Science.gov

Sample records for acid protease gene

  1. Purification, characterization, and gene cloning of thermopsin, a thermostable acid protease from Sulfolobus acidocaldarius.

    PubMed

    Lin, X; Tang, J

    1990-01-25

    A thermostable, acid proteolytic activity has been found to be associated with the cells and in the culture medium of Sulfolobus acidocaldarius, an archaebacterium. This acid protease, which has been named thermopsin, was purified to homogeneity from the culture medium by a five-step procedure including column chromatographies on DEAE-Sepharose CL-6B, phenyl-Sepharose CL-4B, Sephadex G-100, monoQ (fast protein liquid chromatography), and gel filtration (high pressure liquid chromatography). The purified thermopsin produced a single band on sodium dodecyl sulfate-polyacrylamide gel electrophoresis and the proteolytic activity was associated with the band. Thermopsin is a single-chain protein as indicated by gel electrophoresis and by a single NH2-terminal sequence. It has maximal proteolytic activity at pH 2 and 90 degrees C. A genomic library of S. acidocaldarius was prepared and screened by an oligonucleotide probe designed from the NH2-terminal sequence of thermopsin. Five positive clones were isolated. From these clones the thermopsin gene was mapped and sequenced. The nucleotide sequence showed that the thermopsin structure is encoded in 1020 bases. In the deduced protein sequence, there are 41 amino acid residues (including the initiation Met) preceding the NH2-terminal position of thermopsin. Most of these residues appear to be characteristic of a leader sequence. However, the presence in this region of a short pro sequence cannot be ruled out. Thermopsin contains a single cysteine at residue 237 that is not essential for activity (Fusek, M., Lin, X.-L., Tang, J. (1990) J. Biol. Chem. 265, 1496-1501. Thermopsin has no apparent sequence similarity to aspartic proteases of the pepsin family nor to pepstatin-insensitive acid protease (Maita, T., Nagata, S., Matsuda, G., Murata, S., Oda, K., Murao, S., and Tsura, D. (1984) J. Biochem. 95, 465-475) and thus may represent a new class of acid proteases. Also absent is the characteristic active site aspartyl sequence

  2. A novel aspartic acid protease gene from pineapple fruit (Ananas comosus): cloning, characterization and relation to postharvest chilling stress resistance.

    PubMed

    Raimbault, Astrid-Kim; Zuily-Fodil, Yasmine; Soler, Alain; Cruz de Carvalho, Maria H

    2013-11-15

    A full-length cDNA encoding a putative aspartic acid protease (AcAP1) was isolated for the first time from the flesh of pineapple (Ananas comosus) fruit. The deduced sequence of AcAP1 showed all the common features of a typical plant aspartic protease phytepsin precursor. Analysis of AcAP1 gene expression under postharvest chilling treatment in two pineapple varieties differing in their resistance to blackheart development revealed opposite trends. The resistant variety showed an up-regulation of AcAP1 precursor gene expression whereas the susceptible showed a down-regulation in response to postharvest chilling treatment. The same trend was observed regarding specific AP enzyme activity in both varieties. Taken together our results support the involvement of AcAP1 in postharvest chilling stress resistance in pineapple fruits.

  3. Effects of dietary soybean stachyose and phytic acid on gene expressions of serine proteases in Japanese flounder ( Paralichthys olivaceus)

    NASA Astrophysics Data System (ADS)

    Mi, Haifeng; Mai, Kangsen; Zhang, Wenbing; Wu, Chenglong; Cai, Yinghua

    2011-09-01

    Soybean stachyose (SBS) and phytic acid (PA) are anti-nutritional factors (ANF) which have deleterious effects on the growth and digestibility in fish. The present research studied the effects of dietary SBS and PA on the expression of three serine protease genes in the liver of Japanese flounder ( Paralichthys olivaceus). These genes are trypsinogen 1 (poTRY), elastase 1 (poEL) and chymotrypsinogen 1 (poCTRY). Eight artificial diets with graded levels of supplemented ANFs were formulated to 4 levels of SBS (0.00, 0.40, 0.80 and 1.50%), 4 levels of PA (0.00, 0.20, 0.40 and 0.80), respectively. Japanese flounder (initial weight 2.45 g ± 0.01 g) were fed with these diets for 10 weeks with three replications per treatment. At the end of 10 weeks, supplementation of 0.40% of dietary SBS or PA significantly increased the gene expression of poTRY and poCTRY ( P<0.05). The same level of dietary SBS significantly decreased the gene expression of poEL. In comparison with the control group (ANF-free), dietary PA (0.2% and 0.8%) significantly decreased the gene expression of poTRY, poCTRY and poEL ( P<0.05). However, excessive supplement of dietary SBS (1.5%) has no significant effects on these gene expressions ( P>0.05). These results suggested that dietary SBS and dietary PA could directly affect the serine protease genes at the transcriptional level in Japanese flounder, and these genes' expression was more sensitive to dietary PA than to SBS under the current experimental conditions.

  4. Analysis of 16S rRNA gene lactic acid bacteria (LAB) isolate from Markisa fruit (Passiflora sp.) as a producer of protease enzyme and probiotics

    NASA Astrophysics Data System (ADS)

    Hidayat, Habibi

    2017-03-01

    16S rRNA gene analysis of bacteria lactic acid (LAB) isolate from Markisa Kuning Fruit (Passiflora edulis var. flavicarpa) as a producer of protease enzyme and probiotics has been done. The aim of the study is to determine the protease enzyme activity and 16S rRNA gene amplification using PCR. The calculation procedure was done to M4 isolate bacteria lactic acid (LAB) Isolate which has been resistant to acids with pH 2.0 in the manner of screening protease enzyme activity test result 6.5 to clear zone is 13 mm againts colony diametre is 2 mm. The results of study enzyme activity used spectrophotometer UV-Vis obtainable the regression equation Y=0.02983+0.001312X, with levels of protein M4 isolate is 0.6594 mg/mL and enzyme activity of obtainable is 0.8626 unit/ml while the spesific enzyme activity produced is 1.308 unit/mg. Then, 16S rRNA gene amplificatiom and DNA sequencing has been done. The results of study showed that the bacteria species contained from M4 bacteria lactic acid (LAB) isolate is Weisella cibiria strain II-I-59. Weisella cibiria strain II-I-59 is one of bacteria could be utilized in the digestive tract.

  5. Leukocyte protease binding to nucleic acids promotes nuclear localization and cleavage of nucleic acid binding proteins.

    PubMed

    Thomas, Marshall P; Whangbo, Jennifer; McCrossan, Geoffrey; Deutsch, Aaron J; Martinod, Kimberly; Walch, Michael; Lieberman, Judy

    2014-06-01

    Killer lymphocyte granzyme (Gzm) serine proteases induce apoptosis of pathogen-infected cells and tumor cells. Many known Gzm substrates are nucleic acid binding proteins, and the Gzms accumulate in the target cell nucleus by an unknown mechanism. In this study, we show that human Gzms bind to DNA and RNA with nanomolar affinity. Gzms cleave their substrates most efficiently when both are bound to nucleic acids. RNase treatment of cell lysates reduces Gzm cleavage of RNA binding protein targets, whereas adding RNA to recombinant RNA binding protein substrates increases in vitro cleavage. Binding to nucleic acids also influences Gzm trafficking within target cells. Preincubation with competitor DNA and DNase treatment both reduce Gzm nuclear localization. The Gzms are closely related to neutrophil proteases, including neutrophil elastase (NE) and cathepsin G. During neutrophil activation, NE translocates to the nucleus to initiate DNA extrusion into neutrophil extracellular traps, which bind NE and cathepsin G. These myeloid cell proteases, but not digestive serine proteases, also bind DNA strongly and localize to nuclei and neutrophil extracellular traps in a DNA-dependent manner. Thus, high-affinity nucleic acid binding is a conserved and functionally important property specific to leukocyte serine proteases. Furthermore, nucleic acid binding provides an elegant and simple mechanism to confer specificity of these proteases for cleavage of nucleic acid binding protein substrates that play essential roles in cellular gene expression and cell proliferation.

  6. Characterization, cloning, and heterologous expression of a subtilisin-like serine protease gene VlPr1 from Verticillium lecanii.

    PubMed

    Yu, Gang; Liu, Jin-Liang; Xie, Li-Qin; Wang, Xue-Liang; Zhang, Shi-Hong; Pan, Hong-Yu

    2012-12-01

    The entomopathogenic fungus Verticillium lecanii is a well-known biocontrol agent. V. lecanii produces subtilisin-like serine protease (Pr1), which is important in the biological control activity of some insect pests by degrading insect cuticles. In this study, a subtilisin-like serine protease gene VlPr1 was cloned from the fungus and the VlPr1 protein was expressed in Escherichia coli. The VlPr1 gene contains an open reading frame (ORF) interrupted by three short introns, and encodes a protein of 379 amino acids. Protein sequence analysis revealed high homology with subtilisin serine proteases. The molecular mass of the protease was 38 kDa, and the serine protease exhibited its maximal activity at 40°C and pH 9.0. Protease activity was also affected by Mg(2+) and Ca(2+) concentration. The protease showed inhibitory activity against several plant pathogens, especially towards Fusarium moniliforme.

  7. Acid phosphatase and protease activities in immobilized rat skeletal muscles

    NASA Technical Reports Server (NTRS)

    Witzmann, F. A.; Troup, J. P.; Fitts, R. H.

    1982-01-01

    The effect of hind-limb immobilization on selected Iysosomal enzyme activities was studied in rat hing-limb muscles composed primarily of type 1. 2A, or 2B fibers. Following immobilization, acid protease and acid phosphatase both exhibited signifcant increases in their activity per unit weight in all three fiber types. Acid phosphatase activity increased at day 14 of immobilization in the three muscles and returned to control levels by day 21. Acid protease activity also changed biphasically, displaying a higher and earlier rise than acid phosphatase. The pattern of change in acid protease, but not acid phosphatase, closely parallels observed muscle wasting. The present data therefore demonstrate enhanced proteolytic capacity of all three fiber types early during muscular atrophy. In addition, the data suggest a dependence of basal hydrolytic and proteolytic activities and their adaptive response to immobilization on muscle fiber composition.

  8. Acid protease production in fungal root endophytes.

    PubMed

    Mayerhofer, Michael S; Fraser, Erica; Kernaghan, Gavin

    2015-01-01

    Fungal endophytes are ubiquitous in healthy root tissue, but little is known about their ecosystem functions, including their ability to utilize organic nutrient sources such as proteins. Root-associated fungi may secrete proteases to access the carbon and mineral nutrients within proteins in the soil or in the cells of their plant host. We compared the protein utilization patterns of multiple isolates of the root endophytes Phialocephala fortinii s.l., Meliniomyces variabilis and Umbelopsis isabellina with those of two ectomycorrhizal (ECM) fungi, Hebeloma incarnatulum and Laccaria bicolor, and the wood-decay fungus Irpex lacteus at pH values of 2-9 on liquid BSA media. We also assessed protease activity using a fluorescently labeled casein assay and gelatin zymography and characterized proteases using specific protease inhibitors. I. lacteus and U. isabellina utilized protein efficiently, while the ECM fungi exhibited poor protein utilization. ECM fungi secreted metallo-proteases and had pH optima above 4, while other fungi produced aspartic proteases with lower pH optima. The ascomycetous root endophytes M. variabilis and P. fortinii exhibited intermediate levels of protein utilization and M. variabilis exhibited a very low pH optimum. Comparing proteolytic profiles between fungal root endophytes and fungi with well defined ecological roles provides insight into the ecology of these cryptic root associates.

  9. Yeast extracellular proteases.

    PubMed

    Ogrydziak, D M

    1993-01-01

    Many species of yeast secrete significant amounts of protease(s). In this article, results of numerous surveys of yeast extracellular protease production have been compiled and inconsistencies in the data and limitations of the methodology have been examined. Regulation, purification, characterization, and processing of yeast extracellular proteases are reviewed. Results obtained from the sequences of cloned genes, especially the Saccharomyces cerevisiae Bar protease, the Candida albicans acid protease, and the Yarrowia lipolytica alkaline protease, have been emphasized. Biotechnological applications and the medical relevance of yeast extracellular proteases are covered. Yeast extracellular proteases have potential in beer and wine stabilization, and they probably contribute to pathogenicity of Candida spp. Yeast extracellular protease genes also provide secretion and processing signals for yeast expression systems designed for secretion of heterologous proteins. Coverage of the secretion of foreign proteases such as prochymosin, urokinase, and tissue plasminogen activator by yeast in included.

  10. Detergent alkaline proteases: enzymatic properties, genes, and crystal structures.

    PubMed

    Saeki, Katsuhisa; Ozaki, Katsuya; Kobayashi, Tohru; Ito, Susumu

    2007-06-01

    Subtilisin-like serine proteases from bacilli have been used in various industrial fields worldwide, particularly in the production of laundry and automatic dishwashing detergents. They belong to family A of the subtilase superfamily, which is composed of three clans, namely, true subtilisins, high-alkaline proteases, and intracellular proteases. We succeeded in the large-scale production of a high-alkaline protease (M-protease) from alkaliphilic Bacillus clausii KSM-K16, and the enzyme has been introduced into compact heavy-duty laundry detergents. We have also succeeded in the industrial-scale production of a new alkaline protease, KP-43, which was originally resistant to chemical oxidants and to surfactants, produced by alkaliphilic Bacillus sp. strain KSM-KP43 and have incorporated it into laundry detergents. KP-43 and related proteases form a new clan, oxidatively stable proteases, in subtilase family A. In this review, we describe the enzymatic properties, gene sequences, and crystal structures of M-protease, KP-43, and related enzymes.

  11. Differential expression of a protease gene family in African Trypanosomes

    PubMed Central

    Helm, Jared R.; Wilson, Mary E.; Donelson, John E.

    2008-01-01

    During their life cycle African trypanosomes must quickly adapt to the different environments of the tsetse fly midgut and the mammalian bloodstream by modulating expression of many of their genes. One group of these differentially expressed genes encodes different forms of a major surface protease. Using a luciferase reporter gene transiently or permanently transfected into trypanosomes, we show here that the 3′-UTRs of these protease genes are responsible for their differential expression. Deletion analysis of the 389-bp 3′-UTR of one of the protease genes, MSP-B, demonstrated that it contains a U-rich regulatory region of about 23 bp (UCGUCUGUUAUUUCUUAGUCCAG), which suppresses expression of the reporter protein in bloodstream trypanosomes by as much as 25-fold, but has little effect on the reporter expression in procyclic (tsetse fly) trypanosomes. Replacing the entire 3′-UTR with just this 23-bp element mimicked most of the suppression effect of the complete 3′-UTR. Northern blots showed that the 23-bp element influences the steady state RNA level, but not enough to account for the 25-fold suppression effect. Polysome analyses showed that in procyclic trypanosomes more of the total protease mRNA is associated with intermediate-sized and large polysomes than in bloodstream trypanosomes. Thus, the 23-bp element of this protease gene affects both the level of RNA and its translation. PMID:18848586

  12. Mycobacterial Caseinolytic Protease Gene Regulator ClgR Is a Substrate of Caseinolytic Protease

    PubMed Central

    Yamada, Yoshiyuki

    2017-01-01

    ABSTRACT The mycobacterial caseinolytic protease ClpP1P2 is a degradative protease that recently gained interest as a genetically and pharmacologically validated drug target for tuberculosis. The first whole-cell active ClpP1P2 inhibitor, the human proteasome inhibitor bortezomib, is currently undergoing lead optimization to introduce selectivity for the bacterial target. How inhibition of ClpP1P2 translates into whole-cell antimicrobial activity is little understood. Previous work has shown that the caseinolytic protease gene regulator ClgR is an activator of the clpP1P2 genes and also suggested that this transcription factor may be a substrate of the protease. Here, we employ promoter activity reporters and direct mRNA level measurements showing that bortezomib treatment of Mycobacterium bovis BCG increased transcription of clpP1P2 and other ClgR-dependent promoters, suggesting that inhibition of ClpP1P2 increases cellular ClgR levels. Then, we carried out red fluorescent protein-ClgR fusion analyses to show that ClgR is indeed a substrate of ClpP1P2 and to identify ClgR’s C-terminal nonapeptide APVVSLAVA as the signal sufficient for recognition and efficient protein degradation by ClpP1P2. Interestingly, accumulation of ClgR appears to be toxic for bacilli, suggesting a mechanism for how pharmacological inhibition of ClpP1P2 protease activity by bortezomib translates into whole-cell antibacterial activity. IMPORTANCE With 9 million new cases and more than 1 million deaths per year, tuberculosis, caused by Mycobacterium tuberculosis, is the biggest infectious disease killer globally. New drugs for the treatment of the drug-resistant forms of the disease are needed. Recently, a new target-lead couple, the mycobacterial protease ClpP1P2 and the human anticancer drug bortezomib, was identified. However, we know little about how expression of this protease is regulated, which proteins in the bacterium it degrades, how the protease recognizes its target proteins

  13. A new member of the plasma protease inhibitor gene family.

    PubMed Central

    Ragg, H

    1986-01-01

    A 2.1-kb cDNA clone representing a new member of the protease inhibitor family was isolated from a human liver cDNA library. The inhibitor, named human Leuserpin 2 (hLS2), comprises 480 amino acids and contains a leucine residue at its putative reactive center. HLS2 is about 25-28% homologous to three human members of the plasma protease inhibitor family: antithrombin III, alpha 1-antitrypsin and alpha 1-antichymotrypsin. A comparison with published partial amino acid sequences shows that hLS2 is closely related to the thrombin inhibitor heparin cofactor II. Images PMID:3003690

  14. Proteases.

    PubMed

    Barrett, A J

    2001-05-01

    The processes of growth and remodeling of cells and tissues in multicellular organisms require the breakdown of old protein molecules, in concert with the synthesis of new ones. For example, many newly-synthesized molecules require proteolytic processing to convert them to biologically active forms. Proteolysis can terminate the activity of a protein--e.g., capsases mediate apoptosis, which is a vital step in the life cycle of the cell. Proteolysis contributes to defense systems too, as the recognition of peptide fragments of foreign proteins triggers the immune response. Proteases are the class of enzymes involved in these important reactions. This unit discusses the general categories of proteases, and sets the stage for addition of overview units on cysteine proteases, aspartic proteases, and metalloproteases, as well as protocol units featuring techniques for analyzing mammalian and yeast proteasomes and protease inhibitors, among other topics.

  15. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  16. A facile analytical method for the identification of protease gene profiles from Bacillus thuringiensis strains.

    PubMed

    Chen, Fu-Chu; Shen, Li-Fen; Chak, Kin-Fu

    2004-01-01

    Five pairs of degenerate universal primers have been designed to identify the general protease gene profiles from some distinct Bacillus thuringiensis strains. Based on the PCR amplification patterns and DNA sequences of the cloned fragments, it was noted that the protease gene profiles of the three distinct strains of B. thuringiensis subsp. kurstaki HD73, tenebrionis and israelensis T14001 are varied. Seven protease genes, neutral protease B (nprB), intracellular serine protease A (ispA), extracellular serine protease (vpr), envelope-associated protease (prtH), neutral protease F (nprF), thermostable alkaline serine protease and alkaline serine protease (aprS), with known functions were identified from three distinct B. thuringiensis strains. In addition, five DNA sequences with unknown functions were also identified by this facile analytical method. However, based on the alignment of the derived protein sequences with the protein domain database, it suggested that at least one of these unknown genes, yunA, might be highly protease-related. Thus, the proposed PCR-mediated amplification design could be a facile method for identifying the protease gene profiles as well as for detecting novel protease genes of the B. thuringiensis strains.

  17. Proteases of germinating winged-bean (Psophocarpus tetragonolobus) seeds: purification and characterization of an acidic protease.

    PubMed

    Usha, R; Singh, M

    1996-01-15

    Two major classes of protease are shown to occur in germinating winged-bean (Psophocarpus tetragonolobus) seeds, by assaying extracts at pH 8.0 and pH 5.1 with [14C]gelatin as substrate. At pH 8.0, the activity profile of the enzyme shows a steady rise throughout the period of germination, whereas the activity at the acidic pH is very low up to day 5 and then increases sharply reaching a peak on day 11, followed by an equally sharp decline. The winged-bean acidic protease (WbAP) has been purified to apparent homogeneity, as attested by a single protein band on both PAGE and SDS/PAGE. WbAP is a monomeric enzyme with a molecular mass of 35 kDa and a pH optimum of 6.0. It is a thiol protease that does not belong to the papain family and it has tightly bound Ca2+ as shown by 45Ca(2+)-exchange studies. Besides gelatin and casein, it hydrolyses a 29 kDa winged-bean protein, indicating a prospective physiological role for it in storage-protein mobilization. Immunoblot analysis shows that it occurs only in the seeds and sprouting tubers of this plant and also that it is synthesized in developing seeds just before desiccation. It appears that the newly synthesized enzyme is inactive, and activation takes place around day 6 of germination. However, neither the mechanism of activation nor the signal that triggers it is clearly understood.

  18. Optimum production and characterization of an acid protease from marine yeast Metschnikowia reukaufii W6b

    NASA Astrophysics Data System (ADS)

    Li, Jing; Peng, Ying; Wang, Xianghong; Chi, Zhenming

    2010-12-01

    The marine yeast strain W6b isolated from sediment of the South China Sea was found to produce a cell-bound acid protease. The crude acid protease produced by this marine yeast showed the highest activity at pH 3.5 and 40 °C. The optimal pH and temperature for the crude acid protease were in agreement with those for acid protease produced by the terrestrial yeasts. The optimal medium of the acid protease production was seawater containing 1.0% glucose, 1.5% casein, and 0.5% yeast extract, and the optimal cultivation conditions of the acid protease production were pH 4.0, a temperature of 25 °C and a shaking speed of 140 rmin-1. Under the optimal conditions, 72.5 UmL-1 of acid protease activity could be obtained in cell suspension within 48 h of fermentation at shake flask level. The acid protease production was induced by high-molecular-weight nitrogen sources and repressed by low-molecular-weight nitrogen sources. Skimmed-milk-clotting test showed that the crude acid protease from the cell suspension of the yeast W6b had high skimmed milk coagulability. The acid protease produced by M. reukaufii W6b may have highly potential applications in cheese, food and fermentation industries.

  19. Human mast cell tryptase: Multiple cDNAs and genes reveal a multigene serine protease family

    SciTech Connect

    Vanderslice, P.; Ballinger, S.M., Tam, E.K.; Goldstein, S.M.; Craik, C.S.; Caughey, G.H. )

    1990-05-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the {approx}1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5{prime} regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family.

  20. Human mast cell tryptase: multiple cDNAs and genes reveal a multigene serine protease family.

    PubMed Central

    Vanderslice, P; Ballinger, S M; Tam, E K; Goldstein, S M; Craik, C S; Caughey, G H

    1990-01-01

    Three different cDNAs and a gene encoding human skin mast cell tryptase have been cloned and sequenced in their entirety. The deduced amino acid sequences reveal a 30-amino acid prepropeptide followed by a 245-amino acid catalytic domain. The C-terminal undecapeptide of the human preprosequence is identical in dog tryptase and appears to be part of a prosequence unique among serine proteases. The differences among the three human tryptase catalytic domains include the loss of a consensus N-glycosylation site in one cDNA, which may explain some of the heterogeneity in size and susceptibility to deglycosylation seen in tryptase preparations. All three tryptase cDNAs are distinct from a recently reported cDNA obtained from a human lung mast cell library. A skin tryptase cDNA was used to isolate a human tryptase gene, the exons of which match one of the skin-derived cDNAs. The organization of the approximately 1.8-kilobase-pair tryptase gene is unique and is not closely related to that of any other mast cell or leukocyte serine protease. The 5' regulatory regions of the gene share features with those of other serine proteases, including mast cell chymase, but are unusual in being separated from the protein-coding sequence by an intron. High-stringency hybridization of a human genomic DNA blot with a fragment of the tryptase gene confirms the presence of multiple tryptase genes. These findings provide genetic evidence that human mast cell tryptases are the products of a multigene family. Images PMID:2187193

  1. Gene identification and molecular characterization of solvent stable protease from a moderately haloalkaliphilic bacterium, Geomicrobium sp. EMB2.

    PubMed

    Karan, Ram; Singh, Raj Kumar Mohan; Kapoor, Sanjay; Khare, S K

    2011-02-01

    Cloning and characterization of the gene encoding a solvent-tolerant protease from the haloalkaliphilic bacterium Geomicrobium sp. EMB2 are described. Primers designed based on the N-terminal amino acid sequence of the purified EMB2 protease helped in the amplification of a 1,505-bp open reading frame that had a coding potential of a 42.7-kDa polypeptide. The deduced EMB2 protein contained a 35.4-kDa mature protein of 311 residues, with a high proportion of acidic amino acid residues. Phylogenetic analysis placed the EMB2 gene close to a known serine protease from Bacillus clausii KSM-K16. Primary sequence analysis indicated a hydrophobic inclination of the protein; and the 3D structure modeling elucidated a relatively higher percentage of small (glycine, alanine, and valine) and borderline (serine and threonine) hydrophobic residues on its surface. The structure analysis also highlighted enrichment of acidic residues at the cost of basic residues. The study indicated that solvent and salt stabilities in Geomicrobium sp. protease may be accorded to different structural features; that is, the presence of a number of small hydrophobic amino acid residues on the surface and a higher content of acidic amino acid residues, respectively.

  2. Gibberellic Acid-Induced Synthesis of Protease by Isolated Aleurone Layers of Barley 1

    PubMed Central

    Jacobsen, John V.; Varner, J. E.

    1967-01-01

    The production of protease by isolated aleurone layers of barley in response to gibberellic acid has been examined. The protease arises in the aleurone layer and is mostly released from the aleurone cells. The courses of release of amylase and protease from aleurone layers, the dose responses to gibberellic acid and the effects of inhibitors on the production of both enzymes are parallel. As is the case for amylase, protease is made de novo in response to the hormone. These data give some credence to the hypothesis that the effect of gibberellic acid is to promote the simultaneous synthesis and secretion of a group of hydrolases. PMID:16656695

  3. Using in silico techniques: Isolation and characterization of an insect cuticle-degrading-protease gene from Beauveria bassiana.

    PubMed

    Khan, Sehroon; Nadir, Sadia; Wang, Xuewen; Khan, Afsar; Xu, Jianchu; Li, Meng; Tao, Lihong; Khan, Siraj; Karunarathna, Samantha C

    2016-08-01

    Cuticle-degrading-proteases (CDPs) secreted by Beauveria spp. are pivotal biocontrol substances, possessing commercial potential for developing bio-pesticides. Therefore, a thoughtful and contemplative understanding and assessment of the structural and functional features of these proteases would markedly assist the development of biogenic pesticides. Computational molecular biology is a new facile alternative approach to the tedious experimental molecular biology; therefore, by using bioinformatics tools, we isolated and characterized an insect CDP gene from Beauveria bassiana 70 s.l. genomic DNA. The CDP gene (1240 bp with GeneBank accession no. KT804651.1) consisted of three introns and four CDS exons, and shared 74-100% sequence identity to the reference CDP genes. Its phylogenetic tree results showed a unique evolution pattern, and the predicted amino acid peptide (PAAP) consisted of 344 amino acid residues with pI, molecular weight, instability index, grand average hydropathicity value and aliphatic index of 7.2, 35.4 kDa, 24.45, -0.149, and 76.63, respectively. The gene possessed 74-89% amino acid sequence similarity to the 12 reference strains. Three motifs (Peptidase_S8 subtilase family) were detected in the PAAP, and the computed 3D structure possessed 79.09% structural identity to alkaline serine proteases. The PAAP had four (three serine proteases and one Pyridoxal-dependent decarboxylase) conserved domains, a disulfide bridge, two calcium binding sites, MY domain, and three predicted active sites in the serine family domains. These results will set the groundwork for further exploitation of proteases and understanding the mechanism of disease caused by cuticle-degrading-serine-proteases from entomopathogenic fungi.

  4. Salicylic acid induced cysteine protease activity during programmed cell death in tomato plants.

    PubMed

    Kovács, Judit; Poór, Péter; Szepesi, Ágnes; Tari, Irma

    2016-06-01

    The hypersensitive response (HR), a type of programmed cell death (PCD) during biotic stress is mediated by salicylic acid (SA). The aim of this work was to reveal the role of proteolysis and cysteine proteases in the execution of PCD in response of SA. Tomato plants were treated with sublethal (0.1 mM) and lethal (1 mM) SA concentrations through the root system. Treatment with 1 mM SA increased the electrolyte leakage and proteolytic activity and reduced the total protein content of roots after 6 h, while the proteolytic activity did not change in the leaves and in plants exposed to 0.1 mM SA. The expression of the papain-type cysteine protease SlCYP1, the vacuolar processing enzyme SlVPE1 and the tomato metacaspase SlMCA1 was induced within the first three hours in the leaves and after 0.5 h in the roots in the presence of 1 mM SA but the transcript levels did not increase significantly at sublethal SA. The Bax inhibitor-1 (SlBI-1), an antiapoptotic gene was over-expressed in the roots after SA treatments and it proved to be transient in the presence of sublethal SA. Protease inhibitors, SlPI2 and SlLTC were upregulated in the roots by sublethal SA but their expression remained low at 1 mM SA concentration. It is concluded that in contrast to leaves the SA-induced PCD is associated with increased proteolytic activity in the root tissues resulting from a fast up-regulation of specific cysteine proteases and down-regulation of protease inhibitors.

  5. Effect of exchange of amino acid residues of the surface region of the PST-01 protease on its organic solvent-stability.

    PubMed

    Ogino, Hiroyasu; Uchiho, Takeshi; Doukyu, Noriyuki; Yasuda, Masahiro; Ishimi, Kosaku; Ishikawa, Haruo

    2007-07-13

    The PST-01 protease from an organic solvent tolerant Pseudomonas aeruginosa has high stability and activity in the presence of various organic solvents. The structure gene of the PST-01 protease was amplified by the error-prone PCR method. The mutated proteases were incubated in the presence of acetonitrile. By measuring remaining activities, two kinds of mutated PST-01 proteases of which the stabilities were changed were selected. These mutations hardly changed the profile of the activity and stability at various pHs. Their activity and stability at higher temperatures were slightly lower than those of the wild-type PST-01 protease. The stabilities of the mutated enzymes in the presence of various organic solvents were greatly reduced. In both the mutated PST-01 proteases, amino acids located at the surface of the enzyme had been substituted.

  6. Homology among acid proteases: comparison of crystal structures at 3A resolution of acid proteases from Rhizopus chinensis and Endothia parasitica.

    PubMed Central

    Subramanian, E; Swan, I D; Liu, M; Davies, D R; Jenkins, J A; Tickle, I J; Blundell, T L

    1977-01-01

    The molecular structures of two fungal acid proteases at 3 A resolution have been compared, and found to have similar secondary and tertiary folding. These enzymes are bilobal and have a pronounced cleft between the two lobes. This cleft has been identified as the active site region from inhibitor binding studies. The results of the comparison are discussed in terms of homology among the acid proteases in general. Images PMID:322132

  7. Purification, characterization and gene cloning of Da-36, a novel serine protease from Deinagkistrodon acutus venom.

    PubMed

    Zheng, Ying; Ye, Feng-Ping; Wang, Jie; Liao, Guo-Yang; Zhang, Yun; Fan, Quan-Shui; Lee, Wen-Hui

    2013-06-01

    A serine protease termed Da-36 was isolated from crude venom of Deinagkistrodon acutus. The enzyme was a single chain protein with an apparent molecular weight of 36,000 on SDS-PAGE with an isoelectric point of 6.59. Da-36 could clot human plasma by cleaving the Aα, Bβ and γ chains of fibrinogen and also exhibited arginine esterase activity. The proteolytic activity of Da-36 toward TAME was strongly inhibited by PMSF and moderately affected by benzamidine and aprotinin, indicating that it was a serine protease. Meanwhile, Da-36 showed stability with wide temperature (20-50 °C) and pH value ranges (pH 6-10). Divalent metal ions of Ca(2+), Mg(2+), and Mn(2+) had no effects but Zn(2+) and Cu(2+) inhibited the arginine esterase activity of Da-36. Total DNA was extracted directly from the lyophilized crude venom and the gene (5.5 kbp) coding for Da-36 had been successfully cloned. Sequence analysis revealed that the Da-36 gene contained five exons and four introns. The mature Da-36 was encoded by four separate exons. The deduced mature amino acid sequence of Da-36 was in good agreement with the determined N-terminal sequence of the purified protein and shared high homology with other serine proteases isolated from different snake venoms. Blast search using amino acid sequence of Da-36 against public database revealed that Da-36 showed a maximal identity of 90% with both Dav-X (Swiss-Prot: Q9I8W9.1) and thrombin-like protein 1 (GenBank: AAW56608.1) from the same snake species, indicating that Da-36 is a novel serine protease.

  8. Identification of two new keratinolytic proteases from a Bacillus pumilus strain using protein analysis and gene sequencing.

    PubMed

    Fellahi, Soltana; Chibani, Abdelwaheb; Feuk-Lagerstedt, Elisabeth; Taherzadeh, Mohammad J

    2016-12-01

    The Bacillus strain (CCUG 66887) has a high capacity to excrete keratinase with the ability to degrade both alpha- and beta keratin. In this study we aimed to show the characteristics of the keratinolytic protease and to identify its gene by using liquid chromatography-electrospray ionization tandem mass spectrometry methods (nanoHPLC-ESI-MS/MS) followed by Mascot data base search. The results showed that the enzyme in fact consists of two different keratinases, both with a molecular mass of 38 kDa. Further, DNA sequencing generated the open reading frame (ORF) of one of the genes (Ker1), and de novo genome sequencing identified the ORF of the second gene (Ker2). The two keratinase genes contain 1153 base pairs each and have a gene similarity of 67 %. In addition, the Bacillus strain was classified as Bacillus pumilus and its genes were annotated in the GeneBank at NCBI (accession: CP011109.1). Amino acid sequences alignment with known B. pumilus proteases indicated that the two keratinases of B. pumilus strain C4 are subtilisin-like serine proteases belonging to the Protease S8 family. Taken together, these result suggest the two keratinases as promising candidates for enzymatic processing of keratinous wastes in waste refinery.

  9. Identification and partial characterization of extracellular aspartic protease genes from Metschnikowia pulcherrima IWBT Y1123 and Candida apicola IWBT Y1384.

    PubMed

    Reid, Vernita J; Theron, Louwrens W; du Toit, Maret; Divol, Benoit

    2012-10-01

    The extracellular acid proteases of non-Saccharomyces wine yeasts may fulfill a number of roles in winemaking, which include increasing the available nitrogen sources for the growth of fermentative microbes, affecting the aroma profile of the wine, and potentially reducing protein haze formation. These proteases, however, remain poorly characterized, especially at genetic level. In this study, two extracellular aspartic protease-encoding genes were identified and sequenced, from two yeast species of enological origin: one gene from Metschnikowia pulcherrima IWBT Y1123, named MpAPr1, and the other gene from Candida apicola IWBT Y1384, named CaAPr1. In silico analysis of these two genes revealed a number of features peculiar to aspartic protease genes, and both the MpAPr1 and CaAPr1 putative proteins showed homology to proteases of yeast genera. Heterologous expression of MpAPr1 in Saccharomyces cerevisiae YHUM272 confirmed that it encodes an aspartic protease. MpAPr1 production, which was shown to be constitutive, and secretion were confirmed in the presence of bovine serum albumin (BSA), casein, and grape juice proteins. The MpAPr1 gene was found to be present in 12 other M. pulcherrima strains; however, plate assays revealed that the intensity of protease activity was strain dependent and unrelated to the gene sequence.

  10. Identification and Partial Characterization of Extracellular Aspartic Protease Genes from Metschnikowia pulcherrima IWBT Y1123 and Candida apicola IWBT Y1384

    PubMed Central

    Reid, Vernita J.; Theron, Louwrens W.; du Toit, Maret

    2012-01-01

    The extracellular acid proteases of non-Saccharomyces wine yeasts may fulfill a number of roles in winemaking, which include increasing the available nitrogen sources for the growth of fermentative microbes, affecting the aroma profile of the wine, and potentially reducing protein haze formation. These proteases, however, remain poorly characterized, especially at genetic level. In this study, two extracellular aspartic protease-encoding genes were identified and sequenced, from two yeast species of enological origin: one gene from Metschnikowia pulcherrima IWBT Y1123, named MpAPr1, and the other gene from Candida apicola IWBT Y1384, named CaAPr1. In silico analysis of these two genes revealed a number of features peculiar to aspartic protease genes, and both the MpAPr1 and CaAPr1 putative proteins showed homology to proteases of yeast genera. Heterologous expression of MpAPr1 in Saccharomyces cerevisiae YHUM272 confirmed that it encodes an aspartic protease. MpAPr1 production, which was shown to be constitutive, and secretion were confirmed in the presence of bovine serum albumin (BSA), casein, and grape juice proteins. The MpAPr1 gene was found to be present in 12 other M. pulcherrima strains; however, plate assays revealed that the intensity of protease activity was strain dependent and unrelated to the gene sequence. PMID:22820332

  11. Distinguishing Functional Amino Acid Covariation from Background Linkage Disequilibrium in HIV Protease and Reverse Transcriptase

    PubMed Central

    Wang, Qi; Lee, Christopher

    2007-01-01

    Correlated amino acid mutation analysis has been widely used to infer functional interactions between different sites in a protein. However, this analysis can be confounded by important phylogenetic effects broadly classifiable as background linkage disequilibrium (BLD). We have systematically separated the covariation induced by selective interactions between amino acids from background LD, using synonymous (S) vs. amino acid (A) mutations. Covariation between two amino acid mutations, (A,A), can be affected by selective interactions between amino acids, whereas covariation within (A,S) pairs or (S,S) pairs cannot. Our analysis of the pol gene — including the protease and the reverse transcriptase genes — in HIV reveals that (A,A) covariation levels are enormously higher than for either (A,S) or (S,S), and thus cannot be attributed to phylogenetic effects. The magnitude of these effects suggests that a large portion of (A,A) covariation in the HIV pol gene results from selective interactions. Inspection of the most prominent (A,A) interactions in the HIV pol gene showed that they are known sites of independently identified drug resistance mutations, and physically cluster around the drug binding site. Moreover, the specific set of (A,A) interaction pairs was reproducible in different drug treatment studies, and vanished in untreated HIV samples. The (S,S) covariation curves measured a low but detectable level of background LD in HIV. PMID:17726544

  12. Characterization of a novel serine protease inhibitor gene from a marine metagenome.

    PubMed

    Jiang, Cheng-Jian; Hao, Zhen-Yu; Zeng, Rong; Shen, Pei-Hong; Li, Jun-Fang; Wu, Bo

    2011-01-01

    A novel serine protease inhibitor (serpin) gene designated as Spi1C was cloned via the sequenced-based screening of a metagenomic library from uncultured marine microorganisms. The gene had an open reading frame of 642 base pairs, and encoded a 214-amino acid polypeptide with a predicted molecular mass of about 28.7 kDa. The deduced amino acid sequence comparison and phylogenetic analysis indicated that Spi1C and some partial proteinase inhibitor I4 serpins were closely related. Functional characterization demonstrated that the recombinant Spi1C protein could inhibit a series of serine proteases. The Spi1C protein exhibited inhibitory activity against α-chymotrypsin and trypsin with K(i) values of around 1.79 × 10(-8) and 1.52 × 10(-8) M, respectively. No inhibition activity was exhibited against elastase. Using H-d-Phe-Pip-Arg-pNA as the chromogenic substrate, the optimum pH and temperature of the inhibition activity against trypsin were 7.0-8.0 and 25 °C, respectively. The identification of a novel serpin gene underscores the potential of marine metagenome screening for novel biomolecules.

  13. Novel zinc protease gene isolated from Dictyostelium discoideum is structurally related to mammalian leukotriene A4 hydrolase.

    PubMed

    Fan, D; Hou, L S

    2015-12-09

    The allantoicase (allC) gene of Dictyostelium discoideum allC RNAi mutant strain was silenced using the RNA interference technique. The mutant strain is motile, aggregated, and could not undergo further morphological development. The growth rate is high and the cells show a shortened cell cycle comparing with wild-type D. discoideum. However, the mechanisms regarding these actions remain unclear. mRNA differential display was used in this study to identify genetic differences. A novel D. discoideum gene (GenBank accession number: KC759140) encoding a new zinc protease was cloned. The amino acid sequence of the novel gene exhibited a conserved zinc-binding domain (HEX2HX18E) that allowed its classification into the M1 family of metallopeptidases. The gene encoded a 345-amino acid protein with a theoretical molecular mass of 39.69 kDa and a theoretical pI of 6.05. This protein showed strong homology with leukotriene A4 (LTA4) hydrolase of Homo sapiens (41% identity and 60% similarity at the amino acid level). By analyzing quantitative reverse transcription-polymerase chain reaction data, this zinc protease gene was more highly expressed in D. discoideum allC RNAi mutant type than in wild-type KAx-3 cells during the trophophase. The novel zinc protease gene may function as an LTA4 hydrolase and contribute to the shortening of the allC RNAi mutant cell cycle.

  14. Scouring Potential of Mesophile Acidic Proteases of Pseudomonas aeruginosa for Grey Cotton Fabrics

    NASA Astrophysics Data System (ADS)

    Saravanan, D.

    2013-04-01

    Mesophile, acidic proteases were produced using the microbial source, Pseudomonas aeruginosa, with wider thermal tolerances. Process conditions of scouring treatment were optimized using Taguchi method for optimum temperature, time, pH and concentration of protease. Treatment with the protease lower weight loss values compared to the alkali scouring, however, significant improvement in the absorbency compared to the grey samples was observed. Large amounts of pectin left out in the samples resulted in higher extractable impurities, substantiated by the FTIR results. Relatively, lower reduction in the tear strengths was observed in both warp and weft directions after protease treatment of the cotton fabrics.

  15. Cloning, expression, and characterization of a milk-clotting aspartic protease gene (Po-Asp) from Pleurotus ostreatus.

    PubMed

    Yin, Chaomin; Zheng, Liesheng; Chen, Liguo; Tan, Qi; Shang, Xiaodong; Ma, Aimin

    2014-02-01

    An aspartic protease gene from Pleurotus ostreatus (Po-Asp) had been cloned based on the 3' portion of cDNA in our previous work. The Po-Asp cDNA contained 1,324 nucleotides with an open reading frame (ORF) of 1,212 bp encoding 403 amino acid residues. The putative amino acid sequence included a signal peptide, an activation peptide, two most possible N-glycosylation sites and two conserved catalytic active site. The mature polypeptide with 327 amino acid residues had a calculated molecular mass of 35.3 kDa and a theoretical isoelectric point of 4.57. Basic Local Alignment Search Tool analysis showed 68-80 % amino acid sequence identical to other basidiomycetous aspartic proteases. Sequence comparison and evolutionary analysis revealed that Po-Asp is a member of fungal aspartic protease family. The DNA sequence of Po-Asp is 1,525 bp in length without untranslated region, consisting of seven exons and six introns. The Po-Asp cDNA without signal sequence was expressed in Pichia pastoris and sodium dodecyl sulfate-polyacrylamide gel electrophoresis demonstrated the molecular mass of recombinant Po-Asp was about 43 kDa. The crude recombinant aspartic protease had milk-clotting activity.

  16. Prevalence of genes encoding extracellular proteases in Staphylococcus aureus - important targets triggering immune response in vivo.

    PubMed

    Zdzalik, Michal; Karim, Abdulkarim Y; Wolski, Krzysztof; Buda, Pawel; Wojcik, Kinga; Brueggemann, Sarah; Wojciechowski, Piotr; Eick, Sigrun; Calander, Ann-Marie; Jonsson, Ing-Marie; Kubica, Malgorzata; Polakowska, Klaudia; Miedzobrodzki, Jacek; Wladyka, Benedykt; Potempa, Jan; Dubin, Grzegorz

    2012-11-01

    Proteases of Staphylococcus aureus have long been considered to function as important virulence factors, although direct evidence of the role of particular enzymes remains incomplete and elusive. Here, we sought to provide a collective view of the prevalence of extracellular protease genes in genomes of commensal and pathogenic strains of S. aureus and their expression in the course of human and mouse infection. Data on V8 protease, staphopains A and B, aureolysin, and the recently described and poorly characterized group of six Spl proteases are provided. A phylogenetically diverse collection of 167 clinical isolates was analyzed, resulting in the comprehensive genetic survey of the prevalence of protease-encoding genes. No correlation between identified gene patterns with specific infections was established. Humoral response against the proteases of interest was examined in the sera derived from human patients and from a model mouse infection. The analysis suggests that at least some, if not all, tested proteases are expressed and secreted during the course of infection. Overall, the results presented in this study support the hypothesis that the secretory proteases as a group may contribute to the virulence of S. aureus.

  17. NGF induction of the gene encoding the protease transin accompanies neuronal differentiation in PC12 cells.

    PubMed

    Machida, C M; Rodland, K D; Matrisian, L; Magun, B E; Ciment, G

    1989-06-01

    Various proteases have been found to be released by the growth cones of developing neurons in culture and have been hypothesized to play a role in the process of axon elongation. We report here that nerve growth factor (NGF) induced the gene encoding the metalloprotease transin in PC12 cells with a time course coincident with the initial appearance of neurites by these cells. Acidic and basic fibroblast growth factors also stimulated transin mRNA expression and neurite outgrowth, whereas various other agents had no effects on either of these phenomena. In contrast, dexamethasone was found to inhibit the induction of transin mRNA when added with, or following, NGF treatment. Finally, we show that sequences contained within 750 bp of the 5' untranscribed region of the transin gene confer responsiveness to NGF and dexamethasone.

  18. MOLECULAR IDENTIFICATION OF CYSTEINE AND TRYPSIN PROTEASE, EFFECT OF DIFFERENT HOSTS ON PROTEASE EXPRESSION, AND RNAI MEDIATED SILENCING OF CYSTEINE PROTEASE GENE IN THE SUNN PEST.

    PubMed

    Amiri, Azam; Bandani, Ali Reza; Alizadeh, Houshang

    2016-04-01

    Sunn pest, Eurygaster integriceps, is a serious pest of cereals in the wide area of the globe from Near and Middle East to East and South Europe and North Africa. This study described for the first time, identification of E. integriceps trypsin serine protease and cathepsin-L cysteine, transcripts involved in digestion, which might serve as targets for pest control management. A total of 478 and 500 base pair long putative trypsin and cysteine gene sequences were characterized and named Tryp and Cys, respectively. In addition, the tissue-specific relative gene expression levels of these genes as well as gluten hydrolase (Gl) were determined under different host kernels feeding conditions. Result showed that mRNA expression of Cys, Tryp, and Gl was significantly affected after feeding on various host plant species. Transcript levels of these genes were most abundant in the wheat-fed E. integriceps larvae compared to other hosts. The Cys transcript was detected exclusively in the gut, whereas the Gl and Tryp transcripts were detectable in both salivary glands and gut. Also possibility of Sunn pest gene silencing was studied by topical application of cysteine double-stranded RNA (dsRNA). The results indicated that topically applied dsRNA on fifth nymphal stage can penetrate the cuticle of the insect and induce RNA interference. The Cys gene mRNA transcript in the gut was reduced to 83.8% 2 days posttreatment. Also, it was found that dsRNA of Cys gene affected fifth nymphal stage development suggesting the involvement of this protease in the insect growth, development, and molting.

  19. The circadian Clock gene regulates acrosin activity of sperm through serine protease inhibitor A3K

    PubMed Central

    Cheng, Shuting; Liang, Xin; Wang, Yuhui; Jiang, Zhou; Liu, Yanyou; Hou, Wang; Li, Shiping; Zhang, Jing

    2015-01-01

    Our previous study found that CLOCK knockdown in the testes of male mice led to a reduced fertility, which might be associated with the lower acrosin activity. In this present study, we examined the differential expression in proteins of CLOCK knockdown sperm. Clock gene expression was knocked down in cells to confirm those differentially expressions and serine protease inhibitor SERPINA3K was identified as a potential target. The up-regulated SERPINA3K revealed an inverse relationship with Clock knockdown. Direct treatment of normal sperm with recombinant SERPINA3K protein inhibited the acrosin activity and reduced in vitro fertilization rate. The luciferase reporter gene assay showed that the down-regulated of Clock gene could activate the Serpina3k promoter, but this activation was not affected by the mutation of E-box core sequence. Co-IP demonstrated a natural interaction between SERPIAN3K and RORs (α and β). Taken together, these results demonstrated that SERPINA3K is involved in the Clock gene-mediated male fertility by regulating acrosin activity and provide the first evidence that SERPINA3K could be regulated by Clock gene via retinoic acid-related orphan receptor response elements. PMID:26264441

  20. Characterization of cysteine protease-like genes in the striped rice stem borer, Chilo suppressalis.

    PubMed

    Ge, Zhao-Yu; Wan, Pin-Jun; Li, Guo-Qing; Xia, Yong-Gui; Han, Zhao-Jun

    2014-02-01

    The striped rice stem borer, Chilo suppressalis (Walker), is a major pest for rice production in China and the rest of Southeast Asia. Chemical control is the main means to alleviate losses due to this pest, which causes serious environmental pollution. An effective and environmentally friendly approach is needed for the management of the striped rice stem borer. Cysteine proteases in insects could be useful targets for pest management either through engineering plant protease inhibitors, targeting insect digestive cysteine proteases, or through RNA interference-based silencing of cysteine proteases, disrupting developmental regulation of insects. In this study, eight cysteine protease-like genes were identified and partially characterized. The genes CCO2 and CCL4 were exclusively expressed in the larval gut, and their expression was affected by the state of nutrition in the insect. The expression of CCL2, CCL3, and CCO1 was significantly affected by the type of host plant, suggesting a role in host plant - insect interactions. Our initial characterization of the striped rice stem borer cysteine protease-like genes provides a foundation for further research on this important group of genes in this major insect pest of rice.

  1. Functional analysis of five trypsin-like protease genes in the oriental fruit fly, Bactrocera dorsalis (Diptera: Tephritidae).

    PubMed

    Li, Ya-Li; Hou, Ming-Zhe; Shen, Guang-Mao; Lu, Xue-Ping; Wang, Zhe; Jia, Fu-Xian; Wang, Jin-Jun; Dou, Wei

    2017-03-01

    Insect midgut proteases catalyze the release of free amino acids from dietary proteins and are essential for insect normal development. To date, digestive proteases as potential candidates have made great progress in pest control. To clarify the function of trypsin-like protease genes in the digestive system of Bactrocera dorsalis, a serious pest of a wide range of tropical and subtropical fruit and vegetable crops, five trypsin genes (BdTry1, BdTry2, BdTry3, BdTry4 and BdTry5) were identified from transcriptome dataset, and the effects of feeding condition on their expression levels were examined subsequently. RNA interference (RNAi) was applied to further explore their function on the growth of B. dorsalis. The results showed that all the BdTrys in starving midgut expressed at a minimal level but up-regulated upon feeding (except BdTry3). Besides, RNAi by feeding dsRNAs to larvae proved to be an effective method to cause gene silencing and the mixed dsRNAs of the five BdTrys slowed larvae growth of B. dorsalis. The current data suggest that trypsin genes are actively involved in digestion process of B. dorsalis larvae and thereafter play crucial roles in their development.

  2. Cloning of the gene encoding streptococcal immunoglobulin A protease and its expression in Escherichia coli.

    PubMed Central

    Gilbert, J V; Plaut, A G; Fishman, Y; Wright, A

    1988-01-01

    We have identified and cloned a 6-kilobase-pair segment of chromosomal DNA from Streptococcus sanguis ATCC 10556 that encodes immunoglobulin A (IgA) protease activity when cloned into Escherichia coli. The enzyme specified by the iga gene in plasmid pJG1 accumulates in the periplasm of E. coli MM294 cells and has a substrate specificity for human IgA1 identical to that of native S. sanguis protease. Hybridization experiments with probes from within the encoding DNA showed no detectable homology at the nucleotide sequence level with chromosomal DNA of gram-negative bacteria that excrete IgA protease. Moreover, the S. sanguis iga gene probes showed no detectable hybridization with chromosomal DNA of S. pneumoniae, although the IgA proteases of these two streptococcal species cleaved the identical peptide bond in the human IgA1 heavy-chain hinge region. Images PMID:3294181

  3. Purification and characterization of cloned alkaline protease gene of Geobacillus stearothermophilus.

    PubMed

    Iqbal, Irfana; Aftab, Muhammad Nauman; Afzal, Mohammed; Ur-Rehman, Asad; Aftab, Saima; Zafar, Asma; Ud-Din, Zia; Khuharo, Ateeque Rahman; Iqbal, Jawad; Ul-Haq, Ikram

    2015-02-01

    Thermostable alkaline serine protease gene of Geobacillus stearothermophilus B-1172 was cloned and expressed in Escherichia coli BL21 (DE3) using pET-22b(+), as an expression vector. The growth conditions were optimized for maximal production of the protease using variable fermentation parameters, i.e., pH, temperature, and addition of an inducer. Protease, thus produced, was purified by ammonium sulfate precipitation followed by ion exchange chromatography with 13.7-fold purification, with specific activity of 97.5 U mg(-1) , and a recovery of 23.6%. Molecular weight of the purified protease, 39 kDa, was determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The enzyme was stable at 90 °C at pH 9. The enzyme activity was steady in the presence of EDTA indicating that the protease was not a metalloprotease. No significant change in the activity of protease after addition of various metal ions further strengthened this fact. However, an addition of 1% Triton X-100 or SDS surfactants constrained the enzyme specific activity to 34 and 19%, respectively. Among organic solvents, an addition of 1-butanol (20%) augmented the enzyme activity by 29% of the original activity. With casein as a substrate, the enzyme activity under optimized conditions was found to be 73.8 U mg(-1) . The effect of protease expression on the host cells growth was also studied and found to negatively affect E. coli cells to certain extent. Catalytic domains of serine proteases from eight important thermostable organisms were analyzed through WebLogo and found to be conserved in all serine protease sequences suggesting that protease of G. stearothermophilus could be beneficially used as a biocontrol agent and in many industries including detergent industry.

  4. Skin Barrier Recovery by Protease-Activated Receptor-2 Antagonist Lobaric Acid

    PubMed Central

    Joo, Yeon Ah; Chung, Hyunjin; Yoon, Sohyun; Park, Jong Il; Lee, Ji Eun; Myung, Cheol Hwan; Hwang, Jae Sung

    2016-01-01

    Atopic dermatitis (AD) results from gene and environment interactions that lead to a range of immunological abnormalities and breakdown of the skin barrier. Protease-activated receptor 2 (PAR2) belongs to a family of G-protein coupled receptors and is expressed in suprabasal layers of the epidermis. PAR2 is activated by both trypsin and a specific agonist peptide, SLIGKV-NH2 and is involved in both epidermal permeability barrier homeostasis and epithelial inflammation. In this study, we investigated the effect of lobaric acid on inflammation, keratinocyte differentiation, and recovery of the skin barrier in hairless mice. Lobaric acid blocked trypsin-induced and SLIGKV-NH2-induced PAR2 activation resulting in decreased mobilization of intracellular Ca2+ in HaCaT keratinocytes. Lobaric acid reduced expression of interleukin-8 induced by SLIGKV-NH2 and thymus and activation regulated chemokine (TARC) induced by tumor necrosis factor-a (TNF-α) and IFN-γ in HaCaT keratinocytes. Lobaric acid also blocked SLIGKV-NH2-induced activation of ERK, which is a downstream signal of PAR2 in normal human keratinocytes (NHEKs). Treatment with SLIGKV-NH2 downregulated expression of involucrin, a differentiation marker protein in HaCaT keratinocytes, and upregulated expression of involucrin, transglutamase1 and filaggrin in NHEKs. However, lobaric acid antagonized the effect of SLIGKV-NH2 in HaCaT keratinocytes and NHEKs. Topical application of lobaric acid accelerated barrier recovery kinetics in a SKH-1 hairless mouse model. These results suggested that lobaric acid is a PAR2 antagonist and could be a possible therapeutic agent for atopic dermatitis. PMID:27169822

  5. Potent inhibitors of HCV-NS3 protease derived from boronic acids

    SciTech Connect

    Venkatraman, Srikanth; Wu, Wanli; Prongay, Andrew; Girijavallabhan, Viyyoor; Njoroge, F. George

    2009-07-23

    Chronic hepatitis C infection is the leading causes for cirrhosis of the liver and hepatocellular carcinoma, leading to liver failure and liver transplantation. The etiological agent, HCV virus produces a single positive strand of RNA that is processed with the help of serine protease NS3 to produce mature virus. Inhibition of NS3 protease can be potentially used to develop effective drugs for HCV infections. Numerous efforts are now underway to develop potent inhibitors of HCV protease that contain ketoamides as serine traps. Herein we report the synthesis of a series of potent inhibitors that contain a boronic acid as a serine trap. The activity of these compounds were optimized to 200 pM. X-ray structure of compound 17 bound to NS3 protease is also discussed.

  6. Molecular characterization of a gene encoding extracellular serine protease isolated from a subtilisin inhibitor-deficient mutant of Streptomyces albogriseolus S-3253.

    PubMed Central

    Taguchi, S; Odaka, A; Watanabe, Y; Momose, H

    1995-01-01

    An extracellular serine protease produced by a mutant, M1, derived from Streptomyces albogriseolus S-3253 that no longer produces a protease inhibitor (Streptomyces subtilisin inhibitor [SSI]) was isolated. A 20-kDa protein was purified by its affinity for SSI and designated SAM-P20. The amino acid sequence of the amino-terminal region of SAM-P20 revealed high homology with the sequences of Streptomyces griseus proteases A and B, and the gene sequence confirmed the relationships. The sequence also revealed a putative amino acid signal sequence for SAM-P20 that apparently functioned to allow secretion of SAM-P20 from Escherichia coli carrying the recombinant gene. SAM-P20 produced by E. coli cells was shown to be sensitive to SSI inhibition. PMID:7887600

  7. Cloning and targeted disruption, via Agrobacterium tumefaciens-mediated transformation, of a trypsin protease gene from the vascular wilt fungus Verticillium dahliae.

    PubMed

    Dobinson, Katherine F; Grant, Sandra J; Kang, Seogchan

    2004-02-01

    A gene encoding a trypsin protease was isolated from a tomato isolate of Verticillium dahliae. The gene, designated VTP1, contains two introns and is predicted to encode a protein of 256 amino acids. The gene is present in V. dahliae isolates from different host plants and in V. albo-atrum; weakly hybridizing sequences are present in V. tricorpus. VTP1 cDNA sequences were identified in a sequence tag analysis of genes expressed under growth conditions that promote microsclerotia development. Replacement of the gene, by Agrobacterium tumefaciens-mediated transformation (ATMT), with a mutant allele construct did not noticeably alter either pathogenicity or growth in culture. Searches of expressed sequence tag databases showed that, in addition to the VTP1 gene, V. dahliae contains two genes encoding subtilisin-like proteases similar to those produced by pathogenic Aspergillus spp. This is the first description of the application of ATMT to the molecular analysis of phytopathogenic Verticillium spp.

  8. Nonnatural amino acid incorporation into the methionine 214 position of the metzincin Pseudomonas aeruginosa alkaline protease

    PubMed Central

    Walasek, Paula; Honek, John F

    2005-01-01

    Background The alkaline protease from Pseudomonas aeruginosa (AprA) is a member of the metzincin superfamily of metalloendoproteases. A key feature of these proteases is a conserved methionine-containing 1,4-tight β turn at the base of the active site zinc binding region. Results To explore the invariant methionine position in this class of protease, incorporation of a nonnatural fluorinated methionine, L-difluoromethionine (DFM), into this site was accomplished. Although overproduction of the N-terminal catalytic fragment of AprA resulted in protein aggregates which could not be resolved, successful heterologous production of the entire AprA was accomplished in the presence and absence of the nonnatural amino acid. DFM incorporation was found to only slightly alter the enzyme kinetics of AprA. In addition, differential scanning calorimetry indicated no significant alteration in the thermal stability of the modified enzyme. Conclusion Although invariant in all metzincin proteases, the methionine 214 position in AprA can be successfully replaced by the nonnatural amino acid DFM resulting in little effect on protein structure and function. This study indicates that the increased size of the methyl group by the introduction of two fluorines is still sufficiently non-sterically demanding, and bodes well for the application of DFM to biophysical studies of protein structure and function in this class of protease. PMID:16221305

  9. MALT1 Protease Activity Controls the Expression of Inflammatory Genes in Keratinocytes upon Zymosan Stimulation.

    PubMed

    Schmitt, Anja; Grondona, Paula; Maier, Tabea; Brändle, Marc; Schönfeld, Caroline; Jäger, Günter; Kosnopfel, Corinna; Eberle, Franziska C; Schittek, Birgit; Schulze-Osthoff, Klaus; Yazdi, Amir S; Hailfinger, Stephan

    2016-04-01

    The protease activity of the paracaspase mucosa-associated lymphoid tissue lymphoma translocation gene 1 (MALT1) plays an important role in antigen receptor-mediated lymphocyte activation by controlling the activity of the transcription factor nuclear factor-κB and is thus essential for the expression of inflammatory target genes. MALT1 is not only present in cells of the hematopoietic lineage, but is ubiquitously expressed. Here we report that stimulation with zymosan or Staphylococcus aureus induced MALT1 protease activity in human primary keratinocytes. Inhibition of the Src family of kinases or novel protein kinase C isoforms as well as silencing of CARMA2 or BCL10 interfered with activation of MALT1 protease. Silencing or inhibition of MALT1 protease strongly decreased the expression of important inflammatory genes such as TNFα, IL-17C, CXCL8 and HBD-2. MALT1-inhibited cells were unable to mount an antimicrobial response upon zymosan stimulation or phorbolester/ionomycin treatment, demonstrating a central role of MALT1 protease activity in keratinocyte immunity and suggesting MALT1 as a potential target in inflammatory skin diseases.

  10. The gene encoding DRAP (BACE2), a glycosylated transmembrane protein of the aspartic protease family, maps to the down critical region.

    PubMed

    Acquati, F; Accarino, M; Nucci, C; Fumagalli, P; Jovine, L; Ottolenghi, S; Taramelli, R

    2000-02-18

    We applied cDNA selection methods to a genomic clone (YAC 761B5) from chromosome 21 located in the so-called 'Down critical region' in 21q22.3. Starting from human fetal heart and brain mRNAs we obtained and sequenced several cDNA clones. One of these clones (Down region aspartic protease (DRAP), named also BACE2 according to the gene nomenclature) revealed a striking nucleotide and amino acid sequence identity with several motifs present in members of the aspartic protease family. In particular the amino acid sequences comprising the two catalytic sites found in all mammalian aspartic proteases are perfectly conserved. Interestingly, the predicted protein shows a typical membrane spanning region; this is at variance with most other known aspartic proteases, which are soluble molecules. We present preliminary evidence, on the basis of in vitro translation studies and cell transfection, that this gene encodes a glycosylated protein which localizes mainly intracellularly but to some extent also to the plasma membrane. Furthermore DRAP/BACE2 shares a high homology with a newly described beta-secretase enzyme (BACE-1) which is a transmembrane aspartic protease. The implications of this finding for Down syndrome are discussed.

  11. Cysteine protease gene expression and proteolytic activity during senescence of Alstroemeria petals.

    PubMed

    Wagstaff, Carol; Leverentz, Michael K; Griffiths, Gareth; Thomas, Brian; Chanasut, Usawadee; Stead, Anthony D; Rogers, Hilary J

    2002-02-01

    The functional life of the flower is terminated by senescence and/or abscission. Multiple processes contribute to produce the visible signs of petal wilting and inrolling that typify senescence, but one of the most important is that of protein degradation and remobilization. This is mediated in many species through protein ubiquitination and the action of specific protease enzymes. This paper reports the changes in protein and protease activity during development and senescence of Alstroemeria flowers, a Liliaceous species that shows very little sensitivity to ethylene during senescence and which shows perianth abscission 8-10 d after flower opening. Partial cDNAs of ubiquitin (ALSUQ1) and a putative cysteine protease (ALSCYP1) were cloned from Alstroemeria using degenerate PCR primers and the expression pattern of these genes was determined semi-quantitatively by RT-PCR. While the levels of ALSUQ1 only fluctuated slightly during floral development and senescence, there was a dramatic increase in the expression of ALSCYP1 indicating that this gene may encode an important enzyme for the proteolytic process in this species. Three papain class cysteine protease enzymes showing different patterns of activity during flower development were identified on zymograms, one of which showed a similar expression pattern to the cysteine protease cDNA.

  12. Acidic mammalian chitinase is a proteases-resistant glycosidase in mouse digestive system

    PubMed Central

    Ohno, Misa; Kimura, Masahiro; Miyazaki, Haruko; Okawa, Kazuaki; Onuki, Riho; Nemoto, Chiyuki; Tabata, Eri; Wakita, Satoshi; Kashimura, Akinori; Sakaguchi, Masayoshi; Sugahara, Yasusato; Nukina, Nobuyuki; Bauer, Peter O.; Oyama, Fumitaka

    2016-01-01

    Chitinases are enzymes that hydrolyze chitin, a polymer of β-1, 4-linked N-acetyl-D-glucosamine (GlcNAc). Chitin has long been considered as a source of dietary fiber that is not digested in the mammalian digestive system. Here, we provide evidence that acidic mammalian chitinase (AMCase) can function as a major digestive enzyme that constitutively degrades chitin substrates and produces (GlcNAc)2 fragments in the mouse gastrointestinal environment. AMCase was resistant to endogenous pepsin C digestion and remained active in the mouse stomach extract at pH 2.0. The AMCase mRNA levels were much higher than those of four major gastric proteins and two housekeeping genes and comparable to the level of pepsinogen C in the mouse stomach tissues. Furthermore, AMCase was expressed in the gastric pepsinogen-synthesizing chief cells. The enzyme was also stable and active in the presence of trypsin and chymotrypsin at pH 7.6, where pepsin C was completely degraded. Mouse AMCase degraded polymeric colloidal and crystalline chitin substrates in the gastrointestinal environments in presence of the proteolytic enzymes. Thus, AMCase can function as a protease-resistant major glycosidase under the conditions of stomach and intestine and degrade chitin substrates to produce (GlcNAc)2, a source of carbon, nitrogen and energy. PMID:27883045

  13. Site-Directed Mutagenesis and Structural Studies Suggest that the Germination Protease, GPR, in Spores of Bacillus Species Is an Atypical Aspartic Acid Protease

    PubMed Central

    Carroll, Thomas M.; Setlow, Peter

    2005-01-01

    Germination protease (GPR) initiates the degradation of small, acid-soluble spore proteins (SASP) during germination of spores of Bacillus and Clostridium species. The GPR amino acid sequence is not homologous to members of the major protease families, and previous work has not identified residues involved in GPR catalysis. The current work has focused on identifying catalytically essential amino acids by mutagenesis of Bacillus megaterium gpr. A residue was selected for alteration if it (i) was conserved among spore-forming bacteria, (ii) was a potential nucleophile, and (iii) had not been ruled out as inessential for catalysis. GPR variants were overexpressed in Escherichia coli, and the active form (P41) was assayed for activity against SASP and the zymogen form (P46) was assayed for the ability to autoprocess to P41. Variants inactive against SASP and unable to autoprocess were analyzed by circular dichroism spectroscopy and multiangle laser light scattering to determine whether the variant's inactivity was due to loss of secondary or quaternary structure, respectively. Variation of D127 and D193, but no other residues, resulted in inactive P46 and P41, while variants of each form were well structured and tetrameric, suggesting that D127 and D193 are essential for activity and autoprocessing. Mapping these two aspartate residues and a highly conserved lysine onto the B. megaterium P46 crystal structure revealed a striking similarity to the catalytic residues and propeptide lysine of aspartic acid proteases. These data indicate that GPR is an atypical aspartic acid protease. PMID:16199582

  14. Glutamate alteration of glutamic acid decarboxylase (GAD) in GABAergic neurons: the role of cysteine proteases.

    PubMed

    Monnerie, Hubert; Le Roux, Peter D

    2008-09-01

    Brain cell vulnerability to neurologic insults varies greatly, depending on their neuronal subpopulation. Among cells that survive a pathological insult such as ischemia or brain trauma, some may undergo morphological and/or biochemical changes that could compromise brain function. We previously reported that surviving cortical GABAergic neurons exposed to glutamate in vitro displayed an NMDA receptor (NMDAR)-mediated alteration in the levels of the GABA synthesizing enzyme glutamic acid decarboxylase (GAD65/67) [Monnerie, H., Le Roux, P., 2007. Reduced dendrite growth and altered glutamic acid decarboxylase (GAD) 65- and 67-kDa isoform protein expression from mouse cortical GABAergic neurons following excitotoxic injury in vitro. Exp. Neurol. 205, 367-382]. In this study, we examined the mechanisms by which glutamate excitotoxicity caused a change in cortical GABAergic neurons' GAD protein levels. Removing extracellular calcium prevented the NMDAR-mediated decrease in GAD protein levels, measured using Western blot techniques, whereas inhibiting calcium entry through voltage-gated calcium channels had no effect. Glutamate's effect on GAD protein isoforms was significantly attenuated by preincubation with the cysteine protease inhibitor N-Acetyl-L-Leucyl-L-Leucyl-L-norleucinal (ALLN). Using class-specific protease inhibitors, we observed that ALLN's effect resulted from the blockade of calpain and cathepsin protease activities. Cell-free proteolysis assay confirmed that both proteases were involved in glutamate-induced alteration in GAD protein levels. Together these results suggest that glutamate-induced excitotoxic stimulation of NMDAR in cultured cortical neurons leads to altered GAD protein levels from GABAergic neurons through intracellular calcium increase and protease activation including calpain and cathepsin. Biochemical alterations in surviving cortical GABAergic neurons in various disease states may contribute to the altered balance between excitation

  15. Alternative splicing, a new target to block cellular gene expression by poliovirus 2A protease

    SciTech Connect

    Alvarez, Enrique; Castello, Alfredo; Carrasco, Luis; Izquierdo, Jose M.

    2011-10-14

    Highlights: {yields} Novel role for poliovirus 2A protease as splicing modulator. {yields} Poliovirus 2A protease inhibits the alternative splicing of pre-mRNAs. {yields} Poliovirus 2A protease blocks the second catalytic step of splicing. -- Abstract: Viruses have developed multiple strategies to interfere with the gene expression of host cells at different stages to ensure their own survival. Here we report a new role for poliovirus 2A{sup pro} modulating the alternative splicing of pre-mRNAs. Expression of 2A{sup pro} potently inhibits splicing of reporter genes in HeLa cells. Low amounts of 2A{sup pro} abrogate Fas exon 6 skipping, whereas higher levels of protease fully abolish Fas and FGFR2 splicing. In vitro splicing of MINX mRNA using nuclear extracts is also strongly inhibited by 2A{sup pro}, leading to accumulation of the first exon and the lariat product containing the unspliced second exon. These findings reveal that the mechanism of action of 2A{sup pro} on splicing is to selectively block the second catalytic step.

  16. Protease Gene Duplication and Proteolytic Activity in Drosophila Female Reproductive Tracts

    PubMed Central

    Kelleher, Erin S.; Pennington, James E.

    2009-01-01

    Secreted proteases play integral roles in sexual reproduction in a broad range of taxa. In the genetic model Drosophila melanogaster, these molecules are thought to process peptides and activate enzymes inside female reproductive tracts, mediating critical postmating responses. A recent study of female reproductive tract proteins in the cactophilic fruit fly Drosophila arizonae, identified pervasive, lineage-specific gene duplication amongst secreted proteases. Here, we compare the evolutionary dynamics, biochemical nature, and physiological significance of secreted female reproductive serine endoproteases between D. arizonae and its congener D. melanogaster. We show that D. arizonae lower female reproductive tract (LFRT) proteins are significantly enriched for recently duplicated secreted proteases, particularly serine endoproteases, relative to D. melanogaster. Isolated lumen from D. arizonae LFRTs, furthermore, exhibits significant trypsin-like and elastase-like serine endoprotease acitivity, whereas no such activity is seen in D. melanogaster. Finally, trypsin- and elastase-like activity in D. arizonae female reproductive tracts is negatively regulated by mating. We propose that the intense proteolytic environment of the D. arizonae female reproductive tract relates to the extraordinary reproductive physiology of this species and that ongoing gene duplication amongst these proteases is an evolutionary consequence of sexual conflict. PMID:19546158

  17. A Mycobacterium avium subsp. paratuberculosis Predicted Serine Protease Is Associated with Acid Stress and Intraphagosomal Survival

    PubMed Central

    Kugadas, Abirami; Lamont, Elise A.; Bannantine, John P.; Shoyama, Fernanda M.; Brenner, Evan; Janagama, Harish K.; Sreevatsan, Srinand

    2016-01-01

    The ability to maintain intra-cellular pH is crucial for bacteria and other microbes to survive in diverse environments, particularly those that undergo fluctuations in pH. Mechanisms of acid resistance remain poorly understood in mycobacteria. Although, studies investigating acid stress in M. tuberculosis are gaining traction, few center on Mycobacterium avium subsp. paratuberculosis (MAP), the etiological agent of chronic enteritis in ruminants. We identified a MAP acid stress response network involved in macrophage infection. The central node of this network was MAP0403, a predicted serine protease that shared an 86% amino acid identity with MarP in M. tuberculosis. Previous studies confirmed MarP as a serine protease integral to maintaining intra-bacterial pH and survival in acid in vitro and in vivo. We show that MAP0403 is upregulated in infected macrophages and MAC-T cells that coincided with phagosome acidification. Treatment of mammalian cells with bafilomcyin A1, a potent inhibitor of phagosomal vATPases, diminished MAP0403 transcription. MAP0403 expression was also noted in acidic medium. A surrogate host, M. smegmatis mc2 155, was designed to express MAP0403 and when exposed to either macrophages or in vitro acid stress had increased bacterial cell viability, which corresponds to maintenance of intra-bacterial pH in acidic (pH = 5) conditions, compared to the parent strain. These data suggest that MAP0403 may be the equivalent of MarP in MAP. Future studies confirming MAP0403 as a serine protease and exploring its structure and possible substrates are warranted. PMID:27597934

  18. Proteaselike sequence in hepatitis B virus core antigen is not required for e antigen generation and may not be part of an aspartic acid-type protease.

