequence of PaOMT1 contains 909 bp, and is predicted to encode a protein with 302 amino acids. The gene products were 40-50% identical to CCoAOMT sequences of other plants. Experiments based on recombinant PaOMT1 showed that the enzyme was able to methylate phenylpropanoids, flavonoids and coumarins, with a preference for the flavonoid quercetin (19). Although the substrate selectivity and biochemical feature of PaOMT1 is similar to CCoAOMT-like enzymes, the sequence alignment results indicated PaOMT1 is closer to true CCoAOMT enzymes. A phylogenetic analysis indicated that PaOMT1 is intermediate between true CCoAOMTs and CCoAOMT-like enzymes. The transient expression of a PaOMT1-GFP fusion in tobacco demonstrated that PaOMT1 is directed to the plastids. PaOMT1 may represent an ancestral form of higher plant true CCoAOMT and CCoAOMT-like enzymes. This is the first time an O-methyltransferase was characterized in liverworts.

  17. Evaluating water deficit and glyphosate treatment on the accumulation of phenolic compounds and photosynthesis rate in transgenic Codonopsis lanceolata (Siebold & Zucc.) Trautv. over-expressing γ-tocopherol methyltransferase (γ-tmt) gene.

    PubMed

    Ghimire, Bimal Kumar; Son, Na-Young; Kim, Seung-Hyun; Yu, Chang Yeon; Chung, Ill-Min

    2017-07-01

    The effect of water stress and herbicide treatment on the phenolic compound concentration and photosynthesis rate in transgenic Codonopsis lanceolata plants over-expressing the γ-tmt gene was investigated and compared to that in control non-transgenic C. lanceolata plants. The total phenolic compound content was investigated using high-performance liquid chromatography combined with diode array detection in C. lanceolata seedlings 3 weeks after water stress and treatment with glyphosate. Changes in the composition of phenolic compounds were observed in leaf and root extracts from transformed C. lanceolata plants following water stress and treatment with glyphosate. The total concentration of phenolic compounds in the leaf extracts of transgenic samples after water stress ranged from 3455.13 ± 40.48 to 8695.00 ± 45.44 µg g(-1) dry weight (DW), whereas the total concentration phenolic compound in the leaf extracts of non-transgenic control samples was 5630.83 ± 45.91 µg g(-1) DW. The predominant phenolic compounds that increased after the water stress in the transgenic leaf were (+) catechin, benzoic acid, chlorogenic acid, ferulic acid, gallic acid, rutin, vanillic acid, and veratric acid. The total concentration of phenolic compounds in the leaf extracts of transgenic samples after glyphosate treatment ranged from 4744.37 ± 81.81 to 12,051.02 ± 75.00 µg g(-1) DW, whereas the total concentration of the leaf extracts of non-transgenic control samples after glyphosate treatment was 3778.28 ± 59.73 µg g(-1) DW. Major phenolic compounds that increased in the transgenic C. lanceolata plants after glyphosate treatment included kaempherol, gallic acid, myricetin, p-hydroxybenzjoic acid, quercetin, salicylic acid, t-cinnamic acid, catechin, benzoicacid, ferulic acid, protocatechuic acid, veratric acid, and vanillic acid. Among these, vanillic acid showed the greatest increase in both leaf and root extracts from transgenic plants relative to

  18. Dietary Flavones as Dual Inhibitors of DNA Methyltransferases and Histone Methyltransferases

    PubMed Central

    Kanwal, Rajnee; Datt, Manish; Liu, Xiaoqi; Gupta, Sanjay

    2016-01-01

    Methylation of DNA and histone proteins are mutually involved in the epigenetic regulation of gene expression mediated by DNA methyltransferases (DNMTs) and histone methyltransferases (HMTs). DNMTs methylate cytosine residues within gene promoters, whereas HMTs catalyze the transfer of methyl groups to lysine and arginine residues of histone proteins, thus causing chromatin condensation and transcriptional repression, which play an important role in the pathogenesis of cancer. The potential reversibility of epigenetic alterations has encouraged the development of dual pharmacologic inhibitors of DNA and histone methylation as anticancer therapeutics. Dietary flavones can affect epigenetic modifications that accumulate over time and have shown anticancer properties, which are undefined. Through DNA binding and in silico protein-ligand docking studies with plant flavones viz. Apigenin, Chrysin and Luteolin, the effect of flavones on DNA and histone methylation was assessed. Spectroscopic analysis of flavones with calf-thymus DNA revealed intercalation as the dominant binding mode, with specific binding to a GC-rich sequence in the DNA duplex. A virtual screening approach using a model of the catalytic site of DNMT and EZH2 demonstrated that plant flavones are tethered at both ends inside the catalytic pocket of DNMT and EZH2 by means of hydrogen bonding. Epigenetic studies performed with flavones exhibited a decrease in DNMT enzyme activity and a reversal of the hypermethylation of cytosine bases in the DNA and prevented cytosine methylation in the GC-rich promoter sequence incubated with the M.SssI enzyme. Furthermore, a marked decrease in HMT activity and a decrease in EZH2 protein expression and trimethylation of H3K27 were noted in histones isolated from cancer cells treated with plant flavones. Our results suggest that dietary flavones can alter DNMT and HMT activities and the methylation of DNA and histone proteins that regulate epigenetic modifications, thus

  19. Yeast genes involved in response to lactic acid and acetic acid: acidic conditions caused by the organic acids in Saccharomyces cerevisiae cultures induce expression of intracellular metal metabolism genes regulated by Aft1p.

    PubMed

    Kawahata, Miho; Masaki, Kazuo; Fujii, Tsutomu; Iefuji, Haruyuki

    2006-09-01

    Using two types of genome-wide analysis to investigate yeast genes involved in response to lactic acid and acetic acid, we found that the acidic condition affects metal metabolism. The first type is an expression analysis using DNA microarrays to investigate 'acid shock response' as the first step to adapt to an acidic condition, and 'acid adaptation' by maintaining integrity in the acidic condition. The other is a functional screening using the nonessential genes deletion collection of Saccharomyces cerevisiae. The expression analysis showed that genes involved in stress response, such as YGP1, TPS1 and HSP150, were induced under the acid shock response. Genes such as FIT2, ARN1 and ARN2, involved in metal metabolism regulated by Aft1p, were induced under the acid adaptation. AFT1 was induced under acid shock response and under acid adaptation with lactic acid. Moreover, green fluorescent protein-fused Aft1p was localized to the nucleus in cells grown in media containing lactic acid, acetic acid, or hydrochloric acid. Both analyses suggested that the acidic condition affects cell wall architecture. The depletion of cell-wall components encoded by SED1, DSE2, CTS1, EGT2, SCW11, SUN4 and YNL300W and histone acetyltransferase complex proteins encoded by YID21, EAF3, EAF5, EAF6 and YAF9 increased resistance to lactic acid. Depletion of the cell-wall mannoprotein Sed1p provided resistance to lactic acid, although the expression of SED1 was induced by exposure to lactic acid. Depletion of vacuolar membrane H+-ATPase and high-osmolarity glycerol mitogen-activated protein kinase proteins caused acid sensitivity. Moreover, our quantitative PCR showed that expression of PDR12 increased under acid shock response with lactic acid and decreased under acid adaptation with hydrochloric acid.

  20. Single amino acid polymorphism in aldehyde dehydrogenase gene superfamily.

    PubMed

    Priyadharshini Christy, J; George Priya Doss, C

    2015-01-01

    The aldehyde dehydrogenase gene superfamily comprises of 19 genes and 3 pseudogenes. These superfamily genes play a vital role in the formation of molecules that are involved in life processes, and detoxification of endogenous and exogenous aldehydes. ALDH superfamily genes associated mutations are implicated in various diseases, such as pyridoxine-dependent seizures, gamma-hydroxybutyric aciduria, type II Hyperprolinemia, Sjogren-Larsson syndrome including cancer and Alzheimer's disease. Accumulation of large DNA variations data especially Single Amino acid Polymorphisms (SAPs) in public databases related to ALDH superfamily genes insisted us to conduct a survey on the disease associated mutations and predict their function impact on protein structure and function. Overall this study provides an update and highlights the importance of pathogenic mutations in associated diseases. Using KD4v and Project HOPE a computational based platform, we summarized all the deleterious properties of SAPs in ALDH superfamily genes by the providing valuable insight into structural alteration rendered due to mutation. We hope this review might provide a way to define the deleteriousness of a SAP and helps to understand the molecular basis of the associated disease and also permits precise diagnosis and treatment in the near future.

  1. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-05-01

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  2. Lysine methyltransferase Smyd2 regulates Hsp90-mediated protection of the sarcomeric titin springs and cardiac function.

