Science.gov

Sample records for acid polymerase chain

  1. Polymerase chain reaction system using magnetic beads for analyzing a sample that includes nucleic acid

    DOEpatents

    Nasarabadi, Shanavaz [Livermore, CA

    2011-01-11

    A polymerase chain reaction system for analyzing a sample containing nucleic acid includes providing magnetic beads; providing a flow channel having a polymerase chain reaction chamber, a pre polymerase chain reaction magnet position adjacent the polymerase chain reaction chamber, and a post pre polymerase magnet position adjacent the polymerase chain reaction chamber. The nucleic acid is bound to the magnetic beads. The magnetic beads with the nucleic acid flow to the pre polymerase chain reaction magnet position in the flow channel. The magnetic beads and the nucleic acid are washed with ethanol. The nucleic acid in the polymerase chain reaction chamber is amplified. The magnetic beads and the nucleic acid are separated into a waste stream containing the magnetic beads and a post polymerase chain reaction mix containing the nucleic acid. The reaction mix containing the nucleic acid flows to an analysis unit in the channel for analysis.

  2. Nucleic acid amplification: Alternative methods of polymerase chain reaction

    PubMed Central

    Fakruddin, Md; Mannan, Khanjada Shahnewaj Bin; Chowdhury, Abhijit; Mazumdar, Reaz Mohammad; Hossain, Md. Nur; Islam, Sumaiya; Chowdhury, Md. Alimuddin

    2013-01-01

    Nucleic acid amplification is a valuable molecular tool not only in basic research but also in application oriented fields, such as clinical medicine development, infectious diseases diagnosis, gene cloning and industrial quality control. A comperehensive review of the literature on the principles, applications, challenges and prospects of different alternative methods of polymerase chain reaction (PCR) was performed. PCR was the first nucleic acid amplification method. With the advancement of research, a no of alternative nucleic acid amplification methods has been developed such as loop mediated isothermal amplification, nucleic acid sequence based amplification, strand displacement amplification, multiple displacement amplification. Most of the alternative methods are isothermal obviating the need for thermal cyclers. Though principles of most of the alternate methods are relatively complex than that of PCR, they offer better applicability and sensitivity in cases where PCR has limitations. Most of the alternate methods still have to prove themselves through extensive validation studies and are not available in commercial form; they pose the potentiality to be used as replacements of PCR. Continuous research is going on in different parts of the world to make these methods viable technically and economically. PMID:24302831

  3. Nucleic acid amplification: Alternative methods of polymerase chain reaction.

    PubMed

    Fakruddin, Md; Mannan, Khanjada Shahnewaj Bin; Chowdhury, Abhijit; Mazumdar, Reaz Mohammad; Hossain, Md Nur; Islam, Sumaiya; Chowdhury, Md Alimuddin

    2013-10-01

    Nucleic acid amplification is a valuable molecular tool not only in basic research but also in application oriented fields, such as clinical medicine development, infectious diseases diagnosis, gene cloning and industrial quality control. A comperehensive review of the literature on the principles, applications, challenges and prospects of different alternative methods of polymerase chain reaction (PCR) was performed. PCR was the first nucleic acid amplification method. With the advancement of research, a no of alternative nucleic acid amplification methods has been developed such as loop mediated isothermal amplification, nucleic acid sequence based amplification, strand displacement amplification, multiple displacement amplification. Most of the alternative methods are isothermal obviating the need for thermal cyclers. Though principles of most of the alternate methods are relatively complex than that of PCR, they offer better applicability and sensitivity in cases where PCR has limitations. Most of the alternate methods still have to prove themselves through extensive validation studies and are not available in commercial form; they pose the potentiality to be used as replacements of PCR. Continuous research is going on in different parts of the world to make these methods viable technically and economically.

  4. Polymerase chain reaction system

    DOEpatents

    Benett, William J.; Richards, James B.; Stratton, Paul L.; Hadley, Dean R.; Milanovich, Fred P.; Belgrader, Phil; Meyer, Peter L.

    2004-03-02

    A portable polymerase chain reaction DNA amplification and detection system includes one or more chamber modules. Each module supports a duplex assay of a biological sample. Each module has two parallel interrogation ports with a linear optical system. The system is capable of being handheld.

  5. The polymerase chain reaction.

    PubMed

    Welch, Hazel M

    2012-01-01

    The polymerase chain reaction (PCR) has had a significant impact on all aspects of the molecular biosciences, from cancer research to forensic science. The sensitivity and specificity inherent in the technique allow minute quantities of genetic material to be detected while the unique properties of thermostable DNA polymerase ensure that abundant copies are reliably reproduced to levels that can be visualized and/or used for further applications. This chapter describes applications of PCR and PCR-RT to investigate primary cancer and metastatic disease at both the DNA and mRNA expression levels.

  6. Polymerase chain reaction (PCR) identification of Penicillium brevicompactum, a grape contaminant and mycophenolic acid producer.

    PubMed

    Patiño, B; Medina, A; Doménech, M; González-Jaén, M T; Jiménez, M; Vázquez, C

    2007-02-01

    Penicillium brevicompactum is a ubiquitous fungal species that contaminates diverse substrates and commodities and produces an array of metabolites toxic to human and animals. The present work has obtained evidence, by liquid chromatography (LC)-ion-trap mass spectrometry, of the ability of P. brevicompactum strains isolated from grapes to produce mycophenolic acid, a potent immunosuppressor. In order to facilitate early diagnosis of this species on commodities for human and animal consumption, a rapid, sensitive and specific polymerase chain reaction (PCR) assay for P. brevicompactum was developed. The specific primers were designed based on the ITS1-5.8S-ITS2ITS (Internal Transcribed Spacers of rRNA genes) multicopy region. This method provides a useful aid to detect the presence of this fungal species in grapes and other commodities in order to prevent the toxins produced entering the food chain.

  7. Presence of human immunodeficiency virus nucleic acids in wastewater and their detection by polymerase chain reaction.

    PubMed Central

    Ansari, S A; Farrah, S R; Chaudhry, G R

    1992-01-01

    The human immunodeficiency virus type 1 (HIV-1) released by infected individuals or present in human and hospital wastes can potentially cause contamination problems. The presence of HIV-1 was investigated in 16 environmental samples, including raw wastewater, sludge, final effluent, soil, and pond water, collected from different locations. A method was developed to extract total nucleic acids in intact form directly from the raw samples or from the viral concentrates of the raw samples. The isolated nucleic acids were analyzed for the presence of HIV-1 by using in vitro amplification of the target sequences by the polymerase chain reaction (PCR) method. HIV-1-specific proviral DNA and viral RNA were detected in the extracted nucleic acids obtained from three wastewater samples by this method. The specificity of the PCR-amplified products was determined by Southern blot hybridization with an HIV-1-specific oligonucleotide probe, SK19. The isolated nucleic acids from wastewater samples were also screened for the presence of poliovirus type 1, representing a commonly found enteric virus, and simian immunodeficiency virus, representing, presumably, rare viruses. While poliovirus type 1 viral RNA was found in all of the wastewater samples, none of the samples yielded a simian immunodeficiency virus-specific product. No PCR-amplified product was yielded when wastewater samples were directly used for the detection of HIV-1 and poliovirus type 1. The wastewater constituents appeared to be inhibitory to the enzymes reverse transcriptase and DNA polymerase.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:1476440

  8. Multiplex-microsphere-quantitative polymerase chain reaction: nucleic acid amplification and detection on microspheres.

    PubMed

    Liang, Fang; Lai, Richard; Arora, Neetika; Zhang, Kang Liang; Yeh, Che-Cheng; Barnett, Graeme R; Voigt, Paul; Corrie, Simon R; Barnard, Ross T

    2013-01-01

    We report the development of a new system to monitor the amplification of nucleic acids on microspheres. This was realized by the design of (i) a "universal" oligonucleotide "tagged" polymerase chain reaction (PCR) forward primer, (ii) a sensor sequence complementary to the universal sequence on the forward PCR primer modified with a fluorescent dye, and (iii) a universal oligonucleotide coupled to Luminex microspheres. The PCR takes place with the microspheres present in the reaction tube. With the consumption of the universal oligonucleotide tagged forward primer, the fluorescently labeled sequences can bind to the universal oligonucleotide on the microspheres. We tested the microsphere quantitative PCR system with up to three different target genes (Neisseria meningitides porA and ctrA and influenza A M gene segment) as templates in a single PCR tube. The analytical sensitivity of this quantitative PCR system was tested and compared with the TaqMan system. The multiplex-microsphere-quantitative PCR system does not require design of unique internal probes for each target and has potential for a high degree of multiplexing, greater than the limited multiplexing achievable with current real-time protocols.

  9. A new, multiplex, quantitative real-time polymerase chain reaction system for nucleic acid detection and quantification.

    PubMed

    Liang, Fang; Arora, Neetika; Zhang, Kang Liang; Yeh, David Che Cheng; Lai, Richard; Pearson, Darnley; Barnett, Graeme; Whiley, David; Sloots, Theo; Corrie, Simon R; Barnard, Ross T

    2013-01-01

    Quantitative real-time polymerase chain reaction (qPCR) has emerged as a powerful investigative and diagnostic tool with potential to generate accurate and reproducible results. qPCR can be designed to fulfil the four key aspects required for the detection of nucleic acids: simplicity, speed, sensitivity, and specificity. This chapter reports the development of a novel real-time multiplex quantitative PCR technology, dubbed PrimRglo™, with a potential for high-degree multiplexing. It combines the capacity to simultaneously detect many viruses, bacteria, or nucleic acids, in a single reaction tube, with the ability to quantitate viral or bacterial load. The system utilizes oligonucleotide-tagged PCR primers, along with complementary fluorophore-labelled and quencher-labelled oligonucleotides. The analytic sensitivity of PrimRglo technology was compared with the widely used Taqman(®) and SYBR green detection systems.

  10. Thermal denaturation of double-stranded nucleic acids: prediction of temperatures critical for gradient gel electrophoresis and polymerase chain reaction.

    PubMed Central

    Steger, G

    1994-01-01

    A program is described which calculates the thermal stability and the denaturation behaviour of double-stranded DNAs and RNAs up to a length of 1000 base pairs. The algorithm is based on recursive generation of conditional and a priori probabilities for base stacking. Output of the program may be compared directly to experimental results; thus the program may be used to optimize the nucleic acid fragments, the primers and the experimental conditions prior to experiments like polymerase chain reactions, temperature-gradient gel electrophoresis, denaturing-gradient gel electrophoresis and hybridizations. The program is available in three versions; the first version runs interactively on VAXstations producing graphics output directly, the second is implemented as part of the HUSAR package at GENIUSnet, the third runs on any computer producing text output which serves as input to available graphics programs. Images PMID:8052531

  11. Nucleic acid amplification tests (polymerase chain reaction, ligase chain reaction) for the diagnosis of Chlamydia trachomatis and Neisseria gonorrhoeae in pediatric emergency medicine.

    PubMed

    Corneli, Howard M

    2005-04-01

    Nucleic acid amplification tests, such as ligase chain reaction and polymerase chain reaction, offer potential advantages of speed, simplicity, and accuracy in the detection of genitourinary tract infection with Neisseria gonorrhoeae and Chlamydia trachomatis. Their appropriate use in pediatric emergency medicine depends on an understanding of their strengths and weaknesses. Problems arise in defining the sensitivity and, especially, specificity of these tests. The clinical scenario, the site of infection, the age and sex of the patient, and especially the presence or absence of medicolegal concerns strongly affect the applicability of these tests. The risk of false positives may be significant even when legal concerns do not arise and even if a highly specific test is used. This article reviews the uses and limitations of such tests in pediatric emergency medicine. Discussion is directed to both technical and practical considerations.

  12. Investigation on natural diets of larval marine animals using peptide nucleic acid-directed polymerase chain reaction clamping.

    PubMed

    Chow, Seinen; Suzuki, Sayaka; Matsunaga, Tadashi; Lavery, Shane; Jeffs, Andrew; Takeyama, Haruko

    2011-04-01

    The stomach contents of the larvae of marine animals are usually very small in quantity and amorphous, especially in invertebrates, making morphological methods of identification very difficult. Nucleotide sequence analysis using polymerase chain reaction (PCR) is a likely approach, but the large quantity of larval (host) DNA present may mask subtle signals from the prey genome. We have adopted peptide nucleic acid (PNA)-directed PCR clamping to selectively inhibit amplification of host DNA for this purpose. The Japanese spiny lobster (Panulirus japonicus) and eel (Anguilla japonica) were used as model host and prey organisms, respectively. A lobster-specific PNA oligomer (20 bases) was designed to anneal to the sequence at the junction of the 18 S rDNA gene and the internal transcribed spacer 1 (ITS1) of the lobster. PCR using eukaryote universal primers for amplifying the ITS1 region used in conjunction with the lobster-specific PNA on a mixed DNA template of lobster and eel demonstrated successful inhibition of lobster ITS1 amplification while allowing efficient amplification of eel ITS1. This method was then applied to wild-caught lobster larvae of P. japonicus and P. longipes bispinosus collected around Ryukyu Archipelago, Japan. ITS1 sequences of a wide variety of animals (Ctenophora, Cnidaria, Crustacea, Teleostei, Mollusca, and Chaetognatha) were detected.

  13. Thermally multiplexed polymerase chain reaction

    PubMed Central

    Phaneuf, Christopher R.; Pak, Nikita; Saunders, D. Curtis; Holst, Gregory L.; Birjiniuk, Joav; Nagpal, Nikita; Culpepper, Stephen; Popler, Emily; Shane, Andi L.; Jerris, Robert; Forest, Craig R.

    2015-01-01

    Amplification of multiple unique genetic targets using the polymerase chain reaction (PCR) is commonly required in molecular biology laboratories. Such reactions are typically performed either serially or by multiplex PCR. Serial reactions are time consuming, and multiplex PCR, while powerful and widely used, can be prone to amplification bias, PCR drift, and primer-primer interactions. We present a new thermocycling method, termed thermal multiplexing, in which a single heat source is uniformly distributed and selectively modulated for independent temperature control of an array of PCR reactions. Thermal multiplexing allows amplification of multiple targets simultaneously—each reaction segregated and performed at optimal conditions. We demonstrate the method using a microfluidic system consisting of an infrared laser thermocycler, a polymer microchip featuring 1 μl, oil-encapsulated reactions, and closed-loop pulse-width modulation control. Heat transfer modeling is used to characterize thermal performance limitations of the system. We validate the model and perform two reactions simultaneously with widely varying annealing temperatures (48 °C and 68 °C), demonstrating excellent amplification. In addition, to demonstrate microfluidic infrared PCR using clinical specimens, we successfully amplified and detected both influenza A and B from human nasopharyngeal swabs. Thermal multiplexing is scalable and applicable to challenges such as pathogen detection where patients presenting non-specific symptoms need to be efficiently screened across a viral or bacterial panel. PMID:26339317

  14. Detection of deoxyribonucleic acid (DNA) targets using polymerase chain reaction (PCR) and paper surface-enhanced Raman spectroscopy (SERS) chromatography.

    PubMed

    Hoppmann, Eric P; Yu, Wei W; White, Ian M

    2014-01-01

    Surface-enhanced Raman spectroscopy (SERS) enables multiplex detection of analytes using simple, portable equipment consisting of a single excitation source and detector. Thus, in theory, SERS is ideally suited to replace fluorescence in assays that screen for numerous deoxyribonucleic acid (DNA) targets, but in practice, SERS-based assays have suffered from complexity and elaborate processing steps. Here, we report an assay in which a simple inkjet-fabricated plasmonic paper device enables SERS-based detection of multiple DNA targets within a single polymerase chain reaction (PCR). In prior work, we demonstrated the principles of chromatographic separation and SERS-based detection on inkjet-fabricated plasmonic paper. The present work extends that capability for post-PCR gene sequence detection. In this design, hydrolysis DNA probes with 5' Raman labels are utilized; if the target is present, the probe is hydrolyzed during PCR, freeing the reporter. After applying the PCR sample to a paper SERS device, an on-device chromatographic separation and concentration is conducted to discriminate between hydrolyzed and intact probes. SERS is then used to detect the reporter released by the hydrolyzed probes. This simple separation and detection on paper eliminates the need for complex sample processing steps. In this work, we simultaneously detect the methicillin-resistant Staphylococcus aureus genes mecA and femB to illustrate the concept. We envision that this approach could contribute to the development of multiplex DNA diagnostic tests enabling screening for several target sequences within a single reaction, which is necessary for cases in which sample volume and resources are limited.

  15. Dual phase multiplex polymerase chain reaction

    DOEpatents

    Pemov, Alexander; Bavykin, Sergei

    2008-10-07

    Highly specific and sensitive methods were developed for multiplex amplification of nucleic acids on supports such as microarrays. Based on a specific primer design, methods include five types of amplification that proceed in a reaction chamber simultaneously. These relate to four types of multiplex amplification of a target DNA on a solid support, directed by forward and reverse complex primers immobilized to the support and a fifth type--pseudo-monoplex polymerase chain reaction (PCR) of multiple targets in solution, directed by a single pair of unbound universal primers. The addition of the universal primers in the reaction mixture increases the yield over the traditional "bridge" amplification on a solid support by approximately ten times. Methods that provide multitarget amplification and detection of as little as 0.45-4.5.times.10.sup.-12 g (equivalent to 10.sup.2-10.sup.3 genomes) of a bacterial genomic DNA are disclosed.

  16. PrimRglo: a multiplexable quantitative real-time polymerase chain reaction system for nucleic acid detection.

    PubMed

    Lai, Richard; Liang, Fang; Pearson, Darnley; Barnett, Graeme; Whiley, David; Sloots, Theo; Barnard, Ross T; Corrie, Simon R

    2012-03-15

    We report the development of a new real-time polymerase chain reaction (PCR) detection system that uses oligonucleotide "tagged" PCR primers, a fluorophore-labeled "universal" detection oligonucleotides, and a complementary quenching oligonucleotide. The fluorescence signal decreases as PCR product accumulates due to the increase in detection/quencher hybrid formation as the tagged primer is consumed. We use plasmids containing the influenza A matrix gene and the porA and ctrA genes of Neisseria meningitidis as targets for developing the system. Cycle threshold (Ct) values were generated, and the sensitivity of the new system (dubbed "PrimRglo") compared favorably with the commonly used SYBR green and Taqman detection systems and, unlike the latter system, does not require the design of a new dual-labeled detection oligonucleotide for each new target sequence.

  17. [The contamination under polymerase chain reaction studies: problems and solutions].

    PubMed

    Titov, V N; Ameliushkina, V A; Rozhkova, T A

    2015-01-01

    The study was carried out to determine risk factors of false positive and false negative results under polymerase chain reaction-analysis of clinical material. The samples with high viral load can be the source of false positive results. The contamination with nucleic acids can occur at any section of polymerase chain reaction analysis. The study data permitted to establish that the most sensitive stage is isolation and purification of nucleic acids especially under manual mode of operation. The detection of positive signal in most samples of one setting indicates total contamination. The cases when only several samples are polluted are special challenge. The presence of sample with high concentration of viral nucleic acid and several samples with low concentration in one setting means necessity of repeated analysis beginning with stage of isolation of nucleic acid. The analysis of curves of accumulation of products of amplification, their forms and positioning on chart is the obligatory stage of polymerase chain reaction study in real time regimen. These actions permit to exclude the readouts of false negative testing results to departments. The study conclusions are equipotent for polymerase chain reaction testing of any nucleic acid targets.

  18. Determining Annealing Temperatures for Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Porta, Angela R.; Enners, Edward

    2012-01-01

    The polymerase chain reaction (PCR) is a common technique used in high school and undergraduate science teaching. Students often do not fully comprehend the underlying principles of the technique and how optimization of the protocol affects the outcome and analysis. In this molecular biology laboratory, students learn the steps of PCR with an…

  19. Polymerase Chain Reaction for Educational Settings.

    ERIC Educational Resources Information Center

    Garrison, Stephen J.; dePamphillis, Claude

    1994-01-01

    Suggests the incorporation of the Polymerase Chain Reaction (PCR) technique into high school and college biology laboratories. Discusses the following sections: (1) current PCR applications; (2) PCR technique; (3) Manual and Machine PCR; (4) Manual PCR Preparations and Procedure; (5) Materials, Supplies, and Recipes; (6) Primer Selection; and (7)…

  20. Diagnostic challenges of tuberculous lymphadenitis using polymerase chain reaction analysis: a case study.

    PubMed

    Taniguchi, Hirokazu; Nakamura, Masahiko; Shimokawa, Kazuki; Kamiseki, Fumi; Ishizawa, Shin; Abo, Hitoshi; Furuse, Hideaki; Tsuda, Takeshi; Masaki, Yasuaki; Suzuki, Kensuke

    2015-01-01

    This report presents a case of tuberculous lymphadenitis that was difficult to diagnose using polymerase chain reaction analysis. An 80-year-old Japanese female was hospitalized due to swollen cervical lymph nodes. Her lymph node tests revealed paradoxical polymerase chain reaction results. Polymerase chain reaction analysis of two biopsy tissues using the Cobas TaqMan revealed a positive result for Mycobacterium avium and a negative result for Mycobacterium tuberculosis. However, polymerase chain reaction analysis of a cultured colony of acid-fast bacteria from biopsy tissue using the Cobas TaqMan and an alternative polymerase chain reaction analysis of biopsy tissue yielded discordant results. The patient was diagnosed as having tuberculous lymphadenitis. She was treated with antitubercular drugs and subsequently had a reduction in cervical lymph node swelling. Polymerase chain reaction analysis is not 100% accurate; hence, its use as a diagnostic tool for mycobacterial infection requires increased attention.

  1. Polymerase chain reaction assay for avian polyomavirus.

    PubMed

    Phalen, D N; Wilson, V G; Graham, D L

    1991-05-01

    A polymerase chain reaction assay was developed for detection of budgerigar fledgling disease virus (BFDV). The assay used a single set of primers complementary to sequences located in the putative coding region for the BFDV VP1 gene. The observed amplification product had the expected size of 550 bp and was confirmed to derive from BFDV DNA by its restriction digestion pattern. This assay was specific for BFDV and highly sensitive, being able to detect as few as 20 copies of the virus. By using the polymerase chain reaction, BFDV was detected in adult, nestling, and embryo budgerigar (Melopsitticus undulatus) tissue DNAs and in sera from adult and nestling budgerigars. These results suggest the possibility of persistent infections in adult birds and lend further support to previously described evidence of possible in ovo transmission. BFDV was also detected in chicken embryo fibroblast cell cultures and chicken eggs inoculated with the virus. A 550-bp product with identical restriction enzyme sites was amplified from a suspected polyomavirus isolated from a peach-faced lovebird (Agapornis pesonata) and from tissue DNA from a Hahn's macaw (Ara nobilis) and a sun conure (Aratinga solstitialis) with histological lesions suggestive of polyomavirus infection. These fragments also hybridized with a BFDV-derived probe, proving that they were derived from a polyomavirus very similar, if not identical, to BFDV.

  2. Polymerase chain reaction assay for avian polyomavirus.

    PubMed Central

    Phalen, D N; Wilson, V G; Graham, D L

    1991-01-01

    A polymerase chain reaction assay was developed for detection of budgerigar fledgling disease virus (BFDV). The assay used a single set of primers complementary to sequences located in the putative coding region for the BFDV VP1 gene. The observed amplification product had the expected size of 550 bp and was confirmed to derive from BFDV DNA by its restriction digestion pattern. This assay was specific for BFDV and highly sensitive, being able to detect as few as 20 copies of the virus. By using the polymerase chain reaction, BFDV was detected in adult, nestling, and embryo budgerigar (Melopsitticus undulatus) tissue DNAs and in sera from adult and nestling budgerigars. These results suggest the possibility of persistent infections in adult birds and lend further support to previously described evidence of possible in ovo transmission. BFDV was also detected in chicken embryo fibroblast cell cultures and chicken eggs inoculated with the virus. A 550-bp product with identical restriction enzyme sites was amplified from a suspected polyomavirus isolated from a peach-faced lovebird (Agapornis pesonata) and from tissue DNA from a Hahn's macaw (Ara nobilis) and a sun conure (Aratinga solstitialis) with histological lesions suggestive of polyomavirus infection. These fragments also hybridized with a BFDV-derived probe, proving that they were derived from a polyomavirus very similar, if not identical, to BFDV. Images PMID:1647403

  3. Development and validation of quantitative polymerase chain reaction protocols targeting the ‘L’, ‘M’, and ‘S’ ribonucleic acid of Soybean vein necrosis virus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Soybean vein necrosis virus (SVNV) was first reported in Wisconsin in 2012. SVNV is a new member of the Tospovirus family and is becoming more frequent in occurrence in the north central region USA. New real-time reverse transcriptase quantitative polymerase chain reaction (RT-qPCR) protocols were d...

  4. Detection of KPC Carbapenemase in Pseudomonas aeruginosa Isolated From Clinical Samples Using Modified Hodge Test and Boronic Acid Phenotypic Methods and Their Comparison With the Polymerase Chain Reaction

    PubMed Central

    Falahat, Saeed; Shojapour, Mana; Sadeghi, Abdorrahim

    2016-01-01

    Background Bacterial resistance to antibiotics has become a major source of concern for public health. Pseudomonas aeruginosa strains are important opportunistic pathogens. These bacteria have a high resistance to a wide range of existing antimicrobials and antibiotics. Objectives The present study was performed to evaluate the frequency of KPC in P. aeruginosa isolated from clinical samples of educational hospitals of Arak University of Medical Sciences, using the mentioned phenotypic and genotypic methods. Materials and Methods One hundred and eight non-duplicate clinical isolates of P. aeruginosa were collected from hospitals of Arak University of Medical Sciences, Arak, Iran. Antibacterial susceptibility was determined by the disk diffusion method. KPC production was confirmed by the Modified Hodge Test (MHT), which is a phenotypic test, and combined-disk test with boronic acid and the Polymerase Chain Reaction (PCR). Results In the present study, 13 isolates (12%) of P. aeruginosa were positive for KPC, using PCR. Comparison of the two phenotypic methods used in this study showed that boronic acid is more sensitive than MHT in identification of KPC-producing strains (84.6% vs. 77%). Conclusions Utilization of reliable methods for identifying carbapenemase-producing strains and determining their antibiotic resistance pattern could have a very important role in treatment of infections caused by these strains. A substantial amount of P. aeruginosa isolated from clinical samples of hospitals in Arak (Iran) produce KPC carbapenemase. Due to their low specificity, MHT and boronic acid phenotypic methods could not completely identify KPC-producing P. aeruginosa. However, the sensitivity of boronic acid phenotypic method in detection of KPC was higher than MHT. PMID:27800140

  5. Error Rate Comparison during Polymerase Chain Reaction by DNA Polymerase

    DOE PAGES

    McInerney, Peter; Adams, Paul; Hadi, Masood Z.

    2014-01-01

    As larger-scale cloning projects become more prevalent, there is an increasing need for comparisons among high fidelity DNA polymerases used for PCR amplification. All polymerases marketed for PCR applications are tested for fidelity properties (i.e., error rate determination) by vendors, and numerous literature reports have addressed PCR enzyme fidelity. Nonetheless, it is often difficult to make direct comparisons among different enzymes due to numerous methodological and analytical differences from study to study. We have measured the error rates for 6 DNA polymerases commonly used in PCR applications, including 3 polymerases typically used for cloning applications requiring high fidelity. Errormore » rate measurement values reported here were obtained by direct sequencing of cloned PCR products. The strategy employed here allows interrogation of error rate across a very large DNA sequence space, since 94 unique DNA targets were used as templates for PCR cloning. The six enzymes included in the study, Taq polymerase, AccuPrime-Taq High Fidelity, KOD Hot Start, cloned Pfu polymerase, Phusion Hot Start, and Pwo polymerase, we find the lowest error rates with Pfu , Phusion, and Pwo polymerases. Error rates are comparable for these 3 enzymes and are >10x lower than the error rate observed with Taq polymerase. Mutation spectra are reported, with the 3 high fidelity enzymes displaying broadly similar types of mutations. For these enzymes, transition mutations predominate, with little bias observed for type of transition.« less

  6. Endonuclease Restriction-Mediated Real-Time Polymerase Chain Reaction: A Novel Technique for Rapid, Sensitive and Quantitative Detection of Nucleic-Acid Sequence.

    PubMed

    Wang, Yi; Wang, Yan; Zhang, Lu; Li, Machao; Luo, Lijuan; Liu, Dongxin; Li, Hua; Cao, Xiaolong; Hu, Shoukui; Jin, Dong; Xu, Jianguo; Ye, Changyun

    2016-01-01

    The article reported a novel methodology for real-time PCR analysis of nucleic acids, termed endonuclease restriction-mediated real-time polymerase chain reaction (ET-PCR). Just like PCR, ET-PCR only required one pair of primers. A short sequence, which was recognized by restriction enzyme BstUI, was attached to the 5' end of the forward (F) or reverse (R) PCR primer, and the new F or R primer was named EF or ER. EF/ER was labeled at the 5' end with a reporter dye and in the middle with a quenching dye. BstUI cleaves the newly synthesized double-stranded terminal sequences (5' end recognition sequences and their complementary sequences) during the extension phase, which separates the reporter molecule from the quenching dye, leading to a gain of fluorescence signal. This process is repeated in each amplification cycle and unaffected the exponential synthesis of the PCR amplification. ET-PCR allowed real-time analysis of single or multiple targets in a single vessel, and provided the reproducible quantitation of nucleic acids. The analytical sensitivity and specificity of ET-PCR were successfully evaluated, detecting down to 250 fg of genomic DNA per tube of target pathogen DNA examined, and the positive results were generated in a relatively short period. Moreover, the practical application of ET-PCR for simultaneous detection of multiple target pathogens was also demonstrated in artificially contaminated blood samples. In conclusion, due to the technique's simplicity of design, reproducible data and low contamination risk, ET-PCR assay is an appealing alternative to conventional approaches currently used for real-time nucleic acid analysis.

  7. Endonuclease Restriction-Mediated Real-Time Polymerase Chain Reaction: A Novel Technique for Rapid, Sensitive and Quantitative Detection of Nucleic-Acid Sequence

    PubMed Central

    Wang, Yi; Wang, Yan; Zhang, Lu; Li, Machao; Luo, Lijuan; Liu, Dongxin; Li, Hua; Cao, Xiaolong; Hu, Shoukui; Jin, Dong; Xu, Jianguo; Ye, Changyun

    2016-01-01

    The article reported a novel methodology for real-time PCR analysis of nucleic acids, termed endonuclease restriction-mediated real-time polymerase chain reaction (ET-PCR). Just like PCR, ET-PCR only required one pair of primers. A short sequence, which was recognized by restriction enzyme BstUI, was attached to the 5′ end of the forward (F) or reverse (R) PCR primer, and the new F or R primer was named EF or ER. EF/ER was labeled at the 5′ end with a reporter dye and in the middle with a quenching dye. BstUI cleaves the newly synthesized double-stranded terminal sequences (5′ end recognition sequences and their complementary sequences) during the extension phase, which separates the reporter molecule from the quenching dye, leading to a gain of fluorescence signal. This process is repeated in each amplification cycle and unaffected the exponential synthesis of the PCR amplification. ET-PCR allowed real-time analysis of single or multiple targets in a single vessel, and provided the reproducible quantitation of nucleic acids. The analytical sensitivity and specificity of ET-PCR were successfully evaluated, detecting down to 250 fg of genomic DNA per tube of target pathogen DNA examined, and the positive results were generated in a relatively short period. Moreover, the practical application of ET-PCR for simultaneous detection of multiple target pathogens was also demonstrated in artificially contaminated blood samples. In conclusion, due to the technique’s simplicity of design, reproducible data and low contamination risk, ET-PCR assay is an appealing alternative to conventional approaches currently used for real-time nucleic acid analysis. PMID:27468284

  8. Development of a peptide nucleic acid polymerase chain reaction clamping assay for semiquantitative evaluation of genetically modified organism content in food.

    PubMed

    Peano, C; Lesignoli, F; Gulli, M; Corradini, R; Samson, M C; Marchelli, R; Marmiroli, N

    2005-09-15

    In the present study a peptide nucleic acid (PNA)-mediated polymerase chain reaction (PCR) clamping method was developed and applied to the detection of genetically modified organisms (GMO), to test PCR products for band identity and to obtain a semiquantitative evaluation of GMO content. The minimal concentration of PNA necessary to block the PCR was determined by comparing PCRs containing a constant amount of DNA in the presence of increasing concentration of target-specific PNA. The lowest PNA concentration at which specific inhibition took place, by the inhibition of primer extension and/or steric hindrance, was the most efficient condition. Optimization of PCR clamping by PNA was observed by testing five different PNAs with a minimum of 13 bp to a maximum of 15 bp, designed on the target sequence of Roundup Ready soybean. The results obtained on the DNA extracted from Roundup Ready soybean standard flour were verified also on DNA extracted from standard flours of maize GA21, Bt176, Bt11, and MON810. A correlation between the PNA concentration necessary for inducing PCR clamping and the percentage of the GMO target sequence in the sample was found.

  9. A Practical Polymerase Chain Reaction Laboratory for Introductory Biology Classes.

    ERIC Educational Resources Information Center

    Bowlus, R. David; Grether, Susan C.

    1996-01-01

    Presents a polymerase chain reaction (PCR) laboratory exercise that can be performed by introductory biology students in 1 45- to 55-minute class period. Includes a general description of the polymerase chain reaction, materials needed, procedure, and details of interest to teachers. (JRH)

  10. Integrated polymerase chain reaction/electrophoresis instrument

    DOEpatents

    Andresen, Brian D.

    2000-01-01

    A new approach and instrument for field identification of micro-organisms and DNA fragments using a small and disposable device containing integrated polymerase chain reaction (PCR) enzymatic reaction wells, attached capillary electrophoresis (CE) channels, detectors, and read-out all on/in a small hand-held package. The analysis instrument may be made inexpensively, for example, of plastic, and thus is disposable, which minimizes cross contamination and the potential for false positive identification between samples. In addition, it is designed for multiple users with individual applications. The integrated PCR/CE is manufactured by the PCR well and CE channels are "stamped" into plastic depressions where conductive coatings are made in the wells and ends of the CE microchannels to carry voltage and current to heat the PCR reaction mixtures and simultaneously draw DNA bands up the CE channels. Light is transmitted through the instrument at appropriate points and detects PCR bands and identifies DNA fragments by size (retention time) and quantifies each by the amount of light generated as each phototransistor positioned below each CE channel detects a passing band. The instrument is so compact that at least 100 PCR/CE reactions/analyses can be performed easily on one detection device.

  11. Actinobaculum suis Detection Using Polymerase Chain Reaction

    PubMed Central

    Amigo, Cristina Román; de Gobbi, Debora Dirani Sena; Gomes, Vasco Túlio de Moura; Perina, Danilo do Prado; Nogueira de Lima Filsner, Pedro Henrique; Costa, Barbara Letícia Pereira; Spindola, Maria Garcia; Ferreira, Thais Sebastiana Porfida; Brandão, Paulo Eduardo; Moreno, Andrea Micke

    2012-01-01

    Actinobaculum suis is an important agent related to urinary infection in swine females. Due to its fastidious growth characteristics, the isolation of this anaerobic bacterium is difficult, thus impairing the estimation of its prevalence. The purpose of this study was to develop and test a polymerase chain reaction (PCR) for the detection and identification of A. suis and then compare these results with traditional isolation methods. Bacterial isolation and PCR were performed on one hundred and ninety-two urine samples from sows and forty-five preputial swabs from boars. The results indicate that this PCR was specific for A. suis, presenting a detection limit between 1.0 × 101 CFU/mL and 1.0 × 102 CFU/mL. A. suis frequencies, as measured by PCR, were 8.9% (17/192) in sow urine samples and 82.2% (37/45) in preputial swabs. Assessed using conventional culturing techniques, none of the urine samples were positive for A. suis; however, A. suis was detected in 31.1% (14/45) of the swabs. This PCR technique was shown to be an efficient method for the detection of A. suis in urine and preputial swabs. PMID:23346017

  12. Diagnosis of Jamestown Canyon encephalitis by polymerase chain reaction.

    PubMed

    Huang, C; Campbell, W; Grady, L; Kirouac, I; LaForce, F M

    1999-06-01

    In recent years, polymerase chain reaction (PCR) has been under study as a potential technique to improve the accuracy of diagnosis of suspected central nervous system viral infections. We describe a case of severe encephalitis in a previously healthy 20-year-old woman from New York who presented with headache, fever, and photophobia. Her illness was characterized by progressive worsening of her neurological status, leading to confusion, delirium, and status epilepticus. The diagnosis of Jamestown Canyon encephalitis was established by positive reverse transcriptase (RT)-PCR and nucleic acid sequencing of the band from both cerebrospinal fluid and brain tissue. The nucleotide sequence and the deduced amino acid sequence of the Jamestown Canyon virus from this patient were very similar to Jamestown Canyon virus isolates from mosquito pools in New York. This report suggests that RT-PCR assays could be important tools in the diagnostic workup of cases of encephalitis.

  13. Problem-Solving Test: Real-Time Polymerase Chain Reaction

    ERIC Educational Resources Information Center

    Szeberenyi, Jozsef

    2009-01-01

    Terms to be familiar with before you start to solve the test: polymerase chain reaction, DNA amplification, electrophoresis, breast cancer, "HER2" gene, genomic DNA, "in vitro" DNA synthesis, template, primer, Taq polymerase, 5[prime][right arrow]3[prime] elongation activity, 5[prime][right arrow]3[prime] exonuclease activity, deoxyribonucleoside…

  14. Modified pseudomonas oleovorans phaC1 nucleic acids encoding bispecific polyhydroxyalkanoate polymerase

    DOEpatents

    Srienc, Friedrich; Jackson, John K.; Somers, David A.

    2000-01-01

    A genetically engineered Pseudomonas oleovorans phaC1 polyhydroxyalkanoate (PHA) polymerase having tailored substrate specificity is provided. The modified PHA polymerase is preferably a "bispecific" PHA polymerase capable of copolymerizing a short chain length monomer and a medium chain length monomer is provided. Methods for making the modified PHA polymerase and for making nucleic acids encoding the modified PHA polymerase are also disclosed, as are methods of producing PHA using the modified PHA polymerase. The invention further includes methods to assay for altered substrate specificity.

  15. Detection and analysis of polymerase chain reaction products by mass spectrometry

    SciTech Connect

    Hurst, G.B., Doktycz, M.J., Britt, P.F., Vass, A.A., Buchanan, M.V.

    1997-02-01

    This paper describes recent and ongoing efforts to overcome some of the obstacles to more routine and robust application of MALDI-TOF to analysis of polymerase chain reaction products and other information- bearing nucleic acid molecules. Methods for purifying nucleic acid samples are described, as is the application of delayed extraction TOF mass spectrometry to analysis of short oligonucleotides.

  16. A noncontact temperature measurement method in polymerase chain reaction reactors

    NASA Astrophysics Data System (ADS)

    Sochivko, D. G.; Varlamov, D. A.; Fedorov, A. A.; Kurochkin, V. E.

    2016-04-01

    A new noncontact method for measuring temperatures of liquids, which is based on the fluorescent probes, is proposed. The method is intended for measuring temperatures of reaction media in reactors of devices for polymerase chain reactions in real time and can be used for determining dynamic temperature parameters.

  17. Mathematics analysis of polymerase chain reaction kinetic curves.

    PubMed

    Sochivko, D G; Fedorov, A A; Varlamov, D A; Kurochkin, V E; Petrov, R V

    2016-01-01

    The paper reviews different approaches to the mathematical analysis of polymerase chain reaction (PCR) kinetic curves. The basic principles of PCR mathematical analysis are presented. Approximation of PCR kinetic curves and PCR efficiency curves by various functions is described. Several PCR models based on chemical kinetics equations are suggested. Decision criteria for an optimal function to describe PCR efficiency are proposed.

  18. Detection of Listeria monocytogenes by using the polymerase chain reaction

    SciTech Connect

    Bessesen, M.T.; Luo, Q.; Blaser, M.J.; Ellison, R.T. III.; Rotbart. H.A. )

    1990-09-01

    A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.

  19. Polymerase Chain Reaction for Detection of Systemic Plant Pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...

  20. Circulating polymerase chain reaction chips utilizing multiple-membrane activation

    NASA Astrophysics Data System (ADS)

    Wang, Chih-Hao; Chen, Yi-Yu; Liao, Chia-Sheng; Hsieh, Tsung-Min; Luo, Ching-Hsing; Wu, Jiunn-Jong; Lee, Huei-Huang; Lee, Gwo-Bin

    2007-02-01

    This paper reports a new micromachined, circulating, polymerase chain reaction (PCR) chip for nucleic acid amplification. The PCR chip is comprised of a microthermal control module and a polydimethylsiloxane (PDMS)-based microfluidic control module. The microthermal control modules are formed with three individual heating and temperature-sensing sections, each modulating a specific set temperature for denaturation, annealing and extension processes, respectively. Micro-pneumatic valves and multiple-membrane activations are used to form the microfluidic control module to transport sample fluids through three reaction regions. Compared with other PCR chips, the new chip is more compact in size, requires less time for heating and cooling processes, and has the capability to randomly adjust time ratios and cycle numbers depending on the PCR process. Experimental results showed that detection genes for two pathogens, Streptococcus pyogenes (S. pyogenes, 777 bps) and Streptococcus pneumoniae (S. pneumoniae, 273 bps), can be successfully amplified using the new circulating PCR chip. The minimum number of thermal cycles to amplify the DNA-based S. pyogenes for slab gel electrophoresis is 20 cycles with an initial concentration of 42.5 pg µl-1. Experimental data also revealed that a high reproducibility up to 98% could be achieved if the initial template concentration of the S. pyogenes was higher than 4 pg µl-1. The preliminary results of the current paper were presented at the 19th IEEE International Conference on Micro Electro Mechanical Systems (IEEE MEMS 2006), Istanbul, Turkey, 22-26 January, 2006.

  1. Total chemical synthesis of a thermostable enzyme capable of polymerase chain reaction.

    PubMed

    Xu, Weiliang; Jiang, Wenjun; Wang, Jiaxing; Yu, Linping; Chen, Ji; Liu, Xianyu; Liu, Lei; Zhu, Ting F

    2017-01-01

    Polymerase chain reaction (PCR) has been a defining tool in modern biology. Towards realizing mirror-image PCR, we have designed and chemically synthesized a mutant version of the 352-residue thermostable Sulfolobus solfataricus P2 DNA polymerase IV with l-amino acids and tested its PCR activity biochemically. To the best of our knowledge, this enzyme is the largest chemically synthesized protein reported to date. We show that with optimization of PCR conditions, the fully synthetic polymerase is capable of amplifying template sequences of up to 1.5 kb. The establishment of this synthetic route for chemically synthesizing DNA polymerase IV is a stepping stone towards building a d-enzyme system for mirror-image PCR, which may open up an avenue for the creation of many mirror-image molecular tools such as mirror-image systematic evolution of ligands by exponential enrichment.

  2. Total chemical synthesis of a thermostable enzyme capable of polymerase chain reaction

    PubMed Central

    Xu, Weiliang; Jiang, Wenjun; Wang, Jiaxing; Yu, Linping; Chen, Ji; Liu, Xianyu; Liu, Lei; Zhu, Ting F

    2017-01-01

    Polymerase chain reaction (PCR) has been a defining tool in modern biology. Towards realizing mirror-image PCR, we have designed and chemically synthesized a mutant version of the 352-residue thermostable Sulfolobus solfataricus P2 DNA polymerase IV with l-amino acids and tested its PCR activity biochemically. To the best of our knowledge, this enzyme is the largest chemically synthesized protein reported to date. We show that with optimization of PCR conditions, the fully synthetic polymerase is capable of amplifying template sequences of up to 1.5 kb. The establishment of this synthetic route for chemically synthesizing DNA polymerase IV is a stepping stone towards building a d-enzyme system for mirror-image PCR, which may open up an avenue for the creation of many mirror-image molecular tools such as mirror-image systematic evolution of ligands by exponential enrichment. PMID:28265464

  3. Detection of enteric viruses in oysters by using the polymerase chain reaction.

    PubMed Central

    Atmar, R L; Metcalf, T G; Neill, F H; Estes, M K

    1993-01-01

    A procedure for the detection of enteric viral nucleic acid in oysters by the polymerase chain reaction was developed. Known quantities of poliovirus type 1 were seeded into oysters. Virus was extracted and concentrated by using organic flocculation and polyethylene glycol precipitation. Inhibitors of reverse transcription-polymerase chain reaction were present in the oyster extracts, preventing amplification of target viral nucleic acid. The use of cetyltrimethylammonium bromide precipitation sufficiently removed inhibitors to allow detection of as few as 10 PFU of poliovirus. Norwalk virus also could be detected after being seeded into oysters. This methodology may be useful for the detection of these and other shellfish-borne viral pathogens. Images PMID:8382024

  4. Polymerase chain reaction with phase change as intrinsic thermal control

    NASA Astrophysics Data System (ADS)

    Hsieh, Yi-Fan; Yonezawa, Eri; Kuo, Long-Sheng; Yeh, Shiou-Hwei; Chen, Pei-Jer; Chen, Ping-Hei

    2013-04-01

    This research demonstrated that without any external temperature controller, the capillary convective polymerase chain reaction (ccPCR) powered by a candle can operate with the help of phase change. The candle ccPCR system productively amplified hepatitis B virus 122 base-pairs DNA fragment. The detection sensitivity can achieve at an initial DNA concentration to 5 copies per reaction. The results also show that the candle ccPCR system can operate functionally even the ambient temperature varies from 7 °C to 45 °C. These features imply that the candle ccPCR system can provide robust medical detection services.

  5. Absolute quantification of the alleles in somatic point mutations by bioluminometric methods based on competitive polymerase chain reaction in the presence of a locked nucleic acid blocker or an allele-specific primer.

    PubMed

    Iliadi, Alexandra; Petropoulou, Margarita; Ioannou, Penelope C; Christopoulos, Theodore K; Anagnostopoulos, Nikolaos I; Kanavakis, Emmanuel; Traeger-Synodinos, Jan

    2011-09-01

    In somatic (acquired) point mutations, the challenge is to quantify minute amounts of the mutant allele in the presence of a large excess of the normal allele that differs only in a single base pair. We report two bioluminometric methods that enable absolute quantification of the alleles. The first method exploits the ability of a locked nucleic acid (LNA) oligonucleotide to bind to and inhibit effectively the polymerase chain reaction (PCR) amplification of the normal allele while the amplification of the mutant allele remains unaffected. The second method employs allele-specific PCR primers, thereby allowing the amplification of the corresponding allele only. DNA internal standards (competitors) are added to the PCR mixture to compensate for any sample-to-sample variation in the amplification efficiency. The amplification products from the two alleles and the internal standards are quantified by a microtiter well-based bioluminometric hybridization assay using the photoprotein aequorin as a reporter. The methods allow absolute quantification of less than 300 copies of the mutant allele even in samples containing less than 1% of the mutant allele.

  6. Detection of Clostridium septicum hemolysin gene by polymerase chain reaction.

    PubMed

    Takeuchi, S; Hashizume, N; Kinoshita, T; Kaidoh, T; Tamura, Y

    1997-09-01

    A polymerase chain reaction (PCR) was developed for the detection of the hemolysin (alpha toxin) gene of Clostridium septicum. The PCR primers were designed from the sequence of the hemolysin gene and synthesized. A DNA fragment of 270 bp was amplified from 10 strains of C. septicum, but was not from strains of C. chauvoei, C. perfringens, C. novyi, or C. haemolyticum. When the PCR product was digested with Sau3AI, two DNA fragments of the expected 148 bp and 122 bp were recognized. The lowest detectable threshold of PCR for the hemolysin gene was 3.8 x 10(3) cells/ml. The PCR technique may be useful for rapid detection or identification of C. septicum associated with malignant edema.

  7. Universal CG cloning of polymerase chain reaction products.

    PubMed

    Stevenson, Julian; Brown, Andrew J

    2015-02-15

    Single-insert cloning of DNA fragments without restriction enzymes has traditionally been achieved using TA cloning, with annealing of a polymerase chain reaction (PCR) fragment containing a single overhanging 3' A to a plasmid vector containing a 3' T. In this article, we show that the analogous "CG cloning" is faster and far more efficient, using AhdI to generate a C-vector. For an afternoon ligation, CG cloning achieved double the cloning efficiency and more than 4-fold the number of transformants compared with TA cloning. However, blunt-end ligation was markedly more efficient than both. CG cloning could prove to be extremely useful for single-copy high-throughput cloning.

  8. Nested methylation-specific polymerase chain reaction cancer detection method

    DOEpatents

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  9. Detection of Mycoplasma pneumoniae by using the polymerase chain reaction.

    PubMed Central

    Bernet, C; Garret, M; de Barbeyrac, B; Bebear, C; Bonnet, J

    1989-01-01

    The polymerase chain reaction (PCR) technique was used to detect Mycoplasma pneumoniae. A specific DNA sequence for M. pneumoniae was selected from a genomic library, and two oligonucleotides were chosen in this sequence to give an amplified fragment of 144 base pairs. We show that DNA from different M. pneumoniae strains can be detected by PCR, with DNA from other Mycoplasma species giving negative results. Analysis of biological samples (throat swabs) obtained from hamsters that were experimentally infected with M. pneumoniae showed that PCR was more sensitive and reliable than conventional culture techniques for the detection of M. pneumoniae. Initial experiments on artificially seeded human bronchoalveolar lavages showed that PCR can be used to detect 10(2) to 10(3) organisms. Images PMID:2509513

  10. Polymerase chain reaction technology as analytical tool in agricultural biotechnology.

    PubMed

    Lipp, Markus; Shillito, Raymond; Giroux, Randal; Spiegelhalter, Frank; Charlton, Stacy; Pinero, David; Song, Ping

    2005-01-01

    The agricultural biotechnology industry applies polymerase chain reaction (PCR) technology at numerous points in product development. Commodity and food companies as well as third-party diagnostic testing companies also rely on PCR technology for a number of purposes. The primary use of the technology is to verify the presence or absence of genetically modified (GM) material in a product or to quantify the amount of GM material present in a product. This article describes the fundamental elements of PCR analysis and its application to the testing of grains. The document highlights the many areas to which attention must be paid in order to produce reliable test results. These include sample preparation, method validation, choice of appropriate reference materials, and biological and instrumental sources of error. The article also discusses issues related to the analysis of different matrixes and the effect they may have on the accuracy of the PCR analytical results.

  11. Toxoplasma polymerase chain reaction on experimental blood samples.

    PubMed

    Joss, A W; Chatterton, J M; Evans, R; Ho-Yen, D O

    1993-01-01

    A two-stage polymerase chain reaction (PCR) assay employing oligonucleotide primers from the B1 gene of Toxoplasma gondii was developed and assessed for sensitivity and specificity. It was able to detect T. gondii DNA from as little as one parasite/sample in mock-infected rat or mouse leucocyte preparations. Parasitaemia was also identified in animals at five stages between 16 and 66 h after infection with the virulent RH strain, and at 12 stages between 2 and 38 days after infection with the cyst-forming Beverley strain. In the latter case, PCR was more sensitive than animal culture. No cross-reactions were observed in samples containing various opportunist pathogens which may also be found in the blood of immunocompromised patients.

  12. Polymerase chain reaction: A molecular diagnostic tool in periodontology.

    PubMed

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease.

  13. Polymerase chain reaction: A molecular diagnostic tool in periodontology

    PubMed Central

    Maheaswari, Rajendran; Kshirsagar, Jaishree Tukaram; Lavanya, Nallasivam

    2016-01-01

    This review discusses the principles of polymerase chain reaction (PCR) and its application as a diagnostic tool in periodontology. The relevant MEDLINE and PubMed indexed journals were searched manually and electronically by typing PCR, applications of PCR, PCR in periodontics, polymorphism studies in periodontitis, and molecular techniques in periodontology. The searches were limited to articles in English language and the articles describing PCR process and its relation to periodontology were collected and used to prepare a concise review. PCR has now become a standard diagnostic and research tool in periodontology. Various studies reveal that its sensitivity and specificity allow it as a rapid, efficient method of detecting, identifying, and quantifying organism. Different immune and inflammatory markers can be identified at the mRNA expression level, and also the determination of genetic polymorphisms, thus providing the deeper insight into the mechanisms underlying the periodontal disease. PMID:27143822

  14. Convective polymerase chain reaction around micro immersion heater

    NASA Astrophysics Data System (ADS)

    Hennig, Martin; Braun, Dieter

    2005-10-01

    Polymerase chain reaction (PCR) is performed in the thermal convection created by a micro immersion heater. Instead of repetitive heating and cooling, the temperature gradient induces thermal convection which drives the reaction liquid between hot and cold parts of the chamber. The convection triggers DNA amplification as the DNA melts into two single strands in the hot region and replicates with the use of proteins into twice the amount in the cold region. The constant heater is simply dipped into the reaction solution. Compared to previous experiments, we demonstrate that convective PCR is possible in a robotically accessible open vessel. Our approach compares well with fast PCR cyclers and replicates DNA 500 000 fold within 20minutes. We reduce the necessary components for PCR to cheap, single-use components and therefore increasing the prospects of bringing PCR to point of care applications—even in third world countries.

  15. Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.

    PubMed

    Lorenz, Todd C

    2012-05-22

    In the biological sciences there have been technological advances that catapult the discipline into golden ages of discovery. For example, the field of microbiology was transformed with the advent of Anton van Leeuwenhoek's microscope, which allowed scientists to visualize prokaryotes for the first time. The development of the polymerase chain reaction (PCR) is one of those innovations that changed the course of molecular science with its impact spanning countless subdisciplines in biology. The theoretical process was outlined by Keppe and coworkers in 1971; however, it was another 14 years until the complete PCR procedure was described and experimentally applied by Kary Mullis while at Cetus Corporation in 1985. Automation and refinement of this technique progressed with the introduction of a thermal stable DNA polymerase from the bacterium Thermus aquaticus, consequently the name Taq DNA polymerase. PCR is a powerful amplification technique that can generate an ample supply of a specific segment of DNA (i.e., an amplicon) from only a small amount of starting material (i.e., DNA template or target sequence). While straightforward and generally trouble-free, there are pitfalls that complicate the reaction producing spurious results. When PCR fails it can lead to many non-specific DNA products of varying sizes that appear as a ladder or smear of bands on agarose gels. Sometimes no products form at all. Another potential problem occurs when mutations are unintentionally introduced in the amplicons, resulting in a heterogeneous population of PCR products. PCR failures can become frustrating unless patience and careful troubleshooting are employed to sort out and solve the problem(s). This protocol outlines the basic principles of PCR, provides a methodology that will result in amplification of most target sequences, and presents strategies for optimizing a reaction. By following this PCR guide, students should be able to: • Set up reactions and thermal cycling

  16. Rapid detection of waterborne viruses using the polymerase chain reaction and a gene probe.

    PubMed

    Jothikumar, N; Khanna, P; Kamatchiammal, S; Murugan, R P

    1992-01-01

    We describe a membrane-filter-based urea-arginine phosphate buffer method for concentrating waterborne viruses from large volumes of water to microlitre volumes, and their subsequent detection by the polymerase chain reaction (PCR). The detection step involves the extraction of RNA, synthesis of complementary DNA, amplification by PCR of target DNA with specific primers, and confirmation through nucleic acid hybridization with a radiolabelled oligonucleotide probe. The PCR technique detected the presence of enteroviruses in spiked as well as in contaminated water samples. The technique is sensitive and detects as few as 120 waterborne viral particles. PCR is simple, rapid, sensitive, specific and adaptable for water quality surveillance in less developed countries.

  17. Taylor dispersion in polymerase chain reaction in a microchannel

    NASA Astrophysics Data System (ADS)

    Lee, Jinkee; Kulla, Elejdis; Chauhan, Anuj; Tripathi, Anubhav

    2008-09-01

    Polymerase chain reaction (PCR) is commonly used for a wide range of DNA applications such as disease detection, genetic fingerprinting, and paternity testing. The importance of PCR has led to an increased interest in performing PCR in a microfluidic platform with a high throughput while using very small DNA quantities. In this paper we solve convection-diffusion equations for the DNA and deoxynucleoside triphosphate (dNTP) under conditions suitable for PCR operation in a microchip. These include pressure driven flow accompanied by temporal temperature changes that lead to an amplification reaction, which is modeled as a first order reaction. The convection-diffusion-reaction equations are solved by using the method of multiple time scales to yield average equations that can be solved to obtain the long time evolution of the concentration profiles. The results obtained by solving the averaged equations agree well with full numerical solutions. The averaged equations are also solved to simulate the PCR to illustrate some interesting aspects of this operation in a microfluidic device. It is shown that insufficient nucleotide concentrations can lead to complete depletion of NTP at certain axial locations, which leads to termination of DNA amplification at these locations, resulting in formation of a plateau in DNA concentration.

  18. Identifying of meat species using polymerase chain reaction (PCR)

    SciTech Connect

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-27

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  19. Integrated polymerase chain reaction chips utilizing digital microfluidics.

    PubMed

    Chang, Yi-Hsien; Lee, Gwo-Bin; Huang, Fu-Chun; Chen, Yi-Yu; Lin, Jr-Lung

    2006-09-01

    This study reports an integrated microfluidic chip for polymerase chain reaction (PCR) applications utilizing digital microfluidic chip (DMC) technology. Several crucial procedures including sample transportation, mixing, and DNA amplification were performed on the integrated chip using electro-wetting-on-dielectric (EWOD) effect. An innovative concept of hydrophobic/hydrophilic structure has been successfully demonstrated to integrate the DMC chip with the on-chip PCR device. Sample droplets were generated, transported and mixed by the EWOD-actuation. Then the mixture droplets were transported to a PCR chamber by utilizing the hydrophilic/hydrophobic interface to generate required surface tension gradient. A micro temperature sensor and two micro heaters inside the PCR chamber along with a controller were used to form a micro temperature control module, which could perform precise PCR thermal cycling for DNA amplification. In order to demonstrate the performance of the integrated DMC/PCR chips, a detection gene for Dengue II virus was successfully amplified and detected. The new integrated DMC/PCR chips only required an operation voltage of 12V(RMS) at a frequency of 3 KHz for digital microfluidic actuation and 9V(DC) for thermal cycling. When compared to its large-scale counterparts for DNA amplification, the developed system consumed less sample and reagent and could reduce the detection time. The developed chips successfully demonstrated the feasibility of Lab-On-a-Chip (LOC) by utilizing EWOD-based digital microfluidics.

  20. Nested polymerase chain reaction for early diagnosis of typhoid fever.

    PubMed

    Sultana, S; Hossain, M A; Alam, M A; Paul, S K; Mahmud, C; Kabir, M R; Haque, N; Yesmin, T; Kayes, M T; Maruf, A A; Kobayashi, N

    2012-01-01

    Typhoid fever, caused by Salmonella typhi, is an important cause of morbidity and mortality in many developing countries. A rapid and sensitive method for the detection of S. typhi is essential for early diagnosis. This was a study to prospectively evaluate the sensitivity and specificity of nested polymerase chain reaction (PCR) to identify the S. typhi using flagellin gene related primers. The study was carried out in the department of Microbiology, Mymensingh Medical College, Mymensingh between July, 2010 and June, 2011, including 82 individuals of different age and sex. Of them, 62 were clinically suspected cases of typhoid fever and remaining 20 were apparently healthy controls. Cultures as well as PCR of blood specimens were performed for each of the cases. Among the 62 suspected typhoid fever cases, 8(12.9%) were blood culture positive and 55(88.7%) were PCR positive for S. typhi. All culture positive cases were positive by PCR and among 54 culture negative cases, 47(87%) were positive by PCR. Neither of the healthy controls was positive by PCR or blood culture. The sensitivity, specificity, positive predictive value and negative predictive value of PCR using blood culture as gold standard were 88.7%, 100%, 100% and 74% respectively for typhoid fever. In this study, the PCR appears highly specific, very sensitive and superior to blood culture for the early diagnosis of typhoid fever.

  1. Multifunctional polyurethane sponge for polymerase chain reaction enhancement.

    PubMed

    Seok, Seunghwan; Shin, Sujeong; Lee, Tae Jae; Jeong, Jae-Min; Yang, MinHo; Kim, Do Hyun; Park, Jung Youn; Lee, Seok Jae; Choi, Bong Gill; Lee, Kyoung G

    2015-03-04

    Selective filtering of target biomaterials from impurities is an important task in DNA amplification through polymerase chain reaction (PCR) enhancement and gene identification to save endangered animals and marine species. Conventional gene extraction methods require complicated steps, skilled persons, and expensive chemicals and instruments to improve DNA amplification. Herein, we proposed an alternative method for overcoming such challenges by imparting secondary functionality using commercially available polyurethane (PU) sponges and cost-effective fabrication approaches through polydopamine and polysiloxane coatings. The porous, highly flexible, and chemically modified superhydrophilic and superhydrophobic PU sponges allow large surface areas and mechanically stable frames for effective extraction of genomic DNA through selective filtering of fish tissues and oils. Furthermore, these chemically modified PU sponges allow separation of genes and improvement of PCR for DNA amplification for the identification of fish species. The combination of a simple fabrication method and functionalized PU sponges could be a useful platform for PCR enhancement and gene-based identification of species for practical applications.

  2. Diagnosis of duck plague in waterfowl by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Nashold, S.W.; Docherty, D.E.; Brown, S.E.; Knudson, D.L.

    2000-01-01

    A recently developed polymerase chain reaction (PCR) assay was used for diagnosis of duck plague in waterfowl tissues from past and current cases of waterfowl mortality and to identify duck plague virus in combined cloacal/oral-pharyngeal swab samples from healthy mallards (Anas platyrhynchos) after a disease outbreak. The PCR was able to detect viral DNA from all the individual or pooled tissues assayed from 10 waterfowl, including liver and spleen samples from three Muscovy ducks (Cairina moschata domesticus) that did not yield virus isolates. The strong staining intensity of the PCR products from the waterfowl tissues indicated that large amounts of virus were present, even when virus was not isolated. Duck plague DNA was also detected in a cloacal swab sample from a wood duck (Aix sponsa) carcass submitted for diagnosis. The PCR assay identified duck plague DNA in 13 swab samples that produced virus isolates from carrier mallards sampled in 1981 after a duck plague die-off. The duck plague PCR clearly demonstrated the ability to quickly diagnose duck plague in suspect mortality cases and to detect virus shed by carrier waterfowl.

  3. Buoyancy-Driven Polymerase Chain Reaction (PCR) Devices

    SciTech Connect

    Ness, K D; Wheeler, E K; Benett, W; Stratton, P; Christian, A; Chen, A; Ortega, J; Weisgraber, T H; Goodson, K E

    2004-09-28

    Polymerase chain reaction (PCR) facilitates DNA detection by significantly increasing the concentration of specific DNA segments. A new class of PCR instruments uses a buoyancy-driven re-circulating flow to thermally cycle the DNA sample and benefits from reduced cycle times, low sample volumes, a miniaturized format, and low power consumption. This paper analyzes a specific buoyancy PCR device in a micro-channel ''race-track'' geometry to determine key parameters about PCR cycle times and other figures of merit as functions of device dimensions. The 1-D model balances the buoyancy driving force with frictional losses. A hydrostatic pressure imbalance concept is used between the left and right sides of the fluid loop to calculate the buoyancy driving force. Velocity and temperature distributions within the channels are determined from two-dimensional analysis of the channel section, with developing region effects included empirically through scaled values of the local Nusselt number. Good agreement between four independent verification steps validate the 1-D simulation approach: (1) analytical expressions for the thermal entrance length are compared against, (2) comparison with a full 3-D finite element simulation, (3) comparison with an experimental flow field characterization, and (4) calculation of the minimum PCR runtime required to get a positive PCR signal from the buoyancy-driven PCR device. The 1-D approach closely models an actual buoyancy-driven PCR device and can further be used as a rapid design tool to simulate buoyancy PCR flows and perform detailed design optimizations studies.

  4. Fluorescence-based temperature control for polymerase chain reaction.

    PubMed

    Sanford, Lindsay N; Wittwer, Carl T

    2014-03-01

    The ability to accurately monitor solution temperature is important for the polymerase chain reaction (PCR). Robust amplification during PCR is contingent on the solution reaching denaturation and annealing temperatures. By correlating temperature to the fluorescence of a passive dye, noninvasive monitoring of solution temperatures is possible. The temperature sensitivity of 22 fluorescent dyes was assessed. Emission spectra were monitored and the change in fluorescence between 45 and 95°C was quantified. Seven dyes decreased in intensity as the temperature increased, and 15 were variable depending on the excitation wavelength. Sulforhodamine B (monosodium salt) exhibited a fold change in fluorescence of 2.85. Faster PCR minimizes cycling times and improves turnaround time, throughput, and specificity. If temperature measurements are accurate, no holding period is required even at rapid speeds. A custom instrument using fluorescence-based temperature monitoring with dynamic feedback control for temperature cycling amplified a fragment surrounding rs917118 from genomic DNA in 3min and 45s using 35 cycles, allowing subsequent genotyping by high-resolution melting analysis. Gold-standard thermocouple readings and fluorescence-based temperature differences were 0.29±0.17 and 0.96±0.26°C at annealing and denaturation, respectively. This new method for temperature cycling may allow faster speeds for PCR than currently considered possible.

  5. Identifying of meat species using polymerase chain reaction (PCR)

    NASA Astrophysics Data System (ADS)

    Foong, Chow Ming; Sani, Norrakiah Abdullah

    2013-11-01

    Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.

  6. Role of multiplex polymerase chain reaction in diagnosing tubercular meningitis

    PubMed Central

    Berwal, Anupam; Chawla, Kiran; Vishwanath, Shashidhar; Shenoy, Vishnu Prasad

    2017-01-01

    Tuberculous meningitis (TBM) is one of the most serious manifestations of extrapulmonary tuberculosis. Timely and accurate diagnosis provides a favorable prognosis in patients with TBM. The study evaluated the use of multiplex polymerase chain reaction (PCR) in the diagnosis of TBM. A study was conducted on 74 patients clinically suspected with TBM. The cerebrospinal fluid (CSF) specimens were processed for smear microscopy, middle brook 7H9 culture, and multiplex PCR using primers directed against IS6110 gene and 38 kD protein for detection of Mycobacterium tuberculosis. The results were analyzed to assess the role of multiplex PCR in the diagnosis of TBM. A total of 26 (35.1%) patients were diagnosed with TBM. Microscopy was negative in all while culture was positive in two cases only. Comparing with clinical diagnosis and CSF adenosine deaminase levels of ≥10 U/L, multiplex PCR showed sensitivity, specificity, positive predictive value, and negative predictive value of 71.4%, 89.6%, 83.3%, and 81.2%, respectively, in the diagnosis of TBM. PMID:28367034

  7. Detection of Penicillium expansum by polymerase chain reaction.

    PubMed

    Marek, Patrick; Annamalai, Thirunavukkarasu; Venkitanarayanan, Kumar

    2003-12-31

    Penicillium expansum is a major causative agent of postharvest decay in a variety of fruits, including apples, peaches, nectarines, and cherries. It causes significant economic losses to the fruit industry and is also of potential public health significance, since it produces patulin, a mycotoxin known to cause harmful effects in animals. Rapid and specific detection of P. expansum is important for ensuring microbiological quality and safety of fruits and fruit juices. The traditional methods for identification of P. expansum are time-consuming and labor-intensive. In this study, we report a polymerase chain reaction utilizing primers based on the polygalacturonase gene of P. expansum. The PCR amplified a 404-bp DNA product from all the P. expansum isolates tested, but not in other common foodborne Penicillium species and Escherichia coli. Experiments to determine the sensitivity of the PCR indicated that it can detect the DNA equivalent from as low as 25 spores of P. expansum. The PCR could potentially be used as a rapid tool for screening fruits for the presence of P. expansum.

  8. Monitoring infection: from blood culture to polymerase chain reaction (PCR).

    PubMed

    Book, Malte; Lehmann, Lutz Eric; Zhang, XiangHong; Stüber, Frank

    2013-06-01

    In patients with sepsis, diagnosis of blood stream infection (BSI) is a key concern to the therapist. Direct verification of pathogens in the blood stream executed by blood cultures (BC) still is regarded as the gold standard up to date. The quickest possible initiation of an appropriate antimicrobial therapy is a cornerstone of an effective therapy. Moreover, in this view BC can also serve to identify antimicrobial agents to target the pathogen. However, when employing BC the time needed until microbiological results are available ranges from 24 up to 72 h. Moreover, infections caused by multiple pathogens often remain undetected and concurrent antibiotic therapy may lower the overall sensitivity. Alternative pathogen characterization can be performed by polymerase chain reaction (PCR) based amplification methods. Results using PCR can be obtained within 6-8 h. Therefore, the time delay until an appropriate therapy can be reduced enormously. Moreover, these methods have the potential to enhance the sensitivity in the diagnosis of blood stream infections. Therefore, PCR based methods might be a valuable adjunct to present procedures of diagnosing bacteraemia.

  9. Polymerase chain reaction based detection of fungi in infected corneas

    PubMed Central

    Gaudio, P A; Gopinathan, U; Sangwan, V; Hughes, T E

    2002-01-01

    Aims: To evaluate a polymerase chain reaction (PCR) based assay to detect fungi in scrapings from infected corneas. Methods: A PCR assay was developed to amplify a portion of the fungal 18S ribosome gene. Corneal scrapings from 30 patients with presumed infectious keratitis were evaluated using this assay, as well as by standard microbiological techniques, and the results were compared. Conjunctival swabs from each patient's healthy, fellow eye were also evaluated by PCR. Results: PCR and fungal culture results matched (were both positive or both negative for fungi) in 22 (74%) of 30 scrapings from infected corneas. Three (10%) of 30 samples were PCR positive but fungal culture negative; two of these appeared clinically to represent fungal infections, and the third was clinically indeterminate. Four (13%) scrapings were positive by PCR but also by bacterial and not fungal culture. One specimen (3%) was PCR negative but fungal culture positive. Of the conjunctival swabs from each patient's healthy fellow eye, five (17%) of 30 were positive by PCR, and the opposite, infected eye of all five of these harboured a fungal infection. Conclusions: PCR is promising as a means to diagnose fungal keratitis and offers some advantages over culture methods, including rapid analysis and the ability to analyse specimens far from where they are collected. PMID:12084744

  10. Accuracy and Significance of Polymerase Chain Reaction Detection of Sentinel Node Metastases in Breast Cancer Patients

    DTIC Science & Technology

    2000-10-01

    specific reverse-transcriptase polymerase chain reaction markers in the detection of metastases in the lymph nodes... chain reaction detection of cytokeratin-19 mRNA in bone marrow and blood of breast cancer patients. J Cancer Res Clin Oncol 1996; 122: 679-86. (43...directly drain a tumor and are most likely to harbor occult cells . Reverse transcriptase- polymerase chain reaction (RT-PCR) is a sensitive

  11. A diagnostic polymerase chain reaction assay for Zika virus.

    PubMed

    Balm, Michelle N D; Lee, Chun Kiat; Lee, Hong Kai; Chiu, Lily; Koay, Evelyn S C; Tang, Julian W

    2012-09-01

    Zika virus (ZIKV) is a mosquito-borne flavivirus. Infection results in a dengue-like illness with fever, headache, malaise, and a maculopapular rash. Nearly all cases are mild and self-limiting but in 2007, a large outbreak of ZIKV was reported from the island of Yap (in Micronesia, northwest of Indonesia). Singapore is already endemic for dengue, and its impact on public health and economic burden is significant. Other dengue-like infections (e.g., Chikungunya virus) are present. Yet only 10% of reported dengue cases have laboratory confirmation. The identification and control of other dengue-like, mosquito-transmitted infections is thus important for the health of Singapore's population, as well as its economy. Given that ZIKV shares the same Aedes mosquito vector with both dengue and Chikungunya, it is possible that this virus is present in Singapore and causing some of the mild dengue-like illness. A specific and sensitive one-step, reverse transcription polymerase chain reaction (RT-PCR) with an internal control (IC) was designed and tested on 88 archived samples of dengue-negative, Chikungunya-negative sera from patients presenting to our hospital with a dengue-like illness, to determine the presence of ZIKV in Singapore. The assay was specific for detection of ZIKV and displayed a lower limit of detection (LoD) of 140 copies viral RNA/reaction when tested on synthetic RNA standards prepared using pooled negative patient plasma. Of the 88 samples tested, none were positive for ZIKV RNA, however, the vast majority of these were from patients admitted to hospital and further study may be warranted in community-based environments.

