Science.gov

Sample records for acid resistance mechanisms

  1. Analysis of proteins responsive to acetic acid in Acetobacter: molecular mechanisms conferring acetic acid resistance in acetic acid bacteria.

    PubMed

    Nakano, Shigeru; Fukaya, Masahiro

    2008-06-30

    Acetic acid bacteria are used for industrial vinegar production because of their remarkable ability to oxidize ethanol and high resistance to acetic acid. Although several molecular machineries responsible for acetic acid resistance in acetic acid bacteria have been reported, the entire mechanism that confers acetic acid resistance has not been completely understood. One of the promising methods to elucidate the entire mechanism is global analysis of proteins responsive to acetic acid by two-dimensional gel electrophoresis. Recently, two proteins whose production was greatly enhanced by acetic acid in Acetobacter aceti were identified to be aconitase and a putative ABC-transporter, respectively; furthermore, overexpression or disruption of the genes encoding these proteins affected acetic acid resistance in A. aceti, indicating that these proteins are involved in acetic acid resistance. Overexpression of each gene increased acetic acid resistance in Acetobacter, which resulted in an improvement in the productivity of acetic acid fermentation. Taken together, the results of the proteomic analysis and those of previous studies indicate that acetic acid resistance in acetic acid bacteria is conferred by several mechanisms. These findings also provide a clue to breed a strain having high resistance to acetic acid for vinegar fermentation.

  2. Overview on mechanisms of acetic acid resistance in acetic acid bacteria.

    PubMed

    Wang, Bin; Shao, Yanchun; Chen, Fusheng

    2015-02-01

    Acetic acid bacteria (AAB) are a group of gram-negative or gram-variable bacteria which possess an obligate aerobic property with oxygen as the terminal electron acceptor, meanwhile transform ethanol and sugar to corresponding aldehydes, ketones and organic acids. Since the first genus Acetobacter of AAB was established in 1898, 16 AAB genera have been recorded so far. As the main producer of a world-wide condiment, vinegar, AAB have evolved an elegant adaptive system that enables them to survive and produce a high concentration of acetic acid. Some researches and reviews focused on mechanisms of acid resistance in enteric bacteria and made the mechanisms thoroughly understood, while a few investigations did in AAB. As the related technologies with proteome, transcriptome and genome were rapidly developed and applied to AAB research, some plausible mechanisms conferring acetic acid resistance in some AAB strains have been published. In this review, the related mechanisms of AAB against acetic acid with acetic acid assimilation, transportation systems, cell morphology and membrane compositions, adaptation response, and fermentation conditions will be described. Finally, a framework for future research for anti-acid AAB will be provided.

  3. A target-protection mechanism of antibiotic resistance at atomic resolution: insights into FusB-type fusidic acid resistance

    PubMed Central

    Tomlinson, Jennifer H.; Thompson, Gary S.; Kalverda, Arnout P.; Zhuravleva, Anastasia; O’Neill, Alex J.

    2016-01-01

    Antibiotic resistance in clinically important bacteria can be mediated by proteins that physically associate with the drug target and act to protect it from the inhibitory effects of an antibiotic. We present here the first detailed structural characterization of such a target protection mechanism mediated through a protein-protein interaction, revealing the architecture of the complex formed between the FusB fusidic acid resistance protein and the drug target (EF-G) it acts to protect. Binding of FusB to EF-G induces conformational and dynamic changes in the latter, shedding light on the molecular mechanism of fusidic acid resistance. PMID:26781961