    PubMed

    Voelkel, Tobias; Andresen, Christian; Unger, Andreas; Just, Steffen; Rottbauer, Wolfgang; Linke, Wolfgang A

    2013-04-01

    Protein lysine methylation controls gene expression and repair of deoxyribonucleic acid in the nucleus but also occurs in the cytoplasm, where the role of this posttranslational modification is less understood. Members of the Smyd protein family of lysine methyltransferases are particularly abundant in the cytoplasm, with Smyd1 and Smyd2 being most highly expressed in the heart and in skeletal muscles. Smyd1 is a crucial myogenic regulator with histone methyltransferase activity but also associates with myosin, which promotes sarcomere assembly. Smyd2 methylates histones and non-histone proteins, such as the tumor suppressors, p53 and retinoblastoma protein, RB. Smyd2 has an intriguing function in the cytoplasm of skeletal myocytes, where it methylates the chaperone Hsp90, thus promoting the interaction of a Smyd2-methyl-Hsp90 complex with the N2A-domain of titin. This complex protects the sarcomeric I-band region and myocyte organization. We briefly summarize some novel functions of Smyd family members, with a focus on Smyd2, and highlight their role in striated muscles and cytoplasmic actions. We then provide experimental evidence that Smyd2 is also important for cardiac function. In the cytoplasm of cardiomyocytes, Smyd2 was found to associate with the sarcomeric I-band region at the titin N2A-domain. Binding to N2A occurred in vitro and in yeast via N-terminal and extreme C-terminal regions of Smyd2. Smyd2-knockdown in zebrafish using an antisense oligonucleotide morpholino approach strongly impaired cardiac performance. We conclude that Smyd2 and presumably several other Smyd family members are lysine methyltransferases which have, next to their nuclear activity, specific regulatory functions in the cytoplasm of heart and skeletal muscle cells. This article is part of a Special Issue entitled: Cardiomyocyte Biology: Cardiac Pathways of Differentiation, Metabolism and Contraction. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Identification of genes regulated by UV/salicylic acid.

    SciTech Connect

    Paunesku, T.; Chang-Liu, C.-M.; Shearin-Jones, P.; Watson, C.; Milton, J.; Oryhon, J.; Salbego, D.; Milosavljevic, A.; Woloschak, G. E.; CuraGen Corp.

    2000-02-01

    Purpose : Previous work from the authors' group and others has demonstrated that some of the effects of UV irradiation on gene expression are modulated in response to the addition of salicylic acid to irradiated cells. The presumed effector molecule responsible for this modulation is NF-kappaB. In the experiments described here, differential-display RT-PCR was used to identify those cDNAs that are differentially modulated by UV radiation with and without the addition of salicylic acid. Materials and methods : Differential-display RT-PCR was used to identify differentially expressed genes. Results : Eight such cDNAs are presented: lactate dehydrogenase (LDH-beta), nuclear encoded mitochondrial NADH ubiquinone reductase 24kDa (NDUFV2), elongation initiation factor 4B (eIF4B), nuclear dots protein SP100, nuclear encoded mitochondrial ATPase inhibitor (IF1), a cDNA similar to a subunit of yeast CCAAT transcription factor HAP5, and two expressed sequence tags (AA187906 and AA513156). Conclusions : Sequences of four of these genes contained NF-kappaB DNA binding sites of the type that may attract transrepressor p55/p55 NF-kappaB homodimers. Down-regulation of these genes upon UV irradiation may contribute to increased cell survival via suppression of p53 independent apoptosis.

  4. Benzoic Acid-Inducible Gene Expression in Mycobacteria

    PubMed Central

    Dragset, Marte S.; Barczak, Amy K.; Kannan, Nisha; Mærk, Mali; Flo, Trude H.; Valla, Svein; Rubin, Eric J.; Steigedal, Magnus

    2015-01-01

    Conditional expression is a powerful tool to investigate the role of bacterial genes. Here, we adapt the Pseudomonas putida-derived positively regulated XylS/Pm expression system to control inducible gene expression in Mycobacterium smegmatis and Mycobacterium tuberculosis, the causative agent of human tuberculosis. By making simple changes to a Gram-negative broad-host-range XylS/Pm-regulated gene expression vector, we prove that it is possible to adapt this well-studied expression system to non-Gram-negative species. With the benzoic acid-derived inducer m-toluate, we achieve a robust, time- and dose-dependent reversible induction of Pm-mediated expression in mycobacteria, with low background expression levels. XylS/Pm is thus an important addition to existing mycobacterial expression tools, especially when low basal expression is of particular importance. PMID:26348349

  5. Rubisco small and large subunit N-methyltransferases. Bi- and mono-functional methyltransferases that methylate the small and large subunits of Rubisco.

    PubMed

    Ying, Z; Mulligan, R M; Janney, N; Houtz, R L

    1999-12-17

    Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco)is methylated at the alpha-amino group of the N-terminal methionine of the processed form of the small subunit (SS), and at the epsilon-amino group of lysine-14 of the large subunit (LS) in some species. The Rubisco LS methyltransferase (LSMT) gene has been cloned and expressed from pea and specifically methylates lysine-14 of the LS of Rubisco. We determine here that both pea and tobacco Rubisco LSMT also exhibit (alpha)N-methyltransferase activity toward the SS of Rubisco, suggesting that a single gene product can produce a bifunctional protein methyltransferase capable of catalyzing both (alpha)N-methylation of the SS and (epsilon)N-methylation of the LS. A homologue of the Rubisco LSMT gene (rbcMT-S) has also been identified in spinach that is closely related to Rubisco LSMT sequences from pea and tobacco. Two mRNAs are produced from rbcMT-S, and both long and short forms of the spinach cDNAs were expressed in Escherichia coli cells and shown to catalyze methylation of the alpha-amino group of the N-terminal methionine of the SS of Rubisco. Thus, the absence of lysine-14 methylation in species like spinach is apparently a consequence of a monofunctional protein methyltransferase incapable of methylating Lys-14, with activity limited to methylation of the SS.

  6. Functional and Structural Characterization of a Cation-dependent O-Methyltransferase from the Cyanobacterium Synechocystis sp. Strain PCC 6803*S⃞

    PubMed Central

    Kopycki, Jakub Grzegorz; Stubbs, Milton T.; Brandt, Wolfgang; Hagemann, Martin; Porzel, Andrea; Schmidt, Jürgen; Schliemann, Willibald; Zenk, Meinhart H.; Vogt, Thomas

    2008-01-01

    The coding sequence of the cyanobacterium Synechocystis sp. strain PCC 6803 slr0095 gene was cloned and functionally expressed in Escherichia coli. The corresponding enzyme was classified as a cation- and S-adenosyl-l-methionine-dependent O-methyltransferase (SynOMT), consistent with considerable amino acid sequence identities to eukaryotic O-methyltransferases (OMTs). The substrate specificity of SynOMT was similar with those of plant and mammalian CCoAOMT-like proteins accepting a variety of hydroxycinnamic acids and flavonoids as substrates. In contrast to the known mammalian and plant enzymes, which exclusively methylate the meta-hydroxyl position of aromatic di- and trihydroxy systems, Syn-OMT also methylates the para-position of hydroxycinnamic acids like 5-hydroxyferulic and 3,4,5-trihydroxycinnamic acid, resulting in the formation of novel compounds. The x-ray structure of SynOMT indicates that the active site allows for two alternative orientations of the hydroxylated substrates in comparison to the active sites of animal and plant enzymes, consistent with the observed preferred para-methylation and position promiscuity. Lys3 close to the N terminus of the recombinant protein appears to play a key role in the activity of the enzyme. The possible implications of these results with respect to modifications of precursors of polymers like lignin are discussed. PMID:18502765

  7. RamA, a protein required for reductive activation of corrinoid-dependent methylamine methyltransferase reactions in methanogenic archaea.

    PubMed

    Ferguson, Tsuneo; Soares, Jitesh A; Lienard, Tanja; Gottschalk, Gerhard; Krzycki, Joseph A

    2009-01-23

    Archaeal methane formation from methylamines is initiated by distinct methyltransferases with specificity for monomethylamine, dimethylamine, or trimethylamine. Each methylamine methyltransferase methylates a cognate corrinoid protein, which is subsequently demethylated by a second methyltransferase to form methyl-coenzyme M, the direct methane precursor. Methylation of the corrinoid protein requires reduction of the central cobalt to the highly reducing and nucleophilic Co(I) state. RamA, a 60-kDa monomeric iron-sulfur protein, was isolated from Methanosarcina barkeri and is required for in vitro ATP-dependent reductive activation of methylamine:CoM methyl transfer from all three methylamines. In the absence of the methyltransferases, highly purified RamA was shown to mediate the ATP-dependent reductive activation of Co(II) corrinoid to the Co(I) state for the monomethylamine corrinoid protein, MtmC. The ramA gene is located near a cluster of genes required for monomethylamine methyltransferase activity, including MtbA, the methylamine-specific CoM methylase and the pyl operon required for co-translational insertion of pyrrolysine into the active site of methylamine methyltransferases. RamA possesses a C-terminal ferredoxin-like domain capable of binding two tetranuclear iron-sulfur proteins. Mutliple ramA homologs were identified in genomes of methanogenic Archaea, often encoded near methyltrophic methyltransferase genes. RamA homologs are also encoded in a diverse selection of bacterial genomes, often located near genes for corrinoid-dependent methyltransferases. These results suggest that RamA mediates reductive activation of corrinoid proteins and that it is the first functional archetype of COG3894, a family of redox proteins of unknown function.