  12. Detection of Aspergillus fumigatus by polymerase chain reaction.

    PubMed Central

    Spreadbury, C; Holden, D; Aufauvre-Brown, A; Bainbridge, B; Cohen, J

    1993-01-01

    Aspergillus fumigatus is an opportunistic nosocomial pathogen causing an often fatal pneumonia, invasive aspergillosis (IA), in immunosuppressed patients. Oligonucleotide primers were used to amplify a 401-bp fragment spanning the 26S/intergenic spacer region of the rDNA complex of A. fumigatus by the polymerase chain reaction (PCR). The primers were highly sensitive and specific: as little as 1 pg of A. fumigatus genomic DNA could be detected, and the primers only amplified DNA from A. fumigatus and not any other fungal, bacterial, viral, or human DNA tested. Using the PCR, we were able to detect A. fumigatus DNA in lung homogenates from immunosuppressed mice experimentally infected with A. fumigatus but not from immunosuppressed uninfected controls. There was 93% correlation between the culture results and the PCR results. In a retrospective clinical study, the sensitivity of the PCR for the detection of A. fumigatus in clinical samples was confirmed by positive amplification in three of three culture-positive respiratory samples from confirmed cases of IA. Because isolation of Aspergillus spp. may reflect contamination and colonization without infection, the feasibility of using the PCR was evaluated by analyzing culture-negative samples from both immunosuppressed patients at high risk for IA and immunocompetent patients with other lung infections. Only 2 of 10 patients were culture negative and PCR positive in the high-risk group, and 2 of 7 patients were culture negative and PCR positive in the immunocompetent group. The results indicate that PCR detection might be a valuable adjunct to current laboratory methods to diagnose IA. Images PMID:8458955

  13. A circular ferrofluid driven microchip for rapid polymerase chain reaction.

    PubMed

    Sun, Y; Kwok, Y C; Nguyen, N T

    2007-08-01

    In the past few years, much attention has been paid to the development of miniaturized polymerase chain reaction (PCR) devices. After a continuous flow (CF) PCR chip was introduced, several CFPCR systems employing various pumping mechanisms were reported. However, the use of pumps increases cost and imposes a high requirement on microchip bonding integrity due to the application of high pressure. Other significant limitations of CFPCR devices include the large footprint of the microchip and the fixed cycle number which is dictated by the channel layout. In this paper, we present a novel circular close-loop ferrofluid driven microchip for rapid PCR. A small ferrofluid plug, containing sub-domain magnetic particles in a liquid carrier, is driven by an external magnet along the circular microchannel, which in turn propels the PCR mixture through three temperature zones. Amplification of a 500 bp lambda DNA fragment has been demonstrated on the polymethyl methacrylate (PMMA) PCR microchip fabricated by CO(2) laser ablation and bonded by a low pressure, high temperature technique. Successful PCR was achieved in less than 4 min. Effects of cycle number and cycle time on PCR products were investigated. Using a magnet as the actuator eliminates the need for expensive pumps and provides advantages of low cost, small power consumption, low requirement on bonding strength and flexible number of PCR cycles. Furthermore, the microchip has a much simpler design and smaller footprint compared to the rectangular serpentine CFPCR devices. To demonstrate its application in forensics, a 16-loci short tandem repeat (STR) sample was successfully amplified using the PCR microchip.

  14. Detection of Listeria monocytogenes with a nonisotopic polymerase chain reaction-coupled ligase chain reaction assay.

    PubMed Central

    Wiedmann, M; Barany, F; Batt, C A

    1993-01-01

    A polymerase chain reaction (PCR)-coupled ligase chain reaction (LCR) assay for the specific detection of Listeria monocytogenes (M. Wiedmann, J. Czajka, F. Barany, and C. A. Batt, Appl. Environ. Microbiol. 58:3443-3447, 1992) has been modified for detection of the LCR products with a nonisotopic readout. When a chemiluminescent or a colorimetric substrate for the nonisotopic detection of the LCR products was used, the PCR-coupled LCR gave a sensitivity of 10 CFU of L. monocytogenes. The detection method with the chemiluminescent substrate Lumi-Phos 530 permitted detection of the LCR products in less than 3 h, so that the whole assay can be completed within 10 h. Images PMID:8368859

  15. Identification of duck plague virus by polymerase chain reaction

    USGS Publications Warehouse

    Hansen, W.R.; Brown, Sean E.; Nashold, S.W.; Knudson, D.L.

    1999-01-01

    A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3a?? ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primer sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague. /// Se desarroll?? una prueba de reacci??n en cadena por la polimerasa para detectar el virus de la peste del pato. Un fragmento EcoRI de 765 pares de bases clonado del genoma del virus vacunal de la peste del pato fue secuenciado para la obtenci??n de los iniciadores de la prueba de la reacci??n en cadena por la polimerasa. En investigaciones de alineaci??n en el banco de genes ('GenBank') se encontr?? que la secuencia del fragmento era similar a los extremos 3a?? de un marco de lectura abierto

  16. Evaluation of Microbial Diversity in Wetland through Polymerase Chain Reaction (PCR) and Restriction Fragment Length Polymorphism (RFLP)

    DTIC Science & Technology

    2006-06-01

    MICROBIAL DIVERSITY IN WETLANDS THROUGH POLYMERASE CHAIN REACTION ( PCR ) AND RESTRICTION FRAGMENT LENGTH POLYMORPHISM ( RFLP ) THESIS Presented to the...MICROBIAL DIVERSITY IN WETLANDS THROUGH POLYMERASE CHAIN REACTION ( PCR ) AND RESTRICTION FRAGMENT LENGTH POLYMORPHISM ( RFLP ) Gregory K. Joseph, B.A...AFIT/GES/ENV/06J-02 EVALUATION OF MICROBIAL DIVERSITY IN WETLANDS THROUGH POLYMERASE CHAIN REACTION ( PCR ) AND RESTRICTION FRAGMENT LENGTH

  17. Humic substances cause fluorescence inhibition in real-time polymerase chain reaction.

    PubMed

    Sidstedt, Maja; Jansson, Linda; Nilsson, Elin; Noppa, Laila; Forsman, Mats; Rådström, Peter; Hedman, Johannes

    2015-10-15

    Real-time polymerase chain reaction (qPCR) is the cornerstone of DNA analysis, enabling detection and quantification of minute nucleic acid amounts. However, PCR-based analysis is limited, in part, by the presence of inhibitors in the samples. PCR inhibition has been viewed solely as failure to efficiently generate amplicons, that is, amplification inhibition. Humic substances (HS) are well-known inhibitors of PCR amplification. Here we show that HS from environmental samples, specifically humic acid (HA), are very potent detection inhibitors, that is, quench the fluorescence signal of double-stranded DNA (dsDNA) binding dyes. HA quenched the fluorescence of the commonly used qPCR dyes EvaGreen, ResoLight, SYBR Green I, and SYTO 82, generating lowered amplification plots, although amplicon production was unaffected. For EvaGreen, 500 ng of HA quenched nearly all fluorescence, whereas 1000 ng of HA completely inhibited amplification when applying Immolase DNA polymerase with bovine serum albumin (BSA). Fluorescence spectroscopy measurements showed that HA quenching was either static or collisional and indicated that HA bound directly to the dye. Fulvic acid did not act as a qPCR detection inhibitor but inhibited amplification similarly to HA. Hydrolysis probe fluorescence was not quenched by HA. Detection inhibition is an overlooked phenomenon that needs to be considered to allow for development of optimal qPCR assays.

  18. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting

    USGS Publications Warehouse

    Purcell, Maureen K.; Getchell, Rodman G.; McClure, Carol A.; Weber, S.E.; Garver, Kyle A.

    2011-01-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  19. Polymerase chain reaction-based assays for the diagnosis of human brucellosis.

    PubMed

    Wang, Ying; Wang, Zhanli; Zhang, Yaxian; Bai, Liyun; Zhao, Yue; Liu, Chunfang; Ma, An; Yu, Hui

    2014-08-01

    Polymerase chain reaction (PCR) is an in vitro technique for the nucleic acid amplification, which is commonly used to diagnose infectious diseases. The use of PCR for pathogens detection, genotyping and quantification has some advantages, such as high sensitivity, high specificity, reproducibility and technical ease. Brucellosis is a common zoonosis caused by Brucella spp., which still remains as a major health problem in many developing countries around the world. The direct culture and immunohistochemistry can be used for detecting infection with Brucella spp. However, PCR has the potential to address limitations of these methods. PCR are now one of the most useful assays for the diagnosis in human brucellosis. The aim of this review was to summarize the main PCR techniques and their applications for diagnosis and follow-up of patients with brucellosis. Moreover, advantages or limitation of the different PCR methods as well as the evaluation of PCR results for treatment and follow-up of human brucellosis were also discussed.

  20. Quantitative polymerase chain reaction (PCR) for detection of aquatic animal pathogens in a diagnostic laboratory setting.

    PubMed

    Purcell, Maureen K; Getchell, Rodman G; McClure, Carol A; Garver, Kyle A

    2011-09-01

    Real-time, or quantitative, polymerase chain reaction (qPCR) is quickly supplanting other molecular methods for detecting the nucleic acids of human and other animal pathogens owing to the speed and robustness of the technology. As the aquatic animal health community moves toward implementing national diagnostic testing schemes, it will need to evaluate how qPCR technology should be employed. This review outlines the basic principles of qPCR technology, considerations for assay development, standards and controls, assay performance, diagnostic validation, implementation in the diagnostic laboratory, and quality assurance and control measures. These factors are fundamental for ensuring the validity of qPCR assay results obtained in the diagnostic laboratory setting.

  1. Extended kinetic model of real-time polymerase chain reaction process

    NASA Astrophysics Data System (ADS)

    Fedorov, A. A.; Sochivko, D. G.; Varlamov, D. A.; Kurochkin, V. E.

    2016-11-01

    Real-time polymerase chain reaction (real-time PCR) is the main molecular genetic method used for qualitative and quantitative analysis of specific nucleic acid sequences in many areas of biomedical research. Theoretical study of pCr models allows to estimate the influence of various reaction components and parameters, and to determine the unknown parameter values by approximating the experimental real-time PCR curves. An extended kinetic model of real-time PCR is presented. The model takes into account the enzyme activity based on Michaelis-Menten kinetics, the hybridization of complementary DNA fragments, the presence of a fluorescent probe used for detection of the reaction products, and the temperature dependence of primers and probe hybridization.

  2. The origin and early evolution of nucleic acid polymerases

    NASA Technical Reports Server (NTRS)

    Lazcano, A.; Cappello, R.; Valverde, V.; Llaca, V.; Oro, J.

    1992-01-01

    The hypothesis that vestiges of the ancestral RNA-dependent RNA polymerase involved in the replication of RNA genomes of Archean cells are present in the eubacterial RNA-polymerase beta-prime subunit and its homologues is discussed. It is shown that, in the DNA-dependent RNA polymerases from three cellular lineages, a very conserved sequence of eight amino acids, also found in a small RNA-binding site previously described for the E. coli polynucleotide phosphorylase and the S1 ribosomal protein, is present. The optimal conditions for the replicase activity of the avian-myeloblastosis-virus reverse transcriptase are presented. The evolutionary significance of the in vitro modifications of substrate and template specificities of RNA polymerases and reverse transcriptases is discussed.

  3. The origin and early evolution of nucleic acid polymerases

    NASA Astrophysics Data System (ADS)

    Lazcano, A.; Llaca, V.; Cappello, R.; Valverde, V.; Oro, J.

    The hypothesis that vestiges of the ancestral RNA-dependent RNA polymerase involved in the replication of RNA genomes of Archean cells are present in the cubacterial RNA polymerase β' subunit and its homologues is discussed. We show that in the DNA-dependent RNA polymerases from the three cellular lineages a very conserved sequence of eight amino acids also found in a small RNA-binding site previously described for the E. coli polynucleotide phosphorylase and the S1 ribosomal protein is present. The optimal conditions for the replicase activity of the avian myeloblastosis virus reverse transcriptase are presented. The evolutionary significance of the in vitro modifications of substrate and template specificities of RNA polymerases and reverse transcriptases is also discussed.

  4. Copy number ratios determined by two digital polymerase chain reaction systems in genetically modified grains

    NASA Astrophysics Data System (ADS)

    Pérez Urquiza, M.; Acatzi Silva, A. I.

    2014-02-01

    Three certified reference materials produced from powdered seeds to measure the copy number ratio sequences of p35S/hmgA in maize containing MON 810 event, p35S/Le1 in soybeans containing GTS 40-3-2 event and DREB1A/acc1 in wheat were produced according to the ISO Guides 34 and 35. In this paper, we report digital polymerase chain reaction (dPCR) protocols, performance parameters and results of copy number ratio content of genetically modified organisms (GMOs) in these materials using two new dPCR systems to detect and quantify molecular deoxyribonucleic acid: the BioMark® (Fluidigm) and the OpenArray® (Life Technologies) systems. These technologies were implemented at the National Institute of Metrology in Mexico (CENAM) and in the Reference Center for GMO Detection from the Ministry of Agriculture (CNRDOGM), respectively. The main advantage of this technique against the more-used quantitative polymerase chain reaction (qPCR) is that it generates an absolute number of target molecules in the sample, without reference to standards or an endogenous control, which is very useful when not much information is available for new developments or there are no standard reference materials in the market as in the wheat case presented, or when it was not possible to test the purity of seeds as in the maize case presented here. Both systems reported enhanced productivity, increased reliability and reduced instrument footprint. In this paper, the performance parameters and uncertainty of measurement obtained with both systems are presented and compared.

  5. Random Mutagenesis by Error-Prone Polymerase Chain Reaction Using a Heavy Water Solvent.

    PubMed

    Minamoto, Toshifumi

    2017-01-01

    Heavy water is a form of water that contains a heavier isotope of hydrogen ((2)H, also known as deuterium, D) or oxygen ((17)O or (18)O). When using heavy water as a solvent, error-prone polymerase chain reaction (epPCR) can induce random mutations independent of the polymerase used or the composition of the PCR reaction mixture. This relatively new method can easily be combined with the existing epPCR methods to increase the rate of mutations.

  6. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics.

    PubMed

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-20

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  7. Solar thermal polymerase chain reaction for smartphone-assisted molecular diagnostics

    NASA Astrophysics Data System (ADS)

    Jiang, Li; Mancuso, Matthew; Lu, Zhengda; Akar, Gunkut; Cesarman, Ethel; Erickson, David

    2014-02-01

    Nucleic acid-based diagnostic techniques such as polymerase chain reaction (PCR) are used extensively in medical diagnostics due to their high sensitivity, specificity and quantification capability. In settings with limited infrastructure and unreliable electricity, however, access to such devices is often limited due to the highly specialized and energy-intensive nature of the thermal cycling process required for nucleic acid amplification. Here we integrate solar heating with microfluidics to eliminate thermal cycling power requirements as well as create a simple device infrastructure for PCR. Tests are completed in less than 30 min, and power consumption is reduced to 80 mW, enabling a standard 5.5 Wh iPhone battery to provide 70 h of power to this system. Additionally, we demonstrate a complete sample-to-answer diagnostic strategy by analyzing human skin biopsies infected with Kaposi's Sarcoma herpesvirus (KSHV/HHV-8) through the combination of solar thermal PCR, HotSHOT DNA extraction and smartphone-based fluorescence detection. We believe that exploiting the ubiquity of solar thermal energy as demonstrated here could facilitate broad availability of nucleic acid-based diagnostics in resource-limited areas.

  8. A colorimetric assay for inorganic pyrophosphate that is also useful for measuring product accumulation in polymerase chain reactions.

    PubMed

    Tagiri-Endo, Misako

    2003-04-15

    A novel coupled enzyme assay for measuring inorganic pyrophosphate (PP(i)) in biological samples is described. The total PP(i) is determined by a reaction with inosine 5'-monophosphate, catalyzed by hypoxanthine-guanine phosphoribosyl transferase, yielding hypoxanthine and phosphoribosyl pyrophosphate. The hypoxanthine is oxidized to uric acid by xanthine oxidase/xanthine dehydrogenase and can be measured by formation of formazan when a tetrazolium salt is used as the oxidant. The method is also useful for detecting and quantifying PP(i) released from nucleotides during polymerase chain reactions. This rapid and simple method for detecting amplified nucleic acids permits low-cost monitoring by eye or spectrophotometer.

  9. Methyl mercury stimulates chain elongation by purified HeLa RNA polymerase II.

    PubMed

    Frenkel, G D; Ducote, J

    1988-11-01

    Methyl mercury (MeHg) inhibited the overall RNA synthetic reaction of HeLa RNA polymerase II. However, when RNA chain initiation was allowed to occur in its absence, MeHg stimulated the rate of the subsequent elongation stage of the reaction. Chain elongation with both double-stranded and single-stranded DNA templates was stimulated. This stimulatory effect was specific for MeHg; both p-hydroxymercuribenzoate and HgCl2 inhibited chain elongation (to about the same degree as they inhibited the overall reaction). The stimulatory effect was also specific for the HeLa polymerase; with Escherichia coli RNA polymerase, MeHg inhibited elongation (to the same degree as it inhibited the overall reaction).

  10. Prenatal detection of trisomy 21 and 18 from amniotic fluid by quantitative fluorescent polymerase chain reaction.

    PubMed Central

    Tóth, T; Findlay, I; Papp, C; Tóth-Pál, E; Marton, T; Nagy, B; Quirke, P; Papp, Z

    1998-01-01

    Prenatal diagnosis of fetal trisomies is usually performed by cytogenetic analysis on amniotic fluid. This requires lengthy laboratory procedures and high costs, and is unsuitable for large scale screening of pregnant women. An alternative method, which is both rapid and inexpensive and suitable for diagnosing trisomies even from single fetal cells, is the fluorescent polymerase chain reaction using polymorphic small tandem repeats (STRs). In this paper we present the preliminary results of a larger study comparing parallel prenatal diagnoses of trisomies 21 and 18 using cytogenetics with quantitative fluorescent polymerase chain reaction using STR markers. The results obtained by the two techniques were concordant in all cases. This is the first study reporting significant numbers of prenatal diagnoses using the quantitative fluorescent polymerase chain reaction. We believe that further studies on greater numbers of samples will determine the absolute reliability of this technique. These results also provide a model for diagnosis of trisomy from single fetal cells isolated from maternal blood. PMID:9507392

  11. Coamplification at lower denaturation temperature polymerase chain reaction enables selective identification of K-Ras mutations in formalin-fixed, paraffin-embedded tumor tissues without tumor-cell enrichment.

    PubMed

    Yu, Shaorong; Xie, Li; Hou, Zhibo; Qian, Xiaoping; Yu, Lixia; Wei, Jia; Ding, Yitao; Liu, Baorui

    2011-09-01

    Conventional polymerase chain reaction-based Sanger sequencing is the standard assay for the detection of K-Ras mutations. However, this method is deficient in identifying small numbers of mutation-bearing cells, and tumor-cell enrichment methods such as microdissection or macrodissection are labor intensive and not always achievable. We applied the recently described coamplification at lower denaturation temperature polymerase chain reaction, which amplifies minority alleles selectively, to detect K-Ras mutations directly in 29 formalin-fixed, paraffin-embedded pancreatic specimens and compared the results with those of conventional polymerase chain reaction. To avoid a false-negative result from the coamplification at lower denaturation temperature polymerase chain reaction assay, we applied a more sensitive peptide nucleic acid polymerase chain reaction method as the gold standard. Dilution experiments indicated an approximately 5-fold improvement in sensitivity with coamplification at lower denaturation temperature polymerase chain reaction-based Sanger sequencing. Conventional polymerase chain reaction detected K-Ras mutations in 11 formalin-fixed, paraffin-embedded pancreatic specimens (37.9%), whereas coamplification at lower denaturation temperature polymerase chain reaction could identify all of those mutations as well as mutations in 10 additional samples, for a total of 21 (72.4%, P = .002) of 29. Unlike peptide nucleic acid polymerase chain reaction, coamplification at lower denaturation temperature polymerase chain reaction identified all K-Ras mutations in specimens in which tumor cells accounted for at least 20% of the total. Adoption of coamplification at lower denaturation temperature polymerase chain reaction is straightforward and requires no additional reagents or instruments. The technique is a good strategy to detect K-Ras mutations selectively in formalin-fixed, paraffin-embedded tissues without tumor-cell enrichment.

  12. Analysis of liver connexin expression using reverse transcription quantitative real-time polymerase chain reaction

    PubMed Central

    Maes, Michaël; Willebrords, Joost; Crespo Yanguas, Sara; Cogliati, Bruno; Vinken, Mathieu

    2016-01-01

    Summary Although connexin production is mainly regulated at the protein level, altered connexin gene expression has been identified as the underlying mechanism of several pathologies. When studying the latter, appropriate methods to quantify connexin mRNA levels are required. The present chapter describes a well-established reverse transcription quantitative real-time polymerase chain reaction procedure optimized for analysis of hepatic connexins. The method includes RNA extraction and subsequent quantification, generation of complementary DNA, quantitative real-time polymerase chain reaction and data analysis. PMID:27207283

  13. Polymerase Chain Reaction/Rapid Methods Are Gaining a Foothold in Developing Countries.

    PubMed

    Ragheb, Suzan Mohammed; Jimenez, Luis

    Detection of microbial contamination in pharmaceutical raw materials and finished products is a critical factor to guarantee their safety, stability, and potency. Rapid microbiological methods-such as polymerase chain reaction-have been widely applied to clinical and food quality control analysis. However, polymerase chain reaction applications to pharmaceutical quality control have been rather slow and sporadic. Successful implementation of these methods in pharmaceutical companies in developing countries requires important considerations to provide sensitive and robust assays that will comply with good manufacturing practices.

  14. A specific oligonucleotide primer for the rapid detection of Lactobacillus lindneri by polymerase chain reaction.

    PubMed

    Yasui, T; Okamoto, T; Taguchi, H

    1997-02-01

    A polymerase chain reaction (PCR) method was developed for the rapid detection of the beer-spoilage heterofermentative lactic acid bacterium Lactobacillus lindneri. Three strains, the Chinese brewery isolate DA1, the Japanese commercial beer isolate BG2, and the Japanese brewery isolate SE3, which were serologically classified as belonging to L. lindneri, were used in this study. After sequencing the 16S rDNA of the isolates DA1 and BG2 and the typical beer-spoilage heterofermentative Lactobacillus brevis L63, these sequences were compared with published data. A L. lindneri specific PCR primer, DA-40, was then constructed based on the V1 variable region of 16S rDNA. The specificity of PCR using the L. lindneri specific primer DA-40 and the universal primer 907r was examined using five L. lidneri strains: the three isolates described above and two strains from culture collection, DSM 20690 and DSM 20692. A variety of beer-spoilage lactic acid bacteria, including 71 Lactobacillus strains and 13 Pediococcus strains, were also included in this examination. No PCR product was obtained from any DNA with the exception of the five L. lindneri strains, indicating that the L. lindneri specific primer DA-40 was highly specific. The detection limit for L. lindneri in beer was 63 CFU/100 mL of beer.

  15. Detection of luciferase gene sequence in nonluminescent Vibrio cholerae by colony hygridization and polymerase chain reaction

    SciTech Connect

    Palmer, L.M.; Colwell, R.R. )

    1991-05-01

    Bioluminescence is a trait observed among approximately 10% of Vibrio cholerae isolates. We have demonstrated that not only do some strains of V. cholerae produce low levels of light, undetectable by the human eye, but the luciferase gene sequence is present in strains of V. cholerae which emit no detectable light, evidenced by hybridization with a luciferase DNA probe. Comparisons of the amino acid sequences of luciferase regions of amino acid identity. The polymerase chain reaction method of DNA amplification with oligonucleotide primers based on these regions was used to isolate a region of the luxA gene from both luminescent and nonluminescent V. cholerae strains. The nucleotide sequence of this region was determined and reveals that nonluminescent V. cholerae have 99.7% nucleotide sequence similarity in this region with the luminescent biovar V. cholerae by albensis as well as significant similarity to other species of bioluminescent bacteria, a finding that is in accord with the hypothesis that these species have a common luminescent ancestor, most probably from the marine environment.

  16. Detection of Murine Typhus Infection in Fleas by Using the Polymerase Chain Reaction

    DTIC Science & Technology

    1990-03-01

    spotted fever ( Rickettsia group-specific primers and probes for the diagnosis of rick- rickettsii ), epidemic typhus ( Rickettsia prowazekii), murine...Polymerase chain reaction, Xenops.yl~j.Lopsis;" Rickettsia typhi,- Enz me-linked immunosorbent assay ’ A amplificatin6 fProu)t 19. ABSTRACT (Continue on...olymerase chain reaction (PCR) amplification of CDNA was used to detect the etiologic agent of murine typhus, Rickettsia typhi, in experimentally infected

  17. Mucosal polymerase chain reaction for diagnosing Helicobacter pylori infection in patients with bleeding peptic ulcers

    PubMed Central

    Lin, Hwai-Jeng; Lo, Wen-Ching; Perng, Chin-Lin; Tseng, Guan-Ying; Li, Anna Fen-Yau; Ou, Yueh-Hsing

    2005-01-01

    AIM: Helicobacter pylori (H pylori) has been linked to chronic gastritis, peptic ulcers, gastric cancer and MALT-lymphoma. Conventional invasive tests are less sensitive than non-invasive tests in diagnosing H pylori infection in patients with bleeding peptic ulcers. Polymerase chain reaction is a sensitive and accurate method for diagnosing H pylori infection. The aim of this study was to evaluate the diagnostic role of mucosal polymerase chain reaction for H pylori infection in patients with bleeding peptic ulcers. METHODS: In patients with bleeding, non-bleeding peptic ulcers and chronic gastritis, we checked rapid urease test, histology, bacterial culture and mucosal polymerase chain reaction for detecting H pylori infection. Positive H pylori infection was defined as positive culture or both a positive histology and a positive rapid urease test. For mucosal polymerase chain reaction of H pylori, we checked vacA (s1a, s1b, s1c, s2, m1, m1T, m2), iceA1, iceA2 and cag A. RESULTS: Between October 2000 and April 2002, 88 patients with bleeding peptic ulcers (males/females: 60/28, gastric ulcers/duodenal ulcers: 55/33), 81 patients with non-bleeding peptic ulcers (males/females: 54/27, gastric ulcers/duodenal ulcers: 45/36) and 37 patients with chronic gastritis (males/females: 24/13) were enrolled in this study. In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, 45 patients (51%), 71 patients (88%) and 20 patients (54%) respectively were found to have positive H pylori infection (P<0.001). In patients with bleeding peptic ulcers, non-bleeding peptic ulcers and chronic gastritis, polymerase chain reaction for H pylori infection was positive in 54 patients (61%), 70 patients (86%) and 20 patients (54%) respectively (P<0.001). The sensitivity, positive predictive value and diagnostic accuracy of mucosal polymerase reaction for H pylori infection were significantly lower in patients with bleeding peptic ulcers (84%, 79% and 81

  18. FUNGAL SPECIATION USING QUANTITATIVE POLYMERASE CHAIN REACTION (QPCR) IN PATIENTS WITH AND WITHOUT CHRONIC RHINOSINUSITIS

    EPA Science Inventory

    Objectives/Hypothesis: 1. to determine the mycology of the middle meatus using an endoscopically guided brush sampling technique and polymerase chain reaction laboratory processing of nasal mucous. 2. To compare the mycology of the middle meatus in patients with sinus disease to...

  19. Novel use of polymerase chain reaction to amplify cellular DNA adjacent to an integrated provirus.

    PubMed Central

    Silver, J; Keerikatte, V

    1989-01-01

    We describe a modification of the polymerase chain reaction technique which allows amplification of cellular DNA adjacent to an integrated provirus given sequence information for the provirus only. The modified technique should be generally useful for studies of insertional mutagenesis and other situations in which one wishes to isolate DNA adjacent to a region of known sequence. Images PMID:2704070

  20. Polymerase Chain Reaction Assay and Bacterial Meningitis Surveillance in Remote Areas, Niger

    PubMed Central

    Sidikou, Fati; Djibo, Saacou; Taha, Muhamed Kheir; Alonso, Jean Michel; Djibo, Ali; Kairo, Kiari Kaka; Chanteau, Suzanne

    2003-01-01

    To compensate for the lack of laboratories in remote areas, the national reference laboratory for meningitis in Niger used polymerase chain reaction (PCR) to enhance the surveillance of meningitis caused by Neisseria meningitidis, Streptococcus pneumoniae, and Haemophilus influenzae. PCR effectively documented the wide geographic spread of N. meningitidis serogroup W135. PMID:14718100

  1. Characterization by polymerase chain reaction of ruminant rotaviruses isolated in Italy.

    PubMed

    Pratelli, A; Martella, V; Tempesta, M; Buonavoglia, C

    1999-04-01

    Several group A rotaviruses isolated in Italy from cattle, buffalos and goats were characterized by polymerase chain reaction assay for G- and P-type. G6 and P5 were the types most frequently recovered. The genotypes of buffalo and goat strains were similar to those of cattle isolates.

  2. Haemophilus ducreyi detection by polymerase chain reaction in oesophageal lesions of HIV patients.

    PubMed

    Borges, M C; Colares, J K B; Lima, D M; Fonseca, B A L

    2009-04-01

    HIV patients frequently have opportunistic oesophageal infections. We report Haemophilus ducreyi genetic material detected by polymerase chain reaction in biopsies of oesophageal lesions in three HIV-1-infected patients. This finding may be an indication of its aetiopathological role in oesophageal lesions of HIV patients.

  3. Rapid identification of Debaryomyces hansenii/Candida famata by polymerase chain reaction.

    PubMed

    Nishikawa, A; Sugita, T; Shinoda, T

    1999-04-01

    Primers designed in this study were used in a polymerase chain reaction test to amplify a species-specific fragment of approximately 340 bp of the large subunit ribosomal DNA of Debaryomyces hansenii/Candida famata. None of the other medically relevant yeasts including C. guilliermondii, and also the related species, D. nepalensis and C. saitoana, were amplified by this primer pair.

  4. Single Multiplex Polymerase Chain Reaction To Detect Diverse Loci Associated with Diarrheagenic Escherichia coli

    PubMed Central

    López-Saucedo, Catalina; Cerna, Jorge F.; Villegas-Sepulveda, Nicolas; Thompson, Rocío; Velazquez, F. Raul; Torres, Javier; Tarr, Phillip I.

    2003-01-01

    We developed and tested a single multiplex polymerase chain reaction (PCR) that detects enterotoxigenic, enteropathogenic, enteroinvasive, and Shiga-toxin–producing Escherichia coli. This PCR is specific, sensitive, and rapid in detecting target isolates in stool and food. Because of its simplicity, economy, and efficiency, this protocol warrants further evaluation in large, prospective studies of polymicrobial substances. PMID:12533296

  5. INTERNAL AMPLIFICATION CONTROL FOR USE IN QUANTITATIVE POLYMERASE CHAIN REACTION FECAL INDICATOR BACTERIA ASSAYS

    EPA Science Inventory

    Quantitative polymerase chain reaction (QPCR) can be used as a rapid method for detecting fecal indicator bacteria. Because false negative results can be caused by PCR inhibitors that co-extract with the DNA samples, an internal amplification control (IAC) should be run with eac...

  6. Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory

    ERIC Educational Resources Information Center

    Elkins, Kelly M.

    2011-01-01

    The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…

  7. Using the Polymerase Chain Reaction in an Undergraduate Laboratory to Produce "DNA Fingerprints."

    ERIC Educational Resources Information Center

    Phelps, Tara L.; And Others

    1996-01-01

    Presents a laboratory exercise that demonstrates the sensitivity of the Polymerase Chain Reaction as well as its potential application to forensic analysis during a criminal investigation. Can also be used to introduce, review, and integrate population and molecular genetics topics such as genotypes, multiple alleles, allelic and genotypic…

  8. Specific Detection of Campylobacter Jejuni and Campylobacter Coli by Using Polymerase Chain Reaction

    DTIC Science & Technology

    1992-10-01

    polymerase descriptions and proposal of Arcobacter gen. nov. Int. J. Syst. chain reaction for the detection of Mycobacterium leprae . 1. Bacteriol. 41:451-455...with Campylobacter spp. Infect. Immun. 59:2259-2264. detection of Mycobacterium tuberculosis in clinical specimens 29. Rashtchian, A. 1985. Detection

  9. Use of enrichment real time-Polymerase Chain Reaction to enumerate Salmonella on chicken parts

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salmonella that survive cooking and that cross-contaminate other food during meal preparation and serving represent primary routes of consumer exposure to this pathogen from chicken. Consequently, the present study was undertaken to use enrichment real time-polymerase chain reaction (RT-PCR) to enu...

  10. Use of the polymerase chain reaction for diagnosing bovine tuberculosis in Panama.

    PubMed

    Cedeño, I; de Obaldía, R; Sanjur, O; Bayard, V; Ortega-Barría, E; Escobar, C

    2005-12-01

    In addition to causing large losses to the cattle industry, Mycobacterium bovis, the causative agent for bovine tuberculosis, is a serious public health issue because it can potentially infect humans. Diagnosis based on isolation and identification of the bacillus is tedious and may take weeks. The diagnosis of M. bovis by polymerase chain reaction (PCR), using species-specific primers, is fast, highly sensitive and of great value in epidemiological studies. In this study, deoxyribonucleic acid (DNA) was extracted from 60 nasal mucus samples collected from three different farms, all located in an area where M. bovis is endemic. Two farms tested negative for an antibody response to the M. tuberculosis purified protein derivative (PPD) antigen, whereas the other farm gave a positive result. The amplified fragment of DNA was 460 base pairs with a sequence similar to that previously reported. Only 5% of the samples from the third farm tested positive for the presence of antibodies against PPD, whereas 65% of samples (from all three farms) gave a positive result when PCR was used. Thus, the authors suggest the use of the PCR species-specific primers test to support the programme against bovine tuberculosis in Panama.

  11. Detection of the genes encoding botulinum neurotoxin types A to E by the polymerase chain reaction.

    PubMed Central

    Szabo, E A; Pemberton, J M; Desmarchelier, P M

    1993-01-01

    The polymerase chain reaction (PCR) was used as the basis for the development of highly sensitive and specific diagnostic tests for organisms harboring botulinum neurotoxin type A through E genes. Synthetic DNA primers were selected from nucleic acid sequence data for Clostridium botulinum neurotoxins. Individual components of the PCR for each serotype (serotypes A through E) were adjusted for optimal amplification of the target fragment. Each PCR assay was tested with organisms expressing each of the botulinum neurotoxin types (types A through G), Clostridium tetani, genetically related nontoxigenic organisms, and unrelated strains. Each assay was specific for the intended target. The PCR reliably identified multiple strains having the same neurotoxin type. The sensitivity of the test was determined with different concentrations of genomic DNA from strains producing each toxin type. As little as 10 fg of DNA (approximately three clostridial cells) was detected. C. botulinum neurotoxin types A, B, and E, which are most commonly associated with human botulism, could be amplified from crude DNA extracts, from vegetative cells, and from spore preparations. This suggests that there is great potential for the PCR in the identification and detection of botulinum neurotoxin-producing strains. Images PMID:8215372

  12. A multiplex polymerase chain reaction for discriminating Erysipelothrix rhusiopathiae from Erysipelothrix tonsillarum.

    PubMed

    Yamazaki, Yoshinao

    2006-07-01

    Erysipelothrix rhusiopathiae is the causative agent of swine erysipelas, and it causes great economic losses in Japan and worldwide. In meat inspection, it is very important to distinguish E. rhusiopathiae from other bacteria showing similar clinical signs of disease or similar bacterial characteristics. To distinguish E. rhusiopathiae from Erysipelothrix tonsillarum, 2 polymerase chain reaction (PCR) systems were combined. The primer sets ERY-1F and ERY-2R were designed to amplify 2210 base pairs (bp) of nucleotide sequence specific for E. rhusiopathiae chromosomal DNA, and the primer sets MO101 and ERS-1R were designed to amplify 719 bp of nucleotide sequence including a highly conserved region of genus Erysipelothrix 16S rRNA. Two fragments were amplified when E. rhusiopathiae was used as the PCR template using the primer sets, whereas a single fragment was amplified when E. tonsillarum was used as the template. No fragments were amplified when nucleic acid from other bacteria that cause clinical signs similar to swine erysipelas were used as the template. Moreover, 5 specimens collected from postinspected swine carcasses were diagnosed as E. rhusiopathiae using the PCR described in this study, in agreement with results of microbiological tests for the genus Erysipelothrix, whereas negative samples were negative both in conventional bacterial tests and by PCR. The detection limit of multiplex PCR ranged from 10(2) to 10(4) colony forming units per reaction tube for positive samples. These results suggest that this method is useful for screening of swine erysipelas in meat inspection centers.

  13. Molecular detection of plant pathogenic bacteria using polymerase chain reaction single-strand conformation polymorphism.

    PubMed

    Srinivasa, Chandrashekar; Sharanaiah, Umesha; Shivamallu, Chandan

    2012-03-01

    The application of polymerase chain reaction (PCR) technology to molecular diagnostics holds great promise for the early identification of agriculturally important plant pathogens. Ralstonia solanacearum, Xanthomoans axonopodis pv. vesicatoria, and Xanthomonas oryzae pv. oryzae are phytopathogenic bacteria, which can infect vegetables, cause severe yield loss. PCR-single-strand conformation polymorphism (PCR-SSCP) is a simple and powerful technique for identifying sequence changes in amplified DNA. The technique of PCR-SSCP is being exploited so far, only to detect and diagnose human bacterial pathogens in addition to plant pathogenic fungi. Selective media and serology are the commonly used methods for the detection of plant pathogens in infected plant materials. In this study, we developed PCR-SSCP technique to identify phytopathogenic bacteria. The PCR product was denatured and separated on a non-denaturing polyacrylamide gel. SSCP banding patterns were detected by silver staining of nucleic acids. We tested over 56 isolates of R. solanacearum, 44 isolates of X. axonopodis pv. vesicatoria, and 20 isolates of X. oryzae pv. oryzae. With the use of universal primer 16S rRNA, we could discriminate such species at the genus and species levels. Species-specific patterns were obtained for bacteria R. solanacearum, X. axonopodis pv. vesicatoria, and X. oryzae pv. oryzae. The potential use of PCR-SSCP technique for the detection and diagnosis of phytobacterial pathogens is discussed in the present paper.

  14. Polymerase chain reaction–based assays for the diagnosis of human brucellosis

    PubMed Central

    2014-01-01

    Polymerase chain reaction (PCR) is an in vitro technique for the nucleic acid amplification, which is commonly used to diagnose infectious diseases. The use of PCR for pathogens detection, genotyping and quantification has some advantages, such as high sensitivity, high specificity, reproducibility and technical ease. Brucellosis is a common zoonosis caused by Brucella spp., which still remains as a major health problem in many developing countries around the world. The direct culture and immunohistochemistry can be used for detecting infection with Brucella spp. However, PCR has the potential to address limitations of these methods. PCR are now one of the most useful assays for the diagnosis in human brucellosis. The aim of this review was to summarize the main PCR techniques and their applications for diagnosis and follow-up of patients with brucellosis. Moreover, advantages or limitation of the different PCR methods as well as the evaluation of PCR results for treatment and follow-up of human brucellosis were also discussed. PMID:25082566

  15. Nested polymerase chain reaction amplification and sequencing analysis of the light-chain and heavy-chain variable regions in the influenza A H1N1 virus hemagglutinin monoclonal antibody gene.

    PubMed

    Li, H J; Guo, C Y; Sun, J Y; Sun, L J; Zhao, P H; Hu, L; Li, Y; Hu, J

    2014-06-11

    The nested polymerase chain reaction (PCR) method was used for the amplification of the influenza A H1N1 virus hemagglutinin monoclonal antibody light-chain and heavy-chain genes. Sequence analysis of the obtained genes was then used to identify common cloning methods of the mouse immunoglobulin-kappa (Igκ) light-chain and heavy-chain variable gene regions. Twenty-two pairs of amplification primers for the mouse Igκ light-chain and heavy-chain variable gene regions were designed, and 6 mouse anti-human H1N1 influenza virus hemagglutinin monoclonal antibody light-chain and heavy-chain variable gene regions were cloned and sequenced. Comparative analysis was conducted between our results and the mouse Ig sequences published in the National Center of Biotechnology Information (NCBI). The nested PCR method effectively avoided cloning the pseudogenes of the monoclonal antibody, and the amino acid sequence obtained was consistent with the characteristics of the mouse Ig variable region. A general method of cloning the mouse Ig light-chain and heavy-chain variable gene regions was established, which provides a basis for further cloning of mouse monoclonal antibody variable gene regions. This study also provides data for further studies of H1N1 influenza virus hemagglutinin antibody binding sites.

  16. Real-time polymerase chain reaction for diagnosing infectious mononucleosis in pediatric patients: A systematic review and meta-analysis.

    PubMed

    Jiang, Sha-Yi; Yang, Jing-Wei; Shao, Jing-Bo; Liao, Xue-Lian; Lu, Zheng-Hua; Jiang, Hui

    2016-05-01

    In this meta-analysis, we evaluated the diagnostic role of Epstein-Barr virus deoxyribonucleic acid detection and quantitation in the serum of pediatric and young adult patients with infectious mononucleosis. The primary outcome of this meta-analysis was the sensitivity and specificity of Epstein-Barr virus (EBV) deoxyribonucleic acid (DNA) detection and quantitation using polymerase chain reaction (PCR). A systematic review and meta-analysis was performed by searching for articles that were published through September 24, 2014 in the following databases: Medline, Cochrane, EMBASE, and Google Scholar. The following keywords were used for the search: "Epstein-Barr virus," "infectious mononucleosis," "children/young adults/infant/pediatric," and "polymerase chain reaction or PCR." Three were included in this analysis. We found that for detection by PCR, the pooled sensitivity for detecting EBV DNA was 77% (95%CI, 66-86%) and the pooled specificity for was 98% (95%CI, 93-100%). Our findings indicate that this PCR-based assay has high specificity and good sensitivity for detecting of EBV DNA, indicating it may useful for identifying patients with infectious mononucleosis. This assay may also be helpful to identify young athletic patients or highly physically active pediatric patients who are at risk for a splenic rupture due to acute infectious mononucleosis.

  17. Studying the effect of graphene-ZnO nanocomposites on polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Sharma, Vinay; Rajaura, Rajveer; Sharma, Preetam Kumar; Srivastava, Rishabh Ronin; Sharma, Shyam Sundar; Agrawal, Kailash

    2016-05-01

    An emerging area of research is improving the efficiency of the polymerase chain reaction (PCR) by using nanoparticles. With graphene nano-flakes showing promising results, in this paper we report the effect of Graphene-ZnO nanocomposites on Polymerase Chain reaction (PCR) efficiency. G-ZnO nanocomposites were efficiently synthesized via in situ chemical method. Transmission electron microscopy (TEM) and scanning electron microscopy (SEM) image confirms the formation of nanocomposites. ZnO nanoparticles of size range ~20-30 nm are uniformly attached on the graphene sheets. No amplification during PCR indicates inhibitory activity of G-ZnO nanocomposites which points the fingers at ZnO moiety of the G-ZnO composite for no amplification during our PCR reaction. Further work should concentrate on finding out the main inhibitory mechanism involved in inhibition of PCR using G-ZnO composites.

  18. Detection of Leishmania siamensis DNA in Saliva by Polymerase Chain Reaction

    PubMed Central

    Phumee, Atchara; Kraivichian, Kanyarat; Chusri, Sarunyou; Noppakun, Nopadon; Vibhagool, Asda; Sanprasert, Vivornpun; Tampanya, Vich; Wilde, Henry; Siriyasatien, Padet

    2013-01-01

    Polymerase chain reaction was used to detect Leishmania siamensis DNA from clinical samples collected from six leishmaniasis patients during 2011–2012. The samples used in this study came from bone marrow, blood, buffy coat, saliva, urine, and tissue biopsy specimens. Saliva was a good source for L. siamensis DNA by polymerase chain reaction. L. siamensis DNA was also found in saliva of an asymptomatic case-patient. Levels of L. siamensis DNA in saliva decreased until being undetectable after treatment. These levels could be used as a marker to evaluate efficacy of the treatment. A larger study is needed to evaluate this method as a screening and survey tool to study the silent background of Leishmania infection among the at-risk population. PMID:24062485

  19. Rapid detection of bovine viral diarrhea virus by polymerase chain reaction.

    PubMed Central

    Lopez, O J; Osorio, F A; Donis, R O

    1991-01-01

    The polymerase chain reaction was used to detect genomic sequences of the positive-stranded RNA of bovine viral diarrhea virus (BVDV), a member of the family Togaviridae. Using a set of 20-bp primers located within the conserved 3' region of the BVDV genome, we were able to consistently amplify a 205-bp target sequence from BVDV cDNA. BVDV RNAs from cell culture-propagated BVDV reference strains, diverse unrelated cytopathic and noncytopathic field isolates, and clinical serum samples were transcribed to cDNA by using avian myeloblastosis virus reverse transcriptase and further specifically amplified by using the polymerase chain reaction assay. The amplification assay was sensitive enough to detect one molecule of cloned BVDV cDNA. Reconstitution experiments conducted by adding decreasing amounts of BVDV (NADL strain) to BVDV-free serum indicated that the threshold of sensitivity of the assay was less than or equal to 1 50% tissue culture infective dose. These results show that the polymerase chain reaction may be used for the rapid detection of diverse strains of BVDV in cell cultures, biological products, and clinical specimens from cattle. Images PMID:1709950

  20. S-layer protein gene of Lactobacillus brevis: cloning by polymerase chain reaction and determination of the nucleotide sequence.

    PubMed Central

    Vidgrén, G; Palva, I; Pakkanen, R; Lounatmaa, K; Palva, A

    1992-01-01

    The surface (S)-layer protein of Lactobacillus brevis was isolated, purified, and characterized. The S-layer protein is the major protein of the cell, with an apparent molecular mass of 46 kDa in sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Immunogold electron microscopy with polyclonal antiserum against the isolated 46-kDa protein was used to confirm the surface location of this protein. N-terminal amino acid sequences of the intact 46-kDa protein and its tryptic peptides were determined. The gene of the S-layer protein was amplified from the genome of L. brevis by polymerase chain reaction with oligonucleotides, synthesized according to the N-terminal amino acid sequences, as primers. The polymerase chain reaction fragments containing the entire S-layer gene and its regulatory regions were sequenced. Nucleic acid sequence analysis revealed one open reading frame with a capacity to encode a protein of 48,159 Da. From the regulatory region of the gene, two subsequent promoters and a ribosome binding site, showing typical features of prokaryotic consensus sequences, were found. The coding region contained a characteristic gram-positive-type signal peptide of 30 amino acids. Removal of the signal peptide results in a polypeptide of 435 amino acids, which is in excellent agreement with the size of the S-layer protein determined by SDS-PAGE. The size and the 5' end analyses of the S-layer transcripts confirmed the monocistronic nature of the S-layer operon and the functionality of the two promoters found. Images PMID:1429463

  1. Principles of rapid polymerase chain reactions: mathematical modeling and experimental verification.

    PubMed

    Whitney, Scott E; Sudhir, Alugupally; Nelson, R Michael; Viljoen, Hendrik J

    2004-07-01

    Polymerase chain reaction (PCR) is an important diagnostic tool for the amplification of DNA. The PCR process can be treated as a problem in biochemical engineering. This study focuses on the development of a mathematical model of the polymerase chain reaction. The PCR process consists of three steps: denaturation of target DNA, annealing of sequence-specific oligonucleotide primers and the enzyme-catalyzed elongation of the annealed complex (primer:DNA:polymerase). The denaturation step separates the double strands of DNA; this model assumes denaturation is complete. The annealing step describes the formation of a primer-fragment complex followed by the attachment of the polymerase to form a ternary complex. This step is complicated by competitive annealing between primers and incomplete fragments including primer-primer reactions. The elongation step is modeled by a stochastic method. Species that compete during the elongation step are deoxynucleotide triphosphates dCTP, dATP, dTTP, dGTP, dUTP, and pyrophosphate. Thermal deamination of dCTP to form dUTP is included in the model. The probability for a species to arrive at the active site is based on its molar fraction. The number of random insertion events depends on the average processing speed of the polymerase and the elongation time of the simulation. The numerical stochastic experiment is repeated a sufficient number of times to construct a probability density distribution (PDF). The moment of the PDF and the annealing step products provide the product distribution at the end of the elongation step. The overall yield is compared to six experimental values of the yield. In all cases the comparisons are very good.

  2. IDENTIFICATION OF MYCOBACTERIUM GENAVENSE IN A DIANA MONKEY (CERCOPITHECUS DIANA) BY POLYMERASE CHAIN REACTION AND HIGH-PERFORMANCE LIQUID CHROMATOGRAPHY.

    PubMed

    Kelly, Kathleen M; Wack, Allison N; Bradway, Dan; Simons, Brian W; Bronson, Ellen; Osterhout, Gerard; Parrish, Nicole M; Montali, Richard J

    2015-06-01

    A 25-yr-old Diana monkey (Cercopithecus diana) with a 1.5-yr history of chronic colitis and diarrhea was found to have disseminated granulomatous disease with intralesional acid fast bacilli. Bacilli were identified as Mycobacterium genavense by polymerase chain reaction, sequencing of the 16S-23S ribosomal RNA intergenic spacer (ITS) gene, and mycolic acid analysis by high-performance liquid chromatography. Mycobacterium genavense is a common cause of mycobacteriosis in free-ranging and captive birds. In addition, recognition of opportunistic infection in human immunodeficiency virus-positive patients is increasing. Disease manifestations of M. genavense are similar to Mycobacterium avium complex (MAC) and include fever, wasting, and diarrhea with disseminated disease. Similar clinical signs and lesions were observed in this monkey. Mycobacterium genavense should be considered as a differential for disseminated mycobacterial disease in nonhuman primates as this agent can mimic MAC and related mycobacteria.

  3. Polymerase chain reaction (PCR) amplification of a nucleoprotein gene sequence of infectious hematopoietic necrosis virus

    USGS Publications Warehouse

    Arakawa, C.K.; Deering, R.E.; Higman, K.H.; Oshima, K.H.; O'Hara, P.J.; Winton, J.R.

    1990-01-01

    The polymerase chain reaction [PCR) was used to amplify a portion of the nucleoprotein [NI gene of infectious hematopoietic necrosis virus (IHNV). Using a published sequence for the Round Butte isolate of IHNV, a pair of PCR pnmers was synthesized that spanned a 252 nucleotide region of the N gene from residue 319 to residue 570 of the open reading frame. This region included a 30 nucleotide target sequence for a synthetic oligonucleotide probe developed for detection of IHNV N gene messenger RNA. After 25 cycles of amplification of either messenger or genomic RNA, the PCR product (DNA) of the expected size was easily visible on agarose gels stained with ethidium bromide. The specificity of the amplified DNA was confirmed by Southern and dot-blot analysis using the biotinylated oligonucleotide probe. The PCR was able to amplify the N gene sequence of purified genomic RNA from isolates of IHNV representing 5 different electropherotypes. Using the IHNV primer set, no PCR product was obtained from viral hemorrhagic septicemia virus RNA, but 2 higher molecular weight products were synthesized from hirame rhabdovirus RNA that did not hybridize with the biotinylated probe. The PCR could be efficiently performed with all IHNV genomic RNA template concentrations tested (1 ng to 1 pg). The lowest level of sensitivity was not determined. The PCR was used to amplify RNA extracted from infected cell cultures and selected tissues of Infected rainbow trout. The combination of PCR and nucleic acid probe promises to provide a detection method for IHNV that is rapid, h~ghly specific, and sensitive.

  4. Diagnosis of leishmaniasis in Maltese dogs with the aid of the polymerase chain reaction.

    PubMed

    Headington, C E; Barbara, C H; Lambson, B E; Hart, D T; Barker, D C

    2002-04-01

    Visceral leishmaniasis due to infection with Leishmania infantum (a member of the L. donovani complex) has been known in Malta since the beginning of the century. In 1946, when human diseases became compulsorily notifiable on the islands, the leishmaniasis figures were 1264 visceral cases, 36 cutaneous cases and 5 unspecified. Five cases of cutaneous infection were reported in 1997 and 23 cases of cutaneous and 3 of visceral infection in January-October 1998. There may be considerable under-reporting of the disease. Figures of between 18% and 47% have been reported for canine leishmaniasis. This large discrepancy between reservoir and human hosts suggests that the canine reservoir could be a serious threat and is worthy of careful examination. This pilot study was carried out to determine the proportion of dogs serologically positive for leishmaniasis in order to assess the necessity for a possible control programme in Malta. Using 60 canine blood samples from the Maltese islands, we tested for deoxyribonucleic acid (DNA) of the L. donovani complex using the polymerase chain reaction (PCR). The samples had all been subjected to the indirect immunofluorescent antibody test (IFAT) and a direct comparison was made. DNA was extracted using the phenol/chloroform method and amplified with primers specific for kinetoplast mini-circle DNA of the L. donovani complex and L. major, Southern blotted and hybridized with a radio-labelled probe specific for the L. donovani complex. Twelve of the samples gave positive results in the IFAT, whilst 37 (62%) were positive by PCR and hybridization. All samples from 36 dogs from a non-endemic area in the UK were negative by PCR. Five of the 12 samples positive by IFAT gave negative PCR results.

  5. Differential diagnosis of Taenia saginata and Taenia solium infections: from DNA probes to polymerase chain reaction.

    PubMed

    González, Luis Miguel; Montero, Estrella; Sciutto, Edda; Harrison, Leslie J S; Parkhouse, R Michael E; Garate, Teresa

    2002-04-01

    The objective of this work was the rapid and easy differential diagnosis of Taenia saginata and T. solium. First, a T. saginata size-selected genomic deoxyribonucleic acid (gDNA) library was constructed in the vector lambda gt10 using the 2-4 kb fraction from the parasite DNA digested with EcoR1, under 'star' conditions. After differential screening of the library and hybridization analysis with DNA from T. saginata, T. solium, T. taeniaeformis, T. crassiceps, and Echinococcus granulosus (bovine, porcine, and human), 2 recombinant phages were selected. They were designated HDP1 and HDP2. HDP1 reacted specifically with T. saginata DNA, and HDP2 recognized DNA from both T. saginata and T. solium. The 2 DNA probes were then sequenced and further characterized. HDP1 was a repetitive sequence with a 53 bp monomeric unit repeated 24 times in direct tandem along the 1272 bp fragment, while the 3954 bp HDP2 was not a repetitive sequence. Using the sequencing data, oligonucleotides were designed and used in a polymerase chain reaction (PCR). The 2 selected oligonucleotides from probe HDP1 (PTs4F1 and PTs4R1) specifically amplified gDNA from T. saginata, but not T. solium or other related cestodes, with a sensitivity of < 10 pg of T. saginata gDNA, about the quantity of DNA in one taeniid egg. The 3 oligonucleotides selected from the HDP2 sequence (PTs7S35F1, PTs7S35F2, and PTs7S35R1) allowed the differential amplification of gDNA from T. saginata, T. solium and E. granulosus in a multiplex PCR, again with a sensitivity of < 10 pg. These diagnostic tools have immediate application in the differential diagnosis of T. solium and T. saginata in humans and in the diagnosis of dubious cysts in the slaughterhouse. We also hope to apply them to epidemiological surveys of, for example, soil and water in endemic areas.

  6. Does Polymerase Chain Reaction of Tissue Specimens Aid in the Diagnosis of Tuberculosis?

    PubMed Central

    Lee, Yoo Jin; Kim, Seojin; Kang, Youngjin; Jung, Jiyoon; Lee, Eunjung; Kim, Joo-Young; Lee, Jeong Hyeon; Lee, Youngseok; Chae, Yang-seok; Kim, Chul Hwan

    2016-01-01

    Background Mycobacterial culture is the gold standard test for diagnosing tuberculosis (TB), but it is time-consuming. Polymerase chain reaction (PCR) is a highly sensitive and specific method that can reduce the time required for diagnosis. The diagnostic efficacy of PCR differs, so this study determined the actual sensitivity of TB-PCR in tissue specimens. Methods We retrospectively reviewed 574 cases. The results of the nested PCR of the IS6110 gene, mycobacterial culture, TB-specific antigen-induced interferon-γ release assay (IGRA), acid-fast bacilli (AFB) staining, and histological findings were evaluated. Results The positivity rates were 17.6% for PCR, 3.3% for the AFB stain, 22.2% for mycobacterial culture, and 55.4% for IGRA. PCR had a low sensitivity (51.1%) and a high specificity (86.3%) based on the culture results of other studies. The sensitivity was higher (65.5%) in cases with necrotizing granuloma but showed the highest sensitivity (66.7%) in those with necrosis only. The concordance rate between the methods indicated that PCR was the best method compared to mycobacterial culture, and the concordance rate increased for the methods using positive result for PCR or histologic features. Conclusions PCR of tissue specimens is a good alternative to detect tuberculosis, but it may not be as sensitive as previously suggested. Its reliability may also be influenced by some histological features. Our data showed a higher sensitivity when specimens contained necrosis, which indicated that only specimens with necrosis should be used for PCR to detect tuberculosis. PMID:27725619

  7. A polymerase chain reaction-based methodology to detect gene doping.

    PubMed

    Carter, Adam; Flueck, Martin

    2012-04-01

    The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.

  8. Molecular epidemiology of human hepatitis A virus defined by an antigen-capture polymerase chain reaction method.

    PubMed Central

    Jansen, R W; Siegl, G; Lemon, S M

    1990-01-01

    We describe an immunoaffinity-linked nucleic acid amplification system (antigen-capture/polymerase chain reaction, or AC/PCR) for detection of viruses in clinical specimens and its application to the study of the molecular epidemiology of a picornavirus, hepatitis A virus (HAV). Immunoaffinity capture of virus, synthesis of viral cDNA, and amplification of cDNA by a polymerase chain reaction (PCR) were carried out sequentially in a single reaction vessel. This approach simplified sample preparation and enhanced the specificity of conventional PCR. AC/PCR detected less than one cell culture infectious unit of virus in 80 microliters of sample. Sequencing of AC/PCR reaction products from 34 virus strains demonstrated remarkable conservation at the nucleotide level among most strains but revealed hitherto unsuspected genetic diversity among human isolates. Epidemiologically related strains were identical or closely related in sequence. Virus strains recovered from epidemics of hepatitis A in the United States and Germany were identical in sequence, providing evidence for a previously unrecognized epidemiologic link between these outbreaks. Images PMID:2158093

  9. Detection of Babesia bigemina-infected carriers by polymerase chain reaction amplification.

    PubMed Central

    Figueroa, J V; Chieves, L P; Johnson, G S; Buening, G M

    1992-01-01

    A SpeI-AvaI fragment (0.3 kbp) from pBbi16 (a pBR322 derivative containing a 6.3-kbp Babesia bigemina DNA insert) was subcloned into the pBluescript phagemid vector and was sequenced by the dideoxy-mediated chain termination method. Two sets of primers were designed for the polymerase chain reaction (PCR) assay. Primer set IA-IB was used to amplify a 278-bp DNA fragment, and primer set IAN-IBN was used to prepare a probe directed to a site within the PCR-amplified target DNA. Digoxigenin-dUTP was incorporated into the probe during the amplification reaction. PCR amplification of target DNA obtained from in vitro-cultured B. bigemina and nucleic acid hybridization of amplified product with the nonradioactive DNA probe showed that a 278-bp fragment could be detected when as little as 100 fg of parasite genomic DNA was used in the assay. A fragment of similar size was amplified from genomic DNAs from several B. bigemina isolates but not from DNAs from Babesia bovis, Anaplasma marginale, or six species of bacteria or bovine leukocytes. Similarly, the PCR product could be detected in DNA samples purified from 200 microliters of blood with a parasitemia of as low as 1 in 10(8) cells and which contained an estimated 30 B. bigemina-infected erythrocytes. By a direct PCR method, B. bigemina DNA was amplified from 20 microliters of packed erythrocytes with a calculated parasitemia of 1 in 10(9) cells. With the analytical sensitivity level of the PCR-DNA probe assay, six cattle with inapparent, 11-month chronic B. bigemina infection were found to be positive. No PCR product was observed in bovine blood samples collected from a splenectomized, A. marginale-infected bovine, a 4-year chronic B. bovis-infected animal, or 20 uninfected cattle from Missouri which were subjected to amplification. The PCR-DNA probe assay was shown to be sensitive in detecting latently infected cattle. The specificity and high analytical sensitivity of the test provide valuable tools for performing

  10. Fluorochrome-functionalized magnetic nanoparticles for high-sensitivity monitoring of the polymerase chain reaction by magnetic resonance.

    PubMed

    Alcantara, David; Guo, Yanyan; Yuan, Hushan; Goergen, Craig J; Chen, Howard H; Cho, Hoonsung; Sosnovik, David E; Josephson, Lee

    2012-07-09

    Easy to find: magnetic nanoparticles bearing fluorochromes (red) that intercalate with DNA (green) form microaggregates with DNA generated by the polymerase chain reaction (PCR). These aggregates can be detected at low cycle numbers by magnetic resonance (MR).

  11. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOEpatents

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  12. Enhanced Specificity of Multiplex Polymerase Chain Reaction via CdTe Quantum Dots

    NASA Astrophysics Data System (ADS)

    Liang, Gaofeng; Ma, Chao; Zhu, Yanliang; Li, Shuchun; Shao, Youhua; Wang, Yong; Xiao, Zhongdang

    2011-12-01

    Nanoparticles were recently reported to be able to improve both efficiency and specificity in polymerase chain reaction (PCR). Here, CdTe QDs were introduced into multi-PCR systems. It was found that an appropriate concentration of CdTe QDs could enhance the performance of multi-PCR by reducing the formation of nonspecific products in the complex system, but an excessive amount of CdTe QDs could suppress the PCR. The effects of QDs on PCR can be reversed by increasing the polymerase concentration or by adding bovine serum albumin (BSA). The mechanisms underlying these effects were also discussed. The results indicated that CdTe QDs could be used to optimize the amplification products of the PCR, especially in the multi-PCR system with different primers annealing temperatures, which is of great significance for molecular diagnosis.

  13. Sulfate- and sialic acid-containing glycolipids inhibit DNA polymerase alpha activity.

    PubMed

    Simbulan, C M; Taki, T; Tamiya-Koizumi, K; Suzuki, M; Savoysky, E; Shoji, M; Yoshida, S

    1994-03-16

    The effects of various glycolipids on the activity of immunoaffinity-purified calf thymus DNA polymerase alpha were studied in vitro. Preincubation with sialic acid-containing glycolipids, such as sialosylparagloboside (SPG), GM3, GM1, and GD1a, and sulfatide (cerebroside sulfate ester, CSE) dose-dependently inhibited the activity of DNA polymerase alpha, while other glycolipids, as well as free sphingosine and ceramide did not. About 50% inhibition was achieved by preincubating the enzyme with 2.5 microM of CSE, 50 microM of SPG or GM3, and 80 microM of GM1. Inhibition was noncompetitive with both the DNA template and the substrate dTTP, as well as with the other dNTPs. Since the inhibition was largely reversed by the addition of 0.05% Nonidet P40, these glycolipids may interact with the hydrophobic region of the enzyme protein. Apparently, the sulfate moiety in CSE and the sialic acid moiety in gangliosides were essential for the inhibition since neither neutral glycolipids (i.e., glucosylceramide, galactosylceramide, lactosylceramide) nor asialo-gangliosides (GA1 and GA2) showed any inhibitory effect. Furthermore, the ceramide backbone was also found to be necessary for maximal inhibition since the inhibition was largely abolished by substituting the lipid backbone with cholesterol. Increasing the number of sialic acid moieties per molecule further enhanced the inhibition, while elongating the sugar chain diminished it. It was clearly shown that the N-acetyl residue of the sialic acid moiety is particularly essential for inhibition by both SPG and GM3 because the loss of this residue or substitution with a glycolyl residue completely negated their inhibitory effect on DNA polymerase alpha activity.

  14. Development of Conventional and Real-Time Reverse Transcription Polymerase Chain Reaction Assays to Detect Tembusu Virus in Culex tarsalis Mosquitoes

    DTIC Science & Technology

    2014-08-11

    specific conventional and real-time quantitative reverse transcription polymerase chain reaction assays for detecting TMUV RNA in infected cell...fold 5 days after inoculation. These assays resulted in the detection of virus-specific RNA in the presence of copurified mosquito nucleic acids. The use...flaviviruses, TMUV is a linear, positive-sense, single-stranded RNA virus with a genome size of approximately 11 kb. Its RNA encodes 10 proteins, including

  15. Improved polymerase chain reaction technique for determining the species composition of Eimeria in poultry litter.

    PubMed

    Jenkins, M C; Miska, K; Klopp, S

    2006-12-01

    An improved polymerase chain reaction (PCR)-based method for determining the species composition of Eimeria in poultry litter was developed by incorporating species-specific internal standards in the assay. Internal standard molecules were prepared by fusing seven different Eimeria species-specific intervening transcribed sequence 1 (ITS1) rDNA primer pairs to a non-Eimeria DNA molecule and by cloning the hybrid DNA molecules into a plasmid. The internal DNA standards were then used in Eimeria-specific ITS 1 PCR, and they were found to be capable of detecting E. acervulina, E. maxima, E. praecox, and E. tenella oocysts isolated directly from poultry litter.

  16. Application of polymerase chain reaction (PCR) for diagnosis of equine herpes virus-1 (EHV-1).

    PubMed

    Gupta, A K; Singh, B K; Yadav, M P

    1996-11-01

    Fifty aborted foetus samples were diagnosed for the presence of equine herpes virus-1 (EHV-1) by polymerase chain reaction (PCR) technique. Specific primer pair for amplification of a particular segment of EHV-1 DNA in gc region having 3 Hae III restriction endonuclease sites was used. A 409 base pair segment obtained as PCR amplification product in 9 samples was digested with Hae III to confirm the presence of EHV-1 as the infectious agent in aborted tissues. It was observed that PCR technique was more sensitive, specific and rapid than the conventional virological diagnostic methods.

  17. Enzymological considerations for a theoretical description of the quantitative competitive polymerase chain reaction (QC-PCR).

    PubMed

    Schnell, S; Mendoza, C

    1997-02-21

    The enzymological principles of the polymerase chain reaction (PCR) and of the quantitative competitive PCR (QC-PCR) are developed, proposing a theoretical framework that will facilitate quantification in experimental methodologies. It is demonstrated that the specificity of the QC-PCR, i.e. the ratio of the target initial velocity to that of the competitor template, remains constant not only during a particular amplification but also for increasing initial competitor concentrations. Linear fitting procedures are thus recommended that will enable a quantitative estimate of the initial target concentration. Finally, expressions for the efficiency of the PCR and QC-PCR are derived that are in agreement with previous experimental inferences.

  18. [Identification of human pathogenic variola and monkeypox viruses by real-time polymerase chain reaction].

    PubMed

    Kostina, E V; Gavrilova, E V; Riabinin, V A; Shchelkunov, S N; Siniakov, A N

    2009-01-01

    A kit of specific oligonucleotide primers and hybridization probes has been proposed to detect orthopoxviruses (OPV) and to discriminate human pathogenic viruses, such as variola virus and monkey virus by real-time polymerase chain reaction (PCR). For real-time PCR, the following pairs of fluorophore and a fluorescence quencher were used: TAMRA-BHQ2 for genus-specific probes and FAM-BHQ1 for species-specific ones (variola virus, monkeypox virus, ectomelia virus). The specificity of this assay was tested on 38 strains of 6 OPV species and it was 100%.

  19. The rapid molecular genetic diagnosis of cystic fibrosis by polymerase chain reaction: an experience report.

    PubMed

    Macek, M; Boehm, I; Arnold, L; Smrt, J; Macek, M; Duspivová, R; Vávrová, V; Sedlácek, Z; Sperling, K; Schmidtke, J

    1990-01-01

    The authors report their experience with about two thousand DNA amplifications by polymerase chain reaction (PCR) in prenatal diagnosis of cystic fibrosis. The method is demonstrated on examples of diagnostic informativity and prenatal diagnosis examination in a family at 1 in 4 risk of the disease using closely CF-linked diagnostic polymorphisms: J3.11/MspI, MetH/MspI, CS7/HhaI, KM19/PstI, Mp6-d9/MspI and XV2c/TaqI, PCR methodology and safety precautions are discussed.

  20. Polymerase chain reaction based detection of Mycobacterium tuberculosis complex in lupus vulgaris: a case report.

    PubMed

    Baylan, O; Arca, E; Ozcan, A; Kisa, O; Albay, A; Doganci, L

    2004-09-01

    Lupus vulgaris (LV), the commonest of all forms of cutaneous tuberculosis, can affect the earlobes. Authors present a 20-year-old male patient with LV of the left earlobe initially misdiagnosed as pyoderma and treated superfluously with antibiotics at different intervals over the last 4 years in another hospital. Mycobacteria could not be seen or isolated by stained smears or conventional or radiometric culture methods from the skin biopsy specimens. Suspected clinical diagnosis of our patient was LV. This was supported by positive polymerase chain reaction assay and histological findings. The lesion was treated successfully with anti-tuberculosis chemotherapy, further confirming the diagnosis of LV.

  1. Differentiation of Giardia duodenalis from other Giardia spp. by using polymerase chain reaction and gene probes.

    PubMed Central

    Mahbubani, M H; Bej, A K; Perlin, M H; Schaefer, F W; Jakubowski, W; Atlas, R M

    1992-01-01

    Giardia spp. are waterborne organisms that are the most commonly identified pathogenic intestinal protozoans in the United States. Current detection techniques for Giardia species in water include microscopy and immunofluorescence techniques. Species of the genus Giardia are classified on the basis of taxonomic criteria, such as cell morphology, and on host specificity. We have developed a polymerase chain reaction- and gene probe-based detection system specific for Giardia spp., which can discriminate between the relevant species of the G. duodenalis type pathogenic to humans and other Giardia species that are not human pathogens. This method can detect a single Giardia cyst and is therefore sensitive enough for environmental monitoring. Images PMID:1734070

  2. DNA from oral bacteria by sodium hydroxide-paper method suitable for polymerase chain reaction.

    PubMed

    Lefimil, Claudia; Lozano, Carla; Morales-Bozo, Irene; Plaza, Anita; Maturana, Cristian; Urzúa, Blanca

    2013-02-15

    In the oral cavity, we can find a complex mixture of microorganisms, commensals, and pathogens. The studies of normal oral microbiota, as well as the studies of much oral pathology (e.g., caries, periodontitis), involve the isolation and cultivation of these microorganisms and their molecular analysis. The aim of this study was to validate a quick, easy, efficient, and inexpensive DNA extraction method for the recovery of genomic DNA from gram-positive and gram-negative oral bacteria to be used in polymerase chain reaction amplification. This method worked great with all samples analyzed, providing an approach to extract DNA for different microorganisms.

  3. Comparison of proteases in DNA extraction via quantitative polymerase chain reaction.

    PubMed

    Eychner, Alison M; Lebo, Roberta J; Elkins, Kelly M

    2015-06-01

    We compared four proteases in the QIAamp DNA Investigator Kit (Qiagen) to extract DNA for use in multiplex polymerase chain reaction (PCR) assays. The aim was to evaluate alternate proteases for improved DNA recovery as compared with proteinase K for forensic, biochemical research, genetic paternity and immigration, and molecular diagnostic purposes. The Quantifiler Kit TaqMan quantitative PCR assay was used to measure the recovery of DNA from human blood, semen, buccal cells, breastmilk, and earwax in addition to low-template samples, including diluted samples, computer keyboard swabs, chewing gum, and cigarette butts. All methods yielded amplifiable DNA from all samples.