  4. Resistance mechanisms

    PubMed Central

    Cag, Yasemin; Caskurlu, Hulya; Fan, Yanyan; Cao, Bin

    2016-01-01

    By definition, the terms sepsis and septic shock refer to a potentially fatal infectious state in which the early administration of an effective antibiotic is the most significant determinant of the outcome. Because of the global spread of resistant bacteria, the efficacy of antibiotics has been severely compromised. S. pneumonia, Escherichia coli (E. coli), Klebsiella, Acinetobacter, and Pseudomonas are the predominant pathogens of sepsis and septic shock. It is common for E. coli, Klebsiella, Acinetobacter and Pseudomonas to be resistant to multiple drugs. Multiple drug resistance is caused by the interplay of multiple resistance mechanisms those emerge via the acquisition of extraneous resistance determinants or spontaneous mutations. Extended-spectrum beta-lactamases (ESBLs), carbapenemases, aminoglycoside-modifying enzymes (AMEs) and quinolone resistance determinants are typically external and disseminate on mobile genetic elements, while porin-efflux mechanisms are activated by spontaneous modifications of inherited structures. Porin and efflux mechanisms are frequent companions of multiple drug resistance in Acinetobacter and P. aeruginosa, but only occasionally detected among E. coli and Klebsiella. Antibiotic resistance became a global health threat. This review examines the major resistance mechanisms of the leading microorganisms of sepsis. PMID:27713884

  5. Investigation of Nalidixic Acid Resistance Mechanism in Salmonella enterica Using Molecular Simulation Techniques.

    PubMed

    Preethi, B; Shanthi, V; Ramanathan, K

    2015-09-01

    The emergence of nalidixic acid-resistant strains of Salmonella typhimurium remains to be a major public health problem. In particular, the substitution of Asn in place of Asp at the 87 loci in the GyrA of S. typhimurium was experimentally stated for nalidixic acid resistance. However, the data on the possible mechanism of nalidixic acid resistance are limited. In this study, I-Mutant2.0 and DUET program were employed to explore the impact of mutation on the stability of GyrA protein. Subsequently, molecular simulation techniques were employed to provide detailed information on the nalidixic acid-resistant associates with the D87N mutation in the GyrA of S. typhimurium. The binding free energy data depicts that nalidixic acid forms stable complex only with native-type GyrA than mutant (D87N) type GyrA protein. Moreover, our results theoretically suggest that hydrogen bonding formed by the Arg91 is certainly responsible for the GyrA of S. typhimurium drug selectivity. It is hoped that these evidences are immensely important for the development of new antibiotic and to overcome the nalidixic acid resistance in the near future. PMID:26208690

  6. Incidence and mechanisms of resistance to the combination of amoxicillin and clavulanic acid in Escherichia coli.

    PubMed Central

    Stapleton, P; Wu, P J; King, A; Shannon, K; French, G; Phillips, I

    1995-01-01

    Among Escherichia coli organisms isolated at St. Thomas's Hospital during the years 1990 to 1994, the frequency of resistance to amoxicillin-clavulanic acid (tested by disk diffusion in a ratio of 2:1) remained constant at about 5% of patient isolates (10 to 15% of the 41 to 45% that were amoxicillin resistant). Mechanisms of increased resistance were determined for 72 consecutively collected such amoxicillin-clavulanic acid-resistant isolates. MICs of the combination were 16-8 micrograms/ml for 51 (71%) of these and > or = 32-16 micrograms/ml for the remainder. The predominant mechanism was hyperproduction of enzymes isoelectrically cofocusing with TEM-1 (beta-lactamase activities, > 200 nmol of nitrocefin hydrolyzed per min per mg of protein) which was found in 44 isolates (61%); two isolates produced smaller amounts (approximately 150 nmol/min/mg) of such enzymes, and two isolates hyperproduced enzymes cofocusing with TEM-2. Eleven isolates produced enzymes cofocusing with OXA-1 beta-lactamase, which has previously been associated with resistance to amoxicillin-clavulanic acid. Ten isolates produced increased amounts of chromosomal beta-lactamase, and four of these additionally produced TEM-1 or TEM-2. Three isolates produced inhibitor-resistant TEM-group enzymes. In one of the enzymes (pI, 5.4), the amino acid sequence change was Met-67-->Val, and thus the enzyme is identical to TEM-34. Another (pI, 5.4) had the substitution Met-67-->Ile and is identical to IRT-I67, which we propose now be given the designation TEM-40. The third (pI, 5.2) had the substitution Arg-241-->Thr; this enzyme has not been reported previously and should be called TEM-41. The rarity and diversity of inhibitor-resistant TEM-group enzymes suggest that they are the result of spontaneous mutations that have not yet spread. PMID:8585729

  7. Plant resistance mechanisms to air pollutants: rhythms in ascorbic acid production during growth under ozone stress

    SciTech Connect

    Lee, E.H. )