  8. AglP is a S-adenosyl-L-methionine-dependent methyltransferase that participates in the N-glycosylation pathway of Haloferax volcanii.

    PubMed

    Magidovich, Hilla; Yurist-Doutsch, Sophie; Konrad, Zvia; Ventura, Valeria V; Dell, Anne; Hitchen, Paul G; Eichler, Jerry

    2010-04-01

    While pathways for N-glycosylation in Eukarya and Bacteria have been solved, considerably less is known of this post-translational modification in Archaea. In the halophilic archaeon Haloferax volcanii, proteins encoded by the agl genes are involved in the assembly and attachment of a pentasaccharide to select asparagine residues of the S-layer glycoprotein. AglP, originally identified based on the proximity of its encoding gene to other agl genes whose products were shown to participate in N-glycosylation, was proposed, based on sequence homology, to serve as a methyltransferase. In the present report, gene deletion and mass spectrometry were employed to reveal that AglP is responsible for adding a 14 Da moiety to a hexuronic acid found at position four of the pentasaccharide decorating the Hfx. volcanii S-layer glycoprotein. Subsequent purification of a tagged version of AglP and development of an in vitro assay to test the function of the protein confirmed that AglP is a S-adenosyl-L-methionine-dependent methyltransferase.

  9. Small molecule regulators of protein arginine methyltransferases.

    PubMed

    Cheng, Donghang; Yadav, Neelu; King, Randall W; Swanson, Maurice S; Weinstein, Edward J; Bedford, Mark T

    2004-06-04

    Here we report the identification of small molecules that specifically inhibit protein arginine N-methyltransferase (PRMT) activity. PRMTs are a family of proteins that either monomethylate or dimethylate the guanidino nitrogen atoms of arginine side chains. This common post-translational modification is implicated in protein trafficking, signal transduction, and transcriptional regulation. Most methyltransferases use the methyl donor, S-adenosyl-L-methionine (AdoMet), as a cofactor. Current methyltransferase inhibitors display limited specificity, indiscriminately targeting all enzymes that use AdoMet. In this screen we have identified a primary compound, AMI-1, that specifically inhibits arginine, but not lysine, methyltransferase activity in vitro and does not compete for the AdoMet binding site. Furthermore, AMI-1 prevents in vivo arginine methylation of cellular proteins and can modulate nuclear receptor-regulated transcription from estrogen and androgen response elements, thus operating as a brake on certain hormone actions.

  10. Isolation of DNA methyltransferase from plants

    SciTech Connect

    Ehrlich, K.; Malbroue, C.

    1987-05-01

    DNA methyltransferases (DMT) were isolated from nuclei of cauliflower, soybean, and pea by extraction with 0.35 M NaCl. Assays were performed on hemimethylated Micrococcus luteus DNA or on M. luteus DNA to test for maintenance or de novo methylase activity, respectively. Fully methylated DNA was used as a substrate to determine background levels of methylation. Based on these tests, yields of maintenance DMT activity in the crude extract from pea hypocotyl, soybean hypocotyl, and cauliflower inflorescence were 2.8, 0.9, and 1.6 units per g wet tissue (one unit equals 1 pmol of methyl from (/sup 3/H)AdoMet incorporated into acid precipitable material per h at 30/sup 0/). Two peaks of DMT activity were detected in the soybean nuclear extract following phosphocellulose chromatography. One eluted at 0.4 M and the other at 0.8 M KCl. With both fractions maintenance activity was approximately 2 times that of the de novo activity. Using gel filtration the DMT eluted at 220,000 Daltons. The optimal pH for activity was between 6.5 and 7.0, and the optimal temperature was 30/sup 0/.

  11. Inducible gene expression and environmentally regulated genes in lactic acid bacteria.

    PubMed

    Kok, J

    1996-10-01

    Relatively recently, a number of genes and operons have been identified in lactic acid bacteria that are inducible and respond to environmental factors. Some of these genes/operons had been isolated and analysed because of their importance in the fermentation industry and, consequently, their transcription was studied and found to be regulatable. Examples are the lactose operon, the operon for nisin production, and genes in the proteolytic pathway of Lactococcus lactis, as well as xylose metabolism in Lactobacillus pentosus. Some other operons were specifically targetted with the aim to compare their mode of regulation with known regulatory mechanisms in other well-studied bacteria. These studies, dealing with the biosynthesis of histidine, tryptophan, and of the branched chain amino acids in L. lactis, have given new insights in gene regulation and in the occurrence of auxotrophy in these bacteria. Also, nucleotide sequence analyses of a number of lactococcal bacteriophages was recently initiated to, among other things, specifically learn more about regulation of the phage life cycle. Yet another approach in the analysis of regulated genes is the 'random' selection of genetic elements that respond to environmental stimuli and the first of such sequences from lactic acid bacteria have been identified and characterized. The potential of these regulatory elements in fundamental research and practical (industrial) applications will be discussed.

  12. DNA methyltransferase immunohistochemical expression in odontogenic tumours.

    PubMed

    Guimarães, Douglas Magno; Antunes, Daniella Moraes; Duarte, Carina Magalhães Esteves; Ferro, Leonardo Borges; Nunes, Fabio Daumas

    2015-01-01

    Odontogenic tumours are a heterogeneous group of lesions formed from tissues that give rise to the tooth. DNA methylation, a covalent addition of a methyl group to the 5-carbon position of a cytosine nucleotide, is considered an important regulator of gene expression. The addition of the methyl radical is catalysed by DNA methyltransferases (DNMTs). Although some epigenetic studies have been conducted in odontogenic tumours, a study with the three types of DNMTs in several different members of this group is missing. This study analyses the expression of DNMTs in odontogenic tumours. Formalin-fixed and paraffin-embedded tissue samples of 20 ameloblastomas, 10 calcifying cystic odontogenic tumours, 10 calcifying epithelial tumours, 10 adenomatoid odontogenic tumours, 10 keratocystic odontogenic tumours, five ameloblastic fibromas, two ameloblastic fibro-odontomas, four central odontogenic fibromas, seven peripheral odontogenic fibromas and 10 odontogenic myxomas were included. Immunohistochemical expression of DNMT1, 3A and 3B was assessed using a semi-quantitative analysis, and also a correlation with p21, p27 and E-cadherin immunoexpression was made. DNMT1, 3A and 3B were expressed in the nucleus and/or cytoplasm of all odontogenic tumours. DNMT1 expression was directly correlated with p27 expression in ameloblastomas. The high expression of DNMTs in odontogenic tumour cells suggests methylation as an important mechanism for this group of tumours. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. The effect of increasing concentrations of dl-methionine and 2-hydroxy-4-(methylthio) butanoic acid on hepatic genes controlling methionine regeneration and gluconeogenesis.

    PubMed

    Zhang, Qian; Bertics, Sandra J; Luchini, N Daniel; White, Heather M

    2016-10-01

    Metabolizable methionine (Met) concentrations can be increased by feeding rumen-protected dl-Met or the isopropyl ester of 2-hydroxy-4-(methylthio) butanoic acid (HMBi). Hepatic responses to increasing concentrations of metabolizable Met as a result of supplementation of different Met sources have not been comparatively examined. The objective of this experiment was to examine the regulation of key genes for Met metabolism, gluconeogenesis, and fatty acid oxidation in response to increasing concentrations of dl-Met or 2-hydroxy-4-(methylthio) butanoic acid (HMB) in bovine primary hepatocytes. Hepatocytes isolated from 4 Holstein calves less than 7d old were maintained as monolayer cultures for 24h before addition of treatments. Cells were then exposed to treatments of dl-Met or HMB (0, 10, 20, 40, or 60 µM) in Met-free medium for 24h and collected for RNA isolation and quantification of gene expression by quantitative PCR. Expression of betaine-homocysteine methyltransferase (BHMT), 5-methyltetrahydrofolate-homocysteine methyltransferase (MTR), and 5,10 methylenetetrahydrofolate reductase (MTHFR) genes, which catalyze regeneration of Met from betaine and homocysteine, decreased linearly with increasing dl-Met concentration. We observed similar effects with increasing HMB concentration, except expression of MTHFR, which was not altered. Expression of Met adenosyltransferase 1A (MAT1A), which catalyzes the first step of Met metabolism to generate S-adenosylmethionine (SAM), a primary methyl donor, was decreased with increasing dl-Met or HMB concentration. Expression of S-adenosylhomocysteine hydrolase (SAHH) was decreased linearly with increasing HMB concentration, but not altered by dl-Met. Increasing concentrations of dl-Met and HMB decreased cytosolic phosphoenolpyruvate carboxykinase (PCK1) expression, but did not alter the expression of mitochondrial phosphoenolpyruvate carboxykinase (PCK2) or pyruvate carboxylase (PC). Expression of glucose-6-phosphatase(G6PC