  4. Touchdown digital polymerase chain reaction for quantification of highly conserved sequences in the HIV-1 genome.

    PubMed

    De Spiegelaere, Ward; Malatinkova, Eva; Kiselinova, Maja; Bonczkowski, Pawel; Verhofstede, Chris; Vogelaers, Dirk; Vandekerckhove, Linos

    2013-08-15

    Digital polymerase chain reaction (PCR) is an emerging absolute quantification method based on the limiting dilution principle and end-point PCR. This methodology provides high flexibility in assay design without influencing quantitative accuracy. This article describes an assay to quantify HIV DNA that targets a highly conserved region of the HIV-1 genome that hampers optimal probe design. To maintain high specificity and allow probe binding and hydrolysis of a probe with low melting temperature, a two-stage touchdown PCR was designed with a first round of amplification at high temperature and a subsequent round at low temperature to allow accumulation of fluorescence.

  5. Rapid diagnosis of invasive pulmonary aspergillosis by quantitative polymerase chain reaction using bronchial lavage fluid.

    PubMed

    Kawazu, Masahito; Kanda, Yoshinobu; Goyama, Susumu; Takeshita, Masataka; Nannya, Yasuhito; Niino, Miyuki; Komeno, Yukiko; Nakamoto, Tetsuya; Kurokawa, Mineo; Tsujino, Shiho; Ogawa, Seishi; Aoki, Katsunori; Chiba, Shigeru; Motokura, Toru; Ohishi, Nobuya; Hirai, Hisamaru

    2003-01-01

    Polymerase chain reaction (PCR) is a sensitive method for detection of Aspergillus DNA in bronchoalveolar lavage fluid, but it has not yet been able to distinguish infection from contamination. We have established a technique to quantify Aspergillus DNA using a real-time PCR method to resolve this problem, and we report herein a successful application of real-time PCR to diagnose invasive pulmonary aspergillosis by comparing the amount of Aspergillus DNA in bronchial lavage fluid from an affected area to that from an unaffected area. This novel tool will provide rapid, sensitive, and specific diagnosis of pulmonary aspergillosis.

  6. Conserved aspartic acid 233 and alanine 231 are not required for poliovirus polymerase function in replicons

    PubMed Central

    Freistadt, Marion S; Eberle, Karen E

    2007-01-01

    Nucleic acid polymerases have similar structures and motifs. The function of an aspartic acid (conserved in all classes of nucleic acid polymerases) in motif A remains poorly understood in RNA-dependent RNA polymerases. We mutated this residue to alanine in a poliovirus replicon. The resulting mutant could still replicate, although at a reduced level. In addition, mutation A231C (also in motif A) yielded high levels of replication. Taken together these results show that poliovirus polymerase conserved residues D233 and A231 are not essential to poliovirus replicon function. PMID:17352827

  7. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples

    PubMed Central

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-01-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR. PMID:26350449

  8. Comparison of Nested Polymerase Chain Reaction and Real-Time Polymerase Chain Reaction with Parasitological Methods for Detection of Strongyloides stercoralis in Human Fecal Samples.

    PubMed

    Sharifdini, Meysam; Mirhendi, Hossein; Ashrafi, Keyhan; Hosseini, Mostafa; Mohebali, Mehdi; Khodadadi, Hossein; Kia, Eshrat Beigom

    2015-12-01

    This study was performed to evaluate nested polymerase chain reaction (PCR) and real-time PCR methods for detection of Strongyloides stercoralis in fecal samples compared with parasitological methods. A total of 466 stool samples were examined by conventional parasitological methods (formalin ether concentration [FEC] and agar plate culture [APC]). DNA was extracted using an in-house method, and mitochondrial cytochrome c oxidase subunit 1 and 18S ribosomal genes were amplified by nested PCR and real-time PCR, respectively. Among 466 samples, 12.7% and 18.2% were found infected with S. stercoralis by FEC and APC, respectively. DNA of S. stercoralis was detected in 18.9% and 25.1% of samples by real-time PCR and nested PCR, respectively. Considering parasitological methods as the diagnostic gold standard, the sensitivity and specificity of nested PCR were 100% and 91.6%, respectively, and that of real-time PCR were 84.7% and 95.8%, respectively. However, considering sequence analyzes of the selected nested PCR products, the specificity of nested PCR is increased. In general, molecular methods were superior to parasitological methods. They were more sensitive and more reliable in detection of S. stercoralis in comparison with parasitological methods. Between the two molecular methods, the sensitivity of nested PCR was higher than real-time PCR.

  9. A real-time polymerase chain reaction assay for rapid, sensitive, and specific quantification of the JAK2V617F mutation using a locked nucleic acid-modified oligonucleotide.

    PubMed

    Denys, Barbara; El Housni, Hakim; Nollet, Friedel; Verhasselt, Bruno; Philippé, Jan

    2010-07-01

    The JAK2V617F mutation has emerged as an essential molecular determinant of myeloproliferative neoplasms (MPNs). The aim of this study was to evaluate the analytical and clinical performances of a real-time PCR (qPCR) assay using a combination of hydrolysis probes and a wild-type blocking oligonucleotide, all containing locked nucleic acid (LNA) bases. Moreover, we validated a procedure for precise quantification of the JAK2V617F allele burden. We used DNA samples from patients suspected to suffer from MPN and dilutions of HEL cells, carrying the mutation, to compare the LNA-qPCR assay to two previously published methods. All assays detected the same 36 JAK2V617F positive patients of 116 suspected MPN diagnostic samples. No amplification of normal donor DNA was observed in the LNA-qPCR, and the assay was able to detect and reproducibly quantify as few as 0.4% of the JAK2V617F allele in wild-type alleles. Quantification of the JAK2V617F allele burden showed similar proportion levels among the different MPN entities as described by other groups. In conclusion, the LNA-qPCR is a rapid, robust, sensitive, and highly specific assay for quantitative JAK2V617F determination that can be easily implemented in clinical molecular diagnostic laboratories. Moreover, precise quantification allows determination of JAK2V617F burden at diagnosis as well as the evaluation of response to JAK2 inhibitors.

  10. Translation of a laboratory-validated equine herpesvirus-1 specific real-time PCR assay into an insulated isothermal polymerase chain reaction (iiPCR) assay for point-of-need diagnosis using POCKIT™ nucleic acid analyzer.

    PubMed

    Balasuriya, Udeni B R; Lee, Pei-Yu Alison; Tsai, Yun-Long; Tsai, Chuan-Fu; Shen, Yu-Han; Chang, Hsiao-Fen Grace; Skillman, Ashley; Wang, Hwa-Tang Thomas; Pronost, Stéphane; Zhang, Yan

    2017-03-01

    Equine herpesvirus myeloencephalopathy (EHM), a major problem for the equine industry in the United States, is caused by equine herpesvirus-1 (EHV-1). In addition, EHV-1 is associated with upper respiratory disease, abortion, and chorioretinal lesions in horses. Here we describe the development and evaluation of an inexpensive, user-friendly insulated isothermal PCR (iiPCR) method targeting open reading 30 (ORF30) to detect both neuropathogenic and non-neuropathogenic strains on the field-deployable POCKIT™ device for point-of-need detection of EHV-1. The analytical sensitivity of the EHV-1 iiPCR assay was 13 genome equivalents per reaction. The assay did not cross react with ten non-target equine viral pathogens. Performance of the EHV-1 iiPCR assay was compared to two previously described real-time PCR (qPCR) assays in two laboratories by using 104 archived clinical samples. All 53 qPCR-positive and 46 of the 51 qPCR-negative samples tested positive and negative, respectively, by the iiPCR. The agreement between the two assays was 95.19% (confidence interval 90.48-99.90%) with a kappa value of 0.90. In conclusion, the newly developed EHV-1 iiPCR assay is robust to provide specificity and sensitivity comparable to qPCR assays for the detection of EHV-1 nucleic acid in clinical specimens.

  11. Fibrin glue mixed with gelatin/hyaluronic acid/chondroitin-6-sulfate tri-copolymer for articular cartilage tissue engineering: the results of real-time polymerase chain reaction.

    PubMed

    Chou, Cheng-Hung; Cheng, Winston T K; Kuo, Tzong-Fu; Sun, Jui-Sheng; Lin, Feng-Huei; Tsai, Jui-Che

    2007-09-01

    Autologous fibrin glue has been demonstrated as a potential scaffold with very good biocompatibility for neocartilage formation. However, fibrin glue has been reported not to provide enough mechanical strength, but with many growth factors to interfere the tissue growth. Gelatin/hyaluronic acid/chondroitin-6-sulfate (GHC6S) tri-copolymer sponge has been prepared as scaffold for cartilage tissue engineering and showed very good results, but problems of cell seeding and cell distribution troubled the researchers. In this study, GHC6S particles would be added into the fibrin glue to provide better mechanical strength, better cell distribution, and easier cell seeding, which would be expected to improve cartilage regeneration in vitro. Porcine cryo-precipitated fibrinogen and thrombin prepared from prothrombin activated by 10% CaCl(2) solution were used in two groups. One is the fibrin glue group in which porcine chondrocytes were mixed with thrombin-fibrinogen solution, which was then converted into fibrin glue. The other is GHC6S-fibrin glue in which GHC6S particles were added into the thrombin-fibrinogen solution with porcine chondrocytes. After culturing for 1-2 weeks, the chondrocytes cultured in GHC6S-fibrin glue showed a round shape with distinct lacuna structure and showed positive in S-100 protein immunohistochemical stain. The related gene expressions of tissue inhibitor of metalloproteinases-1, matrix metalloproteinase-2, MT1-MMP, aggrecan, decorin, type I, II, X collagen, interleukin-1 beta, transforming growth factor-beta 1 (TGF-beta1), and Fas-associating death domain were checked by real-time PCR. The results indicated that the chondrocytes cultured in GHC6S-fibrin glue would effectively promote extracellular matrix (ECM) secretion and inhibit ECM degradation. The evidence could support that GHC6S-fibrin glue would be a promising scaffold for articular cartilage tissue engineering.

  12. A microfluidic device providing continuous-flow polymerase chain reaction heating and cooling

    NASA Astrophysics Data System (ADS)

    Harandi, A.; Farquhar, T.

    2014-11-01

    The objective of this study is to describe a new type of microfluidic device that could be used to manipulate fluid temperature in many microfluidic applications. The key component is a composite material containing a thermally conductive phase placed in a purposeful manner to manipulate heat flow into and out of an embedded microchannel. In actual use, the device is able to vary temperature along a defined flow path with remarkable precision. As a demonstration of capability, a functional prototype was designed and fabricated using four layers of patterned copper laminated between alternating layers of polyimide and acrylic. The key fabrication steps included laser micromachining, acid etching, microchannel formation, and hot lamination. In order to achieve the desired temperature variations along the microchannel, an outer optimization loop and an inner finite element analysis loop were used to iteratively obtain a near-optimal copper pattern. With a minor loss of generality, admissible forms were restricted to comb-like patterns. For a given temperature profile, the pattern was found by refining a starting guess based on a deterministic rubric. Thermal response was measured using fine thermocouples placed at critical locations along the microchannel wall. At most of these points, the agreement between measured and predicted temperatures was within 1 °C, and temperature gradients as high as ±45 °C mm-1 (equivalent to ±90 °C s-1 at 2 μl min-1 flow rate) were obtained within the range of 59-91 °C. The particular profile chosen for case study makes it possible to perform five cycles of continuous-flow polymerase chain reaction (PCR) in less than 15 s, i.e. it entails five successive cycles of cooling from 91 to 59 °C, rapid reheating from 59 to 73 °C, slow reheating from 73 to 76 °C, and a final reheating from 73 to 91 °C, using a resistively heated source at 100 °C at and a thermoelectrically cooled sink at 5 °C.

  13. Quantitative Polymerase Chain Reaction Analysis of the Mouse Cyp2j Subfamily: Tissue Distribution and Regulation.

    PubMed

    Graves, Joan P; Gruzdev, Artiom; Bradbury, J Alyce; DeGraff, Laura M; Li, Huiling; House, John S; Hoopes, Samantha L; Edin, Matthew L; Zeldin, Darryl C

    2015-08-01

    Members of the cytochrome P450 CYP2J subfamily are expressed in multiple tissues in mice and humans. These enzymes are active in the metabolism of fatty acids to generate bioactive compounds. Herein we report new methods and results for quantitative polymerase chain reaction (qPCR) analysis for the seven genes (Cyp2j5, Cyp2j6, Cyp2j8, Cyp2j9, Cyp2j11, Cyp2j12, and Cyp2j13) of the mouse Cyp2j subfamily. SYBR Green primer sets were developed and compared with commercially available TaqMan primer/probe assays for specificity toward mouse Cyp2j cDNA, and analysis of tissue distribution and regulation of Cyp2j genes. Each TaqMan primer/probe set and SYBR Green primer set were shown to be specific for their intended mouse Cyp2j cDNA. Tissue distribution of the mouse Cyp2j isoforms confirmed similar patterns of expression between the two qPCR methods. Cyp2j5 and Cyp2j13 were highly expressed in male kidneys, and Cyp2j11 was highly expressed in both male and female kidneys. Cyp2j6 was expressed in multiple tissues, with the highest expression in the small intestine and duodenum. Cyp2j8 was detected in various tissues, with highest expression found in the skin. Cyp2j9 was highly expressed in the brain, liver, and lung. Cyp2j12 was predominately expressed in the brain. We also determined the Cyp2j isoform expression in Cyp2j5 knockout mice to determine whether there was compensatory regulation of other Cyp2j isoforms, and we assessed Cyp2j isoform regulation during various inflammatory models, including influenza A, bacterial lipopolysaccharide, house dust mite allergen, and corn pollen. Both qPCR methods detected similar suppression of Cyp2j6 and Cyp2j9 during inflammation in the lung.

  14. Direct and sensitive detection of a pathogenic protozoan, Toxoplasma gondii, by polymerase chain reaction.

    PubMed Central

    Burg, J L; Grover, C M; Pouletty, P; Boothroyd, J C

    1989-01-01

    We applied the polymerase chain reaction to detection of the pathogenic protozoan Toxoplasma gondii based on our identification of a 35-fold-repetitive gene (the B1 gene) as a target. Using this procedure, we were able to amplify and detect the DNA of a single organism directly from a crude cell lysate. This level of sensitivity also allowed us to detect the B1 gene from purified DNA samples containing as few as 10 parasites in the presence of 100,000 human leukocytes. This is representative of the maximal cellular infiltration (10(5)/ml) in 1 ml of cerebrospinal fluid obtained from patients with toxoplasmic encephalitis. The B1 gene is present and conserved in all six T. gondii strains tested to date, including two isolates from patients with acquired immunodeficiency syndrome. No signal was detected by using this assay and DNAs from a variety of other organisms, including several which might be found in the central nervous system of an immunocompromised host. This combination of sensitivity and specificity should make detection of the B1 gene based on polymerase chain reaction amplification a very useful method for diagnosis of toxoplasmosis both in immunocompromised hosts and in congenitally infected fetuses. Images PMID:2768467

  15. Diagnosis of Fusarium keratitis in an animal model using the polymerase chain reaction

    PubMed Central

    Alexandrakis, G.; Jalali, S.; Gloor, P.

    1998-01-01

    AIMS/BACKGROUND—The purpose of this study was apply the polymerase chain reaction (PCR) to develop a sensitive, specific, and rapid test to diagnose Fusarium keratitis. Fusarium is the most common cause of fungal corneal infection in some parts of the world. It is often difficult to establish that a keratitis is due to fungal infection.
METHODS—Fusarium solani keratitis was induced in three eyes of three rabbits by injection of a suspension of the fungus into the anterior corneal stroma. In one rabbit the contralateral eye served as a control. From four to 28 days after inoculation, the corneas were scraped for culture, then scraped and swabbed for PCR analysis. The PCR was performed with primers directed against a portion of the Fusarium cutinase gene, and the presence or absence of this amplified target sequence was determined by agarose gel.
RESULTS—The amplified DNA sequence was detected in 25 of 28 samples from the corneas infected with Fusarium, for a sensitivity of 89%. Only three of the 14 samples from these eyes with Fusarium keratitis were positive by culture, for a sensitivity of 21%. Seven of eight control samples were negative by the PCR based test, for a specificity of 88%.
CONCLUSION—This PCR based test holds promise of being an effective method of diagnosing Fusarium keratitis as well as Fusarium infections at other sites.

 Keywords: keratitis; Fusarium; ulcer; cornea; polymerase chain reaction PMID:9602631

  16. Development of an on-site rapid real-time polymerase chain reaction system and the characterization of suitable DNA polymerases for TaqMan probe technology.

    PubMed

    Furutani, Shunsuke; Naruishi, Nahoko; Hagihara, Yoshihisa; Nagai, Hidenori

    2016-08-01

    On-site quantitative analyses of microorganisms (including viruses) by the polymerase chain reaction (PCR) system are significantly influencing medical and biological research. We have developed a remarkably rapid and portable real-time PCR system that is based on microfluidic approaches. Real-time PCR using TaqMan probes consists of a complex reaction. Therefore, in a rapid real-time PCR, the optimum DNA polymerase must be estimated by using actual real-time PCR conditions. In this study, we compared the performance of three DNA polymerases in actual PCR conditions using our rapid real-time PCR system. Although KAPA2G Fast HS DNA Polymerase has the highest enzymatic activity among them, SpeedSTAR HS DNA Polymerase exhibited better performance to rapidly increase the fluorescence signal in an actual real-time PCR using TaqMan probes. Furthermore, we achieved rapid detection of Escherichia coli in 7 min by using SpeedSTAR HS DNA Polymerase with the same sensitivity as that of a conventional thermal cycler.

  17. Validity of the polymerase chain reaction in the diagnosis of clinically suspected cases of American visceral leishmaniasis.

    PubMed

    Pedrosa, Celia Maria Silva; Ximenes, Ricardo Arraes de Alencar; Almeida, Wendell Alexandre Pinheiro de; Rocha, Eliana Maria Mauricio da

    2013-01-01

    To test the validity of the polymerase chain reaction for diagnosing American visceral leishmaniasis, 88 suspected cases were studied. Diagnosis was confirmed in 47 (53.5%) and ruled out in 41 (46.5%) patients. Samples of bone marrow and peripheral blood were processed by polymerase chain reaction to evaluate the sensitivity and specificity of the test and its agreement beyond chance with microscopy examination. The polymerase chain reaction was positive in bone marrow of 100% of the patients with amastigotes seen with microscopy examination, and in 59.5% in those where no parasite were seen. Agreement beyond chance between visualization of the parasite in bone marrow aspirates and polymerase chain reaction was considered weak (Kappa=0.41). Concordance between polymerase chain reaction of bone marrow aspirates and of peripheral blood was considered excellent (Kappa=0.88). The test turned out positive in all bone marrow aspirates of those with the disease and whereas the positivity rate was 58.5% among those without the disease, with specificity rate of 41.5%.

  18. Following DNA chain extension and protein conformational changes in crystals of a Y-family DNA polymerase by Raman crystallography

    PubMed Central

    Espinoza-Herrera, Shirly J.; Gaur, Vineet; Suo, Zucai; Carey, Paul R.

    2013-01-01

    Y-family DNA polymerases are known to bypass DNA lesions in vitro and in vivo. Sulfolobus solfataricus DNA polymerase (Dpo4) was chosen as a model Y-family enzyme for investigating the mechanism of DNA synthesis in single crystals. Crystals of Dpo4 in complexes with DNA (the binary complex) in the presence or absence of an incoming nucleotide were analyzed by Raman microscopy. 13C, 15N labeled d*CTP, or unlabeled dCTP, were soaked into the binary crystals with G as the templating base. In the presence of the catalytic metal ions, Mg2+ or Mn2+, nucleotide incorporation was detected by the disappearance of the triphosphate band of dCTP and the retention of C* modes in the crystal following soaking out of noncovalently bound C(or *C)TP. The addition of the second coded base, thymine, was observed by adding cognate dTTP to the crystal following single d*CTP addition. Adding these two bases caused visible damage to the crystal possibly caused by protein and/or DNA conformational change within the crystal. When d*CTP is soaked into the Dpo4 crystal in the absence of Mn2+ or Mg2+, the primer extension reaction did not occur; instead a ternary protein/template/d*CTP complex was formed. In the Raman difference spectra of both binary and ternary complexes, in addition to the modes of d(*C)CTP, features appear due to ring modes from the template/primer bases being perturbed and from the DNA backbone, as well as from perturbed peptide and amino acid side chain modes. These effects are more pronounced in the ternary than in the binary complex. Using standardized Raman intensities followed as a function of time C(*C)TP population in the crystal maximized at about 20 min. These remained unchanged in the ternary complex but declined in the binary complexes as chain incorporation occurred. PMID:23855392

  19. Single nucleotide polymorphisms in the ovine casein genes detected by polymerase chain reaction-single strand conformation polymorphism.

    PubMed

    Ceriotti, G; Chessa, S; Bolla, P; Budelli, E; Bianchi, L; Duranti, E; Caroli, A

    2004-08-01

    Casein genetic polymorphisms are important and well known due to their effects on quantitative traits and technological properties of milk. At the DNA level, polymerase chain reaction (PCR)-single-strand conformation polymorphism (SSCP) allows for the simultaneous typing of several alleles at casein loci, as well as the detection of unknown polymorphisms. Here we describe the usefulness of the PCR-SSCP technique for casein typing in sheep. In particular, three single-nucleotide polymorphisms (SNP) are described at CSN1S1, CSN2, and CSN3, all resulting in amino acid exchanges. At CSN1S1, a transition T-->C was found, resulting in the deduced amino acid exchange Ile186-->Thr186. A transition A-->G resulting in the deduced amino acid exchange Met183-->Val183 was identified at CSN2. The 2 SNP showed a rather high frequency (ranging from 0.12 to 0.26) in 3 Italian breeds (Sarda, Comisana, Sopravissana). Another transition C-->T (Ser104-->Leu104) was found at CSN3 in one heterozygous animal.

  20. Deoxyribonucleic acid polymerase III of Escherichia coli. Purification and properties.

    PubMed

    Livingston, D M; Hinkle, D C; Richardson, C C

    1975-01-25

    DNA polymerase III has been purified 4,500-fold from the Escherichis coli mutant, HMS83, which lacks DNA polymerases I and II. When subjected to disc gel electrophoresis, the most purified fraction exhibits a single major protein band from which enzymatic activity may be recovered. Polyacrylamide gel electrophoresis under denaturing conditions produces two protein bands with molecular weights of 140,000 and 40,000. The sedimentation coefficient of the enzyme is 7.0 S, and the Stokes radius is 62 A. Taken together these tow parameters indicate a native molecular weight of 180,000. Purified DNA polymerase III catalyzes the polymerization of nucleotides into DNA when provided with both a DNA template and a complementary primer strand. The newly synthesized DNA is covalently attached to the 3' terminus of the primer strand. Because the extent of polymerization is only 10 to 100 nucleotides, the best substrates are native DNA molecules with small single-stranded regions. The most purified enzyme preparation is devoid of endonuclease activities. In addition to the two exonuclease activities described in the accompanying paper, purified polymerase III also catalyzes pyrophosphorolysis and the exchange of pyrophosphate into deoxynucleoside triphosphates. DNA polymerase III has also been isolated from wild type E. coli containing the other two known DNA polymerases. Futhermore, the enzyme purified from three different polC mutants exhibits altered polymerase III activity, confirming that polC is the structural gene for DNA polymerase III (Gefter, M., Hirota, Y., Kornberb, T., Wechsler, J., and Barnoux, C. (1971) Proc. Natl. Acad. Sci. U. S. A. 68, 3150-3153).

  1. Routine application of the polymerase chain reaction for detection of Mycobacterium tuberculosis in clinical samples.

    PubMed Central

    Noordhoek, G T; Kaan, J A; Mulder, S; Wilke, H; Kolk, A H

    1995-01-01

    AIM--To investigate the use of the polymerase chain reaction (PCR) in the routine laboratory for the detection of Mycobacterium tuberculosis in clinical samples. METHODS--Samples were divided and processed separately for the detection of M tuberculosis by microscopy, culture and PCR. After DNA extraction, PCR was performed with primers specific for the insertion element IS6110 and the product was analysed by agarose gel electrophoresis, Southern blotting or dot blotting and hybridisation with a digoxigenin labelled internal probe. Each sample was tested for inhibitors of Taq polymerase with the aid of an internal control. Multiple negative and positive controls were used to monitor each step of the procedure. RESULTS--The data from two laboratories, using the same operating procedures, were combined. Of 1957 specimens, 79 (4%) were culture and PCR positive, while 1839 (93.9%) were negative in both tests. Thirty specimens (1.5%) were PCR positive only and nine (0.5%) were culture positive but PCR negative. CONCLUSION--Using culture and clinical history as the gold standard, sensitivity and specificity for PCR were 92.1% and 99.8%, respectively. With elaborate precautions, PCR is a suitable and reliable method for the detection of M tuberculosis in clinical samples in a routine microbiology laboratory. Images PMID:7490312

  2. Gene synthesis by integrated polymerase chain assembly and PCR amplification using a high-speed thermocycler

    PubMed Central

    TerMaat, Joel R.; Pienaar, Elsje; Whitney, Scott E.; Mamedov, Tarlan G.; Subramanian, Anuradha

    2013-01-01

    Polymerase chain assembly (PCA) is a technique used to synthesize genes ranging from a few hundred base pairs to many kilobase pairs in length. In traditional PCA, equimolar concentrations of single stranded DNA oligonucleotides are repeatedly hybridized and extended by a polymerase enzyme into longer dsDNA constructs, with relatively few full-length sequences being assembled. Thus, traditional PCA is followed by a second primer-mediated PCR reaction to amplify the desired full-length sequence to useful, detectable quantities. Integration of assembly and primer-mediated amplification steps into a single reaction using a high-speed thermocycler is shown to produce similar results. For the integrated technique, the effects of oligo concentration, primer concentration, and number of oligonucleotides are explored. The technique is successfully demonstrated for the synthesis of two genes encoding EPCR-1 (653 bp) and pUC19 β-lactamase (929 bp) in under 20 min. However, rapid integrated PCA–PCR was found to be problematic when attempted with the TM-1 gene (1509 bp). Partial oligonucleotide sets of TM-1 could be assembled and amplified simultaneously, indicating that the technique may be limited to a maximum number of oligonucleotides due to competitive annealing and competition for primers. PMID:19799938

  3. Increased sample capacity for genotyping and expression profiling by kinetic polymerase chain reaction.

    PubMed

    Watson, Robert M; Griaznova, Olga I; Long, Christopher M; Holland, Michael J

    2004-06-01

    We fabricated and evaluated high-throughput kinetic thermal cyclers with 768-reaction capacity for kinetic polymerase chain reaction (kPCR)-based genotyping and kinetic reverse transcription (kRT)-PCR-based transcript quantitation. The system uses dye-based detection with ethidium bromide and a single DNA polymerase-based PCR or RT-PCR assay. Allele-specific detection of the two most common hereditary hemochromotosis mutant alleles, C282Y and H63D, was reliably measured by kPCR using human DNA templates as low as 10 genome equivalents per assay. Transcript profiling was performed for 16 yeast transcripts ranging in intracellular abundance over four orders of magnitude. Standard deviations of the PCR cycle threshold values determined from multiple kRT-PCR assays in three different instruments ranged from 0.11 to 0.97 PCR cycles and were reproducible, transcript specific, and instrument independent. The effects of the sin3, gal11, and snf2 knockout mutations on expression of 385 yeast genes were evaluated by kRT-PCR and compared to published values determined by high-density oligonucleotide array and/or microarray analysis for snf2 and sin3. The 768-reaction kinetic thermalcyclers, each with a capacity for more than a half million assays per year, are well suited to genomics applications such as single nucleotide polymorphism/disease association studies and genomewide transcription profiling where high sensitivity and accuracy are required.

  4. Rapid polymerase chain reaction diagnosis of white-nose syndrome in bats

    USGS Publications Warehouse

    Lorch, J.M.; Gargas, A.; Meteyer, C.U.; Berlowski-Zier, B. M.; Green, D.E.; Shearn-Bochsler, V.; Thomas, N.J.; Blehert, D.S.

    2010-01-01

    A newly developed polymerase chain reaction (PCR)-based method to rapidly and specifically detect Geomyces destructans on the wings of infected bats from small quantities (1-2 mg) of tissue is described in the current study (methods for culturing and isolating G. destructans from bat skin are also described). The lower limits of detection for PCR were 5 fg of purified fungal DNA or 100 conidia per 2 mg of wing tissue. By using histology as the standard, the PCR had a diagnostic specificity of 100% and a diagnostic sensitivity of 96%, whereas the diagnostic sensitivity of culture techniques was only 54%. The accuracy and fast turnaround time of PCR provides field biologists with valuable information on infection status more rapidly than traditional methods, and the small amount of tissue required for the test would allow diagnosis of white-nose syndrome in live animals.

  5. [The application of the polymerase chain reaction technic for the detection of human papillomavirus sequences].

    PubMed

    Soto, Y; Muné, M; Goicolea, A; Morales, E; Santoyo, J M; Valdés, O; Ramírez, R; Pimentel, T

    1998-01-01

    The polymerase chain reaction technique was applied to detect sequences of human Papillomavirus (HPV) by controls of cellular lines of cervical cancer and of tissues obtained through biopsy with a HPV-positive clinical diagnosis. A set of consensus oligonucleotides, which are complementary to a highly conserved region within the open reading frame E1 of the viral genome of HPV affecting the cervical mucosa, was used. With these primers it was possible to amplify DNA sequences corresponding to HPV 6 and 11, considered in the low risk group, and to HPV 16, 18, 31 and 33, included in the high risk group. The study of the sensitivity of the amplification technique showed a level of detection of 3,5 viral particles per each cellular diploid genome.

  6. Polymerase chain reaction detection of potentially pathogenic free-living amoebae in dental units.

    PubMed

    Leduc, Annie; Gravel, Sabrina; Abikhzer, Jérémie; Roy, Stéphane; Barbeau, Jean

    2012-07-01

    Several genera of amoebae can be found in water from dental units and on the inner surface of waterlines. The presence of bacterial biofilms on these surfaces is thought to favor the proliferation of amoebae. Potentially pathogenic Acanthamoeba and Naegleria spp. may be an infection risk for patients through contact with open surgical sites or aerosolization. A polymerase chain reaction of DNA extracted from pelleted samples showed that Acanthamoeba spp. and Naegleria spp. were present in water from dental units, suction lines, and suction filters at the dental clinic of the Université de Montréal. Acanthamoeba spp. were detected in 24.2% of 66 samples and Naegleria spp. in 3.0%. We discuss the infection risk associated with these results.

  7. Glyco-seek: Ultrasensitive Detection of Protein-Specific Glycosylation by Proximity Ligation Polymerase Chain Reaction.

    PubMed

    Robinson, Peter V; Tsai, Cheng-Ting; de Groot, Amber E; McKechnie, Julia L; Bertozzi, Carolyn R

    2016-08-31

    We report a non-destructive biochemical technique, termed "Glyco-seek", for analysis of O-GlcNAcylated proteins. Glyco-seek combines chemoenzymatic labeling, proximity ligation, and quantitative polymerase chain reaction to detect O-GlcNAcylated proteins with ultrahigh sensitivity. Our glycan-specific assay can be paired with traditional proximity ligation assays to simultaneously determine the change in total protein levels. We show that Glyco-seek detects attomoles of glycoproteins of interest from cell lysates, with sensitivity several orders of magnitude higher than that of current techniques. We used the method to directly assay the O-GlcNAcylation status of a low-abundance transcription factor from cell lysates without need for isolation or enrichment.

  8. Prevalence of Dirofilaria immitis infection in dogs from Celestun, Mexico, using polymerase chain reaction test.

    PubMed

    Caro-Gonzalez, Johny Antonio; Bolio-Gonzalez, Manuel Emilio; Escobedo-Ortegón, Francisco Javier; Manrique-Saide, Pablo; Rodriguez-Vivas, Roger Ivan; Rodriguez-Buenfil, Jorge Carlos; Sauri-Arceo, Carlos Humberto

    2011-02-01

    The aim of this study was to determine the prevalence of Dirofilaria immitis in dogs and to analyze risk factors associated with infection at Celestun, a coastal locality in southeast Mexico. Blood samples were collected from 279 asymptomatic individuals between August 2007 and March 2008 and analyzed by polymerase chain reaction technique. The association between D. immitis infection and sex, age group, and distance of residence from a wetland of dogs was statistically analyzed. Prevalence of D. immitis infection was of 59.8%. Age of individuals (>2 years) was a risk factor for infection with D. immitis (odds ratio 2.49, confidence interval 1.47-4.23, p=0.001). In conclusion, Celestun can be considered a focus of D. immitis infection with high levels of transmission among the local dog population, as confirmed by the high prevalence reported and the association of age (dogs >2 years) as a risk associated with infection.

  9. Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications.

    PubMed

    Cao, Lei; Cui, Xingye; Hu, Jie; Li, Zedong; Choi, Jane Ru; Yang, Qingzhen; Lin, Min; Ying Hui, Li; Xu, Feng

    2017-04-15

    Since the invention of polymerase chain reaction (PCR) in 1985, PCR has played a significant role in molecular diagnostics for genetic diseases, pathogens, oncogenes and forensic identification. In the past three decades, PCR has evolved from end-point PCR, through real-time PCR, to its current version, which is the absolute quantitive digital PCR (dPCR). In this review, we first discuss the principles of all key steps of dPCR, i.e., sample dispersion, amplification, and quantification, covering commercialized apparatuses and other devices still under lab development. We highlight the advantages and disadvantages of different technologies based on these steps, and discuss the emerging biomedical applications of dPCR. Finally, we provide a glimpse of the existing challenges and future perspectives for dPCR.

  10. Discrepancies between Antigen and Polymerase Chain Reaction Tests for the Detection of Rotavirus and Norovirus.

    PubMed

    Kim, Hyun Soo; Kim, Jae-Seok

    2016-05-01

    We compared the results of an antigen test (ELISA) with those of polymerase chain reaction (PCR) for the detection of rotavirus and norovirus in stool specimens. Rotavirus and norovirus antigen-positive stool specimens were collected, and rotavirus and norovirus PCRs were performed on these specimens. Of the 325 rotavirus antigen-positive specimens, 200 were positive for both assays and 125 were PCR negative. Of 286 norovirus antigen-positive specimens, 51 were PCR negative. Comparison of the lower limit of detection showed that rotavirus PCR was 16 times more sensitive and norovirus PCR was over 4,000 times more sensitive than the ELISA. Discrepant results between ELISA and PCR were common, and the possibility of false-positive and false-negative results should be considered with rotavirus and norovirus assays.

  11. Detection of flaviviruses by reverse transcriptase-polymerase chain reaction with the universal primer set.

    PubMed

    Meiyu, F; Huosheng, C; Cuihua, C; Xiaodong, T; Lianhua, J; Yifei, P; Weijun, C; Huiyu, G

    1997-01-01

    Using a universal primer set designed to match the sequence of the NS1 gene of flaviviruses, the virus RNA of dengue (DEN), Japanese encephalitis (JEV), powassan and langat of Flaviviridae were successfully amplified by polymerase chain reaction (PCR) via cDNA; and with different internal primers, the serotypes of the dengue viruses were identified. Of the 78 clinically diagnosed dengue fever patients, 18 patients were positive for DEN 1, 48 patients for DEN 2 and 8 patients concurrently infected with DEN 4. Of the 52 patients admitted with Japanese encephalitis (JE), 45 were determined to be JEV infections. By nested PCR, we completed the identification of flaviviruses within 2 days. The results show that seven primers have a potential value for rapid clinical diagnosis of flavivirus infections.

  12. Detection of Mycoplasma Contamination Directly from Culture Supernatant Using Polymerase Chain Reaction.

    PubMed

    Pisal, R V; Hrebíková, H; Chvátalová, J; Kunke, D; Filip, S; Mokrý, J

    2016-01-01

    Ensuring mycoplasma-free cell culture is of prime importance as they severely affect cellular characteristics leading to experimental artefacts and spurious results. Various methods persist for mycoplasma detection; out of the whole array of methods polymerase chain reaction (PCR) is the most favoured one because it is highly sensitive, specific and quick. The PCR-based detection procedure involves three steps: cell culture supernatant collection, DNA isolation, and PCR. We have modified this procedure so that cell culture supernatant can directly be used for PCR without the need for DNA extraction. This modification makes the procedure quicker and more sensitive because loss of mycoplasma DNA is prevented and this loss becomes more significant when the level of mycoplasma contamination is very low.

  13. Identification of genetically modified potato (Solanum tuberosum) cultivars using event specific polymerase chain reaction.

    PubMed

    Côté, Marie-José; Meldrum, Allison J; Raymond, Philippe; Dollard, Cheryl

    2005-08-24

    Several genetically modified (GM) cultivars are registered in Canada although they are not currently in commercial production. The GM cultivars can be distinguished from the non-GM and other GM cultivars by analyzing the DNA nucleotide sequence at the insertion site of the transgene corresponding to a single transformation event in the plant genome. Techniques based on modified polymerase chain reaction (PCR) strategies were used to generate sequence information from the plant genome flanking the insertion site of transgenic DNA for specific GM potato events. The plant genome sequence adjacent to the transgenic insertion was used to design PCR primers, which could be used in combination with a primer annealing to one of the nearby inserted genetic elements to amplify an event specific DNA fragment. The event specific PCR fragments generated were sequenced to confirm the specificity of the method.

  14. Detection of rodent coronaviruses in tissues and cell cultures by using polymerase chain reaction.

    PubMed Central

    Homberger, F R; Smith, A L; Barthold, S W

    1991-01-01

    A polymerase chain reaction (PCR) method was developed for the detection of rodent coronaviruses in biological material by using reverse transcriptase and two primers which flanked an M gene sequence of 375 bp. PCR detected all of 11 different strains of mouse hepatitis virus (MHV) as well as rat sialodacryoadenitis virus but not bovine coronavirus or human coronavirus strains OC43 and 229E. The M gene sequences of bovine coronavirus and human coronavirus OC43 are homologous to that of MHV, but minor differences exist in the primer regions, preventing annealing of the primers. For detecting MHV-Y in tissue samples, PCR was faster than and at least as sensitive as either of the two bioassays (infant mouse bioassay and mouse antibody production test) currently used for MHV diagnostic purposes. Images PMID:1661745

  15. Identification of Actinobacillus actinomycetemcomitans by leukotoxin gene-specific hybridization and polymerase chain reaction assays.

    PubMed Central

    Tønjum, T; Haas, R

    1993-01-01

    Eleven strains of Actinobacillus actinomycetemcomitans isolated from cases of systemic infections, local abscesses, and periodontitis were identified by genetic assays using the leukotoxin gene as the target. We have developed a polymerase chain reaction (PCR) assay, based on the leukotoxin structural gene of this pathogen, which clearly identified all tested strains of A. actinomycetemcomitans and separated them from the closely related Haemophilus aphrophilus as well as other bacterial species. Furthermore, DNA-DNA hybridization was performed with the cloned partial leukotoxin structural gene (lktA) as a probe, which again clearly distinguished A. actinomycetemcomitans from H. aphrophilus, parts of the normal oral flora, and species harboring RTX (repeats in toxin) family-related cytotoxins. The PCR fragment amplified from the leukotoxin structural gene gave results similar to those given by the cloned leukotoxin gene when used as a probe in hybridization experiments. The hybridization and PCR assays described here are fundamental improvements for the identification of A. actinomycetemcomitans. Images PMID:8349764

  16. Polymerase chain reaction of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia in primary endodontic infections.

    PubMed

    Gomes, Brenda P F A; Montagner, Francisco; Jacinto, Rogério Castilho; Zaia, Alexandre A; Ferraz, Caio Cezar Randi; Souza-Filho, Francisco J

    2007-09-01

    The aim of this study was to investigate the correlation between endodontic clinical signs and symptoms and the presence of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia or their association by nested polymerase chain reaction assay. Microbial samples were taken from 50 cases with necrotic pulp tissues in primary infections. DNA was extracted from the samples, which were analyzed for the presence of three endodontic pathogens by using species-specific primers. P gingivalis, T denticola, and T forsythia were detected in 46%, 38%, and 22% of the symptomatic cases, respectively. The bacterial complex composed by T forsythia, P gingivalis, and T denticola was found in 14% of the cases with spontaneous pain, tenderness to percussion, swelling, and pain on palpation. The high prevalence of P gingivalis, T denticola, and T forsythia in the samples examined suggests that these bacteria are related to the etiology of symptomatic periradicular diseases.

  17. Multiplex polymerase chain reaction method to detect Cyclospora, Cystoisospora, and Microsporidia in stool samples.

    PubMed

    Taniuchi, Mami; Verweij, Jaco J; Sethabutr, Orntipa; Bodhidatta, Ladaporn; Garcia, Lynne; Maro, Athanasia; Kumburu, Happiness; Gratz, Jean; Kibiki, Gibson; Houpt, Eric R

    2011-12-01

    Cyclospora, Cystoisospora, and Microsporidia are eukaryotic enteropathogens that are difficult to detect in stool samples because they require special stains and microscopy. We developed a multiplex polymerase chain reaction (PCR) reaction with 4 primer sets to amplify Cyclospora cayetanensis, Cystoisospora belli, Enterocytozoon bieneusi, and Encephalitozoon intestinalis. Detection of the amplicon is through specific probes coupled to Luminex beads. Sensitivity of the assay was evaluated using Encephalitozoon intestinalis spores and revealed detection of 10(1) spores spiked into stool. No cross-reactivity was observed. We evaluated the assay on diarrheal specimens from Thailand, Tanzania, Indonesia, and the Netherlands that had been previously tested by microscopy, and the assay yielded 87-100% sensitivity and 88-100% specificity. Microscopy-negative/PCR-positive samples had lower Luminex values, suggesting they were true but with lower burden infections. In summary, this is a convenient single PCR reaction that can detect Cyclospora, Cystoisospora, and Microsporidia without the need for cumbersome microscopic analysis.

  18. Separation-Type Multiplex Polymerase Chain Reaction Chip for Detecting Male Infertility

    NASA Astrophysics Data System (ADS)

    Ha, Seung-Mo; Ju, Jin-Kyoung; Ahn, Yoomin; Hwang, Seung Young

    2008-06-01

    A novel polymerase chain reaction (PCR) biochip is presented in this paper. In this PCR chip, the glass substrate integrated with the microheater and microsensor is separable from the reaction chamber where the sample is injected, which now makes repeated reuse of the glass substrate possible. The heat transfer efficiency and target gene amplification of the proposed separable PCR chip was compared with that of the conventional united PCR chip. The results showed that the sex-determining Y chromosome (SRY) gene PCR for detecting male infertility was successfully performed in the separable chip. However, repeated multiplex PCR was successful for only two genes, SPGY1 and SRY, but not for gene SY586. Future work is needed for a multiplex PCR with more than three genes.

  19. Genotypic study of verocytotoxic Escherichia coli isolates from deer by multiplex polymerase chain reaction

    PubMed Central

    Mishra, Raghavendra Prasad; Jain, Udit; Singh, Rakesh Kumar

    2016-01-01

    Aim: This study was planned to study the genotypes of verocytotoxigenic Escherichia coli (VTEC) in fecal samples of deer due to its public health significance. Materials and Methods: A total of 160 fecal samples of deer were taken from Mathura district and Kanpur Zoo and screened for VTEC genes by polymerase chain reaction (PCR). Results: All fecal samples were positive for E. coli. All the E. coli isolates were screened by PCR to detect virulence genes stx1, stx2, eaeA, and hlyA. Of these, 15 isolates were found positive for VTEC having one or more genes in different combinations. Conclusion: Genes such as stx1, stx2, eaeA, and hlyA were prevalent in VTEC isolates from feces of deer. The presence of VTEC isolates having virulent genes may pose a threat to public health. PMID:27651685

  20. Rapid identification of mycobacteria to the species level by polymerase chain reaction and restriction enzyme analysis.

    PubMed Central

    Telenti, A; Marchesi, F; Balz, M; Bally, F; Böttger, E C; Bodmer, T

    1993-01-01

    A method for the rapid identification of mycobacteria to the species level was developed on the basis of evaluation by the polymerase chain reaction (PCR) of the gene encoding for the 65-kDa protein. The method involves restriction enzyme analysis of PCR products obtained with primers common to all mycobacteria. Using two restriction enzymes, BstEII and HaeIII, medically relevant and other frequent laboratory isolates were differentiated to the species or subspecies level by PCR-restriction enzyme pattern analysis. PCR-restriction enzyme pattern analysis was performed on isolates (n = 330) from solid and fluid culture media, including BACTEC, or from frozen and lyophilized stocks. The procedure does not involve hybridization steps or the use of radioactivity and can be completed within 1 working day. Images PMID:8381805

  1. The actin multigene family and livestock speciation using the polymerase chain reaction.

    PubMed

    Fairbrother, K S; Hopwood, A J; Lockley, A K; Bardsley, R G

    1998-01-01

    Actins constitute a family of highly-conserved multifunctional intracellular proteins, best known as myofibrillar components in striated muscle fibres. Most vertebrate genomes contain numerous actin genes with high sequence homology in protein coding regions but considerable variability in intron number and sizes. This genetic diversity can be utilised for livestock speciation purposes. The high sequence conservation has enabled a single pair of oligonucleotides to be used to prime the polymerase chain reaction (PCR) with DNA extracted from all animals so far studied. Multiple amplification products were obtained which on gel electrophoresis constituted characteristic species-specific 'fingerprints'. The patterns were reproducible, did not vary between individuals of the same breed or between different breeds within a species, and could be generated even from heat-processed muscle held at 120 degrees C for one hour. Given the capacity of PCR to amplify relatively short sequences in highly-degraded DNA, this approach may be suitable for authentication of processed meat products.

  2. Rapid detection of pathogenic leptospires by lyophilized reagent-based polymerase chain reaction.

    PubMed

    Lee, S V; Tai, E S; Mutalib, A R; Khairani-Bejo, S; Bahaman, A R

    2011-12-01

    A simple and reliable tool for the early diagnosis of leptospirosis is urgently needed. We report the development of a lyophilized reagent-based polymerase chain reaction (PCR) assay targeting lipL32 gene, which is present only in pathogenic leptospires. To determine the effectiveness of the newly developed assay in the early diagnosis of leptospirosis, the sensitivity and specificity was evaluated. In simulated clinical samples, the assay was able to detect 10² and 10³ leptospires/ml in spiked urine and blood samples, respectively. In experimentally infected animals, leptospiral DNA could be detected in blood and lung samples as early as Day 1 post infection. This assay was also shown to be stable and remained sensitive for up to five months at ambient temperature. Hence, this lyophilized reagent-based PCR assay with high specificity, sensitivity and stability would provide a simple, rapid and reliable method in diagnosing acute leptospirosis, especially in the field of veterinary medicine.

  3. A simple multiplex polymerase chain reaction to determine ABO blood types of rhesus macaques (Macaca mulatta).

    PubMed

    Premasuthan, A; Kanthaswamy, S; Satkoski, J; Smith, D G

    2011-06-01

    Rhesus macaques are the most common nonhuman primate model organism used in biomedical research. Their increasingly frequent use as subjects in studies involving transplantation requires that blood and other tissue antigens of donors and recipients be compatible. We report here an easy and rapid multiplex polymerase chain reaction (PCR) to determine the ABO blood group phenotypes of rhesus macaques that can be performed with only small amounts of DNA. We phenotyped 78 individuals and found this species to exhibit the A, B and AB phenotypes in frequencies that vary by geographic region. The probability of randomly pairing rhesus macaque donors and recipients that exhibit major ABO phenotype incompatibility is approximately 0.35 and 0.45 for Indian and Chinese rhesus macaques, respectively.

  4. Assembling long heteroduplexes by asymmetric polymerase chain reaction and annealing the resulting single-stranded DNAs.

    PubMed

    Wang, Mugui; Wei, Chuchu; Ye, Xiufen; Liu, Jianping; Zhang, Cuicui; Chen, Hao; Zhang, Xiaobo; Tu, Jumin

    2015-04-15

    We developed an effective protocol for generating high-purity heteroduplexes via annealing single-stranded DNAs (ssDNAs) derived from plasmid DNA by asymmetric polymerase chain reaction (A-PCR). With the addition of dimethyl sulfoxide, a one-step A-PCR procedure can generate ssDNAs stably at a range of reaction temperatures. Several annealing buffers can anneal two ssDNAs into heteroduplexes effectively. We further developed a simple strategy to create d(GATC) hemimethylated heteroduplexes by annealing fully methylated homoduplexes in the presence of excessive unmethylated ssDNAs. The constructed heteroduplexes have been well tested as substrates for mismatch repair in Escherichia coli and, thus, can be used in various biotechnology applications.

  5. Rapid detection for rabbit-derived dermatophytes using microsatellite-primed polymerase chain reaction.

    PubMed

    Miao, Zengmin; Li, Song; Li, Daijun; Cai, Chunmei; Cai, Yumei

    2014-01-01

    A method exhibiting high sensitivity, specificity and rapidity to detect pathogenic dermatophytes was developed using microsatellite-primed polymerase chain reaction (PCR) in combination with a clustering method. The DNA fragments of Trichophyton mentagrophyton, Microsporum gypseum and Microsporum canis were amplified by using the primer (GACA)4 to detect the DNA polymorphism fingerprints. Twenty-one clinical strains identified as T. mentagrophyton, M. gypseum or M. canis by morphological methods were distinguished according to the differences of standard stains' bands combined with NTSYS-pc2.10 software. The results showed that there were obvious and direct differences in the bands of the three pathogenic dermatophytes, and the similarity of isolated strains and standard strains were above 90%, in line with the results of morphological identification. The method is more accurate, rapid and simple, which is meaningful for the clinical diagnosis and epidemic research of the dermatophytes.

  6. Detection of human papillomavirus types 45 and 51 by type-specific polymerase chain reaction.

    PubMed

    Weyn, Christine; Boulenouar, Selma; Mathys, Vanessa; Vanhoolandt, Julie; Bernis, Aurore; Fontaine, Véronique

    2007-12-01

    Human papillomavirus (HPV) types 45 and 51 are both considered as high risk types for the development of human cervical cancer. To optimize the detection of these two types in clinical samples, HPV-45 and HPV-51 specific primers were designed to amplify respectively a 141bp and a 266bp fragment from the L1 gene by polymerase chain reaction (PCR). The sensitivity and the specificity of these two PCR reactions were determined using varying amounts of HPV DNA containing plasmids and negative and positive controls. Overall, the sensitivity for the HPV-45 plasmid DNA is 10fg, while for HPV-51 the sensitivity is 1fg. This is equivalent to approximately 100 and 10 HPV genome copies per PCR reaction, respectively.

  7. Principles and applications of polymerase chain reaction in medical diagnostic fields: a review

    PubMed Central

    Valones, Marcela Agne Alves; Guimarães, Rafael Lima; Brandão, Lucas André Cavalcanti; de Souza, Paulo Roberto Eleutério; de Albuquerque Tavares Carvalho, Alessandra; Crovela, Sergio

    2009-01-01

    Recent developments in molecular methods have revolutionized the detection and characterization of microorganisms in a broad range of medical diagnostic fields, including virology, mycology, parasitology, microbiology and dentistry. Among these methods, Polymerase Chain Reaction (PCR) has generated great benefits and allowed scientific advancements. PCR is an excellent technique for the rapid detection of pathogens, including those difficult to culture. Along with conventional PCR techniques, Real-Time PCR has emerged as a technological innovation and is playing an ever-increasing role in clinical diagnostics and research laboratories. Due to its capacity to generate both qualitative and quantitative results, Real-Time PCR is considered a fast and accurate platform. The aim of the present literature review is to explore the clinical usefulness and potential of both conventional PCR and Real-Time PCR assays in diverse medical fields, addressing its main uses and advances. PMID:24031310

  8. Identification of Rickettsia conorii infection by polymerase chain reaction in a soldier returning from Somalia.

    PubMed

    Williams, W J; Radulovic, S; Dasch, G A; Lindstrom, J; Kelly, D J; Oster, C N; Walker, D H

    1994-07-01

    A soldier developed characteristic manifestations of boutonneuse fever shortly after leaving Somalia. Rickettsial DNA was detected in a biopsy sample of the tache noire by a polymerase chain reaction (PCR) in which primers derived from the 190-kD antigen gene of Rickettsia rickettsii were used. The source of this DNA was identified as Rickettsia conorii by restriction fragment length polymorphism (RFLP) analysis of the PCR product. R. conorii was also isolated from the skin biopsy specimen. The patient did not develop a significant increase in specific antibodies, as assessed by indirect fluorescent antibody testing, until several weeks after the onset of symptoms. This case demonstrates that the PCR/RFLP technique can be used for the direct identification of rickettsiae from clinical specimens. To our knowledge, this is the first confirmed case of R. conorii infection in Somalia.

  9. Fluorosugar Chain Termination Agents as Probes of the Sequence Specificity of a Carbohydrate Polymerase

    PubMed Central

    Brown, Christopher D.; Rusek, Max S.; Kiessling, Laura L.

    2012-01-01

    Naturally occurring carbohydrate polymers are ubiquitous. They are assembled by polymerizing glycosyltransferases, which can generate polysaccharide products with repeating sequence patterns. The fidelity of enzymes of this class is unknown. We report a method for testing the fidelity of carbohydrate polymerase pattern deposition: we synthesized fluorosugar donors and used them as chain termination agents. The requisite nucleotide fluorosugars could be produced from a single intermediate using the Jacobsen catalyst in a kinetically controlled separation of diastereomers. The resulting fluorosugar donors were used by galactofuranosyltransferase GlfT2 from Myco-bacterium tuberculosis (M. tb), and the data indicate that this enzyme mediates the cell wall galactan production through a sequence-specific polymerization. PMID:22458542

  10. Monitoring Acidophilic Microbes with Real-Time Polymerase Chain Reaction (PCR) Assays

    SciTech Connect

    Frank F. Roberto

    2008-08-01

    Many techniques that are used to characterize and monitor microbial populations associated with sulfide mineral bioleaching require the cultivation of the organisms on solid or liquid media. Chemolithotrophic species, such as Acidithiobacillus ferrooxidans and Leptospirillum ferrooxidans, or thermophilic chemolithotrophs, such as Acidianus brierleyi and Sulfolobus solfataricus can grow quite slowly, requiring weeks to complete efforts to identify and quantify these microbes associated with bioleach samples. Real-time PCR (polymerase chain reaction) assays in which DNA targets are amplified in the presence of fluorescent oligonucleotide primers, allowing the monitoring and quantification of the amplification reactions as they progress, provide a means of rapidly detecting the presence of microbial species of interest, and their relative abundance in a sample. This presentation will describe the design and use of such assays to monitor acidophilic microbes in the environment and in bioleaching operations. These assays provide results within 2-3 hours, and can detect less than 100 individual microbial cells.

  11. Detection of DNA sequence polymorphisms in carcinogen metabolism genes by polymerase chain reaction

    SciTech Connect

    Bell, D.A. )

    1991-01-01

    The glutathione transferase mu gene (GST1) and the debrisoquine hydroxylase gene (CYP2D6) are known to be polymorphic in the human population and have been associated with increased susceptibility to cancer. Smokers with low lymphocyte GST mu activity are at higher risk for lung cancer, while low debrisoquine hydroxylase activity has been correlated with lower risk for lung and bladder cancer. Phenotypic characterization of these polymorphisms by lymphocyte enzyme activity (GST) and urine metabolite ratios (debrisoquine) is cumbersome for population studies. Recent cloning and sequencing of the mutant alleles of these genes has allowed genotyping via the polymerase chain reaction (PCR). Advantages of PCR approaches are speed, technical simplicity, and minimal sample requirements. This article reviews the PCR-based methods for detection of genetic polymorphisms in human cancer susceptibility genes.

  12. Preparation of 13C/15N-labeled oligomers using the polymerase chain reaction

    DOEpatents

    Chen, Xian; Gupta, Goutam; Bradbury, E. Morton

    2001-01-01

    Preparation of .sup.13 C/.sup.15 N-labeled DNA oligomers using the polymerase chain reaction (PCR). A PCR based method for uniform (.sup.13 C/.sup.15 N)-labeling of DNA duplexes is described. Multiple copies of a blunt-ended duplex are cloned into a plasmid, each copy containing the sequence of interest and restriction Hinc II sequences at both the 5' and 3' ends. PCR using bi-directional primers and uniformly .sup.13 C/.sup.15 N-labeled dNTP precursors generates labeled DNA duplexes containing multiple copies of the sequence of interest. Twenty-four cycles of PCR, followed by restriction and purification, gave the uniformly .sup.13 C/.sup.15 N-labeled duplex sequence with a 30% yield. Such labeled duplexes find significant applications in multinuclear magnetic resonance spectroscopy.

  13. Single primer-mediated circular polymerase chain reaction for hairpin DNA cloning and plasmid editing.

    PubMed

    Huang, Jiansheng; Khan, Inamullah; Liu, Rui; Yang, Yan; Zhu, Naishuo

    2016-05-01

    We developed and validated a universal polymerase chain reaction (PCR) method, single primer circular (SPC)-PCR, using single primer to simultaneously insert and amplify a short hairpin sequence into a vector with a high success rate. In this method, the hairpin structure is divided into two parts and fused into a vector by PCR. Then, a single primer is used to cyclize the chimera into a mature short hairpin RNA (shRNA) expression vector. It is not biased by loop length or palindromic structures. Six hairpin DNAs with short 4-nucleotide loops were successfully cloned. Moreover, SPC-PCR was also applied to plasmid editing within 3 h with a success rate higher than 95%.

  14. The quantitative real-time polymerase chain reaction for the analysis of plant gene expression.

    PubMed

    Fitzgerald, Timothy L; McQualter, Richard B

    2014-01-01

    The quantitative real-time polymerase chain reaction is used to simultaneously amplify and quantify a targeted DNA molecule. It can be used to determine exact copy number of a molecule within a sample and/or to compare the quantity of a molecule between samples. When combined with reverse transcription, it is a powerful tool for the analysis of gene expression, and it is widely used for this purpose in plant species. Here we provide an introduction to fundamental concepts relevant for the analysis of gene expression in plants using this technique and a protocol for quantification of the relative expression of a sucrose phosphate synthase gene along the maturation gradient of a sugarcane leaf.

  15. Fast real-time polymerase chain reaction for quantitative detection of Lactobacillus delbrueckii bacteriophages in milk.

    PubMed

    Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A

    2008-12-01

    One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.

  16. Presence of Legionellaceae in warm water supplies and typing of strains by polymerase chain reaction.

    PubMed Central

    Zietz, B.; Wiese, J.; Brengelmann, F.; Dunkelberg, H.

    2001-01-01

    Outbreaks of Legionnaire's disease present a public health challenge especially because fatal outcomes still remain frequent. The aim of this study was to describe the abundance and epidemiology of Legionellaceae in the human-made environment. Water was sampled from hot-water taps in private and public buildings across the area of Göttingen, Germany, including distant suburbs. Following isolation, we used polymerase chain reaction in order to generate strain specific banding profiles of legionella isolates. In total, 70 buildings were examined. Of these 18 (26%) had the bacterium in at least one water sample. Legionella pneumophila serogroups 1, 4, 5 and 6 could be identified in the water samples. Most of the buildings were colonized solely by one distinct strain, as proven by PCR. In three cases equal patterns were found in separate buildings. There were two buildings in this study where isolates with different serogroups were found at the same time. PMID:11293675

  17. Detection of Rickettsia rickettsii DNA in clinical specimens by using polymerase chain reaction technology.

    PubMed Central

    Tzianabos, T; Anderson, B E; McDade, J E

    1989-01-01

    A polymerase chain reaction (PCR) procedure for detecting rickettsial DNA was developed and shown to be specific for Rickettsia rickettsii and R. conorii, the etiologic agents of Rocky Mountain spotted fever (RMSF) and Boutonneuse fever, respectively. Blood clots were obtained from nine confirmed RMSF patients and six controls and analyzed for the presence of rickettsial DNA by the PCR method. A defined region of the rickettsial genome was successfully amplified from seven of the nine clinical specimens tested; all six control specimens gave negative results. These findings indicate that R. rickettsii can be detected early after the onset of RMSF, possibly facilitating the decision regarding appropriate antibiotic therapy for some patients. Further refinement of PCR technology could make this procedure a mainstay in the clinical laboratory. Images PMID:2512328

  18. Use of touch-down polymerase chain reaction to enhance the sensitivity of Mycobacterium bovis detection.

    PubMed

    Zumárraga, Martín J; Meikle, Virginia; Bernardelli, Amelia; Abdala, Alejandro; Tarabla, Hector; Romano, María I; Cataldi, Angel

    2005-05-01

    The confirmatory diagnosis of Mycobacterium bovis (M. bovis) in animal samples is carried out by culture in Stonebrink media. However, culture is very slow because of the extremely long duplication time of the bacillus and difficult because of the scarcity of bacilli in diagnostic samples. This study describes the development of a single-tube touch-down polymerase chain reaction (PCR) protocol for the detection of M. bovis using primers that target the IS6110 element. Spiked water and milk as well as routine diagnostic samples (milk and nasal swabs) from M. bovis-positive cattle were tested. This protocol allows the rapid and sensitive detection of M. bovis in bovine samples by enhancing the sensitivity of standard PCR amplification.

  19. Gene analysis of multiple oral bacteria by the polymerase chain reaction coupled with capillary polymer electrophoresis.

    PubMed

    Liu, Chenchen; Yamaguchi, Yoshinori; Sekine, Shinichi; Ni, Yi; Li, Zhenqing; Zhu, Xifang; Dou, Xiaoming

    2016-03-01

    Capillary polymer electrophoresis is identified as a promising technology for the analysis of DNA from bacteria, virus and cell samples. In this paper, we propose an innovative capillary polymer electrophoresis protocol for the quantification of polymerase chain reaction products. The internal standard method was modified and applied to capillary polymer electrophoresis. The precision of our modified internal standard protocol was evaluated by measuring the relative standard deviation of intermediate capillary polymer electrophoresis experiments. Results showed that the relative standard deviation was reduced from 12.4-15.1 to 0.6-2.3%. Linear regression tests were also implemented to validate our protocol. The modified internal standard method showed good linearity and robust properties. Finally, the ease of our method was illustrated by analyzing a real clinical oral sample using a one-run capillary polymer electrophoresis experiment.

  20. Acanthamoeba can be differentiated by the polymerase chain reaction and simple plating assays.

    PubMed

    Khan, N A; Jarroll, E L; Paget, T A

    2001-09-01

    Acanthamoeba are opportunistic pathogens with invasive and noninvasive species. For clinical purposes it is important to differentiate potentially pathogenic from nonpathogenic isolates. For the rapid and sensitive identification of Acanthamoeba at the genus level, we used a polymerase chain reaction (PCR)-based method which detected as few as five cells. Further, we tested nine isolates of Acanthamoeba for their ability to produce cytopathic effects (CPE) on corneal epithelial cells. On the basis of the results, Acanthamoeba were divided into pathogenic or nonpathogenic groups. However, because CPE assays are not available to every diagnostic laboratory, we developed a simple plating assay based on osmotolerance which correlated well with the CPE assays. Pathogenic Acanthamoeba showed growth on higher osmolarity (agar plates containing one molar mannitol), while growth of nonpathogens was inhibited on these plates. In conclusion, we have developed methods for the rapid identification and differentiation of Acanthamoeba.

  1. Analysis of raw meats and fats of pigs using polymerase chain reaction for Halal authentication.

    PubMed

    Aida, A A; Che Man, Y B; Wong, C M V L; Raha, A R; Son, R

    2005-01-01

    A method for species identification from pork and lard samples using polymerase chain reaction (PCR) analysis of a conserved region in the mitochondrial (mt) cytochrome b (cyt b) gene has been developed. Genomic DNA of pork and lard were extracted using Qiagen DNeasy(®) Tissue Kits and subjected to PCR amplification targeting the mt cyt b gene. The genomic DNA from lard was found to be of good quality and produced clear PCR products on the amplification of the mt cyt b gene of approximately 360 base pairs. To distinguish between species, the amplified PCR products were cut with restriction enzyme BsaJI resulting in porcine-specific restriction fragment length polymorphisms (RFLP). The cyt b PCR-RFLP species identification assay yielded excellent results for identification of pig species. It is a potentially reliable technique for detection of pig meat and fat from other animals for Halal authentication.

  2. A new approach to primer selection in polymerase chain reaction experiments

    SciTech Connect

    Pearson, W.R.; Robins, G.; Wrege, D.E.; Zhang, Tongtong

    1995-12-31

    We address the problem of primer selection in polymerase chain reaction (PCR) experiments. We prove that the problem of minimizing the number of primers required to amplify a set of DNA sequences is NP-complete, and show that even approximating solutions to this problem to within a constant factor times optimal is intractable. On the practical side, we give a simple branch-and-bound algorithm that solves the primers minimization problem within reasonable time for typical instances. We present an efficient approximation scheme for this problem, and prove that our heuristic always produces solutions no worse than a logarithmic factor times the optimal, this being the best approximation possible within polynomial time. Finally, we analyze a weighted variant, where both the number of primers as well as the sum of their {open_quotes}costs{close_quotes} is optimized simultaneously. We conclude by presenting the empirical performance of our methods on biological data.

  3. Polymerase chain reaction method for leptospirosis, analysis on samples from an autochthon swine population in Sicily, Italy.

    PubMed

    Vitale, Maria; Vitale, Fabrizio; Di Marco, Vincenzo; Curró, Vittoria; Vesco, Gesualdo; Caracappa, Santo

    2005-01-01

    We set a method targeting 16 rRNA gene consisting in a single polymerase chain reaction of 40 cycles which is specific for pathogenic leptospira. Negative polymerase chain reaction results were observed with nonpathogenic Leptospira (serovar patoc) and other bacteria species. By this method a survey on a population of autochthon swine herds had been conducted in Sicily particularly on kidney samples of slaughtered animals and on urine samples from live animals. The analysis showed that a prevalence of leptospira up to 40 % can be observed on these animals. Results on other bovine and ovine herds from the same province in Sicily showed a lower prevalence.

  4. Direct polymerase chain reaction for detection of toxigenic Corynebacterium diphtheriae strains from the Republic of Georgia after prolonged storage.

    PubMed

    Kobaidze, K; Popovic, T; Nakao, H; Quick, L

    2000-02-01

    A total of 226 paired nose and throat swab specimens from 113 clinical diphtheria cases from the republic of Georgia were analyzed by direct polymerase chain reaction targeting both A and B subunits of the diphtheria toxin gene, tox. Even after prolonged transport and extensive storage (7-14 months) of the clinical specimens in silica gel packages, direct polymerase chain reaction detected the diphtheria tox gene in 54% of the specimens. Specimens obtained by throat swab were three times more likely than those obtained by nose swab to be positive for Corynebacterium diphtheriae.

  5. Picoliter Well Array Chip-Based Digital Recombinase Polymerase Amplification for Absolute Quantification of Nucleic Acids.

    PubMed

    Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude

    2016-01-01

    Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm(2) area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10(-1) to 4 × 10(-3) copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings.

  6. Picoliter Well Array Chip-Based Digital Recombinase Polymerase Amplification for Absolute Quantification of Nucleic Acids

    PubMed Central

    Li, Zhao; Liu, Yong; Wei, Qingquan; Liu, Yuanjie; Liu, Wenwen; Zhang, Xuelian; Yu, Yude

    2016-01-01

    Absolute, precise quantification methods expand the scope of nucleic acids research and have many practical applications. Digital polymerase chain reaction (dPCR) is a powerful method for nucleic acid detection and absolute quantification. However, it requires thermal cycling and accurate temperature control, which are difficult in resource-limited conditions. Accordingly, isothermal methods, such as recombinase polymerase amplification (RPA), are more attractive. We developed a picoliter well array (PWA) chip with 27,000 consistently sized picoliter reactions (314 pL) for isothermal DNA quantification using digital RPA (dRPA) at 39°C. Sample loading using a scraping liquid blade was simple, fast, and required small reagent volumes (i.e., <20 μL). Passivating the chip surface using a methoxy-PEG-silane agent effectively eliminated cross-contamination during dRPA. Our creative optical design enabled wide-field fluorescence imaging in situ and both end-point and real-time analyses of picoliter wells in a 6-cm2 area. It was not necessary to use scan shooting and stitch serial small images together. Using this method, we quantified serial dilutions of a Listeria monocytogenes gDNA stock solution from 9 × 10-1 to 4 × 10-3 copies per well with an average error of less than 11% (N = 15). Overall dRPA-on-chip processing required less than 30 min, which was a 4-fold decrease compared to dPCR, requiring approximately 2 h. dRPA on the PWA chip provides a simple and highly sensitive method to quantify nucleic acids without thermal cycling or precise micropump/microvalve control. It has applications in fast field analysis and critical clinical diagnostics under resource-limited settings. PMID:27074005

  7. New Deoxyribonucleic Acid Polymerase Induced by Bacillus subtilis Bacteriophage PBS2

    PubMed Central

    Price, Alan R.; Cook, Sandra J.

    1972-01-01

    The deoxyribonucleic acid (DNA) of Bacillus subtilis phage PBS2 has been confirmed to contain uracil instead of thymine. PBS2 phage infection of wild-type cells or DNA polymerase-deficient cells results in an increase in the specific activity of DNA polymerase. This induction of DNA polymerase activity is prevented by actinomycin D and chloramphenicol. In contrast to the major B. subtilis DNA polymerase, which prefers deoxythymidine triphosphate (dTTP) to deoxyuridine triphosphate (dUTP), the DNA polymerase in crude extracts of PBS2-infected cells is equally active whether dTTP or dUTP is employed. This phage-induced polymerase may be responsible for the synthesis of uracil-containing DNA during PBS2 phage infection. PMID:4623224

  8. Development of a polymerase chain reaction test for specific identification of the urinary tract pathogen Aerococcus urinae.

    PubMed Central

    Aguirre, M; Collins, M D

    1993-01-01

    A polymerase chain reaction test was developed for identification of the gram-positive urinary tract pathogen Aerococcus urinae. Oligonucleotide primers were based on highly specific sequences within the small-subunit rRNA gene. A confirmatory test based on hybridization of the amplified products to a highly specific internal probe was also developed. Images PMID:7684752

  9. National Department of Defense Surveillance for Invasive Streptococcus Pneumoniae: Antibiotic Resistance, Serotype Distribution, and Arbitrarily Primed Polymerase Chain Reaction Analyses

    DTIC Science & Technology

    2008-02-15

    penicillin -susceptible and peni- cillin-resistant Streptococcnspneuttmoniae serotypes in Canada. J Infect Dis Streptococcus pneumoniae Surveillance Group...Gray for the Streptococcus pneumonia Surveillance Group Report No. 00-44 Approved for public release; distribution unlimited. NAVAL HEALTH RESEARCH...Defense Surveillance for Invasive Streptococcus pneumoniae : Antibiotic Resistance, Serotype Distribution, and Arbitrarily Primed Polymerase Chain

  10. A multiplex real-time polymerase chain reaction assay differentiates between Bolbphorus damnificus and Bolbophorus type II sp

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A duplex quantitative real-time polymerase chain reaction (qPCR) assay was developed to differentiate between Bolbophorus damnificus and Bolbophorus type II species cercariae. Both trematode species are prevalent throughout the commercial catfish industry,.as both infect the ram’s horn snail, Plano...

  11. Polymerase Chain Reaction in the Diagnosis of Visceral Leishmaniasis Recurrence in the Setting of Negative Splenic Smears.