    PubMed Central

    Nassal, M; Galle, P R; Schaller, H

    1989-01-01

    The hepatitis B virus (HBV) C gene directs the synthesis of two major gene products: HBV core antigen (HBcAg[p21c]), which forms the nucleocapsid, and HBV e antigen (HBeAg [p17e]), a secreted antigen that is produced by several processing events during its maturation. These proteins contain an amino acid sequence similar to the active-site residues of aspartic acid and retroviral proteases. On the basis of this sequence similarity, which is highly conserved among mammalian hepadnaviruses, a model has been put forward according to which processing to HBeAg is due to self-cleavage of p21c involving the proteaselike sequence. Using site-directed mutagenesis in conjunction with transient expression of HBV proteins in the human hepatoma cell line HepG2, we tested this hypothesis. Our results with HBV mutants in which one or two of the conserved amino acids have been replaced by others suggest strongly that processing to HBeAg does not depend on the presence of an intact proteaselike sequence in the core protein. Attempts to detect an influence of this sequence on the processing of HBV P gene products into enzymatically active viral polymerase also gave no conclusive evidence for the existence of an HBV protease. Mutations replacing the putatively essential aspartic acid showed little effect on polymerase activity. Additional substitution of the likewise conserved threonine residue by alanine, in contrast, almost abolished the activity of the polymerase. We conclude that an HBV protease, if it exists, is functionally different from aspartic acid and retroviral proteases. Images PMID:2657101

  19. Overexpression of Aspergillus tubingensis faeA in protease-deficient Aspergillus niger enables ferulic acid production from plant material.

    PubMed

    Zwane, Eunice N; Rose, Shaunita H; van Zyl, Willem H; Rumbold, Karl; Viljoen-Bloom, Marinda

    2014-06-01

    The production of ferulic acid esterase involved in the release of ferulic acid side groups from xylan was investigated in strains of Aspergillus tubingensis, Aspergillus carneus, Aspergillus niger and Rhizopus oryzae. The highest activity on triticale bran as sole carbon source was observed with the A. tubingensis T8.4 strain, which produced a type A ferulic acid esterase active against methyl p-coumarate, methyl ferulate and methyl sinapate. The activity of the A. tubingensis ferulic acid esterase (AtFAEA) was inhibited twofold by glucose and induced twofold in the presence of maize bran. An initial accumulation of endoglucanase was followed by the production of endoxylanase, suggesting a combined action with ferulic acid esterase on maize bran. A genomic copy of the A. tubingensis faeA gene was cloned and expressed in A. niger D15#26 under the control of the A. niger gpd promoter. The recombinant strain has reduced protease activity and does not acidify the media, therefore promoting high-level expression of recombinant enzymes. It produced 13.5 U/ml FAEA after 5 days on autoclaved maize bran as sole carbon source, which was threefold higher than for the A. tubingensis donor strain. The recombinant AtFAEA was able to extract 50 % of the available ferulic acid from non-pretreated maize bran, making this enzyme suitable for the biological production of ferulic acid from lignocellulosic plant material.

  20. Prorenin processing enzyme (PPE) produced by Baculovirus-infected Sf-9 insect cells: PPE is the cysteine protease encoded in the acMNPV gene.

    PubMed

    Gotoh, Takeshi; Awa, Hirono; Kikuchi, Ken-Ichi; Nirasawa, Satoru; Takahashi, Saori

    2010-01-01

    In infection cultures of Spodoptera frugiperda (Sf-9) insect cells with a recombinant baculovirus, vhpR, carrying human preprorenin cDNA in the polyhedrin locus of Autographa californica multiple nuclear polyhedrosis virus (AcMNPV), the expressed inactive recombinant human (rh)-prorenin is reported to be proteolytically processed to yield active rh-renin in the very late phase of culture (Takahashi et al., Biosci. Biotechnol. Biochem., 71, 2610-2613 (2007)). To identify the enzyme that catalyzes the processing of rh-prorenin, referred to as prorenin processing enzyme (PPE), we purified potential PPE from virus-infected Sf-9 culture supernatant by the use of an internally quenched fluorescent (IQF) substrate for PPE. The 32-kDa protein band agreed well with PPE activity on the final Mono Q FPLC. By N-terminal amino acid sequence analysis, the protein was revealed to be a cysteine protease encoded by the AcMNPV gene. Enzyme activity was inhibited by cysteine protease inhibitors but not by other protease inhibitors. When the purified rh-prorenin was incubated with the 32-kDa protein, renin activity appeared concomitant with the disappearance of rh-prorenin. The N-terminal amino acid sequence of the activated product was identical to that of the rh-renin that had accumulated in the infection cultures. These results indicate that the 32-kDa cysteine protease derived from the AcMNPV gene is the enzyme PPE of virus-infected Sf-9 cells.

  1. Protease activity at invadopodial focal digestive areas is dependent on NHE1-driven acidic pHe.

    PubMed

    Greco, Maria Raffaella; Antelmi, Ester; Busco, Giovanni; Guerra, Lorenzo; Rubino, Rosa; Casavola, Valeria; Reshkin, Stephan Joel; Cardone, Rosa Angela

    2014-02-01

    Degradation of the extracellular matrix (ECM) is a critical step of tumor cell invasion and requires protease-dependent proteolysis focalized at the invadopodia where the proteolysis of the ECM occurs. Most of the extracellular proteases belong to serine- or metallo-proteases and the invadopodia is where protease activity is regulated. While recent data looking at global protease activity in the growth medium reported that their activity and role in invasion is dependent on Na+/H+ exchanger 1 (NHE1)-driven extracellular acidification, there is no data on this aspect at the invadopodia, and an open question remains whether this acid extracellular pH (pHe) activation of proteases in tumor cells occurs preferentially at invadopodia. We previously reported that the NHE1 is expressed in breast cancer invadopodia and that the NHE1‑dependent acidification of the peri-invadopodial space is critical for ECM proteolysis. In the present study, using, for the first time, in situ zymography analysis, we demonstrated a concordance between NHE1 activity, extracellular acidification and protease activity at invadopodia to finely regulate ECM digestion. We demonstrated that: (i) ECM proteolysis taking place at invadopodia is driven by acidification of the peri-invadopodia microenvironment; (ii) that the proteases have a functional pHe optimum that is acidic; (iii) more than one protease is functioning to digest the ECM at these invadopodial sites of ECM proteolysis; and (iv) lowering pHe or inhibiting the NHE1 increases protease secretion while blocking protease activity changes NHE1 expression at the invadopodia.

  2. Transcriptional activation by heat and cold of a thiol protease gene in tomato. [Lycopersicon esculentum

    SciTech Connect

    Schaffer, M.A.; Fischer, R.L. )

    1990-08-01

    We previously determined that low temperature induces the accumulation in tomato (Lycopersicon esculentum) fruit of a cloned mRNA, designated C14, encoding a polypeptide related to thiol proteases. We now demonstrate that C14 mRNA accumulation is a response common to both high (40{degree}C) and low (4{degree}C) temperature stresses. Exposure of tomato fruit to 40{degree}C results in the accumulation of C14 mRNA, by 8 hours. This response is more rapid than that to 4{degree}C, but slower than the induction of many heat shock messages by 40{degree}C, and therefore unique. We have also studied the mechanism by which heat and cold exposure activate C14 gene expression. Both high and low temperature regulate protease gene expression through transcriptional induction of a single C14 gene. A hypothesis for the function of C14 thiol protease gene expression in response to heat and cold is discussed.

  3. StAR enhances transcription of genes encoding the mitochondrial proteases involved in its own degradation.

    PubMed

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas; Orly, Joseph

    2014-02-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR.

  4. Isolation and characterization of the hyperthermostable serine protease, pyrolysin, and its gene from the hyperthermophilic archaeon Pyrococcus furiosus.

    PubMed

    Voorhorst, W G; Eggen, R I; Geerling, A C; Platteeuw, C; Siezen, R J; Vos, W M

    1996-08-23

    The hyperthermostable serine protease pyrolysin from the hyperthermophilic archaeon Pyrococcus furiosus was purified from membrane fractions. Two proteolytically active fractions were obtained, designated high (HMW) and low (LMW) molecular weight pyrolysin, that showed immunological cross-reaction and identical NH2-terminal sequences in which the third residue could be glycosylated. The HMW pyrolysin showed a subunit mass of 150 kDa after acid denaturation. Incubation of HMW pyrolysin at 95 degrees C resulted in the formation of LMW pyrolysin, probably as a consequence of COOH-terminal autoproteolysis. The 4194-base pair pls gene encoding pyrolysin was isolated and characterized, and its transcription initiation site was identified. The deduced pyrolysin sequence indicated a prepro-enzyme organization, with a 1249-residue mature protein composed of an NH2-terminal catalytic domain with considerable homology to subtilisin-like serine proteases and a COOH-terminal domain that contained most of the 32 possible N-glycosylation sites. The archaeal pyrolysin showed highest homology with eucaryal tripeptidyl peptidases II on the amino acid level but a different cleavage specificity as shown by its endopeptidase activity toward caseins, casein fragments including alphaS1-casein and synthetic peptides.

  5. Potent and Selective Peptidyl Boronic Acid Inhibitors of the Serine Protease Prostate-Specific Antigen

    PubMed Central

    LeBeau, Aaron M.; Singh, Pratap; Isaacs, John T.; Denmeade, Samuel R.

    2012-01-01

    SUMMARY Prostate cancer cells produce high (microgram to milligram/milliliter) levels of the serine protease Prostate-Specific Antigen (PSA). PSA is enzymatically active in the extracellular fluid surrounding prostate cancers but is found at 1,000- to 10,000-fold lower concentrations in the circulation, where it is inactivated due to binding to abundant serum protease inhibitors. The exclusive presence of high levels of active PSA within prostate cancer sites makes PSA an attractive candidate for targeted imaging and therapeutics. A synthetic approach based on a peptide substrate identified first peptide aldehyde and then boronic acid inhibitors of PSA. The best of these had the sequence Cbz-Ser-Ser-Lys-Leu-(boro)Leu, with a Ki for PSA of 65 nM. The inhibitor had a 60-fold higher Ki for chymotrypsin. A validated model of PSA’s catalytic site confirmed the critical interactions between the inhibitor and residues within the PSA enzyme. PMID:18635003

  6. Characterization of a Clp Protease Gene Regulator and the Reaeration Response in Mycobacterium tuberculosis

    PubMed Central

    Sherrid, Ashley M.; Rustad, Tige R.; Cangelosi, Gerard A.; Sherman, David R.

    2010-01-01

    Mycobacterium tuberculosis (MTB) enters a non-replicating state when exposed to low oxygen tension, a condition the bacillus encounters in granulomas during infection. Determining how mycobacteria enter and maintain this state is a major focus of research. However, from a public health standpoint the importance of latent TB is its ability to reactivate. The mechanism by which mycobacteria return to a replicating state upon re-exposure to favorable conditions is not understood. In this study, we utilized reaeration from a defined hypoxia model to characterize the adaptive response of MTB following a return to favorable growth conditions. Global transcriptional analysis identified the ∼100 gene Reaeration Response, induced relative to both log-phase and hypoxic MTB. This response includes chaperones and proteases, as well as the transcription factor Rv2745c, which we characterize as a Clp protease gene regulator (ClgR) orthologue. During reaeration, genes repressed during hypoxia are also upregulated in a wave of transcription that includes genes crucial to transcription, translation and oxidative phosphorylation and culminates in bacterial replication. In sum, this study defines a new transcriptional response of MTB with potential relevance to disease, and implicates ClgR as a regulator involved in resumption of replication following hypoxia. PMID:20661284

  7. Interplay between acid phosphatase and cysteine proteases in mediating vitellin degradation during early embryogenesis of Periplaneta americana.

    PubMed

    Oliveira, Danielle M P; Ramos, Isabela B; Reis, Flavia C G; Lima, Ana P C A; Machado, Ednildo A

    2008-05-01

    In this work, we characterized the activities of two classes of proteases and AcP during early embryogenesis of Periplaneta americana. AcP activity was first detected at day 6 and reached a maximum level at day 10 of development. Using phosphoamino acids, phosphatase activity was shown to be directed only against phosphotyrosine at day 6 while at day 10 it was also active against phosphoserine. In parallel, two classes of proteases were detected and located within yolk granules: a clan CA-cysteine protease, which was inhibited by E-64, insensitive to CA 074 and activated by acidic pH at day 3; and a neutral serine protease, which was inhibited by aprotinin at day 6. Assays of vitellin (Vt) degradation evidenced that incubations at neutral pH induced slight proteolysis, while the incubations at acidic pH did not result in Vt degradation. However, pre-incubations of Vt with AcP increased the levels of Vt acidic proteolysis and this could be inhibited by the addition of phosphatase inhibitors. On the other hand, the same pre-incubations showed no effects on the profile of degradation at neutral pH. We propose that AcP and cysteine protease cooperate to assure Vt breakdown during early embryogenesis of P. americana.

  8. Impact of an acid fungal protease in high gravity fermentation for ethanol production using Indian sorghum as a feedstock.

    PubMed

    Gohel, V; Duan, G; Maisuria, V B

    2013-01-01

    This study evaluated the conventional jet cooking liquefaction process followed by simultaneous saccharification and fermentation (SSF) at 30% and 35% dry solids (DS) concentration of Indian sorghum feedstock for ethanol production, with addition of acid fungal protease or urea. To evaluate the efficacy of thermostable α-amylase in liquefaction at 30% and 35% DS concentration of Indian sorghum, liquefact solubility, higher dextrins, and fermentable sugars were analyzed at the end of the process. The liquefact was further subjected to SSF using yeast. In comparison with urea, addition of an acid fungal protease during SSF process was observed to accelerate yeast growth (μ), substrate consumption (Q(s)), ultimately ethanol yield based on substrate (Y(p/s)) and ethanol productivity based on fermentation time (Q(p)). The fermentation efficiency and ethanol recovery were determined for both concentrations of Indian sorghum and found to be increased with use of acid fungal protease in SSF process.

  9. Evaluation of a diverse set of potential P1 carboxylic acid bioisosteres in hepatitis C virus NS3 protease inhibitors.

    PubMed

    Rönn, Robert; Gossas, Thomas; Sabnis, Yogesh A; Daoud, Hanna; Kerblom, Eva; Danielson, U Helena; Sandström, Anja

    2007-06-15

    There is an urgent need for more efficient therapies for people infected with hepatitis C virus (HCV). HCV NS3 protease inhibitors have shown proof-of-concept in clinical trials, which make the virally encoded NS3 protease an attractive drug target. Product-based NS3 protease inhibitors comprising a P1 C-terminal carboxylic acid have shown to be effective and we were interested in finding alternatives to this crucial carboxylic acid group. Thus, a series of diverse P1 functional groups with different acidity and with possibilities to form a similar, or an even more powerful, hydrogen bond network as compared to the carboxylic acid were synthesized and incorporated into potential inhibitors of the NS3 protease. Biochemical evaluation of the inhibitors was performed in both enzyme and cell-based assays. Several non-acidic C-terminal groups, such as amides and hydrazides, were evaluated but failed to produce inhibitors more potent than the corresponding carboxylic acid inhibitor. The tetrazole moiety, although of similar acidity to a carboxylic acid, provided an inhibitor with mediocre potencies in both assays. However, the acyl cyanamide and the acyl sulfinamide groups rendered compounds with low nanomolar inhibitory potencies and were more potent than the corresponding carboxylic acid inhibitor in the enzymatic assay. Additionally, results from a pH-study suggest that the P(1) C-terminal of the inhibitors comprising a carboxylic acid, an acyl sulfonamide or an acyl cyanamide group binds in a similar mode in the active site of the NS3 protease.

  10. The Drosophila Stubble-stubbloid gene encodes an apparent transmembrane serine protease required for epithelial morphogenesis.

    PubMed Central

    Appel, L F; Prout, M; Abu-Shumays, R; Hammonds, A; Garbe, J C; Fristrom, D; Fristrom, J

    1993-01-01

    The Stubble-stubbloid (Sb-sbd) gene is required for hormone-dependent epithelial morphogenesis of imaginal discs of Drosophila, including the formation of bristles, legs, and wings. The gene has been cloned by using Sb-sbd-associated DNA lesions in a 20-kilobase (kb) region of a 263-kb genomic walk. The region specifies an approximately 3.8-kb transcript that is induced by the steroid hormone 20-hydroxyecdysone in imaginal discs cultured in vitro. The conceptually translated protein is an apparent 786-residue type II transmembrane protein (N terminus in, C terminus out), including an intracellular N-terminal domain of at least 35 residues and an extracellular C-terminal trypsin-like serine protease domain of 244 residues. Sequence analyses indicate that the Sb-sbd-encoded protease could activate itself by proteolytic cleavage. Consistent with the cell-autonomous nature of the Sb-sbd bristle phenotype, a disulfide bond between cysteine residues in the noncatalytic N-terminal fragment and the C-terminal catalytic fragment could tether the protease to the membrane after activation. Both dominant Sb and recessive sbd mutations affect the organization of microfilament bundles during bristle morphogenesis. We propose that the Sb-sbd product has a dual function. (i) It acts through its proteolytic extracellular domain to detach imaginal disc cells from extracellular matrices, and (ii) it transmits an outside-to-inside signal to its intracellular domain to modify the cytoskeleton and facilitate cell shape changes underlying morphogenesis. Images Fig. 2 Fig. 3 Fig. 4 Fig. 5 PMID:7685111

  11. Evaluation of a D-amino-acid-containing fluorescence resonance energy transfer peptide library for profiling prokaryotic proteases.

    PubMed

    Kaman, Wendy E; Voskamp-Visser, Ingrid; de Jongh, Denise M C; Endtz, Hubert P; van Belkum, Alex; Hays, John P; Bikker, Floris J

    2013-10-01

    Bacterial proteases play an important role in a broad spectrum of processes, including colonization, proliferation, and virulence. In this respect, bacterial proteases are potential biomarkers for bacterial diagnosis and targets for novel therapeutic protease inhibitors. To investigate these potential functions, the authors designed and used a protease substrate fluorescence resonance energy transfer (FRET) library comprising 115 short d- and l-amino-acid-containing fluorogenic substrates as a tool to generate proteolytic profiles for a wide range of bacteria. Bacterial specificity of the d-amino acid substrates was confirmed using enzymes isolated from both eukaryotic and prokaryotic organisms. Interestingly, bacterial proteases that are known to be involved in housekeeping and nutrition, but not in virulence, were able to degrade substrates in which a d-amino acid was present. Using our FRET peptide library and culture supernatants from a total of 60 different bacterial species revealed novel, bacteria-specific, proteolytic profiles, although in-species variation was observed for Pseudomonas aeruginosa, Porphyromonas gingivalis, and Staphylococcus aureus. Overall, the specific characteristic of our substrate peptide library makes it a rapid tool to high-throughput screen for novel substrates to detect bacterial proteolytic activity.

  12. Critical COPD respiratory illness is linked to increased transcriptomic activity of neutrophil proteases genes

    PubMed Central

    2012-01-01

    essential role of neutrophil proteases in COPD patients with critical respiratory illness. Measurement and modulation of the expression of these genes could present an option for clinical monitoring and treatment of severe COPD exacerbations. PMID:22852767

  13. Nucleotide and deduced amino acid sequences of a subtilisin-like serine protease from a deep-sea bacterium, Alkalimonas collagenimarina AC40(T).

    PubMed

    Kurata, Atsushi; Uchimura, Kohsuke; Shimamura, Shigeru; Kobayashi, Tohru; Horikoshi, Koki

    2007-11-01

    The acpI gene encoding an alkaline protease (AcpI) from a deep-sea bacterium, Alkalimonas collagenimarina AC40(T), was shotgun-cloned and sequenced. It had a 1,617-bp open reading frame encoding a protein of 538 amino acids. Based on analysis of the deduced amino acid sequence, AcpI is a subtilisin-like serine protease belonging to subtilase family A. It consists of a prepropeptide, a catalytic domain, and a prepeptidase C-terminal domain like other serine proteases from the genera Pseudomonas, Shewanella, Alteromonas, and Xanthomonas. Heterologous expression of the acpI gene in Escherichia coli cells yielded a 28-kDa recombinant AcpI (rAcpI), suggesting that both the prepropeptide and prepeptidase C-terminal domains were cleaved off to give the mature form. Analysis of N-terminal and C-terminal amino acid sequences of purified rAcpI showed that the mature enzyme would be composed of 273 amino acids. The optimal pH and temperature for the caseinolytic activity of the purified rAcpI were 9.0-9.5 and 45 degrees C in 100 mM glycine-NaOH buffer. Calcium ions slightly enhanced the enzyme activity and stability. The enzyme favorably hydrolyzed gelatin, collagen, and casein. AcpI from A. collagenimarina AC40(T) was also purified from culture broth, and its molecular mass was around 28 kDa, indicating that the cleavage manner of the enzyme is similar to that in E. coli cells.

  14. Novel acid resistance genes from the metagenome of the Tinto River, an extremely acidic environment.

    PubMed

    Guazzaroni, María-Eugenia; Morgante, Verónica; Mirete, Salvador; González-Pastor, José E

    2013-04-01

    Microorganisms that thrive in acidic environments are endowed with specialized molecular mechanisms to survive under this extremely harsh condition. In this work, we performed functional screening of six metagenomic libraries from planktonic and rhizosphere microbial communities of the Tinto River, an extremely acidic environment, to identify genes involved in acid resistance. This approach has revealed 15 different genes conferring acid resistance to Escherichia coli, most of which encoding putative proteins of unknown function or previously described proteins not known to be related to acid resistance. Moreover, we were able to assign function to one unknown and three hypothetical proteins. Among the recovered genes were the ClpXP protease, the transcriptional repressor LexA and nucleic acid-binding proteins such as an RNA-binding protein, HU and Dps. Furthermore, nine of the retrieved genes were cloned and expressed in Pseudomonas putida and Bacillus subtilis and, remarkably, most of them were able to expand the capability of these bacteria to survive under severe acid stress. From this set of genes, four presented a broad-host range as they enhance the acid resistance of the three different organisms tested. These results expand our knowledge about the different strategies used by microorganisms to survive under extremely acid conditions.

  15. The expression of a recombinant cry1Ac gene with subtilisin-like protease CDEP2 gene in acrystalliferous Bacillus thuringiensis by Red/ET homologous recombination.

    PubMed

    Xia, Liqiu; Zeng, Zhi; Ding, Xuezhi; Huang, Fan

    2009-10-01

    A novel cDNA encoding the subtilisin-like serine protease gene CDEP2 was isolated from Beauveria bassiana by reverse transcription polymerase chain reaction (RT-PCR). It contained an 1137 bp ORF that predicted a protein of 379 amino acids with M = 38863 Da and pI = 8.21. In an attempt to improve insecticidal activity, the CDEP2 gene and the cry1Ac gene from Bacillus thuringiensis were co-fused into the vector pHT315 as pHAc-CDEP2 plasmid by Red/ET homologous recombination. The co-fusion gene was attempted under the control of the native cry1Ac promoter. Plasmid pHAc-CDEP2 was electro-transformed into the B. thuringiensis subsp. kurstaki Cry(-)B. Analyzed by SDS-PAGE and Western blotting, the transformant Cry(-)B-pHAc-CDEP2 strain produced a 130 kDa Cry1Ac protein and 39 kDa CDEP2 protein. The 50% lethal concentration values (LC(50)) of Cry(-)B-pHAc-CDEP2 strain (8.5 microl/ml) to Helicoverpa armigera third instars larvae was clearly higher than the Cry(-)B-pHAc strain (16.7 microl/ml) at 72 h.

  16. Protease Inhibition by Oleic Acid Transfer From Chronic Wound Dressings to Albumin

    SciTech Connect

    Edwards, J. V.; Howley, Phyllis; Davis, Rachel M.; Mashchak, Andrew D.; Goheen, Steven C.

    2007-08-01

    High elastase and cathepsin G activities have been observed in chronic wounds. These levels can inhibit healing through degradation of growth factors, cytokines, and extracellular matrix proteins. Oleic acid (18:1) is a non-toxic elastase inhibitor with some potential for redressing the imbalance of elastase activity found in chronic wounds. Cotton wound dressing material was characterized as a transfer carrier for affinity uptake of 18:1 by albumin under conditions mimicking chronic wounds. 18:1-treated cotton was examined for its ability to bind and release the fatty acid in the presence of albumin. The mechanism of 18:1 uptake from cotton and binding by albumin was examined with both intact dressings and cotton fiber-designed chromatography. Raman spectra of the albumin-18:1 complexes under liquid-liquid equilibrium conditions revealed fully saturated albumin-18:1 complexes with a 1:1 weight ratio of albumin:18:1. Cotton chromatography under liquid-solid equilibrium conditions revealed oleic acid transfer from cotton to albumin at 27 mole equivalents of 18:1 per mole albumin. Cotton was contrasted with hydrogel, and hydrocolloid wound dressing for its comparative ability to lower elastase activity. Each dressing material evaluated was found to release 18:1 in the presence of albumin with significant inhibition of elastase activity. The 18:1-formulated wound dressings lowered elastase activity in a dose dependent manner in the order cotton gauze > hydrogel > hydrocolloid. In contrast the cationic serine protease Cathepsin G was inihibited by 18:1 within a narrow range of 18:1-cotton formulations. Four per cent Albumin solutions were most effective in binding cotton bound-18:1. However, 2% albumin was sufficient to transfer quantities of 18:1 necessary to achieve a significant elastase-lowering effect. Formulations with 128 mg 18:1/g cotton gauze had equivalent elastase lowering with 1 - 4% albumin. 18:1 bound to cotton wound dressings may have promise in the

  17. Transcriptional activation of the human cytotoxic serine protease gene CSP-B in T lymphocytes.

    PubMed Central

    Hanson, R D; Ley, T J

    1990-01-01

    The cytotoxic serine protease B (CSP-B) gene is activated during cytotoxic T-lymphocyte maturation. In this report, we demonstrate that the PEER T-cell line (bearing gamma/delta T-cell receptors) accumulates CSP-B mRNA following exposure to 12-O-tetradecanoylphorbol-13-acetate (TPA) and N6-2'-O-dibutyryladenosine 3',5'-cyclic monophosphate (bt2cAMP) because of transcriptional activation of the CSP-B gene. TPA and bt2cAMP act synergistically to induce CSP-B expression, since neither agent alone causes activation of CSP-B transcription or mRNA accumulation. Chromatin upstream from the CSP-B gene is resistant to DNase I digestion in untreated PEER cells, but becomes sensitive following TPA-bt2cAMP treatment. Upon activation of PEER cells, a DNase I-hypersensitive site forms upstream from the CSP-B gene within a region that is highly conserved in the mouse. Transient transfection of CSP-B promoter constructs identified two regulatory regions in the CSP-B 5'-flanking sequence, located at positions -609 to -202 and positions -202 to -80. The region from -615 to -63 is sufficient to activate a heterologous promoter in activated PEER cells, but activation is orientation specific, suggesting that this region behaves as an upstream promoter element rather than a classical enhancer. Consensus AP-1, AP-2, and cAMP response elements are found upstream from the CSP-B gene (as are several T-cell-specific consensus elements), but the roles of these elements in CSP-B gene activation have yet to be determined. Images PMID:2233710

  18. Complete amino acid sequence of ananain and a comparison with stem bromelain and other plant cysteine proteases.

    PubMed Central

    Lee, K L; Albee, K L; Bernasconi, R J; Edmunds, T

    1997-01-01

    The amino acid sequences of ananain (EC3.4.22.31) and stem bromelain (3.4.22.32), two cysteine proteases from pineapple stem, are similar yet ananain and stem bromelain possess distinct specificities towards synthetic peptide substrates and different reactivities towards the cysteine protease inhibitors E-64 and chicken egg white cystatin. We present here the complete amino acid sequence of ananain and compare it with the reported sequences of pineapple stem bromelain, papain and chymopapain from papaya and actinidin from kiwifruit. Ananain is comprised of 216 residues with a theoretical mass of 23464 Da. This primary structure includes a sequence insert between residues 170 and 174 not present in stem bromelain or papain and a hydrophobic series of amino acids adjacent to His-157. It is possible that these sequence differences contribute to the different substrate and inhibitor specificities exhibited by ananain and stem bromelain. PMID:9355753

  19. Disruption of genes involved in CORVET complex leads to enhanced secretion of heterologous carboxylesterase only in protease deficient Pichia pastoris.

    PubMed

    Marsalek, Lukas; Gruber, Clemens; Altmann, Friedrich; Aleschko, Markus; Mattanovich, Diethard; Gasser, Brigitte; Puxbaum, Verena

    2017-02-23

    The methylotrophic yeast Pichia pastoris (Komagataella spp.) is a popular microbial host for the production of recombinant proteins. Previous studies have shown that mis-sorting to the vacuole can be a bottleneck during production of recombinant secretory proteins in yeast, however, no information was available for P. pastoris. In this work the authors have therefore generated vps (vacuolar protein sorting) mutant strains disrupted in genes involved in the CORVET (class C core vacuole/endosome tethering) complex at the early stages of endosomal sorting. Both Δvps8 and Δvps21 strains contained lower extracellular amounts of heterologous carboxylesterase (CES) compared to the control strain, which could be attributed to a high proteolytic activity present in the supernatants of CORVET engineered strains due to rerouting of vacuolar proteases. Serine proteases were identified to be responsible for this proteolytic degradation by liquid chromatography-mass spectrometry and protease inhibitor assays. Deletion of the major cellular serine protease Prb1 in Δvps8 and Δvps21 strains did not only rescue the extracellular CES levels, but even outperformed the parental CES strain (56 and 80% higher yields, respectively). Further deletion of Ybr139W, another serine protease, did not show a further increase in secretion levels. Higher extracellular CES activity and low proteolytic activity were detected also in fed batch cultivation of Δvps21Δprb1 strains, thus confirming that modifying early steps in the vacuolar pathway has a positive impact on heterologous protein secretion.

  20. Cloning, expression and activity analysis of a novel fibrinolytic serine protease from Arenicola cristata

    NASA Astrophysics Data System (ADS)

    Zhao, Chunling; Ju, Jiyu

    2015-06-01

    The full-length cDNA of a protease gene from a marine annelid Arenicola cristata was amplified through rapid amplification of cDNA ends technique and sequenced. The size of the cDNA was 936 bp in length, including an open reading frame encoding a polypeptide of 270 amino acid residues. The deduced amino acid sequnce consisted of pro- and mature sequences. The protease belonged to the serine protease family because it contained the highly conserved sequence GDSGGP. This protease was novel as it showed a low amino acid sequence similarity (< 40%) to other serine proteases. The gene encoding the active form of A. cristata serine protease was cloned and expressed in E. coli. Purified recombinant protease in a supernatant could dissolve an artificial fibrin plate with plasminogen-rich fibrin, whereas the plasminogen-free fibrin showed no clear zone caused by hydrolysis. This result suggested that the recombinant protease showed an indirect fibrinolytic activity of dissolving fibrin, and was probably a plasminogen activator. A rat model with venous thrombosis was established to demonstrate that the recombinant protease could also hydrolyze blood clot in vivo. Therefore, this recombinant protease may be used as a thrombolytic agent for thrombosis treatment. To our knowledge, this study is the first of reporting the fibrinolytic serine protease gene in A. cristata.

  1. A New Subtilase-Like Protease Deriving from Fusarium equiseti with High Potential for Industrial Applications.

    PubMed

    Juntunen, Kari; Mäkinen, Susanna; Isoniemi, Sari; Valtakari, Leena; Pelzer, Alexander; Jänis, Janne; Paloheimo, Marja

    2015-09-01

    A gene encoding a novel extracellular subtilisin-like protease was cloned from the ascomycete Fusarium equiseti and expressed in Trichoderma reesei. The F. equiseti protease (Fe protease) showed excellent performance in stain removal and good compatibility with several commercial laundry detergent formulations, suggesting that it has high potential for use in various industrial applications. The recombinant enzyme was purified and characterized. The temperature optimum of the Fe protease was 60 °C and it showed high activity in the pH range of 6-10, with a sharp decline in activity at pH above 10. The amino acid specificity of the Fe protease was studied using casein, cytochrome c, and ubiquitin as substrates. The Fe protease had broad substrate specificity: almost all amino acid residues were accepted at position P1, even though it showed some preference for cleavage at the C-terminal side of asparagine and histidine residues. The S4 subsite of Fe protease favors aspartic acid and threonine. The other well-characterized proteases from filamentous fungi, Proteinase K from Engyodontium album, Thermomycolin from Malbranchea sulfurea, and alkaline subtilisins from Bacillus species prefer hydrophobic amino acids in both the S1 and S4 subsites. Due to its different specificity compared to the members of the S8 family of clan SB of proteases, we consider that the Fe protease is a new protease. It does not belong to any previously defined IUBMB groups of proteases.

  2. Mutations in the helper component protease gene of zucchini yellow mosaic virus affect its ability to mediate aphid transmissibility.

    PubMed

    Huet, H; Gal-On, A; Meir, E; Lecoq, H; Raccah, B

    1994-06-01

    The nucleotide sequence of the helper component protease (HC-Pro) genes of three zucchini yellow mosaic virus (ZYMV) strains has been compared with that of a helper-deficient strain of ZYMV-HC. The comparisons revealed three unique deduced amino acid differences. Two of these mutations were located in regions which are conserved in other potyviruses. The role of these mutations in aphid transmissibility was examined by exchanging DNA fragments of part of the deficient HC-Pro gene with the respective section within the gene of the infectious full-length clone of the aphid-transmissible ZYMV. The first exchange included two of the three mutations, the first coding for a change from Asp to Gly (in a non-conserved region) and the second coding for a change from Arg to Ile [within the Phe-Arg-Asp-Lys (FRNK) conserved box]. This exchange resulted in a reduced transmission (20.6% for the mutated virus compared with 57.4% in the normal ZYMV when acquired from plants and 37.2% compared with 83.1%, respectively, when acquired from membranes). The second exchange incorporated a single mutation [conferring a change from Thr to Ala within the Pro-Thr-Lys (PTK) conserved box]. This single mutation resulted in almost total loss of HC activity in aphid transmission both from plants and from membranes. The Lys residue in the conserved Lys-Ile-Thr-Cys (KITC) box, which is related to loss of HC activity in potato virus Y, tobacco vein mottling virus and in the Michigan strain of ZYMV, is unchanged in the helper-deficient ZYMV. It is therefore proposed that more than one site in HC-Pro may be functionally related to aphid transmissibility. The possible reasons for the role of these mutations in helper activity in aphid transmission of ZYMV are discussed.

  3. Crystal structure of the caseinolytic protease gene regulator, a transcriptional activator in actinomycetes.

    PubMed

    Russo, Santina; Schweitzer, Jens-Eric; Polen, Tino; Bott, Michael; Pohl, Ehmke

    2009-02-20

    Human pathogens of the genera Corynebacterium and Mycobacterium possess the transcriptional activator ClgR (clp gene regulator) which in Corynebacterium glutamicum has been shown to regulate the expression of the ClpCP protease genes. ClgR specifically binds to pseudo-palindromic operator regions upstream of clpC and clpP1P2. Here, we present the first crystal structure of a ClgR protein from C. glutamicum. The structure was determined from two different crystal forms to resolutions of 1.75 and 2.05 A, respectively. ClgR folds into a five-helix bundle with a helix-turn-helix motif typical for DNA-binding proteins. Upon dimerization the two DNA-recognition helices are arranged opposite to each other at the protein surface in a distance of approximately 30 A, which suggests that they bind into two adjacent major grooves of B-DNA in an anti-parallel manner. A binding pocket is situated at a strategic position in the dimer interface and could possess a regulatory role altering the positions of the DNA-binding helices.

  4. Type II Transmembrane Serine Protease Gene Variants Associate with Breast Cancer

    PubMed Central

    Luostari, Kaisa; Hartikainen, Jaana M.; Tengström, Maria; Palvimo, Jorma J.; Kataja, Vesa

    2014-01-01

    Type II transmembrane serine proteases (TTSPs) are related to tumor growth, invasion, and metastasis in cancer. Genetic variants in these genes may alter their function, leading to cancer onset and progression, and affect patient outcome. Here, 464 breast cancer cases and 370 controls were genotyped for 82 single-nucleotide polymorphisms covering eight genes. Association of the genotypes was estimated against breast cancer risk, breast cancer–specific survival, and survival in different treatment groups, and clinicopathological variables. SNPs in TMPRSS3 (rs3814903 and rs11203200), TMPRSS7 (rs1844925), and HGF (rs5745752) associated significantly with breast cancer risk (Ptrend = 0.008–0.042). SNPs in TMPRSS1 (rs12151195 and rs12461158), TMPRSS2 (rs2276205), TMPRSS3 (rs3814903), and TMPRSS7 (rs2399403) associated with prognosis (P = 0.004–0.046). When estimating the combined effect of the variants, the risk of breast cancer was higher with 4–5 alleles present compared to 0–2 alleles (P = 0.0001; OR, 2.34; 95% CI, 1.39–3.94). Women with 6–8 survival-associating alleles had a 3.3 times higher risk of dying of breast cancer compared to women with 1–3 alleles (P = 0.001; HR, 3.30; 95% CI, 1.58–6.88). The results demonstrate the combined effect of variants in TTSPs and their related genes in breast cancer risk and patient outcome. Functional analysis of these variants will lead to further understanding of this gene family, which may improve individualized risk estimation and development of new strategies for treatment of breast cancer. PMID:25029565

  5. Inactivation of cystein-aspartic acid protease (caspase)-1 by saikosaponin A.

    PubMed

    Han, Na-Ra; Kim, Hyung-Min; Jeong, Hyun-Ja

    2011-01-01

    This work investigates the anti-inflammatory mechanism of saikosaponin A (SA), a major component of Bupleurum falcatum LINNE. SA significantly inhibited phorbol myristate acetate (PMA) plus A23187-induced the production and expression of interleukin (IL)-6 and tumor necrosis factor (TNF)-α in human mast cell (HMC)-1 cells. SA suppressed PMA plus A23187-induced phosphorylation of extracellular signal-regulated kinase and p38. When HMC-1 cells were treated with SA, translocation of nuclear factor (NF)-κB/Rel A into nucleus and degradation of inhibitor of NF-κB (IκB) in cytoplasm were inhibited. SA decreased PMA plus A23187-induced cysteine-aspartic acid protease (caspase)-1 activity. IL-1β production was also inhibited by SA. Finally, SA significantly decreased the number of nasal rubs and serum TNF-α level in the ovalbumin-sensitized allergic rhinitis mouse model. The underlying mechanism involves, at least in part, inactivation of caspase-1, which provides new evidence for therapeutic application of SA to target inflammatory processes.

  6. Improvement of Functional Properties of Wheat Gluten Using Acid Protease from Aspergillus usamii

    PubMed Central

    Deng, Lingli; Wang, Zhaoxia; Yang, Sheng; Song, Junmei; Que, Fei; Zhang, Hui; Feng, Fengqin

    2016-01-01

    Hydrolysis parameters (temperature, E/S ratio, pH, and time) for acid protease (from Aspergillus usamii) hydrolysis of wheat gluten were optimized by response surface methodology (RSM) using emulsifying activity index (EAI) as the response factor. A temperature of 48.9°C, E/S ratio of 1.60%, pH 3.0, hydrolysis time of 2.5 h was found to be the optimum condition to obtain wheat gluten hydrolysate with higher EAI. The solubility of wheat gluten was greatly improved by hydrolysis and became independent of pH over the studied range. Enzymatic hydrolysis resulted in dramatically increase in EAI, water and oil holding capacity. Molecular weight distribution results showed that most of the peptides above 10 kDa have been hydrolyzed into smaller peptides. The results of FTIR spectra and disulfide bond (SS) and sulfhydryl (SH) content suggested that a more extensional conformation was formed after hydrolysis, which could account for the improved functional properties. PMID:27467884

  7. Preferential packing of acidic glycosidases and proteases into Bacteroides outer membrane vesicles.

    PubMed

    Elhenawy, Wael; Debelyy, Mykhaylo O; Feldman, Mario F

    2014-03-11

    Outer membrane vesicles (OMV) are spherical membranous structures released from the outer membrane (OM) of Gram-negative bacteria. OMV have been proposed to play several different roles during both pathogenesis and symbiosis. Despite the fact that OMV were described several decades ago, their biogenesis is a poorly characterized process. Whether OMV are produced by an active mechanism or by passive disintegration of the OM is a still matter of controversy. Bacteroides fragilis and Bacteroides thetaiotaomicron are important members of the human microbiota. In this work, we determined and compared the protein compositions of OM and OMV from B. fragilis and B. thetaiotaomicron. SDS-PAGE analysis of both fractions revealed dramatically different protein profiles. Proteomic analysis of OM and OMV in B. fragilis identified more than 40 proteins found exclusively in OMV and more than 30 proteins detectable only in the OM. The OMV-specific proteome showed a high prevalence of glycosidases and proteases, some of which were shown to be active in vitro. Similar results were obtained for B. thetaiotaomicron. Most of the OMV-exclusive proteins were acidic. Based on these results, we propose that these species possess machinery devoted to selectively pack acidic proteins into the OMV. These OMV equipped with hydrolytic enzymes could help in securing nutrients for the benefit of the whole bacterial community present in the microbiota, uncovering a novel function for bacterial OMV. IMPORTANCE The members of genus Bacteroides are key players in the symbiosis between the human host and the gut microbiota. It is known for its ability to degrade a wide variety of glycans that are not substrates for human glycosidases. The cleaved glycans can be utilized by Bacteroides and other microbiota members, resulting in the production of short-chain fatty acids that are beneficial for the host. Although members of the genus Bacteroides are known to secrete different hydrolases, their secretion

  8. Isolation and gene expression analysis of a papain-type cysteine protease in thermogenic skunk cabbage (Symplocarpus renifolius).

    PubMed

    Ito-Inaba, Yasuko; Masuko, Hiromi; Watanabe, Masao; Inaba, Takehito

    2012-01-01

    Skunk cabbage (Symplocarpus renifolius) spadices contain abundant transcripts for cysteine protease (CP). From thermogenic spadices, we isolated SrCPA, a highly expressed CP gene that encoded a papain-type CP. SrCPA is structurally similar to other plant CPs, including the senescence-associated CPs found in aroids. The expression of SrCPA increased during floral development, and was observed in all floral tissues except for the stamens.

  9. PhAP protease from Pseudoalteromonas haloplanktis TAC125: Gene cloning, recombinant production in E. coli and enzyme characterization

    NASA Astrophysics Data System (ADS)

    de Pascale, D.; Giuliani, M.; De Santi, C.; Bergamasco, N.; Amoresano, A.; Carpentieri, A.; Parrilli, E.; Tutino, M. L.

    2010-08-01

    Cold-adapted proteases have been found to be the dominant activity throughout the cold marine environment, indicating their importance in bacterial acquisition of nitrogen-rich complex organic compounds. However, few extracellular proteases from marine organisms have been characterized so far, and the mechanisms that enable their activity in situ are still largely unknown. Aside from their ecological importance and use as model enzyme for structure/function investigations, cold-active proteolytic enzymes offer great potential for biotechnological applications. Our studies on cold adapted proteases were performed on exo-enzyme produced by the Antarctic marine bacterium Pseudoalteromonas haloplanktis TAC125. By applying a proteomic approach, we identified several proteolytic activities from its culture supernatant. PhAP protease was selected for further investigations. The encoding gene was cloned and the protein was recombinantly produced in E. coli cells. The homogeneous product was biochemically characterised and it turned out that the enzyme is a Zn-dependent aminopeptidase, with an activity dependence from assay temperature typical of psychrophilic enzymes.

  10. Extracellular protease derived from lactic acid bacteria stimulates the fermentative lactic acid production from the by-products of rice as a biomass refinery function.

    PubMed

    Watanabe, Masanori; Techapun, Charin; Kuntiya, Ampin; Leksawasdi, Noppol; Seesuriyachan, Phisit; Chaiyaso, Thanongsak; Takenaka, Shinji; Maeda, Isamu; Koyama, Masahiro; Nakamura, Kozo

    2017-02-01

    A lactic acid producing bacterium, Lactobacillus rhamnosus M-23, newly isolated from a rice washing drainage storage tank was found to produce l-(+)-lactic acid from a non-sterilized mixture of rice washing drainage and rice bran without any additions of nutrients under the simultaneous saccharification and fermentation (SSF) process. This strain has the ability to utilize the non-sterilized rice washing drainage and rice bran as a source of carbohydrate, saccharifying enzymes and nutrients for lactic acid production. Observation of extracellular protease activity in SSF culture broth showed that a higher protease activity was present in strain M-23 than in other isolated lactic acid producing bacteria (LABs). To investigate the structural changes of solid particles of rice washing drainage throughout LAB cultivation, scanning electron microscopic (SEM) observation and Fourier transform infrared-spectroscopy (FT-IR) analysis were performed. The results of the SEM observation showed that the surface material could be removed from solid particles of rice washing drainage treated by culture broth (supernatant) of strain M-23, thus exposing the crystal structure of the starch particle surface. The results of the FT-IR analysis revealed that the specific transmittance decrease of the CC and CO stretching and OH group of the solid particles of the rice washing drainage were highly correlated with the produced lactic acid concentration and extracellular protease activity, respectively. These results demonstrate the high lactic acid producing ability of strain M-23 from a non-sterilized mixture of rice washing drainage and rice bran under the SSF condition due to the removal of proteinaceous material and exposure of the starch particle surface by extracellular protease.

  11. Interplay of CodY and ScoC in the Regulation of Major Extracellular Protease Genes of Bacillus subtilis

    PubMed Central

    Barbieri, Giulia; Albertini, Alessandra M.; Ferrari, Eugenio; Sonenshein, Abraham L.

    2016-01-01

    ABSTRACT AprE and NprE are two major extracellular proteases in Bacillus subtilis whose expression is directly regulated by several pleiotropic transcriptional factors, including AbrB, DegU, ScoC, and SinR. In cells growing in a rich, complex medium, the aprE and nprE genes are strongly expressed only during the post-exponential growth phase; mutations in genes encoding the known regulators affect the level of post-exponential-phase gene expression but do not permit high-level expression during the exponential growth phase. Using DNA-binding assays and expression and mutational analyses, we have shown that the genes for both exoproteases are also under strong, direct, negative control by the global transcriptional regulator CodY. However, because CodY also represses scoC, little or no derepression of aprE and nprE was seen in a codY null mutant due to overexpression of scoC. Thus, CodY is also an indirect positive regulator of these genes by limiting the synthesis of a second repressor. In addition, in cells growing under conditions that activate CodY, a scoC null mutation had little effect on aprE or nprE expression; full effects of scoC or codY null mutations could be seen only in the absence of the other regulator. However, even the codY scoC double mutant did not show high levels of aprE and nprE gene expression during exponential growth phase in a rich, complex medium. Only a third mutation, in abrB, allowed such expression. Thus, three repressors can contribute to reducing exoprotease gene expression during growth in the presence of excess nutrients. IMPORTANCE The major Bacillus subtilis exoproteases, AprE and NprE, are important metabolic enzymes whose genes are subject to complex regulation by multiple transcription factors. We show here that expression of the aprE and nprE genes is also controlled, both directly and indirectly, by CodY, a global transcriptional regulator that responds to the intracellular pools of amino acids. Direct Cod

  12. Design of protease-resistant myelin basic protein-derived peptides by cleavage site directed amino acid substitutions.

    PubMed

    Burster, Timo; Marin-Esteban, Viviana; Boehm, Bernhard O; Dunn, Shannon; Rotzschke, Olaf; Falk, Kirsten; Weber, Ekkehard; Verhelst, Steven H L; Kalbacher, Hubert; Driessen, Christoph

    2007-11-15

    Multiple Sclerosis (MS) is considered to be a T cell-mediated autoimmune disease. An attractive strategy to prevent activation of autoaggressive T cells in MS, is the use of altered peptide ligands (APL), which bind to major histocompatibility complex class II (MHC II) molecules. To be of clinical use, APL must be capable of resisting hostile environments including the proteolytic machinery of antigen presenting cells (APC). The current design of APL relies on cost- and labour-intensive strategies. To overcome these major drawbacks, we used a deductive approach which involved modifying proteolytic cleavage sites in APL. Cleavage site-directed amino acid substitution of the autoantigen myelin basic protein (MBP) resulted in lysosomal protease-resistant, high-affinity binding peptides. In addition, these peptides mitigated T cell activation in a similar fashion as conventional APL. The strategy outlined allows the development of protease-resistant APL and provides a universal design strategy to improve peptide-based immunotherapeutics.

  13. The Arabidopsis Mitochondrial Protease FtSH4 Is Involved in Leaf Senescence via Regulation of WRKY-Dependent Salicylic Acid Accumulation and Signaling.

    PubMed

    Zhang, Shengchun; Li, Cui; Wang, Rui; Chen, Yaxue; Shu, Si; Huang, Ruihua; Zhang, Daowei; Li, Jian; Xiao, Shi; Yao, Nan; Yang, Chengwei

    2017-04-01

    Mitochondria and autophagy play important roles in the networks that regulate plant leaf senescence and cell death. However, the molecular mechanisms underlying the interactions between mitochondrial signaling and autophagy are currently not well understood. This study characterized the function of the Arabidopsis (Arabidopsis thaliana) mitochondrial AAA-protease gene FtSH4 in regulating autophagy and senescence, finding that FtSH4 mediates WRKY-dependent salicylic acid (SA) accumulation and signaling. Knockout of FtSH4 in the ftsh4-4 mutant resulted in severe leaf senescence, cell death, and high autophagy levels. The level of SA increased dramatically in the ftsh4-4 mutant. Expression of nahG in the ftsh4-4 mutant led to decreased SA levels and suppressed the leaf senescence and cell death phenotypes. The transcript levels of several SA synthesis and signaling genes, including SALICYLIC ACIDINDUCTION DEFICIENT2 (SID2), NON-RACE-SPECIFIC DISEASE RESISTANCE1 (NDR1), and NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1), increased significantly in the ftsh4-4 mutants compared with the wild type. Loss of function of SID2, NDR1, or NPR1 in the ftsh4-4 mutant reversed the ftsh4-4 senescence and autophagy phenotypes. Furthermore, ftsh4-4 mutants had elevated levels of transcripts of several WRKY genes, including WRKY40, WRKY46, WRKY51, WRKY60, WRKY63, and WRKY75; all of these WRKY proteins can bind to the promoter of SID2 Loss of function of WRKY75 in the ftsh4-4 mutants decreased the levels of SA and reversed the senescence phenotype. Taken together, these results suggest that the mitochondrial ATP-dependent protease FtSH4 may regulate the expression of WRKY genes by modifying the level of reactive oxygen species and the WRKY transcription factors that control SA synthesis and signaling in autophagy and senescence.

  14. Cloning and analysis of WF146 protease, a novel thermophilic subtilisin-like protease with four inserted surface loops.

    PubMed

    Wu, Jiang; Bian, Yan; Tang, Bing; Chen, Xiangdong; Shen, Ping; Peng, Zhenrong

    2004-01-30

    Cloning and sequencing of the gene encoding WF146 protease, an extracellular subtilisin-like protease from the thermophile Bacillus sp. WF146, revealed that the WF146 protease was translated as a 416-amino acid precursor consisting of a putative 18-amino acid signal peptide, a 10-kDa N-terminal propeptide and a 32-kDa mature protease region. The mature WF146 protease shares a high degree of amino acid sequence identity with two psychrophilic subtilisins, S41 (68.2%) and S39 (65.4%), and a mesophilic subtilisin, SSII (67.1%). Significantly, these closely related proteases adapted to different temperatures all had four inserted surface loops not found in other subtilisins. However, unlike those of S41, S39 and SSII, the inserted loops of the WF146 protease possessed stabilizing features, such as the introduction of Pro residues into the loop regions. Interestingly, the WF146 protease contained five of the seven mutations previously found in a hyperstable variant of subtilisin S41 obtained by directed evolution. The proform of WF146 protease (pro-WF146 protease) was overexpressed in Escherichia coli in an inactive soluble form. After heat treatment, the 42-kDa pro-WF146 protease converted to a 32-kDa active mature form by processing the N-terminal propeptide. The purified mature WF146 protease hydrolyzed casein with an optimum temperature of 85 degrees C, and lost activity with a half-life of 30 min at 80 degrees C in the presence of 10 mM CaCl2.

  15. The human corticosteroid binding globulin gene is located on chromosome 14q31-q32.1 near two other serine protease inhibitor genes.

    PubMed

    Seralini, G E; Bérubé, D; Gagné, R; Hammond, G L

    1990-11-01

    Human corticosteroid binding globulin (CBG) cDNA fragments were radiolabeled and hybridized in situ to metaphase chromosome preparations. The results localized the CBG gene to the q31-q32.1 region of human chromosome 14. This location also contains the genes for two closely related serine protease inhibitors: alpha 1-proteinase inhibitor and alpha 1-antichymotrypsin. It is therefore likely that these genes evolved by duplication events, and it would appear that this region contains a series of functionally related genes.

  16. Aspartic acid protease from Botrytis cinerea removes haze-forming proteins during white winemaking.

    PubMed

    Van Sluyter, Steven C; Warnock, Nicholas I; Schmidt, Simon; Anderson, Peter; van Kan, Jan A L; Bacic, Antony; Waters, Elizabeth J

    2013-10-09

    White wines suffer from heat-induced protein hazes during transport and storage unless the proteins are removed prior to bottling. Bentonite fining is by far the most commonly used method, but it is inefficient and creates several other process challenges. An alternative to bentonite is the enzymatic removal of haze-forming grape pathogenesis-related proteins using added proteases. The major problem with this approach is that grape pathogenesis-related proteins are highly protease resistant unless they are heat denatured in combination with enzymatic treatment. This paper demonstrates that the protease BcAP8, from the grape fungal pathogen Botrytis cinerea , is capable of degrading chitinase, a major class of haze-forming proteins, without heat denaturation. Because BcAP8 effectively removes haze-forming proteins under normal winemaking conditions, it could potentially benefit winemakers by reducing bentonite requirements.

  17. Amino acid sequence and some properties of phytolacain G, a cysteine protease from growing fruit of pokeweed, Phytolacca americana.

    PubMed

    Uchikoba, T; Arima, K; Yonezawa, H; Shimada, M; Kaneda, M

    2000-10-18

    A protease, phytolacain G, has been found to appear on CM-Sepharose ion-exchange chromatography of greenish small-size fruits of pokeweed, Phytolacca americana L, from ca. 2 weeks after flowering, and increases during fruit enlargement. Reddish ripe fruit of the pokeweed contained both phytolacain G and R. The molecular mass of phytolacain G was estimated to be 25.5 kDa by SDS-PAGE. Its amino acid sequence was reconstructed by automated sequence analysis of the peptides obtained after cleavage with Achromobacter protease I, chymotrypsin, and cyanogen bromide. The enzyme is composed of 216 amino acid residues, of which it shares 152 identical amino acid residues (70%) with phytolacain R, 126 (58%) with melain G, 108 (50%) with papain, 106 (49%) with actinidain, and 96 (44%) with stem bromelain. The amino acid residues forming the substrate binding S(2) pocket of papain, Tyr67, Pro68, Trp69, Val133, and Phe207, were predicted to be replaced by Trp, Met, His, Ala, and Ser in phytolacain G, respectively. As a consequence of these substitutions, the S(2) pocket is expected to be less hydrophobic in phytolacain G than in papain.

  18. Improving volatile fatty acids production by exploiting the residual substrates in post-fermented sludge: Protease catalysis of refractory protein.

    PubMed

    Yin, Bo; Liu, Hongbo; Wang, Yuanyuan; Bai, Jie; Liu, He; Fu, Bo

    2016-03-01

    The real cause to the low yield of volatile fatty acids (VFAs), from inhibition or low biodegradation, is uncertain in sludge anaerobic fermentation. In this study, poor biodegradability of proteins and fast decrease of the indigenous hydrolase activity in the residual post-fermented sludge were found to be the major reasons. With the addition of trypsin or alkaline protease in residual post-fermented sludge after primary alkaline fermentation, degradation efficiency of refractory protein increased by 33.6% and 34.8%, respectively. Accordingly, the VFAs yields were improved by 69.7% and 106.1%, respectively. Furthermore, the activities of added trypsin and alkaline protease could maintain at 13.52 U/mL and 19.11 U/mL in the alkaline fermentation process. This study demonstrated that exploiting the refractory proteins in residual post-fermented sludge by protease addition seems to be a very promising way for improving VFAs yield of conventional alkaline fermentations with waste activated sludge.

  19. Effects of worts treated with proteases on the assimilation of free amino acids and fermentation performance of lager yeast.

    PubMed

    Lei, Hongjie; Zheng, Liye; Wang, Chenxia; Zhao, Haifeng; Zhao, Mouming

    2013-02-01

    The objective of this study was to investigate the changes in free amino acids (FAA) composition by supplementing three commercial proteases (Neutrase, Flavorzyme and Protamex) at the beginning of wort mashing, and monitoring the effects on the assimilation pattern of FAA and fermentation performance of lager yeast (Saccharomyces pastorianus) during normal and high gravity fermentations. Proteases supplementation significantly improved the extract yield and FAA level of mashed worts. Normal gravity worts treated with Flavorzyme and Neutrase exhibited higher fermentability, ethanol production and flavor volatiles concentration compared to the control worts, while these beneficial effects were observed in high gravity worts treated with Protamex and Neutrase. The reason for the above results is proposed to be the change in the assimilation pattern of FAA in lager yeast with increased wort gravity, especially for the improved assimilation ratios of Leu, Arg, Phe, His, Asp and Val. In normal gravity fermentations, there were strong correlations between the assimilation amounts of Lys, Leu, Arg and His and fermentability, while in high gravity fermentations, these good correlations were found with only Lys and His. The present study suggested that optimizing the composition of FAA by supplementing proteases during wort mashing was beneficial to beer brewing for improving fermentation performance of lager yeast and flavor volatiles formation.

  20. The natural killer cell serine protease gene Lmet1 maps to mouse chromosome 10

    SciTech Connect

    Thia, K.Y.T.; Smyth, M.J.; Jenkins, N.A.; Gilbert, D.J.; Copeland, N.G.

    1995-01-01

    Cytotoxic lymphocytes play a key role in immune responses against viruses and tumors. Lymphocyte-mediated cytolysis by both cytotoxic T lymphocytes (CTL) and natural killer (NK) cells is often associated with the formation of membrane lesions on target cells caused by exocytosis of cytoplasmic granule serine proteases and a pore-forming protein, perforin. A variety of granzymes have been found to reside within the cytoplasmic granules of cytotoxic lymphocytes, but unlike perforin, isolated serine proteases are not intrinsically lytic. However, a role for serine proteases in cellular cytotoxicity has been supported by the ability of protease inhibitors to completely abrogate lymphocyte cytotoxicity, and the demonstration that serine proteases can initiate DNA fragmentation in target cells transfected or pretreated with a sublytic concentration of perforin. Granzymes cloned in human, mouse, and rat encode four granzyme activities and all are expressed in either T cells, their thymic precursors, and/or NK cells. In particular, a rat granzyme that cleaves after methionine residues, but not phenylalanine residues and its human equivalent, human Met-ase 1, are unique granzymes with restricted expression in CD3-NK cells. 24 refs., 2 figs.

  1. Peptide Mass Fingerprinting and N-Terminal Amino Acid Sequencing of Glycosylated Cysteine Protease of Euphorbia nivulia Buch.-Ham.

    PubMed Central

    Badgujar, Shamkant B.; Mahajan, Raghunath T.

    2013-01-01

    A new cysteine protease named Nivulian-II has been purified from the latex of Euphorbia nivulia Buch.-Ham. The apparent molecular mass of Nivulian-II is 43670.846 Da (MALDI TOF/MS). Peptide mass fingerprint analysis revealed peptide matches to Maturase K (Q52ZV1_9MAGN) of Banksia quercifolia. The N-terminal sequence (DFPPNTCCCICC) showed partial homology with those of other cysteine proteinases of biological origin. This is the first paper to characterize a Nivulian-II of E. nivulia latex with respect to amino acid sequencing. PMID:23476742

  2. Fluctuating partially native-like topologies in the acid denatured ensemble of autolysis resistant HIV-1 protease.

    PubMed

    Rout, Manoj Kumar; Hosur, Ramakrishna V

    2009-02-01

    Folding, in-vivo, starts from a denatured state and thus the nature of the denatured state would play an important role in directing the folding of a protein. We report here NMR characterization of the acid-denatured state of a mutant of HIV-1 protease, designed to prevent autolysis (Q7K, L33I, L63I) and to prevent cysteine oxidation (C67A and C95A). Secondary chemical shifts, TALOS analysis of chemical shifts and (15)N relaxation data (R(1), R(2), NOE) coupled with AABUF and hydrophobicity calculations, suggest formation of hydrophobic clusters and possibility of some partially native-like topologies in the acid denatured state of the protease. The structural and dynamics characteristics of the acid denatured PR seem to be considerably different from those of the guanidine or urea denatured states of some variants of PR. These would have implications for the folding and auto-processing of the enzyme in-vivo.

  3. Effects of L- and iso-ascorbic acid on meat protein hydrolyzing activity of four commercial plant and three microbial protease preparations.

    PubMed

    Ha, Minh; Bekhit, Alaa El-Din; Carne, Alan

    2014-04-15

    The present study investigated the effects of both l- and iso-ascorbic acid (AA) on the activity of four plant proteases (papain, bromelain, actinidin and zingibain) and three microbial proteases (Bacterial Protease G, Fungal 31,000 and Fungal 60,000) preparations using fluorescent-labelled casein, meat myofibrillar and connective tissue extracts to explore their effects on meat structure components upon treatment with individual proteases. While l-AA in the range 0.8-3.2mM inhibited the activity of papain, bromelain and zingibain, iso-AA acted as an inhibitor of papain but as an activator of zingibain and had no significant effect on bromelain. Both AA isoforms acted as an activator of the actinidin protease and the concentration of AA isoforms appeared to affect the level of activation of the protease. The effect of the two AA isoforms on collagen and myofibrillar protein hydrolyzing activity varied depending on the concentration of the two AA isoforms. The results indicate the ability to up and down regulate the activity of the investigated proteases by using an appropriate concentration of the AA isoform.

  4. β-Amino acid catalyzed asymmetric Michael additions: design of organocatalysts with catalytic acid/base dyad inspired by serine proteases.

    PubMed

    Yang, Hui; Wong, Ming Wah

    2011-09-16

    A new type of chiral β-amino acid catalyst has been computationally designed, mimicking the enzyme catalysis of serine proteases. Our catalyst approach is based on the bioinspired catalytic acid/base dyad, namely, a carboxyl and imidazole pair. DFT calculations predict that this designed organocatalyst catalyzes Michael additions of aldehydes to nitroalkenes with excellent enantioselectivities and remarkably high anti diastereoselectivities. The unusual stacked geometry of the enamine intermediate, hydrogen bonding network, and the adoption of an exo transition state are the keys to understand the stereoselectivity.

  5. Genome-wide identification, evolutuionary and expression analysis of aspartic proteases gene superfamily in grape

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aspartic proteases (APs) are a large family of proteolytic enzymes in vertebrates, plants, yeast, nematodes, parasites, fungi, and viruses. In plants, they are involved in many biological processes, such as plant senescence, stress response, programmed cell death, and reproduction. Prior to the pr...

  6. Digestive system development and study of acid and alkaline protease digestive capacities using biochemical and molecular approaches in totoaba (Totoaba macdonaldi) larvae.

    PubMed

    Galaviz, Mario A; López, Lus M; García Gasca, Alejandra; Álvarez González, Carlos Alfonso; True, Conal D; Gisbert, Enric

    2015-10-01

    The present study aimed to describe and understand the development of the digestive system in totoaba (Totoaba macdonaldi) larvae from hatching to 40 days post-hatch (dph) from morphological and functional perspectives. At hatch, the digestive system of totoaba was undifferentiated. The anus and the mouth opened at 4 and 5 dph, respectively. During exogenous feeding, development of the esophagus, pancreas, liver and intestine was observed with a complete differentiation of all digestive organs. Expression and activity of trypsin and chymotrypsin were observed as early as at 1 dph, and increments in their expression and activity coincided with changes in food items (live and compound diets) and morpho-physiological development of the accessory digestive glands. In contrast, pepsin was detected later during development, which includes the appearance of the gastric glands between 24 and 28 dph. One peak in gene expression was detected at 16 dph, few days before the initial development of the stomach at 20 dph. A second peak of pepsin expression was detected at day 35, followed by a peak of activity at day 40, coinciding with the change from live to artificial food. Totoaba larvae showed a fully morphologically developed digestive system between 24 and 28 dph, as demonstrated by histological observations. However, gene expression and activity of alkaline and acid proteases were detected earlier, indicating the functionality of the exocrine pancreas and stomach before the complete morphological development of the digestive organs. These results showed that integrative studies are needed to fully understand the development of the digestive system from a morphological and functional point of views, since the histological organization of digestive structures does not reflect their real functionality. These results indicate that the digestive system of totoaba develops rapidly during the first days post-hatch, especially for alkaline proteases, and the stomach

  7. Effects of Coated Compound Proteases on Apparent Total Tract Digestibility of Nutrients and Apparent Ileal Digestibility of Amino Acids for Pigs

    PubMed Central

    Pan, L.; Zhao, P. F.; Yang, Z. Y.; Long, S. F.; Wang, H. L.; Tian, Q. Y.; Xu, Y. T.; Xu, X.; Zhang, Z. H.; Piao, X. S.

    2016-01-01

    Two experiments were conducted to evaluate effects of coated compound proteases (CC protease) on apparent total tract digestibility (ATTD) of nitrogen (N) and energy, and apparent ileal digestibility (AID) of amino acids (AA) and nutrients in diets for pigs. In Exp. 1, 12 crossbred barrows (initial body weight: 20.14±1.71 kg) were housed in individual metabolism crates and allotted into 2 treatments with 6 piglets per treatment according to weight in a randomized complete block design. The 2 diets were corn-soybean meal basal diets with (0.2 g/kg) or without CC protease supplementation. The CC protease supplementation increased (p<0.05) the digestible and metabolizable N and energy values and the digestibility and retention rate of N in the diet. The ATTD of energy and nutrients had been improved (p<0.05) in the diet supplemented with CC protease. In Exp. 2, 12 crossbred barrows (initial body weight: 20.79±1.94 kg), fitted with T-cannulas at the distal ileum, were blocked by body weight into 2 groups with 6 pigs each. The diets were the same as those in Exp. 1. The CC protease increased (p<0.05) the AID of crude protein and some essential AA including arginine, isoleucine and leucine. The AID and ATTD of energy and nutrients had been improved (p<0.05) by supplemental CC protease, but the hindgut digestibility of nutrients was unaffected. Overall, the CC protease improved the ATTD of N and energy and AID of some indispensible AA and nutrients in the corn-soybean meal diet for pigs. Therefore, the CC protease supplement could improve the utilization of protein in the corn-soybean meal diet and thus contribute to lower N excretion to the environment. PMID:27004811

  8. Effects of Coated Compound Proteases on Apparent Total Tract Digestibility of Nutrients and Apparent Ileal Digestibility of Amino Acids for Pigs.

    PubMed

    Pan, L; Zhao, P F; Yang, Z Y; Long, S F; Wang, H L; Tian, Q Y; Xu, Y T; Xu, X; Zhang, Z H; Piao, X S

    2016-12-01

    Two experiments were conducted to evaluate effects of coated compound proteases (CC protease) on apparent total tract digestibility (ATTD) of nitrogen (N) and energy, and apparent ileal digestibility (AID) of amino acids (AA) and nutrients in diets for pigs. In Exp. 1, 12 crossbred barrows (initial body weight: 20.14±1.71 kg) were housed in individual metabolism crates and allotted into 2 treatments with 6 piglets per treatment according to weight in a randomized complete block design. The 2 diets were corn-soybean meal basal diets with (0.2 g/kg) or without CC protease supplementation. The CC protease supplementation increased (p<0.05) the digestible and metabolizable N and energy values and the digestibility and retention rate of N in the diet. The ATTD of energy and nutrients had been improved (p<0.05) in the diet supplemented with CC protease. In Exp. 2, 12 crossbred barrows (initial body weight: 20.79±1.94 kg), fitted with T-cannulas at the distal ileum, were blocked by body weight into 2 groups with 6 pigs each. The diets were the same as those in Exp. 1. The CC protease increased (p<0.05) the AID of crude protein and some essential AA including arginine, isoleucine and leucine. The AID and ATTD of energy and nutrients had been improved (p<0.05) by supplemental CC protease, but the hindgut digestibility of nutrients was unaffected. Overall, the CC protease improved the ATTD of N and energy and AID of some indispensible AA and nutrients in the corn-soybean meal diet for pigs. Therefore, the CC protease supplement could improve the utilization of protein in the corn-soybean meal diet and thus contribute to lower N excretion to the environment.

  9. T Cell Determinants Incorporating [beta]-Amino Acid Residues Are Protease Resistant and Remain Immunogenic In Vivo

    SciTech Connect

    Webb, Andrew I.; Dunstone, Michelle A.; Williamson, Nicholas A.; Price, Jason D.; Kauwe, Andreade; Chen, Weisan; Oakley, Aaron; Perlmutter, Patrick; McCluskey, James; Aguilar, Marie-Isabel; Rossjohn, Jamie; Purcell, Anthony W.

    2010-07-20

    A major hurdle in designing successful epitope-based vaccines resides in the delivery, stability, and immunogenicity of the peptide immunogen. The short-lived nature of unmodified peptide-based vaccines in vivo limits their therapeutic application in the immunotherapy of cancers and chronic viral infections as well as their use in generating prophylactic immunity. The incorporation of {beta}-amino acids into peptides decreases proteolysis, yet its potential application in the rational design of T cell mimotopes is poorly understood. To address this, we have replaced each residue of the SIINFEKL epitope individually with the corresponding {beta}-amino acid and examined the resultant efficacy of these mimotopes. Some analogs displayed similar MHC binding and superior protease stability compared with the native epitope. Importantly, these analogs were able to generate cross-reactive CTLs in vivo that were capable of lysing tumor cells that expressed the unmodified epitope as a surrogate tumor Ag. Structural analysis of peptides in which anchor residues were substituted with {beta}-amino acids revealed the basis for enhanced MHC binding and retention of immunogenicity observed for these analogs and paves the way for future vaccine design using {beta}-amino acids. We conclude that the rational incorporation of {beta}-amino acids into T cell determinants is a powerful alternative to the traditional homologous substitution of randomly chosen naturally occurring {alpha}-amino acids, and these mimotopes may prove particularly useful for inclusion in epitope-based vaccines.

  10. Ectopic expression of a grape aspartic protease gene, AP13, in Arabidopsis thaliana improves resistance to powdery mildew but increases susceptibility to Botrytis cinerea.

    PubMed

    Guo, Rongrong; Tu, Mingxing; Wang, Xianhang; Zhao, Jiao; Wan, Ran; Li, Zhi; Wang, Yuejin; Wang, Xiping

    2016-07-01

    The grape aspartic protease gene, AP13 was previously reported to be responsive, in Chinese wild Vitis quinquangularis cv. 'Shang-24', to infection by Erysiphe necator, the causal agent of powdery mildew disease, as well as to treatment with salicylic acid in V. labrusca×V. vinifera cv. 'Kyoho'. In the current study, we evaluated the expression levels of AP13 in 'Shang-24' in response to salicylic acid (SA), methyl jasmonate (MeJA) and ethylene (ET) treatments, as well as to infection by the necrotrophic fungus, Botrytis cinerea, and the transcript levels of VqAP13 decreased after B. cinerea infection and MeJA treatment, but increased following ET and SA treatments. Transgenic Arabidopsis thaliana lines over-expressing VqAP13 under the control of a constitutive promoter showed enhanced resistance to powdery mildew and to the bacterium Pseudomonas syringae pv. tomato DC3000, and accumulated more callose than wild type plants, while the resistance of transgenic A. thaliana lines to B. cinerea inoculation was reduced. In addition, the expression profiles of various disease resistance- related genes in the transgenic A. thaliana lines following infection by different pathogens were compared to the equivalent profiles in the wild type plants. The results suggest that VqAP13 action promotes the SA dependent signal transduction pathway, but suppresses the JA signal transduction pathway.

  11. Genotype-dependent expression of specific members of potato protease inhibitor gene families in different tissues and in response to wounding and nematode infection.

    PubMed

    Turrà, David; Bellin, Diana; Lorito, Matteo; Gebhardt, Christiane

    2009-05-01

    Protease inhibitors (PIs) are small ubiquitous proteins with a variety of biological functions in plants, including protein stabilization, modulation of apoptosis and defense against pathogens. Kunitz-like inhibitors (PKPIs) and proteinase inhibitors 1 (PI-1) are abundant in storage organs of potato plants and are up-regulated in other tissues in response to biotic and abiotic stress. However, little information is available on genotype-dependent regulation of individual PKPI group- and PI-1 genes. We isolated, sequenced and characterized four novel full-length PI-1 cDNAs (PPI3A2, PPI3A4, PPI2C4 and PPI2C1A) from Solanum tuberosum cv. Desirée. Specific primers were developed for PI-1 genes PPI3A2, PPI3B2 and PPI2C4 and the three PKPI homology groups A, B and C. Their expression profiles were studied by semi-quantitative RT-PCR in comparison with transcripts of the PI-1, Pin2 and PR1 gene families in various tissues, after wounding and Globodera rostochiensis infection of nematode-resistant genotypes P40 and LB7/4/c-I-7, and susceptible cv. Desirée. Individual PI-1 genes and PKPI homology groups were expressed in a tissue- and genotype-dependent manner after wounding and nematode infection. The differences in PI expression patterns were related to the intensity, type of inhibitors produced, and the kinetics of induction. Therefore, different genotype-environment combinations produce different sets of PI transcripts. Potato plants reacted to G. rostochiensis infection by modulating PKPI, PI-1 and Pin2, but not PR1 gene expression, suggesting that the jasmonic acid but not the salicylic acid defense signaling pathway is activated. PI expression profiles were not correlated with the resistance status of the potato genotype infected with G. rostochiensis.