  14. Nucleic acid modifications in regulation of gene expression

    PubMed Central

    Chen, Kai; Zhao, Boxuan Simen; He, Chuan

    2016-01-01

    Nucleic acids carry a wide range of different chemical modifications. In contrast to previous views that these modifications are static and only play fine-tuning functions, recent research advances paint a much more dynamic picture. Nucleic acids carry diverse modifications and employ these chemical marks to exert essential or critical influences in a variety of cellular processes in eukaryotic organisms. This review covers several nucleic acid modifications that play important regulatory roles in biological systems, especially in regulation of gene expression: 5-methylcytosine (5mC) and its oxidative derivatives, and N6 -methyladenine (6mA) in DNA; N6 -methyladenosine (m6A), pseudouridine (), and 5-methylcytosine (m5C) in messenger RNA and long non-coding RNA. Modifications in other non-coding RNAs, such as tRNA, miRNA, and snRNA, are also briefly summarized. We provide brief historical perspective of the field, and highlight recent progress in identifying diverse nucleic acid modifications and exploring their functions in different organisms. Overall, we believe that work in this field will yield additional layers of both chemical and biological complexity as we continue to uncover functional consequences of known nucleic acid modifications and discover new ones. PMID:26933737

  15. Nucleic Acid Modifications in Regulation of Gene Expression.

    PubMed

    Chen, Kai; Zhao, Boxuan Simen; He, Chuan

    2016-01-21

    Nucleic acids carry a wide range of different chemical modifications. In contrast to previous views that these modifications are static and only play fine-tuning functions, recent research advances paint a much more dynamic picture. Nucleic acids carry diverse modifications and employ these chemical marks to exert essential or critical influences in a variety of cellular processes in eukaryotic organisms. This review covers several nucleic acid modifications that play important regulatory roles in biological systems, especially in regulation of gene expression: 5-methylcytosine (5mC) and its oxidative derivatives, and N(6)-methyladenine (6mA) in DNA; N(6)-methyladenosine (m(6)A), pseudouridine (Ψ), and 5-methylcytidine (m(5)C) in mRNA and long non-coding RNA. Modifications in other non-coding RNAs, such as tRNA, miRNA, and snRNA, are also briefly summarized. We provide brief historical perspective of the field, and highlight recent progress in identifying diverse nucleic acid modifications and exploring their functions in different organisms. Overall, we believe that work in this field will yield additional layers of both chemical and biological complexity as we continue to uncover functional consequences of known nucleic acid modifications and discover new ones. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Horizontal gene transfer in an acid mine drainage microbial community.

    PubMed

    Guo, Jiangtao; Wang, Qi; Wang, Xiaoqi; Wang, Fumeng; Yao, Jinxian; Zhu, Huaiqiu

    2015-07-04

    Horizontal gene transfer (HGT) has been widely identified in complete prokaryotic genomes. However, the roles of HGT among members of a microbial community and in evolution remain largely unknown. With the emergence of metagenomics, it is nontrivial to investigate such horizontal flow of genetic materials among members in a microbial community from the natural environment. Because of the lack of suitable methods for metagenomics gene transfer detection, microorganisms from a low-complexity community acid mine drainage (AMD) with near-complete genomes were used to detect possible gene transfer events and suggest the biological significance. Using the annotation of coding regions by the current tools, a phylogenetic approach, and an approximately unbiased test, we found that HGTs in AMD organisms are not rare, and we predicted 119 putative transferred genes. Among them, 14 HGT events were determined to be transfer events among the AMD members. Further analysis of the 14 transferred genes revealed that the HGT events affected the functional evolution of archaea or bacteria in AMD, and it probably shaped the community structure, such as the dominance of G-plasma in archaea in AMD through HGT. Our study provides a novel insight into HGT events among microorganisms in natural communities. The interconnectedness between HGT and community evolution is essential to understand microbial community formation and development.

  17. Functional Identification of Triterpene Methyltransferases from Botryococcus braunii Race B*

    PubMed Central

    Niehaus, Tom D.; Kinison, Scott; Okada, Shigeru; Yeo, Yun-soo; Bell, Stephen A.; Cui, Ping; Devarenne, Timothy P.; Chappell, Joe

    2012-01-01

    Botryococcus braunii race B is a colony-forming, green algae that accumulates triterpene oils in excess of 30% of its dry weight. The composition of the triterpene oils is dominated by dimethylated to tetramethylated forms of botryococcene and squalene. Although unusual mechanisms for the biosynthesis of botryococcene and squalene were recently described, the enzyme(s) responsible for decorating these triterpene scaffolds with methyl substituents were unknown. A transcriptome of B. braunii was screened computationally assuming that the triterpene methyltransferases (TMTs) might resemble the S-adenosyl methionine-dependent enzymes described for methylating the side chain of sterols. Six sterol methyltransferase-like genes were isolated and functionally characterized. Three of these genes when co-expressed in yeast with complementary squalene synthase or botryococcene synthase expression cassettes resulted in the accumulation of mono- and dimethylated forms of both triterpene scaffolds. Surprisingly, TMT-1 and TMT-2 exhibited preference for squalene as the methyl acceptor substrate, whereas TMT-3 showed a striking preference for botryococcene as its methyl acceptor substrate. These in vivo preferences were confirmed with in vitro assays utilizing microsomal preparations from yeast overexpressing the respective genes, which encode for membrane-associated enzymes. Structural examination of the in vivo yeast generated mono- and dimethylated products by NMR identified terminal carbons, C-3 and C-22/C-20, as the atomic acceptor sites for the methyl additions to squalene and botryococcene, respectively. These sites are identical to those previously reported for the triterpenes extracted from the algae. The availability of closely related triterpene methyltransferases exhibiting distinct substrate selectivity and successive catalytic activities provides important tools for investigating the molecular mechanisms responsible for the specificities exhibited by these unique

  18. Cloning and characterization of PIMT, a protein with a methyltransferase domain, which interacts with and enhances nuclear receptor coactivator PRIP function.

    PubMed

    Zhu, Y; Qi, C; Cao, W Q; Yeldandi, A V; Rao, M S; Reddy, J K

    2001-08-28

    The nuclear receptor coactivators participate in the transcriptional activation of specific genes by nuclear receptors. In this study, we report the isolation of a nuclear receptor coactivator-interacting protein from a human liver cDNA library by using the coactivator peroxisome proliferator-activated receptor-interacting protein (PRIP) (ASC2/AIB3/RAP250/NRC/TRBP) as bait in a yeast two-hybrid screen. Human PRIP-interacting protein cDNA has an ORF of 2,556 nucleotides, encodes a protein with 852 amino acids, and contains a 9-aa VVDAFCGVG methyltransferase motif I and an invariant GXXGXXI segment found in K-homology motifs of many RNA-binding proteins. The gene encoding this protein, designated PRIP-interacting protein with methyltransferase domain (PIMT), is localized on chromosome 8q11 and spans more than 40 kb. PIMT mRNA is ubiquitously expressed, with a high level of expression in heart, skeletal muscle, kidney, liver, and placenta. Using the immunofluorescence localization method, we found that PIMT and PRIP proteins appear colocalized in the nucleus. PIMT strongly interacts with PRIP under in vitro and in vivo conditions, and the PIMT-binding site on PRIP is in the region encompassing amino acids 773-927. PIMT binds S-adenosyl-l-methionine, the methyl donor for methyltransfer reaction, and it also binds RNA, suggesting that it is a putative RNA methyltransferase. PIMT enhances the transcriptional activity of peroxisome proliferator-activated receptor gamma and retinoid-X-receptor alpha, which is further stimulated by coexpression of PRIP, implying that PIMT is a component of nuclear receptor signal transduction apparatus acting through PRIP. Definitive identification of the specific substrate of PIMT and the role of this RNA-binding protein in transcriptional regulation remain to be determined.

  19. Cloning and characterization of PIMT, a protein with a methyltransferase domain, which interacts with and enhances nuclear receptor coactivator PRIP function

    PubMed Central

    Zhu, Yijun; Qi, Chao; Cao, Wen-Qing; Yeldandi, Anjana V.; Rao, M. Sambasiva; Reddy, Janardan K.

    2001-01-01

    The nuclear receptor coactivators participate in the transcriptional activation of specific genes by nuclear receptors. In this study, we report the isolation of a nuclear receptor coactivator-interacting protein from a human liver cDNA library by using the coactivator peroxisome proliferator-activated receptor-interacting protein (PRIP) (ASC2/AIB3/RAP250/NRC/TRBP) as bait in a yeast two-hybrid screen. Human PRIP-interacting protein cDNA has an ORF of 2,556 nucleotides, encodes a protein with 852 amino acids, and contains a 9-aa VVDAFCGVG methyltransferase motif I and an invariant GXXGXXI segment found in K-homology motifs of many RNA-binding proteins. The gene encoding this protein, designated PRIP-interacting protein with methyltransferase domain (PIMT), is localized on chromosome 8q11 and spans more than 40 kb. PIMT mRNA is ubiquitously expressed, with a high level of expression in heart, skeletal muscle, kidney, liver, and placenta. Using the immunofluorescence localization method, we found that PIMT and PRIP proteins appear colocalized in the nucleus. PIMT strongly interacts with PRIP under in vitro and in vivo conditions, and the PIMT-binding site on PRIP is in the region encompassing amino acids 773–927. PIMT binds S-adenosyl-l-methionine, the methyl donor for methyltransfer reaction, and it also binds RNA, suggesting that it is a putative RNA methyltransferase. PIMT enhances the transcriptional activity of peroxisome proliferator-activated receptor γ and retinoid-X-receptor α, which is further stimulated by coexpression of PRIP, implying that PIMT is a component of nuclear receptor signal transduction apparatus acting through PRIP. Definitive identification of the specific substrate of PIMT and the role of this RNA-binding protein in transcriptional regulation remain to be determined. PMID:11517327

  20. Synthetic Fatty Acids Prevent Plasmid-Mediated Horizontal Gene Transfer

    PubMed Central

    Getino, María; Sanabria-Ríos, David J.; Fernández-López, Raúl; Campos-Gómez, Javier; Sánchez-López, José M.; Fernández, Antonio; Carballeira, Néstor M.