    1991-01-01

    Relationships between ozone (O3) tolerance and leaf ascorbic acid concentrations in O3-susceptible (O3-S) 'Hark' and O3-resistant (O3-R) 'Hood' soybean, Glycine max (L.) Merr., cultivars were examined with high-performance liquid chromatography (HPLC). Leaf samples were analyzed at 4 intervals during a 24 h period. Soybean cultivars grown in the greenhouse with charcoal filtered (CF) and nonfiltered (NF) air showed daily oscillations in ascorbic acid production. Highest ascorbic acid levels in leaves during light coincided with highest concentrations of photochemical oxidants in the atmosphere at 2:00 p.m. The resistant genotype produced more ascorbic acid in its trifoliate leaves than did the corresponding susceptible genotype. Under CF air (an O3-reduced environment) O3-S and O3-R cultivars showed rhythms in ascorbic acid production. In NF air (an O3 stress environment) the O3-R cultivar alone showed rhythms in ascorbic acid production. Results indicated that superior O3 tolerance in the Hood soybean cultivar (compared with Hark) was associated with a greater increase in endogenous levels of ascorbic acid. Ascorbic acid may scavenge free radicals and thereby protect cells from injury by O3 or other oxyradical products. Plants defend themselves against photochemical oxidant stress, such as O3, by several mechanisms. Experimental evidence indicates that antioxidant defense systems existing in plant tissues may function to protect cellular components from deleterious effects of photochemical oxidants through endogenous and exogenous controls.

  8. Simvastatin may induce insulin resistance through a novel fatty acid mediated cholesterol independent mechanism

    PubMed Central

    Kain, Vasundhara; Kapadia, Bandish; Misra, Parimal; Saxena, Uday

    2015-01-01

    Statins are a class of oral drugs that are widely used for treatment of hypercholesterolemia. Recent clinical data suggest that chronic use of these drugs increases the frequency of new onset diabetes. Studies to define the risks of statin-induced diabetes and its underlying mechanisms are clearly necessary. We explored the possible mechanism of statin induced insulin resistance using a well-established cell based model and simvastatin as a prototype statin. Our data show that simvastatin induces insulin resistance in a cholesterol biosynthesis inhibition independent fashion but does so by a fatty acid mediated effect on insulin signaling pathway. These data may help design strategies for prevention of statin induced insulin resistance and diabetes in patients with hypercholesterolemia. PMID:26345110

  9. A possible mechanism of acquired acid resistance of human dental enamel by laser irradiation.

    PubMed

    Oho, T; Morioka, T

    1990-01-01

    A possible mechanism of acquired acid resistance of lased enamel was proposed on the basis of the investigations of optical properties, compositional and structural changes and permeability of lased and unlased human dental enamel. Lased enamel showed a high positive birefringence, suggesting the formation of 'microspaces' in enamel. No new products were found, though a decrease of lattice strain and a slight a-axis contraction were recognized in lased enamel compared with unlased enamel. The contents of water, carbonate and organic substances were reduced in lased enamel. Gradual changes of birefringence were observed in lased enamel during treatment with acid solutions, and this change was attributed to mineralization of the microspaces. The ions released by an acid decalcification would be trapped in the microspaces in lased enamel, whereas such ions diffuse to the surrounding solution in unlased enamel.