  12. A Molecular Approach to Nested RT-PCR Using a New Set of Primers for the Detection of the Human Immunodeficiency Virus Protease Gene

    PubMed Central

    Zarei, Mohammad; Ravanshad, Mehrdad; Bagban, Ashraf; Fallahi, Shahab

    2016-01-01

    Background The human immunodeficiency virus (HIV-1) is the etiologic agent of AIDS. The disease can be transmitted via blood in the window period prior to the development of antibodies to the disease. Thus, an appropriate method for the detection of HIV-1 during this window period is very important. Objectives This descriptive study proposes a sensitive, efficient, inexpensive, and easy method to detect HIV-1. Patients and Methods In this study 25 serum samples of patients under treatment and also 10 positive and 10 negative control samples were studied. Twenty-five blood samples were obtained from HIV-1-infected individuals who were receiving treatment at the acquired immune deficiency syndrome (AIDS) research center of Imam Khomeini hospital in Tehran. The identification of HIV-1-positive samples was done by using reverse transcription to produce copy deoxyribonucleic acid (cDNA) and then optimizing the nested polymerase chain reaction (PCR) method. Two pairs of primers were then designed specifically for the protease gene fragment of the nested real time-PCR (RT-PCR) samples. Electrophoresis was used to examine the PCR products. The results were analyzed using statistical tests, including Fisher’s exact test, and SPSS17 software. Results The 325 bp band of the protease gene was observed in all the positive control samples and in none of the negative control samples. The proposed method correctly identified HIV-1 in 23 of the 25 samples. Conclusions These results suggest that, in comparison with viral cultures, antibody detection by enzyme linked immunosorbent assay (ELISAs), and conventional PCR methods, the proposed method has high sensitivity and specificity for the detection of HIV-1. PMID:27679699

  13. Inhibition of Clostridium botulinum 52A toxicity and protease activity by sodium acid pyrophosphate in media systems.

    PubMed Central

    Wagner, M K; Busta, F F

    1985-01-01

    The effects of two pH levels (5.55 or 5.85) in combination with 0.4% sodium acid pyrophosphate (SAPP), NaH2PO4 X H2O, Na2HPO4 X 7H2O, or NaCl on the growth and toxicity of Clostridium botulinum 52A were studied. Absorbancy measurements at 630 nm, microscopic observations, and the mouse bioassay procedure were used to observe the effects. At pH 5.55 and 5.85 most control cultures exhibited toxicity when cell lysis began. Vegetative cell development was normal (4 micron long; 1 micron wide). SAPP-containing (0.4%) treatment cultures displayed similar growth and lysis but no or delayed (48 h) toxicity. Cells grown in the SAPP treatment culture were longer and wider (6 micron long; 1.5 micron wide) than in most other treatment cultures. Trypsinization of nontoxic supernatants from 0.4% SAPP resulted in toxicity. Addition of 0.4% SAPP to toxic C. botulinum supernatant delayed but did not prevent death of mice. The addition of various levels of SAPP to toxic supernatants resulted in a decrease in zone size with an increase in the level of SAPP (9 mm with 0.4% SAPP to 7 mm with 1.0% SAPP), using a dual substrate protease assay. A decrease in the zone size also occurred with the supernatant from cultures grown in the presence of SAPP and with Bacillus polymyxa protease dilutions containing 0.4% SAPP. Results suggest that the actual production or function of the protease responsible for toxin activation may have been inhibited by the presence of SAPP. PMID:2992374

  14. Amino acid regulation of gene expression.

    PubMed Central

    Fafournoux, P; Bruhat, A; Jousse, C

    2000-01-01

    The impact of nutrients on gene expression in mammals has become an important area of research. Nevertheless, the current understanding of the amino acid-dependent control of gene expression is limited. Because amino acids have multiple and important functions, their homoeostasis has to be finely maintained. However, amino-acidaemia can be affected by certain nutritional conditions or various forms of stress. It follows that mammals have to adjust several of their physiological functions involved in the adaptation to amino acid availability by regulating the expression of numerous genes. The aim of the present review is to examine the role of amino acids in regulating mammalian gene expression and protein turnover. It has been reported that some genes involved in the control of growth or amino acid metabolism are regulated by amino acid availability. For instance, limitation of several amino acids greatly increases the expression of the genes encoding insulin-like growth factor binding protein-1, CHOP (C/EBP homologous protein, where C/EBP is CCAAT/enhancer binding protein) and asparagine synthetase. Elevated mRNA levels result from both an increase in the rate of transcription and an increase in mRNA stability. Several observations suggest that the amino acid regulation of gene expression observed in mammalian cells and the general control process described in yeast share common features. Moreover, amino acid response elements have been characterized in the promoters of the CHOP and asparagine synthetase genes. Taken together, the results discussed in the present review demonstrate that amino acids, by themselves, can, in concert with hormones, play an important role in the control of gene expression. PMID:10998343

  15. Cloning and characteristic analysis of a novel aspartic protease gene Asp55 from Trichoderma asperellum ACCC30536.

    PubMed

    Dou, Kai; Wang, Zhiying; Zhang, Rongshu; Wang, Na; Fan, Haijuan; Diao, Guiping; Liu, Zhihua

    2014-12-01

    Proteases secreted by fungi belonging to the genus Trichoderma play important roles in biocontrol. In this study, the coding sequence and promoter region of the novel aspartic protease gene Asp55 were cloned from strain Trichoderma asperellum ACCC30536. Many cis-elements involved in phytopathogenic and environmental stress responses were identified in the Asp55 promoter region and may be recognized by MYB or WRKY transcription factors. The expression pattern of Asp55 under eight culture conditions was investigated by RT-qPCR. The expression level of Asp55 was up-regulated by poplar stem powder, Alternaria alternata cell wall fragments and A. alternata fermentation liquid, while it was down-regulated by carbon and nitrogen source starvation, and by powdered poplar leaves and roots. Additionally, the expression patterns of 15 genes encoding MYB transcription factors (Myb1 to Myb15) were also analyzed by RT-qPCR. Myb2 showed the most similar expression pattern with Asp55. The cDNA of Asp55 was expressed in Escherichia coli BL21, and recombinant ASP55 (rASP55) was purified. The purified rASP55 was evaluated for enzymatic activity and showed inhibitory effect on phytopathogenic A. alternata.

  16. Characterization of the entire cystatin gene family in barley and their target cathepsin L-like cysteine-proteases, partners in the hordein mobilization during seed germination.

    PubMed

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-11-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds.

  17. Molecular analysis of the role of the group A streptococcal cysteine protease, hyaluronic acid capsule, and M protein in a murine model of human invasive soft-tissue infection.

    PubMed Central

    Ashbaugh, C D; Warren, H B; Carey, V J; Wessels, M R

    1998-01-01

    Human invasive soft-tissue infections caused by group A Streptococcus are associated with significant morbidity and mortality. To investigate the pathogenesis of these serious infections, we characterized the host response to bacterial challenge with an M-type 3 isolate recovered from a patient with necrotizing fasciitis, or with isogenic gene replacement mutants deficient in cysteine protease, hyaluronic acid capsule, or M protein in a murine model of human invasive soft-tissue infection. Animals challenged with the wild-type or cysteine protease-deficient strain developed spreading tissue necrosis at the site of inoculation, became bacteremic, and subsequently died. Histopathologic examination of the necrotic lesion revealed bacteria throughout inflamed subcutaneous tissue. Arterioles and venules in the subcutaneous layer were thrombosed and the overlying tissue was infarcted. In contrast, animals challenged with either an acapsular or M protein-deficient mutant developed a focal area of tissue swelling at the site of inoculation without necrosis or subsequent systemic disease. Histopathologic examination of the soft-tissue lesion demonstrated bacteria confined within a well-formed subcutaneous abscess. We conclude that the group A streptococcal hyaluronic acid capsule and M protein, but not the cysteine protease, are critical for the development of tissue necrosis, secondary bacteremia, and lethal infection in a murine model of human necrotizing fasciitis. PMID:9691092

  18. Screening of protease producing fungi for microbial digestion of seed proteins and synthesis of amino acids-metalnutrient chelates.

    PubMed

    Deore, G B; Limaye, A S; Dushing, Y A; Dhobale, S B; Kale, S; Laware, S L

    2013-01-15

    The problem of metalnutrient deficiency is becoming more serious with the introduction of modern agricultural practices. As a result, metalnutrient deficiency is recognized as one of the critical yield limiting factors. Metalnutrients are generally offered in their sulphate or oxide forms. However, it is reported that organically bound minerals generally have a higher bioavailability than inorganic minerals. Chelation makes otherwise unavailable metalnutrients plant available. Amino acids are well known among various chelating agents. In present investigation the fungus Paecilomyces variotii PR-4 was isolated from soil and was used for production of protease and determination of its activity. Proteins from germinating seeds of chick pea, mung bean, soybean and cowpea were hydrolyzed for the production of amino acids. Amino acids were recovered, estimated and utilized for chelation of metalnutrients viz., Zn, Cu, Fe, Mn, Mg, B and Mo. The resultant chelates were employed to detect with Fourier Transform Infra-Red Spectrophotometer (FTIR) analysis. The peaks of most intensive bands in the IR spectra of ligands recorded were present in the intervals of the wave numbers 3500-3300 and 1720-1700 cm(-1). Chelation of metalnutrients led to the broadening of peak and changes of the peak position of hydroxyl groups, which indicated the binding of the carboxylic groups and primary amine groups of amino acids to the metalnutrients. The resultant amino acids-metalnutrient chelates can be utilized as organic fertilizer.

  19. Airway uric acid is a sensor of inhaled protease allergens and initiates type 2 immune responses in respiratory mucosa1

    PubMed Central

    Hara, Kenichiro; Iijima, Koji; Elias, Martha K.; Seno, Satoshi; Tojima, Ichiro; Kobayashi, Takao; Kephart, Gail M.; Kurabayashi, Masahiko; Kita, Hirohito

    2014-01-01

    While type 2 immune responses to environmental antigens are thought to play pivotal roles in asthma and allergic airway diseases, the immunological mechanisms that initiate the responses are largely unknown. Many allergens have biologic activities, including enzymatic activities and abilities to engage innate pattern-recognition receptors such as TLR4. Here we report that IL-33 and thymic stromal lymphopoietin (TSLP) were produced quickly in the lungs of naïve mice exposed to cysteine proteases, such as bromelain and papain, as a model for allergens. IL-33 and TSLP sensitized naïve animals to an innocuous airway antigen OVA, which resulted in production of type 2 cytokines and IgE antibody and eosinophilic airway inflammation when mice were challenged with the same antigen. Importantly, upon exposure to proteases, uric acid (UA) was rapidly released into the airway lumen, and removal of this endogenous UA by uricase prevented type 2 immune responses. UA promoted secretion of IL-33 by airway epithelial cells in vitro, and administration of UA into the airways of naïve animals induced extracellular release of IL-33, followed by both innate and adaptive type 2 immune responses in vivo. Finally, a potent UA synthesis inhibitor, febuxostat, mitigated asthma phenotypes that were caused by repeated exposure to natural airborne allergens. These findings provide mechanistic insights into the development of type 2 immunity to airborne allergens and recognize airway UA as a key player that regulates the process in respiratory mucosa. PMID:24663677

  20. Airway uric acid is a sensor of inhaled protease allergens and initiates type 2 immune responses in respiratory mucosa.

    PubMed

    Hara, Kenichiro; Iijima, Koji; Elias, Martha K; Seno, Satoshi; Tojima, Ichiro; Kobayashi, Takao; Kephart, Gail M; Kurabayashi, Masahiko; Kita, Hirohito

    2014-05-01

    Although type 2 immune responses to environmental Ags are thought to play pivotal roles in asthma and allergic airway diseases, the immunological mechanisms that initiate the responses are largely unknown. Many allergens have biologic activities, including enzymatic activities and abilities to engage innate pattern-recognition receptors such as TLR4. In this article, we report that IL-33 and thymic stromal lymphopoietin were produced quickly in the lungs of naive mice exposed to cysteine proteases, such as bromelain and papain, as a model for allergens. IL-33 and thymic stromal lymphopoietin sensitized naive animals to an innocuous airway Ag OVA, which resulted in production of type 2 cytokines and IgE Ab, and eosinophilic airway inflammation when mice were challenged with the same Ag. Importantly, upon exposure to proteases, uric acid (UA) was rapidly released into the airway lumen, and removal of this endogenous UA by uricase prevented type 2 immune responses. UA promoted secretion of IL-33 by airway epithelial cells in vitro, and administration of UA into the airways of naive animals induced extracellular release of IL-33, followed by both innate and adaptive type 2 immune responses in vivo. Finally, a potent UA synthesis inhibitor, febuxostat, mitigated asthma phenotypes that were caused by repeated exposure to natural airborne allergens. These findings provide mechanistic insights into the development of type 2 immunity to airborne allergens and recognize airway UA as a key player that regulates the process in respiratory mucosa.

  1. Characterization of the S1 binding site of the glutamic acid-specific protease from Streptomyces griseus.

    PubMed Central

    Stennicke, H. R.; Birktoft, J. J.; Breddam, K.

    1996-01-01

    The glutamic acid-specific protease from Streptomyces griseus (SGPE) is an 18.4-kDa serine protease with a distinct preference for Glu in the P1 position. Other enzymes characterized by a strong preference for negatively charged residues in the P1 position, e.g., interleukin-1 beta converting enzyme (ICE), use Arg or Lys residues as counterions within the S1 binding site. However, in SGPE, this function is contributed by a His residue (His 213) and two Ser residues (Ser 192 and S216). It is demonstrated that proSGPE is activated autocatalytically and dependent on the presence of a Glu residue in the -1 position. Based on this observation, the importance of the individual S1 residues is evaluated considering that enzymes unable to recognize a Glu in the P1 position will not be activated. Among the residues constituting the S1 binding site, it is demonstrated that His 213 and Ser 192 are essential for recognition of Glu in the P1 position, whereas Ser 216 is less important for catalysis out has an influence on stabilization of the ground state. From the three-dimensional structure, it appears that His 213 is linked to two other His residues (His 199 and His 228), forming a His triad extending from the S1 binding site to the back of the enzyme. This hypothesis has been tested by substitution of His 199 and His 228 with other amino acid residues. The catalytic parameters obtained with the mutant enzymes, as well as the pH dependence, do not support this theory; rather, it appears that His 199 is responsible for orienting His 213 and that His 228 has no function associated with the recognition of Glu in P1. PMID:8931145

  2. Single amino acid mutation alters thermostability of the alkaline protease from Bacillus pumilus: thermodynamics and temperature dependence.

    PubMed

    Huang, Rong; Yang, Qingjun; Feng, Hong

    2015-02-01

    Dehairing alkaline protease (DHAP) from Bacillus pumilus BA06 has been demonstrated to have high catalytic efficiency and good thermostability, with potential application in leather processing. In order to get insights into its catalytic mechanism, two mutants with single amino acid substitution according to the homology modeling and multiple sequence alignment were characterized in thermodynamics of thermal denaturation and temperature dependence of substrate hydrolysis. The results showed that both mutants of V149I and R249E have a systematic increase in catalytic efficiency (kcat/Km) in a wide range of temperatures, mainly due to an increase of k1 (substrate diffusion) and k2 (acylation) for V149I and of k2 and k3 (deacylation) for R249E. In comparison with the wild-type DHAP, the thermostability is increased for V149I and decreased for R249E. Thermodynamic analysis indicated that the free energy (ΔGa°) of activation for thermal denaturation may govern the thermostability. The value of ΔGa° is increased for V149I and decreased for R249E. Based on these data and the structural modeling, it is suggested that substitution of Val149 with Ile may disturb the local flexibility in the substrate-binding pocket, leading to enhancement of binding affinity for the substrate. In contrast, substitution of Arg249 with Glu leads to interruption of interaction with the C-terminal of enzyme, thus resulting in less thermostability. This study indicates that amino acid residues in the active center or in the substrate-binding pocket may disturb the catalytic process and can be selected as the target for protein engineering in the bacterial alkaline proteases.

  3. Influence of nitrogen source and pH value on undesired poly(γ-glutamic acid) formation of a protease producing Bacillus licheniformis strain.

    PubMed

    Meissner, Lena; Kauffmann, Kira; Wengeler, Timo; Mitsunaga, Hitoshi; Fukusaki, Eiichiro; Büchs, Jochen

    2015-09-01

    Bacillus spp. are used for the production of industrial enzymes but are also known to be capable of producing biopolymers such as poly(γ-glutamic acid). Biopolymers increase the viscosity of the fermentation broth, thereby impairing mixing, gas/liquid mass and heat transfer in any bioreactor system. Undesired biopolymer formation has a significant impact on the fermentation and downstream processing performance. This study shows how undesirable poly(γ-glutamic acid) formation of an industrial protease producing Bacillus licheniformis strain was prevented by switching the nitrogen source from ammonium to nitrate. The viscosity was reduced from 32 to 2.5 mPa s. A constant or changing pH value did not influence the poly(γ-glutamic acid) production. Protease production was not affected: protease activities of 38 and 46 U mL(-1) were obtained for ammonium and nitrate, respectively. With the presented results, protease production with industrial Bacillus strains is now possible without the negative impact on fermentation and downstream processing by undesired poly(γ-glutamic acid) formation.

  4. Conditions influencing the synthesis of acid protease by Mucor pusillus Lindt.

    PubMed

    Somkuti, G A; Babel, F J

    1967-11-01

    Protease synthesis by Mucor pusillus Lindt, in a wheat bran medium under submerged conditions, was influenced by substrate concentration, initial pH of the medium, and temperature of incubation. A 4% wheat bran (dry weight) concentration was satisfactory for enzyme production. The initial pH of the medium had a substantial effect on enzyme synthesis; adjustment of the enzyme production medium to pH 5.0 prior to sterilization was desirable. Incubation at 35 C resulted in the best enzyme yields. Under optimal conditions of enzyme production, maximal activity was detected after 5 days of incubation. The enrichment of the medium with glucose increased the yield of mycelia but lowered the amount of enzyme produced.

  5. Improved protease stability of the antimicrobial peptide Pin2 substituted with D-amino acids.

    PubMed

    Carmona, G; Rodriguez, A; Juarez, D; Corzo, G; Villegas, E

    2013-08-01

    Cationic antimicrobial peptides (AMPs) have attracted a great interest as novel class of antibiotics that might help in the treatment of infectious diseases caused by pathogenic bacteria. However, some AMPs with high antimicrobial activities are also highly hemolytic and subject to proteolytic degradation from human and bacterial proteases that limit their pharmaceutical uses. In this work a D-diastereomer of Pandinin 2, D-Pin2, was constructed to observe if it maintained antimicrobial activity in the same range as the parental one, but with the purpose of reducing its hemolytic activity to human erythrocytes and improving its ability to resist proteolytic cleavage. Although, the hydrophobic and secondary structure characteristics of L- and D-Pin2 were to some extent similar, an important reduction in D-Pin2 hemolytic activity (30-40 %) was achieved compared to that of L-Pin2 over human erythrocytes. Furthermore, D-Pin2 had an antimicrobial activity with a MIC value of 12.5 μM towards Staphylococcus aureus, Escherichia coli, Streptococcus agalactiae and two strains of Pseudomonas aeruginosa in agar diffusion assays, but it was half less potent than that of L-Pin2. Nevertheless, the antimicrobial activity of D-Pin2 was equally effective as that of L-Pin2 in microdilution assays. Yet, when D- and L-Pin2 were incubated with trypsin, elastase and whole human serum, only D-Pin2 kept its antimicrobial activity towards all bacteria, but in diluted human serum, L- and D-Pin2 maintained similar peptide stability. Finally, when L- and D-Pin2 were incubated with proteases from P. aeruginosa DFU3 culture, a clinical isolated strain, D-Pin2 kept its antibiotic activity while L-Pin2 was not effective.

  6. Effects of different dietary conditions on the expression of trypsin- and chymotrypsin-like protease genes in the digestive system of the migratory locust, Locusta migratoria.

    PubMed

    Spit, Jornt; Zels, Sven; Dillen, Senne; Holtof, Michiel; Wynant, Niels; Vanden Broeck, Jozef

    2014-05-01

    While technological advancements have recently led to a steep increase in genomic and transcriptomic data, and large numbers of protease sequences are being discovered in diverse insect species, little information is available about the expression of digestive enzymes in Orthoptera. Here we describe the identification of Locusta migratoria serine protease transcripts (cDNAs) involved in digestion, which might serve as possible targets for pest control management. A total of 5 putative trypsin and 15 putative chymotrypsin gene sequences were characterized. Phylogenetic analysis revealed that these are distributed among 3 evolutionary conserved clusters. In addition, we have determined the relative gene expression levels of representative members in the gut under different feeding conditions. This study demonstrated that the transcript levels for all measured serine proteases were strongly reduced after starvation. On the other hand, larvae of L. migratoria displayed compensatory effects to the presence of Soybean Bowman Birk (SBBI) and Soybean Trypsin (SBTI) inhibitors in their diet by differential upregulation of multiple proteases. A rapid initial upregulation was observed for all tested serine protease transcripts, while only for members belonging to class I, the transcript levels remained elevated after prolonged exposure. In full agreement with these results, we also observed an increase in proteolytic activity in midgut secretions of locusts that were accustomed to the presence of protease inhibitors in their diet, while no change in sensitivity to these inhibitors was observed. Taken together, this paper is the first comprehensive study on dietary dependent transcript levels of proteolytic enzymes in Orthoptera. Our data suggest that compensatory response mechanisms to protease inhibitor ingestion may have appeared early in insect evolution.

  7. A Point Mutation in the FRNK Motif of the Potyvirus Helper Component-Protease Gene Alters Symptom Expression in Cucurbits and Elicits Protection Against the Severe Homologous Virus.

    PubMed

    Gal-On, A

    2000-05-01

    Sequence comparison had previously shown three amino acid changes in conserved motifs in the 455-amino acid sequence of the helper component-protease (HC-Pro) between a severe field strain of Zucchini yellow mosaic virus (ZYMV-NAT) and a mild field strain of ZYMV (ZYMV-WK). In this study, exchange of fragments and site-directed mutagenesis within the HC-Pro gene in an infectious clone of ZYMV enabled the effects of the mutations on symptom expression to be mapped. The substitution of Ile for Arg at position 180 in the conserved motif Phe-Arg-Asn-Lys (FRNK) of potyviruses was found to affect symptom expression. Infection of cucurbits with the engineered ZYMV (ZYMV-AG) that contained this mutation caused a dramatic symptom change from severe to mild in squash and to a symptom-free appearance in cucumber, melon, and watermelon. The Ile to Arg mutation was found to be stable, and no revertant virus was found after several passages through plants after long incubation periods. The AG strain was detected 4 days postinoculation and accumulated in cucurbits to a level and with kinetics similar to that of the wild-type ZYMV-AT strain. Cucurbit plants infected with the AG strain were protected against infection by the severe strain.

  8. Molecular markers of serine protease evolution

    PubMed Central

    Krem, Maxwell M.; Di Cera, Enrico

    2001-01-01

    The evolutionary history of serine proteases can be accounted for by highly conserved amino acids that form crucial structural and chemical elements of the catalytic apparatus. These residues display non- random dichotomies in either amino acid choice or serine codon usage and serve as discrete markers for tracking changes in the active site environment and supporting structures. These markers categorize serine proteases of the chymotrypsin-like, subtilisin-like and α/β-hydrolase fold clans according to phylogenetic lineages, and indicate the relative ages and order of appearance of those lineages. A common theme among these three unrelated clans of serine proteases is the development or maintenance of a catalytic tetrad, the fourth member of which is a Ser or Cys whose side chain helps stabilize other residues of the standard catalytic triad. A genetic mechanism for mutation of conserved markers, domain duplication followed by gene splitting, is suggested by analysis of evolutionary markers from newly sequenced genes with multiple protease domains. PMID:11406580

  9. Tomato transgenic plants expressing hairpin construct of a nematode protease gene conferred enhanced resistance to root-knot nematodes

    PubMed Central

    Dutta, Tushar K.; Papolu, Pradeep K.; Banakar, Prakash; Choudhary, Divya; Sirohi, Anil; Rao, Uma

    2015-01-01

    Root-knot nematodes (Meloidogyne incognita) cause substantial yield losses in vegetables worldwide, and are difficult to manage. Continuous withdrawal of environmentally-harmful nematicides from the global market warrants the need for novel nematode management strategies. Utility of host-delivered RNAi has been demonstrated in several plants (Arabidopsis, tobacco, and soybean) that exhibited resistance against root-knot and cyst nematodes. Herein, a M. incognita-specific protease gene, cathepsin L cysteine proteinase (Mi-cpl-1), was targeted to generate tomato transgenic lines to evaluate the genetically modified nematode resistance. In vitro knockdown of Mi-cpl-1 gene led to the reduced attraction and penetration of M. incognita in tomato, suggesting the involvement of Mi-cpl-1 in nematode parasitism. Transgenic expression of the RNAi construct of Mi-cpl-1 gene resulted in 60–80% reduction in infection and multiplication of M. incognita in tomato. Evidence for in vitro and in vivo silencing of Mi-cpl-1 was confirmed by expression analysis using quantitative PCR. Our study demonstrates that Mi-cpl-1 plays crucial role during plant-nematode interaction and plant-mediated downregulation of this gene elicits detrimental effect on M. incognita development, reinforcing the potential of RNAi technology for management of phytonematodes in crop plants. PMID:25883594

  10. Constitutive over-expression of rice chymotrypsin protease inhibitor gene OCPI2 results in enhanced growth, salinity and osmotic stress tolerance of the transgenic Arabidopsis plants.

    PubMed

    Tiwari, Lalit Dev; Mittal, Dheeraj; Chandra Mishra, Ratnesh; Grover, Anil

    2015-07-01

    Protease inhibitors are involved primarily in defense against pathogens. In recent years, these proteins have also been widely implicated in response of plants to diverse abiotic stresses. Rice chymotrypsin protease inhibitor gene OCPI2 is highly induced under salt and osmotic stresses. The construct containing the complete coding sequence of OCPI2 cloned downstream to CaMV35S promoter was transformed in Arabidopsis and single copy, homozygous transgenic lines were produced. The transgenic plants exhibited significantly enhanced tolerance to NaCl, PEG and mannitol stress as compared to wild type plants. Importantly, the vegetative and reproductive growth of transgenic plants under unstressed, control conditions was also enhanced: transgenic plants were more vigorous than wild type, resulting into higher yield in terms of silique number. The RWC values and membrane stability index of transgenic in comparison to wild type plants was higher. Higher proline content was observed in the AtOCPI2 lines, which was associated with higher transcript expression of pyrroline-5-carboxylate synthase and lowered levels of proline dehydrogenase genes. The chymotrypsin protease activities were lower in the transgenic as against wild type plants, under both unstressed, control as well as stressed conditions. It thus appears that rice chymotrypsin protease inhibitor gene OCPI2 is a useful candidate gene for genetic improvement of plants against salt and osmotic stress.

  11. Genome-wide identification and immune response analysis of serine protease inhibitor genes in the silkworm, Bombyx mori.

    PubMed

    Zhao, Ping; Dong, Zhaoming; Duan, Jun; Wang, Genhong; Wang, Lingyan; Li, Youshan; Xiang, Zhonghuai; Xia, Qingyou

    2012-01-01

    In most insect species, a variety of serine protease inhibitors (SPIs) have been found in multiple tissues, including integument, gonad, salivary gland, and hemolymph, and are required for preventing unwanted proteolysis. These SPIs belong to different families and have distinct inhibitory mechanisms. Herein, we predicted and characterized potential SPI genes based on the genome sequences of silkworm, Bombyx mori. As a result, a total of eighty SPI genes were identified in B. mori. These SPI genes contain 10 kinds of SPI domains, including serpin, Kunitz_BPTI, Kazal, TIL, amfpi, Bowman-Birk, Antistasin, WAP, Pacifastin, and alpha-macroglobulin. Sixty-three SPIs contain single SPI domain while the others have at least two inhibitor units. Some SPIs also contain non-inhibitor domains for protein-protein interactions, including EGF, ADAM_spacer, spondin_N, reeler, TSP_1 and other modules. Microarray analysis showed that fourteen SPI genes from lineage-specific TIL family and Group F of serpin family had enriched expression in the silk gland. The roles of SPIs in resisting pathogens were investigated in silkworms when they were infected by four pathogens. Microarray and qRT-PCR experiments revealed obvious up-regulation of 8, 4, 3 and 3 SPI genes after infection with Escherichia coli, Bacillus bombysepticus, Beauveria bassiana or B. mori nuclear polyhedrosis virus (BmNPV), respectively. On the contrary, 4, 11, 7 and 9 SPI genes were down-regulated after infection with E. coli, B. bombysepticus, B. bassiana or BmNPV, respectively. These results suggested that these SPI genes may be involved in resistance to pathogenic microorganisms. These findings may provide valuable information for further clarifying the roles of SPIs in the development, immune defence, and efficient synthesis of silk gland protein.

  12. Transfecting deoxyribonucleic acid of Bacillus bacteriophage phi 29 that is protease sensitive.

    PubMed

    Hirokawa, H

    1972-06-01

    The transfecting activity of Bacillus phage varphi29 DNA, extracted either by sodium lauroyl sarcosine-phenol or by 2 M perchlorate, was destroyed by treatment with proteolytic enzymes, although these enzymes did not effect transfecting DNAs of SPP1, SPO1, and SP50. These facts suggest that a protein is associated with transfective varphi29 DNA. Stabilization of protease-resistance during transfection appeared earlier than that of DNaseresistance, indicating that the protein associated with varphi29 DNA is necessary for initiation of the incorporation of DNA molecules into competent cells. The physical nature of varphi29 DNA before and after the trypsin treatment was investigated by sucrose and CsCl density gradient centrifugations. The trypsin treatment did not alter the sedimentation rate of the unit varphi29 DNA; however, it did convert the sedimentation rate of the aggregated material in the untreated DNA to that of the unit varphi29 DNA. The density of the trypsinized DNA was 0.009 g/cm(3) greater than that of the untreated DNA. The possible location of the protein on the DNA is discussed.

  13. Nitrated Fatty Acids Reverse Cigarette Smoke-Induced Alveolar Macrophage Activation and Inhibit Protease Activity via Electrophilic S-Alkylation.

    PubMed

    Reddy, Aravind T; Lakshmi, Sowmya P; Muchumarri, Ramamohan R; Reddy, Raju C

    2016-01-01

    Nitrated fatty acids (NFAs), endogenous products of nonenzymatic reactions of NO-derived reactive nitrogen species with unsaturated fatty acids, exhibit substantial anti-inflammatory activities. They are both reversible electrophiles and peroxisome proliferator-activated receptor γ (PPARγ) agonists, but the physiological implications of their electrophilic activity are poorly understood. We tested their effects on inflammatory and emphysema-related biomarkers in alveolar macrophages (AMs) of smoke-exposed mice. NFA (10-nitro-oleic acid or 12-nitrolinoleic acid) treatment downregulated expression and activity of the inflammatory transcription factor NF-κB while upregulating those of PPARγ. It also downregulated production of inflammatory cytokines and chemokines and of the protease cathepsin S (Cat S), a key mediator of emphysematous septal destruction. Cat S downregulation was accompanied by decreased AM elastolytic activity, a major mechanism of septal destruction. NFAs downregulated both Cat S expression and activity in AMs of wild-type mice, but only inhibited its activity in AMs of PPARγ knockout mice, pointing to a PPARγ-independent mechanism of enzyme inhibition. We hypothesized that this mechanism was electrophilic S-alkylation of target Cat S cysteines, and found that NFAs bind directly to Cat S following treatment of intact AMs and, as suggested by in silico modeling and calculation of relevant parameters, elicit S-alkylation of Cys25 when incubated with purified Cat S. These results demonstrate that NFAs' electrophilic activity, in addition to their role as PPARγ agonists, underlies their protective effects in chronic obstructive pulmonary disease (COPD) and support their therapeutic potential in this disease.

  14. Novel 2-oxoimidazolidine-4-carboxylic acid derivatives as Hepatitis C virus NS3-4A serine protease inhibitors: synthesis, activity, and X-ray crystal structure of an enzyme inhibitor complex

    SciTech Connect

    Arasappan, Ashok; Njoroge, F. George; Parekh, Tejal N.; Yang, Xiaozheng; Pichardo, John; Butkiewicz, Nancy; Prongay, Andrew; Yao, Nanhua; Girijavallabhan, Viyyoor

    2008-06-30

    Synthesis and HCV NS3 serine protease inhibitory activity of some novel 2-oxoimidazolidine-4-carboxylic acid derivatives are reported. Inhibitors derived from this new P2 core exhibited activity in the low {micro}M range. X-ray structure of an inhibitor, 15c bound to the protease is presented.

  15. Molecular cloning and regulatory analysis of the cuticle-degrading-protease structural gene from the entomopathogenic fungus Metarhizium anisopliae.

    PubMed

    St Leger, R J; Frank, D C; Roberts, D W; Staples, R C

    1992-03-15

    The proteinaceous insect cuticle is an effective barrier against most microbes, but entomopathogenic fungi can breach it using extracellular proteases. We report here the isolation and characterization of a cDNA clone of the cuticle-degrading protease (Pr1) of Metarhizium anisopliae. The cDNA sequence revealed that Pr1 is synthesized as a large precursor (40.3 kDa) containing a signal peptide, a propeptide and the mature protein predicted to have a molecular mass of 28.6 kDa. The primary structure of Pr1 has extensive similarity with enzymes of the subtilisin subclass of serine endopeptidases and the serine, histidine and aspartate components of the active site in subtilisins are preserved. Proteinase K demonstrated the closest sequence similarity to Pr1 (61%) but Pr1 was twofold more effective than proteinase K at degrading isolated cuticles of Manduca sexta and 33-fold more effective at degrading structural proteins bound to the cuticle by covalent bonds. We postulate that the additional positively charged residues on the surface of the Pr1 molecule, as determined using proteinase K, may facilitate electrostatic binding to cuticle proteins which is a prerequisite for activity. Northern-blot analysis of RNA and nuclear run-on assays demonstrated transcriptional control of the expression of Pr1 during nutrient deprivation and during the formation of infection structures. Southern-blot analysis demonstrated that genes with significant homologies to Metarhizium Pr1 were present in the entomopathogens Aspergillus flavus and Verticillium lecanii but not Zoophthora (= Erynia) radicans.

  16. Genetic control of extracellular protease synthesis in the yeast Yarrowia lipolytica.

    PubMed Central

    Gonzalez-Lopez, Claudia I; Szabo, Roman; Blanchin-Roland, Sylvie; Gaillardin, Claude

    2002-01-01

    Depending on the pH of the growth medium, the yeast Yarrowia lipolytica secretes an acidic protease or an alkaline protease, the synthesis of which is also controlled by carbon, nitrogen, and sulfur availability, as well as by the presence of extracellular proteins. Previous results have indicated that the alkaline protease response to pH was dependent on YlRim101p, YlRim8p/YlPalF, and YlRim21p/YlPalH, three components of a conserved pH signaling pathway initially described in Aspergillus nidulans. To identify other partners of this response pathway, as well as pH-independent regulators of proteases, we searched for mutants that affect the expression of either or both acidic and alkaline proteases, using a YlmTn1-transposed genomic library. Four mutations affected only alkaline protease expression and identified the homolog of Saccharomyces cerevisiae SIN3. Eighty-nine mutations affected the expression of both proteases and identified 10 genes. Five of them define a conserved Rim pathway, which acts, as in other ascomycetes, by activating alkaline genes and repressing acidic genes at alkaline pH. Our results further suggest that in Y. lipolytica this pathway is active at acidic pH and is required for the expression of the acidic AXP1 gene. The five other genes are homologous to S. cerevisiae OPT1, SSY5, VPS28, NUP85, and MED4. YlOPT1 and YlSSY5 are not involved in pH sensing but define at least a second protease regulatory pathway. PMID:11861549

  17. HIV-Protease Inhibitors Suppress Skeletal Muscle Fatty Acid Oxidation by Reducing CD36 and CPT-I Fatty Acid Transporters

    PubMed Central

    Richmond, Scott R.; Carper, Michael J.; Lei, Xiaoyong; Zhang, Sheng; Yarasheski, Kevin E.; Ramanadham, Sasanka

    2010-01-01

    Infection with human immunodeficiency virus (HIV) and treatment with HIV-protease inhibitor (PI)-based highly active antiretroviral therapies (HAART) is associated with dysregulated fatty acid and lipid metabolism. Enhanced lipolysis, increased circulating fatty acid levels, and hepatic and intramuscular lipid accumulation appear to contribute to insulin resistance in HIV-infected people treated with PI-based HAART. However, it is unclear whether currently prescribed HIV-PIs directly alter skeletal muscle fatty acid transport, oxidation, and storage. We find that ritonavir (r, 5 μmol/l) plus 20 μmol/l of atazanavir (ATV), lopinavir (LPV), or darunavir (DRV) reduce palmitate oxidation(16-21%) in differentiated C2C12 myotubes. Palmitate oxidation was increased following exposure to high fatty acid media but this effect was blunted when myotubes were pre-exposed to the HIV-PIs. However, LPV/r and DRV/r, but not ATV/r suppressed palmitate uptake into myotubes. We found no effect of the HIV-PIs on FATP1, FATP4, or FABPpm but both CD36/FAT and carnitine palmitoyltransferase I (CPTI) were reduced by all three regimens though ATV/r caused only a small decrease in CPT1, relative to LPV/r or DRV/r. In contrast, sterol regulatory element binding protein-1 was increased by all 3 HIV-PIs. These findings suggest that HIV-PIs suppress fatty acid oxidation in murine skeletal muscle cells and that this may be related to decreases in cytosolic- and mitochondrial-associated fatty acid transporters. HIV-PIs may also directly impair fatty acid handling and partitioning in skeletal muscle, and this may contribute to the cluster of metabolic complications that occur in people living with HIV. PMID:20117238

  18. RNAi-Mediated Knockdown of Serine Protease Inhibitor Genes Increases the Mortality of Plutella xylostella Challenged by Destruxin A

    PubMed Central

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G. S.; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides. PMID:24837592

  19. RNAi-mediated knockdown of serine protease inhibitor genes increases the mortality of Plutella xylostella challenged by destruxin A.

    PubMed

    Han, Pengfei; Fan, Jiqiao; Liu, Yu; Cuthbertson, Andrew G S; Yan, Shaoqiao; Qiu, Bao-Li; Ren, Shunxiang

    2014-01-01

    Destruxin A is a mycotoxin that is secreted by entomopathogenic fungi which has a broad-spectrum insecticidal effect. Previous transcript and protein profiling analysis showed that destruxin A has significant effects on the expression of serine protease inhibitor genes (serpin-2, 4, 5) in the larvae of Plutella xylostella. In the current study, we aimed to understand the role of serpins under application of destruxin A. We obtained two full-length cDNA sequences of P. xylostella serpins, named serpin-4 and serpin-5, and cloned the serpin-2 gene whose full-length has already been published. Phylogenetic analysis indicated that these two serpin genes were highly clustered with other serpins associated with the immune response in other insects. The temporal and spatial expression of serpin-2, serpin-4 and serpin-5 were determined to be the highest in the fat body and hemolymph of 4th larval stage using qRT-PCR and western blot detection techniques. RNA interference (RNAi) mediated knockdown of P. xylostella serpin genes was carried out by microinjection of double-stranded RNA (dsRNA). The expression levels of serpins decreased significantly after RNAi. Results showed that the depletion of serpins induced cecropins expression, increased phenoloxidase (PO) activity, body melanization and mortality in the larvae of P. xylostella under the same lethal concentration of destruxin A. The superimposed effects of serpins RNAi were similar with the destruxin A treatment upon mortality of P. xylostella larvae. We discovered for the first time that serpins play indispensable role in P. xylostella when challenged by destruxin A and deduced the possible function mechanism of destruxin A. Our findings are conducive to fully understanding the potential insecticidal mechanism of destruxin A and constitute a well-defined potential molecular target for novel insecticides.

  20. Amino Acid Prodrugs: An Approach to Improve the Absorption of HIV-1 Protease Inhibitor, Lopinavir

    PubMed Central

    Patel, Mitesh; Mandava, Nanda; Gokulgandhi, Mitan; Pal, Dhananjay; Mitra, Ashim K.

    2014-01-01

    Poor systemic concentrations of lopinavir (LPV) following oral administration occur due to high cellular efflux by P-glycoprotein (P-gp) and multidrug resistance-associated proteins (MRPs) and extensive metabolism by CYP3A4 enzymes. In this study, amino acid prodrugs of LPV were designed and investigated for their potential to circumvent efflux processes and first pass effects. Three amino acid prodrugs were synthesized by conjugating isoleucine, tryptophan and methionine to LPV. Prodrug formation was confirmed by the LCMS/MS and NMR technique. Interaction of LPV prodrugs with efflux proteins were carried out in P-gp (MDCK-MDR1) and MRP2 (MDCK-MRP2) transfected cells. Aqueous solubility studies demonstrated that prodrugs generate higher solubility relative to LPV. Prodrugs displayed higher stability under acidic conditions and degraded significantly with rise in pH. Uptake and transport data suggested that prodrugs carry significantly lower affinity towards P-gp and MRP2 relative to LPV. Moreover, prodrugs exhibited higher liver microsomal stability relative to LPV. Hence, amino acid prodrug modification might be a viable approach for enhancing LPV absorption across intestinal epithelial and brain endothelial cells which expresses high levels of P-gp and MRP2. PMID:24727459

  1. Three genes expressing Kunitz domains in the epididymis are related to genes of WFDC-type protease inhibitors and semen coagulum proteins in spite of lacking similarity between their protein products

    PubMed Central

    2011-01-01

    Background We have previously identified a locus on human chromosome 20q13.1, encompassing related genes of postulated WFDC-type protease inhibitors and semen coagulum proteins. Three of the genes with WFDC motif also coded for the Kunitz-type protease inhibitor motif. In this report, we have reinvestigated the locus for homologous genes encoding Kunitz motif only. The identified genes have been analyzed with respect to structure, expression and function. Results We identified three novel genes; SPINT3, SPINT4 and SPINT5, and the structure of their transcripts were determined by sequencing of DNA generated by rapid amplification of cDNA ends. Each gene encodes a Kunitz domain preceded by a typical signal peptide sequence, which indicates that the proteins of 7.6, 8.7, and 9.7 kDa are secreted. Analysis of transcripts in 26 tissues showed that the genes predominantly are expressed in the epididymis. The recombinantly produced proteins could not inhibit the amidolytic activity of trypsin, chymotrypsin, plasmin, thrombin, coagulation factor Xa, elastase, urokinase and prostate specific antigen, whereas similarly made bovine pancreatic trypsin inhibitor (BPTI) had the same bioactivity as the protein isolated from bovine pancreas. Conclusions The similar organization, chromosomal location and site of expression, suggests that the novel genes are homologous with the genes of WFDC-type protease inhibitors and semen coagulum proteins, despite the lack of similarity in primary structure of their protein products. Their restricted expression to the epididymis suggests that they could be important for male reproduction. The recombinantly produced proteins are presumably bioactive, as demonstrated with similarly made BPTI, but may have a narrower spectrum of inhibition, as indicated by the lacking activity against eight proteases with differing specificity. Another possibility is that they have lost the protease inhibiting properties, which is typical of Kunitz domains, in

  2. Effect of solvent on the conformation and dynamics of Aspartic Acid Protease by a coarse-grained bond-fluctuating Monte Carlo simulation

    NASA Astrophysics Data System (ADS)

    Pandey, Ras; Farmer, Barry

    2007-03-01

    In a coarse-grained description of a protein chain, all of the 20 amino acid residues can be broadly divided into three groups, hydrophobic (H), polar (P), and electrostatic (E). A protein can be described by tethered nodes in a chain with a node representing the amino acid group. Aspartic acid protease consists of 99 residues in a well-defined sequence. The specific sequence of H, P and E nodes tethered together by fluctuating bonds is placed on a cubic lattice where empty lattice sites constitute an effective solvent medium. The amino groups (nodes) interact with the solvent (S) sites with appropriate attractive (HS) and repulsive (PS) interactions with the solvent. Each node executes its stochastic movement with the Metropolis algorithm. Variations of the root mean square displacements of the center of mass and that of its center node of the protease chain, and its gyration radius with the time steps are examined for different solvent strength. The structure of the protease swells on increasing the solvent interaction strength which tends to enhance the relaxation time to reach diffusive behavior of the chain.

  3. Conformation of a coarse-grained protein chain (an aspartic acid protease) model in effective solvent by a bond-fluctuating Monte Carlo simulation

    NASA Astrophysics Data System (ADS)

    Pandey, R. B.; Farmer, B. L.

    2008-03-01

    In a coarse-grained description of a protein chain, all of the 20 amino acid residues can be broadly divided into three groups: Hydrophobic (H) , polar (P) , and electrostatic (E) . A protein can be described by nodes tethered in a chain with a node representing an amino acid group. Aspartic acid protease consists of 99 residues in a well-defined sequence of H , P , and E nodes tethered together by fluctuating bonds. The protein chain is placed on a cubic lattice where empty lattice sites constitute an effective solvent medium. The amino groups (nodes) interact with the solvent (S) sites with appropriate attractive (PS) and repulsive (HS) interactions with the solvent and execute their stochastic movement with the Metropolis algorithm. Variations of the root mean square displacements of the center of mass and that of its center node of the protease chain and its gyration radius with the time steps are examined for different solvent strength. The structure of the protease swells on increasing the solvent interaction strength which tends to enhance the relaxation time to reach the diffusive behavior of the chain. Equilibrium radius of gyration increases linearly on increasing the solvent strength: A slow rate of increase in weak solvent regime is followed by a faster swelling in stronger solvent. Variation of the gyration radius with the time steps suggests that the protein chain moves via contraction and expansion in a somewhat quasiperiodic pattern particularly in strong solvent.

  4. Supermarket Proteases.

    ERIC Educational Resources Information Center

    Hagar, William G.; Bullerwell, Lornie D.

    2003-01-01

    Presents a laboratory activity on enzymes. Uses common items found in the supermarket that contain protease enzymes, such as contact lens cleaner and meat tenderizer. Demonstrates the digestion of gelatin proteins as part of enzymatic reactions. (Author/SOE)

  5. Molecular characterization of alkaline protease of Bacillus amyloliquefaciens SP1 involved in biocontrol of Fusarium oxysporum.

    PubMed

    Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, C K

    2016-09-02

    An alkaline protease gene was amplified from genomic DNA of Bacillus amyloliquefaciens SP1 which was involved in effective biocontrol of Fusarium oxysporum. We investigated the antagonistic capacity of protease of B. amyloliquifaciens SP1, under in vitro conditions. The 5.62 fold purified enzyme with specific activity of 607.69U/mg reported 24.14% growth inhibition of F. oxysporum. However, no antagonistic activity was found after addition of protease inhibitor i.e. PMSF (15mM) to purified enzyme. An 1149bp nucleotide sequence of protease gene encoded 382 amino acids of 43kDa and calculated isoelectric point of 9.29. Analysis of deduced amino acid sequence revealed high homology (86%) with subtilisin E of Bacillus subtilis. The B. amyloliquefaciens SP1 protease gene was expressed in Escherichiax coli BL21. The expressed protease was secreted into culture medium by E. coli and exhibited optimum activity at pH8.0 and 60°C. The most reliable three dimensional structure of alkaline protease was determined using Phyre 2 server which was validated on the basis of Ramachandran plot and ERRAT value. The expression and structure prediction of the enzyme offers potential value for commercial application in agriculture and industry.

  6. Effects of protease and non-starch polysaccharide enzyme on performance, digestive function, activity and gene expression of endogenous enzyme of broilers.

    PubMed

    Yuan, Lin; Wang, Mingfa; Zhang, Xiaotu; Wang, Zhixiang

    2017-01-01

    Three hundred one-day-old male broiler chickens (Ross-308) were fed corn-soybean basal diets containing non-starch polysaccharide (NSP) enzyme and different levels of acid protease from 1 to 42 days of age to investigate the effects of exogenous enzymes on growth performance, digestive function, activity of endogenous digestive enzymes in the pancreas and mRNA expression of pancreatic digestive enzymes. For days 1-42, compared to the control chickens, average daily feed intake (ADFI) and average daily gain (ADG) were significantly enhanced by the addition of NSP enzyme in combination with protease supplementation at 40 or 80 mg/kg (p<0.05). Feed-to-gain ratio (FGR) was significantly improved by supplementation with NSP enzymes or NSP enzyme combined with 40 or 80 mg/kg protease compared to the control diet (p<0.05). Apparent digestibility of crude protein (ADCP) was significantly enhanced by the addition of NSP enzyme or NSP enzyme combined with 40 or 80 mg/kg protease (p<0.05). Cholecystokinin (CCK) level in serum was reduced by 31.39% with NSP enzyme combined with protease supplementation at 160 mg/kg (p<0.05), but the CCK level in serum was increased by 26.51% with NSP enzyme supplementation alone. After 21 days, supplementation with NSP enzyme and NSP enzyme combined with 40 or 80 mg/kg protease increased the activity of pancreatic trypsin by 74.13%, 70.66% and 42.59% (p<0.05), respectively. After 42 days, supplementation with NSP enzyme and NSP enzyme combined with 40 mg/kg protease increased the activity of pancreatic trypsin by 32.45% and 27.41%, respectively (p<0.05). However, supplementation with NSP enzyme and 80 or 160 mg/kg protease decreased the activity of pancreatic trypsin by 10.75% and 25.88%, respectively (p<0.05). The activities of pancreatic lipase and amylase were significantly higher in treated animals than they were in the control group (p<0.05). Supplementation with NSP enzyme, NSP enzyme combined with 40 or 80 mg/kg protease increased

  7. Effects of protease and non-starch polysaccharide enzyme on performance, digestive function, activity and gene expression of endogenous enzyme of broilers

    PubMed Central

    Wang, Mingfa; Zhang, Xiaotu; Wang, Zhixiang

    2017-01-01

    Three hundred one-day-old male broiler chickens (Ross-308) were fed corn-soybean basal diets containing non-starch polysaccharide (NSP) enzyme and different levels of acid protease from 1 to 42 days of age to investigate the effects of exogenous enzymes on growth performance, digestive function, activity of endogenous digestive enzymes in the pancreas and mRNA expression of pancreatic digestive enzymes. For days 1-42, compared to the control chickens, average daily feed intake (ADFI) and average daily gain (ADG) were significantly enhanced by the addition of NSP enzyme in combination with protease supplementation at 40 or 80 mg/kg (p<0.05). Feed-to-gain ratio (FGR) was significantly improved by supplementation with NSP enzymes or NSP enzyme combined with 40 or 80 mg/kg protease compared to the control diet (p<0.05). Apparent digestibility of crude protein (ADCP) was significantly enhanced by the addition of NSP enzyme or NSP enzyme combined with 40 or 80 mg/kg protease (p<0.05). Cholecystokinin (CCK) level in serum was reduced by 31.39% with NSP enzyme combined with protease supplementation at 160 mg/kg (p<0.05), but the CCK level in serum was increased by 26.51% with NSP enzyme supplementation alone. After 21 days, supplementation with NSP enzyme and NSP enzyme combined with 40 or 80 mg/kg protease increased the activity of pancreatic trypsin by 74.13%, 70.66% and 42.59% (p<0.05), respectively. After 42 days, supplementation with NSP enzyme and NSP enzyme combined with 40 mg/kg protease increased the activity of pancreatic trypsin by 32.45% and 27.41%, respectively (p<0.05). However, supplementation with NSP enzyme and 80 or 160 mg/kg protease decreased the activity of pancreatic trypsin by 10.75% and 25.88%, respectively (p<0.05). The activities of pancreatic lipase and amylase were significantly higher in treated animals than they were in the control group (p<0.05). Supplementation with NSP enzyme, NSP enzyme combined with 40 or 80 mg/kg protease increased

  8. Transcriptional Gene Silencing Maintained by OTS1 SUMO Protease Requires a DNA-Dependent Polymerase V-Dependent Pathway1[OPEN

    PubMed Central

    Liu, Lei; Yan, Xiaojing; Zhao, Yiqiang

    2017-01-01

    The expression of genes with aberrant structure is prevented at both the transcriptional and posttranscriptional regulation levels. Aberrant gene silencing at the posttranscriptional level is well studied; however, it is not well understood how aberrant genes are silenced at the transcriptional level. In this study, through genetic screening a transgenic report line that harbors an aberrant gene (35S-LUC, lacking 3′-untranslated region [3′-UTR]) and lacks luciferase (LUC) activity, we identify that the small ubiquitin-like modifier (SUMO) protease OTS1 gene is required for maintaining the silence of the reporter 35S-LUC and an endogenous mutator-like element MULE-F19G14 at the transcriptional level, which requires DNA-dependent RNA polymerase (Pol) V and DDR complex, but not Pol IV. The increased transcripts in ots1 mutants are terminated by the 3′-UTRs of downstream genes. In addition to ots1 mutations, mutations in several known or putative SUMO proteases and two SUMO E3 ligases, SIZ1 and MMS21, have similar effects on this silencing regulation. Taken together, our results reveal that the enzymes involved in the SUMOylation process restrain aberrant gene transcription by using a downstream gene 3′-UTR, and this regulation requires a functional Pol V-dependent pathway in Arabidopsis (Arabidopsis thaliana). PMID:27852949

  9. Mutagenesis of a novel gene in the prcA-prtP protease locus affects expression of Treponema denticola membrane complexes.

    PubMed

    Bian, Xue-Lin; Wang, Hong-Tao; Ning, Yu; Lee, Si Young; Fenno, J Christopher

    2005-02-01

    A novel gene was identified in the Treponema denticola prcA-prtP protease operon. Strains with mutations in either the prcA-prtP or the msp region showed altered expression of a product(s) of the other locus. Together, these results provide information on the assembly of outer membrane complexes involved in T. denticola interaction with host cells and tissue.

  10. Mutagenesis of a Novel Gene in the prcA-prtP Protease Locus Affects Expression of Treponema denticola Membrane Complexes

    PubMed Central

    Bian, Xue-lin; Wang, Hong-tao; Ning, Yu; Lee, Si Young; Fenno, J. Christopher

    2005-01-01

    A novel gene was identified in the Treponema denticola prcA-prtP protease operon. Strains with mutations in either the prcA-prtP or the msp region showed altered expression of a product(s) of the other locus. Together, these results provide information on the assembly of outer membrane complexes involved in T. denticola interaction with host cells and tissue. PMID:15664975

  11. Conditional Depletion of the Chlamydomonas Chloroplast ClpP Protease Activates Nuclear Genes Involved in Autophagy and Plastid Protein Quality Control[W

    PubMed Central

    Ramundo, Silvia; Casero, David; Mühlhaus, Timo; Hemme, Dorothea; Sommer, Frederik; Crèvecoeur, Michèle; Rahire, Michèle; Schroda, Michael; Rusch, Jannette; Goodenough, Ursula; Pellegrini, Matteo; Perez-Perez, Maria Esther; Crespo, José Luis; Schaad, Olivier; Civic, Natacha; Rochaix, Jean David

    2014-01-01

    Plastid protein homeostasis is critical during chloroplast biogenesis and responses to changes in environmental conditions. Proteases and molecular chaperones involved in plastid protein quality control are encoded by the nucleus except for the catalytic subunit of ClpP, an evolutionarily conserved serine protease. Unlike its Escherichia coli ortholog, this chloroplast protease is essential for cell viability. To study its function, we used a recently developed system of repressible chloroplast gene expression in the alga Chlamydomonas reinhardtii. Using this repressible system, we have shown that a selective gradual depletion of ClpP leads to alteration of chloroplast morphology, causes formation of vesicles, and induces extensive cytoplasmic vacuolization that is reminiscent of autophagy. Analysis of the transcriptome and proteome during ClpP depletion revealed a set of proteins that are more abundant at the protein level, but not at the RNA level. These proteins may comprise some of the ClpP substrates. Moreover, the specific increase in accumulation, both at the RNA and protein level, of small heat shock proteins, chaperones, proteases, and proteins involved in thylakoid maintenance upon perturbation of plastid protein homeostasis suggests the existence of a chloroplast-to-nucleus signaling pathway involved in organelle quality control. We suggest that this represents a chloroplast unfolded protein response that is conceptually similar to that observed in the endoplasmic reticulum and in mitochondria. PMID:24879428

  12. Conditional Depletion of the Chlamydomonas Chloroplast ClpP Protease Activates Nuclear Genes Involved in Autophagy and Plastid Protein Quality Control.

    PubMed

    Ramundo, Silvia; Casero, David; Mühlhaus, Timo; Hemme, Dorothea; Sommer, Frederik; Crèvecoeur, Michèle; Rahire, Michèle; Schroda, Michael; Rusch, Jannette; Goodenough, Ursula; Pellegrini, Matteo; Perez-Perez, Maria Esther; Crespo, José Luis; Schaad, Olivier; Civic, Natacha; Rochaix, Jean David

    2014-05-01

    Plastid protein homeostasis is critical during chloroplast biogenesis and responses to changes in environmental conditions. Proteases and molecular chaperones involved in plastid protein quality control are encoded by the nucleus except for the catalytic subunit of ClpP, an evolutionarily conserved serine protease. Unlike its Escherichia coli ortholog, this chloroplast protease is essential for cell viability. To study its function, we used a recently developed system of repressible chloroplast gene expression in the alga Chlamydomonas reinhardtii. Using this repressible system, we have shown that a selective gradual depletion of ClpP leads to alteration of chloroplast morphology, causes formation of vesicles, and induces extensive cytoplasmic vacuolization that is reminiscent of autophagy. Analysis of the transcriptome and proteome during ClpP depletion revealed a set of proteins that are more abundant at the protein level, but not at the RNA level. These proteins may comprise some of the ClpP substrates. Moreover, the specific increase in accumulation, both at the RNA and protein level, of small heat shock proteins, chaperones, proteases, and proteins involved in thylakoid maintenance upon perturbation of plastid protein homeostasis suggests the existence of a chloroplast-to-nucleus signaling pathway involved in organelle quality control. We suggest that this represents a chloroplast unfolded protein response that is conceptually similar to that observed in the endoplasmic reticulum and in mitochondria.

  13. Mutations in the Reverse Transcriptase and Protease Genes of Human Immunodeficiency Virus-1 from Antiretroviral Naïve and Treated Pediatric Patients

    PubMed Central

    Bure, Dinesh; Makhdoomi, Muzamil A.; Lodha, Rakesh; Prakash, Somi Sankaran; Kumar, Rajesh; Parray, Hilal A.; Singh, Ravinder; Kabra, Sushil K.; Luthra, Kalpana

    2015-01-01

    The success of highly active antiretroviral therapy (HAART) is challenged by the emergence of resistance-associated mutations in human immunodeficiency virus-1 (HIV-1). In this study, resistance associated mutations in the reverse transcriptase (RT) and protease (PR) genes in antiretroviral therapy (ART) naïve and treated HIV-1 infected pediatric patients from North India were evaluated. Genotyping was successfully performed in 46 patients (30 ART naive and 16 treated) for the RT gene and in 53 patients (27 ART naive and 26 treated) for PR gene and mutations were identified using Stanford HIV Drug Resistance Database. A major drug resistant mutation in RT gene, L74I (NRTI), and two such mutations, K101E and G190A (NNRTI), were observed in two ART naïve patients, while M184V was detected in two ART treated patients. Overall, major resistance associated mutations in RT gene were observed in nine (30%) and seven (36%) of ART naïve and treated children respectively. Minor mutations were identified in PR gene in five children. Few non-clade C viral strains (≈30%) were detected, although subtype C was most predominant. The screening of ART naïve children for mutations in HIV-1 RT and protease genes, before and after initiation of ART is desirable for drug efficacy and good prognosis. PMID:25674767

  14. Mutations in the reverse transcriptase and protease genes of human immunodeficiency virus-1 from antiretroviral naïve and treated pediatric patients.

    PubMed

    Bure, Dinesh; Makhdoomi, Muzamil A; Lodha, Rakesh; Prakash, Somi Sankaran; Kumar, Rajesh; Parray, Hilal A; Singh, Ravinder; Kabra, Sushil K; Luthra, Kalpana

    2015-02-10

    The success of highly active antiretroviral therapy (HAART) is challenged by the emergence of resistance-associated mutations in human immunodeficiency virus-1 (HIV-1). In this study, resistance associated mutations in the reverse transcriptase (RT) and protease (PR) genes in antiretroviral therapy (ART) naïve and treated HIV-1 infected pediatric patients from North India were evaluated. Genotyping was successfully performed in 46 patients (30 ART naive and 16 treated) for the RT gene and in 53 patients (27 ART naive and 26 treated) for PR gene and mutations were identified using Stanford HIV Drug Resistance Database. A major drug resistant mutation in RT gene, L74I (NRTI), and two such mutations, K101E and G190A (NNRTI), were observed in two ART naïve patients, while M184V was detected in two ART treated patients. Overall, major resistance associated mutations in RT gene were observed in nine (30%) and seven (36%) of ART naïve and treated children respectively. Minor mutations were identified in PR gene in five children. Few non-clade C viral strains (≈30%) were detected, although subtype C was most predominant. The screening of ART naïve children for mutations in HIV-1 RT and protease genes, before and after initiation of ART is desirable for drug efficacy and good prognosis.

  15. A novel serine protease with caspase- and legumain-like activities from edible basidiomycete Flammulina velutipes.

    PubMed

    Iketani, Aya; Nakamura, Mayumi; Suzuki, Yuya; Awai, Koichiro; Shioi, Yuzo

    2013-03-01

    A serine protease with caspase- and legumain-like activities from basidiocarps of the edible basidiomycete Flammulina velutipes was characterized. The protease was purified to near homogeneity by three steps of chromatography using acetyl-Tyr-Val-Ala-Asp-4-methylcoumaryl-7-amide (Ac-YVAD-MCA) as a substrate. The enzyme was termed FvSerP (F. velutipes serine protease). This enzyme activity was completely inhibited by the caspase-specific inhibitor, Ac-YVAD-CHO, as well as moderately inhibited by serine protease inhibitors. Based on the N-terminal sequence, the cDNA of FvSerP was identified. The deduced protease sequence was a peptide composed of 325 amino acids with a molecular mass of 34.5 kDa. The amino acid sequence of FvSerP showed similarity to neither caspases nor to the plant subtilisin-like serine protease with caspase-like activity called saspase. FvSerP shared identity to the functionally unknown genes from class of Agaricomycetes, with similarity to the peptidase S41 domain of a serine protease. It was thus concluded that this enzyme is likely a novel serine protease with caspase- and legumain-like activities belonging to the peptidase S41 family and distributed in the class Agaricomycetes. This enzyme possibly functions in autolysis, a type of programmed cell death that occurs in the later stages of development of basidiocarps with reference to their enzymatic functions.

  16. [Chloroplast Deg proteases].

    PubMed

    Grabsztunowicz, Magda; Luciński, Robert; Baranek, Małgorzata; Sikora, Bogna; Jackowski, Grzegorz

    2011-01-01

    For some chloroplast proteases ATP binding and hydrolysis is not necessary for their catalytic activity, most probably because even strongly unfolded substrates may penetrate their catalytic chamber. Deg1, 2, 5 and 8 are the best known of Arabidopsis thaliana ATP- independent chloroplast proteases, encoded by orthologues of genes coding for DegP, DegQ and DegS proteases of Escherichia coli. Current awareness in the area of structure and functions of chloroplast Degs is much more limited vs the one about their bacterial counterparts. Deg5 and Deg8 form a catalytic heterododecamer which is loosely attached to luminal side of thylakoid membrane. The complex catalyses--supported by Deg1 and one of FtsH proteases--the degradation of PsbA damaged due to plant exposition to elevated irradiance and thus these protease are of key importance for the plants' sensitivity to photoinhibition. Deg2 role in the disposal of damaged PsbA has not been elucidated. Recombinant Deg1 may degrade PsbO and plastocyanin in vitro but it is not clear whether this reaction is performed in vivo as well.

  17. Structural Insight into Serine Protease Rv3671c that Protects M. tuberculosis from Oxidative and Acidic Stress

    SciTech Connect

    Biswas, Tapan; Small, Jennifer; Vandal, Omar; Odaira, Toshiko; Deng, Haiteng; Ehrt, Sabine; Tsodikov, Oleg V.

    2010-11-15

    Rv3671c, a putative serine protease, is crucial for persistence of Mycobacterium tuberculosis in the hostile environment of the phagosome. We show that Rv3671c is required for M. tuberculosis resistance to oxidative stress in addition to its role in protection from acidification. Structural and biochemical analyses demonstrate that the periplasmic domain of Rv3671c is a functional serine protease of the chymotrypsin family and, remarkably, that its activity increases on oxidation. High-resolution crystal structures of this protease in an active strained state and in an inactive relaxed state reveal that a solvent-exposed disulfide bond controls the protease activity by constraining two distant regions of Rv3671c and stabilizing it in the catalytically active conformation. In vitro biochemical studies confirm that activation of the protease in an oxidative environment is dependent on this reversible disulfide bond. These results suggest that the disulfide bond modulates activity of Rv3671c depending on the oxidative environment in vivo.

  18. Stability of small ubiquitin-like modifier (SUMO) proteases OVERLY TOLERANT TO SALT1 and -2 modulates salicylic acid signalling and SUMO1/2 conjugation in Arabidopsis thaliana.

    PubMed

    Bailey, Mark; Srivastava, Anjil; Conti, Lucio; Nelis, Stuart; Zhang, Cunjin; Florance, Hannah; Love, Andrew; Milner, Joel; Napier, Richard; Grant, Murray; Sadanandom, Ari

    2016-01-01

    Small ubiquitin-like modifier proteases 1 and 2 (SUMO1/2) have been linked to the regulation of salicylic acid (SA)-mediated defence signalling in Arabidopsis thaliana. In order to define the role of the SUMO proteases OVERLY TOLERANT TO SALT1 and -2 (OTS1/2) in defence and to provide insight into SUMO1/2-mediated regulation of SA signalling, we examined the status of SA-mediated defences in ots1/2 mutants. The ots1 ots2 double mutant displayed enhanced resistance to virulent Pseudomonas syringae and higher levels of SA compared with wild-type (WT) plants. Furthermore, ots1 ots2 mutants exhibited upregulated expression of the SA biosynthesis gene ICS1 in addition to enhanced SA-responsive ICS1 expression beyond that of WT. SA stimulated OTS1/2 degradation and promoted accumulation of SUMO1/2 conjugates. These results indicate that OTS1 and -2 act in a feedback loop in SA signalling and that de novo OTS1/2 synthesis works antagonistically to SA-promoted degradation, adjusting the abundance of OTS1/2 to moderate SA signalling. Accumulation of SUMO1/2 conjugates coincides with SA-promoted OTS degradation and may play a positive role in SA-mediated signalling in addition to its repressive roles reported elsewhere.

  19. Genetic improvement of the nematicidal fungus Lecanicillium attenuatum against Heterodera glycines by expression of the Beauveria bassiana Cdep1 protease gene.

    PubMed

    Xie, Ming; Zhang, Yan-Jun; Zhang, Xiao-Lin; Peng, De-Liang; Yu, Wen-Bin; Li, Qian

    2016-07-01

    Lecanicillium attenuatum is an important nematophagous fungus with potential as a biopesticide against plant-parasitic nematodes. The Pr1A-like cuticle-degrading protease (Cdep1) gene originating from the entomopathogenic fungus Beauveria bassiana was transformed into the nematophagous fungus L. attenuatum using a polyethylene-glycol mediated protoplast-based transformation system. Protease activity was increased 0.64- to 1.63-fold 2-10d after growth in the transformed L. attenuatum. Inhibition of egg-hatching and J2 motility of soybean cyst nematodes (Heterodera glycines) by cell-free fungal culture filtrates were enhanced by 17-76% 2-14d and 43-152% 1-13d after incubation, respectively.

  20. The protease inhibitor chagasin of Trypanosoma cruzi adopts an immunoglobulin-type fold and may have arisen by horizontal gene transfer.

    PubMed

    Rigden, D J; Monteiro, A C; Grossi de Sá, M F

    2001-08-24

    Chagasin, a protein from Trypanosoma cruzi, is the first member of a new family of tight binding cysteine protease inhibitors [Monteiro, A.C.S., Abrahamson, M., Lima, A.P.C., Vannier-Santos, M.A. and Scharfstein, J. (2001) J. Cell Sci., in press] [corrected]. Despite its lack of significant sequence identity with known proteins, convincing structural models, using variable light chain templates, could be constructed on the basis of threading results. Experimental support for the final structure came from inhibition data for overlapping oligopeptides spanning the chagasin sequence. Chagasin therefore exemplifies a new protease inhibitor structural class and a new natural use for an immunoglobulin-like domain. Limited sequence resemblance suggests that chagasin may represent the result of a rare horizontal gene transfer from host to parasite.

  1. Protease Profiling in Prostate Cancer

    DTIC Science & Technology

    2004-05-01

    acid synthase, which contains a serine hydrolase domain. We identified a lead inhibitor of this domain of fatty acid synthase, called Orlistat, which...SUBJECT TERMS 15. NUMBER OF PAGES Prostate cancer, tumor biology, protease, proteomics, transgenic, 20 animal model, fatty acid synthase, orlistat 16...the enzymes we identified is fatty acid synthase. Fatty acid synthase is the sole enzyme responsible for the cellular synthesis of fatty acids . This

  2. Mapping of glutamic acid decarboxylase (GAD) genes

    SciTech Connect

    Edelhoff, S.; Adler, D.A.; Disteche, C.M.; Grubin, C.E.; Karlsen, A.E.; Lernmark, A.; Foster, D. )

    1993-07-01

    Glutamic acid decarboxylase (GAD) catalyzes the synthesis of [gamma]-aminobutyric acid (GABA), which is known as a major inhibitory neurotransmitter in the central nervous system (CNS), but is also present outside the CNS. Recent studies showed that GAD is the major target of autoantibodies associated with the development of insulin-dependent diabetes mellitus and of the rare stiff man syndrome. Studies of GAD expression have demonstrated multiple transcripts, suggesting several isoforms of GAD. In this study, three different genes were mapped by in situ hybridization to both human and mouse chromosomes. The GAD1 gene was mapped to human chromosome 2q31 and to mouse chromosome 2D in a known region of conservation between human and mouse. GAD2, previously mapped to human chromosome 10p11.2-p12, was mapped to mouse chromosome 2A2-B, which identifies a new region of conservation between human and mouse chromosomes. A potential GAD3 transcript was mapped to human chromosome 22q13 and to mouse chromosome 15E in a known region of conservation between human and mouse. It is concluded that the GAD genes may form a family with as many as three related members. 30 refs., 5 figs.

  3. Cleavage of peptide bonds bearing ionizable amino acids at P{sub 1} by serine proteases with hydrophobic S{sub 1} pocket

    SciTech Connect

    Qasim, Mohammad A.; Song, Jikui; Markley, John L.; Laskowski, Michael

    2010-10-01

    Research highlights: {yields} Large pK shifts in ionizable groups when buried in the protein interior. {yields} Substrate dependent shifts in pH optimum for serine proteases. {yields} Lys side chain is a stronger acid in serine protease S{sub 1} pocket than Asp side chain. -- Abstract: Enzymatic hydrolysis of the synthetic substrate succinyl-Ala-Ala-Pro-Xxx-pNA (where Xxx = Leu, Asp or Lys) catalyzed by bovine chymotrypsin (CHYM) or Streptomyces griseus protease B (SGPB) has been studied at different pH values in the pH range 3-11. The pH optima for substrates having Leu, Asp, and Lys have been found to be 7.5-8.0, 5.5-6.0, and {approx}10, respectively. At the normally reported pH optimum (pH 7-8) of CHYM and SGPB, the substrate with Leu at the reactive site is more than 25,000-fold more reactive than that with Asp. However, when fully protonated, Asp is nearly as good a substrate as Leu. The pK values of the side chains of Asp and Lys in the hydrophobic S{sub 1} pocket of CHYM and SGPB have been calculated from pH-dependent hydrolysis data and have been found to be about 9 for Asp and 7.4 and 9.7 for Lys for CHYM and SGPB, respectively. The results presented in this communication suggest a possible application of CHYM like enzymes in cleaving peptide bonds contributed by acidic amino acids between pH 5 and 6.

  4. Enzymatic hydrolysis of cuttlefish (Sepia officinalis) and sardine (Sardina pilchardus) viscera using commercial proteases: effects on lipid distribution and amino acid composition.

    PubMed

    Kechaou, Emna Soufi; Dumay, Justine; Donnay-Moreno, Claire; Jaouen, Pascal; Gouygou, Jean-Paul; Bergé, Jean-Pascal; Amar, Raja Ben

    2009-02-01

    Total lipid and phospholipid recovery as well as amino acid quality and composition from cuttlefish (Sepia officinalis) and sardine (Sardina pilchardus) were compared. Enzymatic hydrolyses were performed using the three proteases Protamex, Alcalase, and Flavourzyme by the pH-stat method (24 h, pH 8, 50 degrees C). Three fractions were generated: an insoluble sludge, a soluble aqueous phase, and an oily phase. For each fraction, lipids, phospholipids, and proteins were quantified. Quantitative and qualitative analyses of the raw material and hydrolysates were performed. The degree of hydrolysis (DH) for cuttlefish viscera was 3.2% using Protamex, 6.8% using Flavourzyme, and 7% using Alcalase. DH for sardine viscera was 1.9% (using Flavourzyme), 3.1% (using Protamex) and 3.3% (using Alcalase). Dry matter yields of all hydrolysis reactions increased in the aqueous phases. Protein recovery following hydrolysis ranged from 57.2% to 64.3% for cuttlefish and 57.4% to 61.2% for sardine. Tissue disruption following protease treatment increased lipid extractability, leading to higher total lipid content after hydrolysis. At least 80% of the lipids quantified in the raw material were distributed in the liquid phases for both substrates. The hydrolysed lipids were richer in phospholipids than in the lipids extracted by classical chemical extraction, especially after Flavourzyme hydrolysis for cuttlefish and Alcalase hydrolysis for sardine. The total amino acid content differed according to the substrate and the enzyme used. However, regardless of the raw material or the protease used, hydrolysis increased the level of essential amino acids in the hydrolysates, thereby increasing their potential nutritional value for feed products.

  5. An extracellular serine protease produced by Vibrio vulnificus NCIMB 2137, a metalloprotease-gene negative strain isolated from a diseased eel.