    PubMed

    Hasnain, Golam; Basher, Ariful; Nath, Proggananda; Ghosh, Prakash; Hossain, Faria; Hossain, Shakhawat; Mondal, Dinesh

    2016-01-01

    This report presents two cases of visceral leishmaniasis (VL) recurrence where the microscopy of the splenic smear failed in diagnosis. However, a strong clinical suspicion compelled further evaluation by polymerase chain reaction (PCR), which validated the etiology. This short report highlights the usefulness of PCR in diagnosing cases of suspected smear-negative VL recurrence.

  12. Amplification of Chloroplast DNA Using the Polymerase Chain Reaction (PCR): A Practical Activity for Secondary School Students

    ERIC Educational Resources Information Center

    Hamilton, Kenny; Barfoot, Jan; Crawford, Kathleen E.; Simpson, Craig G.; Beaumont, Paul C.; Bownes, Mary

    2006-01-01

    We describe a polymerase chain reaction (PCR) protocol suitable for use in secondary schools and colleges. This PCR protocol can be used to investigate genetic variation between plants. The protocol makes use of primers which are complementary to sequences of nucleotides that are highly conserved across different plant genera. The regions of…

  13. Polymerase Chain Reaction (PCR)-based methods for detection and identification of mycotoxigenic Penicillium species using conserved genes

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Polymerase chain reaction amplification of conserved genes and sequence analysis provides a very powerful tool for the identification of toxigenic as well as non-toxigenic Penicillium species. Sequences are obtained by amplification of the gene fragment, sequencing via capillary electrophoresis of d...

  14. [THE HIGHLY EFFECTIVE DETECTION OF DNA RICKETTSIA USING TECHNIQUE OF POLYMERASE CHAIN REACTION IN REAL-TIME].

    PubMed

    Kartashov, M Yu; Mikryukova, T P; Ternovoi, V A; Moskvitina, N S; Loktev, V B

    2015-12-01

    The article considers development of highly effective technique of detection of genetic material of ricketsia based on polymerase chain reaction in real-time using original primers to the most conservative sites of gene of citrate synthase (gItA). The analytical sensitivity of the developed polymerase chain reaction in real-time test permits to detect from 80 genome equivalents in analyzed sample during three hours. The high specificity of test-system is substantiated by detection of nucleotide sequences of amplificated fragments of gene gltA. The approbation ofthe polymerase chain reaction in real-time test is carried out on collection of 310 ticks of species I. persulcatus, I. pavlovskyi, D. reticulatus. It is demonstrated that the developed alternate ofprimers and probe permits with high degree of sensitivity and specifcity to detect DNA of different species of ricketsia widespread on territory of Russia (R. sibirica, R. raoultii, R. helvetica, R. tarasevichiae). The proposed polymerase chain reaction in real-time test can be appliedfor isolation of fragment of gene gltA with purpose for detecting nucleotide sequence and subsequent genetic typing of ricketsia. The application ofthe proposed technique can facilitate task of monitoring hot spots of ricketsiosis.

  15. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay.

    PubMed Central

    Young, K K; Resnick, R M; Myers, T W

    1993-01-01

    Amplification of RNA by the polymerase chain reaction (PCR) is normally a two-step process requiring separate enzymes and buffer conditions. We describe a combined reverse transcription-PCR (RT-PCR) assay for hepatitis C virus (HCV) RNA amplification in which a single enzyme and buffer condition are used. In this assay, both the RT and PCR steps are carried out with the thermoactive DNA polymerase of Thermus thermophilus. A transcription vector containing HCV sequences has also been constructed to generate quantifiable HCV RNA templates that can be used to optimize reaction conditions and to assess the efficiency of amplification. Amplification from < or = 100 copies of RNA was detected reproducibly by gel electrophoresis. The assay sensitivity was increased to 10 RNA copies by hybridization to a probe. The patterns of viremia in three individuals infected with HCV were examined by amplification of HCV RNA from plasma samples collected serially over a period of 1 year. These results were correlated with the times of seroconversion and the onset of rise in levels of alanine aminotransferase in serum. In all three subjects, HCV RNA was detected prior to seroconversion and the initial rise in levels of alanine aminotransferase in serum. Upon seroconversion, HCV RNA fell to a level below the detection limit of the assay. This pattern of transient viremia appears to be characteristic of acute, resolving HCV infections. The combined RT-PCR assay is a sensitive method which circumvents the problems associated with PCR amplification of RNA. Using this assay, we demonstrated that three donors infected by the same index case all have similar patterns of viremia. Images PMID:8385151

  16. Gene expression assay in blood and various tissues using a single-tube real-time reverse transcription-polymerase chain reaction method using an oligodeoxythymidine-immobilized polymerase chain reaction tube.

    PubMed

    Harikai, N; Saito, S; Tanaka, A; Kinoshita, K

    2009-06-01

    A single-tube real-time reverse transcription-polymerase chain reaction (RT-PCR) method has been developed which makes it possible to conduct the entire procedure, from nucleic acid extraction to product detection, in a single PCR tube. In this study, we developed the method using an oligodeoxythymidine-immobilized PCR tube, which enables simple and rapid mRNA extraction and quantification of target genes in blood and other tissues. The beta-actin gene was analyzed from lysates of blood and various tissues using this method. The data showed a good correlation between the plotted threshold cycle values and log(10) of blood and tissue amounts without a reduction in PCR efficiency. Gene expression of interleukin-1beta in blood from lipopolysaccharide (LPS)-stimulated rats and of beta(3)-adrenoceptors in adipose tissue from SHRSP.Z-Lepr (fa)/IzmDmcr (obese SHRSP) rats was also analyzed using the single-tube method, as well as a general real-time RT-PCR method, using RNA purified with a silica membrane column. In both methods, the copy number ratio of interleukin-1beta to beta-actin in LPS-stimulated rats was higher than in control rats, and the ratio of beta(3)-adrenoceptors to beta-actin in obese SHRSP rats was lower than in lean littermates. These results indicate that the single-tube method can provide results equivalent to those from general real-time RTPCR methods in gene expression analysis.

  17. Comparison of Analytic Methods for Quantitative Real-Time Polymerase Chain Reaction Data

    PubMed Central

    Chen, Ping

    2015-01-01

    Abstract Polymerase chain reaction (PCR) is a laboratory procedure to amplify and simultaneously quantify targeted DNA molecules, and then detect the product of the reaction at the end of all the amplification cycles. A more modern technique, real-time PCR, also known as quantitative PCR (qPCR), detects the product after each cycle of the progressing reaction by applying a specific fluorescence technique. The quantitative methods currently used to analyze qPCR data result in varying levels of estimation quality. This study compares the accuracy and precision of the estimation achieved by eight different models when applied to the same qPCR dataset. Also, the study evaluates a newly introduced data preprocessing approach, the taking-the-difference approach, and compares it to the currently used approach of subtracting the background fluorescence. The taking-the-difference method subtracts the fluorescence in the former cycle from that in the latter cycle to avoid estimating the background fluorescence. The results obtained from the eight models show that taking-the-difference is a better way to preprocess qPCR data compared to the original approach because of a reduction in the background estimation error. The results also show that weighted models are better than non-weighted models, and that the precision of the estimation achieved by the mixed models is slightly better than that achieved by the linear regression models. PMID:26204477

  18. Polymerase chain reaction analysis of aqueous humour samples in necrotising retinitis

    PubMed Central

    Tran, T H C; Rozenberg, F; Cassoux, N; Rao, N A; LeHoang, P; Bodaghi, B

    2003-01-01

    Aim: To evaluate the diagnostic value of polymerase chain reaction (PCR) performed on aqueous humour for the detection of viral DNA in patients with necrotising herpetic retinitis. Methods: The clinical features and laboratory results of 22 patients (29 eyes) presenting with necrotising herpetic retinitis between March 1999 and June 2001 were reviewed retrospectively. Aqueous humour was obtained after anterior chamber paracentesis and PCR was performed in all cases. Results: Viral DNA was detected in the aqueous humour of 19 patients (86.4%). Epstein-Barr virus (EBV) seroconversion was evidenced in one additional patient. In the acute retinal necrosis (ARN) group (n = 19), varicella zoster virus (VZV) DNA was identified in six patients, herpes simplex virus 1 (HSV-1) DNA in two patients, herpes simplex virus 2 (HSV-2) DNA in four patients, and cytomegalovirus (CMV) genome in four patients. In the progressive outer retinal necrosis (PORN) group (n = 3), VZV DNA was detected in all patients. No sample was positive for more than one virus. Conclusions: PCR analysis of aqueous humour in patients with clinical features of necrotising viral retinitis can provide specific aetiological orientation and the method appears to be safe and highly sensitive. PMID:12488268

  19. Direct detection of Bacillus anthracis DNA in animals by polymerase chain reaction.

    PubMed Central

    Makino, S I; Iinuma-Okada, Y; Maruyama, T; Ezaki, T; Sasakawa, C; Yoshikawa, M

    1993-01-01

    Bacillus anthracis is a soil pathogen capable of causing anthrax. To establish a method for specifically detecting B. anthracis for practical applications, such as for the inspection of slaughterhouses, the cap region, which is essential for encapsulation in B. anthracis, was used in a DNA hybridization study by polymerase chain reaction (PCR). Oligonucleotide primers were designed to amplify a 288-bp DNA fragment within the capA gene by PCR. The amplified DNA sequence specifically hybridized to the DNA of B. anthracis but not to that of other bacterial strains tested. Since this PCR-based method efficiently and specifically detected the capA sequence of bacteria in blood and spleen samples of mice within 8 h after the administration of live B. anthracis, this PCR system could be used for practical applications. By using lysis methods in preparing the samples for PCR, it was possible to amplify the 288-bp DNA segment from samples containing very few bacteria, as few as only 1 sporeforming unit, indicating that the PCR detection method developed in this study will permit the monitoring of B. anthracis contamination in the environment. Images PMID:8458949

  20. Detection of fastidious mycobacteria in human intestines by the polymerase chain reaction.

    PubMed

    Dumonceau, J M; Van Gossum, A; Adler, M; Van Vooren, J P; Fonteyne, P A; De Beenhouwer, H; Portaels, F

    1997-05-01

    The aim of this study was to determine whether difficult-to-grow mycobacteria are present in human intestines. Intestinal tissue samples were subjected to both mycobacterial culture and a polymerase chain reaction (PCR) assay. After detection by PCR, species identity was determined by hybridizing the amplified 16S rRNA gene fragments with species-specific oligonucleotides. Intestinal biopsies from 63 patients with noninflammatory bowel diseases (n = 22), Crohn's disease (n = 31), or ulcerative colitis (n = 10) were analyzed. Culture and PCR revealed mycobacteria in four (6%) and 25 (40%) samples, respectively. Samples positive by PCR were negative with all probes specific to nine common cultivable species but were positive with Mycobacterium genavense-specific probe in 68% of cases. Mycobacterial isolates were identified as Mycobacterium gordonae and Mycobacterium chelonae. Findings were similar in Crohn's disease samples compared to non-Chron's disease samples. This study shows that difficult-to-grow mycobacteria can be detected by PCR in large and similar proportions of inflamed intestinal tissue from patients with inflammatory bowel disease and intestinal tissue that appears normal from patients with noninflammatory bowel disease.

  1. Use of polymerase chain reaction in human African trypanosomiasis stage determination and follow-up.

    PubMed Central

    Truc, P.; Jamonneau, V.; Cuny, G.; Frézil, J. L.

    1999-01-01

    Stage determination of human African trypanosomiasis is based on the detection of parasites and measurements of biological changes in the cerebrospinal fluid (CSF) (concentration of white blood cells > 5 cells per mm3 and increased total protein levels). The patient is treated accordingly. Demonstration of the absence or presence of trypanosomes by the double centrifugation technique is still the only test available to clinicians for assessing treatment success. In this study, however, we evaluate the polymerase chain reaction (PCR) as a tool for assessing the disease stage of trypanosomiasis and for determining whether treatment has been successful. All 15 study patients considered to be in the advanced stage of the disease were PCR positive; however, trypanosomes were demonstrated by double centrifugation in only 11 patients. Of the five remaining patients, who were considered to be in the early stage, PCR and double centrifugation were negative. Following treatment, 13 of the 15 second-stage patients were found to be negative for the disease in at least two samples by PCR and double centrifugation. Two others were still positive by PCR immediately and one month after the treatment. Trypanosome DNA detection using PCR suggested that the two positive patients were not cured but that their possible relapse could not be identified by a search for parasites using the double centrifugation technique. Further evaluation of the PCR method is required, in particular to determine whether PCR assays could be used in studies on patients who fail to respond to melarsoprol, as observed in several foci. PMID:10534898

  2. [Microsporidium spp. infection in an immunocompromised child diagnosed by polymerase chain reaction].

    PubMed

    Usluca, Selma; Aksoy, Umit

    2010-10-01

    Microsporidium spp. may lead to a variety of clinical pictures like sinusitis, keratoconjunctivitis, hepatitis, myositis, peritonitis, nephritis, encephalitis and pneumonia in case of immune deficiencies. In this report, a case of diarrhea due to Microsporidium spp. has been presented. A four years old male patient who was followed with the diagnosis of myotonic dystrophia, was admitted to the hospital with the complaints of respiratory distress and fever. Due to the history of recurrent infections, further investigations was carried out to clarify the immunological status of the patient, and the total IgA and IgM levels were found as 14 mg/dl and 30 mg/dl, respectively (normal values were; 18-160 and 45-200 mg/dl, respectively). Following bronchoscopy done to enlighten respiratory distress, the patient developed high fever and watery diarrhea. Since bacteriological cultures of the stool yielded Shigella spp., antimicrobial therapy with ciprofloxacin was initiated. Parasitological examination of the stool done by Weber's modified trichrome dye, yielded Microsporidium spp. microscopically and albendazole was added to the treatment. Presence of Microsporidium spp. was confirmed by polymerase chain reaction with the use of C1 and C2 primers (Metabion, Germany) targeted to Microsporidium spp. and besides a 270 bp band specific for Encephalitozoon intestinalis was also obtained. This case emphasized that in case of diarrhea the stool samples of the immunocompromised patients should be evaluated in terms of Microsporidium spp. in addition to the routine parasitologic examinations.

  3. Detection of Helicobacter pylori glmM gene in bovine milk using Nested polymerase chain reaction

    PubMed Central

    Osman, Eyman Y.; El-Eragi, A. M. S.; Musa, Abuobeida M.; El-Magboul, Salma B.; A/Rahman, Magdi B.; Abdo, Abdelmounem E.

    2015-01-01

    Aim: The aim was to detect the glmM gene of Helicobacter pylori (H. pylori) in cow’s milk from different dairy farms in Khartoum State using Nested polymerase chain reaction (PCR). Materials and Methods: A total of 50 milk samples were collected from different dairy farms in Khartoum State (13 from Khartoum, 24 Khartoum North, and 13 from Omdurman Provinces). Results: The generated results showed that 11/50 (22%) were harboring the investigated H. pylori glmM gene in Khartoum State (1/13 [7.7%] Khartoum, 9/24 [37.5%] Khartoum North, and 1/13 [7.7%] Omdurman provinces, respectively). Conclusion: To the best of our knowledge, this was the first report on the detection of H. pylori glmM gene in cattle milk in Khartoum State. Nonetheless, the high percentages of H. pylori DNA detection in milk opened new avenues toward exploring the risk of human infection with H. pylori through the consumption of raw milk. PMID:27047175

  4. A real-time reverse transcriptase polymerase chain reaction for detection and quantification of Vesiculovirus

    PubMed Central

    Tolardo, Aline Lavado; de Souza, William Marciel; Romeiro, Marilia Farignoli; Vieira, Luiz Carlos; Luna, Luciano Kleber de Souza; Henriques, Dyana Alves; de Araujo, Jansen; Siqueira, Carlos Eduardo Hassegawa; Colombo, Tatiana Elias; Aquino, Victor Hugo; da Fonseca, Benedito Antonio Lopes; Bronzoni, Roberta Vieira de Morais; Nogueira, Maurício Lacerda; Durigon, Edison Luiz; Figueiredo, Luiz Tadeu Moraes

    2016-01-01

    Vesiculoviruses (VSV) are zoonotic viruses that cause vesicular stomatitis disease in cattle, horses and pigs, as well as sporadic human cases of acute febrile illness. Therefore, diagnosis of VSV infections by reliable laboratory techniques is important to allow a proper case management and implementation of strategies for the containment of virus spread. We show here a sensitive and reproducible real-time reverse transcriptase polymerase chain reaction (RT-PCR) for detection and quantification of VSV. The assay was evaluated with arthropods and serum samples obtained from horses, cattle and patients with acute febrile disease. The real-time RT-PCR amplified the Piry, Carajas, Alagoas and Indiana Vesiculovirus at a melting temperature 81.02 ± 0.8ºC, and the sensitivity of assay was estimated in 10 RNA copies/mL to the Piry Vesiculovirus. The viral genome has been detected in samples of horses and cattle, but not detected in human sera or arthropods. Thus, this assay allows a preliminary differential diagnosis of VSV infections. PMID:27276185

  5. Detection of helicobacter pylori in benign laryngeal lesions by polymerase chain reaction: a cross sectional study

    PubMed Central

    2012-01-01

    Background Although Helicobacter Pylori (HP) was detected in some cases of chronic laryngitis, the results were not confirmed by polymerase chain reaction (PCR). By this time, it has not been found in laryngeal lesions by in house PCR, the most sensitive method for detecting the genome tracks. Regarding the previous results and also few numbers of studies about the presence of HP in benign laryngeal lesions, specifically by PCR, we aimed to investigate the presence of HP in benign laryngeal lesions by in-house PCR. Methods The samples were taken from 55 patients with benign laryngeal lesions and frozen in −20°C. One milliliter (ml) of lysis buffer was added to 100 mg (mg) of each sample and the tube was placed in 56°C overnight. Then DNA extraction was carried out. Results To find HP DNA, in-house PCR was performed that revealed 5 positive results among 55 patients with benign laryngeal lesions. Of them, 3 were polyp, 1 was nodule and 1 was papilloma. Conclusion Although the number of positive results was not a lot in this study, it was in contrast with previous studies which could not find any HP tracks in benign laryngeal lesions by other methods. More studies about the prevalence of HP in benign laryngeal lesions improve judging about the effect of this infection on benign laryngeal lesions. PMID:22515206

  6. Application of polymerase chain reaction based on ITS1 rDNA to speciate Eimeria.

    PubMed

    Jenkins, M C; Miska, K; Klopp, S

    2006-03-01

    A method was developed to recover Eimeria spp. oocysts directly from poultry litter and determine which species of Eimeria were present using polymerase chain reaction (PCR) based on the ITS1 rDNA sequence. The species composition of Eimeria oocysts was also compared before and after propagation in susceptible chickens to determine if the relative proportion of each species changed after expansion. In samples from two broiler operations, ITS1-PCR was able to detect Eimeria spp. oocysts recovered from litter, with Eimeria acervulina, Eimeria maxima, and Eimeria praecox being the predominant species present therein. Although Eimeria tenella was found in one sample, the other species--Eimeria brunetti, Eimeria necatrix, and Eimeria mitis-were not detected. The species composition as determined by ITS1-PCR did not appear to appreciably alter after expansion in susceptible chickens. The described method represents a rapid means for determining the major Eimeria species in a poultry operation and may be helpful in choosing a particular live oocyst vaccine formulation to protect chickens against coccidiosis.

  7. Identification of bacterial plant pathogens using multilocus polymerase chain reaction/electrospray ionization-mass spectrometry.

    PubMed

    Postinikova, E; Baldwin, C; Whitehouse, C A; Sechler, A; Schaad, N W; Sampath, R; Harpin, V; Li, F; Melton, R; Blyn, L; Drader, J; Hofstadler, S; Schneider, W L

    2008-11-01

    Polymerase chain reaction/electrospray ionization-mass spectrometry (PCR/ESI-MS, previously known as "TIGER") utilizes PCR with broad-range primers to amplify products from a wide array of organisms within a taxonomic group, followed by analysis of PCR amplicons using mass spectrometry. Computer analysis of precise masses allows for calculations of base compositions for the broad-range PCR products, which can then be compared to a database for identification. PCR/ESI-MS has the benefits of PCR in sensitivity and high-throughput capacity, but also has the distinct advantage of being able to detect and identify organisms with no prior characterization or sequence data. Existing broad range PCR primers, designed with an emphasis on human pathogens, were tested for their ability to amplify DNA of well characterized phytobacterial strains, as well as to populate the existing PCR/ESI-MS bacterial database with base counts. In a blinded panel study, PCR/ESI-MS successfully identified 93% of unknown bacterial DNAs to the genus level and 73% to the species/subspecies level. Additionally, PCR/ESI-MS was capable of detecting and identifying multiple bacteria within the same sample. The sensitivity of PCR/ESI-MS was consistent with other PCR based assays, and the specificity varied depending on the bacterial species. Preliminary tests with real life samples demonstrate a high potential for using PCR/ESI-MS systems for agricultural diagnostic applications.

  8. Polymerase chain reaction-restriction fragment length polymorphism authentication of raw meats from game birds.

    PubMed

    Rojas, María; González, Isabel; Fajardo, Violeta; Martín, Irene; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2008-01-01

    Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis has been applied to the identification of meats from quail (Coturnix coturnix), pheasant (Phasianus colchicus), red-legged partridge (Alectoris rufa), guinea fowl (Numida meleagris), capercaillie (Tetrao urogallus), Eurasian woodcock (Scolopax rusticola), woodpigeon (Columba palumbus), and song thrush (Turdus philomelos). PCR amplification was performed using a set of primers flanking a conserved region of approximately 720 base pairs (bp) from the mitochondrial 12S rRNA gene. Restriction site analysis based on sequence data from this DNA fragment permitted the selection of AluI and BfaI endonucleases for species identification. The restriction profiles obtained when amplicons were digested with the chosen enzymes allowed the unequivocal identification of all game bird species analyzed. However, the use of the PCR-RFLP technique described is limited to raw meat authentication. It is not suitable for cooked products because thermal treatment strongly accelerates DNA degradation leading to difficulties in amplifying the 720 bp fragment.

  9. [Application of the polymerase chain reaction to the diagnosis of sickle cell anemia in Venezuela].

    PubMed

    Martínez, J; Blanco, Z; Hakshaw, P; Moreno, N

    1998-02-01

    Application of polymerase chain reaction technology to detect sickle cell patients and heterozygous carriers in a group of patients suspect for sickle cell disease was carried out. The sample was composed of 102 normal individuals, and 102 unrelated out patients who were attending in the Hematology Service at the Maracay Central Hospital in the State of Aragua in Venezuela. All patients were interviewed. Results of their medical histories and the physical examination, made during the clinical visit, were recorded. The blood samples were collected in EDTA by venopuncture and genomic DNA was extracted from leucocytes. An amplified 536 base pairs fragment of the beta-globin gene containing codon 6, was digested with an isoschizomer of Mst II, Bsu36 I and electrophoresed in 3% agarose. We have established the technical conditions in our laboratory for the detection of sickle cell disease using a PCR assay. 32 patients having haemoglobin SS (HbSS) and 70 patients in the heterozygous state (HbAS) were identified. We confirm that the normal controls have the HbAA genotype. The standardization of a highly sensitive and specific diagnostic test for sickle cell disease permited us to identify the normal controls, the homozygotes and heterozygotes. This methodology is one of the fundamental technical bases for establishing a newborn screening programme in the Central Region of Venezuela and also has application in research related with other genetic diseases that affect the Venezuelan people.

  10. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar.

    PubMed

    Humphrey, John M; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E; Farag, Elmoubasher; Abu-Raddad, Laith J; Glesby, Marshall J

    2016-12-07

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015-2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray(®) Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4-10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2-7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea.

  11. A disposable, continuous-flow polymerase chain reaction device: design, fabrication and evaluation.

    PubMed

    Ragsdale, Victoria; Li, Huizhong; Sant, Himanshu; Ameel, Tim; Gale, Bruce K

    2016-08-01

    Polymerase Chain Reaction (PCR) is used to amplify a specific segment of DNA through a thermal cycling protocol. The PCR industry is shifting its focus away from macro-scale systems and towards micro-scale devices because: micro-scale sample sizes require less blood from patients, total reaction times are on the order of minutes opposed to hours, and there are cost advantages as many microfluidic devices are manufactured from inexpensive polymers. Some of the fastest PCR devices use continuous flow, but they have all been built of silicon or glass to allow sufficient heat transfer. This article presents a disposable polycarbonate (PC) device that is capable of achieving real-time, continuous flow PCR in a completely disposable polymer device in less than 13 minutes by thermally cycling the sample through an established temperature gradient in a serpentine channel. The desired temperature gradient was determined through simulations and validated by experiments which showed that PCR was achieved. Practical demonstration included amplification of foot-and-mouth disease virus (FMDV) derived cDNA.

  12. [Use of polymerase chain reaction for the diagnosis of central nervous system infections].

    PubMed

    Zambrano, Yelitza; Chiarello, Anna; Soca, Alain; Villalobos, Iris; Marrero, Miguel; Soler, Maritza; Laferte, José; Alvarez, Maritza

    2006-12-01

    In the present work, the polymerase chain reaction (PCR) assay and his variants RT-PCR and Multiplex PCR were applied for the detection of specific sequences of Enterovirus, Human Herpes viruses (Herpes simple virus, Human Herpes virus type 6, Cytomegalovirus, Epstein Barr virus, and Varicella Zoster), Human Immunodeficiency virus, Toxoplasma gondii, Mycobacterium tuberculosis and Mycoplasma pneumoniae in patients' cohorts grouped by medical suspicion of meningoencephalitis. Of 326 samples of processed cerebrospinal fluid (CSF), 93 samples (28.5%) were positive for the different infectious agents. In the group of patients with clinical diagnosis of viral meningoencephalitis (n=212), there was obtained a whole of 73 positive samples (34.4%), of which 37 patients were positive to Enterovirus (50.7%), 19 were positive to VHS (26%) and 10 patients (13.7%) were positive to CMV. Other viral agents as VZV, EBV and HVH6 were detected in minor frequency. The 114 remaining samples were analyzed applying specific PCR to each pathogen for strict medical indication, being able to detect the presence of Human Immunodeficiency Virus (40%), Mycoplasma pneumoniae (40%), Toxoplasma gondii (14%) and Mycobacterium tuberculosis (12%) in CSF samples. The results obtained in this study demonstrate the convenience of the application of the molecular assays in the laboratory diagnosis of the meningoencefalitis of different etiology. Besides this, it is also a very valuable tool for the clinical management of the patients and for the execution of the epidemiological studies.

  13. Rapid detection of genetically modified organisms on a continuous-flow polymerase chain reaction microfluidics.

    PubMed

    Li, Yuyuan; Xing, Da; Zhang, Chunsun

    2009-02-01

    The ability to perform DNA amplification on a microfluidic device is very appealing. In this study, a compact continuous-flow polymerase chain reaction (PCR) microfluidics was developed for rapid analysis of genetically modified organisms (GMOs) in genetically modified soybeans. The device consists of three pieces of copper and a transparent polytetrafluoroethylene capillary tube embedded in the spiral channel fabricated on the copper. On this device, the P35S and Tnos sequences were successfully amplified within 9min, and the limit of detection of the DNA sample was estimated to be 0.005 ng microl(-1). Furthermore, a duplex continuous-flow PCR was also reported for the detection of the P35S and Tnos sequences in GMOs simultaneously. This method was coupled with the intercalating dye SYBR Green I and the melting curve analysis of the amplified products. Using this method, temperature differences were identified by the specific melting temperature values of two sequences, and the limit of detection of the DNA sample was assessed to be 0.01 ng microl(-1). Therefore, our results demonstrated that the continuous-flow PCR assay could discriminate the GMOs in a cost-saving and less time-consuming way.

  14. Identification of rickettsiae from ticks collected in the Central African Republic using the polymerase chain reaction.

    PubMed

    Dupont, H T; Cornet, J P; Raoult, D

    1994-03-01

    Spotted fever rickettsiosis have been identified on the African continent since their historical description in 1909. However, only Rickettsia conorii and R. africae have been described in Africa, and the current techniques for the detection of rickettsiae in ticks are difficult to apply in large field studies. We report here a preliminary study using genomic amplification by the polymerase chain reaction followed by restriction fragment length polymorphism (PCR-RFLP) analysis directly on 310 crushed ticks (Rhipicephalus, Amblyomma, and Haemaphysalis species) collected in 1985 in the Central African Republic. Among 310 specimen tested, 21.6% were positive. The rate of infection ranged from 0% to 64.3%, depending on the tick species. Based on PCR-RFLP, five different rickettsiae profiles were found: R. conorii and R. africae, previously known in Africa, R. rhipicephali, which has never been described in Africa, and two isolates identical to R. massiliae and Mtu5, previously obtained from Rh. turanicus in southern France. This work shows that PCR-RFLP is a powerful tool to study tick collections, and that it is applicable to samples from developing countries. Further work is needed to confirm the identification of the rickettsiae found in this work, using traditional identification procedures.

  15. Ion-Mediated Polymerase Chain Reactions Performed with an Electronically Driven Microfluidic Device.

    PubMed

    Zhang, Yi; Li, Qian; Guo, Linjie; Huang, Qing; Shi, Jiye; Yang, Yang; Liu, Dongsheng; Fan, Chunhai

    2016-09-26

    The polymerase chain reaction (PCR) is a powerful method for exponentially amplifying very low amounts of target DNA from genetic, clinical, and forensic samples. However, the heating and cooling steps in PCR largely hamper the miniaturization of thermocyclers for on-site detection of pathogens and point-of-care tests. Herein, we devise an ion-mediated PCR (IM-PCR) strategy by exploiting ion-induced DNA denaturation/renaturation cycles. DNA duplexes are effectively denatured in alkaline solutions; whereas, the denatured single-stranded DNA strands readily reform duplexes at neutral pH. By using an integrated microchip that can programmably control the solution pH simply switching the potential in a range of several hundred millivolts, we can trigger IM-PCR at a constant temperature. Analogously to thermal cycling, 30 cycles of pH-induced denaturation/renaturation were used to amplify protein DNA fragments as confirmed by DNA sequencing. We anticipate that this portable, low-cost, and scalable IM-PCR holds great promise for widespread biological, clinical, and environmental applications.

  16. Salmonellae in fish feces analyzed by in situ hybridization and quantitative polymerase chain reaction.

    PubMed

    Sha, Qiong; Forstner, Michael R J; Bonner, Timothy H; Hahn, Dittmar

    2013-09-01

    The potential of fish to transfer salmonellae from heterogeneous aquatic biofilms into feces was assessed in controlled aquarium studies with Suckermouth Catfish Hypostomus plecostomus and with biofilms inoculated with salmonellae. Neither the presence of catfish nor inoculation with salmonellae had detectable effects on the abundance of the microbial community. Densities of the microbial community were about 10(5) cells/mL in the water during a 1-week period, whereas densities of the microbial community increased 10-fold (10(6) to 10(7) cells/mg) in catfish feces during the same period. Salmonellae were detected by both quantitative polymerase chain reaction (qPCR) and situ hybridization in water samples immediately after inoculation, in numbers of about 10(4) cells/mL, representing up to 20% of the cells of the microbial community. Numbers decreased by three orders of magnitude within the first 3 d of the study, which represented only 0.01% of the community, and became undetectable after day 5. In catfish feces, numbers of Salmonella initially increased to up to 6% of the cells of the community but then declined. These results suggest that Salmonella are not biomagnified during gut passage, and thus, fish only provide a means for the translocation of this pathogen.

  17. Cell-based polymerase chain reaction for canine transmissible venereal tumor (CTVT) diagnosis

    PubMed Central

    SETTHAWONGSIN, Chanokchon; TECHANGAMSUWAN, Somporn; TANGKAWATTANA, Sirikachorn; RUNGSIPIPAT, Anudep

    2016-01-01

    Canine transmissible venereal tumor (CTVT) is the only naturally contagious tumor that is transmitted during coitus or social behaviors. Based on the tumor’s location, the diagnosis of genital TVT (GTVT) is comparably easier than those in the extragenital area (ETVT) that are more easily incorrectly diagnosed. Fortunately, CTVT cells contain a specific long interspersed nuclear elements (LINE), inserted upstream of the myc gene, allowing a diagnostic polymerase chain reaction (PCR) based detection assay. The objectives of this study were aimed to improve the diagnostic accuracy by applying the diagnostic LINE1-c-myc PCR assay and fine needle aspiration (FNA) collection in direct comparison with standard cytological and histopathological analyses. Seventy-four dogs, comprised of 41 and 31 dogs with tumor masses at their external genitalia and extragenital areas (e.g. skin and nasal cavity), respectively, were included in this study. The signalment of these 65 dogs and clinical history of 20 client-owned dogs were collected. Samples were taken by biopsy for both histopathological examination and FNA for cytological examination and diagnostic PCR. The PCR products from 10 apparently CTVT samples were purified and sequenced. Sixty-one CTVT cases were diagnosed by cytological and histological analyses, but 65 were positive by the PCR assay. Overall, the PCR assay improved the accuracy of diagnostic CTVT results, especially for the more difficult ETVT tumors. Moreover, this PCR-based approach can facilitate the decision as to discontinue chemotherapy by discrimination between residual tumor cell masses and fibrotic tissue. PMID:27075116

  18. GSH2 promoter methylation in pancreatic cancer analyzed by quantitative methylation-specific polymerase chain reaction

    PubMed Central

    GAO, FEI; HUANG, HAO-JIE; GAO, JUN; LI, ZHAO-SHEN; MA, SHU-REN

    2015-01-01

    Tumor suppressor gene silencing via promoter hypermethylation is an important event in pancreatic cancer pathogenesis. Aberrant DNA hypermethylation events are highly tumor specific, and may provide a diagnostic tool for pancreatic cancer patients. The objective of the current study was to identify novel methylation-related genes that may potentially be used to establish novel therapeutic and diagnostic strategies against pancreatic cancer. The methylation status of the GS homeobox 2 (GSH2) gene was analyzed using the sodium bisulfite sequencing method. The GSH2 methylation ratio was examined in primary carcinomas and corresponding normal tissues derived from 47 patients with pancreatic cancer, using quantitative methylation-specific polymerase chain reaction. Methylation ratios were found to be associated with the patient's clinicopathological features. GSH2 gene methylation was detected in 26 (55.3%) of the 47 pancreatic cancer patients, indicating that it occurs frequently in pancreatic cancer. A significant association with methylation was observed for tumor-node-metastasis stage (P=0.031). GSH2 may be a novel methylation-sensitive tumor suppressor gene in pancreatic cancer and may be a tumor-specific biomarker of the disease. PMID:26171036

  19. Characterization of fecal microbiota across seven Chinese ethnic groups by quantitative polymerase chain reaction.

    PubMed

    Kwok, Lai-yu; Zhang, Jiachao; Guo, Zhuang; Gesudu, Qimu; Zheng, Yi; Qiao, Jianmin; Huo, Dongxue; Zhang, Heping

    2014-01-01

    The human gut microbiota consists of complex microbial communities, which possibly play crucial roles in physiological functioning and health maintenance. China has evolved into a multicultural society consisting of the major ethnic group, Han, and 55 official ethnic minority groups. Nowadays, these minority groups inhabit in different Chinese provinces and some of them still keep their unique culture and lifestyle. Currently, only limited data are available on the gut microbiota of these Chinese ethnic groups. In this study, 10 major fecal bacterial groups of 314 healthy individuals from 7 Chinese ethnic origins were enumerated by quantitative polymerase chain reaction. Our data confirmed that the selected bacterial groups were common to all 7 surveyed ethnicities, but the amount of the individual bacterial groups varied to different degree. By principal component and canonical variate analyses of the 314 individuals or the 91 Han subjects, no distinct group clustering pattern was observed. Nevertheless, weak differences were noted between the Han and Zhuang from other ethnic minority groups, and between the Heilongjiang Hans from those of the other provinces. Thus, our results suggest that the ethnic origin may contribute to shaping the human gut microbiota.

  20. A Continuous-Flow Polymerase Chain Reaction Microchip With Regional Velocity Control

    PubMed Central

    Li, Shifeng; Fozdar, David Y.; Ali, Mehnaaz F.; Li, Hao; Shao, Dongbing; Vykoukal, Daynene M.; Vykoukal, Jody; Floriano, Pierre N.; Olsen, Michael; McDevitt, John T.; Gascoyne, Peter R.C.; Chen, Shaochen

    2009-01-01

    This paper presents a continuous-flow polymerase chain reaction (PCR) microchip with a serpentine microchannel of varying width for “regional velocity control.” Varying the channel width by incorporating expanding and contracting conduits made it possible to control DNA sample velocities for the optimization of the exposure times of the sample to each temperature phase while minimizing the transitional periods during temperature transitions. A finite element analysis (FEA) and semi-analytical heat transfer model was used to determine the distances between the three heating assemblies that are responsible for creating the denaturation (96 °C), hybridization (60 °C), and extension (72 °C) temperature zones within the microchip. Predictions from the thermal FEA and semi-analytical model were compared with temperature measurements obtained from an infrared (IR) camera. Flow-field FEAs were also performed to predict the velocity distributions in the regions of the expanding and contracting conduits to study the effects of the microchannel geometry on flow recirculation and bubble nucleation. The flow fields were empirically studied using micro particle image velocimetry (μ-PIV) to validate the flow-field FEA’s and to determine experimental velocities in each of the regions of different width. Successful amplification of a 90 base pair (bp) bacillus anthracis DNA fragment was achieved. PMID:19829760

  1. [Sex identification of the rainbow trout Oncorhynchus mykiss by polymerase chain reaction].

    PubMed

    Rud, Yu P; Maistrenko, M I; Buchatskii, L P

    2015-01-01

    A polymerase chain reaction-based test for rapid sex identification of the rainbow trout Oncorhynchus mykiss has been elaborated. Using the data deposited with the NCBI genome bank, nucleotide sequences of the specific sex-linked locus of salmonid species have been analyzed and the oligonucleotide primers have been selected. The length of the amplification products is 800 nucleotide pairs. Amplification specificity has been tested by nucleotide analysis of the amplicon sequences. All PCR products match the Y chromosome region housing the corresponding specific locus. A comparative analysis of the nucleotide sequences of the fragments carrying the rainbow trout (and other salmonid species) sex-linked marker demonstrates a high degree of identity, amounting to 95-99%. The maximal identity between the sequences (99%) is observed when analyzing representatives of the same genus, for example, Oncorhynchus. Thus, the sex is detectable by a simple PCR test, thereby allowing the male revertants emerging via hormonal sex reversion to be identified. This test is a rapid diagnostic method, since it requires only 1 day for testing and informing the fish farm on its results. Results of abdomen opening of rainbow trout revertants and examination of their hormonal status are also described.

  2. Polymerase chain reaction-single strand conformation polymorphism applied to sex identification of Accipiter cooperii.

    PubMed

    Ramos, Pedro Silveira; Bastos, Estela; Mannan, Richard William; Guedes-Pinto, Henrique

    2009-04-01

    Determination of sex in birds is valuable for studying population dynamics and structure, habitat use, behavior and mating systems. The purpose of the present study was to optimize a DNA-based methodology to allow the sex identification in Accipiter cooperii nestlings. Chromo-helicase-DNA-binding (CHD1) gene was used in this work as a marker for sex identification. CHD-W and CHD-Z sequences should present length and/or sequence differences providing a way to identify gender. We used a non-invasive method for DNA extraction from feathers and performed polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) method. The length difference between CHD-W and CHD-Z amplified fragments observed by electrophoresis in conventional agarose gel was not enough to provide a clear differentiation between males and females. However, patterns obtained by PCR-SSCP differentiated undoubtedly males and females in A. cooperii. This tool provides a precise gender identification assay and will be applied to confirm and refine morphometrically based sexing techniques used in the field.

  3. Sex identification of pigs using polymerase chain reaction amplification of the amelogenin gene.

    PubMed

    Sembon, Shoichiro; Suzuki, Shun-ichi; Fuchimoto, Dai-ichiro; Iwamoto, Masaki; Kawarasaki, Tatsuo; Onishi, Akira

    2008-11-01

    The amelogenin (AMEL) gene exists on both sex chromosomes of various mammalian species and the length and sequence of the noncoding regions differ between the two chromosome-specific alleles. Because both forms can be amplified using a single primer set, the use of AMEL in polymerase chain reaction (PCR)-based methods has facilitated sex identification in various mammalian species, including cattle, sheep and humans. In this study, we designed PCR primers to yield different-sized products from the AMEL genes on the X (AMELX) and Y (AMELY) chromosomes of pigs. PCR amplification of genomic DNA samples collected from various breeds of pigs (European breeds: Landrace, Large White, Duroc and Berkshire; Chinese breeds: Meishan and Jinhua and their crossbreeds) yielded the expected products. For all breeds, DNA from male pigs produced two bands (520 and 350 bp; AMELX and AMELY, respectively), whereas samples from female pigs generated only the 520 bp product. We then tested the use of PCR of AMEL for sex identification of in vitro-produced (IVP) porcine embryos sampled at 2 or 5 to 6 days after fertilization; germinal vesicle (GV)-stage oocytes and electroactivated embryos were used as controls. More than 88% of the GV-stage oocytes and electroactivated embryos yielded a single 520 bp single band and about 50% of the IVP embryos tested produced both bands. Our findings show that PCR analysis of the AMEL gene is reliable for sex identification of pigs and porcine embryos.

  4. Nanostructured biochip for label-free and real-time optical detection of polymerase chain reaction.

    PubMed

    Hiep, Ha Minh; Kerman, Kagan; Endo, Tatsuro; Saito, Masato; Tamiya, Eiichi

    2010-02-19

    In this report, Au-coated nanostructured biochip with functionalized thiolated primers on its surface is developed for label-free and real-time optical detection of polymerase chain reaction (PCR). A PCR chamber of 150 microm in thickness containing Au-coated nanostructured substrate in the bottom layer was bordered with SU-8 100 walls. After immobilization of 5'-thiolated primers on the surface, simultaneous DNA amplification and detection were performed without any labeled molecules via the relative reflected intensity (RRI) of Au-coated nanostructured substrate. When human genomic DNA at several concentrations of 0.2, 0.5 and 1 ng microL(-1) was included in the initial DNA samples, the increases in the RRI peak values were clearly observed with the increasing PCR cycle numbers. We found that the starting point of the optical signal, which was divergent from the background in our PCR biochip, was around 3-4 cycles, much lower than that of the fluorescent real-time PCR analysis (around 23-25 cycles). Our proposed PCR device using Au-coated nanostructured substrate holds noteworthy promise for rapid, label-free and real-time DNA detection for point-of-care testing (POCT) applications.

  5. Polymerase chain reaction and real-time PCR for diagnosing of Leishmania infantum chagasi in dogs.

    PubMed

    Ramos, Rafael Antonio do Nascimento; Ramos, Carlos Alberto do Nascimento; Jusi, Márcia Mariza Gomes; de Araújo, Flábio Ribeiro; Machado, Rosangela Zacarias; Faustino, Maria Aparecida da Glória; Alves, Leucio Câmara

    2012-01-01

    The importance of dogs as a reservoir for Leishmania infantumchagasi in urban environments has stimulated numerous studies assessing diagnostic techniques. When performed properly, such procedures are an important step in preventing leishmaniasis in humans. Molecular methods have become prominent for this purpose. The aim of the present study was to determine the performance of the polymerase chain reaction (PCR) and real-time PCR (qPCR) for diagnosing of canine visceral leishmaniasis (CVL) using different biological samples. For this, 35 dogs from an area endemic for CVL were used. Bone marrow aspirate and lymph node and spleen fragments from these dogs were used for the molecular diagnosis. In the present study, qPCR was able to detect a greater number of positive animals than seen with PCR. Among the different biological samples used, there was no significant difference in L. infantumchagasi DNA detection between PCR and qPCR. However, considering that lymph nodes are easy to acquire, these can be considered to be the best samples for making molecular diagnoses of L. infantum chagasi infection.

  6. A power-efficient thermocycler based on induction heating for DNA amplification by polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Pal, Debjani; Venkataraman, V.; Mohan, K. Naga; Chandra, H. Sharat; Natarajan, Vasant

    2004-09-01

    We have built a thermocycler based on the principles of induction heating for polymerase chain reaction (PCR) of target sequences in DNA samples of interest. The cycler has an average heating rate of ˜0.8 °C/s and a cooling rate of ˜0.5 °C/s, and typically takes ˜4 h to complete a 40-cycle PCR protocol. It is power-efficient (˜6 W per reaction tube), micro-processor controlled, and can be adapted for battery operation. Using this instrument, we have successfully amplified a 350 bp segment from a plasmid and SRY, the human sex determining gene, which occurs as a single-copy sequence in genomic DNA of human males. The PCR products from this thermocycler are comparable to those obtained by the use of commercially available machines. Its easy front-end operation, low-power design, portability and low cost makes it suitable for diagnostic field applications of PCR.

  7. Determination of Sperm Sex Ratio in Bovine Semen Using Multiplex Real-time Polymerase Chain Reaction.

    PubMed

    Khamlor, Trisadee; Pongpiachan, Petai; Sangsritavong, Siwat; Chokesajjawatee, Nipa

    2014-10-01

    Gender selection is important in livestock industries; for example, female calves are required in the dairy industry. Sex-sorted semen is commonly used for the production of calves of the desired gender. However, assessment of the sex ratio of the sorted semen is tedious and expensive. In this study, a rapid, cost effective and reliable method for determining the sex ratio was developed using a multiplex real-time polymerase chain reaction (PCR) assay. In this assay, the X and Y chromosome-specific markers, i.e., bovine proteolipid protein (PLP) gene and sex-determining region Y (SRY) were simultaneously quantified in a single tube. The multiplex real-time PCR assay was shown to have high amplification efficiencies (97% to 99%) comparable to the separated-tube simplex real-time PCR assay. The results obtained from both assays were not significantly different (p>0.05). The multiplex assay was validated using reference DNA of known X ratio (10%, 50%, and 90%) as templates. The measured %X in semen samples were the same within 95% confidence intervals as the expected values, i.e., >90% in X-sorted semen, <10% in Y-sorted semen and close to 50% in the unsorted semen. The multiplex real-time PCR assay as shown in this study can thus be used to assess purity of sex-sorted semen.

  8. Cattle fetal sex determination by polymerase chain reaction using DNA isolated from maternal plasma.

    PubMed

    da Cruz, A S; Silva, D C; Costa, E O A; De M-Jr, P; da Silva, C C; Silva, D M; da Cruz, A D

    2012-03-01

    The objective of this study was to evaluate the use of polymerase chain reaction analysis (PCR) of fetal cells/DNA in the maternal plasma of pregnant cows to determine the sex of the fetus. Plasma was harvested from 35 cows of mixed genotype at different stages of pregnancy ranging from 5 to 35 weeks. A male calf and a heifer calf provided the control samples. Fetal sex was determined by amplification of Y-specific sequences. For the 35 cows, the fetal sex predicted by this technique was in accordance with the sex of the calf at birth in 88.6% of cases. The agreement between predicted and observed fetal sex was less for cows with a gestational length of 35-48 days (63.6%). Regression analysis showed that there was a strong relationship between the probability of correctly predicting fetal sex and the stage of gestation. It was estimated that the test performed at 43.8 days post fertilization would have 95% accuracy, increasing to 99% accuracy for testing at 48.4 days and 99.9% accuracy for tests at 55.0 days or later. It was concluded that PCR analysis of fetal cells in maternal plasma can be used to predict successfully the sex of the fetus in cattle.

  9. Comparison of analytic methods for quantitative real-time polymerase chain reaction data.

    PubMed

    Chen, Ping; Huang, Xuelin

    2015-11-01

    Polymerase chain reaction (PCR) is a laboratory procedure to amplify and simultaneously quantify targeted DNA molecules, and then detect the product of the reaction at the end of all the amplification cycles. A more modern technique, real-time PCR, also known as quantitative PCR (qPCR), detects the product after each cycle of the progressing reaction by applying a specific fluorescence technique. The quantitative methods currently used to analyze qPCR data result in varying levels of estimation quality. This study compares the accuracy and precision of the estimation achieved by eight different models when applied to the same qPCR dataset. Also, the study evaluates a newly introduced data preprocessing approach, the taking-the-difference approach, and compares it to the currently used approach of subtracting the background fluorescence. The taking-the-difference method subtracts the fluorescence in the former cycle from that in the latter cycle to avoid estimating the background fluorescence. The results obtained from the eight models show that taking-the-difference is a better way to preprocess qPCR data compared to the original approach because of a reduction in the background estimation error. The results also show that weighted models are better than non-weighted models, and that the precision of the estimation achieved by the mixed models is slightly better than that achieved by the linear regression models.

  10. A new method for quantitative real-time polymerase chain reaction data analysis.

    PubMed

    Rao, Xiayu; Lai, Dejian; Huang, Xuelin

    2013-09-01

    Quantitative real-time polymerase chain reaction (qPCR) is a sensitive gene quantification method that has been extensively used in biological and biomedical fields. The currently used methods for PCR data analysis, including the threshold cycle method and linear and nonlinear model-fitting methods, all require subtracting background fluorescence. However, the removal of background fluorescence can hardly be accurate and therefore can distort results. We propose a new method, the taking-difference linear regression method, to overcome this limitation. Briefly, for each two consecutive PCR cycles, we subtract the fluorescence in the former cycle from that in the latter cycle, transforming the n cycle raw data into n-1 cycle data. Then, linear regression is applied to the natural logarithm of the transformed data. Finally, PCR amplification efficiencies and the initial DNA molecular numbers are calculated for each reaction. This taking-difference method avoids the error in subtracting an unknown background, and thus it is more accurate and reliable. This method is easy to perform, and this strategy can be extended to all current methods for PCR data analysis.

  11. Polymerase Chain Reaction: A Better Method for Diagnosing Chronic Schistosoma mansoni Infections.

    PubMed

    Abdel-Hafeez, Ekhlas Hamed; Mohamed, Rabie M; Belal, Usama S; Abdel-Raheem, Ehab M; Naoi, Koji; Norose, Kazumi

    2015-12-01

    For more effective diagnosis of the acute and chronic stages of Schistosoma mansoni infection in humans, the polymerase chain reaction (PCR) technique was compared with the Kato-Katz method. A total of 150 stool samples were collected from inpatient and outpatient clinics at the Department of Tropical Medicine, Minia University Hospital, Egypt. Three groups of patients, 50 with acute intestinal schistosomiasis, 70 with chronic intestinal schistosomiasis and 30 normal healthy controls were studied. Stool samples were analyzed by PCR and the Kato-Katz method. The mean number of eggs per gram of feces was 4.6 when estimated by the Kato-Katz method in positive stool samples from acute schistosomiasis cases but only 1.7 in chronic cases. In acute intestinal schistosomiasis, 15 and 45 out of 50 cases were positive by Kato-Katz and PCR, respectively. In the chronic intestinal schistosomiasis cases, 6 and 68 out of 70 cases were positive by the Kato-Katz and PCR methods, respectively. We conclude that PCR appears to be an effective diagnostic technique for S. mansoni infection, especially where a low worm burden exists, such as in chronic cases.

  12. Detection of Giardia cysts by using the polymerase chain reaction and distinguishing live from dead cysts.

    PubMed Central

    Mahbubani, M H; Bej, A K; Perlin, M; Schaefer, F W; Jakubowski, W; Atlas, R M

    1991-01-01

    A method was developed for the detection of Giardia cysts by using the polymerase chain reaction (PCR) and the giardin gene as the target. DNA amplification by PCR, using giardin DNA as the target, resulted in detection of both live and dead cysts. When giardin mRNA was used as the target, the ability to amplify cDNA by PCR depended on the mode of killing. Cysts killed by freezing were not detected by PCR when giardin mRNA was the target. Cysts killed by heating or exposure to monochloramine, however, gave positive detection signals for both DNA and giardin mRNA targets. The amount of giardin mRNA and total RNA was significantly increased in live cysts following the induction of excystation. Cysts killed by freezing, heating, or exposure to monochloramine did not show a change in RNA content. The detection of the giardin gene by PCR permits a sensitive and specific diagnosis for Giardia spp. Discrimination between live and dead cysts can be made by measuring the amounts of RNA or PCR-amplified product from the giardin mRNA target before and after the induction of excystation. Images PMID:1785923

  13. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction

    PubMed Central

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future. PMID:26078959

  14. Sensitive and species-specific detection of Erwinia amylovora by polymerase chain reaction analysis.

    PubMed Central

    Bereswill, S; Pahl, A; Bellemann, P; Zeller, W; Geider, K

    1992-01-01

    Detection and identification of the fire blight pathogen, Erwinia amylovora, can be accurately done by polymerase chain reaction (PCR) analysis in less than 6 h. Two oligomers derived from a 29-kb plasmid which is common to all strains of E. amylovora were used to amplify a 0.9-kb fragment of the plasmid. By separation of the PCR products on agarose gel, this fragment wa specifically detected when E. amylovora DNA was present in the amplification assay. It was not found when DNA from other plant-pathogenic bacteria was used for the assay. A visible band specific to the 0.9-kb fragment was produced with DNA from fewer than 100 E. amylovora cells. A signal of similar strength was also obtained from E. amylovora cell lysates in the presence of the mild detergent Tween 20. Signals were weaker when bacteria were added to the PCR mixture without the detergent. As with results obtained from hybridization experiments using pEA29 DNA< the PCR signal was obtained with E. amylovora isolates from various geographic regions. This technique could also be used for detection of the fire blight pathogen in extracts of tissue obtained from infected plant material. Images PMID:1482178

  15. Detecting and Number Counting of Single Engineered Nanoparticles by Digital Particle Polymerase Chain Reaction.

    PubMed

    Paunescu, Daniela; Mora, Carlos A; Querci, Lorenzo; Heckel, Reinhard; Puddu, Michela; Hattendorf, Bodo; Günther, Detlef; Grass, Robert N

    2015-10-27

    The concentrations of nanoparticles present in colloidal dispersions are usually measured and given in mass concentration (e.g. mg/mL), and number concentrations can only be obtained by making assumptions about nanoparticle size and morphology. Additionally traditional nanoparticle concentration measures are not very sensitive, and only the presence/absence of millions/billions of particles occurring together can be obtained. Here, we describe a method, which not only intrinsically results in number concentrations, but is also sensitive enough to count individual nanoparticles, one by one. To make this possible, the sensitivity of the polymerase chain reaction (PCR) was combined with a binary (=0/1, yes/no) measurement arrangement, binomial statistics and DNA comprising monodisperse silica nanoparticles. With this method, individual tagged particles in the range of 60-250 nm could be detected and counted in drinking water in absolute number, utilizing a standard qPCR device within 1.5 h of measurement time. For comparison, the method was validated with single particle inductively coupled plasma mass spectrometry (sp-ICPMS).

  16. Diagnosis of whooping cough in Switzerland: differentiating Bordetella pertussis from Bordetella holmesii by polymerase chain reaction.

    PubMed

    Pittet, Laure F; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001-, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested.

  17. Rapid screening for sickle cell disease by polymerase chain reaction-high resolution melting analysis.

    PubMed

    Yue, Liang; Lin, Min; Chen, Jiang-Tao; Zhan, Xiao-Fen; Zhong, De-Shang; Monte-Nguba, Santiago-M; Liu, Pei-Fen; Pan, Xue-Fen; Huang, Jiang-Hua; Wang, Xi; Ehapo, Juan Carlos Salas; Eyi, Urbano Monsuy; Yang, Hui-Tian; Yang, Li-Ye

    2014-06-01

    Each year, ~300,000 individuals with sickle cell disease (SCD), a hemoglobinopathy caused by β-globin gene mutation, are born, and >75% of those are in Africa. The present study examined 511 individuals on the island of Bioko (Equatorial Guinea) and attempted to establish a method for rapid sickle cell disease screening. Following DNA extraction and polymerase chain reaction (PCR) amplification, high resolution melting (HRM) analysis was used to assess the specificity of fluorescence signals of the PCR products and to differentiate various genotypes of these products. The analytical results of HRM were validated using DNA sequencing. By HRM analysis, 80 out of 511 samples were classified as hemoglobin S (Hb S) heterozygotes, while 431 out of 511 samples were classified as wild-type. No mutant homozygote was identified. DNA sequencing indicated that within the 431 wild-type samples as indicated by HRM analysis, one case was actually a Hb S heterozygote and another case was a rare hemoglobin S-C genotype (sickle-hemoglobin C disease). One out of 80 suspected Hb S heterozygotes as indicated by HRM was confirmed as wild-type by DNA sequencing and the results of residual 508 cases were consistent for HRM analysis and sequencing. In conclusion, HRM analysis is a simple, high-efficiency approach for Hb S screening and is useful for early diagnosis of SCD and particularly suitable for application in the African area.

  18. Detection of schistosomes polymerase chain reaction amplified DNA by oligochromatographic dipstick.

    PubMed

    Akinwale, O P; Laurent, T; Mertens, P; Leclipteux, T; Rollinson, D; Kane, R; Emery, A; Ajayi, M B; Akande, D O; Fesobi, T W

    2008-08-01

    The applications of highly specific and sensitive molecular techniques based on polymerase chain reaction (PCR) have constituted a valuable tool for the diagnosis of schistosomiasis and also for the detection of schistosome infections in the snail intermediate hosts. The common method of detecting PCR amplicons is gel electrophoresis in the presence of ethidium bromide, a carcinogen, which is followed by UV transillumination. Other methods, which are available for detecting PCR products, are real-time PCR, PCR-enzyme-linked immunosorbent assay (PCR-ELIZA) and mass spectrometry but they are cumbersome while they are sometimes complex and expensive. Therefore, a simple method of PCR product detection would be a welcome idea and a most valuable tool particularly in disease endemic countries with limited research facilities and resources. In this study, we applied a simple and rapid method for the detection of Schistosoma haematobium and Schistosoma mansoni PCR amplified DNA products using oligochromatographic (OC) dipstick. The amplicons are visualized by hybridization with a gold conjugated probe, while a control for the chromatographic migration is incorporated in the assay. The lower detection limit observed was 10fg of genomic DNA from each of the two species, while the dipstick was also specific for each of the species used in this study.

  19. A specific polymerase chain reaction test for the identification of Streptococcus pneumoniae.

    PubMed

    Prère, Marie-Françoise; Fayet, Olivier A

    2011-05-01

    Using an approach based on the comparison of arbitrary primer polymerase chain reaction (PCR) genomic profiles from oral streptococci and Streptococcus pneumoniae strains, we identified a 434-bp genomic fragment apparently specific for S. pneumoniae. From the nucleotidic sequence of this common fragment, a pair of primers was designed and tested on a set of strains comprising the major Streptococcus species. One species, S. anginosus, gave an amplification product of the same length as S. pneumoniae. Sequence comparison of the S. anginosus and S. pneumoniae amplicons revealed several variations which were used to define a new set of primers giving a 181-bp S. pneumoniae-specific fragment. The amplified fragment contains the 5' terminal part of a gene encoding a putative sugar-specific permease and an intergenic sequence. The PCR test was evaluated on 257 strains of invasive S. pneumoniae corresponding to clinical isolates and on 153 non-pneumoniae oral streptococci strains; in addition, 3 S. pseudopneumoniae strains were tested. With these primers, an amplification product was only obtained with the S. pneumoniae strains. Moreover, the test was successfully evaluated on 10 atypical S. pneumoniae strains related to pneumococcal diseases. In this study, we therefore established the capacity of a simple PCR test to discriminate S. pneumoniae from other Streptococci (including S. pseudopneumoniae), thus allowing rapid and accurate diagnosis.

  20. Quantitative detection of human enteric adenoviruses in river water by microfluidic digital polymerase chain reaction.

    PubMed

    Kishida, Naohiro; Noda, Naohiro; Haramoto, Eiji; Kawaharasaki, Mamoru; Akiba, Michihiro; Sekiguchi, Yuji

    2014-01-01

    We describe an assay for simple and accurate quantification of human enteric adenoviruses (EAdVs) in water samples using a recently developed quantification method named microfluidic digital polymerase chain reaction (dPCR). The assay is based on automatic distribution of reaction mixture into a large number of nanolitre-volume reaction chambers and absolute copy number quantification from the number of chambers containing amplification products on the basis of Poisson statistics. This assay allows absolute quantification of target genes without the use of standard DNA. Concentrations of EAdVs in Japanese river water samples were successfully quantified by the developed dPCR assay. The EAdVs were detected in seven of the 10 samples (1 L each), and the concentration ranged from 420 to 2,700 copies/L. The quantified values closely resemble those by most probable number (MPN)-PCR and real-time PCR when standard DNA was validated by dPCR whereas they varied substantially when the standard was not validated. Accuracy and sensitivity of the dPCR was higher than those of real-time PCR and MPN-PCR. To our knowledge, this is the first study that has successfully quantified enteric viruses in river water using dPCR. This method will contribute to better understanding of existence of viruses in water.

  1. An evaluation of serotyping of Avibacterium paragallinarum by use of a multiplex polymerase chain reaction.

    PubMed

    Morales-Erasto, Vladimir; Posadas-Quintana, José de Jesús; Fernández-Díaz, Manolo; Saravia, Luis E; Martínez-Castañeda, José Simón; Blackall, Patrick J; Soriano-Vargas, Edgardo

    2014-03-01

    In the present study, the ability of a recently proposed multiplex polymerase chain reaction (mPCR) to determine the serogroups (A, B, and C) of Avibacterium paragallinarum was evaluated. A total of 12 reference strains and 69 field isolates of Av. paragallinarum from Ecuador, Mexico, Panama, and Peru were included in the study. With some exceptions (which were serotyped in the current study), all of the isolates and strains had been previously examined by 2 serotyping schemes (Page and Kume) or were the formal reference strains for the schemes. Three of 6 (50%) reference strains of serogroup A, 2 (100%) of serogroup B, and 1 of 4 (25%) reference strains of serogroup C were correctly serotyped by the mPCR. With the field isolates, the mPCR correctly recognized 16 of the 17 serogroup A isolates, 10 of the 12 serogroup B isolates, and 18 of the 37 serogroup C isolates. Overall, the specificity and sensitivity of the PCR test was as follows: 82.6% and 87.3% (serogroup A), 85.7% and 71.9% (serogroup B), and 46.3% and 100% (serogroup C). The poor performance of the mPCR in terms of recognition of serogroup C isolates (low sensitivity of 46.3%) and the relatively high level of uncertainty about the accuracy of the serogroup A and B results (specificity of 87.3% and 71.9%, respectively) means that the assay cannot be recommended as a replacement for conventional serotyping.

  2. Sensitive Detection of Thirteen Bacterial Vaginosis-Associated Agents Using Multiplex Polymerase Chain Reaction.

    PubMed

    Malaguti, Natália; Bahls, Larissa Danielle; Uchimura, Nelson Shozo; Gimenes, Fabrícia; Consolaro, Marcia Edilaine Lopes

    2015-01-01

    Bacterial vaginosis (BV) is characterized by a polymicrobial proliferation of anaerobic bacteria and depletion of lactobacilli, which are components of natural vaginal microbiota. Currently, there are limited conventional methods for BV diagnosis, and these methods are time-consuming, expensive, and rarely allow for the detection of more than one agent simultaneously. Therefore, we conceived and validated a multiplex polymerase chain reaction (M-PCR) assay for the simultaneous screening of thirteen bacterial vaginosis-associated agents (BV-AAs) related to symptomatic BV: Gardnerella vaginalis, Mobiluncus curtisii, Mobiluncus mulieris, Bacteroides fragilis, Mycoplasma hominis, Atopobium vaginae, Ureaplasma urealyticum, Megasphaera type I, Clostridia-like bacteria vaginosis-associated bacteria (BVABs) 1, 2, and 3, Sneathia sanguinegens, and Mycoplasma genitalium. The overall validation parameters of M-PCR compared to single PCR (sPCR) were extremely high, including agreement of 99.1% and sensitivity, specificity, and positive predictive values of 100.0%, negative predictive value of 97.0%, accuracy of 99.3%, and agreement with Nugent results of 100.0%. The prevalence of BV-AAs was very high (72.6%), and simultaneous agents were detected in 53.0%, which demonstrates the effectiveness of the M-PCR assay. Therefore, the M-PCR assay has great potential to impact BV diagnostic methods in vaginal samples and diminish associated complications in the near future.

  3. A multiplex real-time polymerase chain reaction assay to diagnose Epiphyas postvittana (Lepidoptera: Tortricidae).

    PubMed

    Barr, N B; Ledezma, L A; Farris, R E; Epstein, M E; Gilligan, T M

    2011-10-01

    A molecular assay for diagnosis of light brown apple moth, Epiphyas postvittana (Walker) (Lepidoptera: Tortricidae), in North America is reported. The assay multiplexes two TaqMan real-time polymerase chain reaction (RT-PCR) probe systems that are designed to target DNA segments of the internal transcribed spacer region 2 (ITS2) and 18S rRNA gene. The RT-PCR probe designed for the 18S target recognizes a DNA sequence conserved in all of the moths included in the study and functions as a control in the assay. The second probe recognizes a segment of the ITS2 specifically found in E. postvittana and not found in the other moths included in the study, i.e., this segment is not conserved. Inclusion of the two markers in a single multiplex reaction did not affect assay performance. The assay was tested against 637 moths representing > 90 taxa in 15 tribes in all three subfamilies in the Tortricidae. The assay generated no false negatives based on analysis of 355 E. postvittana collected from California, Hawaii, England, New Zealand, and Australia. Analysis of a data set including 282 moths representing 41 genera generated no false positives. Only three inconclusive results were generated from the 637 samples. Spike experiments demonstrated that DNA contamination in the assay can affect samples differently. Contaminated samples analyzed with the ITS2 RT-PCR assay and DNA barcode methodology by using the cytochrome oxidase I gene can generate contradictory diagnoses.

  4. Specific detection of Pacific oyster (Crassostrea gigas) larvae in plankton samples using nested polymerase chain reaction.

    PubMed

    Patil, Jawahar G; Gunasekera, Rasanthi M; Deagle, Bruce E; Bax, Nicholas J

    2005-01-01

    Management of sustainable Pacific oyster fisheries would be assisted by an early, rapid, and accurate means of detecting their planktonic larvae. Reported here is an approach, based on polymerase chain reaction (PCR), for the detection of Pacific oyster larvae in plankton samples. Species-specific primers were designed by comparing partial mitochondrial cytochrome oxidase subunit I (COI) sequences from Crassostrea gigas, with other members of the family Ostreidae including those of Crassostrea angulata. Assay specificity was empirically validated through screening DNA samples obtained from several species of oysters. The assay was specific as only C. gigas samples returned PCR-positive results. A nested PCR approach could consistently detect 5 or more D-hinge-stage larvae spiked into a background of about 146 mg of plankton. The assay does not require prior sorting of larvae. We conclude that the assay could be used to screen environmental and ballast water samples, although further specificity testing against local bivalve species is recommended in new locations.

  5. Detection of human papillomavirus in juvenile laryngeal papillomatosis using polymerase chain reaction.

    PubMed

    Gómez, M A; Drut, R; Lojo, M M; Drut, R M

    1995-01-01

    We examined the presence and subtypes of human papillomavirus (HPV) in 20 paraffin-embedded samples (from 12 patients) of juvenile laryngeal papillomatosis using the polymerase chain reaction (PCR). The biopsies had been stored for months to 12 years. Due to the great genetic variability of HPV, we selected a conservative sequence of the viral genome (L1 region) to identify the vast majority of the subtypes. Positive results were obtained by one-step PCR amplification with the MY09-11 consensus primers (L1 region) in only 10 of the cases. After a two-step amplification (nested-PCR) with GP5-6 primers the 20 samples proved to be positive demonstrating the higher sensitivity of this method. In order to amplify a highly variable region of the genome (E6), specific primers for HPV types 6 and 11 (H6/11 L1-R2) were used. 7/12 patients were positive for this subtype. Since more that one subtype has been reported in the same sample, the presence of HPV 6-11 sequences does not exclude that other subtypes might be involved. The results of this study show that: 1) HPV is present in JLP. 2) The most frequent HPV subtype involved was from the 6-11 group. 3) PCR can be successfully used in archived tissue routinely processed in a laboratory of pathology.

  6. A highly sensitive immuno-polymerase chain reaction assay for Clostridium botulinum neurotoxin type A.

    PubMed

    Chao, Hai-Yuan; Wang, Yeau-Ching; Tang, Shiao-Shek; Liu, Hwan-Wun

    2004-01-01

    Our goal was to develop a sensitive method for detecting Clostridium botulinum neurotoxin type A (BoNT/A). We were able to detect BoNT/A in the femtogram (10(-15)g) range using an indirect immuno-polymerase chain reaction (immuno-PCR) assay and an indirect sandwich immuno-PCR assay. For the indirect immuno-PCR assay, enzyme-linked immunosorbent assay (ELISA) plates were coated with BoNT/A that was recognized by anti-BoNT/A monoclonal antibody. For the indirect sandwich immuno-PCR assay, the monoclonal antibody was immobilized on ELISA plates for detecting BoNT/A that was recognized by its polyclonal antibodies. Reporter DNA was prepared by PCR amplification using biotinylated 5'-primers, and it was coupled with biotinylated antibodies through streptavidin. In order to increase sensitivity and reduce background noise, the amounts of reporter DNA (ranging from 50 fg to 50 ng) and streptavidin (ranging from 0.125 ng to 8 ng) were optimized. Using the optimized concentration of reporter DNA and streptavidin, both indirect and indirect sandwich immuno-PCR assays detected BoNT/A as low as 50 fg. These results are a 10(5)-fold improvement over conventional indirect ELISA and indirect sandwich ELISA methods. The assays we developed are currently the most sensitive methods for detecting BoNT/A.

  7. Polymerase chain reaction with lesion scrapping for the diagnosis of human American tegumentary leishmaniasis.

    PubMed

    Venazzi, Eneide Aparecida Sabaini; Roberto, Andréa Claudia Bekner Silva; Barbosa-Tessmann, Ione Parra; Zanzarini, Paulo Donizeti; Lonardoni, Maria Valdrinez Campana; Silveira, Thaís Gomes Verzignassi

    2006-06-01

    The objective of this work was to compare the polymerase chain reaction (PCR) using lesion scrapping with other conventional techniques for the diagnosis of the American tegumentary leishmaniasis (ATL). For this, patients with cutaneous lesions suspected to be ATL were studied. The DNA was amplified with the MP1L/MP3H primers. From the 156 studied patients, 79 (50.6%) presented positive parasite direct search (PD), 81 (51.9%) had positive Montenegro skin test (MST), and 90 (57.7%) presented PD and/or MST positive. The PCR was positive in all of the positive-PD patients (100% sensitivity), in 91.1% of the positive PD and/or MST patients, and in 27.3% of the patients that presented negative PD and positive MST. The PCR positivity was similar to the PD (P = 0.2482) and inferior to the MST (P = 0.0455), and to the PD/MST association (P = 0.0133). The high PCR sensitivity, and positivity in those cases where the PD was negative, highlights the importance of this technique as an auxiliary tool for the diagnosis of ATL.

  8. Detection of Salmonella sp. in Dermanyssus gallinae using an FTA filter-based polymerase chain reaction.

    PubMed

    Moro, C Valiente; Desloire, S; Chauve, C; Zenner, L

    2007-06-01

    Salmonella spp. bacteria are responsible for some of the most important zoonoses worldwide. Because Dermanyssus gallinae (DeGeer) (Acari: Dermanyssidae) has been recently reported to be an experimental vector of Salmonella Enteritidis, it would be of benefit to evaluate the presence of this bacterium in mites. A molecular detection tool associating a simple filter-based DNA preparation with a specific 16S rDNA Salmonella sp. polymerase chain reaction (PCR) amplification was described. The limit of detection with this method was 2 x 10(4) bacteria per mite. To adapt this technique for large-scale studies, two sizes of mite pools were tested and a preliminary investigation was carried out on mites from 16 currently or previously contaminated farms. Mites sampled from one farm of each type were positive for Salmonella, suggesting that Dermanyssus could act as a reservoir between flocks. In further investigations, it will be necessary to carry out a large-scale study to assess the role of D. gallinae in the epidemiology of avian salmonellosis.