    2015-01-01

    ABSTRACT Bacterial conjugation constitutes a major horizontal gene transfer mechanism for the dissemination of antibiotic resistance genes among human pathogens. Antibiotic resistance spread could be halted or diminished by molecules that interfere with the conjugation process. In this work, synthetic 2-alkynoic fatty acids were identified as a novel class of conjugation inhibitors. Their chemical properties were investigated by using the prototype 2-hexadecynoic acid and its derivatives. Essential features of effective inhibitors were the carboxylic group, an optimal long aliphatic chain of 16 carbon atoms, and one unsaturation. Chemical modification of these groups led to inactive or less-active derivatives. Conjugation inhibitors were found to act on the donor cell, affecting a wide number of pathogenic bacterial hosts, including Escherichia, Salmonella, Pseudomonas, and Acinetobacter spp. Conjugation inhibitors were active in inhibiting transfer of IncF, IncW, and IncH plasmids, moderately active against IncI, IncL/M, and IncX plasmids, and inactive against IncP and IncN plasmids. Importantly, the use of 2-hexadecynoic acid avoided the spread of a derepressed IncF plasmid into a recipient population, demonstrating the feasibility of abolishing the dissemination of antimicrobial resistances by blocking bacterial conjugation. PMID:26330514

  1. New enzymes from environmental cassette arrays: Functional attributes of a phosphotransferase and an RNA-methyltransferase

    PubMed Central

    Nield, Blair S.; Willows, Robert D.; Torda, Andrew E.; Gillings, Michael R.; Holmes, Andrew J.; Nevalainen, K.M. Helena; Stokes, H.W.; Mabbutt, Bridget C.

    2004-01-01

    By targeting gene cassettes by polymerase chain reaction (PCR) directly from environmentally derived DNA, we are able to amplify entire open reading frames (ORFs) independently of prior sequence knowledge. Approximately 10% of the mobile genes recovered by these means can be attributed to known protein families. Here we describe the characterization of two ORFs which show moderate homology to known proteins: (1) an aminoglycoside phosphotransferase displaying 25% sequence identity with APH(7″) from Streptomyces hygroscopicus, and (2) an RNA methyltransferase sharing 25%–28% identity with a group of recently defined bacterial RNA methyltransferases distinct from the SpoU enzyme family. Our novel genes were expressed as recombinant products and assayed for appropriate enzyme activity. The aminoglycoside phosphotransferase displayed ATPase activity, consistent with the presence of characteristic Mg2+-binding residues. Unlike related APH(4) or APH(7″) enzymes, however, this activity was not enhanced by hygromycin B or kanamycin, suggesting the normal substrate to be a different aminoglycoside. The RNA methyltransferase contains sequence motifs of the RNA methyltransferase superfamily, and our recombinant version showed methyltransferase activity with RNA. Our data confirm that gene cassettes present in the environment encode folded enzymes with novel sequence variation and demonstrable catalytic activity. Our PCR approach (cassette PCR) may be used to identify a diverse range of ORFs from any environmental sample, as well as to directly access the gene pool found in mobile gene cassettes commonly associated with integrons. This gene pool can be accessed from both cultured and uncultured microbial samples as a source of new enzymes and proteins. PMID:15152095

  2. Transcriptome-wide analysis of SAMe superfamily to novelty phosphoethanolamine N-methyltransferase copy in Lonicera japonica.

    PubMed

    Yuan, Yuan; Qi, Linjie; Yu, Jun; Wang, Xumin; Huang, Luqi

    2014-12-29

    The S-adenosyl-L-methionine-dependent methyltransferase superfamily plays important roles in plant development. The buds of Lonicera japonica are used as Chinese medical material and foods; chinese people began domesticating L. japonica thousands of years ago. Compared to the wild species, L. japonica var. chinensis, L. japonica gives a higher yield of buds, a fact closely related to positive selection over the long cultivation period of the species. Genome duplications, which are always detected in the domestic species, are the source of the multifaceted roles of the functional gene. In this paper, we investigated the evolution of the SAMe genes in L. japonica and L. japonica var. chinensis and further analyzed the roles of the duplicated genes among special groups. The SAMe protein sequences were subdivided into three clusters and several subgroups. The difference in transcriptional levels of the duplicated genes showed that seven SAMe genes could be related to the differences between the wild and the domesticated varieties. The sequence diversity of seven SAMe genes was also analyzed, and the results showed that different gene expression levels between the varieties could not be related to amino acid variation. The transcriptional level of duplicated PEAMT could be regulated through the SAM-SAH cycle.

  3. Cationic liposome–nucleic acid complexes for gene delivery and gene silencing

    PubMed Central

    Ewert, Kai K.; Majzoub, Ramsey N.; Leal, Cecília

    2014-01-01

    Cationic liposomes (CLs) are studied worldwide as carriers of DNA and short interfering RNA (siRNA) for gene delivery and gene silencing, and related clinical trials are ongoing. Optimization of transfection efficiency and silencing efficiency by cationic liposome carriers requires a comprehensive understanding of the structures of CL–nucleic acid complexes and the nature of their interactions with cell membranes as well as events leading to release of active nucleic acids within the cytoplasm. Synchrotron x-ray scattering has revealed that CL–nucleic acid complexes spontaneously assemble into distinct liquid crystalline phases including the lamellar, inverse hexagonal, hexagonal, and gyroid cubic phases, and fluorescence microscopy has revealed CL–DNA pathways and interactions with cells. The combining of custom synthesis with characterization techniques and gene expression and silencing assays has begun to unveil structure–function relations in vitro. As a recent example, this review will briefly describe experiments with surface-functionalized PEGylated CL–DNA nanoparticles. The functionalization, which is achieved through custom synthesis, is intended to address and overcome cell targeting and endosomal escape barriers to nucleic acid delivery faced by PEGylated nanoparticles designed for in vivo applications. PMID:25587216

  4. The CcrM DNA methyltransferase is widespread in the alpha subdivision of proteobacteria, and its essential functions are conserved in Rhizobium meliloti and Caulobacter crescentus.

    PubMed

    Wright, R; Stephens, C; Shapiro, L

    1997-09-01

    The Caulobacter crescentus DNA methyltransferase CcrM (M.CcrMI) methylates the adenine residue in the sequence GANTC. The CcrM DNA methyltransferase is essential for viability, but it does not appear to be part of a DNA restriction-modification system. CcrM homologs are widespread in the alpha subdivision of gram-negative bacteria. We have amplified and sequenced a 258-bp region of the cerM gene from several of these bacteria, including Rhizobium meliloti, Brucella abortus, Agrobacterium tumefaciens, and Rhodobacter capsulatus. Alignment of the deduced amino acid sequences revealed that these proteins constitute a highly conserved DNA methyltransferase family. Isolation of the full-length ccrM genes from the aquatic bacterium C. crescentus, the soil bacterium R. meliloti, and the intracellular pathogen B. abortus showed that this sequence conservation extends over the entire protein. In at least two alpha subdivision bacteria, R. meliloti and C. crescentus, CcrM-mediated methylation has important cellular functions. In both organisms, CcrM is essential for viability. Overexpression of CcrM in either bacterium results in defects in cell division and cell morphology and in the initiation of DNA replication. Finally, the C. crescentus and R. meliloti ccrM genes are functionally interchangeable, as the complemented strains are viable and the chromosomes are methylated. Thus, in both R. meliloti and C. crescentus, CcrM methylation is an integral component of the cell cycle. We speculate that CcrM-mediated DNA methylation is likely to have similar roles among alpha subdivision bacteria.