    PubMed

    Miyoshi, Shin-Ichi; Wang, Jiyou; Katoh, Keizo; Senoh, Mitsutoshi; Mizuno, Tamaki; Maehara, Yoko

    2012-04-01

    Vibrio vulnificus is a ubiquitous estuarine microorganism but causes fatal systemic infections in immunocompromised humans, cultured eels or shrimps. An extracellular metalloprotease VVP/VvpE has been reported to be a potential virulence factor of the bacterium; however, a few strains isolated from a diseased eel or shrimp were recently found to produce a serine protease termed VvsA, but not VVP/VvpE. In the present study, we found that these strains had lost the 80 kb genomic region including the gene encoding VVP/VvpE. We also purified VvsA from the culture supernatant through ammonium sulfate fractionation, gel filtration and ion-exchange column chromatography, and the enzyme was demonstrated to be a chymotrypsin-like protease, as well as those from some vibrios. The gene vvsA was shown to constitute an operon with a downstream gene vvsB, and several Vibrio species were found to have orthologues of vvsAB. These findings indicate that the genes vvp/vvpE and vvsAB might be mobile genetic elements.

  6. Biochemical and functional analysis of the YME1 gene product, an ATP and zinc-dependent mitochondrial protease from S. cerevisiae.

    PubMed Central

    Weber, E R; Hanekamp, T; Thorsness, P E

    1996-01-01

    Inactivation of YME1 in yeast causes several distinct phenotypes: an increased rate of DNA escape from mitochondria, temperature-sensitive growth on nonfermentable carbon sources, extremely slow growth when mitochondrial DNA is completely absent from the cell, and altered morphology of the mitochondrial compartment. The protein encoded by YME1, Yme1p, contains two highly conserved sequence elements, one implicated in the binding and hydrolysis of ATP, and the second characteristic of active site residues found in neutral, zinc-dependent proteases. Both the putative ATPase and zinc-dependent protease elements are necessary for the function of Yme1p as genes having mutations in critical residues of either of these motifs are unable to suppress any of the phenotypes exhibited by yme1 deletion strains. Yme1p co-fractionates with proteins associated with the mitochondrial inner membrane, is tightly associated with this membrane, and is oriented with the bulk of the protein facing the matrix. Unassembled subunit II of cytochrome oxidase is stabilized in yme1 yeast strains. The data support a model in which Yme1p is an ATP and zinc-dependent protease associated with the matrix side of the inner mitochondrial membrane. Subunit II of cytochrome oxidase, when not assembled into a higher order complex, is a likely substrate of Yme1p. Images PMID:8688560

  7. Probing the segmental mobility and energy of the active zones of a protein chain (aspartic acid protease) by a coarse-grained bond-fluctuation Monte Carlo simulation

    NASA Astrophysics Data System (ADS)

    Pandey, Ras; Farmer, Barry

    2008-03-01

    A protein chain such as aspartic acid protease is described by a specific sequence of 99 residues each with its own specific characteristics. In a coarse-grained description, the backbone of a protein chain is described by nodes tethered together by peptide bonds where each node (the amino acid group) is characterized by molecular weight and hydrophobicity. A well-developed and somewhat mature computational modeling tool for the polymer chain such as the bond-fluctuation model is used to study such a specific protein chain with its constitutive amino groups and their sequence. The relative magnitude of hydrophobicity is used to develop appropriate interaction potentials for these amino acid groups in explicit solvent. The Metropolis algorithm is used to move each node and solvent constituent. Local energy and mobility of each amino group are analyzed along with global energy, mobility, and conformation of the protein chain. Effect of the solvent interaction and its concentration on these quantities will be presented.

  8. Intragenomic diversity of the V1 regions of 16S rRNA genes in high-alkaline protease-producing Bacillus clausii spp.

    PubMed

    Kageyama, Yasushi; Takaki, Yoshihiro; Shimamura, Shigeru; Nishi, Shinro; Nogi, Yuichi; Uchimura, Kohsuke; Kobayashi, Tohru; Hitomi, Jun; Ozaki, Katsuya; Kawai, Shuji; Ito, Susumu; Horikoshi, Koki

    2007-07-01

    Alkaliphilic Bacillus sp. strain KSM-K16, which produces high-alkaline M-protease, was characterized phenotypically, biochemically and genetically. This strain was identified as Bacillus clausii based on the results of taxonomic studies, including sequencing of the 16S rRNA gene and DNA-DNA hybridization. Seven rRNA operons in the genome were identified by pulsed-field gel electrophoresis. Sequencing of cloned 16S rRNA genes revealed two distinct types of variable region V1. Moreover, some cloned 16S rRNA genes in some of the reference strains of B. clausii had a V1 region of yet another type. The B. clausii strains could clearly be divided into at least two subgroups based on the frequencies of the types of cloned V1 sequence. Bacillus sp. strain KSM-K16 was found to be in a different phylogenetic position from other high-alkaline protease-producing strains of B. clausii.

  9. Molecular Cloning and Optimization for High Level Expression of Cold-Adapted Serine Protease from Antarctic Yeast Glaciozyma antarctica PI12

    PubMed Central

    Ahmad Mazian, Mu'adz; Salleh, Abu Bakar; Basri, Mahiran; Rahman, Raja Noor Zaliha Raja Abd.

    2014-01-01

    Psychrophilic basidiomycete yeast, Glaciozyma antarctica strain PI12, was shown to be a protease-producer. Isolation of the PI12 protease gene from genomic and mRNA sequences allowed determination of 19 exons and 18 introns. Full-length cDNA of PI12 protease gene was amplified by rapid amplification of cDNA ends (RACE) strategy with an open reading frame (ORF) of 2892 bp, coded for 963 amino acids. PI12 protease showed low homology with the subtilisin-like protease from fungus Rhodosporidium toruloides (42% identity) and no homology to other psychrophilic proteases. The gene encoding mature PI12 protease was cloned into Pichia pastoris expression vector, pPIC9, and positioned under the induction of methanol-alcohol oxidase (AOX) promoter. The recombinant PI12 protease was efficiently secreted into the culture medium driven by the Saccharomyces cerevisiae α-factor signal sequence. The highest protease production (28.3 U/ml) was obtained from P. pastoris GS115 host (GpPro2) at 20°C after 72 hours of postinduction time with 0.5% (v/v) of methanol inducer. The expressed protein was detected by SDS-PAGE and activity staining with a molecular weight of 99 kDa. PMID:25093119

  10. Proteases from psychrotrophs: an overview.

    PubMed

    Kasana, Ramesh Chand

    2010-05-01

    Proteases are hydrolytic enzymes which catalyze the total hydrolysis of proteins in to amino acids. Although proteolytic enzymes can be obtained from animals and plants but microorganisms are the preferred source for industrial applications in view of scientific and economical advantage. Among various groups of microbes, psychrotrophs are ideal candidates for enzymes production keeping in mind that enzymes active at low temperature and stable under alkaline condition, in presence of oxidants and detergents are in large demand as laundry additive. The proteases from psychrotrophs also find application in environmental bioremediation, food and molecular biology. During the previous two decades, proteases from psychrotrophs have received increased attention because of their wide range of applications, but the full potential of psychrotrophic proteases has not been exploited. This review focuses attention on the present status of knowledge on the production, optimization, molecular characteristics, applications, substrate specificity, and crystal structure of psychrotrophic proteases. The review will help in making strategies for exploitation of psychrotrophic protease resources and improvement of enzymes to obtain more robust proteases of industrial and biotechnological significance.

  11. Resistance mutations in protease gene at baseline are not related to virological failure in patients treated with darunavir/ritonavir monotherapy

    PubMed Central

    Gutierrez-Liarte, Angela; Gomez-Berrocal, Ana; Saez, Carmen; Valencia, Jorge; Santos, Ignacio; Sanz, Jesus

    2014-01-01

    Introduction Monotherapy with darunavir plus ritonavir (DRV/r) is a good maintenance strategy for suppressed HIV-infected patients. The clinical trials designed to prove the efficacy of PI/r do not include patients with resistance mutation in protease gene [1,2]. Sometimes in routine practice, basically to avoid NRTIs toxicity, monotherapy with DRV/r is used despite PI resistance mutations. The aim of this study is to know the effect of previous protease resistance mutation on DRV/r monotherapy efficacy. Materials and Methods We designed an observational cohort study of adults in treatment with DRV/r monotherapy in a tertiary Spanish hospital since 2011 to 2014. Demographic data and clinical outcomes were described. The analysis of efficacy was done according to the snapshot algorithm (defining virological failure as viral load >50 copies/mL, ITTe, at 48 and 96 weeks). We analyzed the difference of efficacy between patients with and without baseline resistance mutations at 48 and 96 weeks by using the χ2 test; and during the follow-up by using the Kaplan–Meier test. The statistical analysis was done with SPSS 17.0. Results Eighty-nine patients were included in the cohort but 14 were excluded because they had not reached more than six months with monotherapy. The cohort was composed mainly by men (78%), the medium age was 51 years (SD±10), 35% were MSM and 19% were former IDU. Twenty-four patients (35%) had a previous diagnosis of AIDS. The mean time taking NRTIs was 10.5 years (SD±5.4). Sixty-four patients (85%) had been treated with PI in the past. Previous failure with PI had been reported in 15 (20%). A resistance mutation test had been done at baseline in 45 patients (51%). Twenty-two patients (29%) had some mutations in protease gene, 10 patients (13%) had major mutations and 1 patient had some mutations of resistance for darunavir (I64V). At 48 weeks, 93% (CI 95% 86–98%) had VL<50 copies/mL, and 79% (CI 95% 67–89%) at 96 weeks. There were not

  12. Expression of a Serine Protease Gene prC Is Up-Regulated by Oxidative Stress in the Fungus Clonostachys rosea: Implications for Fungal Survival

    PubMed Central

    Liu, Wen-Jing; Zhou, Wei; Tao, Nan; Tu, Hui-Hui; Huang, Xiao-Wei; Yang, Jin-Kui; Zhang, Ke-Qin

    2010-01-01

    Background Soil fungi face a variety of environmental stresses such as UV light, high temperature, and heavy metals. Adaptation of gene expression through transcriptional regulation is a key mechanism in fungal response to environmental stress. In Saccharomyces cerevisiae, the transcription factors Msn2/4 induce stress-mediated gene expression by binding to the stress response element. Previous studies have demonstrated that the expression of extracellular proteases is up-regulated in response to heat shock in fungi. However, the physiological significance of regulation of these extracellular proteases by heat shock remains unclear. The nematophagous fungus Clonostachys rosea can secret an extracellular serine protease PrC during the infection of nematodes. Since the promoter of prC has three copies of the stress response element, we investigated the effect of environmental stress on the expression of prC. Methodology/Principal Findings Our results demonstrated that the expression of prC was up-regulated by oxidants (H2O2 or menadione) and heat shock, most likely through the stress response element. After oxidant treatment or heat shock, the germination of conidia in the wild type strain was significantly higher than that in the prC mutant strain in the presence of nematode cuticle. Interestingly, the addition of nematode cuticle significantly attenuated the production of reactive oxygen species (ROS) induced by oxidants and heat shock in the wild type strain, but not in prC mutant strain. Moreover, low molecule weight (<3 kD) degradation products of nematode cuticle suppressed the inhibitory effect of conidial germination induced by oxidants and heat shock. Conclusions/Significance These results indicate that PrC plays a protective role in oxidative stress in C. rosea. PrC degrades the nematode cuticle to produce degradation products, which in turn offer a protective effect against oxidative stress by scavenging ROS. Our study reveals a novel strategy for fungi to

  13. The cooperative effect between active site ionized groups and water desolvation controls the alteration of acid/base catalysis in serine proteases.

    PubMed

    Shokhen, Michael; Khazanov, Netaly; Albeck, Amnon

    2007-08-13

    What is the driving force that alters the catalytic function of His57 in serine proteases between general base and general acid in each step along the enzymatic reaction? The stable tetrahedral complexes (TC) of chymotrypsin with trifluoromethyl ketone transition state analogue inhibitors are topologically similar to the catalytic transition state. Therefore, they can serve as a good model to study the enzyme catalytic reaction. We used DFT quantum mechanical calculations to analyze the effect of solvation and of polar factors in the active site of chymotrypsin on the pKa of the catalytic histidine in FE (the free enzyme), EI (the noncovalent enzyme inhibitor complex), and TC. We demonstrated that the acid/base alteration is controlled by the charged groups in the active site--the catalytic Asp102 carboxylate and the oxyanion. The effect of these groups on the catalytic His is modulated by water solvation of the active site.

  14. Mouse Vk gene classification by nucleic acid sequence similarity.

    PubMed

    Strohal, R; Helmberg, A; Kroemer, G; Kofler, R

    1989-01-01

    Analyses of immunoglobulin (Ig) variable (V) region gene usage in the immune response, estimates of V gene germline complexity, and other nucleic acid hybridization-based studies depend on the extent to which such genes are related (i.e., sequence similarity) and their organization in gene families. While mouse Igh heavy chain V region (VH) gene families are relatively well-established, a corresponding systematic classification of Igk light chain V region (Vk) genes has not been reported. The present analysis, in the course of which we reviewed the known extent of the Vk germline gene repertoire and Vk gene usage in a variety of responses to foreign and self antigens, provides a classification of mouse Vk genes in gene families composed of members with greater than 80% overall nucleic acid sequence similarity. This classification differed in several aspects from that of VH genes: only some Vk gene families were as clearly separated (by greater than 25% sequence dissimilarity) as typical VH gene families; most Vk gene families were closely related and, in several instances, members from different families were very similar (greater than 80%) over large sequence portions; frequently, classification by nucleic acid sequence similarity diverged from existing classifications based on amino-terminal protein sequence similarity. Our data have implications for Vk gene analyses by nucleic acid hybridization and describe potentially important differences in sequence organization between VH and Vk genes.

  15. A mild pulsed electric field condition that improves acid tolerance, growth, and protease activity of Lactobacillus acidophilus LA-K and Lactobacillus delbrueckii subspecies bulgaricus LB-12.

    PubMed

    Najim, N; Aryana, Kayanush J

    2013-06-01

    Pulsed electric field (PEF) processing involves the application of pulses of voltage for less than 1 s to fluid products placed between 2 electrodes. The effect of mild PEF on beneficial characteristics of probiotic bacteria Lactobacillus acidophilus and Lactobacillus delbrueckii ssp. bulgaricus is not clearly understood. The objective of this study was to determine the influence of mild PEF conditions on acid tolerance, growth, and protease activity of Lb. acidophilus LA-K and Lactobacillus delbrueckii ssp. bulgaricus LB-12. A pilot plant PEF system (OSU-4M; The Ohio State University, Columbus) was used. The PEF treatments were positive square unipolar pulse width of 3 µs, pulse period of 0.5s, electric field strength of 1 kV/cm, delay time of 20 µs, flow rate of 60 mL/min, and 40.5°C PEF treatment temperature. Both Lb. acidophilus LA-K and Lb. bulgaricus LB-12 subjected to mild PEF conditions were acid tolerant until the end of the 120 min of incubation, unlike the Lb. bulgaricus control, which was not acid tolerant after 30 min. The mild PEF-treated Lb. acidophilus LA-K and Lb. bulgaricus LB-12 reached the logarithmic phase of growth an hour earlier than the control. Mild PEF conditions studied significantly improved acid tolerance, exponential growth, and protease activity of both Lb. acidophilus LA-K and Lb. bulgaricus LB-12 compared with the control. The mild PEF conditions studied can be recommended for pretreating cultures to enhance these desirable attributes.

  16. Characterization of the Entire Cystatin Gene Family in Barley and Their Target Cathepsin L-Like Cysteine-Proteases, Partners in the Hordein Mobilization during Seed Germination1[W

    PubMed Central

    Martinez, Manuel; Cambra, Ines; Carrillo, Laura; Diaz-Mendoza, Mercedes; Diaz, Isabel

    2009-01-01

    Plant cystatins are inhibitors of cysteine-proteases of the papain C1A and legumain C13 families. Cystatin data from multiple plant species have suggested that these inhibitors act as defense proteins against pests and pathogens and as regulators of protein turnover. In this study, we characterize the entire cystatin gene family from barley (Hordeum vulgare), which contain 13 nonredundant genes, and identify and characterize their target enzymes, the barley cathepsin L-like proteases. Cystatins and proteases were expressed and purified from Escherichia coli cultures. Each cystatin was found to have different inhibitory capability against barley cysteine-proteases in in vitro inhibitory assays using specific substrates. Real-time reverse transcription-polymerase chain reaction revealed that inhibitors and enzymes present a wide variation in their messenger RNA expression patterns. Their transcripts were mainly detected in developing and germinating seeds, and some of them were also expressed in leaves and roots. Subcellular localization of cystatins and cathepsin L-like proteases fused to green fluorescent protein demonstrated the presence of both protein families throughout the endoplasmic reticulum and the Golgi complex. Proteases and cystatins not only colocalized but also interacted in vivo in the plant cell, as revealed by bimolecular fluorescence complementation. The functional relationship between cystatins and cathepsin L-like proteases was inferred from their common implication as counterparts of mobilization of storage proteins upon barley seed germination. The opposite pattern of transcription expression in gibberellin-treated aleurones presented by inhibitors and enzymes allowed proteases to specifically degrade B, C, and D hordeins stored in the endosperm of barley seeds. PMID:19759340

  17. Unmasking Heavily O-Glycosylated Serum Proteins Using Perchloric Acid: Identification of Serum Proteoglycan 4 and Protease C1 Inhibitor as Molecular Indicators for Screening of Breast Cancer

    PubMed Central

    Lee, Cheng-Siang; Taib, Nur Aishah Mohd; Ashrafzadeh, Ali; Fadzli, Farhana; Harun, Faizah; Rahmat, Kartini; Hoong, See Mee; Abdul-Rahman, Puteri Shafinaz; Hashim, Onn Haji

    2016-01-01

    Heavily glycosylated mucin glycopeptides such as CA 27.29 and CA 15–3 are currently being used as biomarkers for detection and monitoring of breast cancer. However, they are not well detected at the early stages of the cancer. In the present study, perchloric acid (PCA) was used to enhance detection of mucin-type O-glycosylated proteins in the serum in an attempt to identify new biomarkers for early stage breast cancer. Sensitivity and specificity of an earlier developed sandwich enzyme-linked lectin assay were significantly improved with the use of serum PCA isolates. When a pilot case-control study was performed using the serum PCA isolates of normal participants (n = 105) and patients with stage 0 (n = 31) and stage I (n = 48) breast cancer, higher levels of total O-glycosylated proteins in sera of both groups of early stage breast cancer patients compared to the normal control women were demonstrated. Further analysis by gel-based proteomics detected significant inverse altered abundance of proteoglycan 4 and plasma protease C1 inhibitor in both the early stages of breast cancer patients compared to the controls. Our data suggests that the ratio of serum proteoglycan 4 to protease C1 inhibitor may be used for screening of early breast cancer although this requires further validation in clinically representative populations. PMID:26890881

  18. Cell-free production of integral membrane aspartic acid proteases reveals zinc-dependent methyltransferase activity of the Pseudomonas aeruginosa prepilin peptidase PilD

    PubMed Central

    Aly, Khaled A; Beebe, Emily T; Chan, Chi H; Goren, Michael A; Sepúlveda, Carolina; Makino, Shin-ichi; Fox, Brian G; Forest, Katrina T

    2013-01-01

    Integral membrane aspartic acid proteases are receiving growing recognition for their fundamental roles in cellular physiology of eukaryotes and prokaryotes, and may be medically important pharmaceutical targets. The Gram-negative Pseudomonas aeruginosa PilD and the archaeal Methanococcus voltae FlaK were synthesized in the presence of unilamellar liposomes in a cell-free translation system. Cosynthesis of PilD with its full-length substrate, PilA, or of FlaK with its full-length substrate, FlaB2, led to complete cleavage of the substrate signal peptides. Scaled-up synthesis of PilD, followed by solubilization in dodecyl-β-d-maltoside and chromatography, led to a pure enzyme that retained both of its known biochemical activities: cleavage of the PilA signal peptide and S-adenosyl methionine-dependent methylation of the mature pilin. X-ray fluorescence scans show for the first time that PilD is a zinc-binding protein. Zinc is required for the N-terminal methylation of the mature pilin, but not for signal peptide cleavage. Taken together, our work identifies the P. aeruginosa prepilin peptidase PilD as a zinc-dependent N-methyltransferase and provides a new platform for large-scale synthesis of PilD and other integral membrane proteases important for basic microbial physiology and virulence. PMID:23255525

  19. Survey of the rubber tree genome reveals a high number of cysteine protease-encoding genes homologous to Arabidopsis SAG12

    PubMed Central

    Liu, Jianting; Yang, Lifu; Xie, Guishui

    2017-01-01

    Arabidopsis thaliana SAG12, a senescence-specific gene encoding a cysteine protease, is widely used as a molecular marker for the study of leaf senescence. To date, its potential orthologues have been isolated from several plant species such as Brassica napus and Nicotiana tabacum. However, little information is available in rubber tree (Hevea brasiliensis), a rubber-producing plant of the Euphorbiaceae family. This study presents the identification of SAG12-like genes from the rubber tree genome. Results showed that an unexpected high number of 17 rubber orthologues with a single intron were found, contrasting the single copy with two introns in Arabidopsis. The gene expansion was also observed in another two Euphorbiaceae plants, castor bean (Ricinus communis) and physic nut (Jatropha curcas), both of which contain 8 orthologues. In accordance with no occurrence of recent whole-genome duplication (WGD) events, most duplicates in castor and physic nut were resulted from tandem duplications. In contrast, the duplicated HbSAG12H genes were derived from tandem duplications as well as the recent WGD. Expression analysis showed that most HbSAG12H genes were lowly expressed in examined tissues except for root and male flower. Furthermore, HbSAG12H1 exhibits a strictly senescence-associated expression pattern in rubber tree leaves, and thus can be used as a marker gene for the study of senescence mechanism in Hevea. PMID:28166280

  20. Proteases as Insecticidal Agents

    PubMed Central

    Harrison, Robert L.; Bonning, Bryony C.

    2010-01-01

    Proteases from a variety of sources (viruses, bacteria, fungi, plants, and insects) have toxicity towards insects. Some of these insecticidal proteases evolved as venom components, herbivore resistance factors, or microbial pathogenicity factors, while other proteases play roles in insect development or digestion, but exert an insecticidal effect when over-expressed from genetically engineered plants or microbial pathogens. Many of these proteases are cysteine proteases, although insect-toxic metalloproteases and serine proteases have also been examined. The sites of protease toxic activity range from the insect midgut to the hemocoel (body cavity) to the cuticle. This review discusses these insecticidal proteases along with their evaluation and use as potential pesticides. PMID:22069618

  1. A rhomboid protease gene deletion affects a novel oligosaccharide N-linked to the S-layer glycoprotein of Haloferax volcanii.

    PubMed

    Parente, Juliana; Casabuono, Adriana; Ferrari, María Celeste; Paggi, Roberto Alejandro; De Castro, Rosana Esther; Couto, Alicia Susana; Giménez, María Inés

    2014-04-18

    Rhomboid proteases occur in all domains of life; however, their physiological role is not completely understood, and nothing is known of the biology of these enzymes in Archaea. One of the two rhomboid homologs of Haloferax volcanii (RhoII) is fused to a zinc finger domain. Chromosomal deletion of rhoII was successful, indicating that this gene is not essential for this organism; however, the mutant strain (MIG1) showed reduced motility and increased sensitivity to novobiocin. Membrane preparations of MIG1 were enriched in two glycoproteins, identified as the S-layer glycoprotein and an ABC transporter component. The H. volcanii S-layer glycoprotein has been extensively used as a model to study haloarchaeal protein N-glycosylation. HPLC analysis of oligosaccharides released from the S-layer glycoprotein after PNGase treatment revealed that MIG1 was enriched in species with lower retention times than those derived from the parent strain. Mass spectrometry analysis showed that the wild type glycoprotein released a novel oligosaccharide species corresponding to GlcNAc-GlcNAc(Hex)2-(SQ-Hex)6 in contrast to the mutant protein, which contained the shorter form GlcNAc2(Hex)2-SQ-Hex-SQ. A glycoproteomics approach of the wild type glycopeptide fraction revealed Asn-732 peptide fragments linked to the sulfoquinovose-containing oligosaccharide. This work describes a novel N-linked oligosaccharide containing a repeating SQ-Hex unit bound to Asn-732 of the H. volcanii S-layer glycoprotein, a position that had not been reported as glycosylated. Furthermore, this study provides the first insight on the biological role of rhomboid proteases in Archaea, suggesting a link between protein glycosylation and this protease family.

  2. A Rhomboid Protease Gene Deletion Affects a Novel Oligosaccharide N-Linked to the S-layer Glycoprotein of Haloferax volcanii*

    PubMed Central

    Parente, Juliana; Casabuono, Adriana; Ferrari, María Celeste; Paggi, Roberto Alejandro; De Castro, Rosana Esther; Couto, Alicia Susana; Giménez, María Inés

    2014-01-01

    Rhomboid proteases occur in all domains of life; however, their physiological role is not completely understood, and nothing is known of the biology of these enzymes in Archaea. One of the two rhomboid homologs of Haloferax volcanii (RhoII) is fused to a zinc finger domain. Chromosomal deletion of rhoII was successful, indicating that this gene is not essential for this organism; however, the mutant strain (MIG1) showed reduced motility and increased sensitivity to novobiocin. Membrane preparations of MIG1 were enriched in two glycoproteins, identified as the S-layer glycoprotein and an ABC transporter component. The H. volcanii S-layer glycoprotein has been extensively used as a model to study haloarchaeal protein N-glycosylation. HPLC analysis of oligosaccharides released from the S-layer glycoprotein after PNGase treatment revealed that MIG1 was enriched in species with lower retention times than those derived from the parent strain. Mass spectrometry analysis showed that the wild type glycoprotein released a novel oligosaccharide species corresponding to GlcNAc-GlcNAc(Hex)2-(SQ-Hex)6 in contrast to the mutant protein, which contained the shorter form GlcNAc2(Hex)2-SQ-Hex-SQ. A glycoproteomics approach of the wild type glycopeptide fraction revealed Asn-732 peptide fragments linked to the sulfoquinovose-containing oligosaccharide. This work describes a novel N-linked oligosaccharide containing a repeating SQ-Hex unit bound to Asn-732 of the H. volcanii S-layer glycoprotein, a position that had not been reported as glycosylated. Furthermore, this study provides the first insight on the biological role of rhomboid proteases in Archaea, suggesting a link between protein glycosylation and this protease family. PMID:24596091

  3. Processing and targeting of the thiol protease aleurain: Progress report

    SciTech Connect

    Rogers, J.C.

    1988-01-01

    This study addresses the processing and targeting of the thiol protease aleurain in monocots. A probe derived from the aleurain cDNA specific for the 5'-most 400 bp (a region encoding the first 140 amino acids of the preprotein hybridized to at least 3 separate elements in the barley genome; only one represented the aleurain gene. In contrast, a probe specific for the remaining 2/23 of the cDNA (representing the protease domain) hybridized to only a single copy sequence. To know if this pattern pertained in other, closely related, monocots, we probed Southern blots of genomic DNA from maize, rye, oats, sorghum, and pearl millet with each probe. In each instance except for maize DNA, the 5' domain probe hybridizes to several fragments in addition to those identified by the protease domain probe. Presumable the darkest hybridization in each represents the fragment carrying the sequences homologous to barley aleurain. The fragments from a given restriction enzyme identified by the protease domain probe in sorghum, millet, and maize, were indistinguishable in size indicating that the gene sequences, as well as flanking DNA, are so well conserved among the group that the location of the hexanucleotide sequences have not diverged. (3 refs., 3 figs.)

  4. Biofluid proteases profiling in diabetes mellitus.

    PubMed

    Trindade, Fábio; Ferreira, Rita; Amado, Francisco; Vitorino, Rui

    2015-01-01

    The investigation of protease relevance in biologic systems beyond catabolism of proteins and peptides to amino acids has stimulated interest as to their role in the pathogenesis of several disorders including diabetes mellitus (DM). Evaluation of proteases and the assessment of their activity in biofluids are fundamental to elucidate these proteolytic systems in DM and its related complications. In contrast to traditional immunoassay or substrate based approaches that targeted specific proteases and their inhibitors, the field of degradomics has provided a comprehensive approach to study these enzymes. Although the degradome contains over 500 proteases, very few have been associated with DM and its micro- and macrovascular complications. In this paper, we review these proteases and their respective inhibitors with emphasis on DM. It is likely that future research will expand these initial studies and look to develop high throughput automated technologies to identify and characterize biofluid proteases of diagnostic and prognostic value in other pathologies.

  5. Advances in protease engineering for laundry detergents.

    PubMed

    Vojcic, Ljubica; Pitzler, Christian; Körfer, Georgette; Jakob, Felix; Ronny Martinez; Maurer, Karl-Heinz; Schwaneberg, Ulrich

    2015-12-25

    Proteases are essential ingredients in modern laundry detergents. Over the past 30 years, subtilisin proteases employed in the laundry detergent industry have been engineered by directed evolution and rational design to tailor their properties towards industrial demands. This comprehensive review discusses recent success stories in subtilisin protease engineering. Advances in protease engineering for laundry detergents comprise simultaneous improvement of thermal resistance and activity at low temperatures, a rational strategy to modulate pH profiles, and a general hypothesis for how to increase promiscuous activity towards the production of peroxycarboxylic acids as mild bleaching agents. The three protease engineering campaigns presented provide in-depth analysis of protease properties and have identified principles that can be applied to improve or generate enzyme variants for industrial applications beyond laundry detergents.

  6. Structure and mechanism of rhomboid protease.

    PubMed

    Ha, Ya; Akiyama, Yoshinori; Xue, Yi

    2013-05-31

    Rhomboid protease was first discovered in Drosophila. Mutation of the fly gene interfered with growth factor signaling and produced a characteristic phenotype of a pointed head skeleton. The name rhomboid has since been widely used to describe a large family of related membrane proteins that have diverse biological functions but share a common catalytic core domain composed of six membrane-spanning segments. Most rhomboid proteases cleave membrane protein substrates near the N terminus of their transmembrane domains. How these proteases function within the confines of the membrane is not completely understood. Recent progress in crystallographic analysis of the Escherichia coli rhomboid protease GlpG in complex with inhibitors has provided new insights into the catalytic mechanism of the protease and its conformational change. Improved biochemical assays have also identified a substrate sequence motif that is specifically recognized by many rhomboid proteases.

  7. L-chicoric acid, an inhibitor of human immunodeficiency virus type 1 (HIV-1) integrase, improves on the in vitro anti-HIV-1 effect of Zidovudine plus a protease inhibitor (AG1350).

    PubMed

    Robinson, W E

    1998-08-01

    Combinations of anti-human immunodeficiency virus (HIV) drugs, including reverse transcriptase inhibitors and protease inhibitors, have proven immensely potent in the therapy of acquired immune deficiency syndrome (AIDS). To determine whether HIV integrase is a suitable target for combination therapy, the ability of an HIV integrase inhibitor, L-chicoric acid, to work in combination with a protease inhibitor and Zidovudine was tested in vitro. The addition of L-chicoric acid to either Zidovudine or protease inhibitor improved upon the observed anti-HIV activity of either compound alone. When all three drugs were combined, the anti-HIV activity was substantially better than either of the three compounds alone or any combination of two inhibitors. Doses of both Zidovudine and protease inhibitor could be reduced by more than 33% for an equivalent anti-HIV effect if L-chicoric acid was added. The improved anti-HIV activity was observed with a tissue culture adapted strain of HIV (HIV(LAI)) and with limited passage clinical isolates of HIV (HIV(R19) and HIV(R45)). These data demonstrate that a first generation HIV integrase inhibitor, L-chicoric acid, is at least additive in combination with existing multi-drug regimens and suggest that HIV integrase will be an excellent target for combination therapy of HIV infection.

  8. Enzymes for the laundry industries: tapping the vast metagenomic pool of alkaline proteases

    PubMed Central

    Niehaus, F.; Gabor, E.; Wieland, S.; Siegert, P.; Maurer, K. H.; Eck, J.

    2011-01-01

    Summary In the wide field of laundry and cleaning applications, there is an unbroken need for novel detergent proteases excelling in high stability and activity and a suitable substrate range. We demonstrated the large amount of highly diverse subtilase sequences present in metagenomic DNA by recovering 57 non‐redundant subtilase sequence tags with degenerate primers. Furthermore, an activity‐ as well as a sequence homology‐based screening of metagenomic DNA libraries was carried out, using alkaline soil and habitat enrichments as a source of DNA. In this way, 18 diverse full‐length protease genes were recovered, sharing only 37–85% of their amino acid residues with already known protease genes. Active clones were biochemically characterized and subjected to a laundry application assay, leading to the identification of three promising detergent proteases. According to sequence similarity, two proteases (HP53 and HP70) can be classified as subtilases, while the third enzyme (HP23) belongs to chymotrypsin‐like S1 serine proteases, a class of enzymes that has not yet been described for the use in laundry and cleaning applications. PMID:21895993

  9. Enzymes for the laundry industries: tapping the vast metagenomic pool of alkaline proteases.

    PubMed

    Niehaus, F; Gabor, E; Wieland, S; Siegert, P; Maurer, K H; Eck, J

    2011-11-01

    In the wide field of laundry and cleaning applications, there is an unbroken need for novel detergent proteases excelling in high stability and activity and a suitable substrate range. We demonstrated the large amount of highly diverse subtilase sequences present in metagenomic DNA by recovering 57 non-redundant subtilase sequence tags with degenerate primers. Furthermore, an activity- as well as a sequence homology-based screening of metagenomic DNA libraries was carried out, using alkaline soil and habitat enrichments as a source of DNA. In this way, 18 diverse full-length protease genes were recovered, sharing only 37-85% of their amino acid residues with already known protease genes. Active clones were biochemically characterized and subjected to a laundry application assay, leading to the identification of three promising detergent proteases. According to sequence similarity, two proteases (HP53 and HP70) can be classified as subtilases, while the third enzyme (HP23) belongs to chymotrypsin-like S1 serine proteases, a class of enzymes that has not yet been described for the use in laundry and cleaning applications.

  10. Gene Expressions for Signal Transduction under Acidic Conditions

    PubMed Central

    Fukamachi, Toshihiko; Ikeda, Syunsuke; Wang, Xin; Saito, Hiromi; Tagawa, Masatoshi; Kobayashi, Hiroshi

    2013-01-01

    Although it is now well known that some diseased areas, such as cancer nests, inflammation loci, and infarction areas, are acidified, little is known about cellular signal transduction, gene expression, and cellular functions under acidic conditions. Our group showed that different signal proteins were activated under acidic conditions compared with those observed in a typical medium of around pH 7.4 that has been used until now. Investigations of gene expression under acidic conditions may be crucial to our understanding of signal transduction in acidic diseased areas. In this study, we investigated gene expression in mesothelioma cells cultured at an acidic pH using a DNA microarray technique. After 24 h culture at pH 6.7, expressions of 379 genes were increased more than twofold compared with those in cells cultured at pH 7.5. Genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors numbered 35, 32, and 17 among the 379 genes, respectively. Since the functions of 78 genes are unknown, it can be argued that cells may have other genes for signaling under acidic conditions. The expressions of 37 of the 379 genes were observed to increase after as little as 2 h. After 24 h culture at pH 6.7, expressions of 412 genes were repressed more than twofold compared with those in cells cultured at pH 7.5, and the 412 genes contained 35, 76, and 7 genes encoding receptors, signal proteins including transcription factors, and cytokines including growth factors, respectively. These results suggest that the signal pathways in acidic diseased areas are different, at least in part, from those examined with cells cultured at a pH of around 7.4. PMID:24705103

  11. Effects of degU32(Hy), degQa and degR pleiotropic regulatory genes on the growth and protease fermentation of Bacillus subtilis Ki-2-132.

    PubMed

    Pan, Xue-Feng

    2006-04-01

    Effects of degU32 (Hy), degR genes from Bacillus subtilis 168 and degQa gene from Bacillus amyloliquefaciens on Bacillus subtilis Ki-2-132 cell growth, sporulation and protease fermentation were investigated by introducing these genes into B. subtilis Ki-2-132 chromosome and/or cytoplasm. Although the genes come from different species and strains, they showed pleiotropic effects in B. subtilis Ki-2-132. B. subtilis Ki-2-132degU32 (Hy) showed increased protease production, and when cooperating with degQa either in plasmid or in chromosome, further altered cell growth, increased protease production and affected the spore formation in a glucose and dosage dependent manner. By contrast, degR did not significantly affect the protease productivity in degU32 (Hy) mutant, consisting with that DegR was used to stabilise DegU-phosphate, which in degU32 (Hy) strain no longer further amplify the DegU-phosphate effect.

  12. Amino Acid Starvation Induced by Protease Inhibition Produces Differential Alterations in Redox Status and the Thiol Proteome in Organogenesis-Stage Rat Embryos and Visceral Yolk Sacs

    PubMed Central

    Harris, Craig; Jilek, Joseph L.; Sant, Karilyn E.; Pohl, Jan; Reed, Matthew; Hansen, Jason M.

    2015-01-01

    The process of embryonic nutrition in rodent conceptuses during organogenesis has been shown to involve a dominant histiotrophic mechanism where essential developmental substrates and micronutrients are supplied as whole maternal proteins or cargoes associated with proteins. The histiotrophic nutrition pathways (HNP) responsible for uptake and initial processing of proteins across maternal-conceptal interfaces involve uptake via receptor mediated endocytosis and protein degradation via lysosomal proteolysis. Chemical inhibition of either process can lead to growth deficits and malformation in the embryo (EMB), but selective inhibition of either HNP component will elicit a different subset of developmental perturbations. In vitro, whole embryo culture (WEC) exposure of GD10 or GD11 rat conceptuses to the natural protease inhibitor, leupeptin, leads to significant reductions in all measured embryonic growth parameters as well as a myriad of other effects. Leupeptin doses of 10 μM or 20 μM over a 26 hr period (GD10-GD11) and 50 μM over a 3 hr pulse period produced significant decreases in the clearance of FITC-albumin from culture media. The near complete loss of acid soluble fluorescence and increased total visceral yolk sac (VYS) protein content confirmed the selective inhibition of proteolysis. Inhibition of lysosomal proteolysis thus deprives the developing EMB of essential nutrient amino acids producing conditions akin to amino acid starvation, but may also cause direct effects on pathways critical for normal growth and differentiation. Following leupeptin exposure for 26 or 6 hr, total glutathione (GSH) concentrations dropped significantly in the VYS, but only slightly in yolk sac (YSF) and amniotic (AF) fluids. Cys concentrations increased in VYS and EMB, but dropped in YSF and AF fluids. Redox potentials (Eh) for the GSSG/GSH redox couple trended significantly toward the positive, confirming the net oxidation of conceptual tissues following leupeptin

  13. Protease and Protease-Activated Receptor-2 Signaling in the Pathogenesis of Atopic Dermatitis

    PubMed Central

    Lee, Sang Eun; Jeong, Se Kyoo

    2010-01-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD. PMID:20879045

  14. Protease and protease-activated receptor-2 signaling in the pathogenesis of atopic dermatitis.

    PubMed

    Lee, Sang Eun; Jeong, Se Kyoo; Lee, Seung Hun

    2010-11-01

    Proteases in the skin are essential to epidermal permeability barrier homeostasis. In addition to their direct proteolytic effects, certain proteases signal to cells by activating protease-activated receptors (PARs), the G-protein-coupled receptors. The expression of functional PAR-2 on human skin and its role in inflammation, pruritus, and skin barrier homeostasis have been demonstrated. Atopic dermatitis (AD) is a multifactorial inflammatory skin disease characterized by genetic barrier defects and allergic inflammation, which is sustained by gene-environmental interactions. Recent studies have revealed aberrant expression and activation of serine proteases and PAR-2 in the lesional skin of AD patients. The imbalance between proteases and protease inhibitors associated with genetic defects in the protease/protease inhibitor encoding genes, increase in skin surface pH, and exposure to proteolytically active allergens contribute to this aberrant protease/ PAR-2 signaling in AD. The increased protease activity in AD leads to abnormal desquamation, degradation of lipid-processing enzymes and antimicrobial peptides, and activation of primary cytokines, thereby leading to permeability barrier dysfunction, inflammation, and defects in the antimicrobial barrier. Moreover, up-regulated proteases stimulate PAR-2 in lesional skin of AD and lead to the production of cytokines and chemokines involved in inflammation and immune responses, itching sensation, and sustained epidermal barrier perturbation with easier allergen penetration. In addition, PAR-2 is an important sensor for exogenous danger molecules, such as exogenous proteases from various allergens, and plays an important role in AD pathogenesis. Together, these findings suggest that protease activity or PAR-2 may be a future target for therapeutic intervention for the treatment of AD.

  15. The gene for the serpin thrombin inhibitor (P17), protease nexin I, is located on human chromosome 2q33-q35 and on syntenic regions in the mouse and sheep genomes

    SciTech Connect

    Carter, R.E.; Burkin, D.J.; Fournier, R.E.K.

    1995-05-01

    Protease nexin I (PNI) is the most important physiologic regulator of {alpha}-thrombin in tissues. PNI is highly expressed and developmentally regulated in the nervous system where it is concentrated at neuromuscular junctions and also central synapses in the hippocampus and striatum. Approximately 10% of identified proteins at mammalian neuromuscular junctions are serine protease inhibitors, consistent with their central role in balancing serine protease activity to develop, maintain, and remodel synapses. Southern blot hybridization of PNI cDNA to somatic cell hybrids placed the structural gene for PNI (locus PI7) on human chromosome 2q33-q35 and to syntenic chromosomes in the mouse (chromosome 1) and sheep (chromosome 2). 30 refs., 2 figs.

  16. Protease and protease inhibitory activity in pregnant and postpartum involuting uterus

    SciTech Connect

    Milwidsky, A.; Beller, U.; Palti, Z.; Mayer, M.

    1982-08-15

    The presence of two distinct proteolytic activities in the rat uterus was confirmed with /sup 14/C-labeled globin used as a sensitive protein substrate and following release of label into the trichloroacetic acid-soluble supernatant fraction. Protease I is a cytoplasmic acid protease while protease II is associated with the pellet fraction, can be extracted by 0.6 M sodium chloride, and is active at pH 7.0. Protease I activity is low during pregnancy and markedly increases at term achieving maximal activity at day 3 post partum with a subsequent decline to preterm activity values. Lactation did not affect the uterine protease I activity. Protease II activity is not significantly different during pregnancy, at term, and post partum. The presence of an inhibitor of protease I was suggested by a decrease in enzyme activity with an increased cytosolic protein concentration. The inhibitor also lessened bovine trypsin activity but had no effect on protease II. Although its inhibitory potency on trypsin fluctuated during the various uterine physiologic stages, these changes appeared to be statistically insignificant. Human uterine samples were also found to contain the two protease activities with similar changes in protease I post partum. It is suggested that, both in the rat and in man, uterine involution post partum is associated with a marked increase in activity of acid cytosolic protease, while a particulate neutral protease and a soluble inhibitor of trypsin, which are also present in uterine cells, do not appear to play a significant role in the dissolution of uterine tissues after parturition.

  17. Cytomegalovirus protease targeted prodrug development.

    PubMed

    Sabit, Hairat; Dahan, Arik; Sun, Jing; Provoda, Chester J; Lee, Kyung-Dall; Hilfinger, John H; Amidon, Gordon L

    2013-04-01

    Human cytomegalovirus (HCMV) is a prevalent virus that infects up to 90% of the population. The goal of this research is to determine if small molecular prodrug substrates can be developed for a specific HCMV encoded protease and thus achieve site-specific activation. HCMV encodes a 256 amino acid serine protease that is responsible for capsid assembly, an essential process for herpes virus production. The esterase activity of the more stable HCMV A143T/A144T protease mutant was evaluated with model p-nitrophenol (ONp) esters, Boc-Xaa-ONp (Ala, Leu, Ile, Val, Gln, Phe at the Xaa position). We demonstrate that the A143T/A144T mutant has esterase activity toward specific small ester compounds, e.g., Boc-L-Ala-ONp. Mono amino acid and dipeptide prodrugs of ganciclovir (GCV) were also synthesized and evaluated for hydrolysis by the A143T/A144T protease mutant in solution. Hydrolysis of these prodrugs was also evaluated in Caco-2 cell homogenates, human liver microsomes (HLMs), and rat and human plasma. For the selectivity potential of the prodrugs, the hydrolysis ratio was evaluated as a percentage of prodrug hydrolyzed by the HCMV protease over the percentages of prodrug hydrolyses by Caco-2 cell homogenates, HLMs, and human/rat plasma. A dipeptide prodrug of ganciclovir, Ac-l-Gln-l-Ala-GCV, emerged as a potential selective prodrug candidate. The results of this research demonstrate that targeting prodrugs for activation by a specific protease encoded by the infectious HCMV pathogen may be achievable.

  18. Gene quantification by the NanoGene assay is resistant to inhibition by humic acids.

    PubMed

    Kim, Gha-Young; Wang, Xiaofang; Ahn, Hosang; Son, Ahjeong

    2011-10-15

    NanoGene assay is a magnetic bead and quantum dot nanoparticles based gene quantification assay. It relies on a set of probe and signaling probe DNAs to capture the target DNA via hybridization. We have demonstrated the inhibition resistance of the NanoGene assay using humic acids laden genomic DNA (gDNA). At 1 μg of humic acid per mL, quantitiative PCR (qPCR) was inhibited to 0% of its quantification capability whereas NanoGene assay was able to maintain more than 60% of its quantification capability. To further increase the inhibition resistance of NanoGene assay at high concentration of humic acids, we have identified the specific mechanisms that are responsible for the inhibition. We examined five potential mechanisms with which the humic acids can partially inhibit our NanoGene assay. The mechanisms examined were (1) adsorption of humic acids on the particle surface; (2) particle aggregation induced by humic acids; (3) fluorescence quenching of quantum dots by humic acids during hybridization; (4) humic acids mimicking of target DNA; and (5) nonspecific binding between humic acids and target gDNA. The investigation showed that no adsorption of humic acids onto the particles' surface was observed for the humic acids' concentration. Particle aggregation and fluorescence quenching were also negligible. Humic acids also did not mimic the target gDNA except 1000 μg of humic acids per mL and hence should not contribute to the partial inhibition. Four of the above mechanisms were not related to the inhibition effect of humic acids particularly at the environmentally relevant concentrations (<100 μg/mL). However, a substantial amount of nonspecific binding was observed between the humic acids and target gDNA. This possibly results in lesser amount of target gDNA being captured by the probe and signaling DNA.

  19. Single Nucleotide Variant rs2232710 in the Protein Z-Dependent Protease Inhibitor (ZPI, SERPINA10) Gene Is Not Associated with Deep Vein Thrombosis

    PubMed Central

    Gorski, Marcin M.; Lotta, Luca A.; Pappalardo, Emanuela; de Haan, Hugoline G.; Passamonti, Serena M.; van Hylckama Vlieg, Astrid; Martinelli, Ida; Peyvandi, Flora

    2016-01-01

    Rare mutations in PROC, PROS1 or SERPINC1 as well as common variants in F5, F2, F11 and SERPINC1 have been identified as risk factors for deep vein thrombosis (DVT). To identify novel genetic risk factors for DVT, we have developed and applied next-generation DNA sequencing (NGS) of the coding area of hemostatic and proinflammatory genes. Using this strategy, we previously identified a single nucleotide variant (SNV) rs6050 in the FGA gene and novel, rare SNVs in the ADAMTS13 gene associated with DVT. To identify novel coding variants in the genetic predisposition to DVT, we applied NGS analysis of the coding area of 186 hemostatic and proinflammatory genes in 94 DVT cases and 98 controls and we identified 18 variants with putative role in DVT. A group of 585 Italian idiopathic DVT patients and 550 healthy controls was used to genotype all the 18 risk-associated variants identified by NGS. Replication study in the Italian population identified the rs2232710 variant in the protein Z-dependent protease inhibitor (ZPI) gene to be associated with an increased risk of DVT (OR 2.74; 95% CI 1.33–5.65; P = 0.0045; Bonferroni P = 0.081). However, the rs2232710 SNV showed no association with DVT in two Dutch replication cohorts the LETS study (454 patients and 451 controls) and the MEGA study (3799 patients and 4399 controls), indicating that the rs2232710 variant is not a risk factor for DVT. PMID:26982741

  20. Identification of a single nucleotide promoter polymorphism regulating the transcription of ubiquitin specific protease 18 gene related to the resistance to porcine reproductive and respiratory syndrome virus infection.

    PubMed

    Li, Yanping; Sun, Yi; Xing, Feng; Kang, Li; Wang, Pengfei; Wang, Liyuan; Liu, Hao; Li, Yi; Jiang, Yunliang

    2014-12-15

    Porcine reproductive and respiratory syndrome (PRRS), characterized by reproductive failure in sows and respiratory disease and mortality in piglets, is a major infectious disease that causes great economic loss throughout the world. Previous studies revealed that the overexpression of porcine ubiquitin specific protease 18 (USP18) gene inhibits PRRSV replication in vitro. The objective of this study is to compare the promoter activity of USP18 in Chinese indigenous Dapulian (DPL) pigs and Duroc×Landrace×Yorkshire (DLY) commercial pigs and screen single nucleotide polymorphism (SNP) affecting porcine USP18 transcription. We found that the promoter activity was significantly higher in DPL pigs than DLY commercial pigs (p<0.05), deletion of the promoter from -1790 to -1314bp decreased the transcriptional activity by roughly 60% (p<0.05) and a SNP G-1533A in this region increased the mRNA expression both prior to and post PRRSV infection in MARC-145 cells. Population genetics analysis showed that allele A was only detected in Chinese pig breeds which are generally resistant to PRRSV. These results suggest that the SNP G-1533A polymorphism in the promoter region of porcine USP18 gene is a potential DNA marker for the resistance to PRRSV.

  1. Investigations with Protease.

    ERIC Educational Resources Information Center

    Yip, Din Yan

    1997-01-01

    Presents two simple and reliable ways for measuring protease activity that can be used for a variety of investigations in a range of biology class levels. The investigations use protease from a variety of sources. (DDR)

  2. Post-endocytotic Deubiquitination and Degradation of the Metabotropic γ-Aminobutyric Acid Receptor by the Ubiquitin-specific Protease 14*

    PubMed Central

    Lahaie, Nicolas; Kralikova, Michaela; Prézeau, Laurent; Blahos, Jaroslav; Bouvier, Michel

    2016-01-01

    Mechanisms controlling the metabotropic γ-aminobutyric acid receptor (GABAB) cell surface stability are still poorly understood. In contrast with many other G protein-coupled receptors (GPCR), it is not subject to agonist-promoted internalization, but is constitutively internalized and rapidly down-regulated. In search of novel interacting proteins regulating receptor fate, we report that the ubiquitin-specific protease 14 (USP14) interacts with the GABAB(1b) subunit's second intracellular loop. Probing the receptor for ubiquitination using bioluminescence resonance energy transfer (BRET), we detected a constitutive and phorbol 12-myristate 13-acetate (PMA)-induced ubiquitination of the receptor at the cell surface. PMA also increased internalization and accelerated receptor degradation. Overexpression of USP14 decreased ubiquitination while treatment with a small molecule inhibitor of the deubiquitinase (IU1) increased receptor ubiquitination. Treatment with the internalization inhibitor Dynasore blunted both USP14 and IU1 effects on the receptor ubiquitination state, suggesting a post-endocytic site of action. Overexpression of USP14 also led to an accelerated degradation of GABAB in a catalytically independent fashion. We thus propose a model whereby cell surface ubiquitination precedes endocytosis, after which USP14 acts as an ubiquitin-binding protein that targets the ubiquitinated receptor to lysosomal degradation and promotes its deubiquitination. PMID:26817839

  3. An Escherichia coli Expression Assay and Screen for Human Immunodeficiency Virus Protease Variants with Decreased Susceptibility to Indinavir

    PubMed Central

    Melnick, Laurence; Yang, Shiow-Shong; Rossi, Rick; Zepp, Charlie; Heefner, Donald

    1998-01-01

    We have developed a recombinant Escherichia coli screening system for the rapid detection and identification of amino acid substitutions in the human immunodeficiency virus (HIV) protease associated with decreased susceptibility to the protease inhibitor indinavir (MK-639; Merck & Co.). The assay depends upon the correct processing of a segment of the HIV-1 HXB2 gag-pol polyprotein followed by detection of HIV reverse transcriptase activity by a highly sensitive, colorimetric enzyme-linked immunosorbent assay. The highly sensitive system detects the contributions of single substitutions such as I84V, L90M, and L63P. The combination of single substitutions further decreases the sensitivity to indinavir. We constructed a library of HIV protease variant genes containing dispersed mutations and, using the E. coli recombinant system, screened for mutants with decreased indinavir sensitivity. The discovered HIV protease variants contain amino acid substitutions commonly associated with indinavir resistance in clinical isolates, including the substitutions L90M, L63P, I64V, V82A, L24I, and I54T. One substitution, W6R, is also frequently found by the screen and has not been reported elsewhere. Of a total of 12,000 isolates that were screened, 12 protease variants with decreased sensitivity to indinavir were found. The L63P substitution, which is also associated with indinavir resistance, increases the stability of the isolated protease relative to that of the native HXB2 protease. The rapidity, sensitivity, and accuracy of this screen also make it useful for screening for novel inhibitors. We have found the approach described here to be useful for the detection of amino acid substitutions in HIV protease that have been associated with drug resistance as well as for the screening of novel compounds for inhibitory activity. PMID:9835523

  4. Production of γ-linolenic acid and stearidonic acid by Synechococcus sp. PCC7002 containing cyanobacterial fatty acid desaturase genes

    NASA Astrophysics Data System (ADS)

    Dong, Xuewei; He, Qingfang; Peng, Zhenying; Yu, Jinhui; Bian, Fei; Li, Youzhi; Bi, Yuping

    2016-07-01

    Genetic modification is useful for improving the nutritional qualities of cyanobacteria. To increase the total unsaturated fatty acid content, along with the ratio of ω-3/ω-6 fatty acids, genetic engineering can be used to modify fatty acid metabolism. Synechococcus sp. PCC7002, a fast-growing cyanobacterium, does not contain a Δ6 desaturase gene and is therefore unable to synthesize γ-linolenic acid (GLA) and stearidonic acid (SDA), which are important in human health. In this work, we constructed recombinant vectors Syd6D, Syd15D and Syd6Dd15D to express the Δ15 desaturase and Δ6 desaturase genes from Synechocystis PCC6803 in Synechococcus sp. PCC7002, with the aim of expressing polyunsaturated fatty acids. Overexpression of the Δ15 desaturase gene in Synechococcus resulted in 5.4 times greater accumulation of α-linolenic acid compared with the wild-type while Δ6 desaturase gene expression produced both GLA and SDA. Co-expression of the two genes resulted in low-level accumulation of GLA but much larger amounts of SDA, accounting for as much to 11.64% of the total fatty acid content.

  5. Intergenic sequence between Arabidopsis caseinolytic protease B-cytoplasmic/heat shock protein100 and choline kinase genes functions as a heat-inducible bidirectional promoter.

    PubMed

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-11-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position -517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling.

  6. Secreted fungal aspartic proteases: A review.

    PubMed

    Mandujano-González, Virginia; Villa-Tanaca, Lourdes; Anducho-Reyes, Miguel Angel; Mercado-Flores, Yuridia

    2016-01-01

    The aspartic proteases, also called aspartyl and aspartate proteases or acid proteases (E.C.3.4.23), belong to the endopeptidase family and are characterized by the conserved sequence Asp-Gly-Thr at the active site. These enzymes are found in a wide variety of microorganisms in which they perform important functions related to nutrition and pathogenesis. In addition, their high activity and stability at acid pH make them attractive for industrial application in the food industry; specifically, they are used as milk-coagulating agents in cheese production or serve to improve the taste of some foods. This review presents an analysis of the characteristics and properties of secreted microbial aspartic proteases and their potential for commercial application.

  7. A novel detergent-stable solvent-tolerant serine thiol alkaline protease from Streptomyces koyangensis TN650.

    PubMed

    Ben Elhoul, Mouna; Zaraî Jaouadi, Nadia; Rekik, Hatem; Bejar, Wacim; Boulkour Touioui, Souraya; Hmidi, Maher; Badis, Abdelmalek; Bejar, Samir; Jaouadi, Bassem

    2015-08-01

    An alkaline proteinase (STAP) was produced from strain TN650 isolated from a Tunisian off-shore oil field and assigned as Streptomyces koyangensis strain TN650 based on physiological and biochemical properties and 16S rRNA gene sequencing. Matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF/MS) analysis revealed that the purified enzyme was a monomer with a molecular mass of 45125.17-Da. The enzyme had an NH2-terminal sequence of TQSNPPSWGLDRIDQTTAFTKACSIKY, thus sharing high homology with those of Streptomyces proteases. The results showed that this protease was completely inhibited by phenylmethanesulfonyl fluoride (PMSF), diiodopropyl fluorophosphates (DFP), and partially inhibited by 5,5-dithio-bis-(2-nitro benzoic acid) (DTNB), which strongly suggested its belonging to the serine thiol protease family. Using casein as a substrate, the optimum pH and temperature values for protease activity were pH 10 and 70 °C, respectively. The protease was stable at pH 7-10 and 30-60 °C for 24 h. STAP exhibited high catalytic efficiency, significant detergent stability, and elevated organic solvent resistance compared to the SG-XIV proteases from S. griseus and KERAB from Streptomyces sp. AB1. The stap gene encoding STAP was isolated, and its DNA sequence was determined. These properties make STAP a potential candidate for future application in detergent formulations and non-aqueous peptide biocatalysis.

  8. Effects of oral eicosapentaenoic acid versus docosahexaenoic acid on human peripheral blood mononuclear cell gene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Objective: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have beneficial effects on inflammation and cardiovascular disease (CVD). Our aim was to assess the effect of a six-week supplementation with either olive oil, EPA, or DHA on gene expression in peripheral blood mononuclear cells (...

  9. Genomic organization of the human lysosomal acid lipase gene (LIPA)

    SciTech Connect

    Aslandis, C.; Klima, H.; Lackner, K.J.; Schmitz, G. )

    1994-03-15

    Defects in the human lysosomal acid lipase gene are responsible for cholesteryl ester storage disease (CESD) and Wolman disease. Exon skipping as the cause for CESD has been demonstrated. The authors present here a summary of the exon structure of the entire human lysosomal acid lipase gene consisting of 10 exons, together with the sizes of genomic EcoRI and SacI fragments hybridizing to each exon. In addition, the DNA sequence of the putative promoter region is presented. The EMBL accession numbers for adjacent intron sequences are given. 7 refs., 2 figs., 1 tab.

  10. Use of buckwheat seed protease inhibitor gene for improvement of tobacco and potato plant resistance to biotic stress.

    PubMed

    Khadeeva, N V; Kochieva, E Z; Tcherednitchenko, M Yu; Yakovleva, E Yu; Sydoruk, K V; Bogush, V G; Dunaevsky, Y E; Belozersky, M A

    2009-03-01

    The possibility to use agrobacterial transformation of leaf discs to produce resistance to bacterial infections in tobacco and potato plants by introduction of a single gene encoding the serine proteinase inhibitor BWI-1a (ISP) from buckwheat seeds is shown. All studied PCR-positive transgenic plants exhibited antibacterial activity in biotests. It was shown that the presence of just a single gene of serine proteinase inhibitor provides sufficient protection at least against two bacterial phytopathogens, Pseudomonas syringae pv. tomato and Clavibacter michiganensis sbsp. michiganensis. The biotest including tobacco plant infection by the white wings butterfly in the green house has also demonstrated the existence of protective effect in transgenic tobacco plants. Significant genotypic variations in the protection efficiency were found between members of different genera of the same family (potato and tobacco) as well as between different lines of the same species. Northern blot analysis of four transgenic potato lines and three tobacco lines transformed by a vector plasmid containing the ISP gene of serine proteinases BWI-1a from buckwheat seeds has shown the presence of the expected size mRNA transcript.

  11. Cyclopiazonic acid biosynthesis gene cluster gene cpaM is required for speradine A biosynthesis.

    PubMed

    Tokuoka, Masafumi; Kikuchi, Tomoki; Shinohara, Yasutomo; Koyama, Akifumi; Iio, Shin-Ichiro; Kubota, Takaaki; Kobayashi, Jun'ichi; Koyama, Yasuji; Totsuka, Akira; Shindo, Hitoshi; Sato, Kazuo

    2015-01-01

    Speradine A is a derivative of cyclopiazonic acid (CPA) found in culture of an Aspergillus tamarii isolate. Heterologous expression of a predicted methyltransferase gene, cpaM, in the cpa biosynthesis gene cluster of A. tamarii resulted in the speradine A production in a 2-oxoCPA producing A. oryzae strain, indicating cpaM is involved in the speradine A biosynthesis.

  12. Binary and ternary combinations of anti-HIV protease inhibitors: effect on gene expression and functional activity of CYP3A4 and efflux transporters

    PubMed Central

    Kwatra, Deep; Vadlapudi, Aswani Dutt; Vadlapatla, Ramya Krishna; Khurana, Varun; Pal, Dhananjay; Mitra, Ashim K.

    2015-01-01

    Background The purpose of this study is to identify the effect of binary and ternary combinations of anti-HIV protease inhibitors (PIs) on the expression of metabolizing enzyme (CYP3A4) and efflux transporters [multidrug resistance-associated protein 2 (MRP2), P-glycoprotein (P-gp) and breast cancer resistant protein (BCRP)] in a model intestinal cell line (LS-180). Methods LS-180 cells were treated with various combinations of PIs (amprenavir, indinavir, saquinavir and lopinavir), and the mRNA expression levels of metabolizing enzyme and efflux transporters were measured using quantitative reverse transcription polymerase chain reaction. The alteration of gene expression was further correlated to the expression of nuclear hormone receptor PXR. Uptake of fluorescent and radioactive substrates was carried out to study the functional activity of these proteins. Cytotoxicity and adenosine triphosphate (ATP) assays were carried out to measure stress responses. Results Binary and ternary combinations of PIs appeared to modulate the expression of CYP3A4, MRP2, P-gp and BCRP in a considerable manner. Unlike the individual PIs, their binary combinations showed much greater induction of metabolizing enzyme and efflux proteins. However, such pronounced induction was not observed in the presence of ternary combinations. The observed trend of altered mRNA expression was found to correlate well with the change in expression levels of PXR. The gene expression was found to correlate with activity assays. Lack of cytotoxicity and ATP activity was observed in the treatment samples, suggesting that these alterations in expression levels were probably not stress responses. Conclusions In the present study, we demonstrated that combinations of drugs can have serious consequences toward the treatment of HIV infection by altering their bioavailability and disposition. PMID:24399676

  13. Deletion of Braun lipoprotein and plasminogen-activating protease-encoding genes attenuates Yersinia pestis in mouse models of bubonic and pneumonic plague.

    PubMed

    van Lier, Christina J; Sha, Jian; Kirtley, Michelle L; Cao, Anthony; Tiner, Bethany L; Erova, Tatiana E; Cong, Yingzi; Kozlova, Elena V; Popov, Vsevolod L; Baze, Wallace B; Chopra, Ashok K

    2014-06-01

    Currently, there is no FDA-approved vaccine against Yersinia pestis, the causative agent of bubonic and pneumonic plague. Since both humoral immunity and cell-mediated immunity are essential in providing the host with protection against plague, we developed a live-attenuated vaccine strain by deleting the Braun lipoprotein (lpp) and plasminogen-activating protease (pla) genes from Y. pestis CO92. The Δlpp Δpla double isogenic mutant was highly attenuated in evoking both bubonic and pneumonic plague in a mouse model. Further, animals immunized with the mutant by either the intranasal or the subcutaneous route were significantly protected from developing subsequent pneumonic plague. In mice, the mutant poorly disseminated to peripheral organs and the production of proinflammatory cytokines concurrently decreased. Histopathologically, reduced damage to the lungs and livers of mice infected with the Δlpp Δpla double mutant compared to the level of damage in wild-type (WT) CO92-challenged animals was observed. The Δlpp Δpla mutant-immunized mice elicited a humoral immune response to the WT bacterium, as well as to CO92-specific antigens. Moreover, T cells from mutant-immunized animals exhibited significantly higher proliferative responses, when stimulated ex vivo with heat-killed WT CO92 antigens, than mice immunized with the same sublethal dose of WT CO92. Likewise, T cells from the mutant-immunized mice produced more gamma interferon (IFN-γ) and interleukin-4. These animals had an increasing number of tumor necrosis factor alpha (TNF-α)-producing CD4(+) and CD8(+) T cells than WT CO92-infected mice. These data emphasize the role of TNF-α and IFN-γ in protecting mice against pneumonic plague. Overall, our studies provide evidence that deletion of the lpp and pla genes acts synergistically in protecting animals against pneumonic plague, and we have demonstrated an immunological basis for this protection.

  14. Control of mammalian gene expression by amino acids, especially glutamine.

    PubMed

    Brasse-Lagnel, Carole; Lavoinne, Alain; Husson, Annie

    2009-04-01

    Molecular data rapidly accumulating on the regulation of gene expression by amino acids in mammalian cells highlight the large variety of mechanisms that are involved. Transcription factors, such as the basic-leucine zipper factors, activating transcription factors and CCAAT/enhancer-binding protein, as well as specific regulatory sequences, such as amino acid response element and nutrient-sensing response element, have been shown to mediate the inhibitory effect of some amino acids. Moreover, amino acids exert a wide range of effects via the activation of different signalling pathways and various transcription factors, and a number of cis elements distinct from amino acid response element/nutrient-sensing response element sequences were shown to respond to changes in amino acid concentration. Particular attention has been paid to the effects of glutamine, the most abundant amino acid, which at appropriate concentrations enhances a great number of cell functions via the activation of various transcription factors. The glutamine-responsive genes and the transcription factors involved correspond tightly to the specific effects of the amino acid in the inflammatory response, cell proliferation, differentiation and survival, and metabolic functions. Indeed, in addition to the major role played by nuclear factor-kappaB in the anti-inflammatory action of glutamine, the stimulatory role of activating protein-1 and the inhibitory role of C/EBP homology binding protein in growth-promotion, and the role of c-myc in cell survival, many other transcription factors are also involved in the action of glutamine to regulate apoptosis and intermediary metabolism in different cell types and tissues. The signalling pathways leading to the activation of transcription factors suggest that several kinases are involved, particularly mitogen-activated protein kinases. In most cases, however, the precise pathways from the entrance of the amino acid into the cell to the activation of gene

  15. Proteases as therapeutics

    PubMed Central

    Craik, Charles S.; Page, Michael J.; Madison, Edwin L.

    2015-01-01

    Proteases are an expanding class of drugs that hold great promise. The U.S. FDA (Food and Drug Administration) has approved 12 protease therapies, and a number of next generation or completely new proteases are in clinical development. Although they are a well-recognized class of targets for inhibitors, proteases themselves have not typically been considered as a drug class despite their application in the clinic over the last several decades; initially as plasma fractions and later as purified products. Although the predominant use of proteases has been in treating cardiovascular disease, they are also emerging as useful agents in the treatment of sepsis, digestive disorders, inflammation, cystic fibrosis, retinal disorders, psoriasis and other diseases. In the present review, we outline the history of proteases as therapeutics, provide an overview of their current clinical application, and describe several approaches to improve and expand their clinical application. Undoubtedly, our ability to harness proteolysis for disease treatment will increase with our understanding of protease biology and the molecular mechanisms responsible. New technologies for rationally engineering proteases, as well as improved delivery options, will expand greatly the potential applications of these enzymes. The recognition that proteases are, in fact, an established class of safe and efficacious drugs will stimulate investigation of additional therapeutic applications for these enzymes. Proteases therefore have a bright future as a distinct therapeutic class with diverse clinical applications. PMID:21406063

  16. Identification of nitrogen-fixing genes and gene clusters from metagenomic library of acid mine drainage.

    PubMed

    Dai, Zhimin; Guo, Xue; Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

    2014-01-01

    Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community.

  17. Identification of Nitrogen-Fixing Genes and Gene Clusters from Metagenomic Library of Acid Mine Drainage

    PubMed Central

    Yin, Huaqun; Liang, Yili; Cong, Jing; Liu, Xueduan

    2014-01-01

    Biological nitrogen fixation is an essential function of acid mine drainage (AMD) microbial communities. However, most acidophiles in AMD environments are uncultured microorganisms and little is known about the diversity of nitrogen-fixing genes and structure of nif gene cluster in AMD microbial communities. In this study, we used metagenomic sequencing to isolate nif genes in the AMD microbial community from Dexing Copper Mine, China. Meanwhile, a metagenome microarray containing 7,776 large-insertion fosmids was constructed to screen novel nif gene clusters. Metagenomic analyses revealed that 742 sequences were identified as nif genes including structural subunit genes nifH, nifD, nifK and various additional genes. The AMD community is massively dominated by the genus Acidithiobacillus. However, the phylogenetic diversity of nitrogen-fixing microorganisms is much higher than previously thought in the AMD community. Furthermore, a 32.5-kb genomic sequence harboring nif, fix and associated genes was screened by metagenome microarray. Comparative genome analysis indicated that most nif genes in this cluster are most similar to those of Herbaspirillum seropedicae, but the organization of the nif gene cluster had significant differences from H. seropedicae. Sequence analysis and reverse transcription PCR also suggested that distinct transcription units of nif genes exist in this gene cluster. nifQ gene falls into the same transcription unit with fixABCX genes, which have not been reported in other diazotrophs before. All of these results indicated that more novel diazotrophs survive in the AMD community. PMID:24498417

  18. The fibrinolytic activity of a novel protease derived from a tempeh producing fungus, Fusarium sp. BLB.

    PubMed

    Sugimoto, Satoshi; Fujii, Tadashi; Morimiya, Tatsuo; Johdo, Osamu; Nakamura, Takumi

    2007-09-01

    Tempeh is a traditional Indonesian soybean-fermented food produced by filamentous fungi, Rhizopus sp. and Fusarium sp. We isolated and sequenced the genomic gene and a cDNA clone encoding a novel protease (FP) from Fusarium sp. BLB. The genomic gene was 856 bp in length and contained two introns. An isolated cDNA clone encoded a protein of 250 amino acids. The predicted amino acid sequence of FP showed highest homology, of 76%, with that of trypsin from Fusarium oxysporum. The hydrolysis activity of FP toward synthetic peptide was higher than that of any other protease tested, including Nattokinases. Furthermore, the thrombolytic activity of FP was about 2.1-fold higher than that of Nattokinase when the concentration of plasminogen was 24 units/ml. These results suggest that FP is superior to Nattokinases in dissolving fibrin when absorbed into the blood.

  19. Cadmium Induces Retinoic Acid Signaling by Regulating Retinoic Acid Metabolic Gene Expression*

    PubMed Central

    Cui, Yuxia; Freedman, Jonathan H.

    2009-01-01

    The transition metal cadmium is an environmental teratogen. In addition, cadmium and retinoic acid can act synergistically to induce forelimb malformations. The molecular mechanism underlying the teratogenicity of cadmium and the synergistic effect with retinoic acid has not been addressed. An evolutionarily conserved gene, β,β-carotene 15,15′-monooxygenase (BCMO), which is involved in retinoic acid biosynthesis, was studied in both Caenorhabditis elegans and murine Hepa 1–6 cells. In C. elegans, bcmo-1 was expressed in the intestine and was cadmium inducible. Similarly, in Hepa 1–6 cells, Bcmo1 was induced by cadmium. Retinoic acid-mediated signaling increased after 24-h exposures to 5 and 10 μm cadmium in Hepa 1–6 cells. Examination of gene expression demonstrated that the induction of retinoic acid signaling by cadmium may be mediated by overexpression of Bcmo1. Furthermore, cadmium inhibited the expression of Cyp26a1 and Cyp26b1, which are involved in retinoic acid degradation. These results indicate that cadmium-induced teratogenicity may be due to the ability of the metal to increase the levels of retinoic acid by disrupting the expression of retinoic acid-metabolizing genes. PMID:19556237

  20. Inhibitory Monoclonal Antibodies against Mouse Proteases Raised in Gene-Deficient Mice Block Proteolytic Functions in vivo

    PubMed Central

    Lund, Ida K.; Rasch, Morten G.; Ingvarsen, Signe; Pass, Jesper; Madsen, Daniel H.; Engelholm, Lars H.; Behrendt, Niels; Høyer-Hansen, Gunilla

    2012-01-01

    Identification of targets for cancer therapy requires the understanding of the in vivo roles of proteins, which can be derived from studies using gene-targeted mice. An alternative strategy is the administration of inhibitory monoclonal antibodies (mAbs), causing acute disruption of the target protein function(s). This approach has the advantage of being a model for therapeutic targeting. mAbs for use in mouse models can be obtained through immunization of gene-deficient mice with the autologous protein. Such mAbs react with both species-specific epitopes and epitopes conserved between species. mAbs against proteins involved in extracellular proteolysis, including plasminogen activators urokinase plasminogen activator (uPA), tissue-type plasminogen activator (tPA), their inhibitor PAI-1, the uPA receptor (uPAR), two matrix metalloproteinases (MMP9 and MMP14), as well as the collagen internalization receptor uPARAP, have been developed. The inhibitory mAbs against uPA and uPAR block plasminogen activation and thereby hepatic fibrinolysis in vivo. Wound healing, another plasmin-dependent process, is delayed by an inhibitory mAb against uPA in the adult mouse. Thromboembolism can be inhibited by anti-PAI-1 mAbs in vivo. In conclusion, function-blocking mAbs are well-suited for targeted therapy in mouse models of different diseases, including cancer. PMID:22754528

  1. A biotechnology perspective of fungal proteases

    PubMed Central

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira, Edivaldo Ximenes; Pessoa, Adalberto; Magalhães, Pérola Oliveira

    2015-01-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications. PMID:26273247

  2. A biotechnology perspective of fungal proteases.

    PubMed

    de Souza, Paula Monteiro; Bittencourt, Mona Lisa de Assis; Caprara, Carolina Canielles; de Freitas, Marcela; de Almeida, Renata Paula Coppini; Silveira, Dâmaris; Fonseca, Yris Maria; Ferreira Filho, Edivaldo Ximenes; Pessoa Junior, Adalberto; Magalhães, Pérola Oliveira

    2015-06-01

    Proteases hydrolyze the peptide bonds of proteins into peptides and amino acids, being found in all living organisms, and are essential for cell growth and differentiation. Proteolytic enzymes have potential application in a wide number of industrial processes such as food, laundry detergent and pharmaceutical. Proteases from microbial sources have dominated applications in industrial sectors. Fungal proteases are used for hydrolyzing protein and other components of soy beans and wheat in soy sauce production. Proteases can be produced in large quantities in a short time by established methods of fermentation. The parameters such as variation in C/N ratio, presence of some sugars, besides several other physical factors are important in the development of fermentation process. Proteases of fungal origin can be produced cost effectively, have an advantage faster production, the ease with which the enzymes can be modified and mycelium can be easily removed by filtration. The production of proteases has been carried out using submerged fermentation, but conditions in solid state fermentation lead to several potential advantages for the production of fungal enzymes. This review focuses on the production of fungal proteases, their distribution, structural-functional aspects, physical and chemical parameters, and the use of these enzymes in industrial applications.