  9. Use of Polymerase Chain Reaction for Bivalve Pathogen Surveillance in the Yellow Clam Mesodesma mactroides.

    PubMed

    Carvalho, Yuri Bovi Morais; da Silva Santos, Juan Jethro; Raibenberg, Fernando C; Poersch, Luis Henrique; Romano, Luis Alberto

    2016-06-01

    The yellow clam Mesodesma mactroides is a valuable shellfish occurring from the southeastern coast of Brazil to the northern coast of Argentina. Populations of yellow clams are disappearing from their entire range, and the cause is still unknown. The objective of this paper was to search for World Organisation for Animal Health (OIE)-listed pathogens and their relatives in the genera Marteilia, Bonamia, and Perkinsus as well as Mikrocytos mackini and the virus OsHV-1 μ var the yellow clam population in southern Brazil using molecular techniques and classic histology protocols. A total of 180 clams were manually collected in the intertidal region at six sampling points covering the entire coast of Rio Grande do Sul State (length, 622 km) in 2013. Tissue samples were tested by OIE-recommended single-step conventional polymerase chain reaction assays. The screening showed no evidence of the specific sequences of the protistan parasites and viral pathogens at any site within the six zones under study. We recommend continuous monitoring of the mollusks in the region. Received July 3, 2015; accepted February 3, 2016.

  10. Submicroscopic malaria parasite carriage: how reproducible are polymerase chain reaction-based methods?

    PubMed

    Costa, Daniela Camargos; Madureira, Ana Paula; Amaral, Lara Cotta; Sanchez, Bruno Antônio Marinho; Gomes, Luciano Teixeira; Fontes, Cor Jésus Fernandes; Limongi, Jean Ezequiel; Brito, Cristiana Ferreira Alves de; Carvalho, Luzia Helena

    2014-02-01

    The polymerase chain reaction (PCR)-based methods for the diagnosis of malaria infection are expected to accurately identify submicroscopic parasite carriers. Although a significant number of PCR protocols have been described, few studies have addressed the performance of PCR amplification in cases of field samples with submicroscopic malaria infection. Here, the reproducibility of two well-established PCR protocols (nested-PCR and real-time PCR for the Plasmodium 18 small subunit rRNA gene) were evaluated in a panel of 34 blood field samples from individuals that are potential reservoirs of malaria infection, but were negative for malaria by optical microscopy. Regardless of the PCR protocol, a large variation between the PCR replicates was observed, leading to alternating positive and negative results in 38% (13 out of 34) of the samples. These findings were quite different from those obtained from the microscopy-positive patients or the unexposed individuals; the diagnosis of these individuals could be confirmed based on the high reproducibility and specificity of the PCR-based protocols. The limitation of PCR amplification was restricted to the field samples with very low levels of parasitaemia because titrations of the DNA templates were able to detect < 3 parasites/µL in the blood. In conclusion, conventional PCR protocols require careful interpretation in cases of submicroscopic malaria infection, as inconsistent and false-negative results can occur.

  11. Detection of Mycobacterium tuberculosis complex by nested polymerase chain reaction in pulmonary and extrapulmonary specimens* ,**

    PubMed Central

    Furini, Adriana Antônia da Cruz; Pedro, Heloisa da Silveira Paro; Rodrigues, Jean Francisco; Montenegro, Lilian Maria Lapa; Machado, Ricardo Luiz Dantas; Franco, Célia; Schindler, Haiana Charifker; Batista, Ida Maria Foschiani Dias; Rossit, Andrea Regina Baptista

    2013-01-01

    OBJECTIVE: To compare the performance of nested polymerase chain reaction (NPCR) with that of cultures in the detection of the Mycobacterium tuberculosis complex in pulmonary and extrapulmonary specimens. METHODS: We analyzed 20 and 78 pulmonary and extrapulmonary specimens, respectively, of 67 hospitalized patients suspected of having tuberculosis. An automated microbial system was used for the identification of Mycobacterium spp. cultures, and M. tuberculosis IS6110 was used as the target sequence in the NPCR. The kappa statistic was used in order to assess the level of agreement among the results. RESULTS: Among the 67 patients, 6 and 5, respectively, were diagnosed with pulmonary and extrapulmonary tuberculosis, and the NPCR was positive in all of the cases. Among the 98 clinical specimens, smear microscopy, culture, and NPCR were positive in 6.00%, 8.16%, and 13.26%, respectively. Comparing the results of NPCR with those of cultures (the gold standard), we found that NPCR had a sensitivity and specificity of 100% and 83%, respectively, in pulmonary specimens, compared with 83% and 96%, respectively, in extrapulmonary specimens, with good concordance between the tests (kappa, 0.50 and 0.6867, respectively). CONCLUSIONS: Although NPCR proved to be a very useful tool for the detection of M. tuberculosis complex, clinical, epidemiological, and other laboratory data should also be considered in the diagnosis and treatment of pulmonary and extrapulmonary tuberculosis. PMID:24473765

  12. Utility of Real-Time Quantitative Polymerase Chain Reaction in Detecting Mycobacterium tuberculosis

    PubMed Central

    Zhang, Mingxin; Zhang, Hui

    2017-01-01

    This study aimed to assess the value of real-time quantitative polymerase chain reaction (RT-qPCR) for the detection of Mycobacterium tuberculosis (MTB). Samples from 192 patients with suspected MTB were examined by RT-qPCR and an improved Löwenstein–Jensen (L-J) culture method. To evaluate the diagnostic usefulness of RT-qPCR in detecting MTB, a receiver operating characteristic (ROC) curve for RT-qPCR was generated, and the area under the curve (AUC) as well as a cutoff value was calculated. Using the L-J culture method as the gold standard, accuracy of the RT-qPCR method for detecting MTB was 92.7%, with sensitivity and specificity of 62.5% and 97.02%, respectively. In comparison with the improved L-J culture method, the AUC of RT-qPCR ROC curve was 0.957, which was statistically significant (p < 0.001). The Youden Index reached the maximum value (0.88) for gene copy number of 794.5 IU/mL, which was used as the cutoff value. RT-qPCR detection of MTB yielded results consistent with those of the improved L-J culture method, with high accuracy. RT-qPCR may be used as an auxiliary method for etiological diagnosis of tuberculosis. PMID:28168192

  13. A reverse transcriptase-polymerase chain reaction assay for detecting Highlands J virus.

    PubMed

    Whitehouse, C A; Guibeau, A; McGuire, D; Takeda, T; Mather, T N

    2001-01-01

    Highlands J (HJ) virus is an arbovirus frequently recovered at high rates in mosquitoes collected in the eastern United States. HJ virus is primarily a veterinary pathogen causing disease in domestic birds including turkeys, chickens, and partridges. It has an enzootic cycle similar to eastern equine encephalitis (EEE) virus and is often used as an indicator species in EEE surveillance programs. Current immunologic techniques to identify HJ virus are often inefficient and can involve cross-reactivity of antibodies. Therefore, we developed a molecular-based assay by a reverse transcriptase (RT)-polymerase chain reaction (PCR) technique. Primers were constructed from conserved sequences of the E1 coding region from 19 strains of HJ virus. PCR amplifications from serial dilutions of HJ virus-infected Vero cell culture supernatants indicated that this assay could detect viral RNA at concentrations of 10 plaque-forming units per reaction. Extracted RNAs from western equine encephalitis, EEE, LaCrosse, and Jamestown Canyon viruses were not detected with this assay. RNA extracted directly from the brain tissue of a dead house sparrow and from a pool of Culiseta mosquitoes yielded a PCR product of the expected size. The RT-PCR technique developed was both sensitive and specific for detecting HJ virus from infected cell culture supernatants, bird brain tissues, and mosquitoes. This new assay will permit rapid and accurate diagnosis of HJ virus, both enhancing surveillance activities for EEE transmission risk and monitoring infections in domestic poultry and wild birds.

  14. Molecular identification of Amazonian stingless bees using polymerase chain reaction single-strand conformation polymorphism.

    PubMed

    Souza, M T; Carvalho-Zilse, G A

    2014-07-25

    In countries containing a mega diversity of wildlife, such as Brazil, identifying and characterizing biological diversity is a continuous process for the scientific community, even in face of technological and scientific advances. This activity demands initiatives for the taxonomic identification of highly diverse groups, such as stingless bees, including molecular analysis strategies. This type of bee is distributed in all of the Brazilian states, with the highest species diversity being found in the State of Amazônia. However, the estimated number of species diverges among taxonomists. These bees are considered the main pollinators in the Amazon rainforest, in which they obtain food and shelter; however, their persistence is constantly threatened by deforestation pressure. Hence, it is important to classify the number and abundance of bee specie, to measure their decline and implement meaningful, priority conservation strategies. This study aims to maximize the implementation of more direct, economic and successful techniques for the taxonomic identification of stingless bees. Specifically, the genes 16S rRNA and COI from mitochondrial DNA were used as molecular markers to differentiate 9 species of Amazonian stingless bees based on DNA polymorphism, using the polymerase chain reaction-single-strand conformation polymorphism technique. We registered different, exclusive SSCP haplotypes for both genes in all species analyzed. These results demonstrate that SSCP is a simple and cost-effective technique that is applicable to the molecular identification of stingless bee species.

  15. Cost analysis of real-time polymerase chain reaction microbiological diagnosis in patients with septic shock.

    PubMed

    Alvarez, J; Mar, J; Varela-Ledo, E; Garea, M; Matinez-Lamas, L; Rodriguez, J; Regueiro, B

    2012-11-01

    Antibiotic treatment for septic shock is generally prescribed on an empirical basis using broad-spectrum antibiotics. Molecular diagnostic techniques can detect the presence of microbial DNA in blood within a few hours and facilitate early, targeted treatment. The aim of this study was to evaluate the economic impact of a real-time polymerase chain reaction technique, LightCycler SeptiFast (LSC), in patients with sepsis. A cost-minimisation study was carried out in patients admitted with a diagnosis of severe sepsis or septic shock to the intensive care unit of a university hospital. The stay in the intensive care unit, hospital admission, 28-day and six-month mortality, and the economic cost of the clinical process were also evaluated. The study involved 48 patients in the LSC group and 54 patients in the control group. The total cost was €42,198 in the control group versus €32,228 in the LCS group with statistically significant differences (P <0.05), giving rise to an average net saving of €9970 per patient. The mortality rate was similar in both groups. The main finding of this study was the significant economic saving afforded by the use of the LCS technique, due to the shortening of intensive care unit stay and the use of fewer antibiotics.

  16. Mutagenicity Assessment of Organophosphates using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay

    PubMed Central

    Bhinder, Preety; Chaudhry, Asha

    2013-01-01

    Objectives: In this study we have evaluated the mutagenicity of organophosphate pesticides acephate, chlorpyrifos, and profenofos using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay with the mosquito Culex quinquefasciatus taken as an experimental model. Materials and Methods: Second instar larvae were treated with LC20 of each pesticide for 24 h and mutations induced in the sequence of mitochondrial COII gene (690bp) were studied from restriction patterns generated with AluI, PacI, and PsiI restriction endonucleases. Results: Variations in the number and size of digested fragments were recorded from treated individuals compared with controls showing that the restriction enzymes created a cut at different locations. In addition, sequences of COII gene from control and treated individuals were also used to confirm the RFLP patterns. From the sequence alignment data, it was found that mutations caused the destruction and generation of restriction sites in the gene sequence of treated individuals. Conclusion: This study indicates that all the three pesticides had potential to induce mutations in the normal sequence of COII gene and also advocates the use of PCR-RFLP assay as an efficient, rapid, and sensitive technique to detect mutagenicity of pesticides. PMID:24403735

  17. Detection of hepatitis E virus in raw and treated wastewater with the polymerase chain reaction.

    PubMed Central

    Jothikumar, N; Aparna, K; Kamatchiammal, S; Paulmurugan, R; Saravanadevi, S; Khanna, P

    1993-01-01

    The main objective of this study was to determine the applicability of the polymerase chain reaction (PCR) to detection of hepatitis E virus (HEV) in sewage treatment plants and establishment of the prevalence of hepatitis viral diseases in a population. Epidemics of HEV infection because of inadequate public sanitation have been reported in several developing countries. A procedure for concentration of HEV in sewage samples through adsorption to membrane filters, elution with urea-arginine phosphate buffer, and subsequent reconcentration with magnesium chloride enabled us to concentrate HEV to volumes in the microliter range. HEV-specific cDNA was prepared by reverse transcription of the total RNA extracted from samples. Specific DNA amplification by PCR in combination with slot blot hybridization was used to demonstrate the presence of HEV in sewage samples from the inlets and outlets of three sewage treatment plants. The assay was specific for HEV, and a 240-bp amplified product was visualized by ethidium bromide fluorescence. Sewage samples adjusted to pH 5.0 for adsorption of viruses to membrane filters were PCR positive, while samples adjusted to pH 3.5 were PCR negative. Images PMID:8368844

  18. Quantitative analysis of periodontal pathogens by ELISA and real-time polymerase chain reaction.

    PubMed

    Hamlet, Stephen M

    2010-01-01

    The development of analytical methods enabling the accurate identification and enumeration of bacterial species colonizing the oral cavity has led to the identification of a small number of bacterial pathogens that are major factors in the etiology of periodontal disease. Further, these methods also underpin more recent epidemiological analyses of the impact of periodontal disease on general health. Given the complex milieu of over 700 species of microorganisms known to exist within the complex biofilms found in the oral cavity, the identification and enumeration of oral periodontopathogens has not been an easy task. In recent years however, some of the intrinsic limitations of the more traditional microbiological analyses previously used have been overcome with the advent of immunological and molecular analytical methods. Of the plethora of methodologies reported in the literature, the enzyme-linked immunosorbent assay (ELISA), which combines the specificity of antibody with the sensitivity of simple enzyme assays and the polymerase chain reaction (PCR), has been widely utilized in both laboratory and clinical applications. Although conventional PCR does not allow quantitation of the target organism, real-time PCR (rtPCR) has the ability to detect amplicons as they accumulate in "real time" allowing subsequent quantitation. These methods enable the accurate quantitation of as few as 10(2) (using rtPCR) to 10(4) (using ELISA) periodontopathogens in dental plaque samples.

  19. Towards dynamic coating of glass microchip chambers for amplifying DNA via the polymerase chain reaction.

    PubMed

    Giordano, B C; Copeland, E R; Landers, J P

    2001-01-01

    As microchip technology evolves to allow for the integration of more complex processes, particularly the polymerase chain reaction (PCR), it will become necessary to define simple approaches for minimizing the effects of surfaces on the chemistry/processes to be performed. We have explored alternatives to silanization of the glass surface with the use of additives that either dynamically coat or adsorb to the glass surface. Polyethylene glycol, polyvinylpyrrolidone (PVP), and hydroxyethylcellulose (HEC) have been explored as potential dynamic coatings and epoxy (poly)dimethylacrylamide (EPDMA) evaluated as an adsorbed coating. By carrying out analysis of the PCR products generated under different conditions via microchip electrophoresis, we demonstrate that these coating agents adequately passivate the glass surface in a manner that prevents interference with the subsequent PCR process. While several of the agents tested allowed for PCR amplification of DNA in glass, the EPDMA was clearly superior with respect to ease of preparation. However, more efficient PCR (larger mass of amplified product) could be obtained by silanizing the glass surface.

  20. Leptospirosis diagnosis by immunocapture polymerase chain reaction: a new tool for early diagnosis and epidemiologic surveillance.

    PubMed

    Balassiano, Ilana Teruszkin; Vital-Brazil, Juliana Magalhães; Pereira, Martha Maria

    2012-09-01

    The aim of this study was to develop an immunocapture polymerase chain reaction (IC-PCR) protocol for leptospirosis. For the standardization of IC-PCR, polyclonal (AS) and monoclonal (MAb) antibodies against different serogroups and serovars of Leptospira were coupled to polystyrene plates. Human sera were artificially contaminated with leptospires and incubated on plates. The bacterial DNA was obtained and used in a multiplex PCR. Sensitivity was tested using sera contaminated with crescent concentrations of leptospires, while specificity was established using sera contaminated with different bacterial genera and sera obtained from patients positive for viral infections. IC-PCR using AS was able to recognize specific serogroups, although some cross-reactions have been observed. No cross-reactions were observed when MAbs were used; however, the sensitivity in this case was lower than that of IC-PCR using AS. IC-PCR proved to be specific to Leptospira and is a promising tool for early diagnosis of leptospirosis, providing additional information about the infecting serovar or serogroup.

  1. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples

    PubMed Central

    Pérez, Lester J.; de Arce, Heidy Díaz

    2009-01-01

    Aujeszky’s disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided. PMID:24031383

  2. Ultra-rapid flow-through polymerase chain reaction microfluidics using vapor pressure.

    PubMed

    Fuchiwaki, Yusuke; Nagai, Hidenori; Saito, Masato; Tamiya, Eiichi

    2011-09-15

    A novel flow-through polymerase chain reaction (PCR) microfluidic system using vapor pressure was developed that can achieve ultra-rapid, small-volume DNA amplification on a chip. The 40-cycle amplification can be completed in as little as 120 s, making this device the fastest PCR system in the world. The chip device is made of a pressure-sensitive polyolefin (PSP) film and cyclo-olefin polymer (COP) substrate which was processed by cutting-work to fabricate the microchannel. The enclosed structure of the microchannel was fabricated solely by weighing the PSP film on the COP substrate, resulting in superior practical application. The vapor pressure in the denaturation zone of the destabilizing flow source was applied to the flow force, and ultra-rapid, efficient amplification was accomplished with a minimal amount of PCR reagents for detection. The flowing rhythm created by vapor pressure minimized the residual PCR products, leading to highly efficient amplification. For field test analysis, airborne dust was collected from a public place and tested for the presence of anthrax. The PCR chip had sufficient sensitivity for anthrax identification. The fastest time from aerosol sampling to detection was theoretically estimated as 8 min.

  3. Highly sensitive polymerase chain reaction-free quantum dot-based quantification of forensic genomic DNA.

    PubMed

    Tak, Yu Kyung; Kim, Won Young; Kim, Min Jung; Han, Eunyoung; Han, Myun Soo; Kim, Jong Jin; Kim, Wook; Lee, Jong Eun; Song, Joon Myong

    2012-04-06

    Forensic DNA samples can degrade easily due to exposure to light and moisture at the crime scene. In addition, the amount of DNA acquired at a criminal site is inherently limited. This limited amount of human DNA has to be quantified accurately after the process of DNA extraction. The accurately quantified extracted genomic DNA is then used as a DNA template in polymerase chain reaction (PCR) amplification for short tandem repeat (STR) human identification. Accordingly, highly sensitive and human-specific quantification of forensic DNA samples is an essential issue in forensic study. In this work, a quantum dot (Qdot)-labeled Alu sequence was developed as a probe to simultaneously satisfy both the high sensitivity and human genome selectivity for quantification of forensic DNA samples. This probe provided PCR-free determination of human genomic DNA and had a 2.5-femtogram detection limit due to the strong emission and photostability of the Qdot. The Qdot-labeled Alu sequence has been used successfully to assess 18 different forensic DNA samples for STR human identification.

  4. Mechanisms of Propidium Monoazide Inhibition of Polymerase Chain Reaction and implications for Propidium Monoazide Applications

    NASA Astrophysics Data System (ADS)

    Lee, C. M.; Darrach, H.; Ponce, A.; McFarland, E.; Laymon, C.; Fingland, N. K.

    2015-12-01

    PMA-qPCR is a laboratory technique that can be used to identify viable microbes by employing the use of propidium monoazide (PMA), a DNA-intercalating dye, and quantitative polymerase chain reaction (qPCR). The current model of PMA-qPCR operates under the assumption that PMA is only capable of entering membrane-compromised cells, where it irreversibly cross-links to DNA and makes it unavailable for amplification via qPCR. However, the exact mechanism behind PMA's entry into the cell and its interaction with genetic material is not well understood. To better understand PMA's capabilities, we have examined the effect PMA has on enzyme binding and processivity using endonucleases and exonucleases. Our results suggest that the current model behind PMA-qPCR inhibition is incomplete, in that rather than precipitating the entirety of the DNA, PMA also inhibits enzyme binding and/or processivity in soluble DNA. These results have important implications for studying the viable community of microorganisms in various applications, such as environmental monitoring, planetary protection and bioburden assessment, and biohazard detection.

  5. Development of a polymerase chain reaction assay for the detection of pseudorabies virus in clinical samples.

    PubMed

    Pérez, Lester J; de Arce, Heidy Díaz

    2009-07-01

    Aujeszky's disease, also known as pseudorabies causes severe economic losses in swine industry and affects the pig husbandry all over the world. The conventional diagnostic procedure is time-consuming and false-negative results may occur in submissions from latently infected animals. The development, optimization and evaluation of a polymerase chain reaction (PCR) assay are presented for the diagnosis of pseudorabies infection. This assay was based on the amplification of a highly conserved viral gD gene fragment. PCR products of the expected size were obtained from PRV strains. Non-specific reactions were not observed when a related herpesvirus, other porcine DNA genome viruses and uninfected cells were used to assess PCR. The analytical sensitivity of the test was estimated to be 1.34 TCID50/ 50 uL. The analysis of tissue homogenate samples from naturally infected animals proved the potential usefulness of the method for a rapid disease diagnosis from field cases. A rapid, sensitive and specific PCR-based diagnostic assay to detect pseudorabies virus in clinical samples is provided.

  6. Use of polymerase chain reaction to detect Brucella abortus biovar 1 in infected goats.

    PubMed

    Leal-Klevezas, D S; Martínez-Vázquez, I O; García-Cantú, J; López-Merino, A; Martínez-Soriano, J P

    2000-07-03

    The polymerase chain reaction (PCR) was used to diagnose goat brucellosis and compare its sensitivity against some of the most commonly used serological and bacteriological techniques. Twenty two female and one male out of 300 clinically healthy, mixed-breed goats were randomly chosen from a ranch located at Marín, Nuevo León, Mexico. Milk and blood samples were taken from each animal and used to obtain both microbiological cultures and DNA of the pathogen, and sera was tested against Rose Bengal antigen (RBT). Results showed that 86% of the blood samples were positive on the PCR test, while 60% were positive on the serological test. The pathogen was isolated from only one blood culture. Sixty four percent of the milk samples were positive on PCR tests, but failed to yield bacteria in culture. Biochemical and PCR specific assay demonstrated that Brucella abortus biovar 1 was associated with the infection. This study demonstrates the higher sensitivity of PCR over RBT and blood culture and its potential towards a rapid identification of Brucella strains.

  7. Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification

    SciTech Connect

    Zietkiewicz, E.; Labuda, D. ); Rafalski, A. )

    1994-03-15

    Simple sequence repeats (SSR), or microsatellites, are ubiquitous in eukaryotic genomes. Here the authors demonstrate the utility of microsatellite-directed DNA fingerprinting by polymerase chain reaction (PCR) amplification of the interrepeat region. No sequencing is required to design the oligonucleotide primers. They tested primers anchored at 3[prime] or 5[prime] termini of the (A)[sub n] repeats, extended into the flanking sequence by 2 to 4 nucleotide residues [3[prime]-anchored primers: (CA)[sub 8]RG, (CA)[sub 8]RY, and (CA)[sub 7]RTCY; and 5[prime]-anchored primers: BDB(CA)[sub 7]C, DBDA(CA)[sub 7], VHVG(TG)[sub 7] and HVH(TG)[sub 7]T]. Radioactively labeled amplification products were analyzed by electrophoresis, revealing information on multiple genomic loci in a single gel lane. Complex, species-specific patterns were obtained from a variety of eukaryotic taxa. Intraspecies polymorphisms were also observed and shown to segregate as Mendelian markers. Inter-SSR PCR provides a novel fingerprinting approach applicable for taxonomic and phylogenetic comparisons and as a mapping tool in a wide range of organisms. This application of (CA)[sub n] repeats may be extended to different microsatellites and other common dispersed elements. 24 refs., 6 figs.

  8. Trends and advances in food analysis by real-time polymerase chain reaction.

    PubMed

    Salihah, Nur Thaqifah; Hossain, Mohammad Mosharraf; Lubis, Hamadah; Ahmed, Minhaz Uddin

    2016-05-01

    Analyses to ensure food safety and quality are more relevant now because of rapid changes in the quantity, diversity and mobility of food. Food-contamination must be determined to maintain health and up-hold laws, as well as for ethical and cultural concerns. Real-time polymerase chain reaction (RT-PCR), a rapid and inexpensive quantitative method to detect the presence of targeted DNA-segments in samples, helps in determining both accidental and intentional adulterations of foods by biological contaminants. This review presents recent developments in theory, techniques, and applications of RT-PCR in food analyses, RT-PCR addresses the limitations of traditional food analyses in terms of sensitivity, range of analytes, multiplexing ability, cost, time, and point-of-care applications. A range of targets, including species of plants or animals which are used as food ingredients, food-borne bacteria or viruses, genetically modified organisms, and allergens, even in highly processed foods can be identified by RT-PCR, even at very low concentrations. Microfluidic RT-PCR eliminates the separate sample-processing step to create opportunities for point-of-care analyses. We also cover the challenges related to using RT-PCR for food analyses, such as the need to further improve sample handling.

  9. Nano-magnetic primer based electrochemiluminescence-polymerase chain reaction (NMPE-PCR) assay.

    PubMed

    Zhu, Xiao; Zhou, Xiaoming; Xing, Da

    2012-01-15

    Here we have developed a novel nano-magnetic primer based electrochemiluminescence-polymerase chain reaction (NMPE-PCR) strategy for detection of genome. The key idea of this method is integrating the two in situ processes: PCR on the surface of magnetic nanoparticles (MNPs) and magnetic beads based ECL readout platform, to avoid some laborious manual operations and achieve rapid yet sensitive detection. At first, the approach employs a pair of functional primers for amplification: one is tris-(2,2'-bipyridyl) ruthenium (TBR) labeled primer; the other one is nano-magnetic primer which is prepared by attaching the primer to the surfaces of MNPs. With the presence of DNA analyte and PCR mixture, the TBR labeled products are directly loaded and enriched on the surface of MNPs during PCR cycling. Then the MNPs-TBR complexes can be analyzed by a magnetic ECL platform without any post-modification or post-incubation. Finally, we used Listeria monocytogenes as the target to examine these desirable properties of this assay, reaching a detection limit of 500 fg/μL for genome in 1 h. The proposed study has provided the evidence as a proof-of-concept, thus having potential for development of automatic mode for detection of specific gene.

  10. DNA-based identification of spices: DNA isolation, whole genome amplification, and polymerase chain reaction.

    PubMed

    Focke, Felix; Haase, Ilka; Fischer, Markus

    2011-01-26

    Usually spices are identified morphologically using simple methods like magnifying glasses or microscopic instruments. On the other hand, molecular biological methods like the polymerase chain reaction (PCR) enable an accurate and specific detection also in complex matrices. Generally, the origins of spices are plants with diverse genetic backgrounds and relationships. The processing methods used for the production of spices are complex and individual. Consequently, the development of a reliable DNA-based method for spice analysis is a challenging intention. However, once established, this method will be easily adapted to less difficult food matrices. In the current study, several alternative methods for the isolation of DNA from spices have been developed and evaluated in detail with regard to (i) its purity (photometric), (ii) yield (fluorimetric methods), and (iii) its amplifiability (PCR). Whole genome amplification methods were used to preamplify isolates to improve the ratio between amplifiable DNA and inhibiting substances. Specific primer sets were designed, and the PCR conditions were optimized to detect 18 spices selectively. Assays of self-made spice mixtures were performed to proof the applicability of the developed methods.

  11. Accuracy of mucocutaneous leishmaniasis diagnosis using polymerase chain reaction: systematic literature review and meta-analysis

    PubMed Central

    Gomes, Ciro Martins; Mazin, Suleimy Cristina; dos Santos, Elisa Raphael; Cesetti, Mariana Vicente; Bächtold, Guilherme Albergaria Brízida; Cordeiro, João Henrique de Freitas; Theodoro, Fabrício Claudino Estrela Terra; Damasco, Fabiana dos Santos; Carranza, Sebastián Andrés Vernal; Santos, Adriana de Oliveira; Roselino, Ana Maria; Sampaio, Raimunda Nonata Ribeiro

    2015-01-01

    The diagnosis of mucocutaneous leishmaniasis (MCL) is hampered by the absence of a gold standard. An accurate diagnosis is essential because of the high toxicity of the medications for the disease. This study aimed to assess the ability of polymerase chain reaction (PCR) to identify MCL and to compare these results with clinical research recently published by the authors. A systematic literature review based on the Preferred Reporting Items for Systematic Reviews and Meta-Analyses: the PRISMA Statement was performed using comprehensive search criteria and communication with the authors. A meta-analysis considering the estimates of the univariate and bivariate models was performed. Specificity near 100% was common among the papers. The primary reason for accuracy differences was sensitivity. The meta-analysis, which was only possible for PCR samples of lesion fragments, revealed a sensitivity of 71% [95% confidence interval (CI) = 0.59; 0.81] and a specificity of 93% (95% CI = 0.83; 0.98) in the bivariate model. The search for measures that could increase the sensitivity of PCR should be encouraged. The quality of the collected material and the optimisation of the amplification of genetic material should be prioritised. PMID:25946238

  12. Nested polymerase chain reaction assay for detection of Mycobacterium shottsii and M. pseudoshottsii in striped bass.

    PubMed

    Gauthier, D T; Vogelbein, W K; Rhodes, M W; Reece, K S

    2008-12-01

    Wild striped bass Morone saxatilis in Chesapeake Bay are experiencing a high prevalence of mycobacteriosis, which produces granulomatous lesions of the skin and visceral organs. Culture-based studies have indicated that the newly described species Mycobacterium shottsii and M. pseudoshottsii are the dominant isolates from diseased fish. The classical fish pathogen M. marinum is also found, albeit at much lower frequencies. Both M. shottsii and M. pseudoshottsii are extremely slow-growing on standard selective media, and up to 12 months may be required for isolation and characterization. Epidemiological studies of mycobacteriosis in Chesapeake Bay would therefore benefit from rapid molecular assays with which to detect these species in fish. In this paper, we describe the development of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assays capable of detecting M. shottsii, M. pseudoshottsii, and, in most instances, coinfections thereof in striped bass tissues. In addition, PCR-RFLP assays were designed to detect M. marinum and other as-yet-undescribed Mycobacterium spp. present in Chesapeake Bay striped bass. Comparison of these molecular assays with culture-based techniques using splenic tissue from wild striped bass yielded generally concordant results and demonstrated the applicability of these techniques to the study of wild fish.

  13. Detection of Listeria monocytogenes in cheese with the magnetic immuno-polymerase chain reaction assay.

    PubMed

    Fluit, A C; Torensma, R; Visser, M J; Aarsman, C J; Poppelier, M J; Keller, B H; Klapwijk, P; Verhoef, J

    1993-05-01

    A new detection system, the magnetic immuno-polymerase chain reaction (PCR) assay (MIPA) has been developed to detect Listeria monocytogenes in food. This method separates Listeria cells from PCR-inhibitory factors present in enrichment broths containing food samples by using magnetic beads coated with specific monoclonal antibodies (MAbs). The separated bacteria were lysed, and the supernatant containing the bacterial DNA was subjected to the PCR. Detection of L. monocytogenes in three naturally contaminated cheese samples with two different MAbs and PCR primers specific for the gene encoding the delayed-hypersensitivity factor showed that with MAb 55 all three samples were positive whereas with MAb A two samples were positive. A further improvement of the method was obtained by using a PCR step based on the listeriolysin O gene. A MIPA employing MAb 55 and the listeriolysin O gene primer set detected L. monocytogenes after 24 h of culture in Listeria Enrichment Broth samples from Port Salut artificially contaminated with 40 CFU/25 g. We could detect 1 CFU of L. monocytogenes per g of cheese after a second enrichment for 24 h in Fraser broth. The analysis time including both enrichments is approximately 55 h.

  14. [Species-specific detection of Proteus vulgaris and Proteus mirabilis by the polymerase chain reaction].

    PubMed

    Limanskiĭ, A; Minukhin, V; Limanskaia, O; Pavlenko, N; Mishina, M; Tsygenenko, A

    2005-01-01

    Sets of primers for the species-specific detection of P. mirabilis and P. vulgaris by the polymerase chain reaction (PCR) were developed. As targets for these primers beta-lactamase and 16S rRNA gene fragments were chosen on the basis of the multiple leveling of the sequences of the DNA of all known P. mirabilis and P. vulgaris isolates. For differential detection oligonucleotides were selected in such a way that primers, specific for P. vulgaris, contained the non-paired nucleotide for P. mirabilis isolate at the 3'-end, and all other nucleotides were complementary to the beta-lactamase gene fragment. Primers, specific for gene 16S rRNA of P. mirabilis, contained the non-paired nucleotide for P. vulgaris isolates at the 3'-end. Standard PCR was carried out for 6 P. mirabilis and P. vulgaris strains. The use of PCR species-specific primers to P. vulgaris DNA made it possible to amplify the DNA fragment of the expected length only for P. vulgaris isolates, while the result of PCR for P. mirabilis was negative. PCR with primers specific to P. mirabilis permitted the detection of amplicon sized 101 nucleotides pairs only for P. mirabilis strains. These primers were optimized so as to use them in the specific differentiation of closely related P. mirabilis and P. vulgaris species by multiplex PCR. Genus-specific primers permitted the detection of bacterial gyrB gene of the genus Proteus were developed also.

  15. Confirmation of presumptive Salmonella colonies contaminated with Proteus swarming using the polymerase chain reaction (PCR) method.

    PubMed

    Gutiérrez Rojo, Rosalba; Torres Chavolla, Edith

    2007-01-01

    In Mexico, zero tolerance regulation is practiced regarding Salmonella in food products. the presence of which is verified by the procedure described in NOM 114-SSA-1994. During the period between August 2002 and March 2003, 245 food samples were tested using this procedure in the Central Laboratories of the Department of Health for the State of Jalisco (CEESLAB). Of these 245 samples, 35 showed presumptive colonies contaminated with Proteus swarm cells even after selective isolation. These swarm cells make Salmonella recovery and biochemical identification difficult due to the occurance of atypical biochemical profiles which generally correspond to that of Proteus. Out of the 35 samples contaminated with Proteus, 65 presumptive colonies were isolated. These colonies were analyzed using both normative microbiological method and Polymerase Chain Reaction (PCR). The PCR method detected two positive samples while normative microbiological method was not able to identify. In order to determine the extent of interference of Proteus swarming on the Salmonella-specific PCR band amplification, Salmonella ser. Typhimurium was grown in the presence of Proteus swarming. These results show that Proteus swarming did not interfere with Salmonella PCR-amplification, although the appearance of Sanlmonella was altered such that the black precipitate was no observed in the presence of Proteus swarming. Ours result indicate that the PCR method used in this study may be successfully applied to confirm presumptive Salmnonella colonies contaminated with Proteus swarming.

  16. A simple multiplex polymerase chain reaction assay for the identification of four environmentally relevant fungal contaminants.

    PubMed

    Dean, Timothy R; Roop, Barbara; Betancourt, Doris; Menetrez, Marc Y

    2005-04-01

    Historically, identification of filamentous fungal (mold) species has been based on morphological characteristics, both macroscopic and microscopic. These methods may often be time-consuming and inaccurate, necessitating the development of identification protocols that are rapid, sensitive, and precise. The polymerase chain reaction (PCR) has shown great promise in its ability to identify and quantify individual organisms from a mixed culture environment; however, the cost effectiveness of single organism PCR reactions is quickly becoming an issue. Our laboratory has developed a simple method to identify multiple fungal species, Stachybotrys chartarum, Aspergillus versicolor, Penicillium purpurogenum, and Cladosporium spp. by performing multiplex PCR and distinguishing the different reaction products by their mobility during agarose gel electrophoresis. The amplified genes include the beta-Tubulin gene from A. versicolor, the Tri5 gene from S. chartarum, and ribosomal sequences from both P. purpurogenum and Cladosporium spp. This method was found to be both rapid and easy to perform, while maintaining high sensitivity and specificity for characterizing isolates, even from a mixed culture.

  17. Assessment of cell culture and polymerase chain reaction procedures for the detection of polioviruses in wastewater.

    PubMed Central

    Grabow, W. O.; Botma, K. L.; de Villiers, J. C.; Clay, C. G.; Erasmus, B.

    1999-01-01

    WHO considers that environmental surveillance for wild-type polioviruses is potentially important for surveillance for acute flaccid paralysis as a means of confirming eradication of poliomyelitis. The present study investigated methods for detecting polioviruses in a variety of water environments in South Africa. Most polioviruses were isolated on L20B mouse cells, which, however, were not selective: 16 reoviruses and 8 enteroviruses, apparently animal strains, were also isolated on these cells. Vaccine strains of polioviruses were isolated from surface waters during and shortly after two rounds of mass vaccination of children in an informal settlement where there was no sewerage. The results demonstrated the feasibility of poliovirus surveillance in such settlements. It was also evident that neither poliovirus vaccine strains nor other viruses were likely to interfere significantly with the detection of wild-type polioviruses. Optimal isolation of polioviruses was accomplished by parallel inoculation of L20B mouse cells and at least the PLC/PRF/5 human liver and buffalo green monkey (BGM) kidney cell lines. Analysis of cell cultures using the polymerase chain reaction revealed that 319 test samples contained at least 263 human enteroviruses that failed to produce a cytopathogenic effect. This type of analysis thus significantly increased the sensitivity of enterovirus detection. PMID:10680244

  18. Diagnosis of Whooping Cough in Switzerland: Differentiating Bordetella pertussis from Bordetella holmesii by Polymerase Chain Reaction

    PubMed Central

    Pittet, Laure F.; Emonet, Stéphane; François, Patrice; Bonetti, Eve-Julie; Schrenzel, Jacques; Hug, Melanie; Altwegg, Martin; Siegrist, Claire-Anne; Posfay-Barbe, Klara M.

    2014-01-01

    Bordetella holmesii, an emerging pathogen, can be misidentified as Bordetella pertussis by routine polymerase chain reaction (PCR). In some reports, up to 29% of the patients diagnosed with pertussis have in fact B. holmesii infection and invasive, non-respiratory B. holmesii infections have been reported worldwide. This misdiagnosis undermines the knowledge of pertussis' epidemiology, and may lead to misconceptions on pertussis vaccine's efficacy. Recently, the number of whooping cough cases has increased significantly in several countries. The aim of this retrospective study was to determine whether B. holmesii was contributing to the increase in laboratory-confirmed cases of B. pertussis in Switzerland. A multiplex species-specific quantitative PCR assay was performed on 196 nasopharyngeal samples from Swiss patients with PCR-confirmed Bordetella infection (median age: 6 years-old, minimum 21 days-old, maximum 86 years-old), formerly diagnosed as Bordetella pertussis (IS481+). No B. holmesii (IS481+, IS1001−, hIS1001+) was identified. We discuss whether laboratories should implement specific PCR to recognize different Bordetella species. We conclude that in Switzerland B. holmesii seems to be circulating less than in neighboring countries and that specific diagnostic procedures are not necessary routinely. However, as the epidemiological situation may change rapidly, periodic reevaluation is suggested. PMID:24586447

  19. Diagnosis of feline herpesvirus infection by immunohistochemistry, polymerase chain reaction, and in situ hybridization.

    PubMed

    Suchy, A; Bauder, B; Gelbmann, W; Löhr, C V; Teifke, J P; Weissenböck, H

    2000-03-01

    An adult domestic shorthair cat had severe chemosis due to purulent and necrotizing blepharitis and conjunctivitis. Purulent rhinitis, necrotizing glossitis, and dermatitis were also diagnosed. The cat was positive for feline immunodeficiency virus and feline leukemia virus. Histologically, intranuclear Cowdry type A inclusions were found within numerous epithelial cells adjacent to the lesions in skin, conjunctiva, and tongue. Electron microscopic examination revealed herpesviral particles within the lesions. Paraffin-embedded skin and tongue tissues were processed in a polymerase chain reaction, using primers to amplify a 306-bp region of the thymidine kinase gene of feline herpesvirus type 1, resulting in a distinct amplification product of the predicted size. The distribution of feline herpesvirus was demonstrated by immunohistochemistry and nonradioactive in situ hybridization. Positive immunostaining was found in nuclei and cytoplasm of numerous epithelial cells within and next to the lesions, whereas in situ hybridization, performed with a digoxigenin-labeled double-stranded DNA probe, revealed hybridization signal only in nuclei of intact epithelial cells. Neither immunohistochemistry nor in situ hybridization showed feline herpesvirus type 1 in tissues of lungs, liver, spleen, intestine, or brain.

  20. Detection of feline immunodeficiency virus in saliva and plasma by cultivation and polymerase chain reaction.

    PubMed

    Matteucci, D; Baldinotti, F; Mazzetti, P; Pistello, M; Bandecchi, P; Ghilarducci, R; Poli, A; Tozzini, F; Bendinelli, M

    1993-03-01

    The rates of feline immunodeficiency virus (FIV) isolation from saliva, plasma, and peripheral blood mononuclear cells (PBMC) of infected cats were compared; isolation rates were 18, 14, and 81%, respectively, in naturally infected cats and 25, 57, and 100%, respectively, in experimentally infected animals. There was no obvious relationship between isolation rate and clinical stage or between isolation rate and the titer of neutralizing antibody in serum. Virus could be isolated from one salivary gland as early as 1 week postinfection and, on a more regular basis, starting at 3 weeks postinfection, when, however, most other tissues were also positive. Polymerase chain reaction analysis showed that FIV genomes are present in saliva and plasma more frequently than expected on the basis of isolation data. Saliva was also found to contain viral DNA, indicating that it may harbor virus-infected cells as well as free virus. The addition of plasma but not of saliva to PBMC cultures delayed FIV growth. Isolation from plasma may be hampered by FIV neutralizing antibody and by the cytotoxic activity of this fluid for the PBMC used as a cell substrate.

  1. Real-time polymerase chain reaction for the diagnosis of necrotizing herpes stromal keratitis

    PubMed Central

    Ma, Jun-Xin; Wang, Lin-Nong; Zhou, Ru-Xia; Yu, Yang; Du, Tong-Xin

    2016-01-01

    AIM To design, optimize and validate a rapid, internally controlled real-time polymerase chain reaction (RT-PCR) test for herpes simplex virus (HSV) in the diagnosis of necrotizing herpes stromal keratitis. METHODS Tears alone or together with corneal epithelium scrapings from 30 patients (30 eyes) suspected of necrotizing herpes stromal keratitis were tested for HSV DNA by RT-PCR. The samples were collected during the first visit and then on the subsequent 7, 14, 28, 42, and 56d. The symptoms of the patients were scored before treatment to determine the correlation between HSV concentration in the corneal epithelium scrapings and clinical scores. RESULTS The positive rate (46.4%) in the corneal epithelium group before the therapy was significantly higher than that (13.3%) in the tears group (P=0.006). There were 13 positive HSV patients before the therapy, the concentration of HSV DNA in corneal epithelium scrapings group was significantly higher than that in the tears group (paired t-test, P=0.0397). Multilevel mixed-effects model analysis showed that the difference between the corneal epithelium scrapings group and the tears group was statistically significant (P=0.0049). The Spearman rank correlation analysis indicated a positive correlation between the HSV concentration in the corneal epithelium scrapings and clinical scores before the treatment (r=0.844, P<0.0001). CONCLUSION RT-PCR appears to be a powerful molecular tool for the diagnosis of necrotizing herpes stromal keratitis. PMID:27275421

  2. [Adaptation of a sensitive DNA extraction method for detection of Entamoeba histolytica by real-time polymerase chain reaction].

    PubMed

    Pınar, Ahmet; Akyön, Yakut; Alp, Alpaslan; Ergüven, Sibel

    2010-07-01

    This study was aimed to adapt a sensitive DNA extraction protocol in stool samples for real-time polymerase chain reaction (PCR) detection of Entamoeba histolytica which causes important morbidity and mortality worldwide. Stool extraction is a problematic step and has direct effects on PCR sensitivity. In order to improve the sensitivity of E.histolytica detection by real-time PCR, "QIAamp DNA stool minikit (Qiagen, Germany)" was modified by adding an overnight incubation step with proteinase K and sodium dodecyl sulfate (SDS) in this study. Three different extraction methods [(1) original method, (2) cetyltrimethyl-ammonium bromide (CTAB) method, (3) modified method] were evaluated for effects on sensitivity in real-time quantitative PCR (Artus RealArt TM E.histolytica RG PCR Kit, Qiagen Diagnostics, Germany). For this purpose, several concentrations of standard E.histolytica DNA were spiked in parasite-free stool samples and three different extraction protocols were performed. Detection sensitivities of "QIAamp DNA stool minikit" was found 5000 copies/ml and of CTAB method was found 500 copies/ml. Detection sensitivity of the extraction was improved to 5 copies/mL by modified "QIAamp DNA stool minikit" protocol. Since detection sensitivities of nucleic acid extraction protocols from stool samples directly affect the sensitivity of PCR amplification, different extraction protocols for different microorganisms should be evaluated.

  3. Reverse transcription polymerase chain reaction-based method for selectively detecting vegetative cells of toxigenic Clostridium difficile.

    PubMed

    Senoh, Mitsutoshi; Kato, Haru; Murase, Tomoko; Hagiya, Hideharu; Tagashira, Yasuaki; Fukuda, Tadashi; Iwaki, Masaaki; Yamamoto, Akihiko; Shibayama, Keigo

    2014-11-01

    The laboratory diagnostic methods for Clostridium difficile infection (CDI) include toxigenic culture, enzyme immunoassays (EIAs) to detect the toxins of C. difficile, and nucleic acid amplification tests (NAATs) to detect C. difficile toxin genes, but each of these methods has disadvantages; toxigenic cultures require a long time to produce results, EIAs have low sensitivity, and NAATs that target DNA cannot distinguish vegetative cells from spores and dead cells. Here we report a new detection method that uses reverse transcription polymerase chain reaction to target the toxin-gene transcripts. This method was able to specifically detect the vegetative cells of toxigenic C. difficile in fecal samples in spike tests, with a minimum detection limit of 5 × 10(2) colony-forming units per 100 mg of stool specimen. The performance of this method was also demonstrated in a pilot scale evaluation using clinical fecal specimens, which showed that this method may be more sensitive than EIA and requires a shorter time than toxigenic culture. This method could potentially be applied in the clinical laboratory to detect C. difficile in fecal specimens. The ability of this method to discriminate the presence of vegetative cells from spores and dead cells could help to further the understanding of CDI.

  4. Use of Fluorescence Quantitative Polymerase Chain Reaction (PCR) for the Detection of Escherichia coli Adhesion to Pig Intestinal Epithelial Cells.

    PubMed

    Dai, C H; Gan, L N; Qin, W U; Zi, C; Zhu, G Q; Wu, S L; Bao, W B

    2016-09-01

    An efficient and accurate method to test Escherichia coli (E. coli) adhesion to intestinal epithelial cells will contribute to the study of bacterial pathogenesis and the function of genes that encode receptors related to adhesion. This study used the quantitative real-time polymerase chain reaction (qPCR) method. qPCR primers were designed from the PILIN gene of E. coli F18ab, F18ac, and K88ac, and the pig β-ACTIN gene. Total deoxyribonucleic acid (DNA) from E. coli and intestinal epithelial cells (IPEC-J2 cells) were used as templates for qPCR. The 2-ΔΔCt formula was used to calculate the relative number of bacteria in cultures of different areas. We found that the relative numbers of F18ab, F18ac, and K88ac that adhered to IPEC-J2 cells did not differ significantly in 6-, 12-, and 24-well culture plates. This finding indicated that there was no relationship between the relative adhesion number of E. coli and the area of cells, so the method of qPCR could accurately test the relative number of E. coli. This study provided a convenient and reliable testing method for experiments involving E. coli adhesion, and also provided innovative ideas for similar detection methods.

  5. Detection of Cryptosporidium parvum in secondary effluents using a most probable number-polymerase chain reaction assay.

    PubMed

    Tsuchihashi, Ryujiro; Loge, Frank J; Darby, Jeannie L

    2003-01-01

    Polymerase chain reaction (PCR) was used to detect Cryptosporidium parvum oocysts in secondary effluent samples collected from activated-sludge facilities. Serial dilutions of the purified nucleic acid extracts from the samples were made and PCR was conducted to estimate the C. parvum oocyst concentration via a Poisson distribution-based most probable number (MPN). The degree of oocysts associated with wastewater particles was also evaluated. The sensitivity of the MPN-PCR assay was 20 oocysts/PCR unit. The detection limit of the concentration, extraction, and purification protocols in phosphate buffer saline spiked with a known concentration of oocysts ranged from 1.1 to 4.6 oocysts/L; the detection limit for the wastewater samples ranged from 11 to 4200 oocysts/L depending on the extent of inhibition in each sample. The recovery efficiency of the oocysts ranged from 48 to 59% in most samples. Oocysts were found in two out of seven samples with concentrations of 203 and 308 oocysts/L, as estimated by the MPN-PCR method. The oocysts were found only in the filtrate of the grab samples; particle-associated oocysts were not detected. Association of spiked C. parvum oocysts with particles in secondary effluent drawn from wastewater plants with varying operating conditions indicated a weak correlation between the degree of association and the mean cell residence time of the system.

  6. The utility of polymerase chain reaction for diagnosis of lumpy skin disease in cattle and water buffaloes in Egypt.

    PubMed

    Sharawi, S S A; Abd El-Rahim, I H A

    2011-12-01

    An outbreak of lumpy skin disease (LSD) occurred among cattle and water buffaloes in Egypt in 2006. Polymerase chain reaction (PCR) and the agar gel precipitation test (AGPT) were compared. Eight of ten (80%) tissue specimens from diseased cattle were positive with AGPT while 100% were positive with PCR. Of ten tissue specimens from diseased water buffaloes, 70% were positive with AGPT while 100% were positive with PCR. Ten milk samples were obtained from diseased water buffaloes; PCR detected nucleic acid of LSD virus (LSDV) in 50% while AGPT failed to detect LSDV antigen. Water buffaloes are susceptible to LSDV infection. The clinical signs of LSD were less severe in water buffaloes, but the virus was excreted in their milk. Diagnosis of LSD outbreaks by PCR will facilitate rapid application of control measures. Mass vaccination should be applied in both cattle and water buffaloes in Egypt using an effective specific vaccine against LSD, such as the attenuated Neethling strain vaccine or a recombinant vaccine.

  7. Simple and sensitive method for identification of human DNA by allele-specific polymerase chain reaction of FOXP2.

    PubMed

    Hiroshige, Kenichi; Soejima, Mikiko; Nishioka, Tomoki; Kamimura, Shigeo; Koda, Yoshiro

    2009-07-01

    The forkhead box P2 (FOXP2) gene is specifically involved in speech and language development in humans. The sequence is well conserved among many vertebrate species but has accumulated amino acid changes in the human lineage. The aim of this study was to develop a simple method to discriminate between human and nonhuman vertebrate DNA in forensic specimens by amplification of a human-specific genomic region. In the present study, we designed an allele-specific polymerase chain reaction (PCR) using primers to amplify smaller than 70-bp regions of FOXP2 to identify DNA as being of human or nonhuman, including ape, origin. PCR amplification was also successfully performed using fluorescence-labeled primers, and this method allows a single PCR reaction with a genomic DNA sample as small as 0.01 ng. This system also identified the presence of human DNA in two blood stains stored for 20 and 38 years. The results suggested the potential usefulness of FOXP2 as an identifier of human DNA in forensic samples.

  8. Use of extremely short Förster resonance energy transfer probes in real-time polymerase chain reaction

    PubMed Central

    Kutyavin, Igor V.

    2013-01-01

    Described in the article is a new approach for the sequence-specific detection of nucleic acids in real-time polymerase chain reaction (PCR) using fluorescently labeled oligonucleotide probes. The method is based on the production of PCR amplicons, which fold into dumbbell-like secondary structures carrying a specially designed ‘probe-luring’ sequence at their 5′ ends. Hybridization of this sequence to a complementary ‘anchoring’ tail introduced at the 3′ end of a fluorescent probe enables the probe to bind to its target during PCR, and the subsequent probe cleavage results in the florescence signal. As it has been shown in the study, this amplicon-endorsed and guided formation of the probe-target duplex allows the use of extremely short oligonucleotide probes, up to tetranucleotides in length. In particular, the short length of the fluorescent probes makes possible the development of a ‘universal’ probe inventory that is relatively small in size but represents all possible sequence variations. The unparalleled cost-effectiveness of the inventory approach is discussed. Despite the short length of the probes, this new method, named Angler real-time PCR, remains highly sequence specific, and the results of the study indicate that it can be effectively used for quantitative PCR and the detection of polymorphic variations. PMID:24013564

  9. Dynamic optimization of on-chip polymerase chain reaction by monitoring intracycle fluorescence using fast synchronous detection

    NASA Astrophysics Data System (ADS)

    Mondal, Sudip; Paul, Debjani; Venkataraman, V.

    2007-01-01

    The authors report on-chip dynamic optimization of polymerase chain reaction (PCR) based on a feedback technique utilizing synchronous detection of intracycle fluorescence every 500ms. From a direct measurement of polymerase activity, the authors determine the optimum extension temperature. The authors dynamically optimize PCR in an inductively heated microchip by sensing the saturation of extension in each cycle and applying the feedback. They demonstrate that, even with fast ramp rates, dynamic optimization leads to faster reactions compared to fixed-duration extension protocols for long DNA (>500bp). This optimization scheme uses a fairly universal dye Sybr Green I and can be applied to most PCRs.

  10. Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

    PubMed Central

    Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

    2010-01-01

    Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA∕RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification. PMID:21267083

  11. Exploring the limits of ultrafast polymerase chain reaction using liquid for thermal heat exchange: A proof of principle

    NASA Astrophysics Data System (ADS)

    Maltezos, George; Johnston, Matthew; Taganov, Konstantin; Srichantaratsamee, Chutatip; Gorman, John; Baltimore, David; Chantratita, Wasun; Scherer, Axel

    2010-12-01

    Thermal ramp rate is a major limiting factor in using real-time polymerase chain reaction (PCR) for routine diagnostics. We explored the limits of speed by using liquid for thermal exchange rather than metal as in traditional devices, and by testing different polymerases. In a clinical setting, our system equaled or surpassed state-of-the-art devices for accuracy in amplifying DNA/RNA of avian influenza, cytomegalovirus, and human immunodeficiency virus. Using Thermococcus kodakaraensis polymerase and optimizing both electrical and chemical systems, we obtained an accurate, 35 cycle amplification of an 85-base pair fragment of E. coli O157:H7 Shiga toxin gene in as little as 94.1 s, a significant improvement over a typical 1 h PCR amplification.

  12. Feline coronavirus quantitative reverse transcriptase polymerase chain reaction on effusion samples in cats with and without feline infectious peritonitis.

    PubMed

    Longstaff, Louise; Porter, Emily; Crossley, Victoria J; Hayhow, Sophie E; Helps, Christopher R; Tasker, Séverine

    2017-02-01

    Objectives The aim of the study was to determine whether feline coronavirus (FCoV) RNA in effusion samples can be used as a diagnostic marker of feline infectious peritonitis (FIP); and in FCoV RNA-positive samples to examine amino acid codons in the FCoV spike protein at positions 1058 and 1060 where leucine and alanine, respectively, have been associated with systemic or virulent (FIP) FCoV infection. Methods Total RNA was extracted from effusion samples from 20 cats with confirmed FIP and 23 cats with other diseases. Feline coronavirus RNA was detected using a reverse transcriptase quantitative polymerase chain reaction assay (qRT-PCR), and positive samples underwent pyrosequencing of position 1058 with or without Sanger sequencing of position 1060 in the FCoV spike protein. Results Seventeen (85%) of the effusion samples from 20 cats with FIP were positive for FCoV RNA, whereas none of the 23 cats with other diseases were positive. Pyrosequencing of the 17 FCoV-positive samples showed that 11 (65%) of the cats had leucine and two (12%) had methionine at position 1058. Of the latter two samples with methionine, one had alanine at position 1060. Conclusions and relevance A positive FCoV qRT-PCR result on effusions appears specific for FIP and may be a useful diagnostic marker for FIP in cats with effusions. The majority of FCoVs contained amino acid changes previously associated with systemic spread or virulence (FIP) of the virus.

  13. Selection of reference genes for quantitative reverse-transcription polymerase chain reaction normalization in Brassica napus under various stress conditions.

    PubMed

    Wang, Zheng; Chen, Yu; Fang, Hedi; Shi, Haifeng; Chen, Keping; Zhang, Zhiyan; Tan, Xiaoli

    2014-10-01

    Data normalization is essential for reliable output of quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR) assays, as the unsuitable choice of reference gene(s), whose expression might be influenced by exogenous treatments in plant tissues, could cause misinterpretation of results. To date, no systematic studies on reference genes have been performed in stressed Brassica napus. In this study, we investigated the expression variations of nine candidate reference genes in 40 samples of B. napus leaves subjected to various exogenous treatments. Parallel analyses by geNorm and NormFinder revealed that optimal reference genes differed across the different sets of samples. The best-ranked reference genes were PP2A and TIP41 for salt stress, TIP41 and ACT7 for heavy metal (Cr(6+)) stress, PP2A and UBC21 for drought stress, F-box and SAND for cold stress, F-box and ZNF for salicylic acid stress, TIP41, ACT7, and PP2A for methyl jasmonate stress, TIP41 and ACT7 for abscisic acid stress, and TIP41, UBC21, and PP2A for Sclerotinia sclerotiorum stress. Two newly employed reference genes, TIP41 and PP2A, showed better performances, suggesting their suitability in multiple conditions. To further validate the suitability of the reference genes, the expression patterns of BnWRKY40 and BnMKS1 were studied in parallel. This study is the first systematic analysis of reference gene selection for qRT-PCR normalization in B. napus, an agriculturally important crop, under different stress conditions. The results will contribute toward more accurate and widespread use of qRT-PCR in gene analysis of the genus Brassica.

  14. Detection of enteroviral RNA by polymerase chain reaction in cerebrospinal fluid from patients with aseptic meningitis.

    PubMed

    Glimåker, M; Johansson, B; Olcén, P; Ehrnst, A; Forsgren, M

    1993-01-01

    An assay based on a 2-step (semi-nested) polymerase chain reaction (PCR) was developed and evaluated for detection of enterovirus-specific RNA in cerebrospinal fluid (CSF) from patients with aseptic meningitis of different etiology. The limit of detectability of enteroviral RNA was equivalent to about 0.25 tissue culture infective doses 50%. In samples, stored at -70 degrees C, analyzed without repeated thawing, enteroviral RNA was demonstrable in 21/22 CSF specimens from which an enterovirus had been isolated. Enteroviral RNA was shown to be degraded during freeze-thawing of the samples. In repeatedly freeze-thawed samples from 134 consecutive patients with aseptic meningitis, a lower sensitivity (34/48 = 0.71) was observed. In the latest phase of the study, comprising 35 consecutive patients, the PCR was performed in CSF stored at -20 degrees C without thawing. In this material, the PCR yielded positive results in 19 patients, whereas enteroviruses were isolated from 6 cases only. In the total clinical material of 169 patients, 67 (40%) were found positive by PCR, whereas an enterovirus was isolated from CSF in 54 (32%) cases. All the 13 isolated enterovirus serotypes found in the study were demonstrable by PCR, indicating that the assay is broad-reacting within the enterovirus group. The specificity appeared to be high, since all of 21 patients with non-enteroviral diagnoses were negative by the PCR test, except 1 with an Epstein-Barr virus infection. As serological evidence of enteroviral etiology was found in this patient, a dual infection seemed probable. This study indicates that enteroviral RNA can be detected in CSF by a 2-step PCR in meningitis caused by enterovirus and that the technique has the potential to become a screening method for routine diagnosis of enteroviral meningitis.

  15. A serotype-specific polymerase chain reaction for identification of Pasteurella multocida serotype 1

    USGS Publications Warehouse

    Rocke, Tonie E.; Smith, Susan R.; Miyamoto, Amy; Shadduck, Daniel J.

    2002-01-01

    A serotype-specific polymerase chain reaction (PCR) assay was developed for detection and identification of Pasteurella multocida serotype 1, the causative agent of avian cholera in wild waterfowl. Arbitrarily primed PCR was used to detect DNA fragments that distinguish serotype 1 from the other 15 serotypes of P. multocida (with the exception of serotype 14). Oligonucleotide primers were constructed from these sequences, and a PCR assay was optimized and evaluated. PCR reactions consistently resulted in amplification products with reference strains 1 and 14 and all other serotype 1 strains tested, with cell numbers as low as 2.3 cells/ml. No amplification products were produced with other P. multocida serotypes or any other bacterial species tested. To compare the sensitivity and further test the specificity of this PCR assay with traditional culturing and serotyping techniques, tissue samples from 84 Pekin ducks inoculated with field strains of P. multocida and 54 wild lesser snow geese collected during an avian cholera outbreak were provided by other investigators working on avian cholera. PCR was as sensitive (58/64) as routine isolation (52/64) in detecting and identifying P. multocida serotype 1 from the livers of inoculated Pekins that became sick or died from avian cholera. No product was amplified from tissues of 20 other Pekin ducks that received serotypes other than type 1 (serotype 3, 12 × 3, or 10) or 12 control birds. Of the 54 snow geese necropsied and tested for P. multocida, our PCR detected and identified the bacteria from 44 compared with 45 by direct isolation. The serotype-specific PCR we developed was much faster and less labor intensive than traditional culturing and serotyping procedures and could result in diagnosis of serotype 1 pasteurellosis within 24 hr of specimen submission.

  16. Detection of MYCN Amplification in Serum DNA Using Conventional Polymerase Chain Reaction

    PubMed Central

    2016-01-01

    Neuroblastoma (NB) is the most common extra-cranial solid tumor of childhood and is characterized by a wide range of clinical behaviors. Amplification of MYCN is a well-known poor prognostic factor in NB patients. As the MYCN amplification status is usually tested using tumor specimens, lengthy and invasive procedures are unavoidable. To evaluate the possibility of detecting MYCN amplification without invasive procedure, we performed conventional polymerase chain reaction (PCR) analysis to identify MYCN amplification using the preserved serum DNA. PCR of serum DNA was done in 105 NB patients whose MYCN status had been confirmed by fluorescence in situ hybridization. MYCN amplification was evaluated as the ratio of signal intensities between MYCN and NAGK (M/N ratio). When regarding the tissue FISH results as a reference, 10 patients had MYCN-amplified (MNA) NB, and 95 had non-MNA NB. The M/N ratio of the MNA group (median 2.56, range 1.01-3.58) was significantly higher than that of the non-MNA group (median 0.97, range 0.67-5.18) (P < 0.001). In the receiver operating characteristic curve analysis, the area under the curve was 0.957 (95% confidence interval 0.898–1.000; P < 0.001), and it showed 90.9% sensitivity and 97.9% specificity with the selected cut-off value set as 1.6. The detection of MYCN amplification using conventional PCR analysis of serum samples seems to be a simple and promising method to evaluate the MYCN status of NB patients. Further study with a larger set of patients is needed to confirm the accuracy of this result. PMID:27510381

  17. Fabrication of Polymerase Chain Reaction Plastic Lab-on-a-Chip Device for Rapid Molecular Diagnoses

    PubMed Central

    2016-01-01

    Purpose: We aim to fabricate a thermoplastic poly(methylmethacrylate) (PMMA) Lab-on-a-Chip device to perform continuous- flow polymerase chain reactions (PCRs) for rapid molecular detection of foodborne pathogen bacteria. Methods: A miniaturized plastic device was fabricated by utilizing PMMA substrates mediated by poly(dimethylsiloxane) interfacial coating, enabling bonding under mild conditions, and thus avoiding the deformation or collapse of microchannels. Surface characterizations were carried out and bond strength was measured. The feasibility of the Lab-on-a-Chip device for performing on-chip PCR utilizing a lab-made, portable dual heater was evaluated. The results were compared with those obtained using a commercially available thermal cycler. Results: A PMMA Lab-on-a-Chip device was designed and fabricated for conducting PCR using foodborne pathogens as sample targets. A robust bond was established between the PMMA substrates, which is essential for performing miniaturized PCR on plastic. The feasibility of on-chip PCR was evaluated using Escherichia coli O157:H7 and Cronobacter condimenti, two worldwide foodborne pathogens, and the target amplicons were successfully amplified within 25 minutes. Conclusions: In this study, we present a novel design of a low-cost and high-throughput thermoplastic PMMA Lab-on-a-Chip device for conducting microscale PCR, and we enable rapid molecular diagnoses of two important foodborne pathogens in minute resolution using this device. In this regard, the introduced highly portable system design has the potential to enable PCR investigations of many diseases quickly and accurately. PMID:27230459

  18. National Malaria Prevalence in Cambodia: Microscopy Versus Polymerase Chain Reaction Estimates.

    PubMed

    Lek, Dysoley; Popovici, Jean; Ariey, Frederic; Vinjamuri, Seshu Babu; Meek, Sylvia; Bruce, Jan; Taylor, Walter R J; Socheat, Duong; Menard, Didier; Rogers, William O

    2016-09-07

    Accurate information regarding malaria prevalence at national level is required to design and assess malaria control/elimination efforts. Although many comparisons of microscopy and polymerase chain reaction (PCR)-based methods have been conducted, there is little published literature covering such comparisons in southeast Asia especially at the national level. Both microscopic examination and PCR detection were performed on blood films and dried blood spots samples collected from 8,067 individuals enrolled in a nationwide, stratified, multistage, cluster sampling malaria prevalence survey conducted in Cambodia in 2007. The overall malaria prevalence and prevalence rates of Plasmodium falciparum, Plasmodium vivax, and Plasmodium malariae infections estimated by microscopy (N = 8,067) were 2.74% (95% confidence interval [CI]: 2.39-3.12%), 1.81% (95% CI: 1.53-2.13%), 1.14% (95% CI: 0.92-1.40%), and 0.01% (95% CI: 0.003-0.07%), respectively. The overall malaria prevalence based on PCR detection (N = 7,718) was almost 2.5-fold higher (6.31%, 95% CI: 5.76-6.89%, P < 0.00001). This difference was significantly more pronounced for P. falciparum (4.40%, 95% CI: 3.95-4.90%, P < 0.00001) compared with P. vivax (1.89%, 95% CI: 1.60-2.22%, P < 0.001) and P. malariae infections (0.22%, 95% CI: 0.13-0.35%, P < 0.0001). The significant proportion of microscopy-negative but PCR-positive individuals (289/7,491, 3.85%) suggest microscopic examination frequently underestimated malaria infections and that active case detection based on microscopy may miss a significant reservoir of infection, especially in low-transmission settings.

  19. Detection of Yersinia ruckeri in rainbow trout blood by use of the polymerase chain reaction.

    PubMed

    Altinok, I; Grizzle, J M; Liu, Z

    2001-01-26

    We evaluated a polymerase chain reaction (PCR) method for detecting Yersinia ruckeri, the bacterial pathogen causing enteric redmouth disease (ERM), in blood of rainbow trout Oncorhynchus mykiss. Identification of the PCR product was confirmed by Southern blot hybridization with a 32P-labeled oligonucleotide probe matching a sequence within the small subunit ribosomal RNA gene of Y. ruckeri. Following a 1 h immersion of rainbow trout in water with 4.5 x 10(6) colony-forming units of Y. ruckeri l(-1), the PCR was positive for all blood samples from 1 h (first sample) to 5 d and was negative from 9 to 30 d (last sample). Fish in this experiment did not show signs of disease, probably because they had been vaccinated against Y. ruckeri. To test this method with naturally infected fish, 42 rainbow trout from hatcheries were examined. Four of these fish had clinical signs of ERM and were infected with Y. ruckeri based on bacteriological culture. The PCR method detected Y. ruckeri in blood, intestine, liver, and trunk kidney from the 4 fish with ERM and from 5 additional rainbow trout that were bacteriologically negative for Y. ruckeri. Three of 5 rainbow trout from streams receiving effluent from hatcheries were positive for Y. ruckeri when tested with PCR, although there was no growth of Y. ruckeri on culture plates inoculated with the same samples. Samples were successfully stored for 1 wk in lysis buffer at 25 degrees C. This study demonstrated that a non-lethal blood sample can be used with PCR to detect Y. ruckeri.

  20. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed Central

    Kyambadde, J. W.; Enyaru, J. C.; Matovu, E.; Odiit, M.; Carasco, J. F.

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter. PMID:10686746

  1. mRNA-specific reverse transcription-polymerase chain reaction from human tissue extracts.

    PubMed

    Hurteau, Gregory J; Spivack, Simon D

    2002-08-15

    Reverse transcription-polymerase chain reaction (RT-PCR) has become the method of choice for detection of mRNA transcripts, including those of low abundance obtained from small precious samples of human tissue. A major confounding problem for standard reverse-transcription-priming strategies is the presence of contaminating genomic DNA (gDNA) carried over from the original "RNA" extract into the RT and PCR steps. The contaminating gDNA contains a processed pseudogene sequence-which lacks introns but contains a poly(A) tail-for commonly studied internal reference genes beta-actin and GAPDH, and target genes GSTM1, GSTP1, and others. These pseudogene sequences therefore confound standard-design "RNA-specific" PCR primer pairs which rely, for cDNA versus gDNA specificity, on the pair-spanning introns, or one of the individual primer oligos spanning an exon/exon splice site, because these features are lacking in processed pseudogene sequences. The result is false RT-PCR positives for these "housekeeper" genes in total RNA extracts; the gDNA processed pseudogene is mistaken for mRNA gene transcript. A universal RT primer has been designed that targets the poly(A) tail of mRNA and adds a unique tag sequence not otherwise existing in the human genome. Genomic DNA does not incorporate this RT-inserted unique tag. PCR is then performed using a transcript-specific forward primer and a reverse primer that is identical to the unique tag incorporated at RT. Only cDNA made with this RT primer is compatible with this reverse PCR primer, thus eliminating confounding signal from contaminating gDNA. This method performs RNA-specific qualitative and quantitative evaluation of gene expression, while preserving the sensitivity of standard RT-PCR techniques. Applications to low-copy transcripts in human samples are demonstrated.

  2. Absolute quantification of genetically modified MON810 maize (Zea mays L.) by digital polymerase chain reaction.

    PubMed

    Corbisier, Philippe; Bhat, Somanath; Partis, Lina; Xie, Vicki Rui Dan; Emslie, Kerry R

    2010-03-01

    Quantitative analysis of genetically modified (GM) foods requires estimation of the amount of the transgenic event relative to an endogenous gene. Regulatory authorities in the European Union (EU) have defined the labelling threshold for GM food on the copy number ratio between the transgenic event and an endogenous gene. Real-time polymerase chain reaction (PCR) is currently being used for quantification of GM organisms (GMOs). Limitations in real-time PCR applications to detect very low number of DNA targets has led to new developments such as the digital PCR (dPCR) which allows accurate measurement of DNA copies without the need for a reference calibrator. In this paper, the amount of maize MON810 and hmg copies present in a DNA extract from seed powders certified for their mass content and for their copy number ratio was measured by dPCR. The ratio of these absolute copy numbers determined by dPCR was found to be identical to the ratios measured by real-time quantitative PCR (qPCR) using a plasmid DNA calibrator. These results indicate that both methods could be applied to determine the copy number ratio in MON810. The reported values were in agreement with estimations from a model elaborated to convert mass fractions into copy number fractions in MON810 varieties. This model was challenged on two MON810 varieties used for the production of MON810 certified reference materials (CRMs) which differ in the parental origin of the introduced GM trait. We conclude that dPCR has a high metrological quality and can be used for certifying GM CRMs in terms of DNA copy number ratio.