  10. The Pleiotropic Antibacterial Mechanisms of Ursolic Acid against Methicillin-Resistant Staphylococcus aureus (MRSA).

    PubMed

    Wang, Chao-Min; Jhan, Yun-Lian; Tsai, Shang-Jie; Chou, Chang-Hung

    2016-07-07

    (1) BACKGROUND: Several triterpenoids were found to act synergistically with classes of antibiotic, indicating that plant-derived chemicals have potential to be used as therapeutics to enhance the activity of antibiotics against multidrug-resistant pathogens. However, the mode of action of triterpenoids against bacterial pathogens remains unclear. The objective of this study is to evaluate the interaction between ursolic acid against methicillin-resistant Staphylococcus aureus (MRSA); (2) METHODS: The ability of ursolic acid to damage mammalian and bacterial membranes was examined. The proteomic response of methicillin-resistant S. aureus in ursolic acid treatment was investigated using two-dimensional (2D) proteomic analysis; (3) RESULTS: Ursolic acid caused the loss of staphylococcal membrane integrity without hemolytic activity. The comparison of the protein pattern of ursolic acid-treated and normal MRSA cells revealed that ursolic acid affected a variety of proteins involved in the translation process with translational accuracy, ribonuclease and chaperon subunits, glycolysis and oxidative responses; (4) CONCLUSION: The mode of action of ursolic acid appears to be the influence on the integrity of the bacterial membrane initially, followed by inhibition of protein synthesis and the metabolic pathway. These findings reflect that the pleiotropic effects of ursolic acid against MRSA make it a promising antibacterial agent in pharmaceutical research.

  11. The Pleiotropic Antibacterial Mechanisms of Ursolic Acid against Methicillin-Resistant Staphylococcus aureus (MRSA).

    PubMed

    Wang, Chao-Min; Jhan, Yun-Lian; Tsai, Shang-Jie; Chou, Chang-Hung

    2016-01-01

    (1) BACKGROUND: Several triterpenoids were found to act synergistically with classes of antibiotic, indicating that plant-derived chemicals have potential to be used as therapeutics to enhance the activity of antibiotics against multidrug-resistant pathogens. However, the mode of action of triterpenoids against bacterial pathogens remains unclear. The objective of this study is to evaluate the interaction between ursolic acid against methicillin-resistant Staphylococcus aureus (MRSA); (2) METHODS: The ability of ursolic acid to damage mammalian and bacterial membranes was examined. The proteomic response of methicillin-resistant S. aureus in ursolic acid treatment was investigated using two-dimensional (2D) proteomic analysis; (3) RESULTS: Ursolic acid caused the loss of staphylococcal membrane integrity without hemolytic activity. The comparison of the protein pattern of ursolic acid-treated and normal MRSA cells revealed that ursolic acid affected a variety of proteins involved in the translation process with translational accuracy, ribonuclease and chaperon subunits, glycolysis and oxidative responses; (4) CONCLUSION: The mode of action of ursolic acid appears to be the influence on the integrity of the bacterial membrane initially, followed by inhibition of protein synthesis and the metabolic pathway. These findings reflect that the pleiotropic effects of ursolic acid against MRSA make it a promising antibacterial agent in pharmaceutical research. PMID:27399657

  12. Redox control of retinoic acid receptor activity: a novel mechanism for retinoic acid resistance in melanoma cells.

    PubMed

    Demary, K; Wong, L; Liou, J S; Faller, D V; Spanjaard, R A

    2001-06-01

    Retinoic acid (RA) slows growth and induces differentiation of tumor cells through activation of RA receptors (RARs). However, melanoma cell lines display highly variable responsiveness to RA, which is a poorly understood phenomenon. By using Northern and Western blot analyses, we show that RA-resistant A375 and RA-responsive S91 melanoma cells express comparable levels of major components of RAR-signaling pathways. However, A375 cells have substantially higher intracellular reactive oxygen species (ROS) levels than S91 cells. Lowering ROS levels in A375 cells through hypoxic culture conditions restores RAR-dependent trans-activity, which could be further enhanced by addition of the antioxidant N-acetyl-cysteine. Hypoxia also enhances RAR activity in the moderately RA-responsive C32 cells, which have intermediate ROS levels. Conversely, increasing oxidative stress in highly RA-responsive S91 and B16 cells, which have low ROS levels, by treatment with H(2)O(2) impairs RAR activity. Consistent with these observations, RA more potently inhibited the proliferation of hypoxic A375 cells than that of normoxic cells. Oxidative states diminish, whereas reducing conditions enhance, DNA binding of retinoid X receptor/RAR heterodimers in vitro, providing a molecular basis for the observed inverse correlation between RAR activity and ROS levels. The redox state of melanoma cells provides a novel, epigenetic control mechanism of RAR activity and RA resistance. PMID:11356710

  13. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

    NASA Astrophysics Data System (ADS)

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-12-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.

  14. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

    PubMed Central

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-01-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains. PMID:26691589

  15. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics.

    PubMed

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-12-22

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.