  3. Regulation of protease production in Clostridium sporogenes.

    PubMed Central

    Allison, C; Macfarlane, G T

    1990-01-01

    The physiological and nutritional factors that regulate protease synthesis in Clostridium sporogenes C25 were studied in batch and continuous cultures. Formation of extracellular proteases occurred at the end of active growth and during the stationary phase in batch cultures. Protease production was inversely related to growth rate in glucose-excess and glucose-limited chemostats over the range D = 0.05 to 0.70 h-1. In pulse experiments, glucose, ammonia, phosphate, and some amino acids (tryptophan, proline, tyrosine, and isoleucine) strongly repressed protease synthesis. This repression was not relieved by addition of 4 mM cyclic AMP, cyclic GMP, or dibutyryl cyclic AMP. Protease formation was markedly inhibited by 4 mM ATP and ADP, but GTP and GDP had little effect on the process. It is concluded that protease production by C. sporogenes is strongly influenced by the amount of energy available to the cells, with the highest levels of protease synthesis occurring under energy-limiting conditions. PMID:2268158

  4. Cloning, sequence analysis, and expression in Escherichia coli of the gene encoding an alpha-amino acid ester hydrolase from Acetobacter turbidans.

    PubMed

    Polderman-Tijmes, Jolanda J; Jekel, Peter A; de Vries, Erik J; van Merode, Annet E J; Floris, René; van der Laan, Jan-Metske; Sonke, Theo; Janssen, Dick B

    2002-01-01

    The alpha-amino acid ester hydrolase from Acetobacter turbidans ATCC 9325 is capable of hydrolyzing and synthesizing beta-lactam antibiotics, such as cephalexin and ampicillin. N-terminal amino acid sequencing of the purified alpha-amino acid ester hydrolase allowed cloning and genetic characterization of the corresponding gene from an A. turbidans genomic library. The gene, designated aehA, encodes a polypeptide with a molecular weight of 72,000. Comparison of the determined N-terminal sequence and the deduced amino acid sequence indicated the presence of an N-terminal leader sequence of 40 amino acids. The aehA gene was subcloned in the pET9 expression plasmid and expressed in Escherichia coli. The recombinant protein was purified and found to be dimeric with subunits of 70 kDa. A sequence similarity search revealed 26% identity with a glutaryl 7-ACA acylase precursor from Bacillus laterosporus, but no homology was found with other known penicillin or cephalosporin acylases. There was some similarity to serine proteases, including the conservation of the active site motif, GXSYXG. Together with database searches, this suggested that the alpha-amino acid ester hydrolase is a beta-lactam antibiotic acylase that belongs to a class of hydrolases that is different from the Ntn hydrolase superfamily to which the well-characterized penicillin acylase from E. coli belongs. The alpha-amino acid ester hydrolase of A. turbidans represents a subclass of this new class of beta-lactam antibiotic acylases.

  5. Mutational analysis of human immunodeficiency virus type 1 protease suggests functional homology with aspartic proteinases.

    PubMed Central

    Loeb, D D; Hutchison, C A; Edgell, M H; Farmerie, W G; Swanstrom, R

    1989-01-01

    Processing of the retroviral gag and pol gene products is mediated by a viral protease. Bacterial expression systems have been developed which permit genetic analysis of the human immunodeficiency virus type 1 protease as measured by cleavage of the pol protein precursor. Deletion analysis of the pol reading frame locates the sequences required to encode a protein with appropriate proteolytic activity near the left end of the pol reading frame but largely outside the gag-pol overlap region, which is at the extreme left end of pol. Most missense mutations within an 11-amino-acid domain highly conserved among retroviral proteases and with sequence similarity to the active site of aspartic proteinases abolish appropriate processing, suggesting that the retrovirus proteases share a catalytic mechanism with aspartic proteinases. Substitution of the amino acids flanking the scissile bond at three of the processing sites encoded by pol demonstrates distinct sequence requirements for cleavage at these different sites. The inclusion of a charged amino acid at the processing site blocks cleavage. A subset of these substitutions also inhibits processing at the nonmutated sites. Images PMID:2642305

  6. Tomato ABSCISIC ACID STRESS RIPENING (ASR) gene family revisited.

    PubMed

    Golan, Ido; Dominguez, Pia Guadalupe; Konrad, Zvia; Shkolnik-Inbar, Doron; Carrari, Fernando; Bar-Zvi, Dudy

    2014-01-01

    Tomato ABSCISIC ACID RIPENING 1 (ASR1) was the first cloned plant ASR gene. ASR orthologs were then cloned from a large number of monocot, dicot and gymnosperm plants, where they are mostly involved in response to abiotic (drought and salinity) stress and fruit ripening. The tomato genome encodes five ASR genes: ASR1, 2, 3 and 5 encode low-molecular-weight proteins (ca. 110 amino acid residues each), whereas ASR4 encodes a 297-residue polypeptide. Information on the expression of the tomato ASR gene family is scarce. We used quantitative RT-PCR to assay the expression of this gene family in plant development and in response to salt and osmotic stresses. ASR1 and ASR4 were the main expressed genes in all tested organs and conditions, whereas ASR2 and ASR3/5 expression was two to three orders of magnitude lower (with the exception of cotyledons). ASR1 is expressed in all plant tissues tested whereas ASR4 expression is limited to photosynthetic organs and stamens. Essentially, ASR1 accounted for most of ASR gene expression in roots, stems and fruits at all developmental stages, whereas ASR4 was the major gene expressed in cotyledons and young and fully developed leaves. Both ASR1 and ASR4 were expressed in flower organs, with ASR1 expression dominating in stamens and pistils, ASR4 in sepals and petals. Steady-state levels of ASR1 and ASR4 were upregulated in plant vegetative organs following exposure to salt stress, osmotic stress or the plant abiotic stress hormone abscisic acid (ABA). Tomato plants overexpressing ASR1 displayed enhanced survival rates under conditions of water stress, whereas ASR1-antisense plants displayed marginal hypersensitivity to water withholding.

  7. Repeats in transforming acidic coiled-coil (TACC) genes.

    PubMed

    Trivedi, Seema

    2013-06-01

    Transforming acidic coiled-coil proteins (TACC1, 2, and 3) are essential proteins associated with the assembly of spindle microtubules and maintenance of bipolarity. Dysregulation of TACCs is associated with tumorigenesis, but studies of microsatellite instability in TACC genes have not been extensive. Microsatellite or simple sequence repeat instability is known to cause many types of cancer. The present in silico analysis of SSRs in human TACC gene sequences shows the presence of mono- to hexa-nucleotide repeats, with the highest densities found for mono- and di-nucleotide repeats. Density of repeats is higher in introns than in exons. Some of the repeats are present in regulatory regions and retained introns. Human TACC genes show conservation of many repeat classes. Microsatellites in TACC genes could be valuable markers for monitoring numerical chromosomal aberrations and or cancer.

  8. In vitro selection and characterization of human immunodeficiency virus type 1 (HIV-1) isolates with reduced sensitivity to hydroxyethylamino sulfonamide inhibitors of HIV-1 aspartyl protease.

    PubMed

    Partaledis, J A; Yamaguchi, K; Tisdale, M; Blair, E E; Falcione, C; Maschera, B; Myers, R E; Pazhanisamy, S; Futer, O; Cullinan, A B

    1995-09-01

    Human immunodeficiency virus type 1 (HIV-1) variants with reduced sensitivity to the hydroxyethylamino sulfonamide protease inhibitors VB-11,328 and VX-478 have been selected in vitro by two independent serial passage protocols with HIV-1 in CEM-SS and MT-4 cell lines. Virus populations with greater than 100-fold-increased resistance to both inhibitors compared with the parental virus have been obtained. DNA sequence analyses of the protease genes from VB-11,328- and VX-478-resistant variants reveal a sequential accumulation of point mutations, with similar resistance patterns occurring for the two inhibitors. The deduced amino acid substitutions in the resistant protease are Leu-10-->Phe, Met-46-->Ile, Ile-47-->Val, and Ile-50-->Val. This is the first observation in HIV protease resistance studies of an Ile-50-->Val mutation, a mutation that appears to arise uniquely against the sulfonamide inhibitor class. When the substitutions observed were introduced as single mutations into an HIV-1 infectious clone (HXB2), only the Ile-50-->Val mutant showed reduced sensitivity (two- to threefold) to VB-11,328 and VX-478. A triple protease mutant infectious clone carrying the mutations Met-46-->Ile, Ile-47-->Val, and Ile-50-->Val, however, showed much greater reduction in sensitivity (14- to 20-fold) to VB-11,328 and VX-478. The same mutations were studied in recombinant HIV protease. The mutant protease Ile-50-->Val displays a much lower affinity for the inhibitors than the parent enzyme (< or = 80-fold). The protease triply mutated at Met-46-->Ile, Ile-47-->Val, and Ile-50-->Val shows an even greater decrease in inhibitor binding (< or = 270-fold). The sulfonamide-resistant HIV protease variants remain sensitive to inhibitors from other chemical classes (Ro 31-8959 and L-735,524), suggesting possibilities for clinical use of HIV protease inhibitors in combination or serially.

  9. In vitro selection and characterization of human immunodeficiency virus type 1 (HIV-1) isolates with reduced sensitivity to hydroxyethylamino sulfonamide inhibitors of HIV-1 aspartyl protease.

    PubMed Central

    Partaledis, J A; Yamaguchi, K; Tisdale, M; Blair, E E; Falcione, C; Maschera, B; Myers, R E; Pazhanisamy, S; Futer, O; Cullinan, A B

    1995-01-01

    Human immunodeficiency virus type 1 (HIV-1) variants with reduced sensitivity to the hydroxyethylamino sulfonamide protease inhibitors VB-11,328 and VX-478 have been selected in vitro by two independent serial passage protocols with HIV-1 in CEM-SS and MT-4 cell lines. Virus populations with greater than 100-fold-increased resistance to both inhibitors compared with the parental virus have been obtained. DNA sequence analyses of the protease genes from VB-11,328- and VX-478-resistant variants reveal a sequential accumulation of point mutations, with similar resistance patterns occurring for the two inhibitors. The deduced amino acid substitutions in the resistant protease are Leu-10-->Phe, Met-46-->Ile, Ile-47-->Val, and Ile-50-->Val. This is the first observation in HIV protease resistance studies of an Ile-50-->Val mutation, a mutation that appears to arise uniquely against the sulfonamide inhibitor class. When the substitutions observed were introduced as single mutations into an HIV-1 infectious clone (HXB2), only the Ile-50-->Val mutant showed reduced sensitivity (two- to threefold) to VB-11,328 and VX-478. A triple protease mutant infectious clone carrying the mutations Met-46-->Ile, Ile-47-->Val, and Ile-50-->Val, however, showed much greater reduction in sensitivity (14- to 20-fold) to VB-11,328 and VX-478. The same mutations were studied in recombinant HIV protease. The mutant protease Ile-50-->Val displays a much lower affinity for the inhibitors than the parent enzyme (< or = 80-fold). The protease triply mutated at Met-46-->Ile, Ile-47-->Val, and Ile-50-->Val shows an even greater decrease in inhibitor binding (< or = 270-fold). The sulfonamide-resistant HIV protease variants remain sensitive to inhibitors from other chemical classes (Ro 31-8959 and L-735,524), suggesting possibilities for clinical use of HIV protease inhibitors in combination or serially. PMID:7636964

  10. Serine proteases inhibiting cyanopeptides.

    PubMed

    Radau, G

    2000-08-01

    There are many compounds inhibiting serine proteases which play an important role in the human organism. This article reviews publications on the low-molecular weight, serine protease inhibitory cyanopeptides and reports on new developments in establishing structure-activity relationships.

  11. Yeast genes involved in response to lactic acid and acetic acid: acidic conditions caused by the organic acids in Saccharomyces cerevisiae cultures induce expression of intracellular metal metabolism genes regulated by Aft1p.

    PubMed

    Kawahata, Miho; Masaki, Kazuo; Fujii, Tsutomu; Iefuji, Haruyuki

    2006-09-01

    Using two types of genome-wide analysis to investigate yeast genes involved in response to lactic acid and acetic acid, we found that the acidic condition affects metal metabolism. The first type is an expression analysis using DNA microarrays to investigate 'acid shock response' as the first step to adapt to an acidic condition, and 'acid adaptation' by maintaining integrity in the acidic condition. The other is a functional screening using the nonessential genes deletion collection of Saccharomyces cerevisiae. The expression analysis showed that genes involved in stress response, such as YGP1, TPS1 and HSP150, were induced under the acid shock response. Genes such as FIT2, ARN1 and ARN2, involved in metal metabolism regulated by Aft1p, were induced under the acid adaptation. AFT1 was induced under acid shock response and under acid adaptation with lactic acid. Moreover, green fluorescent protein-fused Aft1p was localized to the nucleus in cells grown in media containing lactic acid, acetic acid, or hydrochloric acid. Both analyses suggested that the acidic condition affects cell wall architecture. The depletion of cell-wall components encoded by SED1, DSE2, CTS1, EGT2, SCW11, SUN4 and YNL300W and histone acetyltransferase complex proteins encoded by YID21, EAF3, EAF5, EAF6 and YAF9 increased resistance to lactic acid. Depletion of the cell-wall mannoprotein Sed1p provided resistance to lactic acid, although the expression of SED1 was induced by exposure to lactic acid. Depletion of vacuolar membrane H+-ATPase and high-osmolarity glycerol mitogen-activated protein kinase proteins caused acid sensitivity. Moreover, our quantitative PCR showed that expression of PDR12 increased under acid shock response with lactic acid and decreased under acid adaptation with hydrochloric acid.

  12. Molecular cloning, sequence and structural analysis of dehairing Mn(2+) dependent alkaline serine protease (MASPT) of Bacillus pumilus TMS55.

    PubMed

    Ibrahim, Kalibulla Syed; Muniyandi, Jeyaraj; Pandian, Shunmugiah Karutha

    2011-10-01

    Leather industries release a large amount of pollution-causing chemicals which creates one of the major industrial pollutions. The development of enzyme based processes as a potent alternative to pollution-causing chemicals is useful to overcome this issue. Proteases are enzymes which have extensive applications in leather processing and in several bioremediation processes due to their high alkaline protease activity and dehairing efficacy. In the present study, we report cloning, characterization of a Mn2+ dependent alkaline serine protease gene (MASPT) of Bacillus pumilus TMS55. The gene encoding the protease from B. pumilus TMS55 was cloned and its nucleotide sequence was determined. This gene has an open reading frame (ORF) of 1,149 bp that encodes a polypeptide of 383 amino acid residues. Our analysis showed that this polypeptide is composed of 29 residues N-terminal signal peptide, a propeptide of 79 residues and a mature protein of 275 amino acids. We performed bioinformatics analysis to compare MASPT enzyme with other proteases. Homology modeling was employed to model three dimensional structure for MASPT. Structural analysis showed that MASPT structure is composed of nine α-helices and nine β-strands. It has 3 catalytic residues and 14 metal binding residues. Docking analysis showed that residues S223, A260, N263, T328 and S329 interact with Mn2+. This study allows initial inferences about the structure of the protease and will allow the rational design of its derivatives for structure-function studies and also for further improvement of the enzyme.

  13. The AtCathB3 gene, encoding a cathepsin B-like protease, is expressed during germination of Arabidopsis thaliana and transcriptionally repressed by the basic leucine zipper protein GBF1

    PubMed Central

    Wozny, Dorothee; Barrero-Sicilia, Cristina

    2014-01-01

    Protein hydrolysis plays an important role during seed germination and post-germination seedling establishment. In Arabidopsis thaliana, cathepsin B-like proteases are encoded by a gene family of three members, but only the AtCathB3 gene is highly induced upon seed germination and at the early post-germination stage. Seeds of a homozygous T-DNA insertion mutant in the AtCathB3 gene have, besides a reduced cathepsin B activity, a slower germination than the wild type. To explore the transcriptional regulation of this gene, we used a combined phylogenetic shadowing approach together with a yeast one-hybrid screening of an arrayed library of approximately 1200 transcription factor open reading frames from Arabidopsis thaliana. We identified a conserved CathB3-element in the promoters of orthologous CathB3 genes within the Brassicaceae species analysed, and, as its DNA-interacting protein, the G-Box Binding Factor1 (GBF1). Transient overexpression of GBF1 together with a PAtCathB3::uidA (β-glucuronidase) construct in tobacco plants revealed a negative effect of GBF1 on expression driven by the AtCathB3 promoter. In stable P35S::GBF1 lines, not only was the expression of the AtCathB3 gene drastically reduced, but a significant slower germination was also observed. In the homozygous knockout mutant for the GBF1 gene, the opposite effect was found. These data indicate that GBF1 is a transcriptional repressor of the AtCathB3 gene and affects the germination kinetics of Arabidopsis thaliana seeds. As AtCathB3 is also expressed during post-germination in the cotyledons, a role for the AtCathB3-like protease in reserve mobilization is also inferred. PMID:24600022

  14. The AtCathB3 gene, encoding a cathepsin B-like protease, is expressed during germination of Arabidopsis thaliana and transcriptionally repressed by the basic leucine zipper protein GBF1.

    PubMed

    Iglesias-Fernández, Raquel; Wozny, Dorothee; Iriondo-de Hond, Maite; Oñate-Sánchez, Luis; Carbonero, Pilar; Barrero-Sicilia, Cristina

    2014-05-01

    Protein hydrolysis plays an important role during seed germination and post-germination seedling establishment. In Arabidopsis thaliana, cathepsin B-like proteases are encoded by a gene family of three members, but only the AtCathB3 gene is highly induced upon seed germination and at the early post-germination stage. Seeds of a homozygous T-DNA insertion mutant in the AtCathB3 gene have, besides a reduced cathepsin B activity, a slower germination than the wild type. To explore the transcriptional regulation of this gene, we used a combined phylogenetic shadowing approach together with a yeast one-hybrid screening of an arrayed library of approximately 1200 transcription factor open reading frames from Arabidopsis thaliana. We identified a conserved CathB3-element in the promoters of orthologous CathB3 genes within the Brassicaceae species analysed, and, as its DNA-interacting protein, the G-Box Binding Factor1 (GBF1). Transient overexpression of GBF1 together with a PAtCathB3::uidA (β-glucuronidase) construct in tobacco plants revealed a negative effect of GBF1 on expression driven by the AtCathB3 promoter. In stable P35S::GBF1 lines, not only was the expression of the AtCathB3 gene drastically reduced, but a significant slower germination was also observed. In the homozygous knockout mutant for the GBF1 gene, the opposite effect was found. These data indicate that GBF1 is a transcriptional repressor of the AtCathB3 gene and affects the germination kinetics of Arabidopsis thaliana seeds. As AtCathB3 is also expressed during post-germination in the cotyledons, a role for the AtCathB3-like protease in reserve mobilization is also inferred.

  15. Single amino acid polymorphism in aldehyde dehydrogenase gene superfamily.

    PubMed

    Priyadharshini Christy, J; George Priya Doss, C

    2015-01-01

    The aldehyde dehydrogenase gene superfamily comprises of 19 genes and 3 pseudogenes. These superfamily genes play a vital role in the formation of molecules that are involved in life processes, and detoxification of endogenous and exogenous aldehydes. ALDH superfamily genes associated mutations are implicated in various diseases, such as pyridoxine-dependent seizures, gamma-hydroxybutyric aciduria, type II Hyperprolinemia, Sjogren-Larsson syndrome including cancer and Alzheimer's disease. Accumulation of large DNA variations data especially Single Amino acid Polymorphisms (SAPs) in public databases related to ALDH superfamily genes insisted us to conduct a survey on the disease associated mutations and predict their function impact on protein structure and function. Overall this study provides an update and highlights the importance of pathogenic mutations in associated diseases. Using KD4v and Project HOPE a computational based platform, we summarized all the deleterious properties of SAPs in ALDH superfamily genes by the providing valuable insight into structural alteration rendered due to mutation. We hope this review might provide a way to define the deleteriousness of a SAP and helps to understand the molecular basis of the associated disease and also permits precise diagnosis and treatment in the near future.

  16. Genetic characterization and expression of the novel fungal protease, EPg222 active in dry-cured meat products.

    PubMed

    Benito, María J; Connerton, Ian F; Córdoba, Juan J

    2006-11-01

    EPg222 protease is a novel extracellular enzyme produced by Penicillium chrysogenum (Pg222) isolated from dry-cured hams that has the potential for use over a broad range of applications in industries that produce dry-cured meat products. The gene encoding EPg222 protease has been identified. Peptide sequences of EPg222 were obtained by de novo sequencing of tryptic peptides using mass spectrometry. The corresponding gene was amplified by PCR using degenerated primers based on a combination of conserved serine protease-encoding sequences and reverse translation of the peptide sequences. EPg222 is encoded as a gene of 1,361 bp interrupted by two introns. The deduced amino acid sequence indicated that the enzyme is synthesized as a preproenzyme with a putative signal sequence of 19 amino acids (aa), a prosequence of 96 aa and a mature protein of 283 aa. A cDNA encoding EPg222 has been cloned and expressed as a functionally active enzyme in Pichia pastoris. The recombinant enzyme exhibits similar activities to the native enzyme against a wide range of protein substrates including muscle myofibrillar protein. The mature sequence contains conserved aa residues characteristic of those forming the catalytic triad of serine proteases (Asp42, His76 and Ser228) but notably the food enzyme exhibits specific aa substitutions in the immunoglobulin-E recognition regions that have been identified in protein homologues that are allergenic.

  17. Differential Gene Expression of Longan Under Simulated Acid Rain Stress.

    PubMed

    Zheng, Shan; Pan, Tengfei; Ma, Cuilan; Qiu, Dongliang

    2017-03-16

    Differential gene expression profile was studied in Dimocarpus longan Lour. in response to treatments of simulated acid rain with pH 2.5, 3.5, and a control (pH 5.6) using differential display reverse transcription polymerase chain reaction (DDRT-PCR). Results showed that mRNA differential display conditions were optimized to find an expressed sequence tag (EST) related with acid rain stress. The potential encoding products had 80% similarity with a transcription initiation factor IIF of Gossypium raimondii and 81% similarity with a protein product of Theobroma cacao. This fragment is the transcription factor activated by second messenger substances in longan leaves after signal perception of acid rain.

  18. Identification of genes regulated by UV/salicylic acid.

    SciTech Connect

    Paunesku, T.; Chang-Liu, C.-M.; Shearin-Jones, P.; Watson, C.; Milton, J.; Oryhon, J.; Salbego, D.; Milosavljevic, A.; Woloschak, G. E.; CuraGen Corp.

    2000-02-01

    Purpose : Previous work from the authors' group and others has demonstrated that some of the effects of UV irradiation on gene expression are modulated in response to the addition of salicylic acid to irradiated cells. The presumed effector molecule responsible for this modulation is NF-kappaB. In the experiments described here, differential-display RT-PCR was used to identify those cDNAs that are differentially modulated by UV radiation with and without the addition of salicylic acid. Materials and methods : Differential-display RT-PCR was used to identify differentially expressed genes. Results : Eight such cDNAs are presented: lactate dehydrogenase (LDH-beta), nuclear encoded mitochondrial NADH ubiquinone reductase 24kDa (NDUFV2), elongation initiation factor 4B (eIF4B), nuclear dots protein SP100, nuclear encoded mitochondrial ATPase inhibitor (IF1), a cDNA similar to a subunit of yeast CCAAT transcription factor HAP5, and two expressed sequence tags (AA187906 and AA513156). Conclusions : Sequences of four of these genes contained NF-kappaB DNA binding sites of the type that may attract transrepressor p55/p55 NF-kappaB homodimers. Down-regulation of these genes upon UV irradiation may contribute to increased cell survival via suppression of p53 independent apoptosis.

  19. Expression and characterization of Coprothermobacter proteolyticus alkaline serine protease

    Technology Transfer Automated Retrieval System (TEKTRAN)

    TECHNICAL ABSTRACT A putative protease gene (aprE) from the thermophilic bacterium Coprothermobacter proteolyticus was cloned and expressed in Bacillus subtilis. The enzyme was determined to be a serine protease based on inhibition by PMSF. Biochemical characterization demonstrated the enzyme had...

  20. Improving the performance of industrial ethanol-producing yeast by expressing the aspartyl protease on the cell surface.

    PubMed

    Guo, Zhong-peng; Zhang, Liang; Ding, Zhong-yang; Wang, Zheng-Xiang; Shi, Gui-Yang

    2010-12-01

    The yeasts used in fuel ethanol manufacture are unable to metabolize soluble proteins. The PEP4 gene, encoding a vacuolar aspartyl protease in Saccharomyces cerevisiae, was either secretively or cell-surface anchored expressed in industrial ethanol-producing S. cerevisiae. The obtained recombinant strains APA (expressing the protease secretively) and APB (expressing the protease on the cell wall) were studied under ethanol fermentation conditions in feed barley cultures. The effects of expression of the protease on product formation, growth and cell protein content were measured. The biomass yield of the wild-type was clearly lower than that of the recombinant strains (0.578 ± 0.12 g biomass/g glucose for APA and 0.582 ± 0.08 g biomass/g glucose for APB). In addition, nearly 98-99% of the theoretical maximum level of ethanol yield was achieved (relative to the amount of substrate consumed) for the recombinant strains, while limiting the nitrogen source resulted in dissatisfactory fermentation for the wild-type and more than 30 g/l residual sugar was detected at the end of fermentation. In addition, higher growth rate, viability and lower yields of byproducts such as glycerol and pyruvic acid for recombinant strains were observed. Expressing acid protease can be expected to lead to a significant increase in ethanol productivity.

  1. Bacterial proteases and virulence.

    PubMed

    Frees, Dorte; Brøndsted, Lone; Ingmer, Hanne

    2013-01-01

    Bacterial pathogens rely on proteolysis for variety of purposes during the infection process. In the cytosol, the main proteolytic players are the conserved Clp and Lon proteases that directly contribute to virulence through the timely degradation of virulence regulators and indirectly by providing tolerance to adverse conditions such as those experienced in the host. In the membrane, HtrA performs similar functions whereas the extracellular proteases, in close contact with host components, pave the way for spreading infections by degrading host matrix components or interfering with host cell signalling to short-circuit host cell processes. Common to both intra- and extracellular proteases is the tight control of their proteolytic activities. In general, substrate recognition by the intracellular proteases is highly selective which is, in part, attributed to the chaperone activity associated with the proteases either encoded within the same polypeptide or on separate subunits. In contrast, substrate recognition by extracellular proteases is less selective and therefore these enzymes are generally expressed as zymogens to prevent premature proteolytic activity that would be detrimental to the cell. These extracellular proteases are activated in complex cascades involving auto-processing and proteolytic maturation. Thus, proteolysis has been adopted by bacterial pathogens at multiple levels to ensure the success of the pathogen in contact with the human host.

  2. Salt stress represses production of extracellular proteases in Bacillus pumilus.

    PubMed

    Liu, R F; Huang, C L; Feng, H

    2015-05-11

    Bacillus pumilus is able to secrete subtilisin-like prote-ases, one of which has been purified and characterized biochemically, demonstrating great potential for use in industrial applications. In the current study, the biosynthesis and transcription of extracellular pro-teases in B. pumilus (BA06) under salt stress were investigated using various methods, including a proteolytic assay, zymogram analysis, and real-time PCR. Our results showed that total extracellular proteolytic activity, both in fermentation broth and on milk-containing agar plates, was considerably repressed by salt in a dosage-dependent manner. As Bacillus species usually secret multiple extracellular proteases, a vari-ety of individual extracellular protease encoding genes were selected for real-time PCR analysis. It was shown that proteases encoded by the aprE and aprX genes were the major proteases in the fermentation broth in terms of their transcripts in B. pumilus. Further, transcription of aprE, aprX, and epr genes was indeed repressed by salt stress. In con-trast, transcription of other genes (e.g., vpr and wprA) was not repressed or significantly affected by the salt. Conclusively, salt stress represses total extracellular proteolytic activity in B. pumilus, which can largely be ascribed to suppression of the major protease-encoding genes (aprE, aprX) at the transcriptional level. In contrast, transcription of other pro-tease-encoding genes (e.g., vpr, wprA) was not repressed by salt stress.

  3. Cathepsin F Cysteine Protease of the Human Liver Fluke, Opisthorchis viverrini

    PubMed Central

    Laha, Thewarach; Sripa, Banchob; Kaewkes, Sasithorn; Morales, Maria E.; Mann, Victoria H.; Parriott, Sandi K.; Suttiprapa, Sutas; Robinson, Mark W.; To, Joyce; Dalton, John P.; Loukas, Alex; Brindley, Paul J.

    2009-01-01

    Background The liver fluke Opisthorchis viverrini is classified as a class I carcinogen due to the association between cholangiocarcinoma and chronic O. viverrini infection. During its feeding activity within the bile duct, the parasite secretes several cathepsin F cysteine proteases that may induce or contribute to the pathologies associated with hepatobiliary abnormalities. Methodology/Principal Findings Here, we describe the cDNA, gene organization, phylogenetic relationships, immunolocalization, and functional characterization of the cathepsin F cysteine protease gene, here termed Ov-cf-1, from O. viverrini. The full length mRNA of 1020 nucleotides (nt) encoded a 326 amino acid zymogen consisting of a predicted signal peptide (18 amino acids, aa), prosegment (95 aa), and mature protease (213 aa). BLAST analysis using the Ov-CF-1 protein as the query revealed that the protease shared identity with cathepsin F-like cysteine proteases of other trematodes, including Clonorchis sinensis (81%), Paragonimus westermani (58%), Schistosoma mansoni and S. japonicum (52%), and with vertebrate cathepsin F (51%). Transcripts encoding the protease were detected in all developmental stages that parasitize the mammalian host. The Ov-cf-1 gene, of ∼3 kb in length, included seven exons interrupted by six introns; the exons ranged from 69 to 267 bp in length, the introns from 43 to 1,060 bp. The six intron/exon boundaries of Ov-cf-1 were conserved with intron/exon boundaries in the human cathepsin F gene, although the gene structure of human cathepsin F is more complex. Unlike Ov-CF-1, human cathepsin F zymogen includes a cystatin domain in the prosegment region. Phylogenetic analysis revealed that the fluke, human, and other cathepsin Fs branched together in a clade discrete from the cathepsin L cysteine proteases. A recombinant Ov-CF-1 zymogen that displayed low-level activity was expressed in the yeast Pichia pastoris. Although the recombinant protease did not

  4. Protease increases fermentation rate and ethanol yield in dry-grind ethanol production.

    PubMed

    Johnston, David B; McAloon, Andrew J

    2014-02-01

    The effects of acid protease and urea addition during the fermentation step were evaluated. The fermentations were also tested with and without the addition of urea to determine if protease altered the nitrogen requirements of the yeast. Results show that the addition of the protease had a statistically significant effect on the fermentation rate and yield. Fermentation rates and yields were improved with the addition of the protease over the corresponding controls without protease. Protease addition either with or with added urea resulted in a higher final ethanol yield than without the protease addition. Urea addition levels >1200 ppm of supplemental nitrogen inhibited ethanol production. The economic effects of the protease addition were evaluated by using process engineering and economic models developed at the Eastern Regional Research Center. The decrease in overall processing costs from protease addition was as high as $0.01/L (4 ¢/gal) of denatured ethanol produced.

  5. Expression, purification and molecular modeling of the NIa protease of Cardamom mosaic virus.

    PubMed

    Jebasingh, T; Pandaranayaka, Eswari P J; Mahalakshmi, A; Kasin Yadunandam, A; Krishnaswamy, S; Usha, R

    2013-01-01

    The NIa protease of Potyviridae is the major viral protease that processes potyviral polyproteins. The NIa protease coding region of Cardamom mosaic virus (CdMV) is amplified from the viral cDNA, cloned and expressed in Escherichia coli. NIa protease forms inclusion bodies in E.coli. The inclusion bodies are solubilized with 8 M urea, refolded and purified by Nickel-Nitrilotriacetic acid affinity chromatography. Three-dimensional modeling of the CdMV NIa protease is achieved by threading approach using the homologous X-ray crystallographic structure of Tobacco etch mosaic virus NIa protease. The model gave an insight in to the substrate specificities of the NIa proteases and predicted the complementation of nearby residues in the catalytic triad (H42, D74 and C141) mutants in the cis protease activity of CdMV NIa protease.

  6. Serine protease activity in developmental stages of Eimeria tenella.

    PubMed

    Fetterer, R H; Miska, K B; Lillehoj, H; Barfield, R C

    2007-04-01

    A number of complex processes are involved in Eimeria spp. survival, including control of sporulation, intracellular invasion, evasion of host immune responses, successful reproduction, and nutrition. Proteases have been implicated in many of these processes, but the occurrence and functions of serine proteases have not been characterized. Bioinformatic analysis suggests that the Eimeria tenella genome contains several serine proteases that lack homology to trypsin. Using RT-PCR, a gene encoding a subtilisin-like and a rhomboid protease-like serine protease was shown to be developmentally regulated, both being poorly expressed in sporozoites (SZ) and merozoites (MZ). Casein substrate gel electrophoresis of oocyst extracts during sporulation demonstrated bands of proteolytic activity with relative molecular weights (Mr) of 18, 25, and 45 kDa that were eliminated by coincubation with serine protease inhibitors. A protease with Mr of 25 kDa was purified from extracts of unsporulated oocysts by a combination of affinity and anion exchange chromatography. Extracts of SZ contained only a single band of inhibitor-sensitive proteolytic activity at 25 kDa, while the pattern of proteases from extracts of MZ was similar to that of oocysts except for the occurrence of a 90 kDa protease, resistant to protease inhibitors. Excretory-secretory products (ESP) from MZ contained AEBSF (4-[2-Aminoethyl] benzenesulphonyl fluoride)-sensitive protease activity with a specific activity about 10 times greater than that observed in MZ extracts. No protease activity was observed in the ESP from SZ. Pretreatment of SZ with AEBSF significantly reduced SZ invasion and the release of the microneme protein, MIC2. The current results suggest that serine proteases are present in all the developmental stages examined.

  7. Nucleic acid modifications in regulation of gene expression

    PubMed Central

    Chen, Kai; Zhao, Boxuan Simen; He, Chuan

    2016-01-01

    Nucleic acids carry a wide range of different chemical modifications. In contrast to previous views that these modifications are static and only play fine-tuning functions, recent research advances paint a much more dynamic picture. Nucleic acids carry diverse modifications and employ these chemical marks to exert essential or critical influences in a variety of cellular processes in eukaryotic organisms. This review covers several nucleic acid modifications that play important regulatory roles in biological systems, especially in regulation of gene expression: 5-methylcytosine (5mC) and its oxidative derivatives, and N6 -methyladenine (6mA) in DNA; N6 -methyladenosine (m6A), pseudouridine (), and 5-methylcytosine (m5C) in messenger RNA and long non-coding RNA. Modifications in other non-coding RNAs, such as tRNA, miRNA, and snRNA, are also briefly summarized. We provide brief historical perspective of the field, and highlight recent progress in identifying diverse nucleic acid modifications and exploring their functions in different organisms. Overall, we believe that work in this field will yield additional layers of both chemical and biological complexity as we continue to uncover functional consequences of known nucleic acid modifications and discover new ones. PMID:26933737

  8. Synthetic Fatty Acids Prevent Plasmid-Mediated Horizontal Gene Transfer

    PubMed Central

    Getino, María; Sanabria-Ríos, David J.; Fernández-López, Raúl; Campos-Gómez, Javier; Sánchez-López, José M.; Fernández, Antonio; Carballeira, Néstor M.

    2015-01-01

    ABSTRACT Bacterial conjugation constitutes a major horizontal gene transfer mechanism for the dissemination of antibiotic resistance genes among human pathogens. Antibiotic resistance spread could be halted or diminished by molecules that interfere with the conjugation process. In this work, synthetic 2-alkynoic fatty acids were identified as a novel class of conjugation inhibitors. Their chemical properties were investigated by using the prototype 2-hexadecynoic acid and its derivatives. Essential features of effective inhibitors were the carboxylic group, an optimal long aliphatic chain of 16 carbon atoms, and one unsaturation. Chemical modification of these groups led to inactive or less-active derivatives. Conjugation inhibitors were found to act on the donor cell, affecting a wide number of pathogenic bacterial hosts, including Escherichia, Salmonella, Pseudomonas, and Acinetobacter spp. Conjugation inhibitors were active in inhibiting transfer of IncF, IncW, and IncH plasmids, moderately active against IncI, IncL/M, and IncX plasmids, and inactive against IncP and IncN plasmids. Importantly, the use of 2-hexadecynoic acid avoided the spread of a derepressed IncF plasmid into a recipient population, demonstrating the feasibility of abolishing the dissemination of antimicrobial resistances by blocking bacterial conjugation. PMID:26330514

  9. 2-D zymographic analysis of Broccoli (Brassica oleracea L. var. Italica) florets proteases: follow up of cysteine protease isotypes in the course of post-harvest senescence.

    PubMed

    Rossano, Rocco; Larocca, Marilena; Riccio, Paolo

    2011-09-01

    Zymographic analysis of Broccoli florets (Brassica oleracea L. var. Italica) revealed the presence of acidic metallo-proteases, serine proteases and cysteine proteases. Under conditions which were denaturing for the other proteases, the study was restricted to cysteine proteases. 2-D zymography, a technique that combines IEF and zymography was used to show the presence of 11 different cysteine protease spots with molecular mass of 44 and 47-48kDa and pIs ranging between 4.1 and 4.7. pI differences could be ascribed to different degrees of phosphorylation that partly disappeared in the presence of alkaline phosphatase. Post-harvest senescence of Broccoli florets was characterized by decrease in protein and chlorophyll contents and increase of protease activity. In particular, as determined by 2-D zymography, the presence of cysteine protease clearly increased during senescence, a finding that may represent a useful tool for the control of the aging process.

  10. Population structure of Banana bract mosaic virus reveals recombination and negative selection in the helper component protease (HC-Pro) gene.

    PubMed

    Balasubramanian, V; Sukanya, R S; Anuradha, C; Selvarajan, R

    2014-12-01

    Banana bract mosaic virus (BBrMV) is a serious constraint in the production of banana and plantain in India. In this study, we have cloned, sequenced and analyzed the helper component proteinase (HC-Pro) gene of 22 isolates from India and compared with previously reported BBrMV isolates. Sequence identity of BBrMV isolates encoding HC-Pro gene, were 92-100 % both at the nucleotide (nt) and amino acid level. Phylogenetic analysis based on nt sequences of non recombinant isolates showed that TN15, TN9 and TN24 formed one cluster and all the remaining isolates formed into another cluster. Different functional motifs in the central region of HC-Pro gene of BBrMV isolates were found conserved. Four potential recombinants with a total of 15 breakpoints were mostly observed at the N and a few from C terminal regions. The codon based selection analysis revealed that most of the codons were under purifying or negative selection except a codon at position 74 which was under positive selection. It is likely that recombination identified in Indian BBrMV isolates, along with strong purifying selection, enhances the speed of elimination of deleterious mutations in the HC-Pro gene. This study suggested that negative selection and recombination were important evolutionary factors driving the genetic diversification and population structure of Indian BBrMV isolates. To the best of our knowledge, this is the first report on the diversity analysis and occurrence of recombination in the HC-Pro gene of BBrMV.

  11. Cationic liposome–nucleic acid complexes for gene delivery and gene silencing

    PubMed Central

    Ewert, Kai K.; Majzoub, Ramsey N.; Leal, Cecília

    2014-01-01

    Cationic liposomes (CLs) are studied worldwide as carriers of DNA and short interfering RNA (siRNA) for gene delivery and gene silencing, and related clinical trials are ongoing. Optimization of transfection efficiency and silencing efficiency by cationic liposome carriers requires a comprehensive understanding of the structures of CL–nucleic acid complexes and the nature of their interactions with cell membranes as well as events leading to release of active nucleic acids within the cytoplasm. Synchrotron x-ray scattering has revealed that CL–nucleic acid complexes spontaneously assemble into distinct liquid crystalline phases including the lamellar, inverse hexagonal, hexagonal, and gyroid cubic phases, and fluorescence microscopy has revealed CL–DNA pathways and interactions with cells. The combining of custom synthesis with characterization techniques and gene expression and silencing assays has begun to unveil structure–function relations in vitro. As a recent example, this review will briefly describe experiments with surface-functionalized PEGylated CL–DNA nanoparticles. The functionalization, which is achieved through custom synthesis, is intended to address and overcome cell targeting and endosomal escape barriers to nucleic acid delivery faced by PEGylated nanoparticles designed for in vivo applications. PMID:25587216

  12. Higher transcription levels in ascorbic acid biosynthetic and recycling genes were associated with higher ascorbic acid accumulation in blueberry.

    PubMed

    Liu, Fenghong; Wang, Lei; Gu, Liang; Zhao, Wei; Su, Hongyan; Cheng, Xianhao

    2015-12-01

    In our preliminary study, the ripe fruits of two highbush blueberry (Vaccinium corymbosum L.) cultivars, cv 'Berkeley' and cv 'Bluecrop', were found to contain different levels of ascorbic acid. However, factors responsible for these differences are still unknown. In the present study, ascorbic acid content in fruits was compared with expression profiles of ascorbic acid biosynthetic and recycling genes between 'Bluecrop' and 'Berkeley' cultivars. The results indicated that the l-galactose pathway was the predominant route of ascorbic acid biosynthesis in blueberry fruits. Moreover, higher expression levels of the ascorbic acid biosynthetic genes GME, GGP, and GLDH, as well as the recycling genes MDHAR and DHAR, were associated with higher ascorbic acid content in 'Bluecrop' compared with 'Berkeley', which indicated that a higher efficiency ascorbic acid biosynthesis and regeneration was likely to be responsible for the higher ascorbic acid accumulation in 'Bluecrop'.

  13. A gene network engineering platform for lactic acid bacteria.

    PubMed

    Kong, Wentao; Kapuganti, Venkata S; Lu, Ting

    2016-02-29

    Recent developments in synthetic biology have positioned lactic acid bacteria (LAB) as a major class of cellular chassis for applications. To achieve the full potential of LAB, one fundamental prerequisite is the capacity for rapid engineering of complex gene networks, such as natural biosynthetic pathways and multicomponent synthetic circuits, into which cellular functions are encoded. Here, we present a synthetic biology platform for rapid construction and optimization of large-scale gene networks in LAB. The platform involves a copy-controlled shuttle for hosting target networks and two associated strategies that enable efficient genetic editing and phenotypic validation. By using a nisin biosynthesis pathway and its variants as examples, we demonstrated multiplex, continuous editing of small DNA parts, such as ribosome-binding sites, as well as efficient manipulation of large building blocks such as genes and operons. To showcase the platform, we applied it to expand the phenotypic diversity of the nisin pathway by quickly generating a library of 63 pathway variants. We further demonstrated its utility by altering the regulatory topology of the nisin pathway for constitutive bacteriocin biosynthesis. This work demonstrates the feasibility of rapid and advanced engineering of gene networks in LAB, fostering their applications in biomedicine and other areas.

  14. Fungal fermentation of whey incorporated with certain supplements for the production of proteases.

    PubMed

    Ashour, S A; el-Shora, H M; Metwally, M; Habib, S A

    1996-01-01

    The pattern and the extent of formation of proteases and secretion varied with the fungus, age and/or the nature of the co-supplement. Addition of yeast extract induced the best yield of proteases from both Aspergillus niger and A. terreus. Proteases from A. niger were highly induced by glutamic acid, alanine or albumin, with minor differences, whereas gelatin, peptone, aspartic acid, casein or acetamide stimulated the accumulation of proteases in the culture medium of A. terreus. Galactose stimulated the yield of the enzyme particularly with A. terreus while most C-supplements inhibited such processes, more prominently in the presence of cellulose or starch. Incorporation of nicotinic acid and wheat bran initiated the maximum productivity of proteases from A. niger and A. terreus, respectively. Co+2 and Cu+2 highly stimulated the output of proteases from A. niger and A. terreus, respectively. Co+2 and Ca+2 stimulated the enzyme activity of alkaline and acid proteases from A. terreus and acid proteases from A. niger. The other six cations and DTT inhibited variably the three proteases particularly alkaline proteases from A. terreus indicating that proteases from various sources even from closely related species showed different properties.

  15. Emergence of protease inhibitor resistance mutations in human immunodeficiency virus type 1 isolates from patients and rapid screening procedure for their detection.

    PubMed Central

    Vasudevachari, M B; Zhang, Y M; Imamichi, H; Imamichi, T; Falloon, J; Salzman, N P

    1996-01-01

    Patient human immunodeficiency virus type 1 (HIV-1) isolates that are resistant to protease inhibitors may contain amino acid substitutions L10I/V, M46L/I, G-48V, L63P, V82A/F/T, I84V, and L90M in the protease gene. Substitutions at positions 82 and/or 90 occur in variants that display high levels of resistance to certain protease inhibitors. Nucleotide substitutions at these two sites also lead to the loss of two HindII restriction enzyme digestion sites, and these changes make possible a rapid procedure for the detection of drug-resistant variants in patients on protease inhibitor therapy. This procedure was used to detect the emergence of mutated viruses at various times after the initiation of therapy with the HIV-1 protease inhibitor indinavir. The method includes viral RNA isolation from plasma and reverse transcription PCR amplification of the protease gene with fluorescence-tagged primers. The PCR product is digested with HindII, the cleavage products are separated on a urea-acrylamide gel in a DNA sequencer, and the extent of cleavage is automatically analyzed with commercially available software. In viruses from 34 blood samples from four patients, mutations leading to an amino acid change at residue 82 appeared as early as 6 weeks after the start of therapy and persisted throughout the course of the study period (48 weeks). Mutations leading to double substitutions at residues 82 and 90 were seen at a lower frequency and appeared later than the change at position 82. The changes detected by restriction enzyme cleavage were confirmed by DNA sequencing of the cloned protease genes by reverse transcription PCR amplification of viral RNA from isolates in plasma. In addition to the changes at positions 82 and 90, we have identified M46L/I, G48V, and I54V substitutions in isolates derived from indinavir-treated patients. HindII analysis of uncloned, PCR-amplified DNA offers a rapid screening procedure for the detection of virus isolates containing mutations at

  16. The entomopathogenic fungus Metarhizium anisopliae alters ambient pH, allowing extracellular protease production and activity.

    PubMed

    St Leger, R J; Nelson, J O; Screen, S E

    1999-10-01

    Ambient pH regulates the expression of virulence genes of Metarhizium anisopliae, but it was unknown if M. anisopliae can regulate ambient pH. Mutants of M. anisopliae altered in production of oxalic acid were evaluated for the interrelationship of ambient pH, buffering capacity added to media, growth, and generation of extracellular proteases and ammonia. Wild-type and acid-overproducing mutants [Acid(+)] grew almost as well at pH 8 as at pH 6, but acid-non-producing [Acid(-)] mutants showed limited growth at pH 8, indicating that acid production is linked to the ability to grow at higher pH. Production of ammonia by M. anisopliae was strongly stimulated by low levels of amino acids in the medium when cells were derepressed for nitrogen and carbon. Likewise, although Aspergillus fumigatus and Neurospora crassa produced some ammonia in minimal media, addition of low levels of amino acids enhanced production. Ammonia production by A. fumigatus, N. crassa and M. anisopliae increased the pH of the medium and allowed production of subtilisin proteases, whose activities are observed only at basic pH. In contrast, protease production by the Acid(+) mutants of M. anisopliae was greatly reduced because of the acidification of the medium. This suggests that alkalinization by ammonia production is adaptive by facilitating the utilization of proteinaceous nutrients. Collectively, the data imply that ammonia may have functions related to regulation of the microenvironment and that it represents a previously unconsidered virulence factor in diverse fungi with the potential to harm tissues and disturb the host's immune system.

  17. Clustered Genes Involved in Cyclopiazonic Acid Production are Next to the Aflatoxin Biosynthesis Gene Cluster in Aspergillus flavus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cyclopiazonic acid (CPA), an indole-tetramic acid toxin, is produced by many species of Aspergillus and Penicillium. In addition to CPA Aspergillus flavus produces polyketide-derived carcinogenic aflatoxins (AFs). AF biosynthesis genes form a gene cluster in a subtelomeric region. Isolates of A. fla...

  18. Amino acid regulation of mammalian gene expression in the intestine.

    PubMed

    Brasse-Lagnel, Carole G; Lavoinne, Alain M; Husson, Annie S

    2010-07-01

    Some amino acids exert a wide range of regulatory effects on gene expression via the activation of different signalling pathways and transcription factors, and a number of cis elements were shown to respond to changes in amino acid concentration. Particular attention has been paid to the effects of glutamine and arginine, which modulate a number of cell functions through the activation of various pathways in different tissues. In the intestine, appropriate concentrations of both arginine and/or glutamine contribute to facilitate cell proliferation, to limit the inflammatory response and apoptosis, and to modulate intermediary metabolism through specific transcription factors. Particularly, besides its role as a major fuel for enterocytes, the regulatory effects of glutamine have been extensively studied and the molecular mechanisms involved appear diversified and complex. Indeed, in addition to a major role of NF-kappaB in its anti-inflammatory action and a stimulatory role of AP-1 in its growth-promoting action and cell survival, the involvement of some other transcription factors, such as PPAR-gamma or HSF-1, was shown to maintain intestinal cell integrity. The signalling pathways leading to the activation of transcription factors imply several kinases, particularly MAP kinases in the effect of glutamine and p70 S6 kinase for those of arginine, but in most cases the precise pathways from the entrance of the aminoacid into the cell to the activation of gene transcription has remained elusive.

  19. Insect response to plant defensive protease inhibitors.

    PubMed

    Zhu-Salzman, Keyan; Zeng, Rensen

    2015-01-07

    Plant protease inhibitors (PIs) are natural plant defense proteins that inhibit proteases of invading insect herbivores. However, their anti-insect efficacy is determined not only by their potency toward a vulnerable insect system but also by the response of the insect to such a challenge. Through the long history of coevolution with their host plants, insects have developed sophisticated mechanisms to circumvent antinutritional effects of dietary challenges. Their response takes the form of changes in gene expression and the protein repertoire in cells lining the alimentary tract, the first line of defense. Research in insect digestive proteases has revealed the crucial roles they play in insect adaptation to plant PIs and has brought about a new appreciation of how phytophagous insects employ this group of molecules in both protein digestion and counterdefense. This review provides researchers in related fields an up-to-date summary of recent advances.

  20. Identification of proteolytic bacteria from the Arctic Chukchi Sea expedition cruise and characterization of cold-active proteases.

    PubMed

    Park, Ha Ju; Lee, Yung Mi; Kim, Sunghui; Wi, Ah Ram; Han, Se Jong; Kim, Han-Woo; Kim, Il-Chan; Yim, Joung Han; Kim, Dockyu

    2014-10-01

    Following collection of seawater samples during an Arctic Chukchi Sea expedition cruise of the Korean icebreaker Araon in 2012, a total of 15,696 bacteria were randomly isolated from Marine Broth 2216 agar plates. Of these, 2,526 (16%) showed proteolytic activity and were identified as mainly Alteromonas (31%), Staphylococcus (27%), and Pseudoalteromonas (14%). Among the proteolytic strains, seven were selected based on their significant ability to grow and produce a halo on skim milk plates at low temperatures (<5°C) owing to cold-active proteases. These strains were affiliated with the genus Pseudoalteromonas and were divided into three groups based on phylogenetic analysis of the 16S rRNA genes. Profiling cell membrane fatty acids confirmed the 16S rRNA-based differentiation and revealed the accordance between the two analyses. Seven genes for serine protease precursors were amplified from the corresponding strains, and based on sequence similarities, these genes were divided into three groups that were identical to those identified by the 16S rRNA phylogenetic analysis. Three protease genes from the representative strains of each group were composed of 2,127-2,130 bp, encoding 708-709 amino acids, and these genes yielded products with calculated molecular weights of approximately 72.3-72.8 kDa. Amino acid sequence analysis suggested that the precursors are members of the subtilase serine endo- and exo-peptidase clan and contain four domains (signal peptide, N-terminal prosequence, catalytic domain, and two pre-peptidase C-terminal domains). Upon expression in E. coli, each recombinant protease exhibited proteolytic activity on zymogram gels.

  1. Biochemical and molecular characterization of a detergent-stable serine alkaline protease from Bacillus pumilus CBS with high catalytic efficiency.

    PubMed

    Jaouadi, Bassem; Ellouz-Chaabouni, Semia; Rhimi, Moez; Bejar, Samir

    2008-09-01

    We have described previously the potential use of an alkaline protease from Bacillus pumilus CBS as an effective additive in laundry detergent formulations [B. Jaouadi, S. Ellouz-Chaabouni, M. Ben Ali, E. Ben Messaoud, B. Naili, A. Dhouib, S. Bejar, A novel alkaline protease from Bacillus pumilus CBS having a high compatibility with laundry detergent and a high feather-degrading activity, Process Biochem, submitted for publication]. Here, we purified this enzyme (named SAPB) and we cloned, sequenced and over-expressed the corresponding gene. The enzyme was purified to homogeneity using salt precipitation and gel filtration HPLC. The pure protease was found to be monomeric protein with a molecular mass of 34598.19Da as determined by MALDI-TOF mass spectrometry. The NH2-terminal sequence of first 21 amino acids (aa) of the purified SAPB was AQTVPYGIPQIKAPAVHAQGY and was completely identical to proteases from other Bacillus pumilus species. This protease is strongly inhibited by PMSF and DFP, showing that it belongs to the serine proteases superfamily. Interestingly, the optimum pH is 10.6 while the optimum temperature was determined to be 65 degrees C. The enzyme was completely stable within a wide range of pH (7.0-10.6) and temperature (30-55 degrees C). One of the distinguishing properties is its catalytic efficiency (kcat/Km) calculated to be 45,265min(-1)mM(-1) and 147,000min(-1)mM(-1) using casein and AAPF as substrates, respectively, which is higher than that of Subtilisin Carlsberg, Subtilisin BPN' and Subtilisin 309 determined under the same conditions. In addition, SAPB showed remarkable stability, for 24h at 40 degrees C, in the presence of 5% Tween-80, 1% SDS, 15% urea and 10% H2O2, which comprise the common bleach-based detergent formulation. The sapB gene encoding SAPB was cloned, sequenced and over-expressed in Escherichia coli. The purified recombinant enzyme (rSAPB) has the same physicochemical and kinetic properties as the native one. SapB gene had

  2. Activity, specificity, and probe design for the smallpox virus protease K7L.

    PubMed

    Aleshin, Alexander E; Drag, Marcin; Gombosuren, Naran; Wei, Ge; Mikolajczyk, Jowita; Satterthwait, Arnold C; Strongin, Alex Y; Liddington, Robert C; Salvesen, Guy S

    2012-11-16

    The K7L gene product of the smallpox virus is a protease implicated in the maturation of viral proteins. K7L belongs to protease Clan CE, which includes distantly related cysteine proteases from eukaryotes, pathogenic bacteria, and viruses. Here, we describe its recombinant high level expression, biochemical mechanism, substrate preference, and regulation. Earlier studies inferred that the orthologous I7L vaccinia protease cleaves at an AG-X motif in six viral proteins. Our data for K7L suggest that the AG-X motif is necessary but not sufficient for optimal cleavage activity. Thus, K7L requires peptides extended into the P7 and P8 positions for efficient substrate cleavage. Catalytic activity of K7L is substantially enhanced by homodimerization, by the substrate protein P25K as well as by glycerol. RNA and DNA also enhance cleavage of the P25K protein but not of synthetic peptides, suggesting that nucleic acids augment the interaction of K7L with its protein substrate. Library-based peptide preference analyses enabled us to design an activity-based probe that covalently and selectively labels K7L in lysates of transfected and infected cells. Our study thus provides proof-of-concept for the design of inhibitors and probes that may contribute both to a better understanding of the role of K7L in the virus life cycle and the design of novel anti-virals.

  3. A Circadian Rhythm-Regulated Tomato Gene Is Induced by Arachidonic Acid and Phythophthora infestans Infection1[W

    PubMed Central

    Weyman, Philip D.; Pan, Zhiqiang; Feng, Qin; Gilchrist, David G.; Bostock, Richard M.

    2006-01-01

    A cDNA clone of unknown function, DEA1, was isolated from arachidonic acid-treated tomato (Solanum lycopersicum) leaves by differential display PCR. The gene, DEA1, is expressed in response to the programmed cell death-inducing arachidonic acid within 8 h following treatment of a tomato leaflet, 16 h prior to the development of visible cell death. DEA1 transcript levels were also affected by the late blight pathogen, Phytophthora infestans. To gain further insight into the transcriptional regulation of DEA1, the promoter region was cloned by inverse PCR and was found to contain putative stress-, signaling-, and circadian-response elements. DEA1 is highly expressed in roots, stems, and leaves, but not in flowers. Leaf expression of DEA1 is regulated by circadian rhythms during long days with the peak occurring at midday and the low point midway through the dark period. During short days, the rhythm is lost and DEA1 expression becomes constitutive. The predicted DEA1 protein has a conserved domain shared by the eight-cysteine motif superfamily of protease inhibitors, α-amylase inhibitors, seed storage proteins, and lipid transfer proteins. A DEA1-green fluorescent protein fusion protein localized to the plasma membrane in protoplasts and plasmolysis experiments, suggesting that the native protein is associated with the plasmalemma in intact cells. PMID:16361525

  4. A secretory protease inhibitor requires androgens for its expression in male sex accessory tissues but is expressed constitutively in pancreas.

    PubMed Central

    Mills, J S; Needham, M; Parker, M G

    1987-01-01

    A full length cDNA clone encoding a mouse prostatic secretory glycoprotein (p12) whose synthesis is dependent upon testicular androgens has been cloned and characterized. The predicted amino acid sequence of p12 shares extensive homology with several members of the Kazal family of secretory protease inhibitors, in particular the pancreatic secretory trypsin inhibitors. In agreement with sequence data, prostatic secretory p12, purified from mouse ventral prostate secretion, exhibits anti-trypsin activity. Steady-state levels of protease inhibitor mRNA in ventral prostate are reduced from approximately 0.06% in normal mice to undetectable after androgen withdrawal but are inducible within 4 h by re-administration of testosterone. Androgen-dependent expression of the secretory protease inhibitor mRNA was also observed in coagulating gland and seminal vesicle. In seminal vesicle, a tissue of different embryonic origin to the prostate, the kinetics of secretory protease inhibitor mRNA loss after castration are not as rapid as in the ventral prostate and coagulating gland. Low-level androgen independent expression was also observed in the pancreas. There appears to be a single gene for this secretory protease inhibitor and yet expression is markedly stimulated by testosterone in the sex accessory tissues and unaffected by this hormone in the pancreas. Images Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. PMID:3428272

  5. [Gene cloning and bioinformatics analysis of new gene for chlorogenic acid biosynthesis of Lonicera hypoglauca].

    PubMed

    Yu, Shu-lin; Huang, Lu-qi; Yuan, Yuan; Qi, Lin-jie; Liu, Da-hui

    2015-03-01

    To obtain the key genes for chlorogenic acid biosynthesis of Lonicera hypoglauca, four new genes ware obtained from the our dataset of L. hypoglauca. And we also predicted the structure and function of LHPAL4, LHHCT1 , LHHCT2 and LHHCT3 proteins. The phylogenetic tree showed that LHPAL4 was closely related with LHPAL1, LHHCT1 was closely related with LHHCT3, LHHCT2 clustered into a single group. By Real-time PCR to detect the gene expressed level in different organs of L. hypoglauca, we found that the transcripted level of LHPAL4, LHHCT1 and LHHCT3 was the highest in defeat flowers, and the transcripted level of LHHCT2 was the highest in leaves. These result provided a basis to further analysis the mechanism of active ingredients in different organs, as well as the element for in vitro biosynthesis of active ingredients.

  6. Characterization of Bactrocera dorsalis Serine Proteases and Evidence for Their Indirect Role in Insecticide Tolerance

    PubMed Central

    Hou, Ming-Zhe; Shen, Guang-Mao; Wei, Dong; Li, Ya-Li; Dou, Wei; Wang, Jin-Jun

    2014-01-01

    The oriental fruit fly Bactrocera dorsalis (Hendel) causes devastating losses to agricultural crops world-wide and is considered to be an economically important pest. Little is known about the digestive enzymes such as serine proteases (SPs) in B. dorsalis, which are important both for energy supply and mitigation of fitness cost associated with insecticide tolerance. In this study, we identified five SP genes in the midgut of B. dorsalis, and the alignments of their deduced amino acid sequences revealed the presence of motifs conserved in the SP superfamily. Phylogenetic analyses with known SPs from other insect species suggested that three of them were trypsin-like proteases. Analyses of the expression profiles among the different developmental stages showed that all five genes were most abundant in larvae than in other stages. When larvae were continuously fed on diet containing 0.33 μg/g β-Cypermethrin, expression of all five genes were upregulated in the midgut but the larval development was delayed. Biochemical assays were consistent with the increased protease activity exhibited by SPs in the midgut after treatment with β-Cypermethrin. Taken together, these findings provide evidence for the hypothesis that enhanced SP activity may play an indirect role in relieving the toxicity stress of insecticide in B. dorsalis. PMID:24566149

  7. Diversity of 1,213 hepatitis C virus NS3 protease sequences from a clinical virology laboratory database in Marseille university hospitals, southeastern France.

    PubMed

    Hajji, Hind; Aherfi, Sarah; Motte, Anne; Ravaux, Isabelle; Mokhtari, Saadia; Ruiz, Jean-Marie; Poizot-Martin, Isabelle; Tourres, Christian; Tivoli, Natacha; Gérolami, René; Tamalet, Catherine; Colson, Philippe

    2015-11-01

    Infection with hepatitis C virus (HCV) represents a major public health concern worldwide. Recent therapeutic advances have been considerable, HCV genotype continuing to guide therapeutic management. Since 2008, HCV genotyping in our clinical microbiology laboratory at university hospitals of Marseille, Southeastern France, has been based on NS3 protease gene population sequencing, to allow concurrent HCV genotype and protease inhibitor (PI) genotypic resistance determinations. We aimed, first, to analyze the genetic diversity of HCV NS3 protease obtained from blood samples collected between 2003 and 2013 from patients monitored at university hospitals of Marseille and detect possible atypical sequences; and, second, to identify NS3 protease amino acid patterns associated with decreased susceptibility to HCV PIs. A total of 1,213 HCV NS3 protease sequences were available in our laboratory sequence database. We implemented a strategy based on bioinformatic tools to determine whether HCV sequences are representative of our local HCV genetic diversity, or divergent. In our 2003-2012 HCV NS3 protease sequence database, we delineated 32 clusters representative of the majority HCV genetic diversity, and 61 divergent sequences. Five of these divergent sequences showed less than 85% nucleotide identity with their top GenBank hit. In addition, among the 294 sequences obtained in 2013, three were divergent relative to these 32 previously delineated clusters. Finally, we detected both natural and on-treatment genotypic resistance to HCV NS3 PIs, including a substantial prevalence of Q80K substitutions associated with decreased susceptibility to simeprevir, a second generation PI.

  8. The site-2 protease.

    PubMed

    Rawson, Robert B

    2013-12-01

    The site-2 protease (S2P) is an unusually-hydrophobic integral membrane protease. It cleaves its substrates, which are membrane-bound transcription factors, within membrane-spanning helices. Although structural information for S2P from animals is lacking, the available data suggest that cleavage may occur at or within the lipid bilayer. In mammalian cells, S2P is essential owing to its activation of the sterol regulatory element binding proteins (SREBPs); in the absence of exogenous lipid, cells lacking S2P cannot survive. S2P is also important in the endoplasmic reticulum (ER) stress response, activating several different membrane-bound transcription factors. Human patients harboring reduction-of-function mutations in S2P exhibit an array of pathologies ranging from skin defects to neurological abnormalities. Surprisingly, Drosophila melanogaster lacking S2P are viable and fertile. This article is part of a Special Issue entitled: Intramembrane Proteases.

  9. Oxalic acid production by citric acid-producing Aspergillus niger overexpressing the oxaloacetate hydrolase gene oahA.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Honda, Yuki; Kirimura, Kohtaro

    2014-05-01

    The filamentous fungus Aspergillus niger is used worldwide in the industrial production of citric acid. However, under specific cultivation conditions, citric acid-producing strains of A. niger accumulate oxalic acid as a by-product. Oxalic acid is used as a chelator, detergent, or tanning agent. Here, we sought to develop oxalic acid hyperproducers using A. niger as a host. To generate oxalic acid hyperproducers by metabolic engineering, transformants overexpressing the oahA gene, encoding oxaloacetate hydrolase (OAH; EC 3.7.1.1), were constructed in citric acid-producing A. niger WU-2223L as a host. The oxalic acid production capacity of this strain was examined by cultivation of EOAH-1 under conditions appropriate for oxalic acid production with 30 g/l glucose as a carbon source. Under all the cultivation conditions tested, the amount of oxalic acid produced by EOAH-1, a representative oahA-overexpressing transformant, exceeded that produced by A. niger WU-2223L. A. niger WU-2223L and EOAH-1 produced 15.6 and 28.9 g/l oxalic acid, respectively, during the 12-day cultivation period. The yield of oxalic acid for EOAH-1 was 64.2 % of the maximum theoretical yield. Our method for oxalic acid production gave the highest yield of any study reported to date. Therefore, we succeeded in generating oxalic acid hyperproducers by overexpressing a single gene, i.e., oahA, in citric acid-producing A. niger as a host.

  10. Molecular cloning and functional characterization of an aspartic protease from the hard tick Haemaphysalis longicornis.

    PubMed

    Boldbaatar, Damdinsuren; Sikalizyo Sikasunge, Chummy; Battsetseg, Badgar; Xuan, Xuenan; Fujisaki, Kozo

    2006-01-01

    Haemaphysalis longicornis cDNA encoding an aspartic protease (longepsin) was identified from a midgut cDNA library. The longepsin cDNA contains 1176bp that code for 392 amino acid residues with a predictable molecular weight of 39.3kDa. The cDNA has a signal peptide sequence associated with the N-terminal domains and domain structure analysis revealed that the deduced protein has two aspartic acid residues that are characteristic of a single active site for aspartic proteases. This novel longepsin cDNA exhibits 57% identity to the lysosomal aspartic protease of Aedes aegypti, 52% to Bombyx mori cathepsin D, 38% to Ancylostoma caninum, 44% to Schistosoma mansoni and 28% to Boophilus microplus aspartic proteases. The DNA fragment coding for longepsin was cloned into a pGEX-4T-3 vector and expressed in Escherichia coli. The recombinant longepsin, once activated was able to hydrolyze casein substrate as well as hemoglobin (Hb) under acidic conditions (pH 3.5). RT-PCR analysis showed that the longepsin mRNA transcripts were expressed in salivary glands and midgut and not in the ovary. Northern blot analysis revealed that longepsin (1.5kb) was expressed in unfed and partially fed ticks and expression levels increased during feeding. The finding that longepsin is expressed in the midgut and salivary glands, proteolytic activity occurs under acidic conditions and longepsin can be gene silenced of longepsin provides compelling support for the hypothesis that longepsin plays an integral role in the proteolysis of erythrocyte Hb obtained from a host blood meal.

  11. A Genomic Analysis of Rat Proteases and Protease Inhibitors

    PubMed Central

    Puente, Xose S.; López-Otín, Carlos

    2004-01-01

    Proteases perform important roles in multiple biological and pathological processes. The availability of the rat genome sequence has facilitated the analysis of the complete protease repertoire or degradome of this model organism. The rat degradome consists of at least 626 proteases and homologs, which are distributed into 24 aspartic, 160 cysteine, 192 metallo, 221 serine, and 29 threonine proteases. This distribution is similar to that of the mouse degradome but is more complex than that of the human degradome composed of 561 proteases and homologs. This increased complexity of rat proteases mainly derives from the expansion of several families, including placental cathepsins, testases, kallikreins, and hematopoietic serine proteases, involved in reproductive or immunological functions. These protease families have also evolved differently in rat and mouse and may contribute to explain some functional differences between these closely related species. Likewise, genomic analysis of rat protease inhibitors has shown some differences with mouse protease inhibitors and the expansion of families of cysteine and serine protease inhibitors in rodents with respect to human. These comparative analyses may provide new views on the functional diversity of proteases and inhibitors and contribute to the development of innovative strategies for treating proteolysis diseases. PMID:15060002

  12. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  13. Discovery of novel histidine-derived lipo-amino acids: applied in the synthesis of ultra-short antimicrobial peptidomimetics having potent antimicrobial activity, salt resistance and protease stability.

    PubMed

    Ahn, Mija; Murugan, Ravichandran N; Jacob, Binu; Hyun, Jae-Kyung; Cheong, Chaejoon; Hwang, Eunha; Park, Hyo-Nam; Seo, Ji-Hyung; Srinivasrao, G; Lee, Kyung S; Shin, Song Yub; Bang, Jeong Kyu

    2013-10-01

    Here we report for the first time the synthesis of Histidine (His) derived lipo-amino acids having pendant lipid tails at N(τ)- and N(π)-positions on imidazole group of His and applied it into synthesis of lipo-peptides. The attachment of His-derived lipo-amino acid into the very short inactive cationic peptides endows potent antimicrobial activity against Gram-positive and Gram-negative bacteria without hemolytic activity. Furthermore, our designed His-derived lipo-peptidomimetics (HDLPs) consisting of two or three residues displayed strong anti-MRSA activity and protease stability as well as retained potent antimicrobial activity under high salt concentration. Our results demonstrate that the novel lipo-amino acid is highly flexible to synthesize and carry out the extensive structure-activity relationship (SAR) on lipo-antimicrobial peptidomimetics and represents a unique amenable platform for modifying parameters important for antimicrobial activity. Through this study, we proved that the discovery of His-derived lipo-amino acid and the corresponding HDLPs are an excellent candidate as a lead compound for the development of novel antimicrobial agents.

  14. Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Salicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in s...

  15. Fatty acid transport and activation and the expression patterns of genes involved in fatty acid trafficking.

    PubMed

    Sandoval, Angel; Fraisl, Peter; Arias-Barrau, Elsa; Dirusso, Concetta C; Singer, Diane; Sealls, Whitney; Black, Paul N

    2008-09-15

    These studies defined the expression patterns of genes involved in fatty acid transport, activation and trafficking using quantitative PCR (qPCR) and established the kinetic constants of fatty acid transport in an effort to define whether vectorial acylation represents a common mechanism in different cell types (3T3-L1 fibroblasts and adipocytes, Caco-2 and HepG2 cells and three endothelial cell lines (b-END3, HAEC, and HMEC)). As expected, fatty acid transport protein (FATP)1 and long-chain acyl CoA synthetase (Acsl)1 were the predominant isoforms expressed in adipocytes consistent with their roles in the transport and activation of exogenous fatty acids destined for storage in the form of triglycerides. In cells involved in fatty acid processing including Caco-2 (intestinal-like) and HepG2 (liver-like), FATP2 was the predominant isoform. The patterns of Acsl expression were distinct between these two cell types with Acsl3 and Acsl5 being predominant in Caco-2 cells and Acsl4 in HepG2 cells. In the endothelial lines, FATP1 and FATP4 were the most highly expressed isoforms; the expression patterns for the different Acsl isoforms were highly variable between the different endothelial cell lines. The transport of the fluorescent long-chain fatty acid C(1)-BODIPY-C(12) in 3T3-L1 fibroblasts and 3T3-L1 adipocytes followed typical Michaelis-Menten kinetics; the apparent efficiency (k(cat)/K(T)) of this process increases over 2-fold (2.1 x 10(6)-4.5 x 10(6)s(-1)M(-1)) upon adipocyte differentiation. The V(max) values for fatty acid transport in Caco-2 and HepG2 cells were essentially the same, yet the efficiency was 55% higher in Caco-2 cells (2.3 x 10(6)s(-1)M(-1) versus 1.5 x 10(6)s(-1)M(-1)). The kinetic parameters for fatty acid transport in three endothelial cell types demonstrated they were the least efficient cell types for this process giving V(max) values that were nearly 4-fold lower than those defined form 3T3-L1 adipocytes, Caco-2 cells and HepG2 cells. The

  16. Proteases in bacterial pathogenesis.

    PubMed

    Ingmer, Hanne; Brøndsted, Lone

    2009-11-01

    Bacterial pathogens rely on proteolysis for protein quality control under adverse conditions experienced in the host, as well as for the timely degradation of central virulence regulators. We have focused on the contribution of the conserved Lon, Clp, HtrA and FtsH proteases to pathogenesis and have highlighted common biological processes for which their activities are important for virulence.