  5. Synthetic Fatty Acids Prevent Plasmid-Mediated Horizontal Gene Transfer.

    PubMed

    Getino, María; Sanabria-Ríos, David J; Fernández-López, Raúl; Campos-Gómez, Javier; Sánchez-López, José M; Fernández, Antonio; Carballeira, Néstor M; de la Cruz, Fernando

    2015-09-01

    Bacterial conjugation constitutes a major horizontal gene transfer mechanism for the dissemination of antibiotic resistance genes among human pathogens. Antibiotic resistance spread could be halted or diminished by molecules that interfere with the conjugation process. In this work, synthetic 2-alkynoic fatty acids were identified as a novel class of conjugation inhibitors. Their chemical properties were investigated by using the prototype 2-hexadecynoic acid and its derivatives. Essential features of effective inhibitors were the carboxylic group, an optimal long aliphatic chain of 16 carbon atoms, and one unsaturation. Chemical modification of these groups led to inactive or less-active derivatives. Conjugation inhibitors were found to act on the donor cell, affecting a wide number of pathogenic bacterial hosts, including Escherichia, Salmonella, Pseudomonas, and Acinetobacter spp. Conjugation inhibitors were active in inhibiting transfer of IncF, IncW, and IncH plasmids, moderately active against IncI, IncL/M, and IncX plasmids, and inactive against IncP and IncN plasmids. Importantly, the use of 2-hexadecynoic acid avoided the spread of a derepressed IncF plasmid into a recipient population, demonstrating the feasibility of abolishing the dissemination of antimicrobial resistances by blocking bacterial conjugation. Diseases caused by multidrug-resistant bacteria are taking an important toll with respect to human morbidity and mortality. The most relevant antibiotic resistance genes come to human pathogens carried by plasmids, mainly using conjugation as a transmission mechanism. Here, we identified and characterized a series of compounds that were active against several plasmid groups of clinical relevance, in a wide variety of bacterial hosts. These inhibitors might be used for fighting antibiotic-resistance dissemination by inhibiting conjugation. Potential inhibitors could be used in specific settings (e.g., farm, fish factory, or even clinical settings) to

  6. Higher transcription levels in ascorbic acid biosynthetic and recycling genes were associated with higher ascorbic acid accumulation in blueberry.

    PubMed

    Liu, Fenghong; Wang, Lei; Gu, Liang; Zhao, Wei; Su, Hongyan; Cheng, Xianhao

    2015-12-01

    In our preliminary study, the ripe fruits of two highbush blueberry (Vaccinium corymbosum L.) cultivars, cv 'Berkeley' and cv 'Bluecrop', were found to contain different levels of ascorbic acid. However, factors responsible for these differences are still unknown. In the present study, ascorbic acid content in fruits was compared with expression profiles of ascorbic acid biosynthetic and recycling genes between 'Bluecrop' and 'Berkeley' cultivars. The results indicated that the l-galactose pathway was the predominant route of ascorbic acid biosynthesis in blueberry fruits. Moreover, higher expression levels of the ascorbic acid biosynthetic genes GME, GGP, and GLDH, as well as the recycling genes MDHAR and DHAR, were associated with higher ascorbic acid content in 'Bluecrop' compared with 'Berkeley', which indicated that a higher efficiency ascorbic acid biosynthesis and regeneration was likely to be responsible for the higher ascorbic acid accumulation in 'Bluecrop'.

  7. Epigenetic Regulation of Autophagy by the Methyltransferase G9a

    PubMed Central

    Artal-Martinez de Narvajas, Amaia; Gomez, Timothy S.; Zhang, Jin-San; Mann, Alexander O.; Taoda, Yoshiyuki; Gorman, Jacquelyn A.; Herreros-Villanueva, Marta; Gress, Thomas M.; Ellenrieder, Volker; Bujanda, Luis; Kim, Do-Hyung; Kozikowski, Alan P.

    2013-01-01

    Macroautophagy is an evolutionarily conserved cellular process involved in the clearance of proteins and organelles. Although the cytoplasmic machinery that orchestrates autophagy induction during starvation, hypoxia, or receptor stimulation has been widely studied, the key epigenetic events that initiate and maintain the autophagy process remain unknown. Here we show that the methyltransferase G9a coordinates the transcriptional activation of key regulators of autophagosome formation by remodeling the chromatin landscape. Pharmacological inhibition or RNA interference (RNAi)-mediated suppression of G9a induces LC3B expression and lipidation that is dependent on RNA synthesis, protein translation, and the methyltransferase activity of G9a. Under normal conditions, G9a associates with the LC3B, WIPI1, and DOR gene promoters, epigenetically repressing them. However, G9a and G9a-repressive histone marks are removed during starvation and receptor-stimulated activation of naive T cells, two physiological inducers of macroautophagy. Moreover, we show that the c-Jun N-terminal kinase (JNK) pathway is involved in the regulation of autophagy gene expression during naive-T-cell activation. Together, these findings reveal that G9a directly represses genes known to participate in the autophagic process and that inhibition of G9a-mediated epigenetic repression represents an important regulatory mechanism during autophagy. PMID:23918802

  8. Structure and mechanism of a nonhaem-iron SAM-dependent C-methyltransferase and its engineering to a hydratase and an O-methyltransferase.

    PubMed

    Zou, Xiao-Wei; Liu, Yu-Chen; Hsu, Ning-Shian; Huang, Chuen-Jiuan; Lyu, Syue-Yi; Chan, Hsiu-Chien; Chang, Chin-Yuan; Yeh, Hsien-Wei; Lin, Kuan-Hung; Wu, Chang-Jer; Tsai, Ming-Daw; Li, Tsung-Lin

    2014-06-01

    In biological systems, methylation is most commonly performed by methyltransferases (MTs) using the electrophilic methyl source S-adenosyl-L-methionine (SAM) via the S(N)2 mechanism. (2S,3S)-β-Methylphenylalanine, a nonproteinogenic amino acid, is a building unit of the glycopeptide antibiotic mannopeptimycin. The gene product of mppJ from the mannopeptimycin-biosynthetic gene cluster is the MT that methylates the benzylic C atom of phenylpyruvate (Ppy) to give βMePpy. Although the benzylic C atom of Ppy is acidic, how its nucleophilicity is further enhanced to become an acceptor for C-methylation has not conclusively been determined. Here, a structural approach is used to address the mechanism of MppJ and to engineer it for new functions. The purified MppJ displays a turquoise colour, implying the presence of a metal ion. The crystal structures reveal MppJ to be the first ferric ion SAM-dependent MT. An additional four structures of binary and ternary complexes illustrate the molecular mechanism for the metal ion-dependent methyltransfer reaction. Overall, MppJ has a nonhaem iron centre that bind, orients and activates the α-ketoacid substrate and has developed a sandwiched bi-water device to avoid the formation of the unwanted reactive oxo-iron(IV) species during the C-methylation reaction. This discovery further prompted the conversion of the MT into a structurally/functionally unrelated new enzyme. Through stepwise mutagenesis and manipulation of coordination chemistry, MppJ was engineered to perform both Lewis acid-assisted hydration and/or O-methyltransfer reactions to give stereospecific new compounds. This process was validated by six crystal structures. The results reported in this study will facilitate the development and design of new biocatalysts for difficult-to-synthesize biochemicals.

  9. Dose-Responsive Gene Expression in Suberoylanilide Hydroxamic Acid (SAHA) Treated Resting CD4+ T Cells

    PubMed Central

    Reardon, Brian; Beliakova-Bethell, Nadejda; Spina, Celsa A.; Singhania, Akul; Margolis, David M.; Richman, Douglas R.; Woelk, Christopher H.

    2015-01-01

    Design Persistent latently infected CD4+ T cells represent a major obstacle to HIV eradication. Histone deacetylase inhibitors (HDACis) are a proposed activation therapy. However, off-target effects on expression in host immune cells are poorly understood. We hypothesized that HDACi-modulated genes would be best identified with dose-response analysis. Methods Resting primary CD4+ T cells were treated with 0.34, 1, 3, or 10 μM of the HDACi, SAHA, for 24 hours and subjected to microarray gene expression analysis. Genes with dose-correlated expression were filtered to identify a subset with consistent up or downregulation at each SAHA dose. Histone modifications were characterized in 6 SAHA dose-responsive genes by chromatin immunoprecipitation (ChIP-RT-qPCR). Results A large number of genes were shown to be up (N=657) or downregulated (N=725) by SAHA in a dose-responsive manner (FDR p-value < 0.05, fold change ≥ |2|). Several genes (CTNNAL1, DPEP2, H1F0, IRGM, PHF15, and SELL) are potential in vivo biomarkers of SAHA activity. SAHA dose-responsive genes included transcription factors, HIV restriction factors, histone methyltransferases, and host proteins that interact with HIV. Pathway analysis suggested net downregulation of T cell activation with increasing SAHA dose. Histone acetylation was not correlated with host gene expression, but plausible alternative mechanisms for SAHA-modulated gene expression were identified. Conclusions Numerous genes in CD4+ T cells are modulated by SAHA in a dose-responsive manner, including genes that may negatively influence HIV activation from latency. Our study suggests that SAHA influences gene expression through a confluence of several mechanisms, including histone modification, and altered expression and activity of transcription factors. PMID:26258524

  10. A gene network engineering platform for lactic acid bacteria

    PubMed Central

    Kong, Wentao; Kapuganti, Venkata S.; Lu, Ting

    2016-01-01

    Recent developments in synthetic biology have positioned lactic acid bacteria (LAB) as a major class of cellular chassis for applications. To achieve the full potential of LAB, one fundamental prerequisite is the capacity for rapid engineering of complex gene networks, such as natural biosynthetic pathways and multicomponent synthetic circuits, into which cellular functions are encoded. Here, we present a synthetic biology platform for rapid construction and optimization of large-scale gene networks in LAB. The platform involves a copy-controlled shuttle for hosting target networks and two associated strategies that enable efficient genetic editing and phenotypic validation. By using a nisin biosynthesis pathway and its variants as examples, we demonstrated multiplex, continuous editing of small DNA parts, such as ribosome-binding sites, as well as efficient manipulation of large building blocks such as genes and operons. To showcase the platform, we applied it to expand the phenotypic diversity of the nisin pathway by quickly generating a library of 63 pathway variants. We further demonstrated its utility by altering the regulatory topology of the nisin pathway for constitutive bacteriocin biosynthesis. This work demonstrates the feasibility of rapid and advanced engineering of gene networks in LAB, fostering their applications in biomedicine and other areas. PMID:26503255