  3. Polymerase Chain Reaction: An Important Tool for Early Diagnosis of Leptospirosis Cases

    PubMed Central

    Mullan, Summaiya

    2016-01-01

    Introduction Various diagnostic methods like Microscopic Agglutination Test (MAT), IgM ELISA, Isolation of Leptospira from the clinical specimen, Rapid leptocheck tests etc., are available for diagnosis of leptospirosis. Polymerase Chain Reaction (PCR) is used for diagnosis of various diseases of infectious origin including leptospirosis but there is paucity of data about comparison of PCR with other available method of diagnosis of leptospirosis. Aim The aim of the study was to detect the leptospiral DNA by PCR method and to compare the results of PCR with other available diagnostic methods used for diagnosis of suspected leptospirosis cases in acute phase of illness. Materials and Methods A total of 207 blood samples were obtained from suspected patients of leptospirosis admitted in New Civil Hospital, a tertiary care hospital in South Gujarat, during the period of July 2008 to November 2008. These blood samples were subjected to Rapid leptocheck, IgM ELISA, MAT test to detect (IgG or IgM) antibody level, Leptospira culture and PCR. Results In early phase of the disease, Rapid leptocheck test gave 44% detection, but along with PCR seropositivity reached upto 71%. Detection rate by IgM ELISA was 59% which increased to 80% with PCR. By MAT seropositivity was 57% but combined seropositivity of MAT with PCR was 78%. Sensitivity and specificity of PCR as compared to MAT (Gold standard) was 52% and 79% respectively. Leptospira was not growing in culture. Conclusion In present study, PCR picked up to 50% of cases which were negative by other serological tests so these finding suggest that PCR should be used routinely in acute phase of disease. PMID:28208854

  4. Polymerase chain reaction-free detection of hepatitis B virus DNA using a nanostructured impedance biosensor.

    PubMed

    Chen, Chun-Cheng; Lai, Zi-Lun; Wang, Gou-Jen; Wu, Chun-Ying

    2016-03-15

    A polymerase chain reaction (PCR)-free technique for the effective detection of genomic length hepatitis B virus (HBV) DNA is described in this study. The honeycomb-like barrier layer of an anodic aluminum oxide (AAO) film having a uniform nanohemisphere array was used as the substrate of the sensing electrode. A 30-nm gold film was sputtered onto the AAO barrier layer surface as the electrode, followed by electrochemical deposition of gold nanoparticles (GNPs) on the hemisphere surface. A specially designed single-strand 96-mer gene fragment of the target genomic DNA of HBV based on the genome sequences of HBV was immobilized on the nanostructured electrode as the capture probe. Target HBV DNA obtained from clinical samples was hybridized to the sensing probes. Detection results illustrate two dynamic linear ranges, 10(2)-10(3) and 10(3)-10(5.1) copies/mL, having R(2) values of 0.801 and 0.996 could be obtained, respectively. The detection limit of the proposed sending scheme was measured to be 111 copies/mL. The total of 45 target samples, including 20 samples with HBV concentration being lower than 10(2) copies/mL and 25 samples with HBV concentration being in the range of 10(3)-10(5.1) copies/mL, were used for real test. The concentration of these 45 HBV DNA samples was measured by the COBAS Ampliprep system. Comparing the measured results of the COBAS Ampliprep and our system, it was illustrated that the HBV DNA concentrations measured by the proposed method in this study had a high linear correlation with the COBAS Ampliprep, having R(2) values of 0.983. The proposed sensing scheme is highly feasible for future clinical applications.

  5. A new era of uveitis: impact of polymerase chain reaction in intraocular inflammatory diseases.

    PubMed

    Mochizuki, Manabu; Sugita, Sunao; Kamoi, Koju; Takase, Hiroshi

    2017-01-01

    Uveitis is a sight-threatening intraocular inflammatory disorder which may occur from both infectious and non-infectious or autoimmune causes. The frequency of infectious uveitis and autoimmune uveitis varies depending on countries and regions. According to a nationwide survey conducted by the Japanese Ocular Inflammation Society, infectious and non-infectious uveitis accounted for 16.4 and 50.1% of new patients, respectively while the remaining 33.5% of new uveitis cases were not classified or were idiopathic uveitis. Infectious uveitis is particularly important because it causes tissue damage to the eye and may result in blindness unless treated. However, it can be treated if the pathogenic microorganisms are identified promptly and accurately. Remarkable advancements in molecular and immunological technologies have been made in the last decade, and the diagnosis of infectious uveitis has been greatly improved by the application of molecular and immunological investigations, particularly polymerase chain reaction (PCR). PCR performed on a small amount of ocular samples provides a prompt, sensitive, and specific molecular diagnosis of pathogenic microorganisms in the eye. This technology has opened a new era in the diagnosis and treatment of uveitis, enabling physicians to establish new clinical entities of uveitis caused by infectious microorganisms, identify pathogens in the eyes of many patients with uveitis, and determine prompt diagnosis and appropriate therapy. Here we review the PCR process, new PCR tests specialized for ocular diseases, microorganisms detected by the PCR tests, diseases in the eye caused by these microorganisms, and the clinical characteristics, diagnosis, and therapy of uveitis.

  6. Multiplex Polymerase Chain Reaction for Detection of Gastrointestinal Pathogens in Migrant Workers in Qatar

    PubMed Central

    Humphrey, John M.; Ranbhise, Sanjay; Ibrahim, Emad; Al-Romaihi, Hamad E.; Farag, Elmoubasher; Abu-Raddad, Laith J.; Glesby, Marshall J.

    2016-01-01

    The causes of infectious diarrhea among the migrant worker population in Qatar are not well understood. We conducted a prospective observational study to understand the demographic and clinical characteristics and infectious causes of diarrhea among migrant workers in Doha, Qatar. A total of 126 male workers presenting to the Qatar Red Crescent Worker's Health Center outpatient clinic or emergency department were studied over a 5-month period in 2015–2016. Epidemiologic surveys were administered to all subjects and the prevalence of 22 different stool pathogens was determined using multiplex polymerase chain reaction (PCR) (FilmArray® Gastrointestinal PCR). A target pathogen was identified in 62.7% of subjects. Enteropathogenic Escherichia coli was the most prevalent pathogen and was detected in 24.6% of subjects, followed by Salmonella (22.2%), enteroaggregative E. coli (15.1%), Giardia lamblia (9.5%), and enterotoxigenic E. coli (8.7%). Multiple pathogens were identified in 49.3% of positive stool samples. In a multivariable analysis, the presence of a heart rate ≥ 90 (adjusted odds ratio [OR] = 3.7, 95% confidence interval [CI] = 1.4–10.0) and > 5 fecal leukocytes/high-power field (adjusted OR = 2.8, 95% CI = 1.2–7.0) were significant predictors of detecting an acute inflammatory pathogen by PCR. Use of multiplex PCR enabled the detection of gastrointestinal pathogens in a high proportion of cases, illustrating the utility of this diagnostic tool in epidemiologic studies of infectious diarrhea. PMID:27928081

  7. Revelation of Viral – Bacterial Interrelationship in Aggressive Periodontitis via Polymerase Chain Reaction: A Microbiological Study

    PubMed Central

    Sharma, Sumit; Tapashetti, Roopali P; Patil, Sudhir R; Kalra, Sonali Medsinge; Bhat, Geetha K; Guvva, Sowjanya

    2015-01-01

    Background: Periodontal disease is one of the most common and complex disease affecting mankind. Being multifactorial in etiology it encompasses a variety of infectious entities with various unique microbial constellations and immune responses. A bacteriologic cause alone seems insufficient in explaining several clinical features of the periodontal disease. Recent studies suggest that periodontal herpes viruses comprise an important source of triggering periodontal tissue destruction. The following study aims to assess human cytomegalovirus (HCMV), Epstein-Barr virus (EBV-I) interaction with the established periodontopathic bacteriae, Porphyromonas gingivalis (Pg) and Aggregatibacter actinomycetemcomitans (Aa) in pathogenesis of aggressive periodontitis (AgP) using Hotstart polymerase chain reaction (PCR). Materials and Methods: A total of 30 subjects, 15 with AgP and 15 healthy controls contributed random subgingival plaque samples. PCR methodology was used to identify the subgingival herpesviruses, Pg, and Aa. Yates corrected Chi-square test was employed to identify a statistical association between herpesviruses and periodontopathic bacteriae. Results: Findings suggested that viruses may be pertinent to disease progression. The prevalence of the periodontopathic bacteria Aa was found in 53.33% (P = 0.0168, S) and Pg in 40% (P = 0.2155, NS) of the AgP patients. Herpesviruses, HCMV and EBV-I were found to have a prevalence of 46.67% (P = 0.039, S) and 40% (P = 0.084, NS). The viral and bacterial co-infection was found to be 77.78% (P = 0.0002, S) with Aa and HCMV. Conclusion: The present data reveals, viruses may exert periodontopathic effect by causing local immunosupression which may set a stage for the subgingival colonization and multiplication of periodontal bacteriae. Further studies are needed to develop an understanding into the significance of herpesviruses in human periodontitis which, may allow for improved diagnosis, more specific therapy and

  8. Quantitation of transgenic plant DNA in leachate water: real-time polymerase chain reaction analysis.

    PubMed

    Gulden, Robert H; Lerat, Sylvain; Hart, Miranda M; Powell, Jeff R; Trevors, Jack T; Pauls, K Peter; Klironomos, John N; Swanton, Clarence J

    2005-07-27

    Roundup Ready (RR) genetically modified (GM) corn and soybean comprise a large portion of the annual planted acreage of GM crops. Plant growth and subsequent plant decomposition introduce the recombinant DNA (rDNA) into the soil environment, where its fate has not been completely researched. Little is known of the temporal and spatial distribution of plant-derived rDNA in the soil environment and in situ transport of plant DNA by leachate water has not been studied before. The objectives of this study were to determine whether sufficient quantities of plant rDNA were released by roots during growth and early decomposition to be detected in water collected after percolating through a soil profile and to determine the influence of temperature on DNA persistence in the leachate water. Individual plants of RR corn and RR soybean were grown in modified cylinders in a growth room, and the cylinders were flushed with rain water weekly. Immediately after collection, the leachate was subjected to DNA purification followed by rDNA quantification using real-time Polymerase Chain Reaction (PCR) analysis. To test the effects of temperature on plant DNA persistence in leachate water, water samples were spiked with known quantities of RR soybean or RR corn genomic DNA and DNA persistence was examined at 5, 15, and 25 degrees C. Differences in the amounts and temporal distributions of root-derived rDNA were observed between corn and soybean plants. The results suggest that rainfall events may distribute plant DNA throughout the soil and into leachate water. Half-lives of plant DNA in leachate water ranged from 1.2 to 26.7 h, and persistence was greater at colder temperatures (5 and 15 degrees C).

  9. Aseptic meningitis caused by Leptospira spp diagnosed by polymerase chain reaction.

    PubMed

    Romero, Eliete Caló; Blanco, Roberta Morozetti; Yasuda, Paulo Hideki

    2010-12-01

    Leptospirosis is a zoonotic disease caused by the pathogenic Leptospira spp. The clinical presentations are diverse, ranging from undifferentiated fever to fulminant disease including meningeal forms. The neurological leptospirosis forms are usually neglected. The aim of this study was to investigate leptospirosis as the cause of aseptic meningitis using different diagnostic techniques including the polymerase chain reaction (PCR). Thirty-nine cerebrospinal fluid (CSF) samples from patients presenting with meningeal abnormalities, predominance of lymphocytes and negative results by traditional microbiological tests were processed by leptospiral culture, anti-leptospiral antibody response and PCR. Leptospira spp DNA was detected in 23 (58.97%) of the CSF samples. Anti-leptospiral antibodies were found in 13 (33.33%) CSF samples. Twelve CSF samples were positive by PCR assay and negative by microscopic agglutination test (MAT) assay. Two CSF samples were positive by MAT and negative by PCR. The positive and negative agreement between both tests was 11 and 14, respectively. CSF samples from six cases of unknown diagnosis were positive by PCR assay. Eight cases showed positive results using PCR and MAT. Leptospirosis could be detected by PCR assay from the 3rd-26th day after illness onset. The sensitivity of the PCR was assessed with confirmed cases of leptospirosis (by MAT) and found to be 89.5%. All CSFs were negative by culture. PCR was found to be a powerful tool for diagnosing meningitis cases of leptospirosis. We recommend that it may be used as a supplementary diagnostic tool, especially in the early stages of the disease, when other diagnostic techniques such as serology are not sensitive.

  10. Reverse transcription-polymerase chain reaction detection of transcribed sequences on human chromosome 21

    SciTech Connect

    Cheng, J.F.; Zhu, Y. )

    1994-03-15

    Seventy-four pairs of oligonucleotides derived from sequence-tagged sites (STSs) on the long arm of human chromosome 21, specifically from bands 21q22.1 to 21q22.3, were used in reverse transcription-polymerase chain reactions (RT-PCR) to detect the presence of expressed sequences in a fetal brain. These STSs included 69 that had not been related to transcribed sequences and 5 that had detected two known genes and three previously isolated cDNA clones. Of the 69 STSs analyzed in RT-PCR, 25 allowed amplification of specific cDNA fragments. The sizes of amplified cDNA fragments match those amplified from either human genomic DNA or somatic hybrid cells containing human chromosome 21. Of the 11 cDNA analyzed in Northern blot hybridizations, 6 hybridized to specific RNA species. The rapid screening for cDNA using previously mapped STSs has provided insight into the distribution of expressed sequences in this region of chromosome 21. Northern blot analysis of the amplified cDNA fragments has revealed interesting candidate genes in two disease loci. The marker D21S267 was previously mapped in the Down syndrome region of chromosome 21, and the marker D21S113 is closely linked to progressive myoclonus epilepsy. The cDNA fragments amplified using the primer sequences derived from D21S267 and D21S113 hybridized to 7- and 6.5-kb transcripts, respectively, which seems to express predominantly in brain. 37 refs., 3 figs., 1 tab.

  11. Use of the polymerase chain reaction to detect Mycobacterium leprae in urine.

    PubMed

    Caleffi, K R; Hirata, R D C; Hirata, M H; Caleffi, E R; Siqueira, V L D; Cardoso, R F

    2012-02-01

    Leprosy is an infectious disease caused by Mycobacterium leprae. The polymerase chain reaction (PCR) has been applied to detect M. leprae in different clinical samples and urine seems to be attractive for this purpose. PCR was used to improve the sensitivity for diagnosing leprosy by amplifying a 151-bp PCR fragment of the M. leprae pra gene (PCR-Pra) in urine samples. Seventy-three leprosy patients (39 males and 34 females, 14 to 78 years old) were selected for leprosy diagnosis at a reference laboratory in Maringá, PR, Brazil. Of these, 36 were under anti-leprosy multidrug therapy with dapsone and rifampicin for tuberculoid (TT) and dapsone, rifampicin and clofazimine for borderline (BB) and lepromatous (LL) forms. The control group contained 50 healthy individuals without any clinical history of leprosy. DNA isolated from leprosy patients' urine samples was successfully amplified by PCR-Pra in 46.6% (34/73) of the cases. The positivity of PCR-Pra for patients with the TT form was 75% for both patients under treatment and non-treated patients (P = 0.1306). In patients with the LL form, PCR-Pra positivity was 52 and 30% for patients under treatment and non-treated patients, respectively (P = 0.2386). PCR-Pra showed a statistically significant difference in detecting M. leprae between the TT and LL forms of leprosy in patients under treatment (P = 0.0033). Although the current study showed that the proposed PCR-Pra has some limitations in the detection of M. leprae, this method has the potential to be a useful tool for leprosy diagnosis mainly in TT leprosy where the AFB slit-skin smear is always negative.

  12. Investigation of polymerase chain reaction assays to improve detection of bacterial involvement in bovine respiratory disease.

    PubMed

    Bell, Colin J; Blackburn, Paul; Elliott, Mark; Patterson, Tony I A P; Ellison, Sean; Lahuerta-Marin, Angela; Ball, Hywel J

    2014-09-01

    Bovine respiratory disease (BRD) causes severe economic losses to the cattle farming industry worldwide. The major bacterial organisms contributing to the BRD complex are Mannheimia haemolytica, Histophilus somni, Mycoplasma bovis, Pasteurella multocida, and Trueperella pyogenes. The postmortem detection of these organisms in pneumonic lung tissue is generally conducted using standard culture-based techniques where the presence of therapeutic antibiotics in the tissue can inhibit bacterial isolation. In the current study, conventional and real-time polymerase chain reaction (PCR) assays were used to assess the prevalence of these 5 organisms in grossly pneumonic lung samples from 150 animals submitted for postmortem examination, and the results were compared with those obtained using culture techniques. Mannheimia haemolytica was detected in 51 cases (34%) by PCR and in 33 cases (22%) by culture, H. somni was detected in 35 cases (23.3%) by PCR and in 6 cases (4%) by culture, Myc. bovis was detected in 53 cases (35.3%) by PCR and in 29 cases (19.3%) by culture, P. multocida was detected in 50 cases (33.3%) by PCR and in 31 cases (20.7%) by culture, and T. pyogenes was detected in 42 cases (28%) by PCR and in 31 cases (20.7%) by culture, with all differences being statistically significant. The PCR assays indicated positive results for 111 cases (74%) whereas 82 cases (54.6%) were culture positive. The PCR assays have demonstrated a significantly higher rate of detection of all 5 organisms in cases of pneumonia in cattle in Northern Ireland than was detected by current standard procedures.

  13. Detection of trypanosomes in suspected sleeping sickness patients in Uganda using the polymerase chain reaction.

    PubMed

    Kyambadde, J W; Enyaru, J C; Matovu, E; Odiit, M; Carasco, J F

    2000-01-01

    Diagnosis of sleeping sickness (trypanosomiasis) is difficult because of the fluctuating levels of parasitaemia encountered in patients. In the present study we found that the polymerase chain reaction (PCR) demonstrated trypanosome infection in 20 out of 35 (57.1%) blood samples and in 21 out of 34 (61.7%) cerebrospinal fluid (CSF) samples collected from an area endemic for sleeping sickness in north-west Uganda. A total of 14 blood samples and 13 CSF samples that were positive for trypanosomes by double centrifugation were also positive by PCR, demonstrating good concordance between the two methods. However, 6 (28.6%) of the 21 blood samples that were parasitologically negative were positive by PCR, while 8 (38.0%) out of 21 CSF samples that were negative by double centrifugation were positive by PCR. These 14 negative samples could therefore be from sleeping sickness cases even though a positive PCR test is not evidence for the presence of trypanosomes. Furthermore, of these 8 CSF samples, 4 had been designated as early cases, based on the absence of trypanosomes and on a count of < or = 5 white blood cells (WBC) per microliter. This suggests that some late-stage cases could potentially be missed according to the present criteria, and it is therefore important to perform clinical trials to determine whether these cases could be treated successfully with the first-stage drug alone. The remaining four CSF samples had been classified as late-stage cases, based on a count of > 6 WBC per microliter, even though trypanosomes could not be detected in these samples by either double centrifugation or PCR. A cut-off point of 5 WBC per microliter, which is used as a rule of thumb to stage sleeping sickness patients, seems to leave some late-stage cases undetected since trypanosomes were detected in four CSF samples from suspected cases with < 5 WBC per microliter.

  14. An integrated one-chip-sensor system for microRNA quantitative analysis based on digital droplet polymerase chain reaction

    NASA Astrophysics Data System (ADS)

    Tsukuda, Masahiko; Wiederkehr, Rodrigo Sergio; Cai, Qing; Majeed, Bivragh; Fiorini, Paolo; Stakenborg, Tim; Matsuno, Toshinobu

    2016-04-01

    A silicon microfluidic chip was developed for microRNA (miRNA) quantitative analysis. It performs sequentially reverse transcription and polymerase chain reaction in a digital droplet format. Individual processes take place on different cavities, and reagent and sample mixing is carried out on a chip, prior to entering each compartment. The droplets are generated on a T-junction channel before the polymerase chain reaction step. Also, a miniaturized fluorescence detector was developed, based on an optical pick-up head of digital versatile disc (DVD) and a micro-photomultiplier tube. The chip integrated in the detection system was tested using synthetic miRNA with known concentrations, ranging from 300 to 3,000 templates/µL. Results proved the functionality of the system.

  15. Allele-Specific Polymerase Chain Reaction-Based Genotyping of a Normal Variation in Human Color Vision

    NASA Astrophysics Data System (ADS)

    Wilson, Beth; Lubin, Ira M.; Grant, Kathryn B.

    2003-11-01

    This laboratory exercise offers undergraduate biochemistry students the opportunity to gain experience in a variety of techniques employed in modern molecular biology and biochemistry laboratories. Students utilize microcentrifugation and silica-gel column chromatography to extract DNA from their own buccal (cheek) epithelial cells. The polymerase chain reaction and agarose gel electrophoresis are then employed to identify a single nucleotide polymorphism that is responsible for a commonly encountered variation in human red color vision.

  16. Rapid Identification of Dengue Virus by Reverse Transcription-Polymerase Chain Reaction Using Field-Deployable Instrumentation

    DTIC Science & Technology

    2005-12-01

    dengue serotype 1 to 4, yellow fever, Japanese encephalitis . West Nile, and St. Louis encephalitis viruses. The in vitro sensitivity and specificity...genomic DNA. Sample processing and polymerase chain reaction required ɚ hours. D Introduction engue fever (DF) and the more severe forms of the disease ...extracts of multiple strains of dengue serotype 1 to 4, yellow fever, Japanese encephalitis , West Nile, and St. Louis encephalitis viruses. The in vitro

  17. Evaluation of gold nanoparticles as the additive in real-time polymerase chain reaction with SYBR Green I dye

    NASA Astrophysics Data System (ADS)

    Yang, Wenchao; Mi, Lijuan; Cao, Xueyan; Zhang, Xiaodong; Fan, Chunhai; Hu, Jun

    2008-06-01

    Gold nanoparticles (AuNPs) have been proven to be able to improve the specificity or increase the efficiency of a polymerase chain reaction (PCR) when a suitable amount of AuNPs was used. However, there is still a lack of systematic evaluation of AuNPs in real-time PCR. In this study, DNA degradation and the fluorescence quenching effect of AuNPs were first tested in real-time PCR. Then two different kinds of Taq DNA polymerase, native and recombinant Taq polymerase, were employed to evaluate the AuNPs' effect on the threshold cycle (CT) values, standard curves and melting curves in real-time PCR. Different ratios of the amount of native Taq DNA polymerase to the amount of AuNPs were also tested. It was found that AuNPs could be applied in real-time PCR with correlation coefficient R2>0.989. The combination of 2.09 nM AuNPs with 3.75 U of native Taq DNA polymerase could make the amplification curves shift to the left and enhance the efficiency of the real-time PCR (0.628 39 without AuNPs compared with 0.717 89 with 2.09 nM AuNPs), thus enabling faster detection in comparison with those of control samples. However, no improvement ability of AuNPs was found in real-time PCR based on recombinant rTaq DNA polymerase. Besides, the results suggest that a complex interaction exists between AuNPs and native Taq DNA polymerase.

  18. Molecular diagnosis of A gamma hereditary persistence of fetal hemoglobin using polymerase chain reaction and oligonucleotide analysis.

    PubMed

    Gottardi, E; Alfarano, A; Serra, A; Sciarratta, G; Bertero, M T; Saglio, G; Camaschella, C

    1990-01-01

    By combining the polymerase chain reaction (PCR) of the gamma globin gene promoters with synthetic oligonucleotide analysis we have diagnosed the -196 C----T and the -117 G----A substitutions in heterozygous carriers of non deletional A gamma HPFH from two unrelated Italian families. The identification of the beta-thalassemic defect in a compound heterozygote for -196 A gamma HPFH/beta thalassemia allows us to discuss the effect of this gamma promoter mutation on the globin chain synthetic pattern, and to make a comparison with the mutation at the -117 position.

  19. Comparison between qualitative and real-time polymerase chain reaction to evaluate minimal residual disease in children with acute lymphoblastic leukemia

    PubMed Central

    Paula, Francisco Danilo Ferreira; Elói-Santos, Silvana Maria; Xavier, Sandra Guerra; Ganazza, Mônica Aparecida; Jotta, Patricia Yoshioka; Yunes, José Andrés; Viana, Marcos Borato; Assumpção, Juliana Godoy

    2015-01-01

    Introduction Minimal residual disease is an important independent prognostic factor that can identify poor responders among patients with acute lymphoblastic leukemia. Objective The aim of this study was to analyze minimal residual disease using immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements by conventional polymerase chain reaction followed by homo-heteroduplex analysis and to compare this with real-time polymerase chain reaction at the end of the induction period in children with acute lymphoblastic leukemia. Methods Seventy-four patients diagnosed with acute lymphoblastic leukemia were enrolled. Minimal residual disease was evaluated by qualitative polymerase chain reaction in 57 and by both tests in 44. The Kaplan–Meier and multivariate Cox methods and the log-rank test were used for statistical analysis. Results Nine patients (15.8%) were positive for minimal residual disease by qualitative polymerase chain reaction and 11 (25%) by real-time polymerase chain reaction considering a cut-off point of 1 × 10−3 for precursor B-cell acute lymphoblastic leukemia and 1 × 10−2 for T-cell acute lymphoblastic leukemia. Using the qualitative method, the 3.5-year leukemia-free survival was significantly higher in children negative for minimal residual disease compared to those with positive results (84.1% ± 5.6% versus 41.7% ± 17.3%, respectively; p-value = 0.004). There was no significant association between leukemia-free survival and minimal residual disease by real-time polymerase chain reaction. Minimal residual disease by qualitative polymerase chain reaction was the only variable significantly correlated to leukemia-free survival. Conclusion Given the difficulties in the implementation of minimal residual disease monitoring by real-time polymerase chain reaction in most treatment centers in Brazil, the qualitative polymerase chain reaction strategy may be a cost-effective alternative. PMID:26670399

  20. Recombinase Polymerase Amplification Compared to Real-Time Polymerase Chain Reaction Test for the Detection of Fasciola hepatica in Human Stool.

    PubMed

    Cabada, Miguel M; Malaga, Jose L; Castellanos-Gonzalez, Alejandro; Bagwell, Kelli A; Naeger, Patrick A; Rogers, Hayley K; Maharsi, Safa; Mbaka, Maryann; White, A Clinton

    2017-02-08

    Fasciola hepatica is the most widely distributed trematode infection in the world. Control efforts may be hindered by the lack of diagnostic capacity especially in remote endemic areas. Polymerase chain reaction (PCR)-based methods offer high sensitivity and specificity but require expensive technology. However, the recombinase polymerase amplification (RPA) is an efficient isothermal method that eliminates the need for a thermal cycler and has a high deployment potential to resource-limited settings. We report on the characterization of RPA and PCR tests to detect Fasciola infection in clinical stool samples with low egg burdens. The sensitivity of the RPA and PCR were 87% and 66%, respectively. Both tests were 100% specific showing no cross-reactivity with trematode, cestode, or nematode parasites. In addition, RPA and PCR were able to detect 47% and 26% of infections not detected by microscopy, respectively. The RPA adapted to a lateral flow platform was more sensitive than gel-based detection of the reaction products. In conclusion, the Fasciola RPA is a highly sensitive and specific test to diagnose chronic infection using stool samples. The Fasciola RPA lateral flow has the potential for deployment to endemic areas after further characterization.

  1. Ribonucleic Acid Polymerase Activity in Sendai Virions and Nucleocapsid

    PubMed Central

    Robinson, William S.

    1971-01-01

    After dissociation of purified Sendai virus with the neutral detergent Nonidet P-40 and 2-mercaptoethanol, it catalyzed the incorporation of ribonucleoside triphosphates into an acid-insoluble product. The enzyme activity was associated with viral nucleocapsid as well as whole virions. The reaction product was ribonucleic acid (RNA) which annealed specifically with virion RNA. Sedimentation of the 3H-RNA reaction product revealed two components, a 45S component with properties of double-stranded RNA and 4 to 6S component which appeared to be mostly single-stranded RNA. PMID:4328418

  2. Partial characterization of an rpoD-like gene of Lactococcus lactis subsp. lactis ML3 with a polymerase chain reaction-based approach.

    PubMed

    Gansel, X; Dutreix, M; Hartke, A; Boutibonnes, P; Auffray, Y

    1993-11-01

    With degenerated oligonucleotide primers for conserved regions of bacterial sigma factor proteins, a 117-bp internal DNA fragment of an rpoD-like gene of Lactococcus lactis subsp. lactis ML3 was amplified by the polymerase chain reaction (PCR). The DNA sequence of this PCR product was determined by cycle sequencing, and the deduced amino acid sequence of this internal fragment showed an extensive homology with the known sigma factor sequences from six other microorganisms and present a 13-amino acid region corresponding to the typical "RpoD box" of primary sigma factors. This PCR product was used as a probe to specifically detect sigma homologs in Pediococcus acidilactici, Leuconostoc lactis, Lactobacillus helveticus, Lactobacillus acidophilus, Enterococcus faecalis, Streptococcus thermophilus, and Lactococcus lactis subsp. cremoris. These data are consistent with the existence of a high similarity between the primary sigma factors from diverse Gram-positive microorganisms.

  3. Enhancing the specificity and efficiency of polymerase chain reaction using polyethyleneimine-based derivatives and hybrid nanocomposites

    PubMed Central

    Tong, Weiwei; Cao, Xueyan; Wen, Shihui; Guo, Rui; Shen, Mingwu; Wang, Jianhua; Shi, Xiangyang

    2012-01-01

    There is a general necessity to improve the specificity and efficiency of the polymerase chain reaction (PCR), and exploring the PCR-enhancing mechanism still remains a great challenge. In this paper we report the use of branched polyethyleneimine (PEI)-based derivatives and hybrid nanocomposites as a novel class of enhancers to improve the specificity and efficiency of a nonspecific PCR system. We show that the surface-charge polarity of PEI and PEI derivatives plays a major role in their effectiveness to enhance the PCR. Positively charged amine-terminated pristine PEI, partially (50%) acetylated PEI (PEI-Ac50), and completely acetylated PEI (PEI-Ac) are able to improve PCR efficiency and specificity with an optimum concentration order of PEI < PEI-Ac50 < PEI-Ac, whereas negatively charged carboxyl-terminated PEI (PEI-SAH; SAH denotes succinamic acid groups) and neutralized PEI modified with both polyethylene glycol (PEG) and acetyl (Ac) groups (PEI-PEG-Ac) are unable to improve PCR specificity and efficiency even at concentrations three orders of magnitude higher than that of PEI. Our data clearly suggests that the PCR-enhancing effect is primarily based on the interaction between the PCR components and the PEI derivatives, where electrostatic interaction plays a major role in concentrating the PCR components locally on the backbones of the branched PEI. In addition, multiwalled carbon nanotubes modified with PEI and PEI-stabilized gold nanoparticles are also able to improve the PCR specificity and efficiency with an optimum PEI concentration less than that of the PEI alone, indicating that the inorganic component of the nanocomposites may help improve the interaction between PEI and the PCR components. The developed PEI-based derivatives or nanocomposites may be used as efficient additives to enhance other PCR systems for different biomedical applications. PMID:22393296

  4. Genetic divergence between Mexican Opuntia accessions inferred by polymerase chain reaction-restriction fragment length polymorphism analysis.

    PubMed

    Samah, S; Valadez-Moctezuma, E; Peláez-Luna, K S; Morales-Manzano, S; Meza-Carrera, P; Cid-Contreras, R C

    2016-06-03

    Molecular methods are powerful tools in characterizing and determining relationships between plants. The aim of this study was to study genetic divergence between 103 accessions of Mexican Opuntia. To accomplish this, polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis of three chloroplast intergenic spacers (atpB-rbcL, trnL-trnF, and psbA-trnH), one chloroplast gene (ycf1), two nuclear genes (ppc and PhyC), and one mitochondrial gene (cox3) was conducted. The amplified products from all the samples had very similar molecular sizes, and there were only very small differences between the undigested PCR amplicons for all regions, with the exception of ppc. We obtained 5850 bp from the seven regions, and 136 fragments were detected with eight enzymes, 37 of which (27.2%) were polymorphic. We found that 40% of the fragments from the chloroplast regions were polymorphic, 9.8% of the bands detected in the nuclear genes were polymorphic, and 20% of the bands in the mitochondrial locus were polymorphic. trnL-trnF and psbA-trnH were the most variable regions. The Nei and Li/Dice distance was very short, and ranged from 0 to 0.12; indeed, 77 of the 103 genotypes had the same genetic profile. All the xoconostle accessions (acidic fruits) were grouped together without being separated from three genotypes of prickly pear (sweet fruits). We assume that the genetic divergence between prickly pears and xoconostles is very low, and question the number of Opuntia species currently considered in Mexico.

  5. Semiquantification of circulating hepatocellular carcinoma cells by reverse transcriptase polymerase chain reaction.

    PubMed Central

    Wong, I. H.; Leung, T.; Ho, S.; Lau, W. Y.; Chan, M.; Johnson, P. J.

    1997-01-01

    Hepatocellular carcinoma (HCC) is one of the most common and rapidly fatal malignancies worldwide. Treatment options are severely limited by the frequent presence of metastases. If hepatocyte-specific mRNAs are detected in the circulation, it is possible to infer the presence of circulating, presumably malignant, liver cells. If these can be quantified, it is possible to predict the likelihood of haematogenous metastasis. In this investigation, we have attempted to gain an index of the mass of circulating HCC cells (with reference to the number of hepatoblastoma cells) by measuring the amounts of PCR products for albumin (alb) mRNA and alpha-fetoprotein (afp) mRNA by reverse transcriptase polymerase chain reaction (RT-PCR) and Southern blot analysis. For calibration, total RNA from 1-10(6) HepG2 cells was mixed with total RNA from 10(6) normal peripheral mononuclear cells. A linear relationship was demonstrated between the amount of alb- or afp PCR product and the level of HepG2 total RNA spiked. The assay is sensitive down to a detection level of one HepG2 cell. Alb mRNA was detected in 50% of 18 normal subjects and afp mRNA in only two normal subjects. The alb mRNA cut-off level for the normal was exceeded by seven normal subjects and 34 out of 64 HCC patients, and that for afp mRNA was exceeded by six HCC patients but none of the normal subjects. The level of alb mRNA detected was not linearly proportional to the amount of afp mRNA detected in peripheral blood of the same patients, suggesting heterogeneous expression of alb and afp genes in different circulating tumour cells. In addition, no significant linear association between the levels of afp mRNA and serum AFP was observed. Semiquantification of both mRNA markers for HCC cell detection may prove useful in prediction of metastases. Images Figure 1 Figure 2 Figure 5 Figure 6 PMID:9303362

  6. Detection of Food Hazards in Foods: Comparison of Real Time Polymerase Chain Reaction and Cultural Methods

    PubMed Central

    Bonilauri, Paolo; Bardasi, Lia; Leonelli, Roberto; Ramini, Mattia; Luppi, Andrea; Merialdi, Giuseppe

    2016-01-01

    Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR) are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan) during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples, respectively. In

  7. Detection of Food Hazards in Foods: Comparison of Real Time Polymerase Chain Reaction and Cultural Methods.

    PubMed

    Bonilauri, Paolo; Bardasi, Lia; Leonelli, Roberto; Ramini, Mattia; Luppi, Andrea; Giacometti, Federica; Merialdi, Giuseppe

    2016-01-18

    Foodstuffs should not contain microorganisms or their toxins or metabolites in quantities suggesting an unacceptable risk for human health. The detection of food hazards in foods is performed by several tests that produce results dependent on the analytical method used: an analytical reference method, defined as standard, is associated with each microbiological criterion laid down in Regulation 2073/2005/EC, but, analytical methods other than the reference ones, in particular more rapid methods, could be used. Combined screening methods performed by real time-polymerase chain reaction (RT-PCR) are currently validated as alternative methods according to the ISO 16140:2003 and certified by the Association Française de Normalisation. However, the positive results obtained with these alternative methods, the investigated molecular relations that resulted positive have to be confirmed with cultural methods using the same enrichment media in which the molecular screening was performed. Since it is necessary to assess if these testing schemes provide equivalent guarantees of food safety, the aim of this retrospective study is to analyse the data collected, from 2012 to 2014 by Emilia Romagna Region in the field of Piano Regionale Alimenti (Food Regional Plan) during official controls monitoring food samples of animal and other than animal origin. Records performed by combined methods of molecular screening of Salmonella spp., Listeria monocytogenes and thermophilic Campylobacter and cultural confirmation results were gathered together and the results were compared in order to assess the sensitivity of the methods. A total of 10,604 food samples were considered in this study: the comparison of the data revealed that the RT-PCR method detected Salmonella, L. monocytogenes, and thermophilic Campylobacter in 2.18, 3.85 and 3.73% of the samples, respectively, whereas by using cultural method these pathogens were isolated in 0.43, 1.57 and 1.57% of samples, respectively. In

  8. Factors influencing polymerase chain reaction outcomes in patients with clinically suspected ocular tuberculosis

    PubMed Central

    2014-01-01

    Background Polymerase chain reaction (PCR) assay can be a useful method for definitive diagnosis in paucibacillary infections such as ocular tuberculosis (TB). In this study, we have evaluated factors affecting PCR outcomes in patients with clinically suspected ocular TB. Patients with clinically suspected ocular TB were investigated by PCR of aqueous or vitreous samples. Three control groups were also tested: group 1 included culture-proven non-tuberculous endophthalmitis, group 2 culture-negative non-tuberculous endophthalmitis, and group 3 patients undergoing surgery for uncomplicated cataract. PCR targeted one or more of following targets: IS6110, MPB64, and protein b genes of Mycobacterium tuberculosis complex. Multiple regression analysis (5% level of significance) was done to evaluate the associations between positive PCR outcome and laterality of disease, tuberculin skin test (TST)/interferon-gamma release assay (IGRA), chest radiography, and type of sample (aqueous or vitreous). The main outcome measures were positive PCR by one or more gene targets, and factors influencing positive PCR outcomes. Results All 114 samples were tested for MPB64, 110 for protein b, and 88 for IS6110. MPB64 was positive in 70.2% (n = 80) of tested samples, protein b in 40.0% (n = 44), and IS6110 in only 9.1% (n = 8). DNA sequencing of amplicons from four randomly chosen PCR reactions showed homology for M. tuberculosis complex. Of the 80 PCR-positive patients, 71 completed a full course of antitubercular therapy, of which 65 patients (91.5%) had complete resolution of inflammation at final follow-up. Among controls, 12.5% (3 out of 24) in group 1 and 18.7% (6 out of 32) in group 2 also tested positive by PCR. No PCR-positive outcome was observed in control group 3 (n = 25). Multiple regression analysis revealed significant association of positive PCR outcome with bilateral presentation, but not with a positive TST/IGRA, chest radiography, or type of sample

  9. A Fast-and-Robust Profiler for Improving Polymerase Chain Reaction Diagnostics

    PubMed Central

    Besseris, George J.

    2014-01-01

    Polymerase chain reaction (PCR) is an in vitro technology in molecular genetics that progressively amplifies minimal copies of short DNA sequences in a fast and inexpensive manner. However, PCR performance is sensitive to suboptimal processing conditions. Compromised PCR conditions lead to artifacts and bias that downgrade the discriminatory power and reproducibility of the results. Promising attempts to resolve the PCR performance optimization issue have been guided by quality improvement tactics adopted in the past for industrial trials. Thus, orthogonal arrays (OAs) have been employed to program quick-and-easy structured experiments. Profiling of influences facilitates the quantification of effects that may counteract the detectability of amplified DNA fragments. Nevertheless, the attractive feature of reducing greatly the amount of work and expenditures by planning trials with saturated-unreplicated OA schemes is known to be relinquished in the subsequent analysis phase. This is because of an inherent incompatibility of ordinary multi-factorial comparison techniques to convert small yet dense datasets. Treating unreplicated-saturated data with either the analysis of variance (ANOVA) or regression models destroys the information extraction process. Both of those mentioned approaches are rendered blind to error since the examined effects absorb all available degrees of freedom. Therefore, in lack of approximating an experimental uncertainty, any outcome interpretation is rendered subjective. We propose a profiling method that permits the non-linear maximization of amplicon resolution by eliminating the necessity for direct error estimation. Our approach is distribution-free, calibration-free, simulation-free and sparsity-free with well-known power properties. It is also user-friendly by promoting rudimentary analytics. Testing our method on published amplicon count data, we found that the preponderant effect is the concentration of MgCl2 (p<0.05) followed by the

  10. Detection of submicroscopic lymph node metastases with polymerase chain reaction in patients with malignant melanoma.

    PubMed Central

    Wang, X; Heller, R; VanVoorhis, N; Cruse, C W; Glass, F; Fenske, N; Berman, C; Leo-Messina, J; Rappaport, D; Wells, K

    1994-01-01

    BACKGROUND. The presence or absence of lymph node metastases in patients with malignant melanoma is the most powerful prognostic factor for predicting survival. If regional nodal metastases are found, the 5-year survival for the patient decreases approximately 50%. If the presence or absence of regional nodal metastases will determine which patients receive formal dissections or which patients enter adjuvant trials, then a technique is needed to accurately screen lymph node samples for occult disease. Routine histopathologic examination routinely underestimates the number of patients with metastases. This study was initiated to develop a highly sensitive clinically applicable method to detect micrometastases by examining lymph nodes for the presence of tyrosinase messenger RNA (mRNA). The hypothesis was that if mRNA for tyrosinase is found in the lymph node preparation, that finding is good evidence that metastatic melanoma cells are present. METHODS. The assay is accomplished using the combination of reverse transcription and double-round polymerase chain reaction (RT-PCR). The amplified samples are examined on a 2% agarose gel and tyrosinase cDNA is seen as a 207 base pair fragment. Lymph node preparations from 29 patients who were clinically stage I and II and undergoing elective node dissections were analyzed both by standard pathologic staining and RT-PCR. RESULTS. Eleven of 29 lymph node (38%) samples from 29 patients with intermediate thickness melanoma were pathologically positive. Nineteen of the 29 lymph node preparations (66%) were RT-PCR-positive, and these included all of the pathologically positive samples, so that the false-negative rate was 0. In a spiking experiment, one SK-Mel-28 melanoma cell in a background of one million normal lymphocytes could be detected, thus indicating the sensitivity of this method. In addition, analysis by restriction enzyme mapping showed that the amplified 207-bp PCR product produced is part of the tyrosinase gene

  11. [Comparison of direct microscopy, culture and polymerase chain reaction methods for the diagnosis of cutaneous leishmaniasis].

    PubMed

    Ertabaklar, Hatice; Özlem Çalışkan, Serçin; Boduç, Erengül; Ertuğ, Sema

    2015-01-01

    Cutaneous leishmaniasis (CL) is an endemic disease especially in Southeastern Anatolia of Turkey and recently shows a trend for spread to other regions of the country including the Aegean region. The diagnosis of CL is based on combined evaluation of epidemiological data with the clinical symptoms and laboratory findings. Direct microscopic examination and culture methods are mainly used in the routine diagnosis of CL, while molecular methods are mainly used for research. The aim of this study was to detect the presence of Leishmania spp. in samples obtained from CL-suspected patients by using direct microscopy, culture and polymerase chain reaction (PCR) methods and to compare the results. A total of 55 patients who were admitted to Parasitology Laboratory of Adnan Menderes University Hospital, Aydin (located at Aegean region in Turkey), between 2012-2014 were included in the study. Smear preparations from the skin lesions of cases were fixed and stained with Giemsa, and the presence of amastigote forms were evaluated by direct microscopy. NNN medium was used for the cultivation of samples. Total genomic DNA of Leishmania from the samples were extracted with a commercial kit (NucleoSpin Tissue(®) Kit, Macherey-Nagel, Germany) and PCR was performed by using 13A and 13B primers to amplify the 116 base pair fragment of Leishmania spp. specific kinetoplast DNA. Amastigotes were observed in 29 (53%) of the 55 samples by direct microscopy, promastigotes were detected among 34 (62%) samples in culture, and parasite-specific amplicons were revealed in 30 (55%) samples by PCR. All assays were positive in 24 patients while in 18 patients all of the tests yielded negative results. Thirty-seven (67%) out of 55 cases were diagnosed as CL when reactivity in at least one of these three methods were considered as positive. Accordingly the positivity rates of the methods were 78.4% (29/37) for direct microscopy, 92% (34/37) for culture and 81.1% (30/37) for PCR in CL

  12. One-heater flow-through polymerase chain reaction device by heat pipes cooling

    PubMed Central

    Chen, Jyh Jian; Liao, Ming Huei; Li, Kun Tze; Shen, Chia Ming

    2015-01-01

    This study describes a novel microfluidic reactor capable of flow-through polymerase chain reactions (PCR). For one-heater PCR devices in previous studies, comprehensive simulations and experiments for the chip geometry and the heater arrangement were usually needed before the fabrication of the device. In order to improve the flexibility of the one-heater PCR device, two heat pipes with one fan are used to create the requisite temperature regions in our device. With the integration of one heater onto the chip, the high temperature required for the denaturation stage can be generated at the chip center. By arranging the heat pipes on the opposite sides of the chip, the low temperature needed for the annealing stage is easy to regulate. Numerical calculations and thermal measurements have shown that the temperature distribution in the five-temperature-region PCR chip would be suitable for DNA amplification. In order to ensure temperature uniformity at specific reaction regions, the Re of the sample flow is less than 1. When the microchannel width increases and then decreases gradually between the denaturation and annealing regions, the extension region located in the enlarged part of the channel can be observed numerically and experimentally. From the simulations, the residence time at the extension region with the enlarged channel is 4.25 times longer than that without an enlarged channel at a flow rate of 2 μl/min. The treated surfaces of the flow-through microchannel are characterized using the water contact angle, while the effects of the hydrophilicity of the treated polydimethylsiloxane (PDMS) microchannels on PCR efficiency are determined using gel electrophoresis. By increasing the hydrophilicity of the channel surface after immersing the PDMS substrates into Tween 20 (20%) or BSA (1 mg/ml) solutions, efficient amplifications of DNA segments were proved to occur in our chip device. To our knowledge, our group is the first to introduce heat pipes into

  13. One-heater flow-through polymerase chain reaction device by heat pipes cooling.

    PubMed

    Chen, Jyh Jian; Liao, Ming Huei; Li, Kun Tze; Shen, Chia Ming

    2015-01-01

    This study describes a novel microfluidic reactor capable of flow-through polymerase chain reactions (PCR). For one-heater PCR devices in previous studies, comprehensive simulations and experiments for the chip geometry and the heater arrangement were usually needed before the fabrication of the device. In order to improve the flexibility of the one-heater PCR device, two heat pipes with one fan are used to create the requisite temperature regions in our device. With the integration of one heater onto the chip, the high temperature required for the denaturation stage can be generated at the chip center. By arranging the heat pipes on the opposite sides of the chip, the low temperature needed for the annealing stage is easy to regulate. Numerical calculations and thermal measurements have shown that the temperature distribution in the five-temperature-region PCR chip would be suitable for DNA amplification. In order to ensure temperature uniformity at specific reaction regions, the Re of the sample flow is less than 1. When the microchannel width increases and then decreases gradually between the denaturation and annealing regions, the extension region located in the enlarged part of the channel can be observed numerically and experimentally. From the simulations, the residence time at the extension region with the enlarged channel is 4.25 times longer than that without an enlarged channel at a flow rate of 2 μl/min. The treated surfaces of the flow-through microchannel are characterized using the water contact angle, while the effects of the hydrophilicity of the treated polydimethylsiloxane (PDMS) microchannels on PCR efficiency are determined using gel electrophoresis. By increasing the hydrophilicity of the channel surface after immersing the PDMS substrates into Tween 20 (20%) or BSA (1 mg/ml) solutions, efficient amplifications of DNA segments were proved to occur in our chip device. To our knowledge, our group is the first to introduce heat pipes into

  14. Keratin gene expression in non-epithelial tissues. Detection with polymerase chain reaction.

    PubMed Central

    Traweek, S. T.; Liu, J.; Battifora, H.

    1993-01-01

    Keratin filament are characteristically present in epithelial cells and tumors, but have also been detected in many normal and neoplastic non-epithelial cell types using immunohistochemical techniques. To investigate the validity of this seemingly aberrant protein expression, we applied the highly sensitive polymerase chain reaction (PCR) technique to study keratin gene expression in a variety of non-epithelial tissues. Total RNA was extracted from nine samples of leiomyosarcoma, four non-Hodgkin's lymphoma, seven normal bone marrows, normal lymph node, normal peripheral blood cells, freshly isolated and cultured endothelial cells, cultured skin fibroblasts, and the myeloid leukemia cell line HL-60. Amplification primers and probes for the three most primitive keratin types (8, 18, and 19) were synthesized using published gene sequences. RNA from the breast carcinoma cell line MCF-7, known to be rich in all three keratins, was used as positive control. Concurrently run actin primers were used to confirm RNA integrity. After an initial cycle with reverse transcriptase, PCR amplification was performed for 30 cycles. Southern blots of the PCR products showed variably intense bands corresponding to keratin 8 and 18 gene products in all samples, offering conclusive evidence of keratin gene expression in cells of both stromal and hematopoietic derivation. However, keratin 19 gene transcription was not nearly so ubiquitous, being detected in normal fibroblasts and endothelial cells, two of four non-Hodgkin's lymphoma and four of nine leiomyosarcoma, but not in normal lymph node, peripheral blood cells, HL-60 cells, or any of the seven normal bone marrows examined. Dilutional experiments showed PCR to be highly sensitive in the detection of keratin 19 gene expression, capable of registering one MCF-7 cell in 10(6) HL-60 cells. These studies show that variable levels of keratin 8 and 18 gene expression may be detected by PCR in a wide variety of non-epithelial tissues

  15. A fast-and-robust profiler for improving polymerase chain reaction diagnostics.

    PubMed

    Besseris, George J

    2014-01-01

    Polymerase chain reaction (PCR) is an in vitro technology in molecular genetics that progressively amplifies minimal copies of short DNA sequences in a fast and inexpensive manner. However, PCR performance is sensitive to suboptimal processing conditions. Compromised PCR conditions lead to artifacts and bias that downgrade the discriminatory power and reproducibility of the results. Promising attempts to resolve the PCR performance optimization issue have been guided by quality improvement tactics adopted in the past for industrial trials. Thus, orthogonal arrays (OAs) have been employed to program quick-and-easy structured experiments. Profiling of influences facilitates the quantification of effects that may counteract the detectability of amplified DNA fragments. Nevertheless, the attractive feature of reducing greatly the amount of work and expenditures by planning trials with saturated-unreplicated OA schemes is known to be relinquished in the subsequent analysis phase. This is because of an inherent incompatibility of ordinary multi-factorial comparison techniques to convert small yet dense datasets. Treating unreplicated-saturated data with either the analysis of variance (ANOVA) or regression models destroys the information extraction process. Both of those mentioned approaches are rendered blind to error since the examined effects absorb all available degrees of freedom. Therefore, in lack of approximating an experimental uncertainty, any outcome interpretation is rendered subjective. We propose a profiling method that permits the non-linear maximization of amplicon resolution by eliminating the necessity for direct error estimation. Our approach is distribution-free, calibration-free, simulation-free and sparsity-free with well-known power properties. It is also user-friendly by promoting rudimentary analytics. Testing our method on published amplicon count data, we found that the preponderant effect is the concentration of MgCl2 (p<0.05) followed by the

  16. Cervine (Cervus elaphus) cytokine mRNA quantification by real-time polymerase chain reaction.

    PubMed

    Harrington, Noel P; Surujballi, Om P; Prescott, John F

    2006-04-01

    It has been difficult to perform cytokine studies for many wildlife and nontraditional species because of a lack of immunologic reagents at the protein level. Recently, simple and rapid assays for quantifying mRNA expression by real-time reverse transcription-polymerase chain reaction (RT-PCR) have been used for analysis of cytokine profiles in humans and other mammalian species. This report describes the development and application of real time RT-PCR to measure the expression of several important elk (Cervus elaphus) cytokine mRNAs, including interleukin (IL)-2, IL-4, IL-10, IL-12p40, interferon-gamma, tumor necrosis factor (TNF)-alpha, and the enzyme-inducible nitric oxide synthase, all of which are involved in immune responses and regulation. For the broadest potential application of the assay, primers and probes were designed using consensus sequences from several species of interest. To obtain standardized quantitative results, external controls consisting of a DNA template for each target gene were used to generate linear standard curves over a 6 to 8 log range with detection of as few as 10 copies of amplicon per reaction. Sample-to-sample variation in the efficiency of the RT, as well as in the quantity and quality of the starting RNA, was compensated for by normalizing the results to the endogenous housekeeping gene beta(2)-microglobulin. The assay was evaluated by monitoring the kinetics of cytokine mRNA synthesis induced by mitogenic and antigenic stimulation of peripheral blood mononuclear cells (PBMCs) from Mycobacterium bovis-infected elk. Concanavalin A-stimulated PBMCs demonstrated a rapid but transient increase in cytokine mRNA expression following in vitro mitogenic activation with optimal mRNA induction observed after 4 to 16 hr. The PBMCs stimulated with the mycobacterial recall antigen, bovine-purified protein derivative (PPD-bovis), demonstrated variable mRNA induction kinetics for each cytokine. Whereas PPD-bovis optimally induced IL-2 m

  17. Early detection of Brucella canis via quantitative polymerase chain reaction analysis.

    PubMed

    Kauffman, L K; Bjork, J K; Gallup, J M; Boggiatto, P M; Bellaire, B H; Petersen, C A

    2014-02-01

    Canine brucellosis is a reportable zoonotic disease that can lead to canine reproductive losses and human infection through contact with infected urine or other genitourinary secretions. Although many locations require testing and euthanasia of positive dogs, current diagnosis is limited by the time required for seroconversion, for example, presence of B. canis-specific antibodies. The goal of this study was to determine the diagnostic ability of Brucella canis-specific quantitative polymerase chain reaction (qPCR) assay to detect B. canis in field samples prior to serological positivity for faster diagnosis and prevention of transmission within kennels or in households. Two kennels, one of which was located in the owner's home, were sampled following observation of suggestive clinical signs and positive serology of at least one dog. Specimens obtained were comparatively analysed via serology and qPCR analysis. 107 dogs were analysed for B. canis infection via qPCR: 105 via whole-blood samples, 65 via vaginal swab, six via urine and seven via genitourinary tract tissue taken at necropsy. Forty-five dogs were found to be infected with canine brucellosis via qPCR, of which 22 (48.89%) were seropositive. A statistically significant number (P = 0.0228) of qPCR-positive dogs, 5/25 (20.00%), seroconverted within a 30-day interval after initial serologic testing. As compared to serology, qPCR analysis of DNA from vaginal swabs had a sensitivity of 92.31% and specificity of 51.92%, and qPCR analysis of DNA from whole-blood samples had a sensitivity of 16.67% and specificity of 100%. B. canis outer membrane protein 25 DNA qPCR from non-invasive vaginal swab and urine samples provided early detection of B. canis infection in dogs prior to detection of antibodies. This assay provides a critical tool to decrease zoonotic spread of canine brucellosis, its associated clinical presentation(s), and emotional and economic repercussions.

  18. Elimination of contaminating DNA within polymerase chain reaction reagents: implications for a general approach to detection of uncultured pathogens.

    PubMed Central

    Meier, A; Persing, D H; Finken, M; Böttger, E C

    1993-01-01

    Analysis based on comparisons of 16S rRNA sequences provides a rapid and reliable approach to identifying human pathogens. By directing oligonucleotide primers at sequences conserved throughout the eubacterial kingdom, bacterial 16S ribosomal DNA sequences of virtually any member of the eubacterial kingdom can be amplified by polymerase chain reaction and subsequently analyzed by sequence determination. Indeed, automated systems for broad-range amplification, sequencing, and data analysis are now feasible and may form the basis of the next generation of automated microbial identification systems. However, identification of pathogens by this strategy is hampered by the frequent contamination of reagents used for the amplification reaction, in particular Taq polymerase, with exogenous bacterial DNA. Here, we describe detailed investigations on the use of 8-methoxypsoralen and long-wave UV light to eliminate contaminating DNA in polymerase chain reaction reagents. The clinical utility of the developed procedure was demonstrated in a case of paucibacillary osteomyelitis, for which no specific bacterial agent had been cultured. Images PMID:8458958

  19. Comparison of two real-time quantitative polymerase chain reaction strategies for minimal residual disease evaluation in lymphoproliferative disorders: correlation between immunoglobulin gene mutation load and real-time quantitative polymerase chain reaction performance.

    PubMed

    Della Starza, Irene; Cavalli, Marzia; Del Giudice, Ilaria; Barbero, Daniela; Mantoan, Barbara; Genuardi, Elisa; Urbano, Marina; Mannu, Claudia; Gazzola, Anna; Ciabatti, Elena; Guarini, Anna; Foà, Robin; Galimberti, Sara; Piccaluga, Pierpaolo; Gaidano, Gianluca; Ladetto, Marco; Monitillo, Luigia

    2014-09-01

    We compared two strategies for minimal residual disease evaluation of B-cell lymphoproliferative disorders characterized by a variable immunoglobulin heavy chain (IGH) genes mutation load. Twenty-five samples from chronic lymphocytic leukaemia (n = 18) or mantle cell lymphoma (n = 7) patients were analyzed. Based on IGH variable region genes, 22/25 samples carried > 2% mutations, 20/25 > 5%. In the IGH joining region genes, 23/25 samples carried > 2% mutations, 18/25 > 5%. Real-time quantitative polymerase chain reaction was performed on IGH genes using two strategies: method A utilizes two patient-specific primers, whereas method B employs one patient-specific and one germline primer, with different positions on the variable, diversity and joining regions. Twenty-three samples (92%) resulted evaluable using method A, only six (24%) by method B. Method B poor performance was specifically evident among mutated IGH variable/joining region cases, although no specific mutation load above, which the real-time quantitative polymerase chain reaction failed was found. The molecular strategies for minimal residual disease evaluation should be adapted to the B-cell receptor features of the disease investigated.

  20. A METHOD TO REMOVE ENVIRONMENTAL INHIBITORS PRIOR TO THE DETECTION OF WATERBORNE ENTERIC VIRUSES BY REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION

    EPA Science Inventory

    A method was developed to remove environmental inhibitors from sample concentrates prior to detection of human enteric viruses using the reverse transcription-polymerase chain reaction (RT-PCR).Environmental inhibitors, concentrated along with viruses during water sample processi...

  1. [Development of a real-time polymerase chain reaction method for the identification of Candida species].

    PubMed

    Ağca, Harun; Dalyan Cilo, Burcu; Özmerdiven, Gülşah Ece; Sağlam, Sezcan; Ener, Beyza

    2015-01-01

    Candida species are one of the major causes of nosocomial infections and are the fourth most common agent involved in bloodstream infections. The impact of non-albicans Candida species is increasing, however C.albicans is still the most common species. Since the antifungal susceptibility pattern among Candida spp. may be different, rapid diagnosis and identification of non-albicans Candida spp. are important for the determination of antifungal agents that will be used for treatment. The aim of the study was to describe a real-time polymerase chain reaction (Rt-PCR) assay that rapidly detects, identifies and quantitates Candida species from blood culture samples. A total of 50 consecutive positive blood culture bottles (BACTEC, Beckton Dickinson, USA) identified at our laboratory between June-November 2013, were included in the study. Reference strains of Candida spp. (C.albicans ATCC 10231, C.glabrata ATCC 90030, C.tropicalis ATCC 1021, C.krusei ATCC 6258, C.parapsilosis ATCC 22019 and C. dubliniensis CD36) grown on Sabouraud dextrose agar were used for quality control. BACTEC bottles that were positive for Escherichia coli, Pseudomonas aeruginosa and Staphylococcus aureus were also studied to search the cross-reactivity. A commercial kit (Zymo Research, USA) was used for DNA extraction. Real-time PCR was performed on LightCycler 480 (Roche, Germany) with primers and probes specific for 18S rRNA of Candida species. Twenty microlitres of the reaction mix contained 2 μl of extracted DNA, 2 μl of LightCycler Fast Start DNA Master Probe (Roche Diagnostics, Germany), 2 μl of MgCl(2) (5 mmol), 2 μl of 10x PCR buffer (Roche Diagnostics, Germany), 0.5 μl of each primer (0.01 nmol/μl) and 1 μl of each probe (0.1 μmol/μl) (TibMolBiol, Germany). Amplification was performed using the following conditions; 95°C for 10 mins and 50 cycles of denaturation at 95°C for 10 secs, annealing at 62°C for 10 secs and polymerisation at 72°C for 20 secs. A melting curve was

  2. Identification of co-occurring Branchinecta fairy shrimp species from encysted embryos using multiplex polymerase chain reaction

    USGS Publications Warehouse

    Vandergast, A.G.; Wood, D.A.; Simovich, M.; Bohonak, A.J.

    2009-01-01

    Morphological identification of many fairy shrimp species is difficult because distinguishing characters are restricted to adults. We developed two multiplex polymerase chain reaction assays that differentiate among three Branchinecta fairy shrimp with distributional overlap in southern California vernal pools. Two of the species are federally listed as threatened. Molecular identification of Branchinecta from cysts allows for species surveys to be conducted during the dry season, expanding the timeframe for population assessment and providing a less intrusive method of sampling sensitive vernal pool habitats. ?? Published 2009. This article is a US Government work and is in the public domain in the USA.

  3. An oligonucleotide-ligation assay for the differentiation between Cyclospora and Eimeria spp. polymerase chain reaction amplification products.

    PubMed

    Jinneman, K C; Wetherington, J H; Hill, W E; Omiescinski, C J; Adams, A M; Johnson, J M; Tenge, B J; Dang, N L; Wekell, M M

    1999-06-01

    An oligonucleotide-ligation assay (OLA) was developed and compared to a restriction fragment length polymorphism (RFLP) test for distinguishing between 294-bp polymerase chain reaction (PCR) amplification products of the 18S rRNA gene from Cyclospora and Eimeria spp. The PCR/OLA correctly distinguished between three Cyclospora, three E. tenella, and one E. mitis strains and the ratio of positive to negative spectrophotometric absorbance (A490) values for each strain ranged from 4.086 to 15.280 (median 9.5). PCR/OLA provides a rapid, reliable, spectrophotometric alternative to PCR/RFLP.

  4. Interlaboratory validation data on real-time polymerase chain reaction detection for unauthorized genetically modified papaya line PRSV-YK.

    PubMed

    Nakamura, Kosuke; Kondo, Kazunari; Akiyama, Hiroshi; Ishigaki, Takumi; Noguchi, Akio; Katsumata, Hiroshi; Takasaki, Kazuto; Futo, Satoshi; Sakata, Kozue; Fukuda, Nozomi; Mano, Junichi; Kitta, Kazumi; Tanaka, Hidenori; Akashi, Ryo; Nishimaki-Mogami, Tomoko

    2016-06-01

    This article is referred to research article entitled "Whole genome sequence analysis of unidentified genetically modified papaya for development of a specific detection method" (Nakamura et al., 2016) [1]. Real-time polymerase chain reaction (PCR) detection method for unauthorized genetically modified (GM) papaya (Carica papaya L.) line PRSV-YK (PRSV-YK detection method) was developed using whole genome sequence data (DDBJ Sequenced Read Archive under accession No. PRJDB3976). Interlaboratory validation datasets for PRSV-YK detection method were provided. Data indicating homogeneity of samples prepared for interlaboratory validation were included. Specificity and sensitivity test data for PRSV-YK detection method were also provided.

  5. A simple modification to improve the accuracy of methylation-sensitive restriction enzyme quantitative polymerase chain reaction.

    PubMed

    Krygier, Magdalena; Podolak-Popinigis, Justyna; Limon, Janusz; Sachadyn, Paweł; Stanisławska-Sachadyn, Anna

    2016-05-01

    DNA digestion with endonucleases sensitive to CpG methylation such as HpaII followed by polymerase chain reaction (PCR) quantitation is commonly used in molecular studies as a simple and inexpensive solution for assessment of region-specific DNA methylation. We observed that the results of such analyses were highly overestimated if mock-digested samples were applied as the reference. We determined DNA methylation levels in several promoter regions in two setups implementing different references: mock-digested and treated with a restriction enzyme that has no recognition sites within examined amplicons. Fragmentation of reference templates allowed removing the overestimation effect, thereby improving measurement accuracy.

  6. Multiplex-polymerase chain reaction assay for the authentication of the mackerel Scomber colias in commercial canned products.

    PubMed

    Infante, Carlos; Manchado, Manuel

    2006-01-01

    A multiplex-polymerase chain reaction (PCR) system was developed for the authentication of the mackerel Scomber colias in commercial canned products. This novel method consists of an S. colias-specific fragment [159 base pairs (bp)] located in the nontranscribed spacer (NTS) sequence, and a Scomber genus-specific PCR product in the 5S rRNA gene (196-201 bp) as a positive amplification control. The system was assayed using 18 different canned products labeled as S. colias. A positive identification was made in all but one sample, revealing this methodology as a potential molecular tool for direct application in the authentication of S. colias canned products.

  7. Rapid and inexpensive species differentiation using a multiplex real-time polymerase chain reaction high-resolution melt assay.

    PubMed

    Elkins, Kelly M; Perez, Anjelica C U; Sweetin, Katherine C

    2016-05-01

    We demonstrate a method for developing real-time polymerase chain reaction (PCR) high-resolution melt (HRM) assays to identify multiple species present in a mixture simultaneously using LCGreen Plus and melt temperatures. Highly specific PCR primers are designed to yield amplicons with different melt temperatures for simple routine species identification compared with differentiating melt curve kinetics traces or difference plots. This method is robust and automatable, and it leads to savings in time and reagent costs, is easily modified to probe any species of interest, eliminates the need for post-PCR gel or capillary electrophoresis in routine assays, and requires no expensive dye-labeled primers.

  8. Digital isothermal quantification of nucleic acids via simultaneous chemical initiation of recombinase polymerase amplification reactions on SlipChip.

    PubMed

    Shen, Feng; Davydova, Elena K; Du, Wenbin; Kreutz, Jason E; Piepenburg, Olaf; Ismagilov, Rustem F

    2011-05-01

    In this paper, digital quantitative detection of nucleic acids was achieved at the single-molecule level by chemical initiation of over one thousand sequence-specific, nanoliter isothermal amplification reactions in parallel. Digital polymerase chain reaction (digital PCR), a method used for quantification of nucleic acids, counts the presence or absence of amplification of individual molecules. However, it still requires temperature cycling, which is undesirable under resource-limited conditions. This makes isothermal methods for nucleic acid amplification, such as recombinase polymerase amplification (RPA), more attractive. A microfluidic digital RPA SlipChip is described here for simultaneous initiation of over one thousand nL-scale RPA reactions by adding a chemical initiator to each reaction compartment with a simple slipping step after instrument-free pipet loading. Two designs of the SlipChip, two-step slipping and one-step slipping, were validated using digital RPA. By using the digital RPA SlipChip, false-positive results from preinitiation of the RPA amplification reaction before incubation were eliminated. End point fluorescence readout was used for "yes or no" digital quantification. The performance of digital RPA in a SlipChip was validated by amplifying and counting single molecules of the target nucleic acid, methicillin-resistant Staphylococcus aureus (MRSA) genomic DNA. The digital RPA on SlipChip was also tolerant to fluctuations of the incubation temperature (37-42 °C), and its performance was comparable to digital PCR on the same SlipChip design. The digital RPA SlipChip provides a simple method to quantify nucleic acids without requiring thermal cycling or kinetic measurements, with potential applications in diagnostics and environmental monitoring under resource-limited settings. The ability to initiate thousands of chemical reactions in parallel on the nanoliter scale using solvent-resistant glass devices is likely to be useful for a broader

  9. The effect of feeding with a tryptophan-free amino acid mixture on rat liver magnesium ion-activated deoxyribonucleic acid-dependent ribonucleic acid polymerase

    PubMed Central

    Henderson, A. R.

    1970-01-01

    1. The Widnell & Tata (1966) assay method for Mg2+-activated DNA-dependent RNA polymerase was used for initial-velocity determinations of rat liver nuclear RNA polymerase. One unit (U) of RNA polymerase was defined as that amount of enzyme required for 1 mmol of [3H]GMP incorporation/min at 37°C. 2. Colony fed rats were found to have a mean RNA polymerase activity of 65.9μU/mg of DNA and 18h-starved rats had a mean activity of 53.2μU/mg of DNA. Longer periods of starvation did not significantly decrease RNA polymerase activity further. 3. Rats that had been starved for 18h were used for all feeding experiments. Complete and tryptophan-deficient amino acid mixtures were given by stomach tube and the animals were killed 15–120min later. The response of RNA polymerase to the feeding with the complete amino acid mixture was rapid and almost linear over the first hour of feeding, resulting in a doubling of activity. The activity was still elevated above the starvation value at 120min after feeding. The tryptophan-deficient amino acid mixture produced a much less vigorous response about 45min after the feeding, and the activity had returned to the starvation value by 120min after the feeding. 4. The response of RNA polymerase to the feeding with the complete amino acid mixture was shown to occur within a period of less than 5min to about 10min after the feeding. 5. Pretreatment of the animals with puromycin or cycloheximide was found to abolish the 15min RNA polymerase response to the feeding with the complete amino acid mixture, but the activity of the controls was unaffected. 6. The characteristics of the RNA polymerase from 18h-starved animals and animals fed with the complete or incomplete amino acid mixtures for 1h were examined. The effects of Mg2+ ions, pH, actinomycin D and nucleoside triphosphate omissions were determined. The [Mg2+]– and pH–activity profiles of the RNA polymerase from the animal fed with the complete mixture appeared to differ from

  10. [Universal or broad-range polymerase chain reaction (PCR): a contribution to the detection and identification of bacteria and fungi in clinical practice].

    PubMed

    Poggi M, Helena; Guzmán D, Ana María; García C, Patricia; Lagos L, Marcela

    2009-08-01

    The use of techniques for the detection of nucleic acids such as the polymerase chain reaction (PCR) has had a major impact on microbiological analysis, playing an important role in the clinical laboratory. Most of the techniques currently used are designed for specific detection of a particular microorganism. However, infectious agents can also be identified even if genus or species are unknown, using universal primers to amplify bacterial or fungal DNA and then identify the species by sequence (universal or wide spectrum PCR). This methodology is applied in cultures that are difficult to identify using phenotypic techniques, and more recently it is also being used directly in clinical samples, where the detection and identification of the infectious agent by traditional techniques is difficult or not possible.

  11. [The reagents kit to detect Metyorchis biis, Opisthorchis viverrini and Clonorchis sinensis, Opisthorchis felineus--agents of opisthorchiasis using technique of polymerase chain reaction in real-time].

    PubMed

    Seredina, T A; Petrenko, V A; Tronin, A V; Sazonov, A Iu; Sapugol'tseva, O B; Katokhin, A V; Odintsova, E S

    2014-08-01

    The helminths Opisthorchis felineus, Opisthorchis viverrini, Clonorchis sinensis, Metorchis bilis are the agents of opisthorchiasis. The actual diagnostic of parasitic diseases based on microscope analysis of samples of human feces to detect presence of ova of parasites suffers of many shortcomings, in particular low sensitivity especially at earlier stages. The purpose of this study was to compare results of detection of parasites using both classical technique and technique of specific differentiation based on extraction of nucleic acids from samples of human feces and implementation of reaction of amplification of the chosen fragment of DNA with detection of products of polymerase chain reaction in the real time. The study detected 150 out of 165 positive samples and also 6 out of 37 negative samples both validated by coproovoscopy.

  12. Sensitive and specific identification by polymerase chain reaction of Eimeria tenella and Eimeria maxima, important protozoan pathogens in laboratory avian facilities

    PubMed Central

    Lee, Hyun-A; Hong, Sunhwa; Chung, Yungho

    2011-01-01

    Eimeria tenella and Eimeria maxima are important pathogens causing intracellular protozoa infections in laboratory avian animals and are known to affect experimental results obtained from contaminated animals. This study aimed to find a fast, sensitive, and efficient protocol for the molecular identification of E. tenella and E. maxima in experimental samples using chickens as laboratory avian animals. DNA was extracted from fecal samples collected from chickens and polymerase chain reaction (PCR) analysis was employed to detect E. tenella and E. maxima from the extracted DNA. The target nucleic acid fragments were specifically amplified by PCR. Feces secreting E. tenella and E. maxima were detected by a positive PCR reaction. In this study, we were able to successfully detect E. tenella and E. maxima using the molecular diagnostic method of PCR. As such, we recommended PCR for monitoring E. tenella and E. maxima in laboratory avian facilities. PMID:21998616

  13. Interphase fluorescence in situ hybridization and reverse transcription polymerase chain reaction as a diagnostic aid for synovial sarcoma.