  17. Structural gene and complete amino acid sequence of Vibrio alginolyticus collagenase.

    PubMed Central

    Takeuchi, H; Shibano, Y; Morihara, K; Fukushima, J; Inami, S; Keil, B; Gilles, A M; Kawamoto, S; Okuda, K

    1992-01-01

    The DNA encoding the collagenase of Vibrio alginolyticus was cloned, and its complete nucleotide sequence was determined. When the cloned gene was ligated to pUC18, the Escherichia coli expression vector, bacteria carrying the gene exhibited both collagenase antigen and collagenase activity. The open reading frame from the ATG initiation codon was 2442 bp in length for the collagenase structural gene. The amino acid sequence, deduced from the nucleotide sequence, revealed that the mature collagenase consists of 739 amino acids with an Mr of 81875. The amino acid sequences of 20 polypeptide fragments were completely identical with the deduced amino acid sequences of the collagenase gene. The amino acid composition predicted from the DNA sequence was similar to the chemically determined composition of purified collagenase reported previously. The analyses of both the DNA and amino acid sequences of the collagenase gene were rigorously performed, but we could not detect any significant sequence similarity to other collagenases. Images Fig. 2. PMID:1311172

  18. The PH gene determines fruit acidity and contributes to the evolution of sweet melons.

    PubMed

    Cohen, Shahar; Itkin, Maxim; Yeselson, Yelena; Tzuri, Galil; Portnoy, Vitaly; Harel-Baja, Rotem; Lev, Shery; Sa'ar, Uzi; Davidovitz-Rikanati, Rachel; Baranes, Nadine; Bar, Einat; Wolf, Dalia; Petreikov, Marina; Shen, Shmuel; Ben-Dor, Shifra; Rogachev, Ilana; Aharoni, Asaph; Ast, Tslil; Schuldiner, Maya; Belausov, Eduard; Eshed, Ravit; Ophir, Ron; Sherman, Amir; Frei, Benedikt; Neuhaus, H Ekkehard; Xu, Yimin; Fei, Zhangjun; Giovannoni, Jim; Lewinsohn, Efraim; Tadmor, Yaakov; Paris, Harry S; Katzir, Nurit; Burger, Yosef; Schaffer, Arthur A

    2014-06-05

    Taste has been the subject of human selection in the evolution of agricultural crops, and acidity is one of the three major components of fleshy fruit taste, together with sugars and volatile flavour compounds. We identify a family of plant-specific genes with a major effect on fruit acidity by map-based cloning of C. melo PH gene (CmPH) from melon, Cucumis melo taking advantage of the novel natural genetic variation for both high and low fruit acidity in this species. Functional silencing of orthologous PH genes in two distantly related plant families, cucumber and tomato, produced low-acid, bland tasting fruit, showing that PH genes control fruit acidity across plant families. A four amino-acid duplication in CmPH distinguishes between primitive acidic varieties and modern dessert melons. This fortuitous mutation served as a preadaptive antecedent to the development of sweet melon cultigens in Central Asia over 1,000 years ago.

  19. Tolerance to acetic acid is improved by mutations of the TATA-binding protein gene.

    PubMed

    An, Jieun; Kwon, Hyeji; Kim, Eunjung; Lee, Young Mi; Ko, Hyeok Jin; Park, Hongjae; Choi, In-Geol; Kim, Sooah; Kim, Kyoung Heon; Kim, Wankee; Choi, Wonja

    2015-03-01

    Screening a library of overexpressing mutant alleles of the TATA-binding gene SPT15 yielded two Saccharomyces cerevisiae strains (MRRC 3252 and 3253) with enhanced tolerance to acetic acid. They were also tolerant to propionic acid and hydrogen peroxide. Transcriptome profile analysis identified 58 upregulated genes and 106 downregulated genes in MRRC 3252. Stress- and protein synthesis-related transcription factors were predominantly enriched in the upregulated and downregulated genes respectively. Eight deletion mutants for some of the highly downregulated genes were acetic acid-tolerant. The level of intracellular reactive oxygen species was considerably lessened in MRRC 3252 and 3253 upon exposure to acetic acid. Metabolome profile analysis revealed that intracellular concentrations of 5 and 102 metabolites were increased and decreased, respectively, in MRRC 3252, featuring a large increase of urea and a significant decrease of amino acids. The dur1/2Δmutant, in which the urea degradation gene DUR1/2 is deleted, displayed enhanced tolerance to acetic acid. Enhanced tolerance to acetic acid was also observed on the medium containing a low concentration of amino acids. Taken together, this study identified two SPT15 alleles, nine gene deletions and low concentration of amino acids in the medium that confer enhanced tolerance to acetic acid.

  20. Purification and Characterization of a Novel Extracellular Thermostable Alkaline Protease from Streptomyces sp. M30.

    PubMed

    Xin, Yan; Sun, Zhibin; Chen, Qiongzhen; Wang, Jue; Wang, Yicheng; Luogong, Linfeng; Li, Shuhuan; Dong, Weiliang; Cui, Zhongli; Huang, Yan

    2015-11-01

    A novel alkaline protease from Streptomyces sp. M30, SapHM, was purified by ammonium sulfate precipitation, hydrophobic interaction chromatography, and DEAE-Sepharose chromatography, with a yield of 15.5% and a specific activity of 29,070 U/mg. Tryptic fragments of the purified SapHM were obtained by electrospray ionization quadrupole time-of- flight mass spectrometry. Nucleotide sequence analysis revealed that the gene sapHM contained 1,179 bp, corresponding to 392 amino acids with conserved Asp156, His187, and Ser339 residues of alkaline protease. The first 24 amino acid residues were predicted to be a signal peptide, and the molecular mass of the mature peptide was 37.1 kDa based on amino acid sequences and mass spectrometry. Pure SapHM was optimally active at 80°C in 50 mM glycine-NaOH buffer (pH 9.0), and was broadly stable at 0-50 °C and pH 4.0-9.0. The protease relative activity was increased in the presence of Ni(2+), Mn(2+), and Cu(2+) to 112%, 113%, and 147% of control, respectively. Pure SapHM was also activated by dimethylformamide, dimethyl sulfoxide, Tween 80, and urea. The activity of the purified enzyme was completely inhibited by phenylmethylsulfonyl fluoride, indicating that it is a serine-type protease. The Km and Vmax values were estimated to be 35.7 mg/ml, and 5 × 10(4) U/mg for casein. Substrate specificity analysis showed that SapH was active on casein, bovine serum albumin, and bovine serum fibrin.

  1. CodY Regulates Expression of the Bacillus subtilis Extracellular Proteases Vpr and Mpr

    PubMed Central

    Barbieri, Giulia; Voigt, Birgit; Albrecht, Dirk; Hecker, Michael; Albertini, Alessandra M.; Sonenshein, Abraham L.; Ferrari, Eugenio

    2015-01-01

    ABSTRACT CodY is a global transcriptional regulator in low-G+C Gram-positive bacteria that is responsive to GTP and branched-chain amino acids. By interacting with its two cofactors, it is able to sense the nutritional and energetic status of the cell and respond by regulating expression of adaptive genetic programs. In Bacillus subtilis, more than 200 genes, including those for peptide transporters, intracellular proteolytic enzymes, and amino acid degradative pathways, are controlled by CodY. In this study, we demonstrated that expression of two extracellular proteases, Vpr and Mpr, is negatively controlled by CodY. By gel mobility shift and DNase I footprinting assays, we showed that CodY binds to the regulatory regions of both genes, in the vicinity of their transcription start points. The mpr gene is also characterized by the presence of a second, higher-affinity CodY-binding site located at the beginning of its coding sequence. Using strains carrying vpr- or mpr-lacZ transcriptional fusions in which CodY-binding sites were mutated, we demonstrated that repression of both protease genes is due to the direct effect by CodY and that the mpr internal site is required for regulation. The vpr promoter is a rare example of a sigma H-dependent promoter that is regulated by CodY. In a codY null mutant, Vpr became one of the more abundant proteins of the B. subtilis exoproteome. IMPORTANCE CodY is a global transcriptional regulator of metabolism and virulence in low-G+C Gram-positive bacteria. In B. subtilis, more than 200 genes, including those for peptide transporters, intracellular proteolytic enzymes, and amino acid degradative pathways, are controlled by CodY. However, no role for B. subtilis CodY in regulating expression of extracellular proteases has been established to date. In this work, we demonstrate that by binding to the regulatory regions of the corresponding genes, B. subtilis CodY negatively controls expression of Vpr and Mpr, two extracellular

  2. Laundry performance of subtilisin proteases.

    PubMed

    Wolff, A M; Showell, M S; Venegas, M G; Barnett, B L; Wertz, W C

    1996-01-01

    Effective laundry protease performance against susceptible stains depends upon both the enzyme itself and the environment in which it must work. In order to technically design superior laundry proteases, a model for protease's mechanism of action in detergents was developed which has been substantiated through-the-wash. While evaluation of this model and/or a given protease's effectiveness could be judged by a variety of methods, the utility of using visual wash performance comparisons, analytical, and stain characterization studies is described. Finally, data comparing the performance of wild type Subtilisin proteases with mutants designed via the projected model are given, demonstrating possible utility of the system.

  3. Diversity of both the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China sea.

    PubMed

    Zhou, Ming-Yang; Chen, Xiu-Lan; Zhao, Hui-Lin; Dang, Hong-Yue; Luan, Xi-Wu; Zhang, Xi-Ying; He, Hai-Lun; Zhou, Bai-Cheng; Zhang, Yu-Zhong

    2009-10-01

    Protease-producing bacteria are known to play an important role in degrading sedimentary particular organic nitrogen, and yet, their diversity and extracellular proteases remain largely unknown. In this paper, the diversity of the cultivable protease-producing bacteria and their extracellular proteases in the sediments of the South China Sea was investigated. The richness of the cultivable protease-producing bacteria reached 10(6) cells/g in all sediment samples. Analysis of the 16S rRNA gene sequences revealed that the predominant cultivated protease-producing bacteria are Gammaproteobacteria affiliated with the genera Pseudoalteromonas, Alteromonas, Marinobacter, Idiomarina, Halomonas, Vibrio, Shewanella, Pseudomonas, and Rheinheimera, with Alteromonas (34.6%) and Pseudoalteromonas (28.2%) as the predominant groups. Inhibitor analysis showed that nearly all the extracellular proteases from the bacteria are serine proteases or metalloproteases. Moreover, these proteases have different hydrolytic ability to different proteins, reflecting they may belong to different kinds of serine proteases or metalloproteases. To our knowledge, this study represents the first report of the diversity of bacterial proteases in deep-sea sediments.

  4. Effects of the aspartic protease inhibitor from Lupinus bogotensis seeds on the growth and development of Hypothenemus hampei: an inhibitor showing high homology with storage proteins.

    PubMed

    Molina, Diana; Patiño, Luisa; Quintero, Mónica; Cortes, José; Bastos, Sara

    2014-02-01

    The coffee berry borer Hypothenemus hampei is a pest that causes great economic damage to coffee grains worldwide. Because the proteins consumed are digested by aspartic proteases in the insect's midgut, the inhibition of these proteases by transferring a gene encoding an aspartic protease inhibitor from Lupinus bogotensis Benth. to coffee plants could provide a promising strategy to control this pest. Five aspartic protease inhibitors from L. bogotensis (LbAPI) were accordingly purified and characterized. The gene encoding the L. bogotensis aspartic protease inhibitor (LbAPI), with the highest inhibitory activity against H. hampei, was expressed in Escherichia coli and the purified recombinant protein (rLbAPI), with a molecular mass of 15 kDa, was subsequently assessed for its ability to inhibit the aspartic protease activity present in the H. hampei midgut in vitro, as well as its effects on the growth and development of H. hampei in vivo. The in vitro experiments showed that rLbAPI was highly effective against aspartic proteases from H. hampei guts, with a half maximal inhibitory concentration (IC50) of 2.9 μg. The in vivo experiments showed that the concentration of rLbAPI (w/w) in the artificial diet necessary to cause 50% mortality (LD50) of the larvae was 0.91%. The amino acid sequence of LbAPI had high homology (52-80%) to the seed storage proteins, vicilin and β-conglutin, suggesting that this protein was generated by evolutionary events from a β-conglutin precursor. Based on these results, LbAPI may have a dual function as storage protein, and as defense protein against H. hampei. These results provide a promising alternative to obtain a coffee plant resistant to H. hampei.

  5. Purification and structural characterization of the putative gag-pol protease of human immunodeficiency virus.

    PubMed Central

    Lillehoj, E P; Salazar, F H; Mervis, R J; Raum, M G; Chan, H W; Ahmad, N; Venkatesan, S

    1988-01-01

    We have purified a 10,774-dalton protein from human immunodeficiency virus (HIV) type 1 that is encoded in the protease domain of the pol open reading frame (ORF). Radiochemical amino acid microsequencing identified 12 amino acids from the stretch of 39 N-terminal residues of this protein, beginning with a PQITLW sequence at position 69 of the pol ORF. Radiosequencing of selected tryptic peptides of the protein identified 11 additional residues (Leu-9 and Val-2) in six peptides encompassing the entire molecule of 99 residues. A protein of similar size and identical N-terminal sequence (determined through the first 39 residues) was present among the processed HIV pol gene products in Escherichia coli which expressed the entire HIV pol ORF. The C terminus of both the viral and E. coli-expressed proteins was inferred to be contiguous with the N terminus of the p64-p51 reverse transcriptase on the basis of tryptic mapping and specific immunoreactivity with an antiserum against a dodecapeptide located upstream of the reverse transcriptase. Thus, the initial processing of the pol precursor that generates the native protease is apparently preserved across phylogenetic barriers. Although the purified viral protease lacked measurable proteolytic activity, the bacterial extracts were capable of processing an HIV gag precursor protein synthesized in E. coli. Images PMID:3292793

  6. The effects of bioprocess parameters on extracellular proteases in a recombinant Aspergillus niger B1-D.

    PubMed

    Li, Qiang; Harvey, Linda M; McNeil, Brian

    2008-02-01

    Although host proteases are often considered to have a negative impact upon heterologous protein production by filamentous fungi, relatively little is known about the pattern of their appearance in recombinant fungal bioprocesses. In the present study, we investigated extracellular proteases from a filamentous fungus, Aspergillus niger B1-D, genetically modified to secrete hen egg white lysozyme (HEWL). Our findings indicate that extracellular protease activity is only detected after the carbon source is completely utilised in batch cultures. The proteases are predominantly acid proteases and have optimal temperature for activity at around 45 degrees C. Their activity could be partially inhibited by protease inhibitors, indicating the existence of at least four kinds of proteases in these culture fluids, aspartic-, serine-, cysteine-, and metallo-proteases. Oxygen enrichment does not have any noticeable effects on extracellular protease activity except that the onset of protease activity appears earlier in oxygen enrichment runs. Oxygen enrichment stimulates HEWL production substantially, and we propose that it is related to fungal morphology. Thermal stress imposed by raising process temperature (from 25 to 30 and 35 degrees C) in early exponential phase, led to appearance of protease activity in the medium following the heat shock. Continued cultivation at high temperatures significantly reduced HEWL production, which was associated with increased activity of the extracellular proteases in these cultures.

  7. Way toward "dietary pesticides": molecular investigation of insecticidal action of caffeic acid against Helicoverpa armigera.

    PubMed

    Joshi, R S; Wagh, T P; Sharma, N; Mulani, F A; Sonavane, U; Thulasiram, H V; Joshi, R; Gupta, V S; Giri, A P

    2014-11-12

    Bioprospecting of natural molecules is essential to overcome serious environmental issues and pesticide resistance in insects. Here we are reporting insights into insecticidal activity of a plant natural phenol. In silico and in vitro screening of multiple molecules supported by in vivo validations suggested that caffeic acid (CA) is a potent inhibitor of Helicoverpa armigera gut proteases. Protease activity and gene expression were altered in CA-fed larvae. The structure-activity relationship of CA highlighted that all the functional groups are crucial for inhibition of protease activity. Biophysical studies and molecular dynamic simulations revealed that sequential binding of multiple CA molecules induces conformational changes in the protease(s) and thus lead to a significant decline in their activity. CA treatment significantly inhibits the insect's detoxification enzymes, thus intensifying the insecticidal effect. Our findings suggest that CA can be implicated as a potent insecticidal molecule and explored for the development of effective dietary pesticides.

  8. Copper inhibits the HIV-1 protease by both oxygen-dependent and oxygen-independent mechanisms

    SciTech Connect

    Karlstroem, A.R.; Levine, R.L. )

    1991-03-11

    The protease encoded by HIV-1 is essential for the processing of the viral polyproteins encoded by the gag and pol genes into mature viral proteins. Mutation or deletion of the protease gene blocks replication of the virus, making the protease an attractive target for antiviral therapy. The authors found that the HIV-1 protease is inhibited by micromolar concentrations of Cu{sup 2+}. Protease was 50% inhibited by exposure to 5 {mu}M copper for 5 min while exposure to 25 {mu}M caused complete inhibition. This inhibition was not oxygen-dependent and was not reversed by treatment with EDTA, presumably due to the slow off-rate of copper from the protease. Consistent with this interpretation, enzyme activity was recovered after denaturation and refolding of the copper exposed protease. Titration of the inactivated enzyme with Ellman's reagent demonstrated a loss of one of the two sulfhydryl groups present in the molecule, suggesting that copper inhibition was mediated through binding to a cysteine. This was confirmed in studies with a chemically synthesize, mutant protease in which the two cysteine residues were replaced by {alpha}-amino butyrate: The mutant protease was not inhibited by copper. However, both the wild-type and mutant protease were inactivated when exposed to copper, oxygen, and dithiothreitol. This inactivation required oxygen. Thus, the protease can also be inactivated by metal catalyzed oxidation (MCO), a presumably irreversible covalent modification.

  9. The rice OsLpa1 gene encodse a novel protein involved in phytic acid metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rice low phytic acid 1 (OsLpa1) gene was originally identified using a forward genetics approach. Mutation of this gene resulted in a 45% reduction in rice seed phytic acid with a molar-equivalent increase in inorganic phosphorus; however, the rice lpa1 mutant does not appear to differ significa...

  10. Molecular evolution of monotreme and marsupial whey acidic protein genes.

    PubMed

    Sharp, Julie A; Lefèvre, Christophe; Nicholas, Kevin R

    2007-01-01

    Whey acidic protein (WAP), a major whey protein present in milk of a number of mammalian species has characteristic cysteine-rich domains known as four-disulfide cores (4-DSC). Eutherian WAP, expressed in the mammary gland throughout lactation, has two 4-DSC domains, (DI-DII) whereas marsupial WAP, expressed only during mid-late lactation, contains an additional 4-DSC (DIII), and has a DIII-D1-DII configuration. We report the expression and evolution of echidna (Tachyglossus aculeatus) and platypus (Onithorhynchus anatinus) WAP cDNAs. Predicted translation of monotreme cDNAs showed echidna WAP contains two 4-DSC domains corresponding to DIII-DII, whereas platypus WAP contains an additional domain at the C-terminus with homology to DII and has the configuration DIII-DII-DII. Both monotreme WAPs represent new WAP protein configurations. We propose models for evolution of the WAP gene in the mammalian lineage either through exon loss from an ancient ancestor or by rapid evolution via the process of exon shuffling. This evolutionary outcome may reflect differences in lactation strategy between marsupials, monotremes, and eutherians, and give insight to biological function of the gene products. WAP four-disulfide core domain 2 (WFDC2) proteins were also identified in echidna, platypus and tammar wallaby (Macropus eugenii) lactating mammary cells. WFDC2 proteins are secreted proteins not previously associated with lactation. Mammary gland expression of tammar WFDC2 during the course of lactation showed WFDC2 was elevated during pregnancy, reduced in early lactation and absent in mid-late lactation.

  11. Hyaluronic acid enhances gene delivery into the cochlea.

    PubMed

    Shibata, Seiji B; Cortez, Sarah R; Wiler, James A; Swiderski, Donald L; Raphael, Yehoash

    2012-03-01

    Cochlear gene therapy can be a new avenue for the treatment of severe hearing loss by inducing regeneration or phenotypic rescue. One necessary step to establish this therapy is the development of a safe and feasible inoculation surgery, ideally without drilling the bony cochlear wall. The round window membrane (RWM) is accessible in the middle-ear space, but viral vectors placed on this membrane do not readily cross the membrane to the cochlear tissues. In an attempt to enhance permeability of the RWM, we applied hyaluronic acid (HA), a nontoxic and biodegradable reagent, onto the RWM of guinea pigs, prior to delivering an adenovirus carrying enhanced green fluorescent protein (eGFP) reporter gene (Ad-eGFP) at the same site. We examined distribution of eGFP in the cochlea 1 week after treatment, comparing delivery of the vector via the RWM, with or without HA, to delivery by a cochleostomy into the perilymph. We found that cochlear tissue treated with HA-assisted delivery of Ad-eGFP demonstrated wider expression of transgenes in cochlear cells than did tissue treated by cochleostomy injection. HA-assisted vector delivery facilitated expression in cells lining the scala media, which are less accessible and not transduced after perilymphatic injection. We assessed auditory function by measuring auditory brainstem responses and determined that thresholds were significantly better in the ears treated with HA-assisted Ad-eGFP placement on the RWM as compared with cochleostomy. Together, these data demonstrate that HA-assisted delivery of viral vectors provides an atraumatic and clinically feasible method to introduce transgenes into cochlear cells, thereby enhancing both research methods and future clinical application.

  12. Cloning and enhancing production of a detergent- and organic-solvent-resistant nattokinase from Bacillus subtilis VTCC-DVN-12-01 by using an eight-protease-gene-deficient Bacillus subtilis WB800

    PubMed Central

    2013-01-01

    Background Nattokinases/Subtilisins (EC 3.4.21.62) belong to the second large family of serine proteases, which gain significant attention and play important role in many biotechnology processes. Thus, a number of nattokinases/subtilisins from various Bacillus species, especially from B. subtilis strains, extensively have been investigated to understand their biochemical and physical properties as well as to improve the production for industrial application. The purpose of this study was to clone a nattokinase gene from Bacillus subtilis strain VTCC-DVN-12-01, enhance its production in B. subtilis WB800, which is deficient in eight extracellular proteases and characterize its physicochemical properties for potential application in organic synthesis and detergent production. Results A gene coding for the nattokinase (Nk) from B. subtilis strain VTCC-DVN-12-01 consisted of an ORF of 1146 nucleotides, encoding a pre-pro-protein enzyme (30-aa pre-signal peptide, 76-aa pro-peptide and 275-aa mature protein with a predicted molecular mass of 27.7 kDa and pI 6.6). The nattokinase showed 98-99% identity with other nattokinases/subtilisins from B. subtilis strains in GenBank. Nk was expressed in B. subtilis WB800 under the control of acoA promoter at a high level of 600 mg protein per liter culture medium which is highest yield of proteins expressed in any extracellular-protease-deficient B. subtilis system till date. Nk was purified to homogeneity with 3.25 fold purification, a specific activity of 12.7 U/mg, and a recovery of 54.17%. The purified Nk was identified by MALDI-TOF mass spectrometry through three peptides, which showed 100% identity to corresponding peptides of the B. subtilis nattokinase (CAC41625). An optimal activity for Nk was observed at 65°C and pH 9. The nattokinase was stable at temperature up to 50°C and in pH range of 5–11 and retained more than 85% of its initial activity after incubation for 1 h. Mg2+ activated Nk up to 162% of its activity

  13. Hybrid proteins between Pseudomonas exotoxin A and poliovirus protease 2Apro.

    PubMed

    Novoa, I; Feduchi, E; Carrasco, L

    1994-11-21

    Two hybrid proteins between Pseudomonas aeruginosa exotoxin A (PE) and poliovirus protease 2Apro have been generated. One hybrid protein contains the poliovirus 2Apro sequence replacing the region of PE corresponding to amino acids 413-607. The other hybrid contains in addition the transforming growth factor sequence. The two hybrid proteins were efficiently synthesized in E. coli cells using the inducible pET vectors. Both hybrid toxins cleaved p220 (eIF-4 gamma) when the recombinant plasmids were transfected in COS cells infected with recombinant vaccinia virus bearing the T7 RNA polymerase gene.

  14. Acanthamoeba protease activity promotes allergic airway inflammation via protease-activated receptor 2.

    PubMed

    Park, Mi Kyung; Cho, Min Kyoung; Kang, Shin Ae; Park, Hye-Kyung; Kim, Dong-Hee; Yu, Hak Sun

    2014-01-01

    Acanthamoeba is a free-living amoeba commonly present in the environment and often found in human airway cavities. Acanthamoeba possesses strong proteases that can elicit allergic airway inflammation. To our knowledge, the aeroallergenicity of Acanthamoeba has not been reported. We repeatedly inoculated mice with Acanthamoeba trophozoites or excretory-secretory (ES) proteins intra-nasally and evaluated symptoms and airway immune responses. Acanthamoeba trophozoites or ES proteins elicited immune responses in mice that resembled allergic airway inflammation. ES proteins had strong protease activity and activated the expression of several chemokine genes (CCL11, CCL17, CCL22, TSLP, and IL-25) in mouse lung epithelial cells. The serine protease inhibitor phenyl-methane-sulfonyl fluoride (PMSF) inhibited ES protein activity. ES proteins also stimulated dendritic cells and enhanced the differentiation of naive T cells into IL-4-secreting T cells. After repeated inoculation of the protease-activated receptor 2 knockout mouse with ES proteins, airway inflammation and Th2 immune responses were markedly reduced, but not to basal levels. Furthermore, asthma patients had higher Acanthamoeba-specific IgE titers than healthy controls and we found Acanthamoeba specific antigen from house dust in typical living room. Our findings suggest that Acanthamoeba elicits allergic airway symptoms in mice via a protease allergen. In addition, it is possible that Acanthamoeba may be one of the triggers human airway allergic disease.

  15. Identification of a 12-gene fusaric acid biosynthetic gene cluster in Fusarium species through comparative and functional genomics

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In fungi, genes involved in biosynthesis of a secondary metabolite (SM) are often located adjacent to one another in the genome and are coordinately regulated. These SM biosynthetic gene clusters typically encode enzymes, one or more transcription factors, and a transport protein. Fusaric acid is a ...

  16. From proteases to proteomics.

    PubMed

    Neurath, H

    2001-04-01

    This personal and professional autobiography covers the 50-yr period of 1950-2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments).

  17. From proteases to proteomics

    PubMed Central

    Neurath, Hans

    2001-01-01

    This personal and professional autobiography covers the 50-yr period of 1950–2000 and includes the following topics: History of the University of Washington School of Medicine and its Department of Biochemistry (Mount Rainier and the University of Washington, recruiting faculty, biology, research programs); scientific editing (publication, Biochemistry, Protein Science, electronic publication); Europe revisited (Heidelberg, approaching retirement, the German Research Center, reunion in Vienna); and 50 yr of research on proteolytic enzymes (trypsin, carboxypeptidases, mast cell proteases, future developments). PMID:11274481

  18. Molecular characterization of the acid-inducible asr gene of Escherichia coli and its role in acid stress response.

    PubMed

    Seputiene, Vaida; Motiejūnas, Domantas; Suziedelis, Kestutis; Tomenius, Henrik; Normark, Staffan; Melefors, Ojar; Suziedeliene, Edita

    2003-04-01

    Enterobacteria have developed numerous constitutive and inducible strategies to sense and adapt to an external acidity. These molecular responses require dozens of specific acid shock proteins (ASPs), as shown by genomic and proteomic analysis. Most of the ASPs remain poorly characterized, and their role in the acid response and survival is unknown. We recently identified an Escherichia coli gene, asr (acid shock RNA), encoding a protein of unknown function, which is strongly induced by high environmental acidity (pH < 5.0). We show here that Asr is required for growth at moderate acidity (pH 4.5) as well as for the induction of acid tolerance at moderate acidity, as shown by its ability to survive subsequent transfer to extreme acidity (pH 2.0). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western analysis of acid-shocked E. coli cells harboring a plasmid-borne asr gene demonstrated that the Asr protein is synthesized as a precursor with an apparent molecular mass of 18 kDa. Mutational studies of the asr gene also demonstrated the Asr preprotein contains 102 amino acids. This protein is subjected to an N-terminal cleavage of the signal peptide and a second processing event, yielding 15- and 8-kDa products, respectively. Only the 8-kDa polypeptide was detected in acid-shocked cells containing only the chromosomal copy of the asr gene. N-terminal sequencing and site-directed mutagenesis revealed the two processing sites in the Asr protein precursor. Deletion of amino acids encompassing the processing site required for release of the 8-kDa protein resulted in an acid-sensitive phenotype similar to that observed for the asr null mutant, suggesting that the 8-kDa product plays an important role in the adaptation to acid shock. Analysis of Asr:PhoA fusions demonstrated a periplasmic location for the Asr protein after removal of the signal peptide. Homologues of the asr gene from other Enterobacteriaceae were cloned and shown to be induced in E. coli

  19. Multiple Classes of Immune-Related Proteases Associated with the Cell Death Response in Pepper Plants

    PubMed Central

    Bae, Chungyun; Kim, Su-min; Lee, Dong Ju; Choi, Doil

    2013-01-01

    Proteases regulate a large number of biological processes in plants, such as metabolism, physiology, growth, and defense. In this study, we carried out virus-induced gene silencing assays with pepper cDNA clones to elucidate the biological roles of protease superfamilies. A total of 153 representative protease genes from pepper cDNA were selected and cloned into a Tobacco rattle virus-ligation independent cloning vector in a loss-of-function study. Silencing of 61 proteases resulted in altered phenotypes, such as the inhibition of shoot growth, abnormal leaf shape, leaf color change, and lethality. Furthermore, the silencing experiments revealed that multiple proteases play a role in cell death and immune response against avirulent and virulent pathogens. Among these 153 proteases, 34 modulated the hypersensitive cell death response caused by infection with an avirulent pathogen, and 16 proteases affected disease symptom development caused by a virulent pathogen. Specifically, we provide experimental evidence for the roles of multiple protease genes in plant development and immune defense following pathogen infection. With these results, we created a broad sketch of each protease function. This information will provide basic information for further understanding the roles of the protease superfamily in plant growth, development, and defense. PMID:23696830

  20. Proteases in blood clotting.

    PubMed

    Walsh, Peter N; Ahmad, Syed S

    2002-01-01

    The serine proteases, cofactors and cell-receptor molecules that comprise the haemostatic mechanism are highly conserved modular proteins that have evolved to participate in biochemical reactions in blood coagulation, anticoagulation and fibrinolysis. Blood coagulation is initiated by exposure of tissue factor, which forms a complex with factor VIIa and factor X, which results in the generation of small quantities of thrombin and is rapidly shutdown by the tissue factor pathway inhibitor. The generation of these small quantities of thrombin then activates factor XI, resulting in a sequence of events that lead to the activation of factor IX, factor X and prothrombin. Sufficient thrombin is generated to effect normal haemostasis by converting fibrinogen into fibrin. The anticoagulant pathways that regulate blood coagulation include the protein C anticoagulant mechanism, the serine protease inhibitors in plasma, and the Kunitz-like inhibitors, tissue factor pathway inhibitor and protease nexin 2. Finally, the fibrinolytic mechanism that comprises the activation of plasminogen into plasmin prevents excessive fibrin accumulation by promoting local dissolution of thrombi and promoting wound healing by reestablishment of blood flow.

  1. The PH gene determines fruit acidity and contributes to the evolution of sweet melons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Acids are one of the three major components of fleshy fruit taste, together with sugars and volatile flavor compounds. However, the molecular-genetic control of acid accumulation in fruit is poorly understood and, to date, no genes responsible for acid accumulation in fleshy fruit have been function...

  2. Cloning, characterization, expression and antifungal activity of an alkaline serine protease of Aureobasidium pullulans PL5 involved in the biological control of postharvest pathogens.

    PubMed

    Zhang, Dianpeng; Spadaro, Davide; Valente, Silvia; Garibaldi, Angelo; Gullino, Maria Lodovica

    2012-02-15

    An alkaline protease gene was amplified from genomic DNA and cDNA of the antagonistic yeast-like fungus Aureobasidium pullulans PL5, a biocontrol agent effective against Monilinia laxa on stone fruit and Botrytis cinerea and Penicillium expansum on pome fruits. An open reading frame of 1248 bp encoding a 415-amino acid (aa) protein with a calculated molecular weight (M(r)) of 42.9 kDa and an isoelectric point (pI) of 4.5 was characterized. The cDNAALP5 gene had an 18-amino acid signal peptide, one N-gylcosylation, one histidine active site, and one serine active site. The ALP5 gene with a M(r) of 1351 bp contained two introns. One intron was of 54 bp, while the other was of 50 bp. Protein BLAST and phylogenetic tree analysis of the deduced amino sequences from the cDNAALP5 gene showed that the encoded protein had 100% homology to a protease enzyme (ALP2) of a sea strain of A. pullulans, suggesting that the protein ALP5 was an alkaline serine protease. Expression of ALP5 in Escherichia coli BL21 (DE3), followed by identification with Western-blotting, purification with Ni-NTA and analysis of enzymatic activity, yielded an homogeneous recombinant ALP5 which hydrolysed the substrate casein and inhibited the mycelial growth of the pathogens. At its optimal pH of 10.0 and reaction temperature of 50°C, the recombinant protease exhibited the highest activity towards the substrate casein, though the highest stability was at lower temperatures and pH between 7.0 and 9.0. This study provided the direct evidence that extracellular proteases secreted by the antagonist A. pullulans PL5 played a role in the biocontrol activities against some postharvest pathogens of apple and peach.

  3. Biosynthesis of Essential Polyunsaturated Fatty Acids in Wheat Triggered by Expression of Artificial Gene

    PubMed Central

    Mihálik, Daniel; Klčová, Lenka; Ondreičková, Katarína; Hudcovicová, Martina; Gubišová, Marcela; Klempová, Tatiana; Čertík, Milan; Pauk, János; Kraic, Ján

    2015-01-01

    The artificial gene D6D encoding the enzyme ∆6desaturase was designed and synthesized using the sequence of the same gene from the fungus Thamnidium elegans. The original start codon was replaced by the signal sequence derived from the wheat gene for high-molecular-weight glutenin subunit and the codon usage was completely changed for optimal expression in wheat. Synthesized artificial D6D gene was delivered into plants of the spring wheat line CY-45 and the gene itself, as well as transcribed D6D mRNA were confirmed in plants of T0 and T1 generations. The desired product of the wheat genetic modification by artificial D6D gene was the γ-linolenic acid. Its presence was confirmed in mature grains of transgenic wheat plants in the amount 0.04%–0.32% (v/v) of the total amount of fatty acids. Both newly synthesized γ-linolenic acid and stearidonic acid have been detected also in leaves, stems, roots, awns, paleas, rachillas, and immature grains of the T1 generation as well as in immature and mature grains of the T2 generation. Contents of γ-linolenic acid and stearidonic acid varied in range 0%–1.40% (v/v) and 0%–1.53% (v/v) from the total amount of fatty acids, respectively. This approach has opened the pathway of desaturation of fatty acids and production of essential polyunsaturated fatty acids in wheat. PMID:26694368

  4. Management of protease inhibitor-associated hyperlipidemia.

    PubMed

    Penzak, Scott R; Chuck, Susan K

    2002-01-01

    and lovastatin are significantly metabolized by cytochrome P450 enzymes (CYP3A4) and are therefore not recommended for coadministration with protease inhibitors. A fibric acid derivative (gemfibrozil or fenofibrate) should be used in patients with primary hypertriglyceridemia. However, it must be kept in mind that protease inhibitors, such as nelfinavir and ritonavir, induce enzymes involved in the metabolism of the fibric acid derivatives and may, therefore, reduce the lipid-lowering activity of coadministered gemfibrozil or fenofibrate. In certain patients HMG-CoA reductase inhibitors may be used in combination with fibric acid derivatives but patients should be carefully monitored for liver and skeletal muscle toxicity. Select patients may experience improvements in serum lipid levels when their offending protease inhibitor(s) is/are exchanged for efavirenz, nevirapine, or abacavir; however each patient's virologic and immunologic status must be taken closely into consideration.

  5. A metagenomic alkaline protease from saline habitat: cloning, over-expression and functional attributes.

    PubMed

    Purohit, Megha K; Singh, Satya P

    2013-02-01

    Metagenomics has opened new horizon to unlock the biotechnological potential for novel enzymes. An alkaline protease gene was obtained from the total environmental DNA extracted from a saline habitat. After cloning and sequencing, it was identified that the protease gene related to uncultivable bacteria (HM219181). The protease was over expressed at 6h of induction with optimum induction at 1mM IPTG and 27°C. The purified enzyme was characterized with respect to various factors; temperature, pH, NaCl and chemical denaturant. The sequence analysis indicated a hydrophobic tendency of the protein, while the predicted 3D structure indicated the enzyme as a serine protease.

  6. Cowpea bruchid Callosobruchus maculatus counteracts dietary protease inhibitors by modulating propeptides of major digestive enzymes.

    PubMed

    Ahn, J-E; Lovingshimer, M R; Salzman, R A; Presnail, J K; Lu, A L; Koiwa, H; Zhu-Salzman, K

    2007-06-01

    Cowpea bruchids, when challenged by consumption of the soybean cysteine protease inhibitor scN, reconfigure expression of their major CmCP digestive proteases and resume normal feeding and development. Previous evidence indicated that insects selectively induced CmCPs from subfamily B, that were more efficient in autoprocessing and possessed not only higher proteolytic, but also scN-degrading activities. In contrast, dietary scN only marginally up-regulated genes from the more predominant CmCP subfamily A that were inferior to subfamily B. To gain further molecular insight into this adaptive adjustment, we performed domain swapping between the two respective subfamily members B1 and A16, the latter unable to autoprocess or degrade scN even after intermolecular processing. Swapping the propeptides did not qualitatively alter autoprocessing in either protease isoform. Incorporation of either the N- (pAmBA) or C-terminal (pAmAB) mature B1 segment into A16, however, was sufficient to prime autoprocessing of A16 to its mature form. Further, the swap at the N-terminal mature A16 protein region (pAmBA) resulted in four amino acid changes. Replacement of these amino acid residues by the corresponding B1 residues, singly and pair-wise, revealed that autoprocessing activation in pAmBA resulted from cumulative and/or coordinated individual effects. Bacterially expressed isolated propeptides (pA16 and pB1) differed in their ability to inhibit mature B1 enzyme. Lower inhibitory activity in pB1 is likely attributable to its lack of protein stability. This instability in the cleaved propeptide is necessary, although insufficient by itself, for scN-degradation by the mature B1 enzyme. Taken together, cowpea bruchids modulate proteolysis of their digestive enzymes by controlling proCmCP cleavage and propeptide stability, which explains at least in part the plasticity cowpea bruchids demonstrate in response to protease inhibitors.

  7. Expression Profile of the Schistosoma japonicum Degradome Reveals Differential Protease Expression Patterns and Potential Anti-schistosomal Intervention Targets

    PubMed Central

    Liu, Shuai; Cai, Pengfei; Piao, Xianyu; Hou, Nan; Zhou, Xiaosu; Wu, Chuang; Wang, Heng; Chen, Qijun

    2014-01-01

    Blood fluke proteases play pivotal roles in the processes of invasion, nutrition acquisition, immune evasion, and other host-parasite interactions. Hundreds of genes encoding putative proteases have been identified in the recently published schistosome genomes. However, the expression profiles of these proteases in Schistosoma species have not yet been systematically analyzed. We retrieved and culled the redundant protease sequences of Schistosoma japonicum, Schistosoma mansoni, Echinococcus multilocularis, and Clonorchis sinensis from public databases utilizing bioinformatic approaches. The degradomes of the four parasitic organisms and Homo sapiens were then comparatively analyzed. A total of 262 S. japonicum protease sequences were obtained and the expression profiles generated using whole-genome microarray. Four main clusters of protease genes with different expression patterns were identified: proteases up-regulated in hepatic schistosomula and adult worms, egg-specific or predominantly expressed proteases, cercaria-specific or predominantly expressed proteases, and constantly expressed proteases. A subset of protease genes with different expression patterns were further validated using real-time quantitative PCR. The present study represents the most comprehensive analysis of a degradome in Schistosoma species to date. These results provide a firm foundation for future research on the specific function(s) of individual proteases and may help to refine anti-proteolytic strategies in blood flukes. PMID:25275570

  8. Serine protease inhibitors suppress pancreatic endogenous proteases and modulate bacterial neutral proteases.

    PubMed

    Nduaguibe, Chikodili C; Bentsi-Barnes, Kwamina; Mullen, Yoko; Kandeel, Fouad; Al-Abdullah, Ismail

    2010-01-01

    Pefabloc, Trasylol and Urinary Trypsin Inhibitor (UTI) have been reported to be effective serine protease inhibitors that impair pancreatic endogenous proteases resulting in improved islet yield. Here we evaluated the effect of these inhibitors on endogenous proteases (trypsin, chymotrypsin and elastase), bacterial neutral proteases (thermolysin and neutral protease) and islet isolation digestion samples. Protease activity was measured using a fluorimetric assay and islet function was assessed by dynamic perifusion. Trypsin, chymotrypsin and elastase were significantly inhibited by Pefabloc and UTI. Trasylol showed strong inhibitory effects on trypsin and chymotrypsin but also decreased thermolysin activity. UTI was found to inhibit the activity of endogenous proteases and increase the activity of bacterial neutral proteases. Human islets exposed to Pefabloc had reduced insulin response, unlike Trasylol or UTI, which had no detrimental effect on insulin secretion. Although Trasylol was an effective inhibitor of endogenous proteases, FDA regulatory issues preclude its use in clinical application and thus in the isolation process. UTI has the greatest potential because it impairs endogenous pancreatic proteases and enhances digestion enzymes.

  9. A tobacco etch virus protease with increased substrate tolerance at the P1' position.

    PubMed

    Renicke, Christian; Spadaccini, Roberta; Taxis, Christof

    2013-01-01

    Site-specific proteases are important tools for in vitro and in vivo cleavage of proteins. They are widely used for diverse applications, like protein purification, assessment of protein-protein interactions or regulation of protein localization, abundance or activity. Here, we report the development of a procedure to select protease variants with altered specificity based on the well-established Saccharomyces cerevisiae adenine auxotrophy-dependent red/white colony assay. We applied this method on the tobacco etch virus (TEV) protease to obtain a protease variant with altered substrate specificity at the P1' Position. In vivo experiments with tester substrates showed that the mutated TEV protease still efficiently recognizes the sequence ENLYFQ, but has almost lost all bias for the amino acid at the P1' Position. Thus, we generated a site-specific protease for synthetic approaches requiring in vivo generation of proteins or peptides with a specific N-terminal amino acid.

  10. Protease-mediated drug delivery

    NASA Astrophysics Data System (ADS)

    Dickson, Eva F.; Goyan, Rebecca L.; Kennedy, James C.; Mackay, M.; Mendes, M. A. K.; Pottier, Roy H.

    2003-12-01

    Drugs used in disease treatment can cause damage to both malignant and normal tissue. This toxicity limits the maximum therapeutic dose. Drug targeting is of high interest to increase the therapeutic efficacy of the drug without increasing systemic toxicity. Certain tissue abnormalities, disease processes, cancers, and infections are characterized by high levels of activity of specific extracellular and/or intracellular proteases. Abnormally high activity levels of specific proteases are present at sites of physical or chemical trauma, blood clots, malignant tumors, rheumatoid arthritis, inflammatory bowel disease, gingival disease, glomerulonerphritis, and acute pancreatitis. Abnormal protease activity is suspected in development of liver thrombosis, pulmonary emphysema, atherosclerosis, and muscular dystrophy. Inactiviating disease-associated proteases by the administration of appropriate protease inhibitors has had limited success. Instead, one could use such proteases to target drugs to treat the condition. Protease mediated drug delivery offers such a possibility. Solubilizing groups are attached to insoluble drugs via a polypeptide chain which is specifically cleavable by certian proteases. When the solubilized drug enounters the protease, the solubilizing moieties are cleaved, and the drug precipitates at the disease location. Thus, a smaller systemic dosage could result in a therapeutic drug concentration at the treatment site with less systemic toxicity.

  11. Acid environments affect biofilm formation and gene expression in isolates of Salmonella enterica Typhimurium DT104.

    PubMed

    O'Leary, Denis; McCabe, Evonne M; McCusker, Matthew P; Martins, Marta; Fanning, Séamus; Duffy, Geraldine

    2015-08-03

    The aim of this study was to examine the survival and potential virulence of biofilm-forming Salmonella Typhimurium DT104 under mild acid conditions. Salmonella Typhimurium DT104 employs an acid tolerance response (ATR) allowing it to adapt to acidic environments. The threat that these acid adapted cells pose to food safety could be enhanced if they also produce biofilms in acidic conditions. The cells were acid-adapted by culturing them in 1% glucose and their ability to form biofilms on stainless steel and on the surface of Luria Bertani (LB) broth at pH7 and pH5 was examined. Plate counts were performed to examine cell survival. RNA was isolated from cells to examine changes in the expression of genes associated with virulence, invasion, biofilm formation and global gene regulation in response to acid stress. Of the 4 isolates that were examined only one (1481) that produced a rigid biofilm in LB broth at pH7 also formed this same structure at pH5. This indicated that the lactic acid severely impeded the biofilm producing capabilities of the other isolates examined under these conditions. Isolate 1481 also had higher expression of genes associated with virulence (hilA) and invasion (invA) with a 24.34-fold and 13.68-fold increase in relative gene expression respectively at pH5 compared to pH7. Although genes associated with biofilm formation had increased expression in response to acid stress for all the isolates this only resulted in the formation of a biofilm by isolate 1481. This suggests that in addition to the range of genes associated with biofilm production at neutral pH, there are genes whose protein products specifically aid in biofilm production in acidic environments. Furthermore, it highlights the potential for the use of lactic acid for the inhibition of Salmonella biofilms.

  12. PCSK9: an enigmatic protease.

    PubMed

    Lopez, Dayami

    2008-04-01

    Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays a critical role in cholesterol metabolism by controlling the levels of low density lipoprotein (LDL) particles that circulate in the bloodstream. Several gain-of-function and loss-of-function mutations in the PCSK9 gene, that occur naturally, have been identified and linked to hypercholesterolemia and hypocholesterolemia, respectively. PCSK9 expression has been shown to be regulated by sterol regulatory element binding proteins (SREBPs) and statins similar to other genes involved in cholesterol homeostasis. The most critical finding concerning PCSK9 is that this protease is able to influence the number of LDL receptor molecules expressed on the cell surface. Studies have demonstrated that PCSK9 acts mainly by enhancing degradation of LDL receptor protein in the liver. Inactivation of PCSK9 in mice reduces plasma cholesterol levels primarily by increasing hepatic expression of LDL receptor protein and thereby accelerating clearance of circulating LDL cholesterol. The objective of this review is to summarize the current information related to the regulation and function of PCSK9 and to identify gaps in our present knowledge.

  13. Phytanic acid, a novel activator of uncoupling protein-1 gene transcription and brown adipocyte differentiation.

    PubMed Central

    Schlüter, Agatha; Barberá, Maria José; Iglesias, Roser; Giralt, Marta; Villarroya, Francesc

    2002-01-01

    Phytanic acid (3,7,11,15-tetramethylhexadecanoic acid) is a phytol-derived branched-chain fatty acid present in dietary products. Phytanic acid increased uncoupling protein-1 (UCP1) mRNA expression in brown adipocytes differentiated in culture. Phytanic acid induced the expression of the UCP1 gene promoter, which was enhanced by co-transfection with a retinoid X receptor (RXR) expression vector but not with other expression vectors driving peroxisome proliferator-activated receptor (PPAR)alpha, PPARgamma or a form of RXR devoid of ligand-dependent sensitivity. The effect of phytanic acid on the UCP1 gene required the 5' enhancer region of the gene and the effects of phytanic acid were mediated in an additive manner by three binding sites for RXR. Moreover, phytanic acid activates brown adipocyte differentiation: long-term exposure of brown preadipocytes to phytanic acid promoted the acquisition of the brown adipocyte morphology and caused a co-ordinate induction of the mRNAs for gene markers of brown adipocyte differentiation, such as UCP1, adipocyte lipid-binding protein aP2, lipoprotein lipase, the glucose transporter GLUT4 or subunit II of cytochrome c oxidase. In conclusion, phytanic acid is a natural product of phytol metabolism that activates brown adipocyte thermogenic function. It constitutes a potential nutritional signal linking dietary status to adaptive thermogenesis. PMID:11829740

  14. Role of Lon1 protease in post-germinative growth and maintenance of mitochondrial function in Arabidopsis thaliana.

    PubMed

    Rigas, Stamatis; Daras, Gerasimos; Laxa, Miriam; Marathias, Nikolas; Fasseas, Constantinos; Sweetlove, Lee J; Hatzopoulos, Polydefkis

    2009-01-01

    Maintenance of protein quality control and turnover is essential for cellular homeostasis. In plant organelles this biological process is predominantly performed by ATP-dependent proteases. Here, a genetic screen was performed that led to the identification of Arabidopsis thaliana Lon1 protease mutants that exhibit a post-embryonic growth retardation phenotype. Translational fusion to yellow fluorescent protein revealed AtLon1 subcellular localization in plant mitochondria, and the AtLon1 gene could complement the respiratory-deficient phenotype of the yeast PIM1 gene homolog. AtLon1 is highly expressed in rapidly growing plant organs of embryonic origin, including cotyledons and primary roots, and in inflorescences, which have increased mitochondria numbers per cell to fulfill their high energy requirements. In lon1 mutants, the expression of both mitochondrial and nuclear genes encoding respiratory proteins was normal. However, mitochondria isolated from lon1 mutants had a lower capacity for respiration of succinate and cytochrome c via complexes II and IV, respectively. Furthermore, the activity of key enzymes of the tricarboxylic acid (TCA) cycle was significantly reduced. Additionally, mitochondria in lon1 mutants had an aberrant morphology. These results shed light on the developmental mechanisms of selective proteolysis in plant mitochondria and suggest a critical role for AtLon1 protease in organelle biogenesis and seedling establishment.

  15. ShRNA-mediated silencing of the ubiquitin-specific protease 22 gene restrained cell progression and affected the Akt pathway in nasopharyngeal carcinoma

    PubMed Central

    Zhuang, Ya-Jing; Liao, Zhi-Wei; Yu, Hong-wei; Song, Xian-Lu; Liu, Yuan; Shi, Xing-Yuan; Lin, Xiao-dan; Zhou, Tong-Chong

    2015-01-01

    Ubiquitin-specific protease 22 (USP22) is closely related with poor prognosis of cancer patients. However, the role of USP22 expression in nasopharyngeal carcinoma (NPC) has not been determined. The main aim of this study was to determine the role of USP22 in the pathologic processes of NPC. Immunohistochemistry (IHC), western blot (WB), and real-time polymerase chain reaction (RT-PCR) were used to measure the expression of USP22 in cell lines and tissues of NPC in comparison with expression in non-cancerous cells and tissues. USP22-specific short hairpin RNA (shRNA) was used to knock down USP22 expression in the NPC cell line CNE-1 and CNE-2. Furthermore, the impact of USP22 in cellular proliferation, growth, and cell cycle were detected respectively. WB was used to determine the role of USP22 in the AKT/GSK-3/Cyclin signaling pathway. The expression levels of USP22 were remarkably higher in NPC cell lines and tissues. With cell counting and the MTS assay, cellular growth and proliferation progression of USP22 knockdown cell line was shown to be effectively restrained. The USP22 silencing both in CNE-1 and CNE-2 cells caused them to accumulate in the G0/G1 phase of the cell cycle. USP22 knockdown was also found to modulate the AKT/GSK-3/Cyclin pathway, resulting in downregulation of p-AKT, p-GSK-3β, and cyclinD1. This study suggests that USP22 plays a critical regulatory role in the pathologic processes of NPC, and that it may be a potential biological treatment target in the future. PMID:25482932

  16. TOPORS, a Dual E3 Ubiquitin and Sumo1 Ligase, Interacts with 26 S Protease Regulatory Subunit 4, Encoded by the PSMC1 Gene.

    PubMed

    Czub, Barbara; Shah, Amna Z; Alfano, Giovanna; Kruczek, Przemysław M; Chakarova, Christina F; Bhattacharya, Shomi S

    2016-01-01

    The significance of the ubiquitin-proteasome system (UPS) for protein degradation has been highlighted in the context of neurodegenerative diseases, including retinal dystrophies. TOPORS, a dual E3 ubiquitin and SUMO1 ligase, forms a component of the UPS and selected substrates for its enzymatic activities, such as DJ-1/PARK7 and APOBEC2, are important for neuronal as well as retinal homeostasis, respectively. TOPORS is ubiquitously expressed, yet its mutations are only known to result in autosomal dominant retinitis pigmentosa. We performed a yeast two-hybrid (Y2H) screen of a human retinal cDNA library in order to identify interacting protein partners of TOPORS from the retina, and thus begin delineating the putative disease mechanism(s) associated with the retina-specific phenotype resulting from mutations in TOPORS. The screen led to isolation of the 26 S protease regulatory subunit 4 (P26s4/ PSMC1), an ATPase indispensable for correct functioning of UPS-mediated proteostasis. The interaction between endogenous TOPORS and P26s4 proteins was validated by co-immuno-precipitation from mammalian cell extracts and further characterised by immunofluorescent co-localisation studies in cell lines and retinal sections. Findings from hTERT-RPE1 and 661W cells demonstrated that TOPORS and P26s4 co-localise at the centrosome in cultured cells. Immunofluorescent staining of mouse retinae revealed a strong P26s4 reactivity at the interface between retinal pigmented epithelium (RPE) layer and the photoreceptors outer segments (OS). This finding leads us to speculate that P26s4, along with TOPORS, may have a role(s) in RPE phagocytosis, in addition to contributing to the overall photoreceptor and retinal homeostasis via the UPS.

  17. TOPORS, a Dual E3 Ubiquitin and Sumo1 Ligase, Interacts with 26 S Protease Regulatory Subunit 4, Encoded by the PSMC1 Gene

    PubMed Central

    Czub, Barbara; Shah, Amna Z.; Alfano, Giovanna; Kruczek, Przemysław M.; Chakarova, Christina F.; Bhattacharya, Shomi S.

    2016-01-01

    The significance of the ubiquitin-proteasome system (UPS) for protein degradation has been highlighted in the context of neurodegenerative diseases, including retinal dystrophies. TOPORS, a dual E3 ubiquitin and SUMO1 ligase, forms a component of the UPS and selected substrates for its enzymatic activities, such as DJ-1/PARK7 and APOBEC2, are important for neuronal as well as retinal homeostasis, respectively. TOPORS is ubiquitously expressed, yet its mutations are only known to result in autosomal dominant retinitis pigmentosa. We performed a yeast two-hybrid (Y2H) screen of a human retinal cDNA library in order to identify interacting protein partners of TOPORS from the retina, and thus begin delineating the putative disease mechanism(s) associated with the retina-specific phenotype resulting from mutations in TOPORS. The screen led to isolation of the 26 S protease regulatory subunit 4 (P26s4/ PSMC1), an ATPase indispensable for correct functioning of UPS-mediated proteostasis. The interaction between endogenous TOPORS and P26s4 proteins was validated by co-immuno-precipitation from mammalian cell extracts and further characterised by immunofluorescent co-localisation studies in cell lines and retinal sections. Findings from hTERT-RPE1 and 661W cells demonstrated that TOPORS and P26s4 co-localise at the centrosome in cultured cells. Immunofluorescent staining of mouse retinae revealed a strong P26s4 reactivity at the interface between retinal pigmented epithelium (RPE) layer and the photoreceptors outer segments (OS). This finding leads us to speculate that P26s4, along with TOPORS, may have a role(s) in RPE phagocytosis, in addition to contributing to the overall photoreceptor and retinal homeostasis via the UPS. PMID:26872363

  18. Cloning of L-amino acid deaminase gene from Proteus vulgaris.

    PubMed

    Takahashi, E; Ito, K; Yoshimoto, T

    1999-12-01

    The L-amino acid degrading enzyme gene from Proteus vulgaris was cloned and the nucleotide sequence of the enzyme gene was clarified. An open reading frame of 1,413 bp starting at an ATG methionine codon was found, which encodes a protein of 471 amino acid residues, the calculated molecular weight of which is 51,518. The amino acid sequence of P. vulgaris was 58.6% identical with the L-amino acid deaminase of P. mirabilis. A significantly conserved sequence was found around the FAD-binding sequence of flavo-proteins. The partially purified wild and recombinant enzymes had the same substrate specificity for L-amino acids to form the respective keto-acids, however not for D-amino acids.

  19. Zoledronic acid and geranylgeraniol regulate cellular behaviour and angiogenic gene expression in human gingival fibroblasts.

    PubMed

    Zafar, S; Coates, D E; Cullinan, M P; Drummond, B K; Milne, T; Seymour, G J

    2014-10-01

    The mevalonate pathway (MVP) and the anti-angiogenic effect of bisphosphonates have been shown to play a role in the pathogenesis of bisphosphonate-related osteonecrosis of the jaw (BRONJ). This study determined the effect of the bisphosphonate, zoledronic acid and the replenishment of the MVP by geranylgeraniol on human gingival fibroblasts. Cell viability, apoptosis, morphological analysis using transmission electron microscopy, and gene expression for vascular endothelial growth factor A, bone morphogenic protein 2, ras homologue gene family member B, epiregulin and interferon-alpha were conducted. Results showed cellular viability was decreased in the presence of zoledronic acid and the co-addition of zoledronic acid with geranylgeraniol restored cell viability to control levels. Caspase 3/7 was detected in zoledronic-acid-treated cells indicating apoptosis. Transmission electron microscopy revealed dilation of the rough endoplasmic reticulum with zoledronic acid and the appearance of multiple lipid-like vesicles following the addition of geranylgeraniol. Zoledronic acid significantly (P < 0.05, FR > ± 2) up-regulated vascular endothelial growth factor A, bone morphogenic protein 2, ras homologue gene family member B and epiregulin at one or more time points but not interferon-alpha. Addition of geranylgeraniol resulted in a reduction in the expression of all five genes compared with zoledronic-acid-treated human gingival fibroblasts. The study concluded geranylgeraniol partially reversed the effects of zoledronic acid in human gingival fibroblasts both at the cellular and genetic levels, suggesting the regulation of these genes is mediated via the mevalonate pathway.

  20. Nucleic acid binding property of the gene products of rice stripe virus.

    PubMed

    Liang, Delin; Ma, Xiangqiang; Qu, Zhicai; Hull, Roger

    2005-10-01

    GST fusion proteins of the six gene products from RNAs 2,3 and 4 of the tenuivirus, Rice stripe virus (RSV), were used to study the nucleic acid binding activities in vitro. Three of the proteins, p3, pc3 and pc4, bound both single- and double-stranded cDNA of RSV RNA4 and also RNA3 transcribed from its cDNA clone, while p2, pc2-N (the N-terminal part of pc2) nor p4 bound the cDNA or RNA transcript. The binding activity of p3 is located in the carboxyl-terminus amino acid 154-194, which contains basic amino acid rich beta-sheets. The acidic amino acid-rich amino-terminus (amino acids 1-100) of p3 did not have nucleic acid binding activity. The related analogous gene product of the tenuivirus, Rice hoja blanca virus, is a suppressor of gene silencing and the possibility of the nucleic acid binding ability of RSV p3 being associated with this property is discussed. The C-terminal part of the RSV nucleocapsid protein, which also contains a basic region, binds nucleic acids, which is consistent with its function. The central and C-terminal regions of pc4 bind nucleic acid. It has been suggested that this protein is a cell-to-cell movement protein and nucleic acid binding would be in accord with this function.

  1. Association of circulating factor seven activating protease (FSAP) and of oral Omega-3 fatty acids supplements with clinical outcome in patients with atrial fibrillation: the OMEGA-AF study.

    PubMed

    Parahuleva, Mariana S; Kanse, Sandip; Hölschermann, Hans; Zheleva, Kirila; Zandt, Daniel; Worsch, Michael; Parviz, Behnoush; Güttler, Norbert; Tillmanns, Harald; Böning, Andreas; Erdogan, Ali

    2014-04-01

    Factor VII Activating Protease (FSAP) activates factor VII (FVII) as well as pro-urokinase (uPA). Our goal was to evaluate the relation between plasma levels of FSAP and clinical instability in atrial fibrillation (AF) and possible effects of oral omega-3 fatty acids (FA) supplements. 101 patients with persistent AF were analyzed in the OMEGA-AF Study. Plasma FSAP levels were measured at baseline and after 12 weeks of treatment with omega-3 FA. The median FSAP antigen concentration, in contrast to FSAP activity, was higher in patients with persistent AF. The maintenance of SR after successful cardioversion (CV) did not lead to a normalization of FSAP concentration. Supplementation with omega-3 FA but not placebo significantly reduced elevated FSAP concentration. Furthermore, elevated FSAP levels did not indicate a significantly increased risk of recurrence of AF after electrical CV or cardiovascular clinical events during 1 year of follow-up. Plasma FSAP concentration was increased in patients with AF and may be involved in the pathogenesis of this condition. The possible effects of omega-3 FA on clinical AF potential could be linked with modulation of circulating FSAP levels.

  2. In vivo sequence diversity of the protease of human immunodeficiency virus type 1: presence of protease inhibitor-resistant variants in untreated subjects.

    PubMed Central

    Lech, W J; Wang, G; Yang, Y L; Chee, Y; Dorman, K; McCrae, D; Lazzeroni, L C; Erickson, J W; Sinsheimer, J S; Kaplan, A H

    1996-01-01

    We have evaluated the sequence diversity of the protease human immunodeficiency virus type 1 in vivo. Our analysis of 246 protease coding domain sequences obtained from 12 subjects indicates that amino acid substitutions predicted to give rise to protease inhibitor resistance may be present in patients who have not received protease inhibitors. In addition, we demonstrated that amino acid residues directly involved in enzyme-substrate interactions may be varied in infected individuals. Several of these substitutions occurred in combination either more or less frequently than would be expected if their appearance was independent, suggesting that one substitution may compensate for the effects of another. Taken together, our analysis indicates that the human immunodeficiency virus type 1 protease has flexibility sufficient to vary critical subsites in vivo, thereby retaining enzyme function and viral pathogenicity. PMID:8627733

  3. Rhb1 regulates the expression of secreted aspartic protease 2 through the TOR signaling pathway in Candida albicans.

    PubMed

    Chen, Yu-Ting; Lin, Chia-Ying; Tsai, Pei-Wen; Yang, Cheng-Yao; Hsieh, Wen-Ping; Lan, Chung-Yu

    2012-02-01

    Candida albicans is a major fungal pathogen in humans. In C. albicans, secreted aspartyl protease 2 (Sap2) is the most highly expressed secreted aspartic protease in vitro and is a virulence factor. Recent research links the small GTPase Rhb1 to C. albicans target of rapamycin (TOR) signaling in response to nitrogen availability. The results of this study show that Rhb1 is related to cell growth through the control of SAP2 expression when protein is the major nitrogen source. This process involves various components of the TOR signaling pathway, including Tor1 kinase and its downstream effectors. TOR signaling not only controls SAP2 transcription but also affects Sap2 protein levels, possibly through general amino acid control. DNA microarray analysis identifies other target genes downstream of Rhb1 in addition to SAP2. These findings provide new insight into nutrients, Rhb1-TOR signaling, and expression of C. albicans virulence factor.

  4. Kinetics of alkaline protease production by Streptomyces griseoflavus PTCC1130

    PubMed Central

    Hosseini, Seyed Vesal; Saffari, Zahra; Farhanghi, Ali; Atyabi, Seyed Mohammad; Norouzian, Dariush

    2016-01-01

    Background and Objectives: Proteases are a group of enzymes that catalyze the degradation of proteins resulting in the production of their amino acid constituents. They are the most important group of industrial enzymes which account for about 60% of total enzymes in the market and produced mainly by microorganisms. The attempts were made to study the kinetic parameters of protease produced by Streptomyces griseoflavus PTCC1130. Materials and Methods: Streptomyces griseoflavus PTCC1130 was grown on casein agar. Different media such as BM1, BM2, BM3 and BM4 were prepared. Data obtained from growth and protease production were subjected to kinetics evaluation. Casein was used as substrate for protease activity and the released soluble peptide bearing aromatic amino acid were quantified by Folin Cioclateaue reagent. Protein content of the enzyme and the sugar utilized by the organism were estimated by Bradford and Miller’s methods respectively. Results: Basal Medium named as BM1, BM2, BM3 and BM4(50 mL in 250 mL Erlen Meyer flasks) were screened out to evaluate protease production by Streptomyces griseoflavus PTCC1130. They were inoculated with known amount of seed culture and kept on rotary shaker. To obtain the specific growth rate, wet weight of biomass was plotted against the time. The clarified supernatant was used for the analysis of protease by measuring the soluble peptide containing aromatic amino acid residues employing Folin Cioclateaue reagent. Our results showed that maximum level of enzyme production (14035 U/L) was occurred at late exponential phase using Basal Medium supplemented with zinc sulfate (0.5g/L), casein (10g/L) at pH 6.5. Conclusions: A kinetic study of protease production by Streptomyces griseoflavus PTCC1130 provided highly quantitative information regarding the behavior of a system, which is essential to study the fermentation process. Exploitation of such kinetics analysis would be useful in commercialization of microbial enzyme

  5. Oleic acid attenuates trans-10,cis-12 conjugated linoleic acid-mediated inflammatory gene expression in human adipocytes.

    PubMed

    Reardon, Meaghan; Gobern, Semone; Martinez, Kristina; Shen, Wan; Reid, Tanya; McIntosh, Michael

    2012-11-01

    The weight loss supplement conjugated linoleic acid (CLA) consists of an equal mixture of trans-10,cis-12 (10,12) and cis-9,trans-11 (9,11) isomers. However, high levels of mixed CLA isomers, or the 10,12 isomer, causes chronic inflammation, lipodystrophy, or insulin resistance. We previously demonstrated that 10,12 CLA decreases de novo lipid synthesis along with the abundance and activity of stearoyl-CoA desaturase (SCD)-1, a δ-9 desaturase essential for the synthesis of monounsaturated fatty acids (MUFA). Thus, we hypothesized that the 10,12 CLA-mediated decrease in SCD-1, with the subsequent decrease in MUFA, was responsible for the observed effects. To test this hypothesis, 10,12 CLA-treated human adipocytes were supplemented with oleic acid for 12 h to 7 days, and inflammatory gene expression, insulin-stimulated glucose uptake, and lipid content were measured. Oleic acid reduced inflammatory gene expression in a dose-dependent manner, and restored the lipid content of 10,12 CLA-treated adipocytes without improving insulin-stimulated glucose uptake. In contrast, supplementation with stearic acid, a substrate for SCD-1, or 9,11 CLA did not prevent inflammatory gene expression by 10,12 CLA. Notably, 10,12 CLA impacted the expression of several G-protein coupled receptors that was attenuated by oleic acid. Collectively, these data show that oleic acid attenuates 10,12 CLA-induced inflammatory gene expression and lipid content, possibly by alleviating cell stress caused by the inhibition of MUFA needed for phospholipid and neutral lipid synthesis.

  6. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage.

    PubMed

    Tchetina, Elena V; Markova, Galina A; Poole, A Robin; Zukor, David J; Antoniou, John; Makarov, Sergey A; Kuzin, Aleksandr N

    2016-01-01

    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1-50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10-50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients.

  7. Deferoxamine Suppresses Collagen Cleavage and Protease, Cytokine, and COL10A1 Expression and Upregulates AMPK and Krebs Cycle Genes in Human Osteoarthritic Cartilage

    PubMed Central

    Markova, Galina A.; Poole, A. Robin; Zukor, David J.; Antoniou, John; Makarov, Sergey A.; Kuzin, Aleksandr N.

    2016-01-01

    This study reports the effects of the iron chelator deferoxamine (DFO) on collagen cleavage, inflammation, and chondrocyte hypertrophy in relation to energy metabolism-related gene expression in osteoarthritic (OA) articular cartilage. Full-depth explants of human OA knee articular cartilage from arthroplasty were cultured with exogenous DFO (1–50 μM). Type II collagen cleavage and phospho-adenosine monophosphate-activated protein kinase (pAMPK) concentrations were measured using ELISAs. Gene expression studies employed real-time PCR and included AMPK analyses in PBMCs. In OA explants collagen cleavage was frequently downregulated by 10–50 μM DFO. PCR analysis of 7 OA patient cartilages revealed that 10 μM DFO suppressed expression of MMP-1, MMP-13, IL-1β, and TNFα and a marker of chondrocyte hypertrophy, COL10A1. No changes were observed in the expression of glycolysis-related genes. In contrast, expressions of genes associated with the mitochondrial Krebs cycle (TCA), AMPK, HIF1α, and COL2A1 were upregulated. AMPK gene expression was reduced in OA cartilage and increased in PBMCs from the same patients compared to healthy controls. Our studies demonstrate that DFO is capable of suppressing excessive collagenase-mediated type II collagen cleavage in OA cartilage and reversing phenotypic changes. The concomitant upregulation of proanabolic TCA-related gene expressions points to a potential for availability of energy generating substrates required for matrix repair by end-stage OA chondrocytes. This might normally be prevented by high whole-body energy requirements indicated by elevated AMPK expression in PBMCs of OA patients. PMID:28042296

  8. Intergenic Sequence between Arabidopsis Caseinolytic Protease B-Cytoplasmic/Heat Shock Protein100 and Choline Kinase Genes Functions as a Heat-Inducible Bidirectional Promoter1[C][W][OPEN

    PubMed Central

    Mishra, Ratnesh Chandra; Grover, Anil

    2014-01-01

    In Arabidopsis (Arabidopsis thaliana), the At1g74310 locus encodes for caseinolytic protease B-cytoplasmic (ClpB-C)/heat shock protein100 protein (AtClpB-C), which is critical for the acquisition of thermotolerance, and At1g74320 encodes for choline kinase (AtCK2) that catalyzes the first reaction in the Kennedy pathway for phosphatidylcholine biosynthesis. Previous work has established that the knockout mutants of these genes display heat-sensitive phenotypes. While analyzing the AtClpB-C promoter and upstream genomic regions in this study, we noted that AtClpB-C and AtCK2 genes are head-to-head oriented on chromosome 1 of the Arabidopsis genome. Expression analysis showed that transcripts of these genes are rapidly induced in response to heat stress treatment. In stably transformed Arabidopsis plants harboring this intergenic sequence between head-to-head oriented green fluorescent protein and β-glucuronidase reporter genes, both transcripts and proteins of the two reporters were up-regulated upon heat stress. Four heat shock elements were noted in the intergenic region by in silico analysis. In the homozygous transfer DNA insertion mutant Salk_014505, 4,393-bp transfer DNA is inserted at position −517 upstream of ATG of the AtClpB-C gene. As a result, AtCk2 loses proximity to three of the four heat shock elements in the mutant line. Heat-inducible expression of the AtCK2 transcript was completely lost, whereas the expression of AtClpB-C was not affected in the mutant plants. Our results suggest that the 1,329-bp intergenic fragment functions as a heat-inducible bidirectional promoter and the region governing the heat inducibility is possibly shared between the two genes. We propose a model in which AtClpB-C shares its regulatory region with heat-induced choline kinase, which has a possible role in heat signaling. PMID:25281707

  9. PEGylated substrates of NSP4 protease: A tool to study protease specificity

    NASA Astrophysics Data System (ADS)

    Wysocka, Magdalena; Gruba, Natalia; Grzywa, Renata; Giełdoń, Artur; Bąchor, Remigiusz; Brzozowski, Krzysztof; Sieńczyk, Marcin; Dieter, Jenne; Szewczuk, Zbigniew; Rolka, Krzysztof; Lesner, Adam

    2016-03-01

    Herein we present the synthesis of a novel type of peptidomimetics composed of repeating diaminopropionic acid residues modified with structurally diverse heterobifunctional polyethylene glycol chains (abbreviated as DAPEG). Based on the developed compounds, a library of fluorogenic substrates was synthesized. Further library deconvolution towards human neutrophil serine protease 4 (NSP4) yielded highly sensitive and selective internally quenched peptidomimetic substrates. In silico analysis of the obtained peptidomimetics revealed the presence of an interaction network with distant subsites located on the enzyme surface.

  10. EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHOLORACETC ACID

    EPA Science Inventory

    EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHLOROACETIC ACID

    Dichloroacetic acid COCA) is a major by-product ofwater disinfection by cWorination. Several
    studies have shown that DCA induces liver tumors in rodents when administered in drinkmg wate...

  11. recA gene product is responsible for inhibition of deoxyribonucleic acid synthesis after ultraviolet irradiation.

    PubMed Central

    Trgovcević, Z; Petranović, D; Petranović, M; Salaj-Smic, E

    1980-01-01

    Deoxyribonucleic acid synthesis after ultraviolet irradiation was studied in wild-type, uvrA, recB, recA recB, and recA Escherichia coli strains. Inhibition of deoxyribonucleic acid synthesis, which occurs almost immediately after exposing the cells to ultraviolet radiation, depends on the functional gene recA. PMID:6997276

  12. MICROARRAY ANALYSIS OF DICHLOROACETIC ACID-INDUCED CHANGES IN GENE EXPRESSION

    EPA Science Inventory


    MICROARRAY ANALYSIS OF DICHLOROACETIC ACID-INDUCED CHANGES IN GENE EXPRESSION

    Dichloroacetic acid (DCA) is a major by-product of water disinfection by chlorination. Several studies have demonstrated the hepatocarcinogenicity of DCA in rodents when administered in dri...

  13. EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHLOROACETIC ACID

    EPA Science Inventory

    EARLY GENE EXPRESSION CHANGES IN THE LIVERS OF MICE EXPOSED TO DICHLOROACETIC ACID

    Dichloroacetic acid (DCA) is a major by-product of water disinfection by chlorination. Several studies have shown that DCA induces liver tumors in rodents when administered in drinking wate...

  14. Regulation of the expression of key genes involved in HDL metabolism by unsaturated fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The aim of this study was to determine the effects, and possible mechanisms of action, of unsaturated fatty acids on the expression of genes involved in HDL metabolism in HepG2 cells. The mRNA concentration of target genes was assessed by real time PCR. Protein concentrations were determined by wes...

  15. Temporal dependence of cysteine protease activation following excitotoxic hippocampal injury.

    PubMed

    Berry, J N; Sharrett-Field, L J; Butler, T R; Prendergast, M A

    2012-10-11

    Excitotoxic insults can lead to intracellular signaling cascades that contribute to cell death, in part by activation of proteases, phospholipases, and endonucleases. Cysteine proteases, such as calpains, are calcium (Ca(2+))-activated enzymes which degrade cytoskeletal proteins, including microtubule-associated proteins, tubulin, and spectrin, among others. The current study used the organotypic hippocampal slice culture model to examine whether pharmacologic inhibition of cysteine protease activity inhibits N-methyl-D-aspartate- (NMDA-) induced excitotoxic (20 μM NMDA) cell death and changes in synaptophysin immunoreactivity. Significant NMDA-induced cytotoxicity (as measured by propidium iodide [PI] uptake) was found in the CA1 region of the hippocampus at all timepoints examined (24, 72, 120 h), an effect significantly attenuated by co-exposure to the selective NMDA receptor antagonist DL-2-Amino-5-phosphonopentanoic acid (APV), but not MDL-28170, a potent cysteine protease inhibitor. Results indicated sparing of NMDA-induced loss of the synaptic vesicular protein synaptophysin in all regions of the hippocampus by MDL-28170, though only at early timepoints after injury. These results suggest Ca(2+)-dependent recruitment of cysteine proteases within 24h of excitotoxic insult, but activation of alternative cellular degrading mechanisms after 24h. Further, these data suggest that synaptophysin may be a substrate for calpains and related proteases.