  16. Preparation of a multifunctional material with superhydrophobicity, superparamagnetism, mechanical stability and acids-bases resistance by electrospinning

    NASA Astrophysics Data System (ADS)

    Wang, Shuai; Liu, Qingwen; Zhang, Yang; Wang, Shaodan; Li, Yaoxian; Yang, Qingbiao; Song, Yan

    2013-08-01

    A multifunctional material with superhydrophobicity, superparamagnetism, mechanical stability and acids-bases resistance was developed from the bead-on-string PVDF and Fe3O4@SiO2@POTS nanoparticles by electrospinning in this work. The Fe3O4@SiO2@POTS nanoparticles which have excellent superparamagnetism were successfully prepared and subsequently introduced into PVDF precursor solution. Through electrospinning, Fe3O4@SiO2@POTS nanoparticles irregularly distributed in the membrane to not only make a dual-scale roughness which is beneficial to obtain a superhydrophobic surface but also stimulate the material turns to superparamagnetic for wider use in different fields. More importantly, the film shows stable superhydrophobicity even for many corrosive solutions, such as acidic or basic solutions over a wide pH range and remarkable mechanical stability. The composition and surface structure of the film are the two critical factors that induce such unusual properties. The weight ratio of Fe3O4@SiO2@POTS/PVDF can strongly influence the superhydrophobicity and mechanical properties of the composite films.

  17. N-Acetylneuraminic Acid Supplementation Prevents High Fat Diet-Induced Insulin Resistance in Rats through Transcriptional and Nontranscriptional Mechanisms

    PubMed Central

    Yida, Zhang; Imam, Mustapha Umar; Ismail, Maznah; Ismail, Norsharina; Azmi, Nur Hanisah; Wong, Waiteng; Altine Adamu, Hadiza; Md Zamri, Nur Diyana; Ideris, Aini; Abdullah, Maizaton Atmadini

    2015-01-01

    N-Acetylneuraminic acid (Neu5Ac) is a biomarker of cardiometabolic diseases. In the present study, we tested the hypothesis that dietary Neu5Ac may improve cardiometabolic indices. A high fat diet (HFD) + Neu5Ac (50 or 400 mg/kg BW/day) was fed to rats and compared with HFD + simvastatin (10 mg/kg BW/day) or HFD alone for 12 weeks. Weights and serum biochemicals (lipid profile, oral glucose tolerance test, leptin, adiponectin, and insulin) were measured, and mRNA levels of insulin signaling genes were determined. The results indicated that low and high doses of sialic acid (SA) improved metabolic indices, although only the oral glucose tolerance test, serum triglycerides, leptin, and adiponectin were significantly better than those in the HFD and HFD + simvastatin groups (P < 0.05). Furthermore, the results showed that only high-dose SA significantly affected the transcription of hepatic and adipose tissue insulin signaling genes. The data suggested that SA prevented HFD-induced insulin resistance in rats after 12 weeks of administration through nontranscriptionally mediated biochemical changes that may have differentially sialylated glycoprotein structures at a low dose. At higher doses, SA induced transcriptional regulation of insulin signaling genes. These effects suggest that low and high doses of SA may produce similar metabolic outcomes in relation to insulin sensitivity through multiple mechanisms. These findings are worth studying further. PMID:26688813

  18. Mechanisms of Antibiotic Resistance

    PubMed Central

    Munita, Jose M.; Arias, Cesar A.

    2015-01-01

    Emergence of resistance among the most important bacterial pathogens is recognized as a major public health threat affecting humans worldwide. Multidrug-resistant organisms have emerged not only in the hospital environment but are now often identified in community settings, suggesting that reservoirs of antibiotic-resistant bacteria are present outside the hospital. The bacterial response to the antibiotic “attack” is the prime example of bacterial adaptation and the pinnacle of evolution. “Survival of the fittest” is a consequence of an immense genetic plasticity of bacterial pathogens that trigger specific responses that result in mutational adaptations, acquisition of genetic material or alteration of gene expression producing resistance to virtually all antibiotics currently available in clinical practice. Therefore, understanding the biochemical and genetic basis of resistance is of paramount importance to design strategies to curtail the emergence and spread of resistance and devise innovative therapeutic approaches against multidrug-resistant organisms. In this chapter, we will describe in detail the major mechanisms of antibiotic resistance encountered in clinical practice providing specific examples in relevant bacterial pathogens. PMID:27227291