    PubMed Central

    Shipley, J.; Crew, J.; Birdsall, S.; Gill, S.; Clark, J.; Fisher, C.; Kelsey, A.; Nojima, T.; Sonobe, H.; Cooper, C.; Gusterson, B.

    1996-01-01

    Identification of the t(X;18)(p11.2;q11.2) that is associated with a high proportion of synovial sarcoma can be a useful diagnostic aid. The translocation results in fusion of the SYT gene on chromosome 18 to either the SSX1 or the SSX2 gene, two homologous genes within Xp11.2. Two-color interphase fluorescence in situ hybridization and reverse transcription polymerase chain reaction were assessed as approaches to identify the rearrangement in well characterized cases. The presence of the translocation, and the specific chromosome X gene disrupted, were inferred from the configuration of signals from chromosome-specific centromere probes, paints, and markers flanking each gene in preparations of interphase nuclei. Rearrangement was found in two cell lines and eight of nine tumor samples, including analysis of five touch imprints. This was consistent with cytogenetic data in four cases and reverse transcription polymerase chain reaction analysis using primers known to amplify both SYT-SSX1 and SYT-SSX2 transcripts. The transcripts were distinguished by restriction with LspI and SmaI. Contrary to previous suggestions, there was no obvious correlation between histological subtype and involvement of the SSX1 or SSX2 gene. These approaches could also be applied to the identification of tumor-free margins and metastatic disease. Images Figure 1 Figure 3 PMID:8579118

  14. Performance of transport and selective media for swine Bordetella bronchiseptica recovery and it comparison to polymerase chain reaction detection

    PubMed Central

    Coutinho, Tania Alen; Bernardi, Mari Lourdes; de Itapema Cardoso, Marisa Ribeiro; Borowski, Sandra Maria; Moreno, Andrea Micke; de Barcellos, David Emilio Santos Neves

    2009-01-01

    Three comparative assays were performed seeking to improve the sensitivity of the diagnosis of Bordetella bronchiseptica infection analyzing swine nasal swabs. An initial assay compared the recovery of B. bronchiseptica from swabs simultaneously inoculated with B. bronchiseptica and some interfering bacteria, immersed into three transport formulations (Amies with charcoal, trypticase soy broth and phosphate buffer according to Soerensen supplemented with 5% of bovine fetal serum) and submitted to different temperatures (10°C and 27°C) and periods of incubation (24, 72 and 120 hours). A subsequent assay compared three selective media (MacConkey agar, modified selective medium G20G and a ceftiofur medium) for their recovery capabilities from clinical specimens. One last assay compared the polymerase chain reaction to the three selective media. In the first assay, the recovery of B. bronchiseptica from transport systems was better at 27°C and the three formulations had good performances at this temperature, but the collection of qualitative and quantitative analysis indicated the advantage of Amies medium for nasal swabs transportation. The second assay indicated that MacConkey agar and modified G20G had similar results and were superior to the ceftiofur medium. In the final assay, polymerase chain reaction presented superior capability of B. bronchiseptica detection to culture procedures. PMID:24031390

  15. Detection of Escherichia coli Enteropathogens by Multiplex Polymerase Chain Reaction from Children's Diarrheal Stools in Two Caribbean–Colombian Cities

    PubMed Central

    Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y.

    2010-01-01

    Abstract Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean–Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1–9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin–producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area. PMID:19839760

  16. Detection of Escherichia coli enteropathogens by multiplex polymerase chain reaction from children's diarrheal stools in two Caribbean-Colombian cities.

    PubMed

    Gómez-Duarte, Oscar G; Arzuza, Octavio; Urbina, Delfina; Bai, Jing; Guerra, Julio; Montes, Oscar; Puello, Marta; Mendoza, Ketty; Castro, Gregorio Y

    2010-02-01

    Acute diarrheal disease is a leading cause of childhood morbidity and mortality in the developing world and Escherichia coli intestinal pathogens are important causative agents. Information on the epidemiology of E. coli intestinal pathogens and their association with diarrheal disease is limited because no diagnostic testing is available in countries with limited resources. To evaluate the prevalence of E. coli intestinal pathogens in a Caribbean-Colombian region, E. coli clinical isolates from children with diarrhea were analyzed by a recently reported two-reaction multiplex polymerase chain reaction (Gomez-Duarte et al., Diagn Microbiol Infect Dis 2009;63:1-9). The phylogenetic group from all E. coli isolates was also typed by a single-reaction multiplex polymerase chain reaction. We found that among 139 E. coli strains analyzed, 20 (14.4%) corresponded to E. coli diarrheagenic pathotypes. Enterotoxigenic, shiga-toxin-producing, enteroaggregative, diffuse adherent, and enteropathogenic E. coli pathotypes were detected, and most of them belonged to the phylogenetic groups A and B1, known to be associated with intestinal pathogens. This is the first report on the molecular characterization of E. coli diarrheogenic isolates in Colombia and the first report on the potential role of E. coli in childhood diarrhea in this geographic area.

  17. Evaluation of canine and feline leishmaniasis by the association of blood culture, immunofluorescent antibody test and polymerase chain reaction

    PubMed Central

    2014-01-01

    Background This study aimed to evaluate the occurrence of Leishmania spp. in dogs and cats from Botucatu, São Paulo state, and Campo Grande, Mato Grosso do Sul state, Brazil, by the association of three diagnostic tests: blood culture in liver infusion tryptose medium, immunofluorescent antibody test and polymerase chain reaction. Fifty blood samples of dogs and cats from the Center for Zoonosis Control in Campo Grande, an area endemic for canine visceral leishmaniasis, were collected randomly, as well as canine and feline blood samples from the Municipal Kennel and Animal Protection Association in Botucatu, currently considered a transmission-free, non-endemic area. Results Of the 50 dog blood cultures from Botucatu, three (6%) were positive and of the 50 cats, two (4%) were positive. In Campo Grande, 29 dog blood cultures (58%) were positive and all (100%) cats negative by this test. Polymerase chain reaction detected Leishmania spp. in 100% of dog and cat samples from Botucatu but found all the cats from Campo Grande to be negative. On the other hand, 36 dogs from Campo Grande were positive (72%) by the same technique. Immunofluorescent antibody test in Botucatu found 100% of dogs and cats non-reactive, while in Campo Grande, it detected positivity in 32 dogs (64%) and 15 cats (30%). Conclusions The results show the importance of not only continuous epidemiological surveillance in areas not endemic for leishmaniasis, but also research for accurate diagnosis of this zoonosis. PMID:24565284

  18. Reverse transcription-polymerase chain reaction molecular testing of cytology specimens: Pre-analytic and analytic factors.

    PubMed

    Bridge, Julia A

    2017-01-01

    The introduction of molecular testing into cytopathology laboratory practice has expanded the types of samples considered feasible for identifying genetic alterations that play an essential role in cancer diagnosis and treatment. Reverse transcription-polymerase chain reaction (RT-PCR), a sensitive and specific technical approach for amplifying a defined segment of RNA after it has been reverse-transcribed into its DNA complement, is commonly used in clinical practice for the identification of recurrent or tumor-specific fusion gene events. Real-time RT-PCR (quantitative RT-PCR), a technical variation, also permits the quantitation of products generated during each cycle of the polymerase chain reaction process. This review addresses qualitative and quantitative pre-analytic and analytic considerations of RT-PCR as they relate to various cytologic specimens. An understanding of these aspects of genetic testing is central to attaining optimal results in the face of the challenges that cytology specimens may present. Cancer Cytopathol 2017;125:11-19. © 2016 American Cancer Society.

  19. The 'helix clamp' in HIV-1 reverse transcriptase: a new nucleic acid binding motif common in nucleic acid polymerases.

    PubMed Central

    Hermann, T; Meier, T; Götte, M; Heumann, H

    1994-01-01

    Amino acid sequences homologous to 259KLVGKL (X)16KLLR284 of human immunodeficiency virus type 1 reverse transcriptase (HIV-1 RT) are conserved in several nucleotide polymerizing enzymes. This amino acid motif has been identified in the crystal structure model as an element of the enzyme's nucleic acid binding apparatus. It is part of the helix-turn-helix structure, alpha H-turn-alpha I, within the 'thumb' region of HIV-1 RT. The motif grasps the complexed nucleic acid at one side. Molecular modeling studies on HIV-1 RT in complex with a nucleic acid fragment suggest that the motif has binding function in the p66 subunit as well as in the p51 subunit, acting as a kind of 'helix clamp'. Given its wide distribution within the nucleic acid polymerases, the helix clamp motif is assumed to be a structure of general significance for nucleic acid binding. Images PMID:7527138

  20. Enhancing the specificity of polymerase chain reaction by graphene oxide through surface modification: zwitterionic polymer is superior to other polymers with different charges.

    PubMed

    Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian

    Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA < GO-PAM < GO-PEG < GO-pSB. Thus, zwitterionic polymer-modified GO is superior to other GO derivatives with different charges in enhancing the specificity of PCR. GO derivatives are also successfully used to enhance the specificity of PCR for the amplification of human mitochondrial DNA using blood genomic DNA as template. Molecular dynamics simulations and molecular docking are performed to elucidate the interaction between the polymers and Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR.

  1. Enhancing the specificity of polymerase chain reaction by graphene oxide through surface modification: zwitterionic polymer is superior to other polymers with different charges

    PubMed Central

    Zhong, Yong; Huang, Lihong; Zhang, Zhisen; Xiong, Yunjing; Sun, Liping; Weng, Jian

    2016-01-01

    Graphene oxides (GOs) with different surface characteristics, such as size, reduction degree and charge, are prepared, and their effects on the specificity of polymerase chain reaction (PCR) are investigated. In this study, we demonstrate that GO with a large size and high reduction degree is superior to small and nonreduced GO in enhancing the specificity of PCR. Negatively charged polyacrylic acid (PAA), positively charged polyacrylamide (PAM), neutral polyethylene glycol (PEG) and zwitterionic polymer poly(sulfobetaine) (pSB) are used to modify GO. The PCR specificity-enhancing ability increases in the following order: GO-PAA < GO-PAM < GO-PEG < GO-pSB. Thus, zwitterionic polymer-modified GO is superior to other GO derivatives with different charges in enhancing the specificity of PCR. GO derivatives are also successfully used to enhance the specificity of PCR for the amplification of human mitochondrial DNA using blood genomic DNA as template. Molecular dynamics simulations and molecular docking are performed to elucidate the interaction between the polymers and Pfu DNA polymerase. Our data demonstrate that the size, reduction degree and surface charge of GO affect the specificity of PCR. Based on our results, zwitterionic polymer-modified GO may be used as an efficient additive for enhancing the specificity of PCR. PMID:27956830

  2. Triplex DNA: A new platform for polymerase chain reaction – based biosensor

    PubMed Central

    Li, Yubin; Miao, Xiangmin; Ling, Liansheng

    2015-01-01

    Non - specific PCR amplification and DNA contamination usually accompany with PCR process, to overcome these problems, here we establish a sensor for thrombin by sequence - specific recognition of the PCR product with molecular beacon through triplex formation. Probe A and probe B were designed for the sensor, upon addition of thrombin, two probes hybridized to each other and the probe B was extended in the presence of Klenow Fragment polymerase and dNTPs. The PCR amplification occurred with further addition of Taq DNA Polymerase and two primers, the PCR product was recognized by molecular beacon through triplex formation. The fluorescence intensity increased with the logarithm of the concentration of thrombin over the range from 1.0 × 10−12 M to 1.0 × 10−7 M, with a detection limit of 261 fM. Moreover, the effect of DNA contamination and non - specific amplification could be ignored completely in the proposed strategy. PMID:26268575

  3. [The experience of implementation of REP-u RAPD-polymerase chain reaction in epidemiologic characteristic of nosocomial isolates Pseudomonas aeruginosa].

    PubMed

    Kuznetsova, M V; Maksimova, A V; Karpunina, T I

    2015-03-01

    The article presents comparative evaluation of diagnostic value of technique REP- u RAPD-polymerase chain reaction applied under genetic typing of clinical isolates of Pseudomonas Aeruginosa. The strains are isolated in different hospital departments of medical institutions in adult (8 medical institutions; n = 145) and children (5 medical institutions; n = 151) medical networks. The results of study demonstrated different boundary capacity of three reactions. The Simpson discrimination index made up to 0.993, 0.875 and 0.639 for RAPD-, ERIC- and BOX-polymerase chain reaction correspondingly. The RAPD-polymerase chain reaction makes it possible to detect individual characteristics of strains. Out of two alternatives the REP-polymerase chain reaction demonstrated its advantage, besides only with one primer ERIC2. The BOX-polymerase chain reaction has a least discriminating capacity under typing of isolates P. aeruginosa, detecting only species' characteristics. The clinical strains P. aeruginosa are distributed on 24 genome groups and 52 isolates had individual genotypes. The evaluation of results of genetic typing permitted to point out both similarity of tendencies in propagation of strains of P. aeruginosa among hospitalized adults and adolescents and specificity of detection in neonatal clinics. It is obvious that hospitals of different profiles, including departments of reanimation and intensive therapy represent specific ecological environment significantly different in its level of endogenous and exogenous infection.

  4. Radiolabeled dimethyl branched long chain fatty acid for heart imaging

    DOEpatents

    Knapp, Jr., Furn F.; Goodman, Mark M.; Kirsch, Gilbert

    1988-08-16

    A radiolabeled long chain fatty acid for heart imaging that has dimethyl branching at one of the carbons of the chain which inhibits the extent to which oxidation can occur. The closer to the carboxyl the branching is positioned, the more limited the oxidation, thereby resulting in prolonged retention of the radiolabeled compound in the heart.

  5. RAPID MONITORING BY QUANTITATIVE POLYMERASE CHAIN REACTION FOR PATHOGENIC ASPERGILLUS DURING CARPET REMOVAL FROM A HOSPITAL

    EPA Science Inventory

    Monitoring for pathogenic Aspergillus species using a rapid, highly sensitive, quantitative polumerase chain reaction technique during carpet removal in a burn unit provided data which allowed the patients to be safely returned to the re-floored area sooner than if only conventio...

  6. Detection of Norwalk virus in stool specimens by reverse transcriptase-polymerase chain reaction and nonradioactive oligoprobes.

    PubMed Central

    De Leon, R; Matsui, S M; Baric, R S; Herrmann, J E; Blacklow, N R; Greenberg, H B; Sobsey, M D

    1992-01-01

    A reverse transcriptase (RT)-polymerase chain reaction (PCR)-oligoprobe (OP), or RT-PCR-OP, method was developed for the detection of the Norwalk virus, which causes acute, epidemic gastroenteritis, in stool specimens. The Norwalk virus genome regions encoding the following two proteins were amplified by RT-PCR: the RNA polymerase (260-bp product) and a putative immunogenic protein (224-bp product). The resulting DNA fragments (amplicons) were hybridized to a digoxigenin-labeled internal OP specific to each amplicon. The detection limit of Norwalk virus, as determined by the endpoint of RT-PCR amplification for serially diluted, positive stool specimens, was similar to the actual virion titer as estimated by electron microscopy and at least 100-fold greater than the titer determined by radioimmunoassay (RIA). The RT-PCR-OP assay was specific for Norwalk virus and negative for other enteric viruses, including human and animal caliciviruses, hepatitis E virus, Snow Mountain agent, astroviruses, 16 human enteroviruses, and 5 human rotaviruses. Components of fecal specimens that interfere with RT-PCR were removed successfully by Sephadex G-200 gel chromatography. Of 20 stool specimens from human volunteers that were positive for Norwalk virus by RIA, a specific RT-PCR-OP result was obtained in 95% (19 of 20) of the samples by using the immunogenic protein primers and 75% (15 of 20) by using the polymerase primers. Twenty-six stool specimens from asymptomatic children and adults were negative by the Norwalk virus RT-PCR-OP. RT-PCR-OP detected Norwalk virus in the 4 of 21 coded fecal specimens that were also positive by enzyme immunoassay. Two samples that were positive by RIA or enzyme immunoassay were negative by RT-PCR, perhaps because viral RNA was not present or RT-PCR inhibitors were not adequately removed. Images PMID:1280649

  7. Inhibition of Poly(ADP-Ribose) Polymerase by Nucleic Acid Metabolite 7-Methylguanine

    PubMed Central

    Nilov, D. K.; Tararov, V. I.; Kulikov, A. V.; Zakharenko, A. L.; Gushchina, I. V.; Mikhailov, S. N.; Lavrik, O. I.; Švedas, V. K.

    2016-01-01

    The ability of 7-methylguanine, a nucleic acid metabolite, to inhibit poly(ADP-ribose)polymerase-1 (PARP-1) and poly(ADP-ribose)polymerase-2 (PARP-2) has been identified in silico and studied experimentally. The amino group at position 2 and the methyl group at position 7 were shown to be important substituents for the efficient binding of purine derivatives to PARPs. The activity of both tested enzymes, PARP-1 and PARP-2, was suppressed by 7-methylguanine with IC50 values of 150 and 50 μM, respectively. At the PARP inhibitory concentration, 7-methylguanine itself was not cytotoxic, but it was able to accelerate apoptotic death of BRCA1-deficient breast cancer cells induced by cisplatin and doxorubicin, the widely used DNA-damaging chemotherapeutic agents. 7-Methylguanine possesses attractive predictable pharmacokinetics and an adverse-effect profile and may be considered as a new additive to chemotherapeutic treatment. PMID:27437145

  8. Segmented continuous-flow multiplex polymerase chain reaction microfluidics for high-throughput and rapid foodborne pathogen detection.

    PubMed

    Shu, Bowen; Zhang, Chunsun; Xing, Da

    2014-05-15

    High-throughput and rapid identification of multiple foodborne bacterial pathogens is vital in global public health and food industry. To fulfill this need, we propose a segmented continuous-flow multiplex polymerase chain reaction (SCF-MPCR) on a spiral-channel microfluidic device. The device consists of a disposable polytetrafluoroethylene (PTFE) capillary microchannel coiled on three isothermal blocks. Within the channel, n segmented flow regimes are sequentially generated, and m-plex PCR is individually performed in each regime when each mixture is driven to pass three temperature zones, thus providing a rapid analysis throughput of m×n. To characterize the performance of the microfluidic device, continuous-flow multiplex PCR in a single segmented flow has been evaluated by investigating the effect of key reaction parameters, including annealing temperatures, flow rates, polymerase concentration and amount of input DNA. With the optimized parameters, the genomic DNAs from Salmonella enterica, Listeria monocytogenes, Escherichia coli O157:H7 and Staphylococcus aureus could be amplified simultaneously in 19min, and the limit of detection was low, down to 10(2) copiesμL(-1). As proof of principle, the spiral-channel SCF-MPCR was applied to sequentially amplify four different bacterial pathogens from banana, milk, and sausage, displaying a throughput of 4×3 with no detectable cross-contamination.

  9. An A-T linker adapter polymerase chain reaction method for chromosome walking without restriction site cloning bias.

    PubMed

    Trinh, Quoclinh; Xu, Wentao; Shi, Hui; Luo, Yunbo; Huang, Kunlun

    2012-06-01

    A-T linker adapter polymerase chain reaction (PCR) was modified and employed for the isolation of genomic fragments adjacent to a known DNA sequence. The improvements in the method focus on two points. The first is the modification of the PO(4) and NH(2) groups in the adapter to inhibit the self-ligation of the adapter or the generation of nonspecific products. The second improvement is the use of the capacity of rTaq DNA polymerase to add an adenosine overhang at the 3' ends of digested DNA to suppress self-ligation in the digested DNA and simultaneously resolve restriction site clone bias. The combination of modifications in the adapter and in the digested DNA leads to T/A-specific ligation, which enhances the flexibility of this method and makes it feasible to use many different restriction enzymes with a single adapter. This novel A-T linker adapter PCR overcomes the inherent limitations of the original ligation-mediated PCR method such as low specificity and a lack of restriction enzyme choice. Moreover, this method also offers higher amplification efficiency, greater flexibility, and easier manipulation compared with other PCR methods for chromosome walking. Experimental results from 143 Arabidopsis mutants illustrate that this method is reliable and efficient in high-throughput experiments.

  10. In planta distribution of 'Candidatus Liberibacter asiaticus' as revealed by polymerase chain reaction (PCR) and real-time PCR.

    PubMed

    Tatineni, Satyanarayana; Sagaram, Uma Shankar; Gowda, Siddarame; Robertson, Cecile J; Dawson, William O; Iwanami, Toru; Wang, Nian

    2008-05-01

    Huanglongbing (HLB) is one of the most devastating diseases of citrus worldwide, and is caused by a phloem-limited fastidious prokaryotic alpha-proteobacterium that is yet to be cultured. In this study, a combination of traditional polymerase chain reaction (PCR) and real-time PCR targeting the putative DNA polymerase and 16S rDNA sequence of 'Candidatus Liberibacter asiaticus,' respectively, were used to examine the distribution and movement of the HLB pathogen in the infected citrus tree. We found that 'Ca. Liberibacter asiaticus' was distributed in bark tissue, leaf midrib, roots, and different floral and fruit parts, but not in endosperm and embryo, of infected citrus trees. Quantification analysis of the HLB bacterium indicated that it was distributed unevenly in planta and ranged from 14 to 137,031 cells/mug of total DNA in different tissues. A relatively high concentration of 'Ca. Liberibacter asiaticus' was observed in fruit peduncles. Our data from greenhouse-infected plants also indicated that 'Ca. Liberibacter asiaticus' was transmitted systemically from infection site to different parts of the plant. Understanding the distribution and movement of the HLB bacterium inside an individual citrus tree is critical for discerning its virulence mechanism and to develop management strategies for HLB.

  11. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions

    NASA Astrophysics Data System (ADS)

    Shen, Cenchao; Yang, Wenjuan; Ji, Qiaoli; Maki, Hisaji; Dong, Anjie; Zhang, Zhizhou

    2009-11-01

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  12. NanoPCR observation: different levels of DNA replication fidelity in nanoparticle-enhanced polymerase chain reactions.

    PubMed

    Shen, Cenchao; Yang, Wenjuan; Ji, Qiaoli; Maki, Hisaji; Dong, Anjie; Zhang, Zhizhou

    2009-11-11

    Nanoparticle-assisted PCR (polymerase chain reaction) technology is getting more and more attention recently. It is believed that some of the DNA recombinant technologies will be upgraded by nanotechnology in the near future, among which DNA replication is one of the core manipulation techniques. So whether or not the DNA replication fidelity is compromised in nanoparticle-assisted PCR is a question. In this study, a total of 16 different metallic and non-metallic nanoparticles (NPs) were tested for their effects on DNA replication fidelity in vitro and in vivo. Sixteen types of nanomaterials were distinctly different in enhancing the PCR efficiency, and their relative capacity to retain DNA replication fidelity was largely different from each other based on rpsL gene mutation assay. Generally speaking, metallic nanoparticles induced larger error rates in DNA replication fidelity than non-metallic nanoparticles, and non-metallic nanomaterials such as carbon nanopowder or nanotubes were still safe as PCR enhancers because they did not compromise the DNA replication fidelity in the Taq DNA polymerase-based PCR system.

  13. Discrepancy between Penner serotyping and polymerase chain reaction fingerprinting of Campylobacter isolated from poultry and other animal sources.

    PubMed

    Aarts, H J; van Lith, L A; Jacobs-Reitsma, W F

    1995-06-01

    Thirty-four Campylobacter jejuni or coli strains, isolated from various livestock and darkling beetles from two Dutch poultry farms during different broiler production cycles, were subjected to Penner serotyping and polymerase chain reaction (PCR) fingerprint analysis. Ten different Penner serotypes were determined in the isolates. Visual scoring of the PCR fingerprints resulted in 14 clearly different profiles. Some strains with identical Penner serotypes exhibited different PCR fingerprints and conversely strains with different serotypes produced identical PCR fingerprints. Discrepancies between Penner serotyping and PCR fingerprinting were most obvious between isolates from different animal sources. Indications for the occurrence of genomic rearrangements were found. The inconsistency between serotyping and fingerprinting of Campylobacter strains suggests that conventional typing methods should be used in combination with fingerprinting if the epidemiological factors that contribute to Campylobacter colonization of live chickens are to be assessed reliably.

  14. Detection of Leptospira spp. in wildlife reservoir hosts in Ontario through comparison of immunohistochemical and polymerase chain reaction genotyping methods

    PubMed Central

    Shearer, Karen E.; Harte, Michael J.; Ojkic, Davor; DeLay, Josepha; Campbell, Douglas

    2014-01-01

    A total of 460 kidney samples from wildlife (beavers, coyotes, deer, foxes, opossums, otters, raccoons, skunks) were obtained from road-kill and hunter/trapper donations in Ontario between January 2010 and November 2012. The objectives of the study were to detect Leptospira spp. by immunohistochemistry and polymerase chain reaction (PCR), to map presence of leptospires in wildlife relative to livestock and human populations, and to characterize positive samples by sequencing and comparison to leptospires known to affect domestic animals and humans. The proportion of samples that tested positive ranged from 0% to 42%, with the highest rates in skunks and raccoons. Leptospira spp. were present in kidneys of wildlife across Ontario, particularly in areas of high human density, and areas in which livestock populations are abundant. The PCR was too weak in most samples to permit genotyping and examination of the relationship between the leptospires found in this study and those affecting domestic animals and humans. PMID:24587507

  15. Development and interlaboratory validation of quantitative polymerase chain reaction method for screening analysis of genetically modified soybeans.

    PubMed

    Takabatake, Reona; Onishi, Mari; Koiwa, Tomohiro; Futo, Satoshi; Minegishi, Yasutaka; Akiyama, Hiroshi; Teshima, Reiko; Kurashima, Takeyo; Mano, Junichi; Furui, Satoshi; Kitta, Kazumi

    2013-01-01

    A novel real-time polymerase chain reaction (PCR)-based quantitative screening method was developed for three genetically modified soybeans: RRS, A2704-12, and MON89788. The 35S promoter (P35S) of cauliflower mosaic virus is introduced into RRS and A2704-12 but not MON89788. We then designed a screening method comprised of the combination of the quantification of P35S and the event-specific quantification of MON89788. The conversion factor (Cf) required to convert the amount of a genetically modified organism (GMO) from a copy number ratio to a weight ratio was determined experimentally. The trueness and precision were evaluated as the bias and reproducibility of relative standard deviation (RSDR), respectively. The determined RSDR values for the method were less than 25% for both targets. We consider that the developed method would be suitable for the simple detection and approximate quantification of GMO.

  16. Development of a screening method for genetically modified soybean by plasmid-based quantitative competitive polymerase chain reaction.

    PubMed

    Shimizu, Eri; Kato, Hisashi; Nakagawa, Yuki; Kodama, Takashi; Futo, Satoshi; Minegishi, Yasutaka; Watanabe, Takahiro; Akiyama, Hiroshi; Teshima, Reiko; Furui, Satoshi; Hino, Akihiro; Kitta, Kazumi

    2008-07-23

    A novel type of quantitative competitive polymerase chain reaction (QC-PCR) system for the detection and quantification of the Roundup Ready soybean (RRS) was developed. This system was designed based on the advantage of a fully validated real-time PCR method used for the quantification of RRS in Japan. A plasmid was constructed as a competitor plasmid for the detection and quantification of genetically modified soy, RRS. The plasmid contained the construct-specific sequence of RRS and the taxon-specific sequence of lectin1 (Le1), and both had 21 bp oligonucleotide insertion in the sequences. The plasmid DNA was used as a reference molecule instead of ground seeds, which enabled us to precisely and stably adjust the copy number of targets. The present study demonstrated that the novel plasmid-based QC-PCR method could be a simple and feasible alternative to the real-time PCR method used for the quantification of genetically modified organism contents.

  17. Clinical validation of a real-time polymerase chain reaction assay for rapid detection of Acinetobacter baumannii colonization.

    PubMed

    Blanco-Lobo, P; González-Galán, V; García-Quintanilla, M; Valencia, R; Cazalla, A; Martín, C; Alonso, I; Pérez-Romero, P; Cisneros, J M; Aznar, J; McConnell, M J

    2016-09-01

    Real-time polymerase chain reaction (PCR)-based approaches have not been assessed in terms of their ability to detect patients colonized by Acinetobacter baumannii during active surveillance. This prospective, double-blind study demonstrated that a real-time PCR assay had high sensitivity (100%) and specificity (91.2%) compared with conventional culture for detecting A. baumannii in 397 active surveillance samples, and provided results within 3h. Receiver-operator curve analyses demonstrated that the technique has diagnostic accuracy of 97.7% (95% confidence interval 96.0-99.3%). This method could facilitate the rapid implementation of infection control measures for preventing the transmission of A. baumannii.

  18. Bladder and prostate cancer screening for human papillomavirus by polymerase chain reaction: conflicting results using different annealing temperatures.

    PubMed

    Sinclair, A L; Nouri, A M; Oliver, R T; Sexton, C; Dalgleish, A G

    1993-12-01

    Two sets of L1 ORF degenerative primers, GP5/6 and MYO9/11, have been used to screen for human papillomavirus (HPV) sequences in bladder tumours, cell lines and controls by polymerase chain reaction (PCR). None of the 14 bladder and prostate tumours or nine bladder cell lines contained HPV sequences when tested with L1 ORF primer pair GP5/6 at 40 degrees C annealing temperature. In contrast, use of the L1 ORF primer pair MY09/11 at this low annealing temperature consistently gave a 450 bp band, suggesting the presence of HPV. This occurred in all samples including the negative DNA controls. An increase in stringency to an annealing temperature of 55 degrees C resulted in an elimination of this band in the test and negative control samples. This finding may explain why there are contradictory reports in the literature, and further studies are in progress to clarify this issue.

  19. Identification of the five human Plasmodium species including P. knowlesi by real-time polymerase chain reaction.

    PubMed

    Oddoux, O; Debourgogne, A; Kantele, A; Kocken, C H; Jokiranta, T S; Vedy, S; Puyhardy, J M; Machouart, M

    2011-04-01

    Recently, Plasmodium knowlesi has been recognised as the fifth Plasmodium species causing malaria in humans. Hundreds of human cases infected with this originally simian Plasmodium species have been described in Asian countries and increasing numbers are reported in Europe from travellers. The growing impact of tourism and economic development in South and Southeast Asia are expected to subsequently lead to a further increase in cases both among locals and among travellers. P. knowlesi is easily misidentified in microscopy as P. malariae or P. falciparum. We developed new primers for the rapid and specific detection of this species by low-cost real-time polymerase chain reaction (PCR) and added this method to an already existing panel of primers used for the molecular identification of the other four species in one reaction. Reference laboratories should now be able to identify undisputably and rapidly P. knowlesi, as it is a potentially fatal pathogen.

  20. Identification of Endosymbionts in Ticks by Broad-Range Polymerase Chain Reaction and Electrospray Ionization Mass Spectrometry

    PubMed Central

    ROUNDS, MEGAN A.; CROWDER, CHRISTOPHER D.; MATTHEWS, HEATHER E.; PHILIPSON, CURTIS A.; SCOLES, GLEN A.; ECKER, DAVID J.; SCHUTZER, STEVEN E.; ESHOO, MARK W.

    2012-01-01

    Many organisms, such as insects, filarial nematodes, and ticks, contain heritable bacterial endosymbionts that are often closely related to transmissible tickborne pathogens. These intracellular bacteria are sometimes unique to the host species, presumably due to isolation and genetic drift. We used a polymerase chain reaction/electrospray ionization-mass spectrometry assay designed to detect a wide range of vectorborne microorganisms to characterize endosymbiont genetic signatures from Amblyomma americanum (L.), Amblyomma maculatum Koch, Dermacentor andersoni Stiles, Dermacentor occidentalis Marx, Dermacentor variabilis (Say), Ixodes scapularis Say, Ixodes pacificus Cooley & Kohls, Ixodes ricinus (L.), and Rhipicephalus sanguineus (Latreille) ticks collected at various sites and of different stages and both sexes. The assay combines the abilities to simultaneously detect pathogens and closely related endosymbionts and to identify tick species via characterization of their respective unique endosymbionts in a single test. PMID:22897044

  1. Case Report of Focal Epithelial Hyperplasia (Heck's Disease) with Polymerase Chain Reaction Detection of Human Papillomavirus 13.

    PubMed

    Brehm, Mary A; Gordon, Katie; Firan, Miahil; Rady, Peter; Agim, Nnenna

    2016-05-01

    Focal epithelial hyperplasia (FEH), or Heck's disease, is an uncommon benign proliferation of oral mucosa caused by the human papillomavirus (HPV), particularly subtypes 13 and 32. The disease typically presents in young Native American patients and is characterized by multiple asymptomatic papules and nodules on the oral mucosa, lips, tongue, and gingiva. The factors that determine susceptibility to FEH are unknown, but the ethnic and geographic distribution of FEH suggests that genetic predisposition, particularly having the human lymphocytic antigen DR4 type, may be involved in pathogenesis. We report a case of FEH with polymerase chain reaction detection of HPV13 in a healthy 11-year-old Hispanic girl and discuss the current understanding of disease pathogenesis, susceptibility, and treatment.

  2. Real-Time Polymerase Chain Reaction Detection of Angiostrongylus cantonensis DNA in Cerebrospinal Fluid from Patients with Eosinophilic Meningitis.

    PubMed

    Qvarnstrom, Yvonne; Xayavong, Maniphet; da Silva, Ana Cristina Aramburu; Park, Sarah Y; Whelen, A Christian; Calimlim, Precilia S; Sciulli, Rebecca H; Honda, Stacey A A; Higa, Karen; Kitsutani, Paul; Chea, Nora; Heng, Seng; Johnson, Stuart; Graeff-Teixeira, Carlos; Fox, LeAnne M; da Silva, Alexandre J

    2016-01-01

    Angiostrongylus cantonensis is the most common infectious cause of eosinophilic meningitis. Timely diagnosis of these infections is difficult, partly because reliable laboratory diagnostic methods are unavailable. The aim of this study was to evaluate the usefulness of a real-time polymerase chain reaction (PCR) assay for the detection of A. cantonensis DNA in human cerebrospinal fluid (CSF) specimens. A total of 49 CSF specimens from 33 patients with eosinophilic meningitis were included: A. cantonensis DNA was detected in 32 CSF specimens, from 22 patients. Four patients had intermittently positive and negative real-time PCR results on subsequent samples, indicating that the level of A. cantonensis DNA present in CSF may fluctuate during the course of the illness. Immunodiagnosis and/or supplemental PCR testing supported the real-time PCR findings for 30 patients. On the basis of these observations, this real-time PCR assay can be useful to detect A. cantonensis in the CSF from patients with eosinophilic meningitis.

  3. Identification of goose, mule duck, chicken, turkey, and swine in foie gras by species-specific polymerase chain reaction.

    PubMed

    Rodríguez, Miguel A; García, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martín, Rosario

    2003-03-12

    A specific Polymerase Chain Reaction (PCR) has been developed for the identification of goose (Anser anser), mule duck (Anas platyrhynchos x Cairina moschata), chicken (Gallus gallus), turkey (Meleagris gallopavo), and swine (Sus scrofa domesticus) in foie gras. A forward common primer was designed on a conserved DNA sequence in the mitochondrial 12S ribosomal RNA gene (rRNA), and reverse primers were designed to hybridize on species-specific DNA sequences of each species considered. The different sizes of the species-specific amplicons, separated by agarose gel electrophoresis, allowed clear identification of goose, mule duck, chicken, turkey, and swine in foie gras. Analysis of experimental mixtures demonstrated that the detection limit of the assay was approximately 1% for each species analyzed. This genetic marker can be very useful for the accurate identification of these species, avoiding mislabeling or fraudulent species substitution in foie gras.

  4. Development of a polymerase chain reaction assay for species identification of goose and mule duck in foie gras products.

    PubMed

    Rodrı X0301 Guez, Miguel A; Garcı X0301 A, Teresa; González, Isabel; Asensio, Luis; Mayoral, Belén; López-Calleja, Inés; Hernández, Pablo E; Martı X0301 N, Rosario

    2003-12-01

    Polymerase chain reaction amplification of a conserved region of the α-actin gene has been used for the specific identification of goose (Anser anser) and mule duck (Anas platyrhynchos×Cairina moschata) foie gras. Universal primers were used for the amplification of a DNA fragment containing three introns and four exons of the α-actin gene in goose and mule duck. Sequence analysis of the amplified fragments was necessary for the design of forward species-specific primers in the goose and mule duck α-actin genes. The use of species-specific forward primers, together with a reverse universal primer, produced amplicons of different length, allowing clear identification of goose and mule duck foie gras samples. Analysis of experimental mixtures demonstrated that 1% of duck can be easily detected in goose foie gras using the PCR method developed here. This genetic marker can be very useful for the accurate identification of these two species in foie gras products.

  5. Identification of endosymbionts in ticks by broad-range polymerase chain reaction and electrospray ionization mass spectrometry.

    PubMed

    Rounds, Megan A; Crowder, Christopher D; Matthews, Heather E; Philipson, Curtis A; Scoles, Glen A; Ecker, David J; Schutzer, Steven E; Eshoo, Mark W

    2012-07-01

    Many organisms, such as insects, filarial nematodes, and ticks, contain heritable bacterial endosymbionts that are often closely related to transmissible tickborne pathogens. These intracellular bacteria are sometimes unique to the host species, presumably due to isolation and genetic drift. We used a polymerase chain reaction/electrospray ionization-mass spectrometry assay designed to detect a wide range of vectorborne microorganisms to characterize endosymbiont genetic signatures from Amblyomma americanum (L.), Amblyomma maculatum Koch, Dermacentor andersoni Stiles, Dermacentor occidentalis Marx, Dermacentor variabilis (Say), Ixodes scapularis Say, Ixodes pacificus Cooley & Kohls, Ixodes ricinus (L.), and Rhipicephalus sanguineus (Latreille) ticks collected at various sites and of different stages and both sexes. The assay combines the abilities to simultaneously detect pathogens and closely related endosymbionts and to identify tick species via characterization of their respective unique endosymbionts in a single test.

  6. Real-time quantitative polymerase chain reaction methods for four genetically modified maize varieties and maize DNA content in food.

    PubMed

    Brodmann, Peter D; Ilg, Evelyn C; Berthoud, Hélène; Herrmann, Andre

    2002-01-01

    Quantitative detection methods are needed for enforcement of the recently introduced labeling threshold for genetically modified organisms (GMOs) in food ingredients. This labeling threshold, which is set to 1% in the European Union and Switzerland, must be applied to all approved GMOs. Four different varieties of maize are approved in the European Union: the insect-resistant Bt176 maize (Maximizer), Btl 1 maize, Mon810 (YieldGard) maize, and the herbicide-tolerant T25 (Liberty Link) maize. Because the labeling must be considered individually for each ingredient, a quantitation system for the endogenous maize content is needed in addition to the GMO-specific detection systems. Quantitative real-time polymerase chain reaction detection methods were developed for the 4 approved genetically modified maize varieties and for an endogenous maize (invertase) gene system.

  7. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique tilapia (Oreochromis mossambicus) by polymerase chain reaction

    USGS Publications Warehouse

    Nol, P.; Williamson, J.L.; Rocke, T.E.; Yuill, Thomas M.

    2004-01-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5×104 cells per 0.25 g material or 1.9×103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  8. Potential of the polymerase chain reaction in the diagnosis of active Toxoplasma infection by detection of parasite in blood.

    PubMed

    Guy, E C; Joynson, D H

    1995-07-01

    Blood samples from 54 patients presenting with acute toxoplasmic lymphadenopathy were tested for the presence of Toxoplasma gondii DNA using a nested polymerase chain reaction (PCR). PCR test results of a single blood sample obtained 2-23 weeks after onset of illness were positive for 19 (35%) of the 54 patients. Nine (53%) of 17 patients were positive by PCR when the initial blood sample was collected within the first 5 weeks of illness. In 7 of the 19 patients found positive, further blood samples were available, and subsequent clearance of T. gondii DNA from the blood was demonstrated. On the basis of positive findings among patients with acute toxoplasmosis and the absence of positive findings among 10 uninfected persons and 43 with past Toxoplasma infection, a positive PCR result appears to be a helpful indicator of active disease. However, since only 53% of patients with lymphadenopathy persisting < or = 5 weeks were positive, a negative PCR result does not exclude recent infection.

  9. Reverse Transcription Polymerase Chain Reaction-based System for Simultaneous Detection of Multiple Lily-infecting Viruses

    PubMed Central

    Kwon, Ji Yeon; Ryu, Ki Hyun; Choi, Sun Hee

    2013-01-01

    A detection system based on a multiplex reverse transcription (RT) polymerase chain reaction (PCR) was developed to simultaneously identify multiple viruses in the lily plant. The most common viruses infecting lily plants are the cucumber mosaic virus (CMV), lily mottle virus (LMoV), lily symptomless virus (LSV). Leaf samples were collected at lily-cultivation facilities located in the Kangwon province of Korea and used to evaluate the detection system. Simplex and multiplex RT-PCR were performed using virus-specific primers to detect single-or mixed viral infections in lily plants. Our results demonstrate the selective detection of 3 different viruses (CMV, LMoV and LSV) by using specific primers as well as the potential of simultaneously detecting 2 or 3 different viruses in lily plants with mixed infections. Three sets of primers for each target virus, and one set of internal control primers were used to evaluate the detection system for efficiency, reliability, and reproducibility. PMID:25288961

  10. Repeatedly positive human immunodeficiency virus type 1 DNA polymerase chain reaction in human immunodeficiency virus-exposed seroreverting infants.

    PubMed

    Bakshi, S S; Tetali, S; Abrams, E J; Paul, M O; Pahwa, S G

    1995-08-01

    Three human immunodeficiency virus type 1 (HIV-1)-exposed children who had repeatedly positive DNA polymerase chain reaction (PCR) tests for HIV in > or = 5 samples before seroreversion to HIV-negative status are reported. The children belong to a cohort of 210 infants who were born to HIV-infected mothers and were tested at intervals of 1 to 3 months by HIV viral culture, PCR, and p24 antigen; only the PCR was positive in > or = 5 samples in the children reported here. Their clinical features were indistinguishable from other seroreverters. All three children had a transient drop in CD4:CD8 ratio to < 1.0. The transiently positive DNA PCR in HIV-exposed infants may indicate either that HIV infection was eliminated by a strong host immune response or that infection was caused by an attenuated/defective strain of virus.

  11. Multiplex polymerase chain reaction assay for the detection of minute virus of mice and mouse parvovirus infections in laboratory mice.

    PubMed

    Wang, K W; Chueh, L L; Wang, M H; Huang, Y T; Fang, B H; Chang, C Y; Fang, M C; Chou, J Y; Hsieh, S C; Wan, C H

    2013-04-01

    Mouse parvoviruses are among the most prevalent infectious pathogens in contemporary mouse colonies. To improve the efficiency of routine screening for mouse parvovirus infections, a multiplex polymerase chain reaction (PCR) assay targeting the VP gene was developed. The assay detected minute virus of mice (MVM), mouse parvovirus (MPV) and a mouse housekeeping gene (α-actin) and was able to specifically detect MVM and MPV at levels as low as 50 copies. Co-infection with the two viruses with up to 200-fold differences in viral concentrations can easily be detected. The multiplex PCR assay developed here could be a useful tool for monitoring mouse health and the viral contamination of biological materials.

  12. Detection of parvalbumin, a common fish allergen gene in food, by real-time polymerase chain reaction.

    PubMed

    Sun, Min; Liang, Chengzhu; Gao, Hongwei; Lin, Chao; Deng, Mingjun

    2009-01-01

    Fish, as one of the most common causes of IgE-mediated food hypersensitivity, has recently received increasing attention from the food industry and legislative and regulatory agencies. A real-time polymerase chain reaction assay based on TaqMan-MGB probe technology was developed for the detection of parvalbumin, a major fish allergen gene. The assay had a sensitivity up to 5 pg purified fish DNA and had no cross-reaction with other species, such as cattle, sheep, swine, chicken, shrimp, lobster, crab, squid, clam, rice, soybean, maize, and potato. The coefficient of variation for both intra- and interexperimental variability demonstrated high reproducibility and accuracy. The assay proved to be a potential tool for the detection and label management of fish allergens in food.

  13. A rapid, efficient, and economical inverse polymerase chain reaction-based method for generating a site saturation mutant library.

    PubMed

    Jain, Pankaj C; Varadarajan, Raghavan

    2014-03-15

    With the development of deep sequencing methodologies, it has become important to construct site saturation mutant (SSM) libraries in which every nucleotide/codon in a gene is individually randomized. We describe methodologies for the rapid, efficient, and economical construction of such libraries using inverse polymerase chain reaction (PCR). We show that if the degenerate codon is in the middle of the mutagenic primer, there is an inherent PCR bias due to the thermodynamic mismatch penalty, which decreases the proportion of unique mutants. Introducing a nucleotide bias in the primer can alleviate the problem. Alternatively, if the degenerate codon is placed at the 5' end, there is no PCR bias, which results in a higher proportion of unique mutants. This also facilitates detection of deletion mutants resulting from errors during primer synthesis. This method can be used to rapidly generate SSM libraries for any gene or nucleotide sequence, which can subsequently be screened and analyzed by deep sequencing.

  14. Detection of loss of heterozygosity in formalin-fixed paraffin-embedded tumor specimens by the polymerase chain reaction.

    PubMed Central

    Bianchi, A. B.; Navone, N. M.; Conti, C. J.

    1991-01-01

    A polymerase chain reaction-based procedure was used for the detection of DNA length polymorphisms generated by naturally occurring genetic deletions or insertions of known sequence. This method consists of a simple one-step assay that does not require any restriction enzyme analysis or Southern blot hybridization, allowing identification in ethidium bromide-stained gels. The procedure described here was used to detect loss of heterozygosity at various loci, including the Hbb beta-globin gene cluster, in chemically induced mouse skin tumors, using a variety of tissue preparations, including microdissection of formalin-fixed, paraffin-embedded specimens, short-term cultures, and fluorescence-activated cell sorting of epithelial populations. This approach may be useful in detecting tumor-specific reduction to homozygosity at polymorphic chromosomal loci, allowing the mapping of putative tumor-suppressor loci involved in carcinogenesis. Images Figure 2 Figure 3 Figure 4 Figure 5 PMID:1992758

  15. Cloning of flanking sequence in transgenic plants by restriction site-anchored single-primer polymerase chain reaction.

    PubMed

    Ma, J; Wang, N N; Ren, S; Fu, Y P; Lu, S; Wang, Y P; Wang, P W

    2014-12-12

    Determining the insertion position of an exogenous gene in the target plant genome is one of the main issues in the transgenic plant field. This study introduced a simple, rapid, and accurate method to clone the flanking sequences of the transgenic bar gene as the anchoring gene in the transgenic maize genome using single-primer polymerase chain reaction (PCR). This method was based on the distribution of restriction sites in the maize genome and adopted the single-primer PCR method. Cloning the flanking sequences with the restriction site-anchored single-primer PCR simplified the experimental procedures by about 70% and reduced the experimental time by more than 80%. In conclusion, the restriction site-anchored single-primer PCR was a simple, rapid method to obtain the unknown flanking sequences in the transgenic plants.

  16. Detection of Clostridium botulinum type C cells in the gastrointestinal tracts of Mozambique Tilapia (Oreochromis mossambicus) by polymerase chain reaction.

    PubMed

    Nol, P; Williamson, J L; Rocke, T E; Yuill, T M

    2004-10-01

    We established a method of directly detecting Clostridium botulinum type C cells, while minimizing spore detection, in the intestinal contents of Mozambique tilapia (Oreochromis mossambicus). This technique involved extraction of predominantly cellular DNA from tilapia intestinal tracts and used a polymerase chain reaction assay to detect presence of type C1 toxin gene. We consistently detected C. botulinum type C cells in tilapia gastrointestinal contents at a level of 7.5 x 104 cells per 0.25 g material or 1.9 x 103 cells. This technique is useful for determining prevalence of the potentially active organisms within a given population of fish and may be adapted to other types of C. botulinum and vertebrate populations as well.

  17. Analysis of ancient DNA from coprolites: a perspective with random amplified polymorphic DNA-polymerase chain reaction approach.

    PubMed

    Iñiguez, Alena M; Araújo, Adauto; Ferreira, Luiz Fernando; Vicente, Ana Carolina P

    2003-01-01

    The aim of this work was to determine approaches that would improve the quality of ancient DNA (aDNA) present in coprolites to enhance the possibility of success in retrieving specific sequence targets. We worked with coprolites from South American archaeological sites in Brazil and Chile dating up to 7,000 years ago. Using established protocols for aDNA extraction we obtained samples showing high degradation as usually happens with this kind of material. The reconstructive polymerization pretreatment was essential to overcome the DNA degradation and the serial dilutions helped with to prevent polymerase chain reaction (PCR) inhibitors. Moreover, the random amplified polymorphic DNA-PCR has been shown to be a reliable technique for further experiments to recover specific aDNA sequences.

  18. Biofunctionalization of Polyoxometalates with DNA Primers, Their Use in the Polymerase Chain Reaction (PCR) and Electrochemical Detection of PCR Products.

    PubMed

    Debela, Ahmed M; Ortiz, Mayreli; Beni, Valerio; Thorimbert, Serge; Lesage, Denis; Cole, Richard B; O'Sullivan, Ciara K; Hasenknopf, Bernold

    2015-12-01

    The bioconjugation of polyoxometalates (POMs), which are inorganic metal oxido clusters, to DNA strands to obtain functional labeled DNA primers and their potential use in electrochemical detection have been investigated. Activated monooxoacylated polyoxotungstates [SiW11 O39 {Sn(CH2 )2 CO}](8-) and [P2 W17 O61 {Sn(CH2 )2 CO}](6-) have been used to link to a 5'-NH2 terminated 21-mer DNA forward primer through amide coupling. The functionalized primer was characterized by using a battery of techniques, including electrophoresis, mass spectrometry, as well as IR and Raman spectroscopy. The functionality of the POM-labeled primers was demonstrated through hybridization with a surface-immobilized probe. Finally, the labeled primers were successfully used in the polymerase chain reaction (PCR) and the PCR products were characterized by using electrophoresis.

  19. Meningitis with polymerase chain reaction for varicella zoster positivity in cerebrospinal flid of a young immunocompetent adult

    PubMed Central

    Gupta, Pooja; Ranjan, Rajeev; Agrawal, C. S.; Muralikrishnan, K; Dave, Nikhil; Rana, Davinder Singh

    2016-01-01

    Meningitis caused by varicella zoster virus (VZV) is quite rare among young immunocompetent adults though immunocompromised patients are often seen to be affected by reactivation of VZV presenting with primary clinical features of dermatomal rashes and neurological sequelae. Here, we report the clinical scenario of a young, healthy male who had presented with fever, headache, and onset of dermatomal rashes later than the fever and was eventually diagnosed to be a case of VZV meningitis. We would like to highlight the fact that even young immunocompetent patients though rarely, might contract VZV meningitis and clinicians should have a high index of suspicion and keen eyes to catch the more obvious features of VZV infection on complete physical examination and must not harbor any reservations in ordering polymerase chain reaction for VZV DNA or initiating aggressive antiviral therapy. PMID:27695246

  20. Detection of cashew nut DNA in spiked baked goods using a real-time polymerase chain reaction method.

    PubMed

    Brzezinski, Jennifer L

    2006-01-01

    The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.

  1. [Detection of mycobacterial DNA with polymerase chain reaction in eye discharge and gastric juices in a case of scleritis].

    PubMed

    Tanemoto, K; Ishikawa, H; Kigasawa, K; Obazawa, H; Fusegawa, H; Miyachi, H; Ando, Y

    1997-01-01

    We report a case of mycobacterial scleritis in which prompt diagnosis was made by the detection of mycobacterial DNA with polymerase chain reaction (PCR) in eye discharge and gastric juices, when conventional tests were negative. A 77-year-old woman who had a past history of pulmonary tuberculosis visited the outpatient clinic of Tokai University Hospital complaining of pain in her right eye. She was diagnosed as having scleritis and uveitis. There were no indications of active tuberculosis. We examined the gastric juices, sputum, and eye discharge by microscopy, culture, and PCR for detection of mycobacterium. The results of microscopy and culture were negative, but with PCR we detected atypical mycobacterium in eye discharge and gastric juices. After oral treatment with antituberculosis agents, the patient's eye symptoms disappeared. Detecting mycobacterial DNA with PCR could be useful for early diagnosis of mycobacterial scleritis, so that treatment with antituberculosis agents could be started.

  2. Mitochondrial DNA variation in chinook salmon and chum salmon detected by restriction enzyme analysis of polymerase chain reaction products

    USGS Publications Warehouse

    Cronin, M.; Spearman, R.; Wilmot, R.; Patton, J.; Bickman, J.

    1993-01-01

    We analyze intraspecific mitochondrial DNA variation in chinook salmon from drainages in the Yukon River, the Kenai River, and Oregon and California rivers; and chum salmon from the Yukon River and vancouver Island, and Washington rivers. For each species, three different portions of the mtDNA molecule were amplified seperately using the polymerase chain reaction and then digested with at least 19 restrictions enzymes. Intraspecific sequence divergences between haplotypes were less than 0.01 base subsitution per nucleotide. Nine chum salmon haplotypes were identified. Yukon River chum salmon stocks displayed more haplotypes (8) occurred in all areas. Seven chinook salmon haplotypes were identified. Four haplotypes occurred in the Yukon and Kenai rviers and four occured in the Oregon/California, with only one haplotype shared between the regions. Sample sizes were too small to quantify the degree of stock seperation among drainages, but the patterns of variation that we observed suggest utility of the technique in genetic stock identification.

  3. [Rapid detection of influenza virus A (AH1, AH3) and B by nested-polymerase chain reaction].

    PubMed

    Shimizu, H; Watanabe, S; Imai, M

    1997-06-01

    We applied the Nested-polymerase chain reaction (PCR) for laboratory diagnosis of influenza virus infection. We used three primer sets for detection of influenza virus A (AH1, AH3) and B. The primer sets for each type (AH1, AH3, B) was able to detect specifically each type of influenza. We measured the sensitivity for detection of vaccine strains. The PCR method was able to detect 0.9 PFU/assey of AH1 type, 1.0 PFU/assey of AH3 type and 1.8 PFU/assey of B type. Out of 46 isolation negative but antibody positive cases, 38 cases were positive for PCR (82.6%). This method is sensitive and useful for rapid diagnosis of influenza virus infection.

  4. Scrub typhus induced by peripheral blood stem cell transplantation in the immunocompromised patient: diagnostic usefulness of nested polymerase chain reaction.

    PubMed

    Kang, Seung-Ji; Park, Kyung-Hwa; Jung, Sook-In; Jang, Hee Chang; Ji, Soo Young; Ahn, Jae Sook; Kim, Hyeoung Joon; Shin, Jong-Hee; Kim, Dong Min

    2010-02-01

    Scrub typhus (Orientia tsutsugamushi) is a Gram-negative rickettsial disease in parts of Asia, transmitted from wild rodents to human by mites. This is a case report of scrub typhus contraction in an acute leukemia patient by transfusion of peripheral blood stem cells collected during the incubation period. Although human-to-human transmission of scrub typhus by needle-stick injury or transplacental transmission has previously been reported, this is the first case confirmed by polymerase chain reaction (PCR) and DNA sequencing. This type of incident shows the need to heighten awareness of the threat of rickettsial agents in transfused blood. Nested PCR is a useful diagnostic method to confirm the diagnosis during incubation period and in the early phase of disease, especially for immunocompromised patients.

  5. Sensitive Detection of Polyalanine Expansions in PHOX2B by Polymerase Chain Reaction Using Bisulfite-Converted DNA

    PubMed Central

    Horiuchi, Hidekazu; Sasaki, Ayako; Osawa, Motoki; Kijima, Kazuki; Ino, Yukiko; Matoba, Ryoji; Hayasaka, Kiyoshi

    2005-01-01

    Congenital central hypoventilation syndrome, also known as Ondine’s curse, is characterized by idiopathic abnormal control of respiration during sleep. Recent studies indicate that a polyalanine expansion of PHOX2B is relevant to the pathogenesis of this disorder. However, it is difficult to detect the repeated tract because its high GC content inhibits conventional polymerase chain reaction (PCR) amplification. Here, we describe a bisulfite treatment for DNA in which uracil is obtained by deamination of unmethylated cytosine residues. Deamination of DNA permitted direct PCR amplification that yielded a product of 123 bp for the common 20-residue repetitive tract with replacement of C with T by sequencing. It settled allele dropouts accompanied by insufficient amplification of expanded alleles. The defined procedure dramatically improved detection of expansions to 9 of 10 congenital central hypoventilation syndrome patients examined in a previous study. The chemical conversion of DNA before PCR amplification facilitates effective detection of GC-rich polyalanine tracts. PMID:16258163

  6. Nested polymerase chain reaction for detection of Theileria annulata and comparison with conventional diagnostic techniques: its use in epidemiology studies.

    PubMed

    Martín-Sánchez, J; Viseras, J; Adroher, F J; García-Fernández, P

    1999-03-01

    In this work we studied the ability of a nested polymerase chain reaction (PCR) to detect Theileria annulata, the causative agent of Mediterranean theileriosis, in blood samples obtained from cattle on farms in different Spanish regions and its possible use in epidemiology studies. Of the 214 samples analyzed, 78.04%, 69.86%, and 62.26% were found to be positive by nested PCR, indirect immunofluorescent antibody test, and optical microscopy of Giemsa-stained smears, respectively. The three techniques were in agreement in 68.6% of the results. The observation that the prevalence of Mediterranean theileriosis estimated using nested PCR alone (70.3%) and that obtained using all three diagnostic techniques together (80.4%) did not significantly differ verifies the utility of this technique in epidemiology studies.

  7. Development of a DNA probe for the myxosporean parasite, Ceratomyxa shasta, using the polymerase chain reaction with arbitrary primers

    USGS Publications Warehouse

    Bartholomew, Jerri L; Rodriguez, Rusty J.; Arakawa, Cindy K.

    1995-01-01

    The arbitrarily primed polymerase chain reaction (PCR) was used to generate a DNA marker specific for the myxosporean parasite Ceratomyxa shasta. The [32~]-labeled marker hybridized to purified C. shasta DNA and to parasite DNA combined with salmonid DNA in a dot blot assay, demonstrating its potential as a diagnostic tool. The amplified DNA segment was cloned and sequenced, and primers specific for the marker were designed. When these primers were used in a standard PCR assay, DNA was amplified from C. shasta and from infected fish tissues, but not from uninfected fish tissues or from 2 other myxosporean parasites. The sensitivity of the PCR assay will permit detection of low levels of C. shasta from infected fish or oligochaetes and will be useful in defining the parasite's life cycle as well as examining its impact on salmonid populatiosn

  8. Absence of measles viral genomic sequence in intestinal tissues from Crohn's disease by nested polymerase chain reaction.

    PubMed Central

    Haga, Y; Funakoshi, O; Kuroe, K; Kanazawa, K; Nakajima, H; Saito, H; Murata, Y; Munakata, A; Yoshida, Y

    1996-01-01

    The aetiology of Crohn's disease remains unknown, although evidence for a viral cause has long been sought. Recent studies have shown inflammation of the submucosal microvascular endothelium and granulomata, and endothelial cell cytoplasmic inclusions, consistent with paramyxovirus, were identified by electron microscopy suggesting a persistent measles virus infection in Crohn's disease. Measles, mumps, and rubella viruses were tested for Crohn's disease by polymerase chain reaction (PCR). RNA was extracted from resected intestinal specimens from 15 patients with Crohn's disease, 14 with ulcerative colitis, and 14 controls without inflammatory bowel disease. This was used to perform nested PCR after reverse transcription (RT) of the RNA to cDNA with primer pairs directed against two regions in the genome of the measles virus and one region in the mumps and rubella viral genomes. Despite enhanced sensitivity of nested RT-PCR, measles, mumps, and rubella viral genomic sequences were not found in any intestinal specimen. Images Figure 1 Figure 2 PMID:8801199

  9. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation.

    PubMed

    Rahman, Md Mahfujur; Ali, Md Eaqub; Hamid, Sharifah Bee Abd; Mustafa, Shuhaimi; Hashim, Uda; Hanapi, Ummi Kalthum

    2014-08-01

    A polymerase chain reaction (PCR) assay for the assessment of dog meat adulteration in meatballs was developed. The assay selectively amplified a 100-bp region of canine mitochondrial cytochrome b gene from pure, raw, processed and mixed backgrounds. The specificity of the assay was tested against 11 animals and 3 plants species, commonly available for meatball formulation. The stability of the assay was proven under extensively autoclaving conditions that breakdown target DNA. A blind test from ready to eat chicken and beef meatballs showed that the assay can repeatedly detect 0.2% canine meat tissues under complex matrices using 0.04 ng of dog DNA extracted from differentially treated meatballs. The simplicity, stability and sensitivity of the assay suggested that it could be used in halal food industry for the authentication of canine derivatives in processed foods.

  10. Detection of Zaire Ebola virus by real-time reverse transcription-polymerase chain reaction, Sierra Leone, 2014.

    PubMed

    Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun

    2015-09-15

    During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus.

  11. Molecular detection of field isolates of Turkey Eimeria by polymerase chain reaction amplification of the cytochrome c oxidase I gene.

    PubMed

    Rathinam, T; Gadde, U; Chapman, H D

    2015-07-01

    Oocysts of Eimeria spp. were isolated from litter samples obtained from 30 commercial turkey farms. Genomic DNA was extracted from clean oocysts, and polymerase chain amplification of the species-specific cytochrome c oxidase subunit I (COI) gene was performed for five species of turkey Eimeria. The species tested were Eimeria adenoeides, Eimeria meleagrimitis, Eimeria meleagridis, Eimeria dispersa, and Eimeria gallopavonis. All DNA samples were positive for E. meleagrimitis, nine were positive for E. adenoeides, two were positive for E. dispersa, and none for E. meleagridis and E. gallopavonis. E. meleagrimitis occurred as a single species in 21 (70 %) of the farms while 9 (30 %) farms had a mixed species with E. meleagrimitis and E. adenoeides and 2 (7 %) were triple positive with E. meleagrimitis, E. adenoeides, and E. dispersa. This is the first account of the field prevalence of turkey Eimeria species using molecular methods.

  12. Dual Combined Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Diagnosis of Lyssavirus Infection

    PubMed Central

    Lavenir, Rachel; Lepelletier, Anthony; Faouzi, Abdellah; Troupin, Cécile; Nourlil, Jalal; Buchy, Philippe; Bourhy, Herve

    2016-01-01

    The definitive diagnosis of lyssavirus infection (including rabies) in animals and humans is based on laboratory confirmation. The reference techniques for post-mortem rabies diagnosis are still based on direct immunofluorescence and virus isolation, but molecular techniques, such as polymerase chain reaction (PCR) based methods, are increasingly being used and now constitute the principal tools for diagnosing rabies in humans and for epidemiological analyses. However, it remains a key challenge to obtain relevant specificity and sensitivity with these techniques while ensuring that the genetic diversity of lyssaviruses does not compromise detection. We developed a dual combined real-time reverse transcription polymerase chain reaction (combo RT-qPCR) method for pan-lyssavirus detection. This method is based on two complementary technologies: a probe-based (TaqMan) RT-qPCR for detecting the RABV species (pan-RABV RT-qPCR) and a second reaction using an intercalating dye (SYBR Green) to detect other lyssavirus species (pan-lyssa RT-qPCR). The performance parameters of this combined assay were evaluated with a large panel of primary animal samples covering almost all the genetic variability encountered at the viral species level, and they extended to almost all lyssavirus species characterized to date. This method was also evaluated for the diagnosis of human rabies on 211 biological samples (positive n = 76 and negative n = 135) including saliva, skin and brain biopsies. It detected all 41 human cases of rabies tested and confirmed the sensitivity and the interest of skin biopsy (91.5%) and saliva (54%) samples for intra-vitam diagnosis of human rabies. Finally, this method was successfully implemented in two rabies reference laboratories in enzootic countries (Cambodia and Morocco). This combined RT-qPCR method constitutes a relevant, useful, validated tool for the diagnosis of rabies in both humans and animals, and represents a promising tool for lyssavirus

  13. Search for Mycobacterium paratuberculosis DNA in orofacial granulomatosis and oral Crohn's disease tissue by polymerase chain reaction

    PubMed Central

    Riggio, M; Gibson, J; Lennon, A; Wray, D; MacDonald, D

    1997-01-01

    Background—Although intestinal Crohn's disease has long been suspected to have a mycobacterial cause, possible mycobacterial involvement in orofacial granulomatosis (OFG) and oral lesions of Crohn's disease has not yet been investigated.
Aims—As the slow growing Mycobacterium paratuberculosis has been implicated in the aetiology of intestinal Crohn's disease, the potential involvement of this mycobacterial species in OFG and oral lesions of Crohn's disease was investigated.
Patients—To attempt detection of the organism in OFG and oral Crohn's disease tissue samples, a polymerase chain reaction (PCR) assay was used on archival formalin fixed, paraffin wax embedded oral tissue sections from 30 patients with OFG, seven with Crohn's disease, and 12 normal controls.
Methods—The PCR assay used was based on primers targeting the 5' region of the multicopy IS900 DNA insertion element of the M paratuberculosis genome. In order to achieve maximum sensitivity, two rounds of PCR were carried out and amplicons confirmed by Southern blot hybridisation to a digoxigenin labelled IS900 DNA probe.
Results—None of the OFG and oral lesions of Crohn's disease samples were positive for M paratuberculosis and all normal controls were also negative. 
Conclusions—These results suggest that M paratuberculosis may not be a major aetiological agent in OFG or oral Crohn's disease lesions, although the use of paraffin wax embedded tissue as opposed to fresh tissue as a sample source could underestimate the true prevalence of the organism. 

 Keywords: oral Crohn's disease; Mycobacterium paratuberculosis; orofacial granulomatosis; polymerase chain reaction PMID:9414972

  14. Differential diagnosis of fowlpox and infectious laryngotracheitis viruses in chicken diphtheritic manifestations by mono and duplex real-time polymerase chain reaction.

    PubMed

    Davidson, Irit; Raibstein, Israel; Altory, Amira

    2015-01-01

    Infectious laryngotracheitis virus (ILTV) and fowlpox virus (FPV) cause diphtheritic lesions in chicken tracheas and can simultaneously infect the same bird. A differential molecular diagnostic test, the duplex real-time polymerase chain reaction, is now reported using ILTV and FPV vaccine viruses and clinical samples from chickens, either uninfected or naturally infected with ILTV or FPV, or with both viruses. The dual virus amplification by real-time polymerase chain reaction was demonstrated to behave similarly to monoplex amplification, in spite of the fact that the real-time exponential amplification plots of the vaccine viruses were more illustrative than those of the clinical samples.

  15. Human Y-chromosome haplotyping by allele-specific polymerase chain reaction.

    PubMed

    Gayden, Tenzin; Regueiro, Maria; Martinez, Laisel; Cadenas, Alicia M; Herrera, Rene J

    2008-06-01

    We describe the application of allele-specific PCR (AS-PCR) for screening biallelic markers, including SNPs, within the nonrecombining region of the human Y-chromosome (NRY). The AS-PCR method is based on the concept that the perfectly annealed primer-template complex is more stable, and therefore, more efficiently amplified under the appropriate annealing temperature than the complex with a mismatched 3'-residue. Furthermore, a mismatched nucleotide at the primer's 3'-OH end provides for a poor extension substrate for Taq DNA polymerase, allowing for discrimination between the two alleles. This method has the dual advantage of amplification and detection of alleles in a single expeditious and inexpensive procedure. The amplification conditions of over 50 binary markers, mostly SNPs, that define the major Y-haplogroups as well as their derived lineages were optimized and are provided for the first time. In addition, artificial restriction sites were designed for those markers that are not selectively amplified by AS-PCR. Our results are consistent with allele designations derived from other techniques such as RFLP and direct sequencing of PCR products.

  16. Synthesis and SAR optimization of diketo acid pharmacophore for HCV NS5B polymerase inhibition

    PubMed Central

    Bhatt, Aaditya; Gurukumar, K. R.; Basu, Amartya; Patel, Maulik R.; Kaushik-Basu, Neerja; Talele, Tanaji T.

    2011-01-01

    Hepatitis C virus (HCV) NS5B polymerase is a key target for anti-HCV therapeutics development. Here we report the synthesis and biological evaluation of a new series of α,γ-diketo acids (DKAs) as NS5B polymerase inhibitors. We initiated structure-activity relationship (SAR) optimization around the furan moiety of compound 1a [IC50 = 21.8 μM] to achieve more active NS5B inhibitors. This yielded compound 3a [IC50 = 8.2 μM] bearing the 5-bromobenzofuran-2-yl moiety, the first promising lead compound of the series. Varying the furan moiety with thiophene, thiazole and indazole moieties resulted in compound 11a [IC50 = 7.5 μM] bearing 3-methylthiophen-2-yl moiety. Finally replacement of the thiophene ring with a bioisosteric phenyl ring further improved the inhibitory activity as seen in compounds 21a [IC50 = 5.2 μM] and 24a [IC50 = 2.4 μM]. Binding mode of compound 24a using glide docking within the active site of NS5B polymerase will form the basis for future SAR optimization. PMID:21893371

  17. Dispersion quality of amine functionalized multiwall carbon nanotubes plays critical roles in polymerase chain reaction enhancement

    NASA Astrophysics Data System (ADS)

    Yuce, Meral; Budak, Hikmet

    2014-12-01

    Impact of dispersion quality of NH2-MWCNTs (13-18 nm in diameter with a length between 1 and 12 µm, >99 % purity) in the amplification efficiency of a random DNA oligonucleotide library (96 bp) was investigated. Amplification yield in the presence of non-filtered NH2-MWCNT dispersion, filtered NH2-MWCNT dispersion and surface-attached NH2-MWCNTs was explored, and physical interactions between NH2-MWCNTs and major PCR reagents including DNA template, wild type Taq DNA polymerase enzyme and primers were determined using high resolution polyacrylamide gel electrophoresis, dynamic light scattering, UV-Vis-NIR spectroscopy and scanning electron microscopy techniques. The results revealed that presence of NH2-MWCNT dispersion which was sonicated, centrifuged and filtered, enhanced the total PCR efficiency up to 70 % while the presence of NH2-MWCNT only centrifuged after sonication, inhibited the reaction significantly at similar concentrations. Furthermore, the NH2-MWCNTs coupled covalently onto magnetic microspheres, contributed for the specificity enhancement whilst decreasing the amplification efficiency by 30 % at the maximum concentration, which suggests a removable enhancement system for sensitive applications. On the other hand, the relative hydrodynamic size distribution measurements displayed a clear difference between the filtered NH2 and non-filtered NH2-MWCNT water dispersions, which justifies the inhibition of the amplification by the non-filtered NH2-MWCNTs containing big agglomerates and bundles. Finally, we demonstrated that major PCR components adsorb onto the NH2-MWCNTs with diverse affinities, and maintain their functions after adsorption, which provides a good framework to further develop tunable NH2-MWCNT-carriers to be utilized in various nanobiotechnology and material science applications.

  18. New buffers to improve the quantitative real-time polymerase chain reaction.

    PubMed

    Ahmad, Ashraf; Ghasemi, Jahan

    2007-08-01

    Real-time PCR is a potent technique for nucleic acid quantification for research and diagnostic purposes, the wide dynamic range being one of the advantages over other techniques like the microarray. Several additives and enhancers have been studied to expand the PCR dynamic range in order to be more efficient in quantifying low quantities of nucleic acids, increase the yield and improve reaction efficiency. Shown here is that a combination of new buffers with the regularly used Tris buffer makes it possible to expand the real-time PCR dynamic range and to improve the efficiency and correlation coefficient. Mixing HEPES, TEA or MOPS with Tris was more efficient than Tris alone. It was also found that, if the pH value of the Tris buffer was calibrated with phosphoric acid instead of hydrochloric acid, then the dynamic range was significantly improved and low quantities could be detected and quantified more efficiently. Mixing more than one compound with the Tris buffer was also effective for expanding the dynamic range and increasing the efficiency and correlation coefficient in quantitative real-time PCR.