  11. A gene network engineering platform for lactic acid bacteria.

    PubMed

    Kong, Wentao; Kapuganti, Venkata S; Lu, Ting

    2016-02-29

    Recent developments in synthetic biology have positioned lactic acid bacteria (LAB) as a major class of cellular chassis for applications. To achieve the full potential of LAB, one fundamental prerequisite is the capacity for rapid engineering of complex gene networks, such as natural biosynthetic pathways and multicomponent synthetic circuits, into which cellular functions are encoded. Here, we present a synthetic biology platform for rapid construction and optimization of large-scale gene networks in LAB. The platform involves a copy-controlled shuttle for hosting target networks and two associated strategies that enable efficient genetic editing and phenotypic validation. By using a nisin biosynthesis pathway and its variants as examples, we demonstrated multiplex, continuous editing of small DNA parts, such as ribosome-binding sites, as well as efficient manipulation of large building blocks such as genes and operons. To showcase the platform, we applied it to expand the phenotypic diversity of the nisin pathway by quickly generating a library of 63 pathway variants. We further demonstrated its utility by altering the regulatory topology of the nisin pathway for constitutive bacteriocin biosynthesis. This work demonstrates the feasibility of rapid and advanced engineering of gene networks in LAB, fostering their applications in biomedicine and other areas.

  12. The crystal structure of a novel SAM-dependent methyltransferase PH1915 from Pyrococcus horikoshii.

    SciTech Connect

    Sun, W.; Xu, X.; Pavlova, M.; Edwards, A.; Joachimiak, A.; Savchenko, A.; Christendat, D.; Biosciences Division; Univ. of Toronto; Univ. Health Network

    2005-01-01

    The S-adenosyl-L-methionine (SAM)-dependent methyltransferases represent a diverse and biologically important class of enzymes. These enzymes utilize the ubiquitous methyl donor SAM as a cofactor to methylate proteins, small molecules, lipids, and nucleic acids. Here we present the crystal structure of PH1915 from Pyrococcus horikoshii OT3, a predicted SAM-dependent methyltransferase. This protein belongs to the Cluster of Orthologous Group 1092, and the presented crystal structure is the first representative structure of this protein family. Based on sequence and 3D structure analysis, we have made valuable functional insights that will facilitate further studies for characterizing this group of proteins. Specifically, we propose that PH1915 and its orthologs are rRNA- or tRNA-specific methyltransferases.

  13. Thermus thermophilus L11 methyltransferase, PrmA, is dispensable for growth and preferentially modifies free ribosomal protein L11 prior to ribosome assembly.

    PubMed

    Cameron, Dale M; Gregory, Steven T; Thompson, Jill; Suh, Moo-Jin; Limbach, Patrick A; Dahlberg, Albert E

    2004-09-01

    The ribosomal protein L11 in bacteria is posttranslationally trimethylated at multiple amino acid positions by the L11 methyltransferase PrmA, the product of the prmA gene. The role of L11 methylation in ribosome function or assembly has yet to be determined, although the deletion of Escherichia coli prmA has no apparent phenotype. We have constructed a mutant of the extreme thermophile Thermus thermophilus in which the prmA gene has been disrupted with the htk gene encoding a heat-stable kanamycin adenyltransferase. This mutant shows no growth defects, indicating that T. thermophilus PrmA, like its E. coli homolog, is dispensable. Ribosomes prepared from this mutant contain unmethylated L11, as determined by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS), and are effective substrates for in vitro methylation by cloned and purified T. thermophilus PrmA. MALDI-TOF MS also revealed that T. thermophilus L11 contains a total of 12 methyl groups, in contrast to the 9 methyl groups found in E. coli L11. Finally, we found that, as with the E. coli methyltransferase, the ribosomal protein L11 dissociated from ribosomes is a more efficient substrate for in vitro methylation by PrmA than intact 70S ribosomes, suggesting that methylation in vivo occurs on free L11 prior to its incorporation into ribosomes.

  14. Genome-wide DNA methylation analysis of Haloferax volcanii H26 and identification of DNA methyltransferase related PD-(D/E)XK nuclease family protein HVO_A0006

    PubMed Central

    Ouellette, Matthew; Jackson, Laura; Chimileski, Scott; Papke, R. Thane

    2015-01-01

    Restriction-modification (RM) systems have evolved to protect the cell from invading DNAs and are composed of two enzymes: a DNA methyltransferase and a restriction endonuclease. Although RM systems are present in both archaeal and bacterial genomes, DNA methylation in archaea has not been well defined. In order to characterize the function of RM systems in archaeal species, we have made use of the model haloarchaeon Haloferax volcanii. A genomic DNA methylation analysis of H. volcanii strain H26 was performed using PacBio single molecule real-time (SMRT) sequencing. This analysis was also performed on a strain of H. volcanii in which an annotated DNA methyltransferase gene HVO_A0006 was deleted from the genome. Sequence analysis of H26 revealed two motifs which are modified in the genome: Cm4TAG and GCAm6BN6VTGC. Analysis of the ΔHVO_A0006 strain indicated that it exhibited reduced adenine methylation compared to the parental strain and altered the detected adenine motif. However, protein domain architecture analysis and amino acid alignments revealed that HVO_A0006 is homologous only to the N-terminal endonuclease region of Type IIG RM proteins and contains a PD-(D/E)XK nuclease motif, suggesting that HVO_A0006 is a PD-(D/E)XK nuclease family protein. Further bioinformatic analysis of the HVO_A0006 gene demonstrated that the gene is rare among the Halobacteria. It is surrounded by two transposition genes suggesting that HVO_A0006 is a fragment of a Type IIG RM gene, which has likely been acquired through gene transfer, and affects restriction-modification activity by interacting with another RM system component(s). Here, we present the first genome-wide characterization of DNA methylation in an archaeal species and examine the function of a DNA methyltransferase related gene HVO_A0006. PMID:25904898

  15. Structural Biology of Human H3K9 Methyltransferases

    SciTech Connect

    Wu, H.; Min, J; Lunin, V; Antoshenko, T; Dombrovsk, L; Zeng, H; Allali-Hassani, A; Campagna-Slater, V; Vedadi, M; et. al.

    2010-01-01

    SET domain methyltransferases deposit methyl marks on specific histone tail lysine residues and play a major role in epigenetic regulation of gene transcription. We solved the structures of the catalytic domains of GLP, G9a, Suv39H2 and PRDM2, four of the eight known human H3K9 methyltransferases in their apo conformation or in complex with the methyl donating cofactor, and peptide substrates. We analyzed the structural determinants for methylation state specificity, and designed a G9a mutant able to tri-methylate H3K9. We show that the I-SET domain acts as a rigid docking platform, while induced-fit of the Post-SET domain is necessary to achieve a catalytically competent conformation. We also propose a model where long-range electrostatics bring enzyme and histone substrate together, while the presence of an arginine upstream of the target lysine is critical for binding and specificity. Post-translational modifications of histone proteins regulate chromatin compaction, mediate epigenetic regulation of transcription, and control cellular differentiation in health and disease. Methylation of histone tails is one of the fundamental events of epigenetic signaling. Tri-methylation of lysine 9 of histone 3 (H3K9) mediates chromatin recruitment of HP1, heterochromatin condensation and gene silencing. Similarly, methylation of H3K27 and H4K20 are associated with a repressed state of chromatin, whereas expressed genes are methylated at H3K4, H3K36 and H3K79. Histone methyltransferases are divided into protein arginine methyltransferases (PRMTs) and histone lysine methyltransferases (HKMTs). HKMTs catalyze the transfer of a methyl group from the co-factor S-adenosyl-L-methionine (SAM) to a substrate lysine and, with the exception of DOT1L, are all organized around a canonical SET domain. The structures of a number of HKMTs have been reported, including ternary complexes of human orthologs with co-factor and substrate peptides (SETD7-H3K4, SETD8-H4K20 and MLL1-H3K4), as well

  16. Clustered Genes Involved in Cyclopiazonic Acid Production are Next to the Aflatoxin Biosynthesis Gene Cluster in Aspergillus flavus

    USDA-ARS?s Scientific Manuscript database

    Cyclopiazonic acid (CPA), an indole-tetramic acid toxin, is produced by many species of Aspergillus and Penicillium. In addition to CPA Aspergillus flavus produces polyketide-derived carcinogenic aflatoxins (AFs). AF biosynthesis genes form a gene cluster in a subtelomeric region. Isolates of A. fla...