  16. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed

    Schauperl, Michael; Fuchs, Julian E; Waldner, Birgit J; Huber, Roland G; Kramer, Christian; Liedl, Klaus R

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4') with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design.

  17. Characterizing Protease Specificity: How Many Substrates Do We Need?

    PubMed Central

    Schauperl, Michael; Fuchs, Julian E.; Waldner, Birgit J.; Huber, Roland G.; Kramer, Christian; Liedl, Klaus R.

    2015-01-01

    Calculation of cleavage entropies allows to quantify, map and compare protease substrate specificity by an information entropy based approach. The metric intrinsically depends on the number of experimentally determined substrates (data points). Thus a statistical analysis of its numerical stability is crucial to estimate the systematic error made by estimating specificity based on a limited number of substrates. In this contribution, we show the mathematical basis for estimating the uncertainty in cleavage entropies. Sets of cleavage entropies are calculated using experimental cleavage data and modeled extreme cases. By analyzing the underlying mathematics and applying statistical tools, a linear dependence of the metric in respect to 1/n was found. This allows us to extrapolate the values to an infinite number of samples and to estimate the errors. Analyzing the errors, a minimum number of 30 substrates was found to be necessary to characterize substrate specificity, in terms of amino acid variability, for a protease (S4-S4’) with an uncertainty of 5 percent. Therefore, we encourage experimental researchers in the protease field to record specificity profiles of novel proteases aiming to identify at least 30 peptide substrates of maximum sequence diversity. We expect a full characterization of protease specificity helpful to rationalize biological functions of proteases and to assist rational drug design. PMID:26559682

  18. Role of rhomboid proteases in bacteria.

    PubMed

    Rather, Philip

    2013-12-01

    The first member of the rhomboid family of intramembrane serine proteases in bacteria was discovered almost 20years ago. It is now known that rhomboid proteins are widely distributed in bacteria, with some bacteria containing multiple rhomboids. At the present time, only a single rhomboid-dependent function in bacteria has been identified, which is the cleavage of TatA in Providencia stuartii. Mutational analysis has shown that loss of the GlpG rhomboid in Escherichia coli alters cefotaxime resistance, loss of the YqgP (GluP) rhomboid in Bacillus subtilis alters cell division and glucose uptake, and loss of the MSMEG_5036 and MSMEG_4904 genes in Mycobacterium smegmatis results in altered colony morphology, biofilm formation and antibiotic susceptibilities. However, the cellular substrates for these proteins have not been identified. In addition, analysis of the rhombosortases, together with their possible Gly-Gly CTERM substrates, may shed new light on the role of these proteases in bacteria. This article is part of a Special Issue entitled: Intramembrane Proteases.

  19. A primitive enzyme for a primitive cell: the protease required for excystation of Giardia.

    PubMed

    Ward, W; Alvarado, L; Rawlings, N D; Engel, J C; Franklin, C; McKerrow, J H

    1997-05-02

    Protozoan parasites of the genus Giardia are one of the earliest lineages of eukaryotic cells. To initiate infection, trophozoites emerge from a cyst in the host. Excystation is blocked by specific cysteine protease inhibitors. Using a biotinylated inhibitor, the target protease was identified and its corresponding gene cloned. The protease was localized to vesicles that release their contents just prior to excystation. The Giardia protease is the earliest known branch of the cathepsin B family. Its phylogeny confirms that the cathepsin B lineage evolved in primitive eukaryotic cells, prior to the divergence of plant and animal kingdoms, and underscores the diversity of cellular functions that this enzyme family facilitates.

  20. A Culture-Based Method for Determining the Production of Secreted Protease Inhibitors

    PubMed Central

    Quintero, David; Bermudes, David

    2014-01-01

    We have developed a culture-based method for determining the production of secreted protease inhibitors. The assay utilizes standard proteolysis detection plates to support microbial growth followed by infiltrating the plate with a protease and subsequently detecting the remaining protein by trichloroacetic acid (TCA) precipitation, or by bromocreosol green (BCG) or Ponseau S (PS) staining. The presence of a protease inhibitor can be observed in the form of a protected zone of protein around the protease inhibitor-producing strain. Using the protease inhibitors α-2-macroglobulin, aprotinin, leupeptin, and bestatin and the primary and secondary forms of Photorhabdus luminescens in combination with the protease trypsin, we were able to demonstrate that the assay is specific for the cognate inhibitor of the protease and for bacteria secreting protease inhibitors. In addition, when casein-containing plates were used, the size of the diffusion zone was inversely correlated with the molecular weight of the inhibitor allowing a relative estimation of the protease inhibitor molecular weight. This assay is useful for detecting the presence of microbial secreted protease inhibitors and may reveal their production by microorganisms that were not previously recognized to produce them. PMID:24632514

  1. Enhanced production of heterologous proteins by the filamentous fungus Trichoderma reesei via disruption of the alkaline serine protease SPW combined with a pH control strategy.

    PubMed

    Zhang, Guoxiu; Zhu, Yao; Wei, Dongzhi; Wang, Wei

    2014-01-01

    The filamentous fungus Trichoderma reesei has received attention as a host for heterologous protein production because of its high secretion capacity and eukaryotic post-translational modifications. However, the heterologous production of proteins in T. reesei is limited by its high expression of proteases. The pH control strategies have been proposed for eliminating acidic, but not alkaline, protease activity. In this study, we verified the expression of a relatively major extracellular alkaline protease (GenBank accession number: EGR49466.1, named spw in this study) from 20 candidates through real-time polymerase chain reaction. The transcriptional level of spw increased about 136 times in response to bovine serum albumin as the sole nitrogen source. Additionally, extracellular protease activity was reduced by deleting the spw gene. Therefore, using this gene expression system, we observed enhanced production and stability of the heterologous alkaline endoglucanase EGV from Humicola insolens using the Δspw strain as compared to the parental strain RUT-C30.

  2. Carbohydrate protease conjugates: Stabilized proteases for peptide synthesis

    SciTech Connect

    Wartchow, C.A.; Wang, Peng; Bednarski, M.D.; Callstrom, M.R. |

    1995-12-31

    The synthesis of oligopeptides using stable carbohydrate protease conjugates (CPCs) was examined in acetonitrile solvent systems. CPC[{alpha}-chymotrypsin] was used for the preparation of peptides containing histidine, phenylalanine, tryptophan in the P{sub 1} position in 60-93% yield. The CPC[{alpha}-chymotrypsin]-catalyzed synthesis of octamer Z-Gly-Gly-Phe-Gly-Gly-Phe-Gly-Gly-OEt from Z-Gly-Gly-Phe-Gly-Gly-Phe-OMe was achieved in 71% yield demonstrating that synthesis peptides containing both hydrophylic and hydrophobic amino acids. The P{sub 2} specificity of papain for aromatic residues was utilized for the 2 + 3 coupling of Z-Tyr-Gly-OMe to H{sub 2}N-Gly-Phe-Leu-OH to generate the leucine enkephalin derivative in 79% yield. Although papain is nonspecific for the hydrolysis of N-benzyloxycarbonyl amino acid methyl esters in aqueous solution, the rates of synthesis for these derivitives with nucleophile leucine tert-butyl ester differed by nearly 2 orders of magnitude. CPC[thermolysin] was used to prepare the aspartame precursor Z-Asp-Phe-OMe in 90% yield. The increased stability of CPCs prepared from periodate-modified poly(2-methacryl- amido-2-deoxy-D-glucose), poly(2-methacrylamido-2-deoxy-D-galactose), and poly(5-methacryl-amido-5-deoxy-D-ribose), carbohydrate materials designed to increase the aldehyde concentration in aqueous solution, suggests that the stability of CPCs is directly related to the aldehyde concentration of the carbohydrate material. Periodate oxidation of poly(2-methacrylamido-2-deoxy-D-glucose) followed by covalent attachment to {alpha}-chymotrypsin gave a CPC with catalytic activity in potassium phosphate buffer at 90{degrees}C for 2 h. 1 fig., 1 tab., 40 refs.

  3. Prediction of Bacillus weihenstephanensis acid resistance: the use of gene expression patterns to select potential biomarkers.

    PubMed

    Desriac, N; Postollec, F; Coroller, L; Sohier, D; Abee, T; den Besten, H M W

    2013-10-01

    Exposure to mild stress conditions can activate stress adaptation mechanisms and provide cross-resistance towards otherwise lethal stresses. In this study, an approach was followed to select molecular biomarkers (quantitative gene expressions) to predict induced acid resistance after exposure to various mild stresses, i.e. exposure to sublethal concentrations of salt, acid and hydrogen peroxide during 5 min to 60 min. Gene expression patterns of unstressed and mildly stressed cells of Bacillus weihenstephanensis were correlated to their acid resistance (3D value) which was estimated after exposure to lethal acid conditions. Among the twenty-nine candidate biomarkers, 12 genes showed expression patterns that were correlated either linearly or non-linearly to acid resistance, while for the 17 other genes the correlation remains to be determined. The selected genes represented two types of biomarkers, (i) four direct biomarker genes (lexA, spxA, narL, bkdR) for which expression patterns upon mild stress treatment were linearly correlated to induced acid resistance; and (ii) nine long-acting biomarker genes (spxA, BcerKBAB4_0325, katA, trxB, codY, lacI, BcerKBAB4_1716, BcerKBAB4_2108, relA) which were transiently up-regulated during mild stress exposure and correlated to increased acid resistance over time. Our results highlight that mild stress induced transcripts can be linearly or non-linearly correlated to induced acid resistance and both approaches can be used to find relevant biomarkers. This quantitative and systematic approach opens avenues to select cellular biomarkers that could be incremented in mathematical models to predict microbial behaviour.

  4. Regulation of hepatic gene expression by saturated fatty acids.

    PubMed

    Vallim, T; Salter, A M

    2010-01-01

    Diets rich in saturated fatty acids have long been associated with increased plasma cholesterol concentrations and hence increased risk of cardiovascular disease. More recently, they have also been suggested to promote the development of non-alcoholic fatty liver disease. While there is now considerable evidence to suggest that polyunsaturated fatty acids exert many of their effects through regulating the activity of transcription factors, including peroxisome proliferator activated receptors, sterol regulatory binding proteins (SREBPs) and liver X receptor, our understanding of how saturated fatty acids act is still limited. Here we review the potential mechanisms whereby saturated fatty acids modulate hepatic lipid metabolism thereby impacting on the synthesis, storage and secretion of lipids. Evidence is presented that their effects are, at least partly, mediated through modulation of the activity of the SREBP family of transcription factors.

  5. Properties of bacteriophage T4 mutants defective in gene 30 (deoxyribonucleic acid ligase) and the rII gene.

    PubMed

    Karam, J D; Barker, B

    1971-02-01

    In Escherichia coli K-12 strains infected with phage T4 which is defective in gene 30 [deoxyribonucleic acid (DNA) ligase] and in the rII gene (product unknown), near normal levels of DNA and viable phage were produced. Growth of such T4 ligase-rII double mutants was less efficient in E. coli B strains which show the "rapidlysis" phenotype of rII mutations. In pulse-chase experiments coupled with temperature shifts and with inhibition of DNA synthesis, it was observed that DNA synthesized by gene 30-defective phage is more susceptible to breakdown in vivo when the phage is carrying a wild-type rII gene. Breakdown was delayed or inhibited by continued DNA synthesis. Mutations of the rII gene decreased but did not completely abolish the breakdown. T4 ligase-rII double mutants had normal sensitivity to ultraviolet irradiation.

  6. Minimal Streptomyces sp. strain C5 daunorubicin polyketide biosynthesis genes required for aklanonic acid biosynthesis.

    PubMed Central

    Rajgarhia, V B; Strohl, W R

    1997-01-01

    The structure of the Streptomyces sp. strain C5 daunorubicin type II polyketide synthase (PKS) gene region is different from that of other known type II PKS gene clusters. Directly downstream of the genes encoding ketoacylsynthase alpha and beta (KS alpha, KS beta) are two genes (dpsC, dpsD) encoding proteins of unproven function, both absent from other type II PKS gene clusters. Also in contrast to other type II PKS clusters, the gene encoding the acyl carrier protein (ACP), dpsG, is located about 6.8 kbp upstream of the genes encoding the daunorubicin KS alpha and KS beta. In this work, we demonstrate that the minimal genes required to produce aklanonic acid in heterologous hosts are dpsG (ACP), dauI (regulatory activator), dpsA (KS alpha), dpsB (KS beta), dpsF (aromatase), dpsE (polyketide reductase), and dauG (putative deoxyaklanonic acid oxygenase). The two unusual open reading frames, dpsC (KASIII homolog lacking a known active site) and dpsD (acyltransferase homolog), are not required to synthesize aklanonic acid. Additionally, replacement of dpsD or dpsCD in Streptomyces sp. strain C5 with a neomycin resistance gene (aphI) results in mutant strains that still produced anthracyclines. PMID:9098068

  7. Gene Expression Analysis of Alfalfa Seedlings Response to Acid-Aluminum

    PubMed Central

    Lv, Aimin; Wang, Shengyin; Huang, Bingru

    2016-01-01

    Acid-Aluminum (Al) is toxic to plants and greatly affects crop production worldwide. To understand the responses of plants to acid soils and Aluminum toxicity, we examined global gene expression using microarray data in alfalfa seedlings with the treatment of acid-Aluminum. 3,926 genes that were identified significantly up- or downregulated in response to Al3+ ions with pH 4.5 treatment, 66.33% of which were found in roots. Their functional categories were mainly involved with phytohormone regulation, reactive oxygen species, and transporters. Both gene ontology (GO) enrichment and KEGG analysis indicated that phenylpropanoid biosynthesis, phenylalanine metabolism, and flavonoid biosynthesis played a critical role on defense to Aluminum stress in alfalfa. In addition, we found that transcription factors such as the MYB and WRKY family proteins may be also involved in the regulation of reactive oxygen species reactions and flavonoid biosynthesis. Thus, the finding of global gene expression profile provided insights into the mechanisms of plant defense to acid-Al stress in alfalfa. Understanding the key regulatory genes and pathways would be advantageous for improving crop production not only in alfalfa but also in other crops under acid-Aluminum stress. PMID:28074175

  8. Folic acid rivals methylenetetrahydrofolate reductase (MTHFR) gene-silencing effect on MEPM cell proliferation and apoptosis.

    PubMed

    Xiao, Wen-Lin; Wu, Min; Shi, Bing

    2006-11-01

    It's clear that environmental factors play a role in the aetiology of orofacial clefting (OFC) and an important area of future research will be to unravel interactions that occur between candidate genes and environmental factors during early development of the embryo. Periconceptional folic acid supplementation may reduce the risk of OFC. Polymorphisms in the methylenetetrahydrofolate reductase (MTHFR) gene reduce availability of 5-methylenetetrahydrofolate, the predominant circulating form of folic acid. To determine the effect of MTHFR gene mutation on murine embryonic palatal mesenchymal (MEPM) cells and the interaction with folic acid supplement, we used RNAi study in the primary cultures of MEPM cells. The cells of MTHFR gene silencing grew slower and the apoptosis cell number was more than the cells of control. Supplement with 20 microg/ml folic acid was the best to preventing teratogenic effect of MTHFR gene silencing. By flow cytometry analysis of cell cycle, results were shown that the MEPM cells were retarded in G(0)/G(1) after MTHFR gene silencing. While using 20 microg/ml folic acid supplements could make cell transit the G(1)/S restriction point and the cells growth was close to normal level.

  9. A fibrinolytic protease AfeE from Streptomyces sp. CC5, with potent thrombolytic activity in a mouse model.

    PubMed

    Sun, Zhibin; Liu, Pingping; Cheng, Guangyan; Zhang, Biying; Dong, Weiliang; Su, Xingli; Huang, Yan; Cui, Zhongli; Kong, Yi

    2016-04-01

    Fibrinolytic proteases have potential applications in cardiovascular disease therapy. A novel fibrinolytic protease, AfeE, with strong thrombolytic activity was purified from Streptomyces sp. CC5. AfeE displayed maximum activity at 40°C in the pH range of 7.0-12.0. It was strongly inhibited by serine protease inhibitor phenylmethanesulfonylfluoride, soybean trypsin inhibitor, tosyl-l-lysine chloromethyl ketone and tosyl-l-phenylalanine chloromethyl ketone. The activity of the enzyme was partially inhibited by Cu(2+), Co(2+) and Zn(2+). AfeE exhibited higher substrate specificity for fibrin than fibrinogen, which has rarely been reported in fibrinolytic enzymes. AfeE also showed high thrombolytic activity in a carrageenan-induced mouse tail thrombosis model. AfeE prolonged prothrombin time, activated partial thromboplastin time, and thrombin time in rat blood. A bleeding time assay revealed that AfeE did not prolong bleeding time in mice at a dose of 1mg/kg. No acute cytotoxicity was observed for AfeE at 320μg/well in human umbilical vein endothelial cells. The afeE gene was cloned from the genome of Streptomyces sp. CC5. Full-length AFE-CC5E contained 434 amino acids and was processed into a mature form consisting 284 amino acids by posttranslational modification, as revealed by high-resolution mass spectrometry analysis. These results indicate that AfeE is a prospective candidate for antithrombotic drug development.

  10. Cathepsin proteases in Toxoplasma gondii

    PubMed Central

    Dou, Zhicheng; Carruthers, Vern B.

    2014-01-01

    Cysteine proteases are important for the growth and survival of apicomplexan parasites that infect humans. The apicomplexan Toxoplasma gondii expresses five members of the C1 family of cysteine proteases, including one cathepsin L-like (TgCPL), one cathepsin B-like (TgCPB), and three cathepsin C-like (TgCPC1, 2 and 3) proteases. Recent genetic, biochemical and structural studies reveal that cathepsins function in microneme and rhoptry protein maturation, host cell invasion, replication, and nutrient acquisition.. Here, we review the key features and roles of T. gondii cathepsins and discuss the therapeutic potential for specific inhibitor development. PMID:21660658

  11. Gene expression levels are correlated with synonymous codon usage, amino acid composition, and gene architecture in the red flour beetle, Tribolium castaneum.

    PubMed

    Williford, Anna; Demuth, Jeffery P

    2012-12-01

    Gene expression levels correlate with multiple aspects of gene sequence and gene structure in phylogenetically diverse taxa, suggesting an important role of gene expression levels in the evolution of protein-coding genes. Here we present results of a genome-wide study of the influence of gene expression on synonymous codon usage, amino acid composition, and gene structure in the red flour beetle, Tribolium castaneum. Consistent with the action of translational selection, we find that synonymous codon usage bias increases with gene expression. However, the correspondence between tRNA gene copy number and optimal codons is weak. At the amino acid level, translational selection is suggested by the positive correlation between tRNA gene numbers and amino acid usage, which is stronger for highly expressed genes. In addition, there is a clear trend for increased use of metabolically cheaper, less complex amino acids as gene expression increases. tRNA gene numbers also correlate negatively with amino acid size/complexity (S/C) score indicating the coupling between translational selection and selection to minimize the use of large/complex amino acids. Interestingly, the analysis of 10 additional genomes suggests that the correlation between tRNA gene numbers and amino acid S/C score is widespread and might be explained by selection against negative consequences of protein misfolding. At the level of gene structure, three major trends are detected: 1) complete coding region length increases across low and intermediate expression levels but decreases in highly expressed genes; 2) the average intron size shows the opposite trend, first decreasing with expression, followed by a slight increase in highly expressed genes; and 3) intron density remains nearly constant across all expression levels. These changes in gene architecture are only in partial agreement with selection favoring reduced cost of biosynthesis.

  12. Regulatory Genes Controlling Fatty Acid Catabolism and Peroxisomal Functions in the Filamentous Fungus Aspergillus nidulans†

    PubMed Central

    Hynes, Michael J.; Murray, Sandra L.; Duncan, Anna; Khew, Gillian S.; Davis, Meryl A.

    2006-01-01

    The catabolism of fatty acids is important in the lifestyle of many fungi, including plant and animal pathogens. This has been investigated in Aspergillus nidulans, which can grow on acetate and fatty acids as sources of carbon, resulting in the production of acetyl coenzyme A (CoA). Acetyl-CoA is metabolized via the glyoxalate bypass, located in peroxisomes, enabling gluconeogenesis. Acetate induction of enzymes specific for acetate utilization as well as glyoxalate bypass enzymes is via the Zn2-Cys6 binuclear cluster activator FacB. However, enzymes of the glyoxalate bypass as well as fatty acid beta-oxidation and peroxisomal proteins are also inducible by fatty acids. We have isolated mutants that cannot grow on fatty acids. Two of the corresponding genes, farA and farB, encode two highly conserved families of related Zn2-Cys6 binuclear proteins present in filamentous ascomycetes, including plant pathogens. A single ortholog is found in the yeasts Candida albicans, Debaryomyces hansenii, and Yarrowia lipolytica, but not in the Ashbya, Kluyveromyces, Saccharomyces lineage. Northern blot analysis has shown that deletion of the farA gene eliminates induction of a number of genes by both short- and long-chain fatty acids, while deletion of the farB gene eliminates short-chain induction. An identical core 6-bp in vitro binding site for each protein has been identified in genes encoding glyoxalate bypass, beta-oxidation, and peroxisomal functions. This sequence is overrepresented in the 5′ region of genes predicted to be fatty acid induced in other filamentous ascomycetes, C. albicans, D. hansenii, and Y. lipolytica, but not in the corresponding genes in Saccharomyces cerevisiae. PMID:16682457

  13. IFN-λ gene polymorphisms as predictive factors in chronic hepatitis C treatment-naive patients without access to protease inhibitors.

    PubMed

    Olmedo, Daniele Blasquez; Cader, Samária Ali; Porto, Luís Cristóvão

    2015-10-01

    The single nucleotides polymorphisms analyses in the regions near the IL28B gene in patients chronically infected with genotype 1 hepatitis C virus (HCV) are an important predictive factor for sustained virological response (SVR). The aim was to assess the predictive value of the polymorphisms of the IL28B/IFNL3 gene in patients chronically infected with genotype 1 for the viral clearance obtained after initial treatment including admixed populations. A systematic review was conducted, using a meta-analysis in the PubMed, Embase, LILACS, and SCIELO using MesH and DECS in 42 studies. The parameters were IL28B polymorphisms, rs12979860, rs8099917, and rs12980275, SVR ratio, and OR (odds ratio). OR and confidence Interval of 95% (95%CI), were calculated by fixed or random effects models. Heterogeneity, sensitivity analysis, and publication bias were also performed. Significant differences were noted between carriers groups with the major versus minor allele at rs12979860 CC versus CT/TT-genotype (OR = 4.18; 95%CI = 3.37-5.17), rs8099917 TT versus TG/GG-genotype (OR = 4.07; 95%CI = 2.94-5.63), and rs12980275 AA versus AA/AG-genotype (OR = 5.34; 95%CI = 1.60-17.82). There was selection bias in the rs8099917 analysis (Egger's regression P = 0.049), which reversed after performing a sensitivity analysis (P = 0.510). The incorporation of SNP analyses in IL28B/IFNL3 gene during the diagnosis process in Brazil should be used as a complementary tool to determine the appropriate treatment for HCV genotype 1. Here, we confirm that the rs12979860 CC, rs8099917 TT, and rs12980275 AA genotype-carriers have favorable responses to standard therapy, including two studies with Brazilian population, and this information should be considered.

  14. Linoleic acid isomerase gene FgLAI12 affects sensitivity to salicylic acid, mycelial growth and virulence of Fusarium graminearum

    PubMed Central

    Zhang, Ya-Zhou; Wei, Zhen-Zhen; Liu, Cai-Hong; Chen, Qing; Xu, Bin-Jie; Guo, Zhen-Ru; Cao, Yong-Li; Wang, Yan; Han, Ya-Nan; Chen, Chen; Feng, Xiang; Qiao, Yuan-Yuan; Zong, Lu-Juan; Zheng, Ting; Deng, Mei; Jiang, Qian-Tao; Li, Wei; Zheng, You-Liang; Wei, Yu-Ming; Qi, Peng-Fei

    2017-01-01

    Fusarium graminearum is the major causal agent of fusarium head blight in wheat, a serious disease worldwide. Linoleic acid isomerase (LAI) catalyses the transformation of linoleic acid (LA) to conjugated linoleic acid (CLA), which is beneficial for human health. We characterised a cis-12 LAI gene of F. graminearum (FGSG_02668; FgLAI12), which was downregulated by salicylic acid (SA), a plant defence hormone. Disruption of FgLAI12 in F. graminearum resulted in decreased accumulation of cis-9,trans-11 CLA, enhanced sensitivity to SA, and increased accumulation of LA and SA in wheat spikes during infection. In addition, mycelial growth, accumulation of deoxynivalenol, and pathogenicity in wheat spikes were reduced. Re-introduction of a functional FgLAI12 gene into ΔFgLAI12 recovered the wild-type phenotype. Fluorescent microscopic analysis showed that FgLAI12 protein was usually expressed in the septa zone of conidia and the vacuole of hyphae, but was expressed in the cell membrane of hyphae in response to exogenous LA, which may be an element of LA metabolism during infection by F. graminearum. The cis-12 LAI enzyme encoded by FgLAI12 is critical for fungal response to SA, mycelial growth and virulence in wheat. The gene FgLAI12 is potentially valuable for biotechnological synthesis of cis-9,trans-11 CLA. PMID:28387243

  15. Immune-responsive gene 1 protein links metabolism to immunity by catalyzing itaconic acid production.

    PubMed

    Michelucci, Alessandro; Cordes, Thekla; Ghelfi, Jenny; Pailot, Arnaud; Reiling, Norbert; Goldmann, Oliver; Binz, Tina; Wegner, André; Tallam, Aravind; Rausell, Antonio; Buttini, Manuel; Linster, Carole L; Medina, Eva; Balling, Rudi; Hiller, Karsten

    2013-05-07

    Immunoresponsive gene 1 (Irg1) is highly expressed in mammalian macrophages during inflammation, but its biological function has not yet been elucidated. Here, we identify Irg1 as the gene coding for an enzyme producing itaconic acid (also known as methylenesuccinic acid) through the decarboxylation of cis-aconitate, a tricarboxylic acid cycle intermediate. Using a gain-and-loss-of-function approach in both mouse and human immune cells, we found Irg1 expression levels correlating with the amounts of itaconic acid, a metabolite previously proposed to have an antimicrobial effect. We purified IRG1 protein and identified its cis-aconitate decarboxylating activity in an enzymatic assay. Itaconic acid is an organic compound that inhibits isocitrate lyase, the key enzyme of the glyoxylate shunt, a pathway essential for bacterial growth under specific conditions. Here we show that itaconic acid inhibits the growth of bacteria expressing isocitrate lyase, such as Salmonella enterica and Mycobacterium tuberculosis. Furthermore, Irg1 gene silencing in macrophages resulted in significantly decreased intracellular itaconic acid levels as well as significantly reduced antimicrobial activity during bacterial infections. Taken together, our results demonstrate that IRG1 links cellular metabolism with immune defense by catalyzing itaconic acid production.

  16. ALTERED GENE EXPRESSION IN MOUSE LIVERS AFTER DICHLOROACETIC ACID EXPOSURE

    EPA Science Inventory

    Dichloroacetic acid (DCA) is a major by-product of water disinfection by chlorination. Several studies have demonstrated that DCA exhibits hepatocarcinogenic effects in rodents when administered in drinking water. The mechanism(s) involved in DCA induction of cancer are not clear...

  17. Effects of Protease, Phytase and a Bacillus sp. Direct-Fed Microbial on Nutrient and Energy Digestibility, Ileal Brush Border Digestive Enzyme Activity and Cecal Short-Chain Fatty Acid Concentration in Broiler Chickens

    PubMed Central

    Murugesan, Ganapathi R.; Romero, Luis F.; Persia, Michael E.

    2014-01-01

    Two experiments were conducted to determine the effects of protease and phytase (PP) and a Bacillus sp. direct-fed microbial (DFM) on dietary energy and nutrient utilization in broiler chickens. In the first experiment, Ross 308 broiler chicks were fed diets supplemented with PP and DFM in a 2×2 factorial arrangement. The 4 diets (control (CON), CON + PP, CON + DFM, and CON + PP + DFM) were fed from 15–21 days of age. In Experiment 1, significant interaction (P≤0.01) between PP and DFM on the apparent ileal digestibility coefficient for starch, crude protein, and amino acid indicated that both additives increased the digestibility. Both additives increased the nitrogen retention coefficient with a significant interaction (P≤0.01). Although no interaction was observed, significant main effects (P≤0.01) for nitrogen-corrected apparent ME (AMEn) for PP or DFM indicated an additive response. In a follow-up experiment, Ross 308 broiler chicks were fed the same experimental diets from 1–21 days of age. Activities of ileal brush border maltase, sucrase, and L-alanine aminopeptidase were increased (P≤0.01) by PP addition, while a trend (P = 0.07) for increased sucrase activity was observed in chickens fed DFM, in Experiment 2. The proportion of cecal butyrate was increased (P≤0.01) by DFM addition. Increased nutrient utilization and nitrogen retention appear to involve separate but complementary mechanisms for PP and DFM, however AMEn responses appear to have separate and additive mechanisms. PMID:25013936

  18. Serine Proteases of Parasitic Helminths

    PubMed Central

    Yang, Yong; Wen, Yun jun; Cai, Ya Nan; Vallée, Isabelle; Boireau, Pascal; Liu, Ming Yuan; Cheng, Shi Peng

    2015-01-01

    Serine proteases form one of the most important families of enzymes and perform significant functions in a broad range of biological processes, such as intra- and extracellular protein metabolism, digestion, blood coagulation, regulation of development, and fertilization. A number of serine proteases have been identified in parasitic helminths that have putative roles in parasite development and nutrition, host tissues and cell invasion, anticoagulation, and immune evasion. In this review, we described the serine proteases that have been identified in parasitic helminths, including nematodes (Trichinella spiralis, T. pseudospiralis, Trichuris muris, Anisakis simplex, Ascaris suum, Onchocerca volvulus, O. lienalis, Brugia malayi, Ancylostoma caninum, and Steinernema carpocapsae), cestodes (Spirometra mansoni, Echinococcus granulosus, and Schistocephalus solidus), and trematodes (Fasciola hepatica, F. gigantica, and Schistosoma mansoni). Moreover, the possible biological functions of these serine proteases in the endogenous biological phenomena of these parasites and in the host-parasite interaction were also discussed. PMID:25748703

  19. Interfering ribonucleic acids that suppress expression of multiple unrelated genes

    PubMed Central

    Passioura, Toby; Gozar, Mary M; Goodchild, Amber; King, Andrew; Arndt, Greg M; Poidinger, Michael; Birkett, Donald J; Rivory, Laurent P

    2009-01-01

    Background Short interfering RNAs (siRNAs) have become the research tool of choice for gene suppression, with human clinical trials ongoing. The emphasis so far in siRNA therapeutics has been the design of one siRNA with complete complementarity to the intended target. However, there is a need for multi-targeting interfering RNA in diseases in which multiple gene products are of importance. We have investigated the possibility of using a single short synthetic duplex RNA to suppress the expression of VEGF-A and ICAM-1; genes implicated in the progression of ocular neovascular diseases such as diabetic retinopathy. Results Duplex RNA were designed to have incomplete complementarity with the 3'UTR sequences of both target genes. One such duplex, CODEMIR-1, was found to suppress VEGF and ICAM-1 by 90 and 60%, respectively in ARPE-19 cells at a transfected concentration of 40 ng/mL. Use of a cyan fusion reporter with target sites constructed in its 3'UTR demonstrated that the repression of VEGF and ICAM-1 by CODEMIR-1 was indeed due to interaction with the target sequence. An exhaustive analysis of sequence variants of CODEMIR-1 demonstrated a clear positive correlation between activity against VEGF (but not ICAM-1) and the length of the contiguous complementary region (from the 5' end of the guide strand). Various strategies, including the use of inosine bases at the sites of divergence of the target sequences were investigated. Conclusion Our work demonstrates the possibility of designing multitargeting dsRNA to suppress more than one disease-altering gene. This warrants further investigation as a possible therapeutic approach. PMID:19531249

  20. Utilization of lactic acid bacterial genes in Synechocystis sp. PCC 6803 in the production of lactic acid.

    PubMed

    Joseph, Ancy; Aikawa, Shimpei; Sasaki, Kengo; Tsuge, Yota; Matsuda, Fumio; Tanaka, Tsutomu; Kondo, Akihiko

    2013-01-01

    Metabolic pathway engineering of cyanobacteria for the production of industrially important chemicals from atmospheric CO2 has generated interest recently. Here, we engineered Synechocystis sp. PCC 6803 to produce lactic acid using a lactate dehydrogenase (ldh) gene from various lactic acid-producing bacteria, Lactococcus lactis (ldhB and ldhX), Lactobacillus plantarum (ldhL and ldh), and Lactobacillus rhamnosus (ldhL). The lactic acid was secreted outside the cell using a transporter (lldp) gene from L. plantarum. Expression of each ldh in Synechocystis sp. PCC6803 was ascertained by reverse-transcriptase polymerase chain reaction. Five transformants led to the production of L-lactic acid. Co-expression of lldp with ldhB from L. plantarum or ldhL from L. rhamnosus led to the secretion of lactic acid into the medium at concentration of 0.17 ± 0.02 or 0.14 ± 0.02 mM after 18 d of cultivation.

  1. The Arabidopsis thaliana REDUCED EPIDERMAL FLUORESCENCE1 Gene Encodes an Aldehyde Dehydrogenase Involved in Ferulic Acid and Sinapic Acid Biosynthesis

    PubMed Central

    Nair, Ramesh B.; Bastress, Kristen L.; Ruegger, Max O.; Denault, Jeff W.; Chapple, Clint

    2004-01-01

    Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP+-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall–esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes. PMID:14729911

  2. Tissue Specific Expression Levels of Apoptosis Involved Genes Have Correlations with Codon and Amino Acid Usage

    PubMed Central

    Sadeghi, Iman; Salavaty, Abbas; Nasiri, Habib

    2016-01-01

    Different mechanisms, including transcriptional and post transcriptional processes, regulate tissue specific expression of genes. In this study, we report differences in gene/protein compositional features between apoptosis involved genes selectively expressed in human tissues. We found some correlations between codon/amino acid usage and tissue specific expression level of genes. The findings can be significant for understanding the translational selection on these features. The selection may play an important role in the differentiation of human tissues and can be considered for future studies in diagnosis of some diseases such as cancer. PMID:28154517

  3. Purification and characterization of a fibrinolytic subtilisin-like protease of Bacillus subtilis TP-6 from an Indonesian fermented soybean, Tempeh.

    PubMed

    Kim, Seong-Bo; Lee, Dong-Woo; Cheigh, Chan-Ick; Choe, Eun-Ah; Lee, Sang-Jae; Hong, Young-Ho; Choi, Hak-Jong; Pyun, Yu-Ryang

    2006-06-01

    We have isolated a bacterium (TP-6) from the Indonesian fermented soybean, Tempeh, which produces a strong fibrinolytic protease and was identified as Bacillus subtilis. The protease (TPase) was purified to homogeneity by ammonium sulfate fractionation and octyl sepharose and SP sepharose chromatography. The N-terminal amino acid sequence of the 27.5 kDa enzyme was determined, and the encoding gene was cloned and sequenced. The result demonstrates that TPase is a serine protease of the subtilisin family consisting of 275 amino acid residues in its mature form. Its apparent K (m) and V (max) for the synthetic substrate N-succinyl-Ala-Ala-Pro-Phe-pNA were 259 microM and 145 micromol mg(-1) min(-1), respectively. The fibrinogen degradation pattern generated by TPase as a function of time was similar to that obtained with plasmin. In addition, N-terminal amino acid sequence analysis of the fibrinogen degradation products demonstrated that TPase cleaves Glu (or Asp) near hydrophobic acids as a P1 site in the alpha- and beta-chains of fibrinogen to generate fragments D', E', and D' similar to those generated by plasmin. On plasminogen-rich fibrin plates, TPase did not seem to activate fibrin clot lysis. Moreover, the enzyme converted the active plasminogen activator inhibitor-1 to the latent form.

  4. Lvserpin3 is involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

    PubMed

    Liu, Yongjie; Liu, Tao; Hou, Fujun; Wang, Xianzong; Liu, Xiaolin

    2016-01-01

    Serine protease inhibitor, represented by serpin, plays an important inhibitory role on proteases involved in the immune responses. To clarify the immune characterizations of serpin, a novel serpin (Lvserpin3) encoding for 410 amino acids with a 23-amino acid signal peptide and a serpin domain was identified from the Pacific white shrimp Litopenaeus vannamei. Lvserpin3 expressed strongest in hepatopancreas, and was significantly up-regulated in the early stage upon Vibrio anguillarum, Micrococcus lysodeikticus or White Spot Syndrome Virus (WSSV) infection. Suppression of Lvserpin3 by dsRNA led to a significant increase in the transcripts of LvPPAF, LvproPO and phenoloxidase (PO) activity, and also led to the high cumulative mortality. The recombinant Lvserpin3 protein (rLvserpin3) inhibited the proteases secreted by M. lysodeikticus and Bacillus subtilis, and further exhibited inhibitory role on the growth of B. subtilis and M. lysodeikticu. Moreover, rLvserpin3 was found to be able to block the activation of prophenoloxidase system. Taken together, the results imply that Lvserpin3 may be involved in shrimp innate immunity via the inhibition of bacterial proteases and proteases involved in prophenoloxidase system.

  5. Identification of novel tumor suppressor proteases by degradome profiling of colorectal carcinomas

    PubMed Central

    Fraile, Julia M.; Ordóñez, Gonzalo R.; Quirós, Pedro M.; Astudillo, Aurora; Galván, José A.; Colomer, Dolors; López-Otín, Carlos; Freije, José M.P.; Puente, Xose S.

    2013-01-01

    Proteolytic enzymes play important roles during tumor development and progression through their ability to promote cell growth or by facilitating the invasion of surrounding tissues. The human genome contains more than 570 protease-coding genes, many of them forming functional networks, which has forced the use of global strategies for the analysis of this group of enzymes. In this study, we have designed a new quantitative PCR-based device for profiling the entire degradome in human malignancies. We have used this method to evaluate protease expression levels in colorectal carcinomas with the finding that most proteases with altered expression in these tumors exert their function in the extracellular compartment. In addition, we have found that among genes encoding repressed proteases there was a higher proportion with somatic mutations in colorectal cancer when compared to genes coding for upregulated proteases (14% vs. 4%, p<0.05). One of these genes, MASP3, is consistently repressed in colorectal carcinomas as well as in colorectal cancer cell lines when compared to normal colonic mucosa. Functional analysis of this gene revealed that ectopic expression of MASP3 reduces cell proliferation in vitro and restrains subcutaneous tumor growth, whereas its downregulation induces an increase in the tumorigenic potential of colorectal cancer cells. These results provide new insights into the diversity of proteases associated with cancer and support the utility of degradome profiling to identify novel proteases with tumor-defying functions.

  6. Identification of novel tumor suppressor proteases by degradome profiling of colorectal carcinomas.

    PubMed

    Fraile, Julia M; Ordóñez, Gonzalo R; Quirós, Pedro M; Astudillo, Aurora; Galván, José A; Colomer, Dolors; López-Otín, Carlos; Freije, José M P; Puente, Xose S

    2013-11-01

    Proteolytic enzymes play important roles during tumor development and progression through their ability to promote cell growth or by facilitating the invasion of surrounding tissues. The human genome contains more than 570 protease-coding genes, many of them forming functional networks, which has forced the use of global strategies for the analysis of this group of enzymes. In this study, we have designed a new quantitative PCR-based device for profiling the entire degradome in human malignancies. We have used this method to evaluate protease expression levels in colorectal carcinomas with the finding that most proteases with altered expression in these tumors exert their function in the extracellular compartment. In addition, we have found that among genes encoding repressed proteases there was a higher proportion with somatic mutations in colorectal cancer when compared to genes coding for upregulated proteases (14% vs. 4%, p<0.05). One of these genes, MASP3, is consistently repressed in colorectal carcinomas as well as in colorectal cancer cell lines when compared to normal colonic mucosa. Functional analysis of this gene revealed that ectopic expression of MASP3 reduces cell proliferation in vitro and restrains subcutaneous tumor growth, whereas its downregulation induces an increase in the tumorigenic potential of colorectal cancer cells. These results provide new insights into the diversity of proteases associated with cancer and support the utility of degradome profiling to identify novel proteases with tumor-defying functions.

  7. Application of Protease Technology in Dermatology

    PubMed Central

    Del Rosso, James Q.

    2013-01-01

    This article reviews background on proteases and their functions, their physiological significance in skin, and the potential implications of incorporating specific proteases and protease blends into dermatological products, including skin care formulations. The history of protease blend formulations used in wound model studies and for other disorders is reviewed. In vitro data with use of a specific 3-protease blend with evaluation of the impact on various skin proteins and peptides is also discussed in this article. PMID:23882305

  8. The AAA+ ATPases and HflB/FtsH proteases of 'Candidatus Phytoplasma mali': phylogenetic diversity, membrane topology, and relationship to strain virulence.

    PubMed

    Seemüller, Erich; Sule, Sandor; Kube, Michael; Jelkmann, Wilhelm; Schneider, Bernd

    2013-03-01

    Previous examination revealed a correlation of phytopathogenic data of 'Candidatus Phytoplasma mali' strains and the DNA sequence variability of a type ATP00464 hflB gene fragment. To further investigate such a relationship, all distinct genes previously annotated as hflB in the genome of 'Ca. P. mali' strain AT were fully sequenced and analyzed from a number of representative mild, moderate, and severe strains. The re-annotation indicated that the sequences encode six AAA+ ATPases and six HflB proteases. Each of the nine distinct deduced AAA+ proteins that were examined formed a coherent phylogenetic cluster. However, within these groups, sequences of three ATPases and three proteases from mild and severe strains clustered distantly, according to their virulence. This grouping was supported by an association with virulence-related amino acid substitutions. Another finding was that full-length genes from ATPase AP11 could only be identified in mild and moderate strains. Prediction of the membrane topology indicated that the long ATPase- and protease-carrying C-terminal tails of approximately half of the AAA+ proteins are extracellular, putatively facing the environment of the sieve tubes. Thus, they may be involved in pathogen-host interactions and may compromise phloem function, a major effect of phytoplasma infection. All full-length genes examined appear transcriptionally active and all deduced peptides show the key positions indicative for protein function.

  9. Multiplexed analysis of genes using nucleic acid-stabilized silver-nanocluster quantum dots.

    PubMed

    Enkin, Natalie; Wang, Fuan; Sharon, Etery; Albada, H Bauke; Willner, Itamar

    2014-11-25

    Luminescent nucleic acid-stabilized Ag nanoclusters (Ag NCs) are applied for the optical detection of DNA and for the multiplexed analysis of genes. Two different sensing modules including Ag NCs as luminescence labels are described. One sensing module involves the assembly of a three-component sensing module composed of a nucleic acid-stabilized Ag NC and a quencher-modified nucleic acid hybridized with a nucleic acid scaffold that is complementary to the target DNA. The luminescence of the Ag NCs is quenched in the sensing module nanostructure. The strand displacement of the scaffold by the target DNA separates the nucleic acid-functionalized Ag NCs, leading to the turned-on luminescence of the NCs and to the optical readout of the sensing process. By implementing two different-sized Ag NC-modified sensing modules, the parallel multiplexed analysis of two genes (the Werner Syndrome gene and the HIV, human immunodeficiency, gene), using 615 and 560 nm luminescent Ag NCs, is demonstrated. The second sensing module includes the nucleic acid functionalized Ag NCs and the quencher-modified nucleic acid hybridized with a hairpin DNA scaffold. The luminescence of the Ag NCs is quenched in the sensing module. Opening of the hairpin by the target DNA triggers the luminescence of the Ag NCs, due to the spatial separation of the Ag NCs/quencher units. The system is applied for the optical detection of the BRAC1 gene. In addition, by implementing two-sized Ag NCs, the multiplexed analysis of two genes by the hairpin sensing module approach is demonstrated.

  10. The expansion of amino-acid repeats is not associated to adaptive evolution in mammalian genes

    PubMed Central

    2009-01-01

    Background The expansion of amino acid repeats is determined by a high mutation rate and can be increased or limited by selection. It has been suggested that recent expansions could be associated with the potential of adaptation to new environments. In this work, we quantify the strength of this association, as well as the contribution of potential confounding factors. Results Mammalian positively selected genes have accumulated more recent amino acid repeats than other mammalian genes. However, we found little support for an accelerated evolutionary rate as the main driver for the expansion of amino acid repeats. The most significant predictors of amino acid repeats are gene function and GC content. There is no correlation with expression level. Conclusions Our analyses show that amino acid repeat expansions are causally independent from protein adaptive evolution in mammalian genomes. Relaxed purifying selection or positive selection do not associate with more or more recent amino acid repeats. Their occurrence is slightly favoured by the sequence context but mainly determined by the molecular function of the gene. PMID:20021652

  11. Analysis of the aspartic acid metabolic pathway using mutant genes.

    PubMed

    Azevedo, R A

    2002-01-01

    Amino acid metabolism is a fundamental process for plant growth and development. Although a considerable amount of information is available, little is known about the genetic control of enzymatic steps or regulation of several pathways. Much of the information about biochemical pathways has arisen from the use of mutants lacking key enzymes. Although mutants were largely used already in the 60's, by bacterial and fungal geneticists, it took plant research a long time to catch up. The advance in this area was rapid in the 80's, which was followed in the 90's by the development of techniques of plant transformation. In this review we present an overview of the aspartic acid metabolic pathway, the key regulatory enzymes and the mutants and transgenic plants produced for lysine and threonine metabolism. We also discuss and propose a new study of high-lysine mutants.

  12. Foreign gene recruitment to the fatty acid biosynthesis pathway in diatoms.

    PubMed

    Chan, Cheong Xin; Baglivi, Francesca L; Jenkins, Christina E; Bhattacharya, Debashish

    2013-09-01

    Diatoms are highly successful marine and freshwater algae that contribute up to 20% of global carbon fixation. These species are leading candidates for biofuel production owing to ease of culturing and high fatty acid content. To assist in strain improvement and downstream applications for potential use as a biofuel, it is important to understand the evolution of lipid biosynthesis in diatoms. The evolutionary history of diatoms is however complicated by likely multiple endosymbioses involving the capture of foreign cells and horizontal gene transfer into the host genome. Using a phylogenomic approach, we assessed the evolutionary history of 12 diatom genes putatively encoding functions related to lipid biosynthesis. We found evidence of gene transfer likely from a green algal source for seven of these genes, with the remaining showing either vertical inheritance or evolutionary histories too complicated to interpret given current genome data. The functions of horizontally transferred genes encompass all aspects of lipid biosynthesis (initiation, biosynthesis, and desaturation of fatty acids) as well as fatty acid elongation, and are not restricted to plastid-targeted proteins. Our findings demonstrate that the transfer, duplication, and subfunctionalization of genes were key steps in the evolution of lipid biosynthesis in diatoms and other photosynthetic eukaryotes. This target pathway for biofuel research is highly chimeric and surprisingly, our results suggest that research done on related genes in green algae may have application to diatom models.

  13. Serine proteases, serine protease inhibitors, and protease-activated receptors: roles in synaptic function and behavior.

    PubMed

    Almonte, Antoine G; Sweatt, J David

    2011-08-17

    Serine proteases, serine protease inhibitors, and protease-activated receptors have been intensively investigated in the periphery and their roles in a wide range of processes-coagulation, inflammation, and digestion, for example-have been well characterized (see Coughlin, 2000; Macfarlane et al., 2001; Molinari et al., 2003; Wang et al., 2008; Di Cera, 2009 for reviews). A growing number of studies demonstrate that these protein systems are widely expressed in many cell types and regions in mammalian brains. Accumulating lines of evidence suggest that the brain has co-opted the activities of these interesting proteins to regulate various processes underlying synaptic activity and behavior. In this review, we discuss emerging roles for serine proteases in the regulation of mechanisms underlying synaptic plasticity and memory formation.

  14. Mutations of the Corynebacterium glutamicum NCgl1221 gene, encoding a mechanosensitive channel homolog, induce L-glutamic acid production.

    PubMed

    Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki

    2007-07-01

    Corynebacterium glutamicum is a biotin auxotroph that secretes L-glutamic acid in response to biotin limitation; this process is employed in industrial L-glutamic acid production. Fatty acid ester surfactants and penicillin also induce L-glutamic acid secretion, even in the presence of biotin. However, the mechanism of L-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in L-glutamic acid secretion without induction. In this study, we analyzed odhA disruptants and found that those which exhibited constitutive L-glutamic acid secretion carried additional mutations in the NCgl1221 gene, which encodes a mechanosensitive channel homolog. These NCgl1221 gene mutations lead to constitutive L-glutamic acid secretion even in the absence of odhA disruption and also render cells resistant to an L-glutamic acid analog, 4-fluoroglutamic acid. Disruption of the NCgl1221 gene essentially abolishes L-glutamic acid secretion, causing an increase in the intracellular L-glutamic acid pool under biotin-limiting conditions, while amplification of the wild-type NCgl1221 gene increased L-glutamate secretion, although only in response to induction. These results suggest that the NCgl1221 gene encodes an L-glutamic acid exporter. We propose that treatments that induce L-glutamic acid secretion alter membrane tension and trigger a structural transformation of the NCgl1221 protein, enabling it to export L-glutamic acid.

  15. Modification of nitrogen remobilization, grain fill and leaf senescence in maize (Zea mays) by transposon insertional mutagenesis in a protease gene.

    PubMed

    Donnison, Iain S; Gay, Alan P; Thomas, Howard; Edwards, Keith J; Edwards, David; James, Caron L; Thomas, Ann M; Ougham, Helen J

    2007-01-01

    A maize (Zea mays) senescence-associated legumain gene, See2beta, was characterized at the physiological and molecular levels to determine its role in senescence and resource allocation. A reverse-genetics screen of a maize Mutator (Mu) population identified a Mu insertion in See2beta. Maize plants homozygous for the insertion were produced. These See2 mutant and sibling wild-type plants were grown under high or low quantities of nitrogen (N). The early development of both genotypes was similar; however, tassel tip and collar emergence occurred earlier in the mutant. Senescence of the mutant leaves followed a similar pattern to that of wild-type leaves, but at later sampling points mutant plants contained more chlorophyll than wild-type plants and showed a small extension in photosynthetic activity. Total plant weight was higher in the wild-type than in the mutant, and there was a genotype x N interaction. Mutant plants under low N maintained cob weight, in contrast to wild-type plants under the same treatment. It is concluded, on the basis of transposon mutagenesis, that See2beta has an important role in N-use and resource allocation under N-limited conditions, and a minor but significant function in the later stages of senescence.

  16. Association of a protease with polytene chromosomes of Drosophila melanogaster.

    PubMed

    Cavagnaro, J; Pierce, D A; Lucchesi, J C; Chae, C B

    1980-11-01

    Incubation of Drosophila salivary glands with radioactive diisopropyl fluorophosphate results in the uniform labeling of polytene chromosomes. Extensive labeling is seen only when chromosome squashes are prepared by a formaldehyde fixation procedure and not by standard acetic acid techniques. The labeling is inhibited in the presence of tosylphenylalanine chloromethyl ketone and phenylmethane sulfonylfluoride but not by tosyllysine chloromethyl ketone, suggesting that a chymotrypsin-like serine protease is associated with the chromosomes. Protease inhibitors show no apparent effect on heat-shock specific puffing.

  17. Acidic duodenal pH alters gene expression in the cystic fibrosis mouse pancreas.

    PubMed

    Kaur, Simran; Norkina, Oxana; Ziemer, Donna; Samuelson, Linda C; De Lisle, Robert C

    2004-08-01

    The duodenum is abnormally acidic in cystic fibrosis (CF) due to decreased bicarbonate ion secretion that is dependent on the CF gene product CFTR. In the CFTR null mouse, the acidic duodenum results in increased signaling from the intestine to the exocrine pancreas in an attempt to stimulate pancreatic bicarbonate ion secretion. Excess stimulation is proposed to add to the stress/inflammation of the pancreas in CF. DNA microarray analysis of the CF mouse revealed altered pancreatic gene expression characteristic of stress/inflammation. When the duodenal pH was corrected genetically (crossing CFTR null with gastrin null mice) or pharmacologically (use of the proton pump inhibitor omeprazole), expression levels of genes measured by quantitative RT-PCR were significantly normalized. It is concluded that the acidic duodenal pH in CF contributes to the stress on the exocrine pancreas and that normalizing duodenal pH reduces this stress.

  18. Collagenolytic subtilisin-like protease from the deep-sea bacterium Alkalimonas collagenimarina AC40T.

    PubMed

    Kurata, Atsushi; Uchimura, Kohsuke; Kobayashi, Tohru; Horikoshi, Koki

    2010-03-01

    A new alkaline protease (AcpII) was purified from a culture of the deep-sea bacterium Alkalimonas collagenimarina AC40(T). AcpII degraded collagen three times faster than it degraded casein. The optimal pH was 8.5-9, and the optimal temperature was 45 degrees C for the degradation of collagen. AcpII was completely inhibited by phenylmethylsulfonyl fluoride and partially by EDTA. Cloning and sequencing the gene for AcpII revealed a 2,283-bp open reading frame encoding a protein of 760 amino acids. AcpII comprises a prepropeptide, a catalytic domain that includes a protease-associated domain (PA domain), and tandem repeat prepeptidase C-terminal domains. To elucidate the role of the PA domain of AcpII, we constructed genes for two enzyme derivatives that possessed the catalytic domains with or without the PA domain and expressed them in Escherichia coli. The derivative without the PA domain showed increased specific activities toward all proteinaceous substrates tested, including gelatin, casein, and collagen, compared with those of the derivative with the PA domain.

  19. Location of functional regions of the Escherichia coli RecA protein by DNA sequence analysis of RecA protease-constitutive mutants.

    PubMed Central

    Wang, W B; Tessman, E S

    1986-01-01

    In previous work (E. S. Tessman and P. K. Peterson, J. Bacteriol. 163:677-687 and 688-695, 1985), we isolated many novel protease-constitutive (Prtc) recA mutants, i.e., mutants in which the RecA protein was always in the protease state without the usual need for DNA damage to activate it. Most Prtc mutants were recombinase positive and were designated Prtc Rec+; only a few Prtc mutants were recombinase negative, and those were designated Prtc Rec-. We report changes in DNA sequence of the recA gene for several of these mutants. The mutational changes clustered at three regions on the linear RecA polypeptide. Region 1 includes amino acid residues 25 through 39, region 2 includes amino acid residues 157 through 184, and region 3 includes amino acid residues 298 through 301. The in vivo response of these Prtc mutants to different effectors suggests that the RecA effector-binding sites have been altered. In particular we propose that the mutations may define single-stranded DNA- and nucleoside triphosphate-binding domains of RecA, that polypeptide regions 1 and 3 comprise part of the single-stranded DNA-binding domain, and that polypeptide regions 2 and 3 comprise part of the nucleoside triphosphate-binding domain. The overlapping of single-stranded DNA- and nucleoside triphosphate-binding domains in region 3 can explain previously known complex allosteric effects. Each of four Prtc Rec- mutants sequenced was found to contain a single amino acid change, showing that the change of just one amino acid can affect both the protease and recombinase activities and indicating that the functional domains for these two activities of RecA overlap. A recA promoter-down mutation was isolated by its ability to suppress the RecA protease activity of one of our strong Prtc mutants. PMID:3536864

  20. Proteochemometrics mapping of the interaction space for retroviral proteases and their substrates.

    PubMed

    Kontijevskis, Aleksejs; Petrovska, Ramona; Yahorava, Sviatlana; Komorowski, Jan; Wikberg, Jarl E S

    2009-07-15

    Understanding the complex interactions of retroviral proteases with their ligands is an important scientific challenge in efforts to achieve control of retroviral infections. Development of drug resistance because of high mutation rates and extensive polymorphisms causes major problems in treating the deadly diseases these viruses cause, and prompts efforts to identify new strategies. Here we report a comprehensive analysis of the interaction of 63 retroviral proteases from nine different viral species with their substrates and inhibitors based on publicly available data from the past 17years of retroviral research. By correlating physico-chemical descriptions of retroviral proteases and substrates to their biological activities we constructed a highly statistically valid 'proteochemometric' model for the interactome of retroviral proteases. Analysis of the model indicated amino acid positions in retroviral proteases with the highest influence on ligand activity and revealed general physicochemical properties essential for tight binding of substrates across multiple retroviral proteases. Hexapeptide inhibitors developed based on the discovered general properties effectively inhibited HIV-1 proteases in vitro, and some exhibited uniformly high inhibitory activity against all HIV-1 proteases mutants evaluated. A generalized proteochemometric model for retroviral proteases interactome has been created and analysed in this study. Our results demonstrate the feasibility of using the developed general strategy in the design of inhibitory peptides that can potentially serve as templates for drug resistance-improved HIV retardants.

  1. Immobilized protease on the magnetic nanoparticles used for the hydrolysis of rapeseed meals

    NASA Astrophysics Data System (ADS)

    Jin, Xin; Li, Ju-Fang; Huang, Ping-Ying; Dong, Xu-Yan; Guo, Lu-Lu; Yang, Liang; Cao, Yuan-Cheng; Wei, Fang; Zhao, Yuan-Di; Chen, Hong

    2010-07-01

    (3-aminopropl) triethoxysilaneand modified magnetic nanoparticles with the average diameter of 25.4 nm were synthesized in water-phase co-precipitation method. And then these nanoparticles were covalently coupled with alkaline protease as enzyme carrier by using 1,4-phenylene diisothlocyanate as coupling agent. Experiments showed that the immobilized protease can keep the catalytic bioactivity, which can reach to 47.8% when casein was served as substrate. Results showed that the catalytic activity of immobilized protease on these magnetic nanoparticles could retain 98.63±2.37% after 60 days. And it is more stable than the free protease during the shelf-life test. The enzyme reaction conditions such as optimum reaction temperature and pH are the same as free protease. Furthermore, mix-and-separate experiments showed that the immobilized protease could be recycled through the magnetic nanoparticles after the biocatalysis process. When the rapeseed meals were used as substrate, the degree of hydrolysis of immobilized alkaline protease achieved 9.86%, while it was 10.41% for the free protease. The macromolecular proteins of rapeseed meals were hydrolyzed by immobilized protease into small molecules such as polypeptides or amino acids. Thus, a novel efficient and economic way for the recycling of enzymes in the application of continuous production of active peptides was provided based on these magnetic nanoparticles.

  2. Dynamic changes in prefrontal cortex gene expression following lysergic acid diethylamide administration.

    PubMed

    Nichols, Charles D; Garcia, Efrain E; Sanders-Bush, Elaine

    2003-03-17

    Lysergic acid diethylamide (LSD) is a psychoactive drug that transiently alters human perception, behavior, and mood at extremely low doses. Certain aspects of the behavior elicited by acute doses of LSD closely resemble symptoms of mental disorders such as schizophrenia. Characterizing gene expression profiles after LSD will be important for understanding how it alters behavior, and will lead to novel insights into disorders, such as schizophrenia, whose behavioral symptoms resemble the temporary effects of hallucinogenic drugs. We previously identified a small collection of genes within the rat prefrontal cortex that respond to LSD. Many of the products of these genes are involved in the process of synaptic plasticity. In the current report, we present a detailed analysis of the expression of these genes within the brain using RNase protection analysis. We find that the gene response to LSD is quite dynamic. The expression of some genes increases rapidly and decreases rapidly, while other genes change more gradually. Dose-response studies show two classes of expression; gene expression maximally stimulated at lower doses, versus gene expression that continues to rise at the higher doses. The role of the 5-HT(1A) and 5-HT(2A) receptor in mediating the increases in gene expression was examined in a series of experiments using receptor specific antagonists. Most expression increases were due to activation of the 5-HT(2A) receptor, however expression of two genes had neither a 5-HT(1A) nor a 5-HT(2A) receptor component.

  3. Short Chain Fatty Acids (SCFA) Reprogram Gene Expression in Human Malignant Epithelial and Lymphoid Cells

    PubMed Central

    Astakhova, Lidiia; Ngara, Mtakai; Babich, Olga; Prosekov, Aleksandr; Asyakina, Lyudmila; Dyshlyuk, Lyubov; Midtvedt, Tore; Zhou, Xiaoying; Ernberg, Ingemar; Matskova, Liudmila

    2016-01-01

    The effect of short chain fatty acids (SCFAs) on gene expression in human, malignant cell lines was investigated, with a focus on signaling pathways. The commensal microbial flora produce high levels of SCFAs with established physiologic effects in humans. The most abundant SCFA metabolite in the human microflora is n-butyric acid. It is well known to activate endogenous latent Epstein-Barr virus (EBV), that was used as a reference read out system and extended to EBV+ epithelial cancer cell lines. N-butyric acid and its salt induced inflammatory and apoptotic responses in tumor cells of epithelial and lymphoid origin. Epithelial cell migration was inhibited. The n-butyric gene activation was reduced by knock-down of the cell membrane transporters MCT-1 and -4 by siRNA. N-butyric acid show biologically significant effects on several important cellular functions, also with relevance for tumor cell phenotype. PMID:27441625

  4. Heterogenous expression of poly-gamma-glutamic acid synthetase complex gene of Bacillus licheniformis WBL-3.

    PubMed

    Wang, N; Yang, G; Che, C; Liu, Y

    2011-01-01

    Bacillus licheniformis WBL-3, one of poly-gamma-glutamic acid (gamma-PGA) producers, depends on the existence of glutamate in the medium. In this paper, gamma-PGA synthetase complex gene (pgsBCA) was cloned from Bacillus licheniformis WBL-3. pgsBCA gene of B. licheniformis WBL-3 was highly homologous with pgsBCA gene of B. licheniformis 14580. The similarity was 97%, but the similarity of pgsBCA gene between B. licheniformis WBL-3 and Bacillus subtilis IF03336 was only 74%. However, when pgsBCA was expressed in Escherichia coli, the E. coli clone produced gamma-PGA extracellularly. The yield of gamma-PGA was 8.624 g/l. This result infers that B. licheniformis and B. subtilis has the similar gamma-PGA biosynthesis mechanism, namely, glutamic acid is catalyzed by an ATP-dependent amide ligase to synthesize gamma-PGA.

  5. Expression analysis for genes involved in arachidonic acid biosynthesis in Mortierella alpina CBS 754.68.

    PubMed

    Samadlouie, Hamid-Reza; Hamidi-Esfahani, Zohreh; Alavi, Seyed-Mehdi; Varastegani, Boshra

    2014-01-01

    The time courses for production of fungal biomass, lipid, phenolic and arachidonic acid (ARA) as well as expression of the genes involved in biosynthesis of ARA and lipid were examined in Mortierella alpina CBS 754.68. A significant increase in the arachidonic acid content in lipids that coincided with reduced levels of lipid was obtained. Reduced gene expression occurred presumably due to the steady reduction of carbon and nitrogen resources. However, these energy resources were inefficiently compensated by the breakdown of the accumulated lipids that in turn, induced up-regulated expression of the candidate genes. The results further indicated that the expression of the GLELO encoding gene is a rate-limiting step in the biosynthesis of ARA in the early growth phase.

  6. KLIKK proteases of Tannerella forsythia: putative virulence factors with a unique domain structure.

    PubMed

    Ksiazek, Miroslaw; Mizgalska, Danuta; Eick, Sigrum; Thøgersen, Ida B; Enghild, Jan J; Potempa, Jan

    2015-01-01

    Comparative genomics of virulent Tannerella forsythia ATCC 43037 and a close health-associated relative, Tannerella BU063, revealed, in the latter, the absence of an entire array of genes encoding putative secretory proteases that possess a nearly identical C-terminal domain (CTD) that ends with a -Lys-Leu-Ile-Lys-Lys motif. This observation suggests that these proteins, referred to as KLIKK proteases, may function as virulence factors. Re-sequencing of the loci of the KLIKK proteases found only six genes grouped in two clusters. All six genes were expressed by T. forsythia in routine culture conditions, although at different levels. More importantly, a transcript of each gene was detected in gingival crevicular fluid (GCF) from periodontitis sites infected with T. forsythia indicating that the proteases are expressed in vivo. In each protein, a protease domain was flanked by a unique N-terminal profragment and a C-terminal extension ending with the CTD. Partially purified recombinant proteases showed variable levels of proteolytic activity in zymography gels and toward protein substrates, including collagen, gelatin, elastin, and casein. Taken together, these results indicate that the pathogenic strain of T. forsythia secretes active proteases capable of degrading an array of host proteins, which likely represents an important pathogenic feature of this bacterium.

  7. KLIKK proteases of Tannerella forsythia: putative virulence factors with a unique domain structure

    PubMed Central

    Ksiazek, Miroslaw; Mizgalska, Danuta; Eick, Sigrum; Thøgersen, Ida B.; Enghild, Jan J.; Potempa, Jan

    2015-01-01

    Comparative genomics of virulent Tannerella forsythia ATCC 43037 and a close health-associated relative, Tannerella BU063, revealed, in the latter, the absence of an entire array of genes encoding putative secretory proteases that possess a nearly identical C-terminal domain (CTD) that ends with a -Lys-Leu-Ile-Lys-Lys motif. This observation suggests that these proteins, referred to as KLIKK proteases, may function as virulence factors. Re-sequencing of the loci of the KLIKK proteases found only six genes grouped in two clusters. All six genes were expressed by T. forsythia in routine culture conditions, although at different levels. More importantly, a transcript of each gene was detected in gingival crevicular fluid (GCF) from periodontitis sites infected with T. forsythia indicating that the proteases are expressed in vivo. In each protein, a protease domain was flanked by a unique N-terminal profragment and a C-terminal extension ending with the CTD. Partially purified recombinant proteases showed variable levels of proteolytic activity in zymography gels and toward protein substrates, including collagen, gelatin, elastin, and casein. Taken together, these results indicate that the pathogenic strain of T. forsythia secretes active proteases capable of degrading an array of host proteins, which likely represents an important pathogenic feature of this bacterium. PMID:25954253

  8. Cloning and phylogenetic analysis of a fatty acid elongase gene from Nannochloropsis oculata CS179

    NASA Astrophysics Data System (ADS)

    Pan, Kehou; Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Yang, Guanpin

    2009-12-01

    Nannochloropsis oculata CS179, a unicellular marine microalga, is rich in long-chain polyunsaturated fatty acids (LCPUFAs). Elongase and desaturase play a key role in the biosynthesis of PUFAs. A new elongase gene, which encodes 322 amino acids, was identified via RT-PCR and 5' and 3' RACE. The sequence of the elongase gene was blast-searched in the NCBI GenBank and showed a similarity to those of the cryptosporidium. But the NJ-tree revealed that the N. oculata CS179 elongase clustered with those of the microalgae Phaeodactylum tricornutum, Ostreococcus tauri and Thalassiosira pseudonana.

  9. Serum homocysteine, vitamin B12, folic acid levels and methylenetetrahydrofolate reductase (MTHFR) gene polymorphism in vitiligo.

    PubMed

    Yasar, Ali; Gunduz, Kamer; Onur, Ece; Calkan, Mehmet

    2012-01-01

    The aim of this study was to determine serum vitamin B12, folic acid and homocysteine (Hcy) levels as well as MTHFR (C677, A1298C) gene polymorphisms in patients with vitiligo, and to compare the results with healthy controls. Forty patients with vitiligo and 40 age and sex matched healthy subjects were studied. Serum vitamin B12 and folate levels were determined by enzyme-linked immunosorbent assay. Plasma Hcy levels and MTHFR polymorphisms were determined by chemiluminescence and real time PCR methods, respectively. Mean serum vitamin B12 and Hcy levels were not significantly different while folic acid levels were significantly lower in the control group. There was no significant relationship between disease activity and vitamin B12, folic acid and homocystein levels. No significant difference in C677T gene polymorphism was detected. Heterozygote A1298C gene polymorphism in the patient group was statistically higher than the control group. There was no significant relationship between MTHFR gene polymorphisms and vitamin B12, folic acid and homocysteine levels. In conclusion, vitamin B12, folate and Hcy levels are not altered in vitiligo and MTHFR gene mutations (C677T and A1298C) do not seem to create susceptibility for vitiligo.

  10. Salicylic acid and gentisic acid induce RNA silencing-related genes and plant resistance to RNA pathogens.

    PubMed

    Campos, Laura; Granell, Pablo; Tárraga, Susana; López-Gresa, Pilar; Conejero, Vicente; Bellés, José María; Rodrigo, Ismael; Lisón, Purificación

    2014-04-01

    We have observed that treatments with salicylic acid (SA) or gentisic acid (GA) induced resistance to RNA pathogens such as ToMV and CEVd in tomato and Gynura auriantiaca, respectively. Accumulation of SA and GA has been found to occur in plants infected by these pathogens, thus pointing out a possible defence role of both molecules. To study the molecular basis of the observed induced resistance to RNA pathogens the induction of silencing-related genes by SA and GA was considered. For that purpose, we searched for tomato genes which were orthologous to those described in Arabidopsis thaliana, such as AtDCL1, AtDCL2, AtDCL4, AtRDR1, AtRDR2 and AtRDR6, and we tracked their induction in tomato along virus and viroid infections. We observed that CEVd significantly induced all these genes in tomato, with the exception of ToRDR6, being the induction of ToDCL4 the most outstanding. Regarding the ToMV asymptomatic infection, with the exception of ToRDR2, we observed a significant induction of all the indicated silencing-related genes, being ToDCL2 the most induced gene. Subsequently, we analyzed their transcriptional activation by SA and at the time when ToMV was inoculated on plants. ToDCL2, ToRDR1 and ToRDR2 were significantly induced by both SA and GA, whereas ToDCL1 was only induced by SA. Such an induction resulted more effective by SA treatment, which is in agreement with the stronger SA-induced resistance observed. Our results suggest that the observed delay in the RNA pathogen accumulation could be due to the pre-induction of RNA silencing-related genes by SA or GA.

  11. Overexpression of a soybean salicylic acid methyltransferase gene confers resistance to soybean cyst nematode.

    PubMed

    Lin, Jingyu; Mazarei, Mitra; Zhao, Nan; Zhu, Junwei J; Zhuang, Xiaofeng; Liu, Wusheng; Pantalone, Vincent R; Arelli, Prakash R; Stewart, Charles N; Chen, Feng

    2013-12-01

    Salicylic acid plays a critical role in activating plant defence responses after pathogen attack. Salicylic acid methyltransferase (SAMT) modulates the level of salicylic acid by converting salicylic acid to methyl salicylate. Here, we report that a SAMT gene from soybean (GmSAMT1) plays a role in soybean defence against soybean cyst nematode (Heterodera glycines Ichinohe, SCN). GmSAMT1 was identified as a candidate SCN defence-related gene in our previous analysis of soybean defence against SCN using GeneChip microarray experiments. The current study started with the isolation of the full-length cDNAs of GmSAMT1 from a SCN-resistant soybean line and from a SCN-susceptible soybean line. The two cDNAs encode proteins of identical sequences. The GmSAMT1 cDNA was expressed in Escherichia coli. Using in vitro enzyme assays, E. coli-expressed GmSAMT1 was confirmed to function as salicylic acid methyltransferase. The apparent Km value of GmSAMT1 for salicylic acid was approximately 46 μM. To determine the role of GmSAMT1 in soybean defence against SCN, transgenic hairy roots overexpressing GmSAMT1 were produced and tested for SCN resistance. Overexpression of GmSAMT1 in SCN-susceptible backgrounds significantly reduced the development of SCN, indicating that overexpression of GmSAMT1 in the transgenic hairy root system could confer resistance to SCN. Overexpression of GmSAMT1 in transgenic hairy roots was also found to affect the expression of selected genes involved in salicylic acid biosynthesis and salicylic acid signal transduction.

  12. Botulinum neurotoxin A protease: discovery of natural product exosite inhibitors.

    PubMed

    Silhár, Peter; Capková, Katerina; Salzameda, Nicholas T; Barbieri, Joseph T; Hixon, Mark S; Janda, Kim D

    2010-03-10

    A new mechanistic class of BoNT/A zinc metalloprotease inhibitors, from Echinacea, exemplified by the natural product d-chicoric acid (I1) is disclosed. A detailed evaluation of chicoric acid's mechanism of inhibition reveals that the inhibitor binds to an exosite, displays noncompetitive partial inhibition, and is synergistic with a competitive active site inhibitor when used in combination. Other components found in Echinacea, I3 and I4, were also inhibitors of the protease.

  13. Epsilon substituted lysinol derivatives as HIV-1 protease inhibitors.

    PubMed

    Jones, Kristen L G; Holloway, M Katharine; Su, Hua-Poo; Carroll, Steven S; Burlein, Christine; Touch, Sinoeun; DiStefano, Daniel J; Sanchez, Rosa I; Williams, Theresa M; Vacca, Joseph P; Coburn, Craig A

    2010-07-15

    A series of HIV-1 protease inhibitors containing an epsilon substituted lysinol backbone was synthesized. Two novel synthetic routes using N-boc-L-glutamic acid alpha-benzyl ester and 2,6-diaminopimelic acid were developed. Incorporation of this epsilon substituent enabled access to the S2 pocket of the enzyme, affording high potency inhibitors. Modeling studies and synthetic efforts suggest the potency increase is due to both conformational bias and van der Waals interactions with the S2 pocket.

  14. Differential Response of Extracellular Proteases of Trichoderma Harzianum Against Fungal Phytopathogens.

    PubMed

    Sharma, Vivek; Salwan, Richa; Sharma, Prem N

    2016-09-01

    In the present study, production of extracellular proteases by Trichoderma harzianum was evaluated based on the relative gene expression and spectrophotometric assay. The fungal isolates were grown in Czapek Dox Broth medium supplemented with deactivated mycelium of plant fungal pathogens such as Fusarium oxysporum, Colletotrichum capsici, Gloeocercospora sorghi, and Colletotrichum truncatum. The maximum protease activity was detected after 48 h of incubation against Colletotrichum spp. Similarly in qRT-PCR, the relative gene expression of four proteases varied from 48 to 96 h against host pathogens in a time-independent manner. Among proteases, statistically significant upregulation of asp, asp, and srp was observed against Colletotrichum spp., followed by F. oxysporum. But in the case of pepM22, maximum upregulation was observed against F. oxysporum. The variation in enzyme assay and qRT-PCR of proteases at different time intervals against various fungal phytopathogens could be due to the limitation of using casein as a substrate for all types of proteases or protease-encoding transcripts selected for qRT-PCR, which may not be true representative of total protease activity.