  19. Kinetic Induction of Oat Shoot Pulvinus Invertase mRNA by Gravistimulation and Partial cDNA Cloning by the Polymerase Chain Reaction

    NASA Technical Reports Server (NTRS)

    Wu, Liu-Lai; Song, Il; Karuppiah, Nadarajah; Kaufman, Peter B.

    1993-01-01

    An asymmetric (top vs. bottom halves of pulvini) induction of invertase mRNA by gravistimulation was analyzed in oat shoot pulvini. Total RNA and poly(A)(+) RNA, isolated from oat pulvini, and two oli-gonucleotide primers, corresponding to two conserved amino acid sequences (NDPNG and WECPD) found in invertase from other species, were used for the polymerase chain reaction (PCR). A partial length cDNA (550 bp) was obtained and characterized. A 62% nucleotide sequence homology and 58% deduced amino acid sequence homology, as compared to beta-fructosidase of carrot cell wall, was found. Northern blot analysis showed that there was an obviously transient induction of invertase mRNA by gravistimulation in the oat pulvinus system. The mRNA was rapidly induced to a maximum level at 1 hour after gravistimulation treatment and gradually decreased afterwards. The mRNA level in the bottom half of the oat pulvinus was significantly higher than that in the top half of the pulvinus tissue. The kinetic induction of invertase mRNA was consistent with the transient accumulation of invertase activity during the graviresponse of the pulvinus. This indicates that the expression of the invertase gene(s) could be regulated by gravistimulation at the transcriptional level. Southern blot analysis showed that there were two to three genomic DNA fragments which hybridized with the partial-length invertase cDNA.

  20. Determination of integron frequency by a polymerase chain reaction-restriction fragment length polymorphism method in multidrug-resistant Escherichia coli, which causes urinary tract infections.

    PubMed

    Fallah, Fatemeh; Karimi, Abdollah; Goudarzi, Mehdi; Shiva, Farideh; Navidinia, Masoumeh; Jahromi, Mana Hadipour; Sajadi Nia, Raheleh Sadat

    2012-12-01

    The purpose of this study was to determine the presence of integrons in Escherichia coli, which cause urinary tract infections, and to define the association between integrons and antimicrobial susceptibility. Susceptibility of 200 isolates from urine samples of patients suffering from urinary tract infections to 13 antibiotics was determined by the Kirby-Bauer disk diffusion method. The existence of class1 and 2 integrons in resistant isolates was assessed by polymerase chain reaction-restriction fragment length polymorphism and sequencing. Antibiotic resistance patterns were observed as follows: amoxicillin 78%, tetracycline 76.1%, co-trimoxazole 67.7%, cephalotin 60%, nalidixic acid 57.4%, chloramphenicol 49%, gentamicin 46.4%, ceftazidim 38.1%, ciprofloxacin 36.2%, nitrofurantoin 33.5%, amikacin 32.1%, norfloxacin 36.1%, and imipenem 27.1%. Of 200 isolates, 155 (77.5%) were multidrug resistant (MDR). The existence of integrons was confirmed in 50.3% of isolates. Three class 1 integron types, aadA2 being the most frequently found, and four class 2 integron types are described. Significant association between resistance to gentamicin, co-trimoxazole, cephalotin, ceftazidim, imipenem, chloramphenicol, and nalidixic acid with the existence of integrons was observed. Multidrug resistance suggests that the strategy for treatment of patients with E.coli infections needs to be revised. Furthermore, it was shown that integrons may be partly responsible for multidrug resistance. Imipenem and norfloxacin were the most effective antibiotics against isolates.

  1. Variation in Bluetongue virus real-time reverse transcription polymerase chain reaction assay results in blood samples of sheep, cattle, and alpaca.

    PubMed

    Brito, Barbara P; Gardner, Ian A; Hietala, Sharon K; Crossley, Beate M

    2011-07-01

    Bluetongue is a vector-borne viral disease that affects domestic and wild ruminants. The epidemiology of this disease has recently changed, with occurrence in new geographic areas. Various real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) assays are used to detect Bluetongue virus (BTV); however, the impact of biologic differences between New World camelids and domestic ruminant samples on PCR efficiency, for which the BTV real-time qRT-PCR was initially validated are unknown. New world camelids are known to have important biologic differences in whole blood composition, including hemoglobin concentration, which can alter PCR performance. In the present study, sheep, cattle, and alpaca blood were spiked with BTV serotypes 10, 11, 13, and 17 and analyzed in 10-fold dilutions by real-time qRT-PCR to determine if species affected nucleic acid recovery and assay performance. A separate experiment was performed using spiked alpaca blood subsequently diluted in 10-fold series in sheep blood to assess the influence of alpaca blood on performance efficiency of the BTV real-time qRT-PCR assay. Results showed that BTV-specific nucleic acid detection from alpaca blood was consistently 1-2 logs lower than from sheep and cattle blood, and results were similar for each of the 4 BTV serotypes analyzed.

  2. Cloning of a gene encoding a lupus-associated human autoantibody VK region using the polymerase chain reaction and degenerate primers.

    PubMed

    Chastagner, P; Thèze, J; Zouali, M

    1991-05-30

    The variable light-chain-encoding gene of a human autoantibody secreted by a B-cell hybridoma derived from a patient with systemic lupus erythematosus was amplified using the polymerase chain reaction and degenerate primers. After cloning, the nucleotide sequence of the EcoRI-HindIII region was determined. It is highly homologous to a previously described gene expressed by a human lymphoid cell line.

  3. Statistical Models for the Analysis and Design of Digital Polymerase Chain Reaction (dPCR) Experiments.

    PubMed

    Dorazio, Robert M; Hunter, Margaret E

    2015-11-03

    Statistical methods for the analysis and design of experiments using digital PCR (dPCR) have received only limited attention and have been misused in many instances. To address this issue and to provide a more general approach to the analysis of dPCR data, we describe a class of statistical models for the analysis and design of experiments that require quantification of nucleic acids. These models are mathematically equivalent to generalized linear models of binomial responses that include a complementary, log-log link function and an offset that is dependent on the dPCR partition volume. These models are both versatile and easy to fit using conventional statistical software. Covariates can be used to specify different sources of variation in nucleic acid concentration, and a model's parameters can be used to quantify the effects of these covariates. For purposes of illustration, we analyzed dPCR data from different types of experiments, including serial dilution, evaluation of copy number variation, and quantification of gene expression. We also showed how these models can be used to help design dPCR experiments, as in selection of sample sizes needed to achieve desired levels of precision in estimates of nucleic acid concentration or to detect differences in concentration among treatments with prescribed levels of statistical power.

  4. Statistical models for the analysis and design of digital polymerase chain (dPCR) experiments

    USGS Publications Warehouse

    Dorazio, Robert; Hunter, Margaret

    2015-01-01

    Statistical methods for the analysis and design of experiments using digital PCR (dPCR) have received only limited attention and have been misused in many instances. To address this issue and to provide a more general approach to the analysis of dPCR data, we describe a class of statistical models for the analysis and design of experiments that require quantification of nucleic acids. These models are mathematically equivalent to generalized linear models of binomial responses that include a complementary, log–log link function and an offset that is dependent on the dPCR partition volume. These models are both versatile and easy to fit using conventional statistical software. Covariates can be used to specify different sources of variation in nucleic acid concentration, and a model’s parameters can be used to quantify the effects of these covariates. For purposes of illustration, we analyzed dPCR data from different types of experiments, including serial dilution, evaluation of copy number variation, and quantification of gene expression. We also showed how these models can be used to help design dPCR experiments, as in selection of sample sizes needed to achieve desired levels of precision in estimates of nucleic acid concentration or to detect differences in concentration among treatments with prescribed levels of statistical power.

  5. VHH phage-based competitive real-time immuno-polymerase chain reaction for ultrasensitive detection of ochratoxin A in cereal.

    PubMed

    Liu, Xing; Xu, Yang; Xiong, Yong-hua; Tu, Zhui; Li, Yan-ping; He, Zhen-yun; Qiu, Yu-lou; Fu, Jin-heng; Gee, Shirley J; Hammock, Bruce D

    2014-08-05

    Phage display-mediated immuno-polymerase chain reaction (PD-IPCR) is an ultrasensitive detection technology that combines the advantages of immuno-PCR and phage display. The phage particle, which displayed antibody fragments including single-chain fragment variable (scFv), variable domain of heavy-chain antibodies (VHH), and antigen-binding fragment (Fab) on the surface can be directly used in IPCR, supplying both the detection antibody and deoxyribonucleic acid (DNA) template. In this work, we used ochratoxin A (OTA) as a model system to study the capacity of PD-IPCR in the detection of toxic small molecular weight compounds, especially mycotoxins. An alpaca-derived VHH library was constructed and subjected to four cycles of panning. In total, 16 clones with four unique sequences were selected by competitive binding with OTA. The clone VHH-28 resulted in the lowest 50% inhibitory concentration of 0.31 ng/mL in the phage enzyme-linked immunosorbent assay (ELISA) and was selected to develop the VHH phage-based real-time immuno-PCR (RT-IPCR). The detection limit of the VHH phage-based RT-IPCR was 3.7 pg/L, with a linear range of 0.01-1000 pg/mL. This method was compared with conventional ELISA, and validation results indicated the reliability of VHH phage-based RT-IPCR in the detection of OTA in cereal samples. This study provides a new idea for the ultrasensitive detection of mycotoxins and other toxic small molecular weight compounds.

  6. Biosynthesis of cyclopropyl long-chain fatty acids from cyclopropanecarboxylic acid by mammalian tissues in vitro

    PubMed Central

    Duncombe, W. G.; Rising, T. J.

    1968-01-01

    1. Radioactivity from cyclopropane[14C]carboxylic acid is incorporated into fatty acids in vitro by rat and guinea-pig adipose tissue, by rat liver slices and by the supernatant fraction of rat liver homogenate. 2. The labelled acids are different from endogenous straight-chain fatty acids, and evidence is produced that they consist of a cyclopropyl ring in the ω-position, the remainder of the chain being built up from C2 units (not derived from cyclopropanecarboxylic acid) in the normal way via the malonate pathway. 3. It is suggested that these unnatural acids have some metabolic effect related to the hypoglycaemic action of cyclopropanecarboxylic acid. PMID:5685874

  7. Improved zeolite regeneration processes for preparing saturated branched-chain fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ferrierite zeolite solid is an excellent catalyst for the skeletal isomerization of unsaturated linear-chain fatty acids (i.e., oleic acid) to unsaturated branched-chain fatty acids (i.e., iso-oleic acid) follow by hydrogenation to give saturated branched-chain fatty acids (i.e., isostearic acid). ...

  8. The Molecular Characterization of Intestinal Explant HIV Infection Using Polymerase Chain Reaction-Based Techniques

    PubMed Central

    Janocko, Laura; Althouse, Andrew D.; Brand, Rhonda M.; Cranston, Ross D.

    2015-01-01

    Abstract The ex vivo mucosal explant model is frequently used to test the efficacy of microbicides that have the potential for preventing HIV-1 transmission. The conventional assessment of product efficacy has been the extent of HIV-1 p24 suppression in supernatant fluids sampled up to day 14 after HIV-1 challenge ex vivo. The purpose of this study was to determine if measurement of HIV-1 nucleic acids by real-time PCR and HIV-1 integration by Alu-gag PCR provides advantages with regard to monitoring HIV-1 infection in explants. Rectal biopsies from HIV-1-negative individuals were challenged with 1 × 105 virions/ml of HIV-1BaL or HIV-1CH077 ex vivo. HIV-1 RNA and HIV-1 p24 in supernatant fluids and HIV-1 nucleic acids and integrated provirus in individual biopsies were measured at days 1–14 after infection. HIV-1 RNA and proviral DNA were measured by quantitative real-time PCR (qRT-PCR) while integrated virus was detected by Alu-gag PCR. Real-time PCR assays detecting HIV-1 DNA and RNA performed similarly provided that the infecting virus sequences were a good match with the sequences of the assay primers and probes. Increased HIV-1 nucleic acid levels and DNA integration were measurable on days 11 and 14 after infection. The magnitude of explant infection was similar after challenge with HIV-1BaL and HIV-1CH077, although the trajectory of infection was delayed in the HIV-1CH077-infected biopsies. In the majority of experiments, qRT-PCR did not appreciably shorten the time necessary to detect evidence of HIV-1 infection. PMID:26214703

  9. Detection of clonality by polymerase chain reaction in childhood B-lineage acute lymphoblastic leukemia.

    PubMed

    Januszkiewicz, D A; Nowak, J S

    1994-09-01

    DNA-based PCR with various sets of primers for TCR gamma/delta, and Ig heavy chain (IgH) genes were used to study clonality in childhood B-lineage acute lymphoblastic leukemia. Amplification of the IgH CDR-III was observed in 75 of 120 analyzed cases (62.5%). From all analyzed groups, the IgH gene rearrangement was most often observed in pre-B ALL (85.7%) and was rather rare in null-ALL (34.5%). TCR delta gene rearrangement was the most common, and was observed in 77 patients (64.2%). The typical pattern of rearrangements was defined as an incomplete V delta 2 to D delta 3, V delta 2 to D delta 2, or D delta 3 to D delta 2 recombination product. Rearrangements of TCR gamma gene we observed in 61 cases (50.8%). TCR gamma gene rearrangements were detected predominantly in null-ALL and early B-ALL (55.2% and 60%, respectively) and were rather rare in other groups. Of all eight V segments of V gamma I group, the most frequent gene usage concerns regions V gamma 2, V gamma 4, and psi V gamma 7. We have confirmed that IgH gene amplification, together with TCR gamma and delta gene amplification, provides a rapid, sensitive approach to assessing clonality in ALL almost in 100% of cases.

  10. A Capsid Gene-Based Real-Time Reverse Transcription Polymerase Chain Reaction Assay for the Detection of Marine Vesiviruses in the Caliciviridae

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A real-time reverse transcription polymerase chain reaction (rtRT-PCR) assay was developed for the identification of marine vesiviruses. The primers were designed to target a 176-nucleotide fragment within a highly conserved region of the San Miguel sea lion viruses (SMSVs) capsid gene. The assay de...

  11. Evaluation of a real-time polymerase chain reaction assay of the outer membrane protein P2 gene for the detection of Haemophilus parasuis in clinical samples

    PubMed Central

    McDowall, Rebeccah; Slavic, Durda; MacInnes, Janet I.; Cai, Hugh Y.

    2014-01-01

    A real-time polymerase chain reaction (PCR) assay of the outer membrane protein (OMP) P2 gene was developed and used to test 97 putative Haemophilus parasuis pure cultures and 175 clinical tissue samples. With standard culture isolation as the gold standard, the diagnostic sensitivity and specificity of the PCR assay were determined to be 83% and 80%, respectively. PMID:24688178

  12. Optimized nested polymerase chain reaction for antemortem detection of Mycobacteria in Amazon parrots (Amazona aestiva) and orange-winged Amazons (Amazona amazonica).

    PubMed

    Baquião, Arianne Costa; Luna, Janaina Oliveira; Medina, Aziz Orro; Sanfilippo, Luiz Francisco; de Faria, Maria Jacinta; dos Santos, Manuel Armando Azevedo

    2014-03-01

    The objectives of this study were to optimize nested polymerase chain reaction (PCR) for Mycobacterium avium complex and Mycobacterium tuberculosis complex and apply them on samples from parrots. Results were negative for the presence of these Mycobacterium in the samples, and nested PCR was specific, faster, and more sensitive than other tests, thereby justifying its use in antemortem diagnosis.

  13. Quantitative real-time polymerase chain reaction improves conventional microbiological diagnosis in an outbreak of brucellosis due to ingestion of unpasteurized goat cheese.

    PubMed

    Colmenero, Juan D; Clavijo, Encarnación; Morata, Pilar; Bravo, María J; Queipo-Ortuño, María I

    2011-11-01

    Rapid diagnosis of individuals involved in brucellosis outbreaks can sometimes be difficult with conventional microbiological techniques. We analyzed, for the first time, the diagnostic yield of a real-time polymerase chain reaction (PCR) assay in a family outbreak of brucellosis due to consumption of unpasteurized goat cheese. PCR correctly identified all symptomatic cases.

  14. Comparison of Enterococcus quantitative polymerase chain reaction analysis results from midwest U.S. river samples using EPA Method 1611 and Method 1609 PCR reagents

    EPA Science Inventory

    The U.S. Environmental Protection Agency (EPA) has provided recommended beach advisory values in its 2012 recreational water quality criteria (RWQC) for states wishing to use quantitative polymerase chain reaction (qPCR) for the monitoring of Enterococcus fecal indicator bacteria...

  15. Introduction of rapid methicillin-resistant Staphylococcus aureus polymerase chain reaction testing and antibiotic selection among hospitalized patients with purulent skin infections.

    PubMed

    Terp, Sophie; Krishnadasan, Anusha; Bowen, William; Joo, Julianne; Furoy, Daniel; Chan, Joseph; Moran, Gregory; Talan, David

    2014-04-01

    Introduction of a rapid methicillin-resistant Staphylococcus aureus (MRSA) polymerase chain reaction assay, with physician education and pharmacist guidance, did not significantly reduce excessive empiric prescription of MRSA-active antibiotics despite the test's accuracy and potential to substantially reduce inappropriate antibiotic use.

  16. Rapid Differentiation and Identification of Potential Severe Strains of Citrus tristeza Virus by Real-Time Reverse Transcription Polymerase Chain Reaction Assays

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A multiplex Taqman®-based real-time reverse transcription (RT) polymerase chain reaction (PCR) assay was developed to detect all strains of Citrus tristeza virus (CTV) and to identify potentially severe strains of the virus. A CTV TaqMan probe (CTV-CY5) based on the coat protein (CP) gene sequences...

  17. Use of polymerase chain reaction in detection of Marek’s disease and reticuloendotheliosis viruses in formalin-fixed, paraffin-embedded tumorous tissues

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A simple polymerase chain reaction (PCR) method was developed for the diagnosis of Marek’s disease (MD) and reticuloendotheliosis (RE) in formalin-fixed paraffin-embedded (FFPE) tissues; and for the diagnosis of MD in tissues only preserved in 10% neutral buffered formalin. MD virus (MDV) and RE vi...

  18. A real time polymerase chain reaction assay for quantification of Edwardsiella ictaluri in catfish pond water and genetic homogeneity of diagnostic case isolates from Mississippi

    Technology Transfer Automated Retrieval System (TEKTRAN)

    A quantitative polymerase chain reaction (qPCR) assay was developed for the detection and quantification of Edwardsiella ictaluri in channel catfish Ictalurus punctatus pond water using modifications to a published E. ictaluri–specific qPCR assay and previously established protocols for the molecula...

  19. Comparison of automated BAX polymerase chain reaction and standard culture methods for detection of Listeria monocyogenes in blue crab meat (Callinectus sapidus) and blue crab processing plants

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This study compared the BAX Polymerase Chain Reaction method (BAX PCR) with the Standard Culture Method (SCM) for detection of L. monocytogenes in blue crab meat and crab processing plants. The aim of this study was to address this data gap. Raw crabs, finished products and environmental sponge samp...

  20. Deconstructing the polymerase chain reaction: understanding and correcting bias associated with primer degeneracies and primer-template mismatches.

    PubMed

    Green, Stefan J; Venkatramanan, Raghavee; Naqib, Ankur

    2015-01-01

    The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3-12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled "Polymerase-exonuclease (PEX) PCR", in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3' end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and

  1. Deoxyribonucleic Acid Polymerase of Rous Sarcoma Virus: Reaction Conditions and Analysis of the Reaction Product Nucleic Acids

    PubMed Central

    Bishop, D. H. L.; Ruprecht, Ruth; Simpson, R. W.; Spiegelman, S.

    1971-01-01

    Reaction conditions for Rous sarcoma virus ribonucleic acid (RNA)-instructed deoxyribonucleic acid (DNA) polymerase activity are described whereby the viral RNA is relatively protected from endogenous or added nuclease activity. Three analyses of reaction product nucleic acids (3H-RNA, 32P-DNA) were compared, namely, gel electrophoresis, Cs2SO4 gradient centrifugation, and hydroxyapatite column chromatography. It was found that hydroxyapatite analysis could be misleading unless the state of the template RNA was monitored concomitantly with the DNA analysis. Gel electrophoresis and Cs2SO4 gradient centrifugation gave comparable results. It was concluded that analyses of the product of reverse transcriptase reactions should not only refer to the template RNA and product DNA species, but also be performed with virus or viral RNA which do not have or obtain nicks in the 60S RNA. Otherwise, interpretation of the results would have the ambiguity of potential artifacts caused by those degraded RNA molecules. PMID:4332143

  2. Bioavailability of long-chain omega-3 fatty acids.

    PubMed

    Schuchardt, Jan Philipp; Hahn, Andreas

    2013-07-01

    Supplements have reached a prominent role in improving the supply of long-chain omega-3 fatty acids, such as Eicosapentaenoic acid (EPA 20:5n-3) and Docosahexaenoic acid (DHA 22:6n-3). Similar to other nutrients, the availability of omega-3 fatty acids is highly variable and determined by numerous factors. However, the question of omega-3 fatty acids bioavailability has long been disregarded, which may have contributed to the neutral or negative results concerning their effects in several studies. This review provides an overview of the influence of chemical binding form (free fatty acids bound in ethylesters, triacylglycerides or phospholipids), matrix effects (capsule ingestion with concomitant intake of food, fat content in food) or galenic form (i.e. microencapsulation, emulsification) on the bioavailability of omega-3 fatty acids. There is a need to systematically investigate the bioavailability of omega-3 fatty acids formulations, which might be a key to designing more effective studies in the future.

  3. Evaluation of a novel real-time fluorescent polymerase chain reaction assay for high-risk human papilloma virus DNA genotypes in cytological cervical screening

    PubMed Central

    CHENG, JIAOYING; BIAN, MEILU; CONG, XIAO; SUN, AIPING; LI, MIN; MA, LI; CHEN, YING; LIU, JUN

    2013-01-01

    It has been confirmed that detection of high-risk human papillomavirus (HR HPV) DNA is useful in cervical cancer (CC) screening. Recently, a new real-time fluorescent polymerase chain reaction (PCR) assay was developed to detect HR HPV. This assay can synchronize nucleic acid amplification and testing using specific primers for 13 types of HR HPV genomes, combined with specific TaqMan fluorescent marker probe techniques through the fluorescence automatic PCR instrument. Furthermore, it uses TaqGold™ DNA polymerase, which minimizes the amount of non-specific amplification and increases the sensitivity of the assay. The aim of this study was to evaluate the analytical and clinical performance of the real-time fluorescent PCR assay in CC screening, compared to the Qiagen Hybrid Capture® II High-Risk HPV DNA test® (HC II). In total, 1,252 cervical specimens were collected from women between 19 and 71 years of age. The specimens were examined with three different assays, real-time fluorescent PCR assay and HC II for HR HPV detection combined with liquid-based cytology. Women with cytological abnormalities or HR HPV-positive results underwent colposcopy and cervical biopsy. This study demonstrated good overall agreement between HC II and real-time fluorescent PCR assay (overall agreement, 92.25%; Cohen’s κ=0.814). For the detection of high-grade cervical intraepithelial neoplasias (CIN) and CC, the sensitivity of HC II and real-time fluorescent PCR was 94.48 and 92.82%, respectively, and the negative predictive value was 98.85 and 98.54%, respectively. High HR HPV infection rate of the high-grade CIN and CC group was detected (P<0.05). In conclusion, real-time fluorescent PCR assay provides similar results compared to the HC II test for HR HPV detection and could be used in CC screening in clinic. PMID:24648936

  4. New Developments in Quantitative Real-time Polymerase Chain Reaction Technology.

    PubMed

    Gadkar, Vija yJ; Filion, Martin

    2014-01-01

    Real time-quantitative PCR (RT-qPCR) technology has revolutionized the detection landscape in every area of molecular biology. The fundamental basis of this technology has remained unchanged since its inception, however various modifications have enhanced the overall performance of this highly versatile technology. These improvements have ranged from changes in the individual components of the enzymatic reaction cocktail (polymerizing enzymes, reaction buffers, probes, etc.) to the detection system itself (instrumentation, software, etc.). The RT-qPCR technology currently available to researchers is more sensitive, faster and affordable than when this technology was first introduced. In this article, we summarize the developments of the last few years in RT-qPCR technology and nucleic acid amplification.

  5. Optimization of the elution buffer and concentration method for detecting hepatitis E virus in swine liver using a nested reverse transcription-polymerase chain reaction and real-time reverse transcription-polymerase chain reaction.

    PubMed

    Son, Na Ry; Seo, Dong Joo; Lee, Min Hwa; Seo, Sheungwoo; Wang, Xiaoyu; Lee, Bog-Hieu; Lee, Jeong-Su; Joo, In-Sun; Hwang, In-Gyun; Choi, Changsun

    2014-09-01

    The aim of this study was to develop an optimal technique for detecting hepatitis E virus (HEV) in swine livers. Here, three elution buffers and two concentration methods were compared with respect to enhancing recovery of HEV from swine liver samples. Real-time reverse transcription-polymerase chain reaction (RT-PCR) and nested RT-PCR were performed to detect HEV RNA. When phosphate-buffered saline (PBS, pH 7.4) was used to concentrate HEV in swine liver samples using ultrafiltration, real-time RT-PCR detected HEV in 6 of the 26 samples. When threonine buffer was used to concentrate HEV using polyethylene glycol (PEG) precipitation and ultrafiltration, real-time RT-PCR detected HEV in 1 and 3 of the 26 samples, respectively. When glycine buffer was used to concentrate HEV using ultrafiltration and PEG precipitation, real-time RT-PCR detected HEV in 1 and 3 samples of the 26 samples, respectively. When nested RT-PCR was used to detect HEV, all samples tested negative regardless of the type of elution buffer or concentration method used. Therefore, the combination of real-time RT-PCR and ultrafiltration with PBS buffer was the most sensitive and reliable method for detecting HEV in swine livers.

  6. Sensitivity of polymerase chain reaction for detection of bovine viral diarrhea virus in pooled serum samples and use of pooled polymerase chain reaction to determine prevalence of bovine viral diarrhea virus in auction market cattle.

    PubMed

    Smith, Rebecca L; Sanderson, Michael W; Walz, Paul H; Givens, M Daniel

    2008-01-01

    Two reverse transcription-nested polymerase chain reaction tests, 1 quantitative (qRT-nPCR) and 1 standard (RT-nPCR), were evaluated to assess sensitivity for detection of bovine viral diarrhea virus (BVDV) of a single positive serum sample in a pool of 30. The RT-nPCR and qRT-nPCR each detected 95 of 100 known positives. The RT-nPCR was used to estimate the prevalence of BVDV in adult beef cows. Serum samples were obtained from the US Department of Agriculture brucellosis testing laboratories in 3 Midwestern states. Samples originated from auction markets and private treaty sales throughout the 3 states. A total of 2,990 serum samples were collected and randomly pooled into 100 pools for testing. Two of the 100 pools of field samples were positive, and each positive pool had a single positive individual sample upon confirmation. The estimate of BVDV prevalence in adult cows in this study was 0.07%. This study estimates the diagnostic sensitivity of RT-nPCR for BVDV and confirms that it is a useful diagnostic tool for pools of 30 serum samples and that prevalence of BVDV in adult cattle from auction markets is low.

  7. Performance of robust regression methods in real-time polymerase chain reaction calibration.

    PubMed

    Orenti, Annalisa; Marubini, Ettore

    2014-12-09

    The ordinary least squares (OLS) method is routinely used to estimate the unknown concentration of nucleic acids in a given solution by means of calibration. However, when outliers are present it could appear sensible to resort to robust regression methods. We analyzed data from an External Quality Control program concerning quantitative real-time PCR and we found that 24 laboratories out of 40 presented outliers, which occurred most frequently at the lowest concentrations. In this article we investigated and compared the performance of the OLS method, the least absolute deviation (LAD) method, and the biweight MM-estimator in real-time PCR calibration via a Monte Carlo simulation. Outliers were introduced by replacement contamination. When contamination was absent the coverages of OLS and MM-estimator intervals were acceptable and their widths small, whereas LAD intervals had acceptable coverages at the expense of higher widths. In the presence of contamination we observed a trade-off between width and coverage: the OLS performance got worse, the MM-estimator intervals widths remained short (but this was associated with a reduction in coverages), while LAD intervals widths were constantly larger with acceptable coverages at the nominal level.

  8. A universal polymerase chain reaction for the detection of psittacine beak and feather disease virus.

    PubMed

    Ypelaar, I; Bassami, M R; Wilcox, G E; Raidal, S R

    1999-08-16

    A universal PCR assay was designed that consistently detected psittacine beak and feather disease virus (BFDV) in psittacine birds affected with psittacine beak and feather disease (PBFD) from different geographic regions across Australia. Primers within open reading frame 1 (ORF1) of the BFDV genome consistently amplified a 717 bp product from blood and/or feathers of 32 birds with PBFD lesions. The PCR did not amplify a product from the feathers or blood from 7 clinically normal psittacine birds. Primers based on regions outside of ORF1 did not consistently produce a PCR product, suggesting there was some genomic variation outside ORF1. The amplified ORF1 PCR products of 10 BFDV isolates, from different psittacine species and from various regions around Australia, were cloned and comparative DNA sequence analysis demonstrated 88-99% of the ORF1 fragments. The derived amino acid sequences of the amplified ORF1 fragments demonstrated similar identity between all 10 isolates. Within ORF1, there was complete conservation of the putative nucleotide binding site and marked conservation of 2 other motifs previously identified as essential components of the replication-associated proteins of other circoviruses and geminiviruses.

  9. On-chip real-time single-copy polymerase chain reaction in picoliter droplets

    SciTech Connect

    Beer, N R; Hindson, B; Wheeler, E; Hall, S B; Rose, K A; Kennedy, I; Colston, B

    2007-04-20

    The first lab-on-chip system for picoliter droplet generation and PCR amplification with real-time fluorescence detection has performed PCR in isolated droplets at volumes 10{sup 6} smaller than commercial real-time PCR systems. The system utilized a shearing T-junction in a silicon device to generate a stream of monodisperse picoliter droplets that were isolated from the microfluidic channel walls and each other by the oil phase carrier. An off-chip valving system stopped the droplets on-chip, allowing them to be thermal cycled through the PCR protocol without droplet motion. With this system a 10-pL droplet, encapsulating less than one copy of viral genomic DNA through Poisson statistics, showed real-time PCR amplification curves with a cycle threshold of {approx}18, twenty cycles earlier than commercial instruments. This combination of the established real-time PCR assay with digital microfluidics is ideal for isolating single-copy nucleic acids in a complex environment.

  10. Gibberellic Acid Activates Chromatin-bound DNA-dependent RNA Polymerase in Wounded Potato Tuber Tissue 1

    PubMed Central

    Wielgat, Bernard; Kahl, Günter

    1979-01-01

    Chromatin-bound DNA-dependent RNA polymerases react upon wounding of white potato tuber tissues with an increase in activity, which is additionally enhanced to 300% in the presence of 0.1 micromolar gibberellic acid (GA3). 2,4-Dichlorophenoxyacetic acid is only weakly effective and indoleacetic acid not at all. Wounding and treatment with GA3 affect template availability of chromatin only slightly. The hormone has no effect on chromatin-bound RNA polymerases, if added in vitro. The enzymes from intact, wounded, and hormone-treated tissues possess similar characteristics: their activity is dependent on the presence of all four ribonucleotides and a divalent cation such as Mg2+ or Mn2+. However, the sensitivity of the enzymes from different preparations toward α-amanitin differs. Total RNA polymerase activity of chromatin was inhibited by α-amanitin to about 44% in intact, to about 22% in wounded, and only 15% in GA3-treated tissues. The relative activities of polymerases I and II were estimated by varying the (NH4)2SO4 and α-amanitin concentrations in the assay system. It is evident that GA3 preferentially stimulates polymerase I and hence ribosomal RNA synthesis. RNA polymerase II is but slightly affected by GA3. Nearest neighbor frequency analysis revealed that the RNA synthesized by the enzymes from the intact tuber is different from that of wounded or GA3-treated tissues. PMID:16661071

  11. Regulation of the Nucleolar DNA-Dependent RNA Polymerase by Amino Acids in Ehrlich Ascites Tumor Cells

    PubMed Central

    Franze-Fernández, M. T.; Pogo, A. O.

    1971-01-01

    Experiments were performed to ascertain the degree to which the amount of amino acids might be one of the regulatory factors that control the activity of the nucleolar RNA polymerase. Assays of the enzymatic activity were done with isolated nuclei from cells incubated with low and high concentrations of amino acids. Soon after the cells were exposed to a medium enriched in amino acids, a rapid increase of nucleolar RNA polymerase activity occurred. A similar result was obtained in cells incubated with lower concentrations of amino acids. However, the rate of ribosomal RNA synthesized was regularly much higher in cells incubated in a medium enriched with amino acids than in a medium low in amino acids. Apparently, the amino acids only controlled ribosomal RNA synthesis. Thus, neither maturation, processing, and transport of nuclear precursors into cytoplasmic ribosomal RNA, nor the synthesis of rapidly labeled RNA was affected. PMID:4108870

  12. Eradication of polymerase chain reaction-detectable chronic lymphocytic leukemia cells is associated with improved outcome after bone marrow transplantation.

    PubMed

    Provan, D; Bartlett-Pandite, L; Zwicky, C; Neuberg, D; Maddocks, A; Corradini, P; Soiffer, R; Ritz, J; Nadler, L M; Gribben, J G

    1996-09-15

    In chronic lymphocytic leukemia (CLL), clonal rearrangement of the immunoglobulin heavy chain locus (IgH) provides a useful marker for the detection of minimal residual disease (MRD) after treatment. At the time of initial presentation, DNA from patients with CLL was polymerase chain reaction (PCR)-amplified using consensus Variable (VH) and Joining (JH) region primers using complementarity determining region III consensus region primers or a panel of VH family-specific framework region 1 (FR1) primers. The clonal product was directly sequenced and patient-specific probes constructed using N region nucleotide sequences. We amplified and sequenced the CDRIII region and designed patient specific oligonucleotide probes for the detection of MRD in 55 of 66 patients (84%, 90% Confidence Intervals (CI): 74% to 90%) with poor prognosis CLL referred for autologous and allogeneic bone marrow transplantation (BMT). To determine the clinical utility of this technique, PCR amplification was performed on patient samples at the time of and following autologous (21 patients) and allogeneic (10 patients) BMT in whom serial bone marrow samples obtained after BMT were available for analysis. We show that the persistence of MRD after BMT is associated with increased probability of relapse. In all cases that have relapsed to date, the IgH CDRII region was identical at the time of initial presentation and at relapse suggesting that clonal evolution of the IgH locus is unusual in this disease. The finding that a significant number of patients remain disease free and with no evidence of PCR-detectable MRD after BMT suggests that high-dose therapy may contribute to improved outcome in selected patients with CLL.

  13. Detection and quantification of Renibacterium salmoninarum DNA in salmonid tissues by real-time quantitative polymerase chain reaction analysis

    USGS Publications Warehouse

    Chase, D.M.; Elliott, D.G.; Pascho, R.J.

    2006-01-01

    Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.

  14. C-myc proto-oncogene amplification detected by polymerase chain reaction in archival human ovarian carcinomas.

    PubMed Central

    Schreiber, G.; Dubeau, L.

    1990-01-01

    Polymerase chain reaction (PCR) technology was used to examine the state of amplification of the proto-oncogene c-myc in archival ovarian carcinomas. Sequences from the c-myc gene and from a control gene were amplified simultaneously by PCR and the ratios of the two products measured. The results provided an accurate measurement of the relative number of copies of the two genes in each tumor genome if the control and test sequences amplified by PCR were of equal lengths. The results were not affected by the number of PCR cycles used. This technique should facilitate gene amplification studies in clinical medicine. Increased c-myc copy number was found in 17% of the 30 cases examined when a control from the same chromosome as c-myc was used, but in 37% of cases if a control from another chromosome was used. This underlines the importance of the genetic location of the selected control genes for such studies. Images Figure 2 PMID:2205100

  15. High-Throughput Multiplex Quantitative Polymerase Chain Reaction Method for Giardia lamblia and Cryptosporidium Species Detection in Stool Samples

    PubMed Central

    Nurminen, Noora; Juuti, Rosa; Oikarinen, Sami; Fan, Yue-Mei; Lehto, Kirsi-Maarit; Mangani, Charles; Maleta, Kenneth; Ashorn, Per; Hyöty, Heikki

    2015-01-01

    Giardia lamblia and Cryptosporidium species belong to a complex group of pathogens that cause diseases hampering development and socioeconomic improvements in the developing countries. Both pathogens are recognized as significant causes of diarrhea and nutritional disorders. However, further studies are needed to clarify the role of parasitic infections, especially asymptomatic infections in malnutrition and stunting. We developed a high-throughput multiplex quantitative polymerase chain reaction (qPCR) method for G. lamblia and Cryptosporidium spp. detection in stool samples. The sensitivity and specificity of the method were ensured by analyzing confirmed positive samples acquired from diagnostics laboratories and participating in an external quality control round. Its capability to detect asymptomatic G. lamblia and Cryptosporidium spp. infections was confirmed by analyzing stool samples collected from 44 asymptomatic 6-month-old infants living in an endemic region in Malawi. Of these, five samples were found to be positive for G. lamblia and two for Cryptosporidium spp. In conclusion, the developed method is suitable for large-scale studies evaluating the occurrence of G. lamblia and Cryptosporidium spp. in endemic regions and for clinical diagnostics of these infections. PMID:25918202

  16. A quantitative reverse transcriptase polymerase chain reaction-based assay to detect carcinoma cells in peripheral blood.

    PubMed Central

    Helfrich, W.; ten Poele, R.; Meersma, G. J.; Mulder, N. H.; de Vries, E. G.; de Leij, L.; Smit, E. F.

    1997-01-01

    The presence of tumour cells in the circulation may predict disease recurrence and metastasis. To improve on existing methods of cytological or immunocytological detection, we have developed a sensitive and quantitative technique for the detection of carcinoma cells in blood, using the reverse transcriptase polymerase chain reaction (RT-PCR) identifying transcripts of the pancarcinoma-associated tumour marker EGP-2 (KSA or 17-1A antigen). The amount of EGP2 mRNA was quantified using an internal recombinant competitor RNA standard with known concentration and which is both reversely transcribed and co-amplified in the same reaction, allowing for a reliable assessment of the initial amount of EGP2 mRNA in the sample. Calibration studies, seeding blood with MCF-7 breast carcinoma cells, showed that the assay can detect ten tumour cells among 1.0 x 10(6) leucocytes. The PCR assay revealed that normal bone marrow expresses low levels of EGP2 mRNA, although immunocytochemistry with the anti-EGP2 MAb MOC31 could not identify any positively stained cell. Analyses using this RT-PCR assay may prove to have applications to the assessment of circulating tumour cells in clinical samples. Images Figure 3 Figure 4 PMID:9218728

  17. Detection of HTLV-1 by polymerase chain reaction in situ hybridization in adult T-cell leukemia/lymphoma.

    PubMed

    Setoyama, M; Kerdel, F A; Elgart, G; Kanzaki, T; Byrnes, J J

    1998-03-01

    A method for nonradioactive polymerase chain reaction in situ hybridization was developed and used to determine the distribution of human T-lymphotropic virus type I (HTLV-I) proviral DNA in paraffin-embedded surgical specimens of adult T-cell leukemia/lymphoma (ATLL). As controls, we used biopsy samples of five cases of mycosis fungoides, cells of an HTLV-I-infected cell line (MT2), as well as HTLV-1-negative cells (YAS). We successfully detected the amplicon of the HTLV-1 tax sequence in the nuclei of the cutaneous infiltrating lymphoid cells in 90% (9/10) of ATLL cases. Studies also revealed the existence of HTLV-1 provirus DNA in nuclei of sweat gland epithelial cells and vascular endothelial cells as well as lymphoid cells in ATLL patients. Mycosis fungoides and YAS cells were negative for the HTLV-I tax sequence, but MT2 cells were strongly positive. The results indicated that this technique was more sensitive in detecting intracellular amplicons than was the previous in situ hybridization method. Through its use, we were able to easily determine the distribution of HTLV-I-positive cells among the various cells and tissues of paraffin-embedded archival materials.

  18. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    PubMed Central

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  19. Development of melting temperature-based SYBR Green I polymerase chain reaction methods for multiplex genetically modified organism detection.

    PubMed

    Hernández, Marta; Rodríguez-Lázaro, David; Esteve, Teresa; Prat, Salomé; Pla, Maria

    2003-12-15

    Commercialization of several genetically modified crops has been approved worldwide to date. Uniplex polymerase chain reaction (PCR)-based methods to identify these different insertion events have been developed, but their use in the analysis of all commercially available genetically modified organisms (GMOs) is becoming progressively insufficient. These methods require a large number of assays to detect all possible GMOs present in the sample and thereby the development of multiplex PCR systems using combined probes and primers targeted to sequences specific to various GMOs is needed for detection of this increasing number of GMOs. Here we report on the development of a multiplex real-time PCR suitable for multiple GMO identification, based on the intercalating dye SYBR Green I and the analysis of the melting curves of the amplified products. Using this method, different amplification products specific for Maximizer 176, Bt11, MON810, and GA21 maize and for GTS 40-3-2 soybean were obtained and identified by their specific Tm. We have combined amplification of these products in a number of multiplex reactions and show the suitability of the methods for identification of GMOs with a sensitivity of 0.1% in duplex reactions. The described methods offer an economic and simple alternative to real-time PCR systems based on sequence-specific probes (i.e., TaqMan chemistry). These methods can be used as selection tests and further optimized for uniplex GMO quantification.

  20. Collaborative ring trial of the papaya endogenous reference gene and its polymerase chain reaction assays for genetically modified organism analysis.

    PubMed

    Wei, Jiaojun; Li, Feiwu; Guo, Jinchao; Li, Xiang; Xu, Junfeng; Wu, Gang; Zhang, Dabing; Yang, Litao

    2013-11-27

    The papaya (Carica papaya L.) Chymopapain (CHY) gene has been reported as a suitable endogenous reference gene for genetically modified (GM) papaya detection in previous studies. Herein, we further validated the use of the CHY gene and its qualitative and quantitative polymerase chain reaction (PCR) assays through an interlaboratory collaborative ring trial. A total of 12 laboratories working on detection of genetically modified organisms participated in the ring trial and returned test results. Statistical analysis of the returned results confirmed the species specificity, low heterogeneity, and single-copy number of the CHY gene among different papaya varieties. The limit of detection of the CHY qualitative PCR assay was 0.1%, while the limit of quantification of the quantitative PCR assay was ∼25 copies of haploid papaya genome with acceptable PCR efficiency and linearity. The differences between the tested and true values of papaya content in 10 blind samples ranged from 0.84 to 6.58%. These results indicated that the CHY gene was suitable as an endogenous reference gene for the identification and quantification of GM papaya.

  1. Detection of nonauthorized genetically modified organisms using differential quantitative polymerase chain reaction: application to 35S in maize.

    PubMed

    Cankar, Katarina; Chauvensy-Ancel, Valérie; Fortabat, Marie-Noelle; Gruden, Kristina; Kobilinsky, André; Zel, Jana; Bertheau, Yves

    2008-05-15

    Detection of nonauthorized genetically modified organisms (GMOs) has always presented an analytical challenge because the complete sequence data needed to detect them are generally unavailable although sequence similarity to known GMOs can be expected. A new approach, differential quantitative polymerase chain reaction (PCR), for detection of nonauthorized GMOs is presented here. This method is based on the presence of several common elements (e.g., promoter, genes of interest) in different GMOs. A statistical model was developed to study the difference between the number of molecules of such a common sequence and the number of molecules identifying the approved GMO (as determined by border-fragment-based PCR) and the donor organism of the common sequence. When this difference differs statistically from zero, the presence of a nonauthorized GMO can be inferred. The interest and scope of such an approach were tested on a case study of different proportions of genetically modified maize events, with the P35S promoter as the Cauliflower Mosaic Virus common sequence. The presence of a nonauthorized GMO was successfully detected in the mixtures analyzed and in the presence of (donor organism of P35S promoter). This method could be easily transposed to other common GMO sequences and other species and is applicable to other detection areas such as microbiology.

  2. Quantitative fucK gene polymerase chain reaction on sputum and nasopharyngeal secretions to detect Haemophilus influenzae pneumonia.

    PubMed

    Abdeldaim, Guma M K; Strålin, Kristoffer; Olcén, Per; Blomberg, Jonas; Mölling, Paula; Herrmann, Björn

    2013-06-01

    A quantitative polymerase chain reaction (PCR) for the fucK gene was developed for specific detection of Haemophilus influenzae. The method was tested on sputum and nasopharyngeal aspirate (NPA) from 78 patients with community-acquired pneumonia (CAP). With a reference standard of sputum culture and/or serology against the patient's own nasopharyngeal isolate, H. influenzae etiology was detected in 20 patients. Compared with the reference standard, fucK PCR (using the detection limit 10(5) DNA copies/mL) on sputum and NPA showed a sensitivity of 95.0% (19/20) in both cases, and specificities of 87.9% (51/58) and 89.5% (52/58), respectively. In a receiver operating characteristic curve analysis, sputum fucK PCR was found to be significantly superior to sputum P6 PCR for detection of H. influenzae CAP. NPA fucK PCR was positive in 3 of 54 adult controls without respiratory symptoms. In conclusion, quantitative fucK real-time PCR provides a sensitive and specific identification of H. influenzae in respiratory secretions.

  3. Utility of polymerase chain reaction for analysis of antigen receptor rearrangement in staging and predicting prognosis in dogs with lymphoma.

    PubMed

    Lana, Susan E; Jackson, Tracey L; Burnett, Robert C; Morley, Paul S; Avery, Anne C

    2006-01-01

    In lymphoid neoplasia, molecular assays to confirm clonality rely on the fact that lymphoid cells normally contain DNA regions with unique sequences, resulting from recombination of the V, D, and J genes. The purpose of this study was to determine the utility of polymerase chain reaction (PCR) for antigen receptor rearrangements (PARR) for molecular staging and predicting prognosis in canine lymphoma. We hypothesized that the PARR assay would offer a sensitive method for detecting neoplastic cells in blood, and that the presence of such cells would be a negative prognostic finding compared with dogs with no detectable circulating tumor cells. Eighty-six patients with histologically or cytologically confirmed lymphoma were studied from initial diagnosis until death or euthanasia. All patients had PARR assays of a representative tumor-infiltrated lymph node and peripheral whole blood. Sixty-two patients had clonal rearrangements detected in the lymph node and were able to be staged by PARR. Seventeen patients (27%) had no detectable tumor in their blood and 45 (73%) were blood positive. Our findings showed that (1) PARR correlated with clinical stage in that the PARR assay was more likely to detect tumor cells in blood in stage 5 lymphomas, (2) PARR was more sensitive for detecting circulating tumor cells than visual assessment of blood or bone marrow because 80% of stage 3 lymphomas were blood-PARR-positive, and (3) PCR stage was not prognostic for disease-free interval (DFI) or survival.

  4. Polymerase Chain Reaction Detection of Leishmania kDNA from the Urine of Peruvian Patients with Cutaneous and Mucocutaneous Leishmaniasis

    PubMed Central

    Veland, Nicolas; Espinosa, Diego; Valencia, Braulio Mark; Ramos, Ana Pilar; Calderon, Flor; Arevalo, Jorge; Low, Donald E.; Llanos-Cuentas, Alejandro; Boggild, Andrea K.

    2011-01-01

    We hypothesized that Leishmania kDNA may be present in urine of patients with cutaneous leishmaniasis (CL). Urine samples and standard diagnostic specimens were collected from patients with skin lesions. kDNA polymerase chain reaction (PCR) was performed on samples from patients and 10 healthy volunteers from non-endemic areas. Eighty-six of 108 patients were diagnosed with CL and 18 (21%) had detectable Leishmania Viannia kDNA in the urine. Sensitivity and specificity were 20.9% (95% confidence interval [CI] 12.3–29.5%) and 100%. Six of 8 patients with mucocutaneous involvement had detectable kDNA in urine versus 12 of 78 patients with isolated cutaneous disease (P < 0.001). L. (V.) braziliensis (N = 3), L. (V.) guyanensis (N = 6), and L. (V.) peruviana (N = 3) were identified from urine. No healthy volunteer or patient with an alternate diagnosis had detectable kDNA in urine. Sensitivity of urine PCR is sub-optimal for diagnosis. On the basis of these preliminary data in a small number of patients, detectable kDNA in urine may identify less localized forms of infection and inform treatment decisions. PMID:21460009

  5. Analysis of plasma viral RNA levels during acute dengue virus infection using quantitative competitor reverse transcription-polymerase chain reaction.

    PubMed

    Sudiro, T M; Zivny, J; Ishiko, H; Green, S; Vaughn, D W; Kalayanarooj, S; Nisalak, A; Norman, J E; Ennis, F A; Rothman, A L

    2001-01-01

    There is increasing recognition of the potential importance of viral burden in the pathogenesis of dengue hemorrhagic fever (DHF). There is little data available, however, describing the kinetics of viral replication in humans with natural dengue virus (DV) infection. Standard procedures for measuring titers of infectious virus in clinical specimens are either laborious or insensitive. We developed a method for measurement of DV RNA in plasma samples based on reverse transcription-polymerase chain reaction (RT-PCR) using a mutant RNA target as a competitor. This technique was reproducible and accurate for samples containing any of the four DV serotypes, and could be applied to samples containing as few as 250 copies of RNA per reaction. We examined plasma viral RNA levels in 80 children with acute DV infection; sequential plasma samples were tested in 34 of these children. Plasma viral RNA levels ranged as high as 10(9) RNA copies/ml, and correlated with titers of infectious virus measured in mosquitoes (r= 0.69). Plasma viral RNA levels fell rapidly during the last several days of the febrile period. We did not find a significant difference in maximal plasma viral RNA levels between children with DHF and children with dengue fever, but peak viral RNA levels were identified in only 16 subjects. We conclude that this quantitative RT-PCR method will be valuable for further studies of natural DV infections.

  6. Hepatitis A virus detection in oysters (Crassostrea gigas) in Santa Catarina State, Brazil, by reverse transcription-polymerase chain reaction.

    PubMed

    Coelho, C; Heinert, A P; Simões, C M O; Barardi, C R M

    2003-03-01

    Shellfish are readily contaminated with viruses present in water containing sewage because of the concentration effect of filter feeding. Hepatitis A virus (HAV) is the main cause of acute hepatitis worldwide and may lead to severe illness or even death. It is transmitted through fecal and oral routes and causes widespread endemic and asymptomatic infections in young children. Here we describe a method for the detection of HAV RNA in shellfish involving the extraction of total RNA from oyster meat followed by reverse transcription-polymerase chain reaction (RT-PCR). Virus recovery from oyster extracts artificially seeded with HAV strain HM 175 was examined by RT-PCR. The minimum detection limit was 3.3 focus-forming units of HAV, and the recovery rate was 75.7%. This method was used to assess the viral contamination of four shellfish beds in Santa Catarina State, Brazil, over a 1-year period. Six (22%) of 27 samples collected in autumn and winter from one shellfish bed tested positive for HAV.

  7. Evaluation of RealStar Reverse Transcription–Polymerase Chain Reaction Kits for Filovirus Detection in the Laboratory and Field

    PubMed Central

    Rieger, Toni; Kerber, Romy; El Halas, Hussein; Pallasch, Elisa; Duraffour, Sophie; Günther, Stephan; Ölschläger, Stephan

    2016-01-01

    Background. Diagnosis of Ebola virus (EBOV) disease (EVD) requires laboratory testing. Methods. The RealStar Filovirus Screen reverse transcription–polymerase chain reaction (RT-PCR) kit and the derived RealStar Zaire Ebolavirus RT-PCR kit were validated using in vitro transcripts, supernatant of infected cell cultures, and clinical specimens from patients with EVD. Results. The Filovirus Screen kit detected EBOV, Sudan virus, Taï Forest virus, Bundibugyo virus, Reston virus, and Marburg virus and differentiated between the genera Ebolavirus and Marburgvirus. The amount of filovirus RNA that could be detected with a probability of 95% ranged from 11 to 67 RNA copies/reaction on a LightCycler 480 II. The Zaire Ebolavirus kit is based on the Filovirus Screen kit but was optimized for detection of EBOV. It has an improved signal-to-noise ratio at low EBOV RNA concentrations and is somewhat more sensitive than the Filovirus kit. Both kits show significantly lower analytical sensitivity on a SmartCycler II. Clinical evaluation revealed that the SmartCycler II, compared with other real-time PCR platforms, decreases the clinical sensitivity of the Filovirus Screen kit to diagnose EVD at an early stage. Conclusions. The Filovirus Screen kit detects all human-pathogenic filoviruses with good analytical sensitivity if performed on an appropriate real-time PCR platform. High analytical sensitivity is important for early diagnosis of EVD. PMID:27549586

  8. Identification of members of several homeobox genes in a planarian using a ligation-mediated polymerase chain reaction technique.

    PubMed Central

    Balavoine, G

    1996-01-01

    I have used a novel single-sided specific polymerase chain reaction (PCR) strategy inspired by ligation-mediated PCR to clone fragments of divergent homeobox genes from a flatworm, the planarian Polycelis nigra. Eight homeobox-containing fragments were amplified, belonging to the Hox, msh, NK-1 and NK-2 classes. Together with the results obtained from several genomes of platyhelminths, my screening shows the presence of the same array of homeodomain developmental regulators in planarians, traditionally regarded as primitive metazoans in terms of body plan, as in coelomate organisms. However, the presence of a Ubx/abd-A homolog may indicate that platyhelminths are more closely related to protostomes than to deuterostomes and supports the idea that flatworms have inherited an elaborate HOX cluster (seven or eight genes) from their ancestor. Likely homologs of the fly genes tinman, bagpipe and S59 suggest that the mesoderm might be patterned by the same genes in all bilaterally symmetrical animals. Finally, a msh-like gene, a family known to be involved in inductive mechanisms in vertebrates, has been found. These results support the hypothesis that the tremendous diversity of metazoan body plans is specified by a largely conserved array of homeobox-containing developmental genes. PMID:8628690

  9. High-throughput multiplex quantitative polymerase chain reaction method for Giardia lamblia and Cryptosporidium species detection in stool samples.

    PubMed

    Nurminen, Noora; Juuti, Rosa; Oikarinen, Sami; Fan, Yue-Mei; Lehto, Kirsi-Maarit; Mangani, Charles; Maleta, Kenneth; Ashorn, Per; Hyöty, Heikki

    2015-06-01

    Giardia lamblia and Cryptosporidium species belong to a complex group of pathogens that cause diseases hampering development and socioeconomic improvements in the developing countries. Both pathogens are recognized as significant causes of diarrhea and nutritional disorders. However, further studies are needed to clarify the role of parasitic infections, especially asymptomatic infections in malnutrition and stunting. We developed a high-throughput multiplex quantitative polymerase chain reaction (qPCR) method for G. lamblia and Cryptosporidium spp. detection in stool samples. The sensitivity and specificity of the method were ensured by analyzing confirmed positive samples acquired from diagnostics laboratories and participating in an external quality control round. Its capability to detect asymptomatic G. lamblia and Cryptosporidium spp. infections was confirmed by analyzing stool samples collected from 44 asymptomatic 6-month-old infants living in an endemic region in Malawi. Of these, five samples were found to be positive for G. lamblia and two for Cryptosporidium spp. In conclusion, the developed method is suitable for large-scale studies evaluating the occurrence of G. lamblia and Cryptosporidium spp. in endemic regions and for clinical diagnostics of these infections.

  10. Real-Time Fluorescent Polymerase Chain Reaction Detection of Phytophthora ramorum and Phytophthora pseudosyringae Using Mitochondrial Gene Regions.

    PubMed

    Tooley, Paul W; Martin, Frank N; Carras, Marie M; Frederick, Reid D

    2006-04-01

    ABSTRACT A real-time fluorescent polymerase chain reaction (PCR) detection method for the sudden oak death pathogen Phytophthora ramorum was developed based on mitochondrial DNA sequence with an ABI Prism 7700 (TaqMan) Sequence Detection System. Primers and probes were also developed for detecting P. pseudosyringae, a newly described species that causes symptoms similar to P. ramorum on certain hosts. The species-specific primer-probe systems were combined in a multiplex assay with a plant primer-probe system to allow plant DNA present in extracted samples to serve as a positive control in each reaction. The lower limit of detection of P. ramorum DNA was 1 fg of genomic DNA, lower than for many other described PCR procedures for detecting Phytophthora species. The assay was also used in a three-way multiplex format to simultaneously detect P. ramorum, P. pseudosyringae, and plant DNA in a single tube. P. ramorum was detected down to a 10(-5) dilution of extracted tissue of artificially infected rhododendron 'Cunningham's White', and the amount of pathogen DNA present in the infected tissue was estimated using a standard curve. The multiplex assay was also used to detect P. ramorum in infected California field samples from several hosts determined to contain the pathogen by other methods. The real-time PCR assay we describe is highly sensitive and specific, and has several advantages over conventional PCR assays used for P. ramorum detection to confirm positive P. ramorum finds in nurseries and elsewhere.

  11. Quantitative real-time polymerase chain reaction for malaria diagnosis and its use in malaria vaccine clinical trials.

    PubMed

    Andrews, Laura; Andersen, Rikke F; Webster, Daniel; Dunachie, Susanna; Walther, R Michael; Bejon, Philip; Hunt-Cooke, Angela; Bergson, Gillian; Sanderson, Frances; Hill, Adrian V S; Gilbert, Sarah C

    2005-07-01

    The demand for an effective malaria vaccine is high, with millions of people being affected by the disease every year. A large variety of potential vaccines are under investigation worldwide, and when tested in clinical trials, researchers need to extract as much data as possible from every vaccinated and control volunteer. The use of quantitative real-time polymerase chain reaction (PCR), carried out in real-time during the clinical trials of vaccines designed to act against the liver stage of the parasite's life cycle, provides more information than the gold standard method of microscopy alone and increases both safety and accuracy. PCR can detect malaria parasites in the blood up to 5 days before experienced microscopists see parasites on blood films, with a sensitivity of 20 parasites/mL blood. This PCR method has so far been used to follow 137 vaccinee and control volunteers in Phase IIa trials in Oxford and on 220 volunteer samples during a Phase IIb field trial in The Gambia.

  12. Identification of suitable reference genes for investigating gene expression in human gallbladder carcinoma using reverse transcription quantitative polymerase chain reaction.

    PubMed

    Yu, Shan; Yang, Qiwei; Yang, Jing Hui; Du, Zhenwu; Zhang, Guizhen

    2015-04-01

    Reverse transcription quantitative polymerase chain reaction (RT‑qPCR) has become a frequently used strategy in gene expression studies. The relative quantification method is an important and commonly used method for the evaluation of RT‑qPCR data. The key aim of this method is to identify an applicable internal reference gene, however, there are currently no suitable reference genes for gene analysis in gallbladder carcinoma. In the present study, screening was performed using 12 common reference genes, which were selected in order to provide an experimental basis for the investigation of gene expression in gallbladder carcinoma. A total of 16 tissue samples of gallbladder carcinoma and their matched normal gallbladder tissues were used. The gene expression stability and applicability of the 12 reference gene candidates were determined using the geNorm, NormFinder and BestKeeper software programs. Following comparison of the results of the three software programs, HPRT1 was identified as the most stably expressed reference gene. In the normal gallbladder group, the relative stably expressed reference gene was PPIA and in the entire sample group, the relatively stably expressed reference gene was PPIA. The present study also demonstrated that the combination of the three reference genes was the most appropriate. The recommended combinations were PPIA + PUM1 + ACTB for the total sample group, GAPDH + PBGD + ALAS1 for the gallbladder carcinoma group and PPIA + PUM1 + TBP for the paired normal gallbladder group.

  13. KRAS detection on archival cytological smears by the novel fully automated polymerase chain reaction-based Idylla mutation test

    PubMed Central

    De Luca, Caterina; Vigliar, Elena; d’Anna, Melania; Pisapia, Pasquale; Bellevicine, Claudio; Malapelle, Umberto; Troncone, Giancarlo

    2017-01-01

    Background: Molecular techniques are relevant to modern cytopathology, but their implementation is difficult without molecular expertise and infrastructure. The assessment of KRAS mutational status on cytological preparations may be useful either to refine uncertain diagnoses on pancreatic aspirates or to yield predictive information to plan targeted treatment of metastatic colorectal cancer (mCRC). The novel test Idylla™ enables fully automated KRAS genotyping in approximately 2 h, even in less experienced hands. Materials and Methods: This study aims to validate this methodology to detect KRAS mutations on archival cytological preparations of pancreatic cancer (n = 9) and mCRC (n = 9) by comparing the Idylla™ performance to that of standard real-time polymerase chain reaction. Results: The same 11 mutations (n = 4: p.G12D; n = 2: p.G12V; n = 2: p.A59E/G/T; n = 1: p.G12R; n = 1: p.G13D; n = 1: p.Q61H) were detected by both techniques. Conclusion: Even in less experienced laboratories, a cytopathologist may easily integrate morphological diagnostic report with accurate KRAS mutation detection, which is relevant for diagnostic and treatment decisions. PMID:28331530

  14. Inter- and Intraspecific Identification of the Screwworm, Cochliomyia hominivorax, Using Random Amplified Polymorphic DNA-Polymerase Chain Reaction

    PubMed Central

    Skoda, Steven R.; Figarola, James L.; Pornkulwat, Saowaluck; Foster, John E.

    2013-01-01

    The screwworm, Cochliomyia hominivorax (Coquerel) (Diptera: Calliphoridae), is one of the most devastating arthropod pests of livestock in the Western Hemisphere. Early instars are very difficult to distinguish morphologically from several closely related blow fly species. Random amplified polymorphic DNA-polymerase chain reaction (RAPD-PCR) markers were developed for identifying C. hominivorax from other wound inhabiting species. Forty decameric primers were screened; nine showed clear reproducible RAPD profiles suitable for distinguishing all life stages of C. hominivorax from 7 other species, including C. macellaria (Fabricius). The results from RAPD-PCR with field-collected samples of unknown first instars agreed with morphological identification that the samples were not C. hominivorax. Three different primers showed DNA polymorphisms (intraspecific) for samples originating from Mexico, Costa Rica, Panama, Jamaica, and Brazil. Therefore, RAPD-PCR may be useful for determining the geographic origin of C. hominivorax samples. Comparing products from these primers, used with known and unknown screwworm samples from an outbreak in Mexico, clearly showed that the outbreak did not originate from the mass rearing facility. Accurate identification of suspected C. hominivorax samples is possible using RAPD-PCR. Further development to identify the geographic origin of samples would benefit the ongoing surveillance programs against C. hominivorax and the decision process during suspected outbreaks of this important pest. PMID:24219502

  15. Polymerase chain reaction localization of constitutive nitric oxide synthase and soluble guanylate cyclase messenger RNAs in microdissected rat nephron segments.

    PubMed Central

    Terada, Y; Tomita, K; Nonoguchi, H; Marumo, F

    1992-01-01

    Stimulation of the release of nitric oxide (NO) in the kidney has been shown to result in renal hemodynamic changes and natriuresis. NO is a potent stimulator of soluble guanylate cyclase, leading to an increase of cyclic GMP. The precise localization of NO synthase and soluble guanylate cyclase in the renal structure is not known. In this study, the microlocalization of mRNAs coding for constitutive NO synthase and soluble guanylate cyclase was carried out in the rat kidney, using an assay of reverse transcription and polymerase chain reaction in individual microdissected renal tubule segments along the nephron, glomeruli, vasa recta bundle, and arcuate arteries. A large signal for constitutive NO synthase was detected in inner medullary collecting duct. Small signals were detected in inner medullary thin limb, cortical collecting duct, outer medullary collecting duct, glomerulus, vasa recta, and arcuate artery. Soluble guanylate cyclase mRNA is expressed largely in glomerulus, proximal convoluted tubule, proximal straight tubule, and cortical collecting duct, and in small amounts in medullary thick ascending limb, inner medullary thin limb, outer medullary collecting duct, inner medullary collecting duct, and the vascular system. Our data demonstrate that NO can be produced locally in the kidney, and that soluble guanylate cyclase is widely distributed in glomerulus, renal tubules, and the vascular system. Images PMID:1379616

  16. An integrated CMOS quantitative-polymerase-chain-reaction lab-on-chip for point-of-care diagnostics.

    PubMed

    Norian, Haig; Field, Ryan M; Kymissis, Ioannis; Shepard, Kenneth L

    2014-10-21

    Considerable effort has recently been directed toward the miniaturization of quantitative-polymerase-chain-reaction (qPCR) instrumentation in an effort to reduce both cost and form factor for point-of-care applications. Considerable gains have been made in shrinking the required volumes of PCR reagents, but resultant prototypes retain their bench-top form factor either due to heavy heating plates or cumbersome optical sensing instrumentation. In this paper, we describe the use of complementary-metal-oxide semiconductor (CMOS) integrated circuit (IC) technology to produce a fully integrated qPCR lab-on-chip. Exploiting a 0.35 μm high-voltage CMOS process, the IC contains all of the key components for performing qPCR. Integrated resistive heaters and temperature sensors regulate the surface temperature of the chip to an accuracy of 0.45 °C. Electrowetting-on-dielectric microfluidics are actively driven from the chip surface, allowing for droplet generation and transport down to volumes less than 1.2 nanoliter. Integrated single-photon avalanche diodes (SPADs) are used for fluorescent monitoring of the reaction, allowing for the quantification of target DNA with more than four-orders-of-magnitude of dynamic range and sensitivities down to a single copy per droplet. Using this device, reliable and sensitive real-time proof-of-concept detection of Staphylococcus aureus (S. aureus) is demonstrated.

  17. Genes that encode botulism neurotoxins A, B, E and F in neotropical bee honey identified with the polymerase chain reaction.

    PubMed

    Fournier, Ana Teresa; Gamboa, María del Mar; Arias, María Laura

    2006-03-01

    Honey can be used for the treatment of wounds, sores and skin bums, but it might be contaminated with Clostridium botulinum spores. In order to evaluate Costa Rican raw honey samples, the detection of neurotoxin gene sequences (corresponding to the bacterium) C. botulinum A, B, E and F was done with the polymerase chain reaction. A total of 64 raw honey samples, coming from different Costa Rican sites were analyzed. Reference C. botulinum strains type A (ATCC 19397), type B (ATCC 7949), type E (ATCC 17786) and type F (ATCC 25764) were used as templates for testing the effectivity of the method. The process consisted in culturing the honey samples in prereduced triptose-peptone-glucose-yeast extract media (TGPY) for 5 days. After this, the bacteria lysate obtained was used for PCR. The amplicons, product of the reaction, were visualized using agarose gel 2%. From the 64 honey samples analyzed, none produced positive results in the PCR, since no amplicons were obtained. Even though, all the reference C. botulinum strains used as controls were visualized and showed the effectivity of the extraction method and of the PCR used. The results obtained show promising therapeutic uses for honey from Costa Rica, but further evaluations shall be done in order to be sure of the safety of the product.

  18. Identification of nickel response genes in abnormal early developments of sea urchin by differential display polymerase chain reaction.

    PubMed

    Ryu, Tae Kwon; Lee, Gunsup; Rhee, Yong; Park, Heung-Sik; Chang, Man; Lee, Sukchan; Lee, Jaean; Lee, Taek-Kyun

    2012-10-01

    Bioassays and biomarkers have been previously developed to assess the effects of heavy metal contaminants on the early life stages of the sea urchin. In this study, malformation in the early developmental processes was observed in sea urchin (Strongylocentrotus intermedius) larvae exposed to 10 ppm Ni for over 30 h. The most critical stage at which the triggering of nickel effects takes place is thought to be the blastula stage, which occurs after fertilization in larval development. To investigate the molecular-level responses of sea urchin exposed to heavy metal stress and to explore the differentially expressed genes that are induced or repressed by nickel, differential display polymerase chain reaction (DD-PCR) was used with sea urchin mRNAs. The malformation-related genes expressed in the early life stages of the sea urchin were cloned from larvae exposed to 10 ppm of nickel for 15 h, and accessed via DD-PCR. Sequence analysis results revealed that each of the genes evidenced high homology with EGF2, PCSK9, serine/threonine protein kinase, apolipophorin precursor protein, and MGC80921 protein/transcript variant 2. This result may prove useful in the development of novel biomarkers for the assessment of heavy metal stresses on sea urchin embryos.

  19. Polymerase chain reaction (PCR) identification of rodent blood meals confirms host sharing by flea vectors of plague.

    PubMed

    Franklin, Heather A; Stapp, Paul; Cohen, Amybeth

    2010-12-01

    Elucidating feeding relationships between hosts and parasites remains a significant challenge in studies of the ecology of infectious diseases, especially those involving small or cryptic vectors. Black-tailed prairie dogs (Cynomys ludovicianus) are a species of conservation importance in the North American Great Plains whose populations are extirpated by plague, a flea-vectored, bacterial disease. Using polymerase chain reaction (PCR) assays, we determined that fleas (Oropsylla hirsuta) associated with prairie dogs feed upon northern grasshopper mice (Onychomys leucogaster), a rodent that has been implicated in the transmission and maintenance of plague in prairie-dog colonies. Our results definitively show that grasshopper mice not only share fleas with prairie dogs during plague epizootics, but also provide them with blood meals, offering a mechanism by which the pathogen, Yersinia pestis, may be transmitted between host species and maintained between epizootics. The lack of identifiable host DNA in a significant fraction of engorged Oropsylla hirsuta collected from animals (47%) and prairie-dog burrows (100%) suggests a rapid rate of digestion and feeding that may facilitate disease transmission during epizootics but also complicate efforts to detect feeding on alternative hosts. Combined with other analytical approaches, e.g., stable isotope analysis, molecular genetic techniques can provide novel insights into host-parasite feeding relationships and improve our understanding of the role of alternative hosts in the transmission and maintenance of disease.

  20. Detection of Leishmania braziliensis in human paraffin-embedded tissues from Tucumán, Argentina by polymerase chain reaction.

    PubMed

    Lanús, Elizabeth Córdoba; Piñero, José Enrique; González, Ana Cristina; Valladares, Basilio; de Grosso, Mercedes Lizarralde; Salomón, Oscar Daniel

    2005-04-01

    American cutaneous leishmaniasis (ACL) is an endemic disease in Northern Argentina. We applied the polymerase chain reaction (PCR) followed by a hybridization labelled probe to 21 paraffin embedded human skin biopsies, already analyzed histologically, from leishmaniasis endemic areas in the province of Tucumán, Argentina. We used primers previously designed to detect a Leishmania-specific 120-base-pair fragment of kinetoplast DNA minicircle, other two primer pairs that amplify kDNA minicircles belonging to the L. braziliensis and L. mexicana complexes respectively, and specific oligonucleotide primers to detect L. (V.) braziliensis which amplify the sequence of the ribosomal protein L-14 of this species. The PCR-hybridization showed a sensitivity of 90.5% when compared to the histopathology test which was 61.9%. Five of the total samples analyzed were positive for the L. braziliensis complex whilst none was positive for the L. mexicana complex. The specific primers for L. (V.) braziliensis detected the parasite in four samples. These results are consistent with those reported for close endemic areas and demonstrate that the causative agent of human leishmaniasis in the analyzed cases was L. (V.) braziliensis. PCR should be used as a diagnostic tool for tegumentary leishmaniasis, especially in the mucosal form, and as a valuable technique for the identification of the Leishmania species that causes the disease in certain areas.