  17. Amino acid regulation of mammalian gene expression in the intestine.

    PubMed

    Brasse-Lagnel, Carole G; Lavoinne, Alain M; Husson, Annie S

    2010-07-01

    Some amino acids exert a wide range of regulatory effects on gene expression via the activation of different signalling pathways and transcription factors, and a number of cis elements were shown to respond to changes in amino acid concentration. Particular attention has been paid to the effects of glutamine and arginine, which modulate a number of cell functions through the activation of various pathways in different tissues. In the intestine, appropriate concentrations of both arginine and/or glutamine contribute to facilitate cell proliferation, to limit the inflammatory response and apoptosis, and to modulate intermediary metabolism through specific transcription factors. Particularly, besides its role as a major fuel for enterocytes, the regulatory effects of glutamine have been extensively studied and the molecular mechanisms involved appear diversified and complex. Indeed, in addition to a major role of NF-kappaB in its anti-inflammatory action and a stimulatory role of AP-1 in its growth-promoting action and cell survival, the involvement of some other transcription factors, such as PPAR-gamma or HSF-1, was shown to maintain intestinal cell integrity. The signalling pathways leading to the activation of transcription factors imply several kinases, particularly MAP kinases in the effect of glutamine and p70 S6 kinase for those of arginine, but in most cases the precise pathways from the entrance of the aminoacid into the cell to the activation of gene transcription has remained elusive.

  18. Relationship of catechol-O-methyltransferase to schizophrenia and its correlates: evidence for associations and complex interactions.

    PubMed

    Lewandowski, Kathryn E

    2007-01-01

    Converging lines of evidence suggest that the gene that codes for catechol-O-methyltransferase (COMT) may play a role in the etiology, neurodevelopment, and expression of schizophrenia. Dopamine dysregulation has long been implicated in schizophrenia pathogenesis, and COMT appears to play a role in dopamine functioning, especially in prefrontal cortex. Additionally, the COMT gene maps to the commonly deleted region on chromosome 22q11 in 22q11 deletion syndrome (22q11DS), a disorder associated with a highly elevated risk for the development of psychosis. An amino acid polymorphism (Val158Met) in the COMT gene affects the activity level of COMT, which affects the levels of available catecholamines in the brain. Val158Met has been found to predict performance on dopamine-mediated prefrontal tasks in healthy adults and patients with schizophrenia. While association and linkage studies have failed to provide conclusive evidence of a strong link between COMT genotype and schizophrenia, evidence linking neural functioning and behavioral output has been somewhat more promising. The present work examines evidence for the role of COMT in schizophrenia pathogenesis, and associations between COMT and cognitive and behavioral correlates of schizophrenia and related disorders. Additionally, evidence for complex interactions involving COMT is examined, including the utility of haplotype analysis and evidence for gene-by-gene and gene-by-environment interactions.

  19. Cationic liposome–nucleic acid nanoparticle assemblies with applications in gene delivery and gene silencing

    PubMed Central

    Majzoub, Ramsey N.

    2016-01-01

    Cationic liposomes (CLs) are synthetic carriers of nucleic acids in gene delivery and gene silencing therapeutics. The introduction will describe the structures of distinct liquid crystalline phases of CL–nucleic acid complexes, which were revealed in earlier synchrotron small-angle X-ray scattering experiments. When mixed with plasmid DNA, CLs containing lipids with distinct shapes spontaneously undergo topological transitions into self-assembled lamellar, inverse hexagonal, and hexagonal CL–DNA phases. CLs containing cubic phase lipids are observed to readily mix with short interfering RNA (siRNA) molecules creating double gyroid CL–siRNA phases for gene silencing. Custom synthesis of multivalent lipids and a range of novel polyethylene glycol (PEG)-lipids with attached targeting ligands and hydrolysable moieties have led to functionalized equilibrium nanoparticles (NPs) optimized for cell targeting, uptake or endosomal escape. Very recent experiments are described with surface-functionalized PEGylated CL–DNA NPs, including fluorescence microscopy colocalization with members of the Rab family of GTPases, which directly reveal interactions with cell membranes and NP pathways. In vitro optimization of CL–DNA and CL–siRNA NPs with relevant primary cancer cells is expected to impact nucleic acid therapeutics in vivo. This article is part of the themed issue ‘Soft interfacial materials: from fundamentals to formulation’. PMID:27298431

  20. Interethnic difference in thiopurine methyltransferase activity.

    PubMed

    Klemetsdal, B; Tollefsen, E; Loennechen, T; Johnsen, K; Utsi, E; Gisholt, K; Wist, E; Aarbakke, J

    1992-01-01

    A number of metabolic pathways are subject to both genetic polymorphism and interethnic differences. A catabolic pathway of 6-mercaptopurine, red blood cell (RBC) thiopurine methyltransferase (TPMT) activity showed genetic polymorphism in Caucasians, but variation according to ethnicity has not been studied. We investigated if red blood cell thiopurine methyltransferase was subject to interethnic variation in a Saami (Lappish; n = 36) and a Caucasian population (n = 50). The Saami population sample had 29% higher thiopurine methyltransferase activity, 17.0 +/- 3.3 U/ml red blood cell compared with the Caucasian population sample, 13.1 +/- 2.9 U/ml red blood cell (p much less than 0.001). Probit plots and frequency distribution histograms supported bimodality consistent with genetic polymorphism in both study populations. Differences in chronic diseases, drug consumption, age, or gender could not explain the interethnic difference in red blood cell thiopurine methyltransferase activity. The higher red blood cell thiopurine methyltransferase activity in the Saami population group indicates that these subjects may require higher dosages of thiopurine drugs than Caucasians.

  1. [Gene mining of sulfur-containing amino acid metabolic enzymes in soybean].

    PubMed

    Qiu, Hongmei; Hao, Wenyuan; Gao, Shuqin; Ma, Xiaoping; Zheng, Yuhong; Meng, Fanfan; Fan, Xuhong; Wang, Yang; Wang, Yueqiang; Wang, Shuming

    2014-09-01

    The genes of sulfur-containing amino acid synthetases in soybean are essential for the synthesis of sulfur-containing amino acids. Gene mining of these enzymes is the basis for the molecular assistant breeding of high sulfur-containing amino acids in soybean. In this study, using software BioMercator2.1, 113 genes of sulfur-containing amino acid enzymes and 33 QTLs controlling the sulfur-containing amino acids content were mapped onto Consensus Map 4.0, which was integrated by genetic and physical maps of soybean. Sixteen candidate genes associated to the synthesis of sulfur-containing amino acids were screened based on the synteny between gene loci and QTLs, and the effect values of QTLs. Through a bioinformatic analysis of the copy number, SNP information, and expression profile of candidate genes, 12 related enzyme genes were identified and mapped on 8 linkage groups, such as D1a, M, A2, K, and G. The genes corresponding to QTL regions can explain 6%?38.5% genetic variation of sulfur-containing amino acids, and among them, the indirect effect values of 9 genes were more than 10%. These 12 genes were involved in sulfur-containing amino acid metabolism and were highly expressed in the cotyledons and flowers, showing an abundance of SNPs. These genes can be used as candidate genes for the development of functional markers, and it will lay a foundation for molecular design breeding in soybean.

  2. [Gene cloning and bioinformatics analysis of new gene for chlorogenic acid biosynthesis of Lonicera hypoglauca].

    PubMed

    Yu, Shu-lin; Huang, Lu-qi; Yuan, Yuan; Qi, Lin-jie; Liu, Da-hui

    2015-03-01

    To obtain the key genes for chlorogenic acid biosynthesis of Lonicera hypoglauca, four new genes ware obtained from the our dataset of L. hypoglauca. And we also predicted the structure and function of LHPAL4, LHHCT1 , LHHCT2 and LHHCT3 proteins. The phylogenetic tree showed that LHPAL4 was closely related with LHPAL1, LHHCT1 was closely related with LHHCT3, LHHCT2 clustered into a single group. By Real-time PCR to detect the gene expressed level in different organs of L. hypoglauca, we found that the transcripted level of LHPAL4, LHHCT1 and LHHCT3 was the highest in defeat flowers, and the transcripted level of LHHCT2 was the highest in leaves. These result provided a basis to further analysis the mechanism of active ingredients in different organs, as well as the element for in vitro biosynthesis of active ingredients.

  3. Methyltransferase-Glo: a universal, bioluminescent and homogenous assay for monitoring all classes of methyltransferases.

    PubMed

    Hsiao, Kevin; Zegzouti, Hicham; Goueli, Said A

    2016-03-01

    To develop a homogenous, nonradioactive, antibody-free and universal assay for diverse families of methyltransferases and monitor the activity of these enzymes in a high-throughput format. The assay conditions are optimized for monitoring the enzymatic activity of a broad range of methyltransferases regardless of the chemical structure or nature of the enzyme substrate in a low- and high-throughput-formatted protocols. The assay detects S-adenosyl-L-homocysteine, the universal reaction products of all methyltransferases. We demonstrate the utility of using this protocol to determine the activity of DNA, protein methyltransferases and also to determine kinetic parameters of several inhibitors using purified enzymes. The assay is sensitive (20-30 nM of S-adenosyl-L-homocysteine) and robust. The methyltransferase Glo is nonradioactive, antibody-free and homogenous, universal assay to determine enzyme activity of diverse families of methyltransferases. The assay is formatted to meet the requirements of high-throughput screening in drug discovery programs searching for modulators of