  15. Peptide synthesis in neat organic solvents with novel thermostable proteases.

    PubMed

    Toplak, Ana; Nuijens, Timo; Quaedflieg, Peter J L M; Wu, Bian; Janssen, Dick B

    2015-06-01

    Biocatalytic peptide synthesis will benefit from enzymes that are active at low water levels in organic solvent compositions that allow good substrate and product solubility. To explore the use of proteases from thermophiles for peptide synthesis under such conditions, putative protease genes of the subtilase class were cloned from Thermus aquaticus and Deinococcus geothermalis and expressed in Escherichia coli. The purified enzymes were highly thermostable and catalyzed efficient peptide bond synthesis at 80°C and 60°C in neat acetonitrile with excellent conversion (>90%). The enzymes tolerated high levels of N,N-dimethylformamide (DMF) as a cosolvent (40-50% v/v), which improved substrate solubility and gave good conversion in 5+3 peptide condensation reactions. The results suggest that proteases from thermophiles can be used for peptide synthesis under harsh reaction conditions.

  16. Molecular docking and structure-based virtual screening studies of potential drug target, CAAX prenyl proteases, of Leishmania donovani.

    PubMed

    Singh, Shalini; Vijaya Prabhu, Sitrarasu; Suryanarayanan, Venkatesan; Bhardwaj, Ruchika; Singh, Sanjeev Kumar; Dubey, Vikash Kumar

    2016-11-01

    Targeting CAAX prenyl proteases of Leishmania donovani can be a good approach towards developing a drug molecule against Leishmaniasis. We have modeled the structure of CAAX prenyl protease I and II of L. donovani, using homology modeling approach. The structures were further validated using Ramachandran plot and ProSA. Active site prediction has shown difference in the amino acid residues present at the active site of CAAX prenyl protease I and CAAX prenyl protease II. The electrostatic potential surface of the CAAX prenyl protease I and II has revealed that CAAX prenyl protease I has more electropositive and electronegative potentials as compared CAAX prenyl protease II suggesting significant difference in their activity. Molecular docking with known bisubstrate analog inhibitors of protein farnesyl transferase and peptidyl (acyloxy) methyl ketones reveals significant binding of these molecules with CAAX prenyl protease I, but comparatively less binding with CAAX prenyl protease II. New and potent inhibitors were also found using structure-based virtual screening. The best docked compounds obtained from virtual screening were subjected to induced fit docking to get best docked configurations. Prediction of drug-like characteristics has revealed that the best docked compounds are in line with Lipinski's rule. Moreover, best docked protein-ligand complexes of CAAX prenyl protease I and II are found to be stable throughout 20 ns simulation. Overall, the study has identified potent drug molecules targeting CAAX prenyl protease I and II of L. donovani whose drug candidature can be verified further using biochemical and cellular studies.

  17. Microbial aspartic proteases: current and potential applications in industry.

    PubMed

    Theron, Louwrens W; Divol, Benoit

    2014-11-01

    Aspartic proteases are a relatively small group of proteolytic enzymes that are active in acidic environments and are found across all forms of life. Certain microorganisms secrete such proteases as virulence agents and/or in order to break down proteins thereby liberating assimilable sources of nitrogen. Some of the earlier applications of these proteolytic enzymes are found in the manufacturing of cheese where they are used as milk-clotting agents. Over the last decade, they have received tremendous research interest because of their involvement in human diseases. Furthermore, there has also been a growing interest on these enzymes for their applications in several other industries. Recent research suggests in particular that they could be used in the wine industry to prevent the formation of protein haze while preserving the wines' organoleptic properties. In this mini-review, the properties and mechanisms of action of aspartic proteases are summarized. Thereafter, a brief overview of the industrial applications of this specific class of proteases is provided. The use of aspartic proteases as alternatives to clarifying agents in various beverage industries is mentioned, and the potential applications in the wine industry are thoroughly discussed.

  18. Effects of Oils Rich in Linoleic and α-Linolenic Acids on Fatty Acid Profile and Gene Expression in Goat Meat

    PubMed Central

    Ebrahimi, Mahdi; Rajion, Mohamed Ali; Goh, Yong Meng

    2014-01-01

    Alteration of the lipid content and fatty acid (FA) composition of foods can result in a healthier product. The aim of this study was to determine the effect of flaxseed oil or sunflower oil in the goat diet on fatty acid composition of muscle and expression of lipogenic genes in the semitendinosus (ST) muscle. Twenty-one entire male Boer kid goats were fed diets containing different levels of linoleic acid (LA) and α-linolenic acid (LNA) for 100 days. Inclusion of flaxseed oil increased (p < 0.05) the α-linolenic acid (C18:3n-3) concentration in the ST muscle. The diet high in α-linolenic acid (p < 0.05) decreased the arachidonic acid (C20:4n-6) and conjugated linolenic acid (CLA) c-9 t-11 content in the ST muscle. There was a significant (p < 0.05) upregulation of PPARα and PPARγ gene expression and downregulation of stearoyl-CoA desaturase (SCD) gene in the ST muscle for the high α-linolenic acid group compared with the low α-linolenic acid group. The results of the present study show that flaxseed oil as a source of α-linolenic acid can be incorporated into the diets of goats to enrich goat meat with n-3 fatty acids, upregulate the PPARα and PPARγ, and downregulate the SCD gene expression. PMID:25255382

  19. Antitumor Molecular Mechanism of Chlorogenic Acid on Inducting Genes GSK-3β and APC and Inhibiting Gene β-Catenin

    PubMed Central

    Xu, Ruoshi; Kang, Qiumei; Ren, Jie; Li, Zukun; Xu, Xiaoping

    2013-01-01

    Objective. Inhibiting gene β-catenin and inducting genes GSK-3β and APC, promoting the tumor cell apoptosis in Wnt pathway, by chlorogenic acid were discussed (CGA). Method. The different genes were scanned by the 4∗44K mouse microarray chips. The effect of the three genes was confirmed by RT-PCR technique with CGA dosage of 5, 10, and 20 mg/kg. Result. The expression of GSK-3β and APC was upregulated in group of 20 mg/kg dosage (P < 0.05) and the expression of β-catenin was downregulated in the same dosage (P < 0.05). Conclusion. The results infer that the multimeric protein complex of β-catenin could be increased by CGA upregulated genes GSK-3β and APC, which could inhibit the free β-catenin into the nucleus to connect with TCF. So the transcriptional expression of the target genes will be cut to abnormal cell proliferation. It is probably one of the ways that can stop the tumor increase by CGA. PMID:23844319

  20. A novel carboxyl-terminal protease derived from Paenibacillus lautus CHN26 exhibiting high activities at multiple sites of substrates

    PubMed Central

    2013-01-01

    Background Carboxyl-terminal protease (CtpA) plays essential functions in posttranslational protein processing in prokaryotic and eukaryotic cells. To date, only a few bacterial ctpA genes have been characterized. Here we cloned and characterized a novel CtpA. The encoding gene, ctpAp (ctpA of Paenibacillus lautus), was derived from P. lautus CHN26, a Gram-positive bacterium isolated by functional screening. Recombinant protein was obtained from protein over-expression in Escherichia coli and the biochemical properties of the enzyme were investigated. Results Screening of environmental sediment samples with a skim milk-containing medium led to the isolation of a P. lautus CHN26 strain that exhibited a high proteolytic activity. A gene encoding a carboxyl-terminal protease (ctpAp) was cloned from the isolate and characterized. The deduced mature protein contains 466 aa with a calculated molecular mass of 51.94 kDa, displaying 29-38% amino acid sequence identity to characterized bacterial CtpA enzymes. CtpAp contains an unusual catalytic dyad (Ser309-Lys334) and a PDZ substrate-binding motif, characteristic for carboxyl-terminal proteases. CtpAp was expressed as a recombinant protein and characterized. The purified enzyme showed an endopeptidase activity, which effectively cleaved α S1- and β- casein substrates at carboxyl-terminus as well as at multiple internal sites. Furthermore, CtpAp exhibited a high activity at room temperature and strong tolerance to conventional protease inhibitors, demonstrating that CtpAp is a novel endopeptidase. Conclusions Our work on CtpA represents the first investigation of a member of Family II CtpA enzymes. The gene was derived from a newly isolated P. lautus CHN26 strain exhibiting a high protease activity in the skim milk assay. We have demonstrated that CtpAp is a novel endopeptidase with distinct cleavage specificities, showing a strong potential in biotechnology and industry applications. PMID:24161150

  1. Unconjugated Bile Acids Influence Expression of Circadian Genes: A Potential Mechanism for Microbe-Host Crosstalk

    PubMed Central

    Govindarajan, Kalaimathi; MacSharry, John; Casey, Patrick G.; Shanahan, Fergus

    2016-01-01

    Disruptions to circadian rhythm in mice and humans have been associated with an increased risk of obesity and metabolic syndrome. The gut microbiota is known to be essential for the maintenance of circadian rhythm in the host suggesting a role for microbe-host interactions in the regulation of the peripheral circadian clock. Previous work suggested a role for gut bacterial bile salt hydrolase (BSH) activity in the regulation of host circadian gene expression. Here we demonstrate that unconjugated bile acids, known to be generated through the BSH activity of the gut microbiota, are potentially chronobiological regulators of host circadian gene expression. We utilised a synchronised Caco-2 epithelial colorectal cell model and demonstrated that unconjugated bile acids, but not the equivalent tauro-conjugated bile salts, enhance the expression levels of genes involved in circadian rhythm. In addition oral administration of mice with unconjugated bile acids significantly altered expression levels of circadian clock genes in the ileum and colon as well as the liver with significant changes to expression of hepatic regulators of circadian rhythm (including Dbp) and associated genes (Per2, Per3 and Cry2). The data demonstrate a potential mechanism for microbe-host crosstalk that significantly impacts upon host circadian gene expression. PMID:27907092

  2. Purification, primary structures and evolution of coagulant proteases from Deinagkistrodon actus venom.

    PubMed

    Nikandrov, Nikolai N; Deshimaru, Masanobu; Tani, Ayako; Chijiwa, Takahito; Shibata, Hiroki; Chang, Chang-Chun; Fukumaki, Yasuyuki; Ito, Tatsumi; Ohno, Motonori

    2005-12-15

    Deinagkistrodon (formerly Agkistrodon) actus (Taiwan) snake venom was found to contain at least seven closely related coagulant proteases. One of them, named actibin, was purified to homogeneity by means of four chromatographic steps. Actibin acted on fibrinogen to form fibrin clots with extremely high specific activity of 1,630 NIH units/mg and preferentially released fibrinopeptide A. Actibin was an acidic glycoprotein (pI 3.4) with molecular weight of 41,000, which was reduced to 28,800 after deglycosylation with N-glycanase. The k(cat)/K(m) values of actibin for hydrolysis of tosyl-l-arginine methyl ester and benzoyl-l-arginine p-nitroanilide were one-third to a half those for thrombin, reflecting a high potency of actibin in fibrinogen clotting. The amidase activities of actibin and its family proteases were inhibited by 3,4-dichloroisocoumarin, a serine protease inhibitor, indicating that actibin and its family proteases are serine proteases. Four cDNAs, named DaP1 and DaP7-DaP9, encoding D. actus coagulant proteases were cloned. All cDNAs contain an open reading frame of 780 bp coding for 260 amino acid residues, including a signal peptide of 24 amino acid residues. Their amino acid sequences predicted are highly homologous to one another with one to five amino acid substitutions. When four D. actus protease cDNAs were compared with the cDNAs coding for Trimeresurus flavoviridis and T. gramineus venom serine proteases, accelerated evolution was clearly observed. Similarity of the nucleotide sequences of four D. actus protease cDNAs with no synonymous and one to five nonsynonymous substitutions seems not to be in direct conformity with accelerated evolution. This possibly suggests that they have evolved to a similar direction to enhance their clotting activity rather than to produce other physiological activities.

  3. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    SciTech Connect

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

    1988-02-01

    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage lambdagt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16/sup +/ natural killer cells and CD3/sup +/, CD16/sup -/ T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells.

  4. Gene expression profiles of murine fatty liver induced by the administration of valproic acid

    SciTech Connect

    Lee, Min-Ho; Hong, Il; Kim, Mingoo; Lee, Byung Hoon; Kim, Ju-Han; Kang, Kyung-Sun; Kim, Hyung-Lae; Yoon, Byung-Il; Chung, Heekyoung; Kong, Gu; Lee, Mi-Ock . E-mail: molee@snu.ac.kr

    2007-04-01

    Valproic acid (VPA) has been used as anticonvulsants, however, it induces hepatotoxicity such as microvesicular steatosis and necrosis in the liver. To explore the mechanisms of VPA-induced steatosis, we profiled the gene expression patterns of the mouse liver that were altered by treatment with VPA using microarray analysis. VPA was orally administered as a single dose of 100 mg/kg (low-dose) or 1000 mg/kg (high-dose) to ICR mice and the animals were killed at 6, 24, or 72 h after treatment. Serum alanine aminotransferase and aspartate aminotransferase levels were not significantly altered in the experimental animals. However, symptoms of steatosis were observed at 72 h with low-dose and at 24 h and 72 h with high-dose. After microarray data analysis, 1910 genes were selected by two-way ANOVA (P < 0.05) as VPA-responsive genes. Hierarchical clustering revealed that gene expression changes depended on the time rather than the dose of VPA treatment. Gene profiling data showed striking changes in the expression of genes associated with lipid, fatty acid, and steroid metabolism, oncogenesis, signal transduction, and development. Functional categorization of 1156 characteristically up- and down-regulated genes (cutoff > 1.5-fold) revealed that 60 genes were involved in lipid metabolism that was interconnected with biological pathways for biosynthesis of triglyceride and cholesterol, catabolism of fatty acid, and lipid transport. This gene expression profile may be associated with the known steatogenic hepatotoxicity of VPA and it may provide useful information for prediction of hepatotoxicity of unknown chemicals or new drug candidates through pattern recognition.

  5. Human-specific amino acid changes found in 103 protein-coding genes.

    PubMed

    Kitano, Takashi; Liu, Yu-Hua; Ueda, Shintaroh; Saitou, Naruya

    2004-05-01

    We humans have many characteristics that are different from those of the great apes. These human-specific characters must have arisen through mutations accumulated in the genome of our direct ancestor after the divergence of the last common ancestor with chimpanzee. Gene trees of human and great apes are necessary for extracting these human-specific genetic changes. We conducted a systematic analysis of 103 protein-coding genes for human, chimpanzee, gorilla, and orangutan. Nucleotide sequences for 18 genes were newly determined for this study, and those for the remaining genes were retrieved from the DDBJ/EMBL/GenBank database. The total number of amino acid changes in the human lineage was 147 for 26,199 codons (0.56%). The total number of amino acid changes in the human genome was, thus, estimated to be about 80,000. We applied the acceleration index test and Fisher's synonymous/nonsynonymous exact test for each gene tree to detect any human-specific enhancement of amino acid changes compared with ape branches. Six and two genes were shown to have significantly higher nonsynonymous changes at the human lineage from the acceleration index and exact tests, respectively. We also compared the distribution of the differences of the nonsynonymous substitutions on the human lineage and those on the great ape lineage. Two genes were more conserved in the ape lineage, whereas one gene was more conserved in the human lineage. These results suggest that a small proportion of protein-coding genes started to evolve differently in the human lineage after it diverged from the ape lineage.

  6. Mast Cell Proteases and Inflammation

    PubMed Central

    Dai, Hongyan; Korthuis, Ronald J.

    2011-01-01

    Mast cells are best known for their role in allergic reactions but are also now recognized for their important contributions to a number of disparate inflammatory conditions through the release of inflammatory mediators, serglycin and other proteoglycans, and proteases. Because these tissue resident inflammatory cells express proteases in such great abundance and their enzymatic activity results in cleavage of a multitude of proteins and peptides, which in turn modify tissue function, their substrate specificity, tissue distribution, and mode of action have become the subjects of great interest. Although mast cell protease-dependent proteolysis is critical to host defense against invading pathogens, regulation of these hydrolytic enzymes is essential to limiting self-induced damage as well. Indeed, dysregulated release of mast cell proteases is now recognized to contribute to the pathogenesis of a number of inflammatory conditions including asthma, abdominal aortic aneurysm formation, vessel damage in atherosclerosis and hypertension, arthritis, and ischemia/reperfusion injury. Understanding how mast cell proteases contribute to inflammation will thus help unravel molecular mechanisms that underlie such immunologic disorders and will help identify new therapeutic targets for drug development. PMID:22125569

  7. A Systems Genetics Approach Identifies Gene Regulatory Networks Associated with Fatty Acid Composition in Brassica rapa Seed1

    PubMed Central

    Xiao, Dong; Bucher, Johan; Jin, Mina; Boyle, Kerry; Fobert, Pierre; Maliepaard, Chris

    2016-01-01

    Fatty acids in seeds affect seed germination and seedling vigor, and fatty acid composition determines the quality of seed oil. In this study, quantitative trait locus (QTL) mapping of fatty acid and transcript abundance was integrated with gene network analysis to unravel the genetic regulation of seed fatty acid composition in a Brassica rapa doubled haploid population from a cross between a yellow sarson oil type and a black-seeded pak choi. The distribution of major QTLs for fatty acids showed a relationship with the fatty acid types: linkage group A03 for monounsaturated fatty acids, A04 for saturated fatty acids, and A05 for polyunsaturated fatty acids. Using a genetical genomics approach, expression quantitative trait locus (eQTL) hotspots were found at major fatty acid QTLs on linkage groups A03, A04, A05, and A09. An eQTL-guided gene coexpression network of lipid metabolism-related genes showed major hubs at the genes BrPLA2-ALPHA, BrWD-40, a number of seed storage protein genes, and the transcription factor BrMD-2, suggesting essential roles for these genes in lipid metabolism. Three subnetworks were extracted for the economically important and most abundant fatty acids erucic, oleic, linoleic, and linolenic acids. Network analysis, combined with comparison of the genome positions of cis- or trans-eQTLs with fatty acid QTLs, allowed the identification of candidate genes for genetic regulation of these fatty acids. The generated insights in the genetic architecture of fatty acid composition and the underlying complex gene regulatory networks in B. rapa seeds are discussed. PMID:26518343

  8. Characterisation of the Thermostable Protease AprX in Strains of Pseudomonas Fluorescens and Impact on the Shelf-life of Dairy Products: Preliminary Results.

    PubMed

    Andreani, Nadia Andrea; Carraro, Lisa; Fasolato, Luca; Balzan, Stefania; Lucchini, Rosaria; Novelli, Enrico; Cardazzo, Barbara

    2016-09-20

    Bacterial proteases are involved in food spoilage and shelf-life reduction. Among the bacterial proteases, a predominant role in spoilage of dairy products seems to be played by the thermostable metallo-protease AprX, which is produced by various strains of Pseudomonas fluorescens. Differences in AprX enzyme activity among different strains were highlighted, but the most proteolytic strains were not identified. In this study, the presence of the aprX gene was evaluated in 69 strains isolated from food matrices and 18 reference strains belonging to the P. fluorescens group, which had been previously typed by the multi locus sequence typing method. Subsequently, a subset of reference strains was inoculated in ultra-high temperature milk, and the expression of the aprX gene was evaluated at 22 and 6°C. On the same milk samples, the proteolytic activity was then evaluated through Azocasein and trinitrobenzenesulfonic acid solution assays. Finally, to assess the applicability of the former assay directly on dairy products the proteolityc activity was tested on industrial ricotta samples using the Azocasein assay. These results demonstrate the spread of aprX gene in most strains tested and the applicability of Azocasein assay to monitor the proteolytic activity in dairy products.

  9. Characterisation of the Thermostable Protease AprX in Strains of Pseudomonas Fluorescens and Impact on the Shelf-life of Dairy Products: Preliminary Results

    PubMed Central

    Andreani, Nadia Andrea; Carraro, Lisa; Fasolato, Luca; Balzan, Stefania; Lucchini, Rosaria; Novelli, Enrico; Cardazzo, Barbara

    2016-01-01

    Bacterial proteases are involved in food spoilage and shelf-life reduction. Among the bacterial proteases, a predominant role in spoilage of dairy products seems to be played by the thermostable metallo-protease AprX, which is produced by various strains of Pseudomonas fluorescens. Differences in AprX enzyme activity among different strains were highlighted, but the most proteolytic strains were not identified. In this study, the presence of the aprX gene was evaluated in 69 strains isolated from food matrices and 18 reference strains belonging to the P. fluorescens group, which had been previously typed by the multi locus sequence typing method. Subsequently, a subset of reference strains was inoculated in ultra-high temperature milk, and the expression of the aprX gene was evaluated at 22 and 6°C. On the same milk samples, the proteolytic activity was then evaluated through Azocasein and trinitrobenzenesulfonic acid solution assays. Finally, to assess the applicability of the former assay directly on dairy products the proteolityc activity was tested on industrial ricotta samples using the Azocasein assay. These results demonstrate the spread of aprX gene in most strains tested and the applicability of Azocasein assay to monitor the proteolytic activity in dairy products. PMID:28217561

  10. Promoter sequence of 3-phosphoglycerate kinase gene 1 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2002-10-15

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 1 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  11. Promoter sequence of 3-phosphoglycerate kinase gene 2 of lactic acid-producing fungus rhizopus oryzae and a method of expressing a gene of interest in fungal species

    DOEpatents

    Gao, Johnway [Richland, WA; Skeen, Rodney S [Pendleton, OR

    2003-03-04

    The present invention provides the promoter clone discovery of phosphoglycerate kinase gene 2 of a lactic acid-producing filamentous fungal strain, Rhizopus oryzae. The isolated promoter can constitutively regulate gene expression under various carbohydrate conditions. In addition, the present invention also provides a design of an integration vector for the transformation of a foreign gene in Rhizopus oryzae.

  12. Molecular cloning and functional characterization of a Δ6-fatty acid desaturase gene from Rhizopus oryzae.

    PubMed

    Zhu, Yu; Zhang, Bi-Bo

    2013-09-01

    The objective was to screen for and isolate a novel enzyme with the specific activity of a Δ6-fatty acid desaturase from Rhizopus oryzae. In this study, R. oryzae was identified as a novel fungal species that produces large amounts of γ-linolenic acid. A full-length cDNA, designated here as RoD6D, with high homology to fungal Δ6-fatty acid desaturase genes was isolated from R. oryzae by using the rapid amplification of cDNA ends method. It had an open reading frame of 1176 bp encoding a deduced polypeptide of 391 amino acids. Bioinformatics analysis characterized the putative RoD6D protein as a typical membrane-bound desaturase, including three conserved histidine-rich motifs, a hydropathy profile, and a cytochrome b5 -like domain in the N terminus. When the coding sequence was expressed in the Saccharomyces cerevisiae strain INVScl, the encoded product of RoD6D exhibited Δ6-fatty acid desaturase activity that led to the accumulation of γ-linolenic acid. The corresponding genomic sequence of RoD6D was 1565 bp in length, with five introns. This is the first report on the characterization and gene cloning of a Δ6-fatty acid desaturase of R. oryzae from Douchi.

  13. Monitoring Gene Expression In Vivo with Nucleic Acid Molecular Switches

    SciTech Connect

    David C. Ward; Patricia Bray-Ward

    2005-01-26

    The overall objectives of this project were (1) to develop allosteric ribozymes capable of acting as molecular switches for monitoring the levels of both wild-type and mutant mRNA species in living cells and whole animals and (2) to develop highly efficient reagents to deliver nucleic acid molecular switches into living cells, tissues and animals with the ultimate goal of expression profiling specific mRNAs of diagnostic or prognostic value within tumors in animals. During the past year, we have moved our laboratory to Nevada and in the moving process we have lost electronic and paper copies of prior progress reports concerning the construction and biological properties of the molecular switches. Since there was minimal progress during the last year on molecular switches, we are relying on past project reports to provide a summary of our data on this facet of the grant. Here we are summarizing the work done on the delivery reagents and their application to inducing mutations in living cells, which will include work done during the no cost extension.

  14. Bugs, genes, fatty acids, and serotonin: Unraveling inflammatory bowel disease?

    PubMed Central

    Kaunitz, Jonathan; Nayyar, Piyush

    2015-01-01

    The annual incidence of the inflammatory bowel diseases (IBDs) ulcerative colitis and Crohn’s disease has increased at an alarming rate. Although the specific pathophysiology underlying IBD continues to be elusive, it is hypothesized that IBD results from an aberrant and persistent immune response directed against microbes or their products in the gut, facilitated by the genetic susceptibility of the host and intrinsic alterations in mucosal barrier function. In this review, we will describe advances in the understanding of how the interaction of host genetics and the intestinal microbiome contribute to the pathogenesis of IBD, with a focus on bacterial metabolites such as short chain fatty acids (SCFAs) as possible key signaling molecules.  In particular, we will describe alterations of the intestinal microbiota in IBD, focusing on how genetic loci affect the gut microbial phylogenetic distribution and the production of their major microbial metabolic product, SCFAs. We then describe how enteroendocrine cells and myenteric nerves express SCFA receptors that integrate networks such as the cholinergic and serotonergic neural systems and the glucagon-like peptide hormonal pathway, to modulate gut inflammation, permeability, and growth as part of an integrated model of IBD pathogenesis.  Through this integrative approach, we hope that novel hypotheses will emerge that will be tested in reductionist, hypothesis-driven studies in order to examine the interrelationship of these systems in the hope of better understanding IBD pathogenesis and to inform novel therapies. PMID:27508055

  15. Disruption of multiple genes whose deletion causes lactic-acid resistance improves lactic-acid resistance and productivity in Saccharomyces cerevisiae.

    PubMed

    Suzuki, Toshihiro; Sakamoto, Takatoshi; Sugiyama, Minetaka; Ishida, Nobuhiro; Kambe, Hiromi; Obata, Shusei; Kaneko, Yoshinobu; Takahashi, Haruo; Harashima, Satoshi

    2013-05-01

    To create strains that have high productivity of lactic acid without neutralization, a genome-wide screening for strains showing hyper-resistance to 6% l-lactic acid (pH 2.6) was performed using the gene deletion collection of Saccharomyces cerevisiae. We identified 94 genes whose disruption led to resistance to 6% lactic acid in rich medium. We also found that multiple combinations of Δdse2, Δscw11, Δeaf3, and/or Δsed1 disruption led to enhanced resistance to lactic acid depending upon their combinations. In particular, the quadruple disruptant Δdse2Δscw11Δeaf3Δsed1 grew well in 6% lactic acid with the shortest lag phase. We then introduced an exogenous lactate dehydrogenase gene (LDH) into those single and multiple disruptants to evaluate their productivity of lactic acid. It was found that the quadruple disruptant displaying highest lactic-acid resistance showed a 27% increase of lactic-acid productivity as compared with the LDH-harboring wild-type strain. These observations suggest that disruption of multiple genes whose deletion leads to lactic-acid resistance is an effective way to enhance resistance to lactic acid, leading to high lactic-acid productivity without neutralization.

  16. Enzymatic Kolbe-Schmitt reaction to form salicylic acid from phenol: enzymatic characterization and gene identification of a novel enzyme, Trichosporon moniliiforme salicylic acid decarboxylase.

    PubMed

    Kirimura, Kohtaro; Gunji, Hiroaki; Wakayama, Rumiko; Hattori, Takasumi; Ishii, Yoshitaka

    2010-04-02

    Salicylic acid decarboxylase (Sdc) can produce salicylic acid from phenol; it was found in the yeast Trichosporon moniliiforme WU-0401 and was for the first time enzymatically characterized, with the sdc gene heterologously expressed. Sdc catalyzed both reactions: decarboxylation of salicylic acid to phenol and the carboxylation of phenol to form salicylic acid without any byproducts. Both reactions were detected without the addition of any cofactors and occurred even in the presence of oxygen, suggesting that this Sdc is reversible, nonoxidative, and oxygen insensitive. Therefore, it is readily applicable in the selective production of salicylic acid from phenol, the enzymatic Kolbe-Schmitt reaction. The deduced amino acid sequence of the gene, sdc, encoding Sdc comprises 350 amino acid residues corresponding to a 40-kDa protein. The recombinant Escherichia coli BL21(DE3) expressing sdc converted phenol to salicylic acid with a 27% (mol/mol) yield at 30 degrees C for 9h.

  17. Expressing yeast SAMdc gene confers broad changes in gene expression and alters fatty acid composition in tomato fruit.

    PubMed

    Kolotilin, Igor; Koltai, Hinanit; Bar-Or, Carmiya; Chen, Lea; Nahon, Sahadia; Shlomo, Haviva; Levin, Ilan; Reuveni, Moshe

    2011-07-01

    Tomato (Solanum lycopersicum) fruits expressing a yeast S-adenosyl methionine decarboxylase (ySAMdc) gene under control of a ripening-induced promoter show altered phytonutrient content and broad changes in gene expression. Genome-wide transcriptional alterations in pericarp tissues of the ySAMdc-expressing fruits are shown. Consistent with the ySAMdc expression pattern from the ripening-induced promoter, very minor transcriptional alterations were detected at the mature green developmental stage. At the breaker and red stages, altered levels of numerous transcripts were observed with a general tendency toward upregulation in the transgenic fruits. Ontological analysis of up- and downregulated transcript groups revealed various affected metabolic processes, mainly carbohydrate and amino acid metabolism, and protein synthesis, which appeared to be intensified in the ripening transgenic fruits. Other functional ontological categories of altered transcripts represented signal transduction, transcription regulation, RNA processing, molecular transport and stress response, as well as metabolism of lipids, glycans, xenobiotics, energy, cofactors and vitamins. In addition, transcript levels of genes encoding structural enzymes for several biosynthetic pathways showed strong correlations to levels of specific metabolites that displayed altered levels in transgenic fruits. Increased transcript levels of fatty acid biosynthesis enzymes were accompanied by a change in the fatty acid profile of transgenic fruits, most notably increasing ω-3 fatty acids at the expense of other lipids. Thus, SAMdc is a prime target in manipulating the nutritional value of tomato fruits. Combined with analyses of selected metabolites in the overripe fruits, a model of enhanced homeostasis of the pericarp tissue in the polyamine-accumulating tomatoes is proposed.

  18. Identification and transcriptional profiling of Pseudomonas putida genes involved in furoic acid metabolism

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Furfural (2-furaldehyde) is a furan formed by dehydration of pentose sugars. Pseudomonas putida Fu1 metabolizes furfural through a pathway involving conversion to 2-oxoglutarate, via 2-furoic acid and Coenzyme A intermediates. To identify genes involved in furan metabolism, two P. putida transposo...

  19. GENE EXPRESSION PATTERNS OF CD-1 DAY-8 EMBRYO CULTURES EXPOSED TO BROMOCHLORO ACETIC ACID

    EPA Science Inventory

    Gene expression patterns of CD-1 day-8 embryo cultures exposed to bromochloro acetic acid

    Edward D. Karoly?*, Judith E. Schmid* and E. Sidney Hunter III*
    ?Curriculum in Toxicology, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina and *Reproductiv...

  20. Differential influence of distinct fatty acids on cardiomyocyte metabolic gene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Diabetes mellitus increases risk for cardiovascular disease, and exposes the heart to high plasma fatty acid (FA) levels, which induce genes promoting FA oxidation (e.g., malonyl-CoA decarboxylase; mcd), as well as those suppressing carbohydrate oxidation (e.g., pyruvate dehydrogenase kinase 4; pdk4...

  1. Characterization of the Fatty Acid Desaturase Genes in Cucumber: Structure, Phylogeny, and Expression Patterns

    PubMed Central

    Dong, Chun-Juan; Cao, Ning; Zhang, Zhi-Gang; Shang, Qing-Mao

    2016-01-01

    Fatty acid desaturases (FADs) introduce double bonds into the hydrocarbon chains of fatty acids to produce unsaturated fatty acids, and therefore play a critical role in plant development and acclimation to environmental stresses. In this study, 23 full-length FAD genes in cucumber (Cucumis sativus L.) were identified through database searches, including three CsFAB2 genes, two CsFAD2 genes, fourteen CsFAD5 genes, and one gene each for CsFAD3, CsFAD4, CsFAD6 and CsFAD7. These cucumber FAD genes were distributed on all seven chromosomes and two additional scaffolds. Based on a phylogenetic analysis, the cucumber FAD proteins were clustered into five subfamilies with their counterparts from other plants. Gene structures and protein sequences were considerably conserved in each subfamily. All three CsFAB2 proteins shared conserved structure with the known plant soluble FAD proteins. The other cucumber FADs belonged to the membrane-bound FADs and contained three highly conserved histidine boxes. Additionally, the putative endoplasmic reticulum retention signal was found at the C-termini of the CsFAD2 and CsFAD3 proteins, while the N-termini of CsFAD4, CsFAD5, CsFAD6, CsFAD7 and three CsFAB2s contained a predicted chloroplast signal peptide, which was consistent with their associated metabolic pathways. Furthermore, a gene expression analysis showed that CsFAD2 and CsFAD3 were universally expressed in all tested tissues, whereas the other cucumber FAD genes were preferentially expressed in the cotyledons or leaves. The tissue-specific expression patterns of cucumber FAD genes were correlated well with the differences in the fatty acid compositions ofroots and leaves. Finally, the cucumber FAD genes showed a cold-induced and heat-repressed expression pattern, although with distinct regulatory time courses among the different CsFAD members, which indicates the potential roles of the FADs in temperature stress resistance in cucumber. PMID:26938877

  2. Gene cloning of an efficiency oleate hydratase from Stenotrophomonas nitritireducens for polyunsaturated fatty acids and its application in the conversion of plant oils to 10-hydroxy fatty acids.

    PubMed

    Kang, Woo-Ri; Seo, Min-Ju; Shin, Kyung-Chul; Park, Jin-Byung; Oh, Deok-Kun

    2017-01-01

    Hydroxy fatty acids are used as precursors of lactones and dicarboxylic acids, as starting materials of polymers, and as additives in coatings and paintings. Stenotrophomonas nitritireducens efficiently converts cis-9 polyunsaturated fatty acids (PUFAs) to 10-hydroxy fatty acids. However, gene encoding enzyme involved in this conversion has not been identified to date. We purified a putative fatty acid double-bond hydratase from S. nitritireducens by ultrafiltration and HiPrep DEAE FF and Resource Q ion exchange chromatographies. Peptide sequences of the purified enzyme were obtained by liquid chromatography-mass spectrometry/mass spectrometry (LC-MS/MS) analysis. Sequence of the partial gene encoding this putative fatty acid double-bond hydratase was determined by degenerate polymerase chain reaction (PCR) based on the peptide sequences. The remaining gene sequence was identified by rapid amplification of cDNA ends using cDNA of S. nitritireducens as a template, and the full-length gene was cloned subsequently. The expressed enzyme was identified as an oleate hydratase by determining its kinetic parameters toward unsaturated fatty acids. S. nitritireducens oleate hydratase showed higher activity toward PUFAs compared with other available oleate hydratases. This suggested that the enzyme could be used effectively to convert plant oils to 10-hydroxy fatty acids because these oils contained unsaturated fatty acids such as oleic acid (OA) and linoleic acid (LA) and PUFAs such as α-linolenic acid and/or γ-linolenic acid. The enzyme converted soybean oil and perilla seed oil hydrolyzates containing 10 mM total unsaturated fatty acids, including OA, LA, and ALA, to 8.87 and 8.70 mM total 10-hydroxy fatty acids, respectively, in 240 min. To our knowledge, this is the first study on the biotechnological conversion of PUFA-containing oils to hydroxy fatty acids. Biotechnol. Bioeng. 2017;114: 74-82. © 2016 Wiley Periodicals, Inc.

  3. Exploring the diversity of arsenic resistance genes from acid mine drainage microorganisms.

    PubMed

    Morgante, Verónica; Mirete, Salvador; de Figueras, Carolina G; Postigo Cacho, Marina; González-Pastor, José E

    2015-06-01

    The microbial communities from the Tinto River, a natural acid mine drainage environment, were explored to search for novel genes involved in arsenic resistance using a functional metagenomic approach. Seven pentavalent arsenate resistance clones were selected and analysed to find the genes responsible for this phenotype. Insights about their possible mechanisms of resistance were obtained from sequence similarities and cellular arsenic concentration. A total of 19 individual open reading frames were analysed, and each one was individually cloned and assayed for its ability to confer arsenic resistance in Escherichia coli cells. A total of 13 functionally active genes involved in arsenic resistance were identified, and they could be classified into different global processes: transport, stress response, DNA damage repair, phospholipids biosynthesis, amino acid biosynthesis and RNA-modifying enzymes. Most genes (11) encode proteins not previously related to heavy metal resistance or hypothetical or unknown proteins. On the other hand, two genes were previously related to heavy metal resistance in microorganisms. In addition, the ClpB chaperone and the RNA-modifying enzymes retrieved in this work were shown to increase the cell survival under different stress conditions (heat shock, acid pH and UV radiation). Thus, these results reveal novel insights about unidentified mechanisms of arsenic resistance.

  4. Gene organization around the phenylalanyl-transfer ribonucleic acid synthetase locus in Escherichia coli.

    PubMed Central

    Comer, M M

    1981-01-01

    The organization of seven genes located at about 38 min on the genetic map of Escherichia coli was examined; these genes included pheS and pheT, which code for the alpha and beta subunits of phenylalanyl-transfer ribonucleic acid synthetase, and thrS, the structural gene for threonyl-transfer ribonucleic acid synthetase. Deletion mutants were isolated from an F-prime-containing merodiploid strain and were characterized genetically. Seventeen different kinds of deletions extending into pheS of pheT were identified. These deletions unambiguously defined the gene order as aroD pps himA pheT pheS thrS pfkB. Mutants with deletions covering either pheS or pheT, but not both, were analyzed further by assay of phenylalanyl-transfer ribonucleic acid synthetase. The phenotype of the mutants with a deletion from pfkB through pheS was anomalous; although the pheT gene was apparently still present, its product, the beta subunit, was much reduced in activity. PMID:7012115

  5. Characterization of the lys2 gene of Penicillium chrysogenum encoding alpha-aminoadipic acid reductase.

    PubMed

    Casqueiro, J; Gutiérrez, S; Bañuelos, O; Fierro, F; Velasco, J; Martín, J F

    1998-09-01

    A DNA fragment containing a gene homologous to LYS2 gene of Saccharomyces cerevisiae was cloned from a genomic DNA library of Penicillium chrysogenum AS-P-78. It encodes a protein of 1409 amino acids (Mr 154859) with strong similarity to the S. cerevisiae (49.9% identity) Schizosaccharomyces pombe (51.3% identity) and Candida albicans (48.12% identity) alpha-aminoadipate reductases and a lesser degree of identity to the amino acid-activating domains of the non-ribosomal peptide synthetases, including the alpha-aminoadipate-activating domain of the alpha-aminoadipyl-cysteinyl-valine synthetase of P. chrysogenum (12.4% identical amino acids). The lys2 gene contained one intron in the 5'-region and other in the 3'-region, as shown by comparing the nucleotide sequences of the cDNA and genomic DNA, and was transcribed as a 4.7-kb monocistronic mRNA. The lys2 gene was localized on chromosome III (7.5 Mb) in P. chrysogenum AS-P-78 and on chromosome IV (5.6 Mb) in strain P2, whereas the penicillin gene cluster is known to be located in chromosome I in both strains. The lys2-encoded protein is a member of the aminoacyladenylate-forming enzyme family with a reductase domain in its C-terminal region.

  6. Transcriptome analysis of acetic-acid-treated yeast cells identifies a large set of genes whose overexpression or deletion enhances acetic acid tolerance.

    PubMed

    Lee, Yeji; Nasution, Olviyani; Choi, Eunyong; Choi, In-Geol; Kim, Wankee; Choi, Wonja

    2015-08-01

    Acetic acid inhibits the metabolic activities of Saccharomyces cerevisiae. Therefore, a better understanding of how S. cerevisiae cells acquire the tolerance to acetic acid is of importance to develop robust yeast strains to be used in industry. To do this, we examined the transcriptional changes that occur at 12 h post-exposure to acetic acid, revealing that 56 and 58 genes were upregulated and downregulated, respectively. Functional categorization of them revealed that 22 protein synthesis genes and 14 stress response genes constituted the largest portion of the upregulated and downregulated genes, respectively. To evaluate the association of the regulated genes with acetic acid tolerance, 3 upregulated genes (DBP2, ASC1, and GND1) were selected among 34 non-protein synthesis genes, and 54 viable mutants individually deleted for the downregulated genes were retrieved from the non-essential haploid deletion library. Strains overexpressing ASC1 and GND1 displayed enhanced tolerance to acetic acid, whereas a strain overexpressing DBP2 was sensitive. Fifty of 54 deletion mutants displayed enhanced acetic acid tolerance. Three chosen deletion mutants (hsps82Δ, ato2Δ, and ssa3Δ) were also tolerant to benzoic acid but not propionic and sorbic acids. Moreover, all those five (two overexpressing and three deleted) strains were more efficient in proton efflux and lower in membrane permeability and internal hydrogen peroxide content than controls. Individually or in combination, those physiological changes are likely to contribute at least in part to enhanced acetic acid tolerance. Overall, information of our transcriptional profile was very useful to identify molecular factors associated with acetic acid tolerance.

  7. Characterization of two cysteine proteases secreted by Blastocystis ST7, a human intestinal parasite.

    PubMed

    Wawrzyniak, Ivan; Texier, Catherine; Poirier, Philippe; Viscogliosi, Eric; Tan, Kevin S W; Delbac, Frédéric; El Alaoui, Hicham

    2012-09-01

    Blastocystis spp. are unicellular anaerobic intestinal parasites of both humans and animals and the most prevalent ones found in human stool samples. Their association with various gastrointestinal disorders raises the questions of its pathogenicity and of the molecular mechanisms involved. Since secreted proteases are well-known to be implicated in intestinal parasite virulence, we intended to determine whether Blastocystis spp. possess such pathogenic factors. In silico analysis of the Blastocystis subtype 7 (ST7) genome sequence highlighted 22 genes coding proteases which were predicted to be secreted. We characterized the proteolytic activities in the secretory products of Blastocystis ST7 using specific protease inhibitors. Two cysteine proteases, a cathepsin B and a legumain, were identified in the parasite culture supernatant by gelatin zymographic SDS-PAGE gel and MS/MS analysis. These proteases might act on intestinal cells and disturb gut function. This work provides serious molecular candidates to link Blastocystis spp. and intestinal disorders.

  8. PlantPIs--an interactive web resource on plant protease inhibitors.

    PubMed

    Consiglio, Arianna; Grillo, Giorgio; Licciulli, Flavio; Ceci, Luigi R; Liuni, Sabino; Losito, Nicola; Volpicella, Mariateresa; Gallerani, Raffaele; De Leo, Francesca

    2011-08-01

    PlantPIs is a web querying system for a database collection of plant protease inhibitors data. Protease inhibitors in plants are naturally occurring proteins that inhibit the function of endogenous and exogenous proteases. In this paper the design and development of a web framework providing a clear and very flexible way of querying plant protease inhibitors data is reported. The web resource is based on a relational database, containing data of plants protease inhibitors publicly accessible, and a graphical user interface providing all the necessary browsing tools, including a data exporting function. PlantPIs contains information extracted principally from MEROPS database, filtered, annotated and compared with data stored in other protein and gene public databases, using both automated techniques and domain expert evaluations. The data are organized to allow a flexible and easy way to access stored information. The database is accessible at http://www.plantpis.ba.itb.cnr.it/.

  9. Active protease mapping in 2DE gels.

    PubMed

    Zhao, Zhenjun; Russell, Pamela J

    2009-01-01

    Proteases act as the molecular mediators of many vital biological processes. To understand the function of each protease, it needs to be separated from other proteins and characterized in its natural, biologically active form. In the method described in this chapter, proteases in a biological sample are separated under nonreducing conditions in 2DE gels. A specific small protease substrate, tagged with a fluorescent dye, is copolymerized into the SDS gel in the second dimension. After electrophoresis, the proteins are renatured by washing the gel with Triton X-100 solution or Milli Q water to remove SDS. The gel is then incubated in a protease assay buffer. The hydrolysis of the tagged specific substrate by the renatured protease releases the free fluorescent dye, which fluoresces in situ. The fluorescent spots indicate the location of the specific proteases in the gel and the specificity of the proteases.

  10. Transcriptional Analysis of Essential Genes of the Escherichia coli Fatty Acid Biosynthesis Gene Cluster by Functional Replacement with the Analogous Salmonella typhimurium Gene Cluster

    PubMed Central

    Zhang, Yan; Cronan, John E.

    1998-01-01

    The genes encoding several key fatty acid biosynthetic enzymes (called the fab cluster) are clustered in the order plsX-fabH-fabD-fabG-acpP-fabF at min 24 of the Escherichia coli chromosome. A difficulty in analysis of the fab cluster by the polar allele duplication approach (Y. Zhang and J. E. Cronan, Jr., J. Bacteriol. 178:3614–3620, 1996) is that several of these genes are essential for the growth of E. coli. We overcame this complication by use of the fab gene cluster of Salmonella typhimurium, a close relative of E. coli, to provide functions necessary for growth. The S. typhimurium fab cluster was isolated by complementation of an E. coli fabD mutant and was found to encode proteins with >94% homology to those of E. coli. However, the S. typhimurium sequences cannot recombine with the E. coli sequences required to direct polar allele duplication via homologous recombination. Using this approach, we found that although approximately 60% of the plsX transcripts initiate at promoters located far upstream and include the upstream rpmF ribosomal protein gene, a promoter located upstream of the plsX coding sequence (probably within the upstream gene, rpmF) is sufficient for normal growth. We have also found that the fabG gene is obligatorily cotranscribed with upstream genes. Insertion of a transcription terminator cassette (Ω-Cm cassette) between the fabD and fabG genes of the E. coli chromosome abolished fabG transcription and blocked cell growth, thus providing the first indication that fabG is an essential gene. Insertion of the Ω-Cm cassette between fabH and fabD caused greatly decreased transcription of the fabD and fabG genes and slower cellular growth, indicating that fabD has only a weak promoter(s). PMID:9642179

  11. Target-Based Screen Against a Periplasmic Serine Protease That Regulates Intrabacterial pH Homeostasis in Mycobacterium tuberculosis

    PubMed Central

    2015-01-01

    Mycobacterium tuberculosis (Mtb) maintains its intrabacterial pH (pHIB) near neutrality in the acidic environment of phagosomes within activated macrophages. A previously reported genetic screen revealed that Mtb loses this ability when the mycobacterial acid resistance protease (marP) gene is disrupted. In the present study, a high throughput screen (HTS) of compounds against the protease domain of MarP identified benzoxazinones as inhibitors of MarP. A potent benzoxazinone, BO43 (6-chloro-2-(2′-methylphenyl)-4H-1,3-benzoxazin-4-one), acylated MarP and lowered Mtb’s pHIB and survival during incubation at pH 4.5. BO43 had similar effects on MarP-deficient Mtb, suggesting the existence of additional target(s). Reaction of an alkynyl-benzoxazinone, BO43T, with Mycobacterium bovis variant bacille Calmette-Guérin (BCG) followed by click chemistry with azido-biotin identified both the MarP homologue and the high temperature requirement A1 (HtrA1) homologue, an essential protein. Thus, the chemical probe identified through a target-based screen not only reacted with its intended target in the intact cells but also implicated an additional enzyme that had eluded a genetic screen biased against essential genes. PMID:25457457

  12. Evolutionary Pattern of the FAE1 Gene in Brassicaceae and Its Correlation with the Erucic Acid Trait

    PubMed Central

    Li, Mimi; Peng, Bin; Guo, Haisong; Yan, Qinqin; Hang, Yueyu

    2013-01-01

    The fatty acid elongase 1 (FAE1) gene catalyzes the initial condensation step in the elongation pathway of VLCFA (very long chain fatty acid) biosynthesis and is thus a key gene in erucic acid biosynthesis. Based on a worldwide collection of 62 accessions representing 14 tribes, 31 genera, 51 species, 4 subspecies and 7 varieties, we conducted a phylogenetic reconstruction and correlation analysis between genetic variations in the FAE1 gene and the erucic acid trait, attempting to gain insight into the evolutionary patterns and the correlations between genetic variations in FAE1 and trait variations. The five clear, deeply diverged clades detected in the phylogenetic reconstruction are largely congruent with a previous multiple gene-derived phylogeny. The Ka/Ks ratio (<1) and overall low level of nucleotide diversity in the FAE1 gene suggest that purifying selection is the major evolutionary force acting on this gene. Sequence variations in FAE1 show a strong correlation with the content of erucic acid in seeds, suggesting a causal link between the two. Furthermore, we detected 16 mutations that were fixed between the low and high phenotypes of the FAE1 gene, which constitute candidate active sites in this gene for altering the content of erucic acid in seeds. Our findings begin to shed light on the evolutionary pattern of this important gene and represent the first step in elucidating how the sequence variations impact the production of erucic acid in plants. PMID:24358289

  13. Synthesis of macrocyclic trypanosomal cysteine protease inhibitors.

    PubMed

    Chen, Yen Ting; Lira, Ricardo; Hansell, Elizabeth; McKerrow, James H; Roush, William R

    2008-11-15

    The importance of cysteine proteases in parasites, compounded with the lack of redundancy compared to their mammalian hosts makes proteases attractive targets for the development of new therapeutic agents. The binding mode of K11002 to cruzain, the major cysteine protease of Trypanosoma cruzi was used in the design of conformationally constrained inhibitors. Vinyl sulfone-containing macrocycles were synthesized via olefin ring-closing metathesis and evaluated against cruzain and the closely related cysteine protease, rhodesain.

  14. The Effect of Multiple Single Nucleotide Polymorphisms in the Folic Acid Pathway Genes on Homocysteine Metabolism

    PubMed Central

    Liang, Shuang; Zhou, Yuanpeng; Wang, Huijun; Qian, Yanyan; Ma, Duan; Tian, Weidong; Persaud-Sharma, Vishwani; Yu, Chen; Ren, Yunyun; Zhou, Shufeng; Li, Xiaotian

    2014-01-01

    Objective. To investigate the joint effects of the single nucleotide polymorphisms (SNPs) of genes in the folic acid pathway on homocysteine (Hcy) metabolism. Methods. Four hundred women with normal pregnancies were enrolled in this study. SNPs were identified by MassARRAY. Serum folic acid and Hcy concentration were measured. Analysis of variance (ANOVA) and support vector machine (SVM) regressions were used to analyze the joint effects of SNPs on the Hcy level. Results. SNPs of MTHFR (rs1801133 and rs3733965) were significantly associated with maternal serum Hcy level. In the different genotypes of MTHFR (rs1801133), SNPs of RFC1 (rs1051266), TCN2 (rs9606756), BHMT (rs3733890), and CBS (rs234713 and rs2851391) were linked with the Hcy level adjusted for folic acid concentration. The integrated SNPs scores were significantly associated with the residual Hcy concentration (RHC) (r = 0.247). The Hcy level was significantly higher in the group with high SNP scores than that in other groups with SNP scores of less than 0.2 (P = 0.000). Moreover, this difference was even more significant in moderate and high levels of folic acid. Conclusion. SNPs of genes in the folic acid pathway possibly affect the Hcy metabolism in the presence of moderate and high levels of folic acid. PMID:24524080

  15. Docosahexaenoic acid regulates gene expression in HUVEC cells treated with polycyclic aromatic hydrocarbons.

    PubMed

    Gdula-Argasińska, Joanna; Czepiel, Jacek; Totoń-Żurańska, Justyna; Jurczyszyn, Artur; Perucki, William; Wołkow, Paweł

    2015-07-16

    The molecular mechanism of inflammation and carcinogenesis induced by exposure of polycyclic aromatic hydrocarbons (PAHs) is not clearly understood. Our study was undertaken due to the strong pro-carcinogenic potential and reactivity of PAH-metabolites, as well as the susceptibility of polyunsaturated fatty acids to oxidation. The aim of this study was to evaluate the pro- or anti-inflammatory impact of n-3 docosahexaenoic acid on human primary umbilical vein endothelial cells (HUVEC) exposed to polycyclic aromatic hydrocarbons. We analysed the influence of docosahexaenoic acid (DHA) and/or PAHs supplementation on the fatty acid profile of cell membranes, on cyclooxygenase-2 (COX-2), aryl hydrocarbon receptor (AHR), and glutathione S transferase Mu1 (GSTM1) protein expression as well as on the prostaglandin synthase 2 (PTGS2), AHR, GSTM1, PLA2G4A, and cytochrome P450 CYP1A1 gene expression. We observed that COX-2 and AHR protein expression was increased while GSTM1 expression was decreased in cells exposed to DHA and PAHs. Docosahexaenoic acid down-regulated CYP1A1 and up-regulated the AHR and PTGS2 genes. Our findings suggested that DHA contributes significantly to alleviate the harmful effects caused by PAHs in endothelial cells. Moreover, these results suggest that a diet rich in n-3 fatty acids is helpful to reduce the harmful effects of PAHs exposure on human living in heavily polluted areas.

  16. An apparent Bacillus subtilis folic acid biosynthetic operon containing pab, an amphibolic trpG gene, a third gene required for synthesis of para-aminobenzoic acid, and the dihydropteroate synthase gene.

    PubMed Central

    Slock, J; Stahly, D P; Han, C Y; Six, E W; Crawford, I P

    1990-01-01

    McDonald and Burke (J. Bacteriol. 149:391-394, 1982) previously cloned a sulfanilamide-resistance gene, sul, residing on a 4.9-kb segment of Bacillus subtilis chromosomal DNA, into plasmid pUB110. In this study we determined the nucleotide sequence of the entire 4.9-kb fragment. Genes identified on the fragment include pab, trpG, pabC, sul, one complete unidentified open reading frame, and one incomplete unidentified open reading frame. The first three of these genes, pab, trpG, and pabC, are required for synthesis of p-aminobenzoic acid. The trpG gene encodes an amphibolic glutamine amidotransferase required for synthesis of both p-aminobenzoate and anthranilate, the latter an intermediate in the tryptophan biosynthetic pathway. The pabC gene may encode a B. subtilis analog of enzyme X, an enzyme needed for p-aminobenzoate synthesis in Escherichia coli. The sul gene probably encodes dihydropteroate synthase, the enzyme responsible for formation of 7,8-dihydropteroate, the immediate precursor of folic acid. All six of the cloned genes are arranged in a single operon. Since all four of the identified genes are needed for folate biosynthesis, we refer to this operon as a folic acid operon. Expression of the trpG gene is known to be negatively controlled by tryptophan. We propose that this regulation is at the level of translation. This hypothesis is supported by the finding of an apparent Mtr-binding site which overlaps with the trpG ribosome-binding site. PMID:2123867

  17. Enhanced gene expression in epithelial cells transfected with amino acid-substituted gemini nanoparticles.

    PubMed

    Yang, Peng; Singh, Jagbir; Wettig, Shawn; Foldvari, Marianna; Verrall, Ronald E; Badea, Ildiko

    2010-08-01

    Gemini surfactants are versatile gene delivery agents because of their ability to bind and compact DNA and their low cellular toxicity. Through modification of the alkyl tail length and the chemical nature of the spacer, new compounds can be generated with the potential to improve the efficiency of gene delivery. Amino acid (glycine and lysine) and dipeptide (glycyl-lysine and lysyl-lysine) substituted spacers of gemini surfactants were synthesized, and their efficiency of gene delivery was assessed in epithelial cells for topical cutaneous and mucosal applications. Three different epithelial cell lines, COS-7, PAM212 and Sf 1Ep cells, were transfected with plasmid DNA encoding for interferon gamma and green fluorescent protein complexed with the amino acid-substituted gemini compounds in the presence of 1,2 dioleyl-sn-glycero-phosphatidyl-ethanolamine as a helper lipid. Gene expression was quantified by ELISA. Size, zeta potential and circular dichroism measurements were used to characterize the plasmid-gemini (PG) and plasmid-gemini surfactant-helper lipid (PGL) complexes. Gene expression was found to increase up to 72h and then declined by the 7th day. In general, the glycine-substituted surfactant showed consistently high gene expression in all three cell lines. Results of physicochemical and spectroscopic studies of the complexes indicate that substitution of the gemini spacer does not interfere with compaction of the DNA. The superior performance of these spacer-substituted gemini surfactants might be attributed to their better biocompatibility compared to the surfactants possessing unsubstituted spacers.

  18. Phylogenetic, Molecular, and Biochemical Characterization of Caffeic Acid o-Methyltransferase Gene Family in Brachypodium distachyon

    PubMed Central

    Wu, Xianting; Wu, Jiajie; Luo, Yangfan; Bragg, Jennifer; Anderson, Olin; Vogel, John; Gu, Yong Q.

    2013-01-01

    Caffeic acid o-methyltransferase (COMT) is one of the important enzymes controlling lignin monomer production in plant cell wall synthesis. Analysis of the genome sequence of the new grass model Brachypodium distachyon identified four COMT gene homologs, designated as BdCOMT1, BdCOMT2, BdCOMT3, and BdCOMT4. Phylogenetic analysis suggested that they belong to the COMT gene family, whereas syntenic analysis through comparisons with rice and sorghum revealed that BdCOMT4 on Chromosome 3 is the orthologous copy of the COMT genes well characterized in other grass species. The other three COMT genes are unique to Brachypodium since orthologous copies are not found in the collinear regions of rice and sorghum genomes. Expression studies indicated that all four Brachypodium COMT genes are transcribed but with distinct patterns of tissue specificity. Full-length cDNAs were cloned in frame into the pQE-T7 expression vector for the purification of recombinant Brachypodium COMT proteins. Biochemical characterization of enzyme activity and substrate specificity showed that BdCOMT4 has significant effect on a broad range of substrates with the highest preference for caffeic acid. The other three COMTs had low or no effect on these substrates, suggesting that a diversified evolution occurred on these duplicate genes that not only impacted their pattern of expression, but also altered their biochemical properties. PMID:23431288

  19. Identification of SlpB, a Cytotoxic Protease from Serratia marcescens

    PubMed Central

    Stella, Nicholas A.; Hunt, Kristin M.; Brothers, Kimberly M.; Zhang, Liang; Thibodeau, Patrick H.

    2015-01-01

    The Gram-negative bacterium and opportunistic pathogen Serratia marcescens causes ocular infections in healthy individuals. Secreted protease activity was characterized from 44 ocular clinical isolates, and a higher frequency of protease-positive strains was observed among keratitis isolates than among conjunctivitis isolates. A positive correlation between protease activity and cytotoxicity to human corneal epithelial cells in vitro was determined. Deletion of prtS in clinical keratitis isolate K904 reduced, but did not eliminate, cytotoxicity and secreted protease production. This indicated that PrtS is necessary for full cytotoxicity to ocular cells and implied the existence of another secreted protease(s) and cytotoxic factors. Bioinformatic analysis of the S. marcescens Db11 genome revealed three additional open reading frames predicted to code for serralysin-like proteases noted here as slpB, slpC, and slpD. Induced expression of prtS and slpB, but not slpC and slpD, in strain PIC3611 rendered the strain cytotoxic to a lung carcinoma cell line; however, only prtS induction was sufficient for cytotoxicity to a corneal cell line. Strain K904 with deletion of both prtS and slpB genes was defective in secreted protease activity and cytotoxicity to human cell lines. PAGE analysis suggests that SlpB is produced at lower levels than PrtS. Purified SlpB demonstrated calcium-dependent and AprI-inhibited protease activity and cytotoxicity to airway and ocular cell lines in vitro. Lastly, genetic analysis indicated that the type I secretion system gene, lipD, is required for SlpB secretion. These genetic data introduce SlpB as a new cytotoxic protease from S. marcescens. PMID:25939509

  20. Identification of SlpB, a Cytotoxic Protease from Serratia marcescens.

    PubMed

    Shanks, Robert M Q; Stella, Nicholas A; Hunt, Kristin M; Brothers, Kimberly M; Zhang, Liang; Thibodeau, Patrick H

    2015-07-01

    The Gram-negative bacterium and opportunistic pathogen Serratia marcescens causes ocular infections in healthy individuals. Secreted protease activity was characterized from 44 ocular clinical isolates, and a higher frequency of protease-positive strains was observed among keratitis isolates than among conjunctivitis isolates. A positive correlation between protease activity and cytotoxicity to human corneal epithelial cells in vitro was determined. Deletion of prtS in clinical keratitis isolate K904 reduced, but did not eliminate, cytotoxicity and secreted protease production. This indicated that PrtS is necessary for full cytotoxicity to ocular cells and implied the existence of another secreted protease(s) and cytotoxic factors. Bioinformatic analysis of the S. marcescens Db11 genome revealed three additional open reading frames predicted to code for serralysin-like proteases noted here as slpB, slpC, and slpD. Induced expression of prtS and slpB, but not slpC and slpD, in strain PIC3611 rendered the strain cytotoxic to a lung carcinoma cell line; however, only prtS induction was sufficient for cytotoxicity to a corneal cell line. Strain K904 with deletion of both prtS and slpB genes was defective in secreted protease activity and cytotoxicity to human cell lines. PAGE analysis suggests that SlpB is produced at lower levels than PrtS. Purified SlpB demonstrated calcium-dependent and AprI-inhibited protease activity and cytotoxicity to airway and ocular cell lines in vitro. Lastly, genetic analysis indicated that the type I secretion system gene, lipD, is required for SlpB secretion. These genetic data introduce SlpB as a new cytotoxic protease from S. marcescens.

  1. Fatty acid regulates gene expression and growth of human prostate cancer PC-3 cells

    NASA Technical Reports Server (NTRS)

    Hughes-Fulford, M.; Chen, Y.; Tjandrawinata, R. R.

    2001-01-01

    It has been proposed that the omega-6 fatty acids increase the rate of tumor growth. Here we test that hypothesis in the PC-3 human prostate tumor. We found that the essential fatty acids, linoleic acid (LA) and arachidonic acid (AA), and the AA metabolite PGE(2) stimulate tumor growth while oleic acid (OA) and the omega-3 fatty acid, eicosapentaenoic acid (EPA) inhibited growth. In examining the role of AA in growth response, we extended our studies to analyze changes in early gene expression induced by AA. We demonstrate that c-fos expression is increased within minutes of addition in a dose-dependent manner. Moreover, the immediate early gene cox-2 is also increased in the presence of AA in a dose-dependent manner, while the constitutive cox-1 message was not increased. Three hours after exposure to AA, the synthesis of PGE(2) via COX-2 was also increased. Previous studies have demonstrated that AA was primarily delivered by low density lipoprotein (LDL) via its receptor (LDLr). Since it is known that hepatomas, acute myelogenous leukemia and colorectal tumors lack normal cholesterol feedback, we examined the role of the LDLr in growth regulation of the PC-3 prostate cancer cells. Analysis of ldlr mRNA expression and LDLr function demonstrated that human PC-3 prostate cancer cells lack normal feedback regulation. While exogenous LDL caused a significant stimulation of cell growth and PGE(2) synthesis, no change was seen in regulation of the LDLr by LDL. Taken together, these data show that normal cholesterol feedback of ldlr message and protein is lost in prostate cancer. These data suggest that unregulated over-expression of LDLr in tumor cells would permit increased availability of AA, which induces immediate early genes c-fos and cox-2 within minutes of uptake.

  2. Network-Guided GWAS Improves Identification of Genes Affecting Free Amino Acids1[OPEN

    PubMed Central

    Deason, Nicholas; DellaPenna, Dean

    2017-01-01

    Amino acids are essential for proper growth and development in plants. Amino acids serve as building blocks for proteins but also are important for responses to stress and the biosynthesis of numerous essential compounds. In seed, the pool of free amino acids (FAAs) also contributes to alternative energy, desiccation, and seed vigor; thus, manipulating FAA levels can significantly impact a seed’s nutritional qualities. While genome-wide association studies (GWAS) on branched-chain amino acids have identified some regulatory genes controlling seed FAAs, the genetic regulation of FAA levels, composition, and homeostasis in seeds remains mostly unresolved. Hence, we performed GWAS on 18 FAAs from a 313-ecotype Arabidopsis (Arabidopsis thaliana) association panel. Specifically, GWAS was performed on 98 traits derived from known amino acid metabolic pathways (approach 1) and then on 92 traits generated from an unbiased correlation-based metabolic network analysis (approach 2), and the results were compared. The latter approach facilitated the discovery of additional novel metabolic interactions and single-nucleotide polymorphism-trait associations not identified by the former approach. The most prominent network-guided GWAS signal was for a histidine (His)-related trait in a region containing two genes: a cationic amino acid transporter (CAT4) and a polynucleotide phosphorylase resistant to inhibition with fosmidomycin. A reverse genetics approach confirmed CAT4 to be responsible for the natural variation of His-related traits across the association panel. Given that His is a semiessential amino acid and a potent metal chelator, CAT4 orthologs could be considered as candidate genes for seed quality biofortification in crop plants. PMID:27872244

  3. Gene Overexpression and Biochemical Characterization of the Biotechnologically Relevant Chlorogenic Acid Hydrolase from Aspergillus niger▿

    PubMed Central

    Benoit, Isabelle; Asther, Michèle; Bourne, Yves; Navarro, David; Canaan, Stéphane; Lesage-Meessen, Laurence; Herweijer, Marga; Coutinho, Pedro M.; Asther, Marcel; Record, Eric

    2007-01-01

    The full-length gene that encodes the chlorogenic acid hydrolase from Aspergillus niger CIRM BRFM 131 was cloned by PCR based on the genome of the strain A. niger CBS 513.88. The complete gene consists of 1,715 bp and codes for a deduced protein of 512 amino acids with a molecular mass of 55,264 Da and an acidic pI of 4.6. The gene was successfully cloned and overexpressed in A. niger to yield 1.25 g liter−1, i.e., 330-fold higher than the production of wild-type strain A. niger CIRM BRFM131. The histidine-tagged recombinant ChlE protein was purified to homogeneity via a single chromatography step, and its main biochemical properties were characterized. The molecular size of the protein checked by mass spectroscopy was 74,553 Da, suggesting the presence of glycosylation. ChlE is assembled in a tetrameric form with several acidic isoforms with pIs of around 4.55 and 5.2. Other characteristics, such as optimal pH and temperature, were found to be similar to those determined for the previously characterized chlorogenic acid hydrolase of A. niger CIRM BRFM 131. However, there was a significant temperature stability difference in favor of the recombinant protein. ChlE exhibits a catalytic efficiency of 12.5 × 106 M−1 s−1 toward chlorogenic acid (CGA), and its ability to release caffeic acid from CGA present in agricultural by-products such as apple marc and coffee pulp was clearly demonstrated, confirming the high potential of this enzyme. PMID:17630312

  4. Plant cysteine proteases that evoke itch activate protease-activated receptors

    PubMed Central

    Reddy, V.B.; Lerner, E.A.

    2013-01-01

    Background Bromelain, ficin and papain are cysteine proteases from plants that produce itch upon injection into skin. Their mechanism of action has not been considered previously. Objectives To determine the mechanism by which these proteases function. Methods The ability of these proteases to activate protease-activated receptors was determined by ratiometric calcium imaging. Results We show here that bromelain, ficin and papain activate protease-activated receptors 2 and 4. Conclusions Bromelain, ficin and papain function as signalling molecules and activate protease-activated receptors. Activation of these receptors is the likely mechanism by which these proteases evoke itch. PMID:20491769

  5. Subchronic effects of valproic acid on gene expression profiles for lipid metabolism in mouse liver

    SciTech Connect

    Lee, Min-Ho |; Kim, Mingoo |; Lee, Byung-Hoon |; Kim, Ju-Han |; Kang, Kyung-Sun |; Kim, Hyung-Lae |; Yoon, Byung-Il |; Chung, Heekyoung; Kong, Gu |; Lee, Mi-Ock ||

    2008-02-01

    Valproic acid (VPA) is used clinically to treat epilepsy, however it induces hepatotoxicity such as microvesicular steatosis. Acute hepatotoxicity of VPA has been well documented by biochemical studies and microarray analysis, but little is known about the chronic effects of VPA in the liver. In the present investigation, we profiled gene expression patterns in the mouse liver after subchronic treatment with VPA. VPA was administered orally at a dose of 100 mg/kg/day or 500 mg/kg/day to ICR mice, and the livers were obtained after 1, 2, or 4 weeks. The activities of serum liver enzymes did not change, whereas triglyceride concentration increased significantly. Microarray analysis revealed that 1325 genes of a set of 32,996 individual genes were VPA responsive when examined by two-way ANOVA (P < 0.05) and fold change (> 1.5). Consistent with our previous results obtained using an acute VPA exposure model (Lee et al., Toxicol Appl Pharmacol. 220:45-59, 2007), the most significantly over-represented biological terms for these genes included lipid, fatty acid, and steroid metabolism. Biological pathway analysis suggests that the genes responsible for increased biosynthesis of cholesterol and triglyceride, and for decreased fatty acid {beta}-oxidation contribute to the abnormalities in lipid metabolism induced by subchronic VPA treatment. A comparison of the VPA-responsive genes in the acute and subchronic models extracted 15 commonly altered genes, such as Cyp4a14 and Adpn, which may have predictive power to distinguish the mode of action of hepatotoxicants. Our data provide a better understanding of the molecular mechanisms of VPA-induced hepatotoxicity and useful information to predict steatogenic hepatotoxicity.

  6. Expanding Duplication of Free Fatty Acid Receptor-2 (GPR43) Genes in the Chicken Genome.

    PubMed

    Meslin, Camille; Desert, Colette; Callebaut, Isabelle; Djari, Anis; Klopp, Christophe; Pitel, Frédérique; Leroux, Sophie; Martin, Pascal; Froment, Pascal; Guilbert, Edith; Gondret, Florence; Lagarrigue, Sandrine; Monget, Philippe

    2015-04-24

    Free fatty acid receptors (FFAR) belong to a family of five G-protein coupled receptors that are involved in the regulation of lipid metabolism, so that their loss of function increases the risk of obesity. The aim of this study was to determine the expansion of genes encoding paralogs of FFAR2 in the chicken, considered as a model organism for developmental biology and biomedical research. By estimating the gene copy number using quantitative polymerase chain reaction, genomic DNA resequencing, and RNA sequencing data, we showed the existence of 23 ± 1.5 genes encoding FFAR2 paralogs in the chicken genome. The FFAR2 paralogs shared an identity from 87.2% up to 99%. Extensive gene conversion was responsible for this high degree of sequence similarities between these genes, and this concerned especially the four amino acids known to be critical for ligand binding. Moreover, elevated nonsynonymous/synonymous substitution ratios on some amino acids within or in close-vicinity of the ligand-binding groove suggest that positive selection may have reduced the effective rate of gene conversion in this region, thus contributing to diversify the function of some FFAR2 paralogs. All the FFAR2 paralogs were located on a microchromosome in a same linkage group. FFAR2 genes were expressed in different tissues and cells such as spleen, peripheral blood mononuclear cells, abdominal adipose tissue, intestine, and lung, with the highest rate of expression in testis. Further investigations are needed to determine whether these chicken-specific events along evolution are the consequence of domestication and may play a role in regulating lipid metabolism in this species.

  7. Curcumin derivatives as HIV-1 protease inhibitors

    SciTech Connect

    Sui, Z.; Li, J.; Craik, C.S.; Ortiz de Montellano, P.R.

    1993-12-31

    Curcumin, a non-toxic natural compound from Curcuma longa, has been found to be an HIV-1 protease inhibitor. Some of its derivatives were synthesized and their inhibitory activity against the HIV-1 protease was tested. Curcumin analogues containing boron enhanced the inhibitory activity. At least of the the synthesized compounds irreversibly inhibits the HIV-1 protease.

  8. Identification and characterization of alkaline serine protease from goat skin surface metagenome

    PubMed Central

    2011-01-01

    Metagenomic DNA isolated from goat skin surface was used to construct plasmid DNA library in Escherichia coli DH10B. Recombinant clones were screened for functional protease activity on skim milk agar plates. Upon screening 70,000 clones, a clone carrying recombinant plasmid pSP1 exhibited protease activity. In vitro transposon mutagenesis and sequencing of the insert DNA in this clone revealed an ORF of 1890 bp encoding a protein with 630 amino acids which showed significant sequence homology to the peptidase S8 and S53 subtilisin kexin sedolisin of Shewanella sp. This ORF was cloned in pET30b and expressed in E. coli BL21 (DE3). Although the cloned Alkaline Serine protease (AS-protease) was overexpressed, it was inactive as a result of forming inclusion bodies. After solubilisation, the protease was purified using Ni-NTA chromatography and then refolded properly to retain protease activity. The purified AS-protease with a molecular mass of ~63 kDa required a divalent cation (Co2+ or Mn2+) for its improved activity. The pH and temperature optima for this protease were 10.5 and 42°C respectively. PMID:21906326

  9. Nutrient uptake by marine invertebrates: cloning and functional analysis of amino acid transporter genes in developing sea urchins (Strongylocentrotus purpuratus).

    PubMed

    Meyer, Eli; Manahan, Donal T

    2009-08-01

    Transport of amino acids from low concentrations in seawater by marine invertebrates has been extensively studied, but few of the genes involved in this physiological process have been identified. We have characterized three amino acid transporter genes cloned from embryos of the sea urchin Strongylocentrotus purpuratus. These genes show phylogenetic proximity to classical amino acid transport systems, including Gly and B0+, and the inebriated gene (INE). Heterologous expression of these genes in frog oocytes induced a 40-fold increase in alanine transport above endogenous levels, demonstrating that these genes mediate alanine transport. Antibodies specific to one of these genes (Sp-AT1) inhibited alanine transport, confirming the physiological activity of this gene in larvae. Whole-mount antibody staining of larvae revealed expression of Sp-AT1 in the ectodermal tissues associated with amino acid transport, as independently demonstrated by autoradiographic localization of radioactive alanine. Maximum rates of alanine transport increased 6-fold during early development, from embryonic to larval stages. Analysis of gene expression during this developmental period revealed that Sp-AT1 transcript abundance remained nearly constant, while that of another transporter gene (Sp-AT2) increased 11-fold. The functional characterization of these genes establishes a molecular biological basis for amino acid transport by developmental stages of marine invertebrates.

  10. Up-regulation of the expression of