  19. Mechanisms of Antibiotic Resistance.

    PubMed

    Munita, Jose M; Arias, Cesar A

    2016-04-01

    Emergence of resistance among the most important bacterial pathogens is recognized as a major public health threat affecting humans worldwide. Multidrug-resistant organisms have not only emerged in the hospital environment but are now often identified in community settings, suggesting that reservoirs of antibiotic-resistant bacteria are present outside the hospital. The bacterial response to the antibiotic "attack" is the prime example of bacterial adaptation and the pinnacle of evolution. "Survival of the fittest" is a consequence of an immense genetic plasticity of bacterial pathogens that trigger specific responses that result in mutational adaptations, acquisition of genetic material, or alteration of gene expression producing resistance to virtually all antibiotics currently available in clinical practice. Therefore, understanding the biochemical and genetic basis of resistance is of paramount importance to design strategies to curtail the emergence and spread of resistance and to devise innovative therapeutic approaches against multidrug-resistant organisms. In this chapter, we will describe in detail the major mechanisms of antibiotic resistance encountered in clinical practice, providing specific examples in relevant bacterial pathogens. PMID:27227291

  20. Mechanisms of buffer therapy resistance.

    PubMed

    Bailey, Kate M; Wojtkowiak, Jonathan W; Cornnell, Heather H; Ribeiro, Maria C; Balagurunathan, Yoganand; Hashim, Arig Ibrahim; Gillies, Robert J

    2014-04-01

    Many studies have shown that the acidity of solid tumors contributes to local invasion and metastasis. Oral pH buffers can specifically neutralize the acidic pH of tumors and reduce the incidence of local invasion and metastatic formation in multiple murine models. However, this effect is not universal as we have previously observed that metastasis is not inhibited by buffers in some tumor models, regardless of buffer used. B16-F10 (murine melanoma), LL/2 (murine lung) and HCT116 (human colon) tumors are resistant to treatment with lysine buffer therapy, whereas metastasis is potently inhibited by lysine buffers in MDA-MB-231 (human breast) and PC3M (human prostate) tumors. In the current work, we confirmed that sensitive cells utilized a pH-dependent mechanism for successful metastasis supported by a highly glycolytic phenotype that acidifies the local tumor microenvironment resulting in morphological changes. In contrast, buffer-resistant cell lines exhibited a pH-independent metastatic mechanism involving constitutive secretion of matrix degrading proteases without elevated glycolysis. These results have identified two distinct mechanisms of experimental metastasis, one of which is pH-dependent (buffer therapy sensitive cells) and one which is pH-independent (buffer therapy resistant cells). Further characterization of these models has potential for therapeutic benefit.

  1. Flame and acid resistant polymide fibers

    NASA Technical Reports Server (NTRS)

    Stringham, R. S.; Toy, M. S.

    1977-01-01

    Economical process improves flame resistance and resistance to acids of polyamide fibers, without modifying colors of mechanical properties. Process improves general safety of garments and other items made from polyamide fibers and makes them suitable for applications requiring exposure to oxygen-rich atmosphere or corrosive acids. Halo-olefins are added to surface of fibers by photoadditon in sealed chamber. Process could be used with films and other forms of polyamide.

  2. Mechanisms of drug resistance: quinolone resistance

    PubMed Central

    Hooper, David C.; Jacoby, George A.

    2015-01-01

    Quinolone antimicrobials are synthetic and widely used in clinical medicine. Resistance emerged with clinical use and became common in some bacterial pathogens. Mechanisms of resistance include two categories of mutation and acquisition of resistance-conferring genes. Resistance mutations in one or both of the two drug target enzymes, DNA gyrase and DNA topoisomerase IV, are commonly in a localized domain of the GyrA and ParE subunits of the respective enzymes and reduce drug binding to the enzyme-DNA complex. Other resistance mutations occur in regulatory genes that control the expression of native efflux pumps localized in the bacterial membrane(s). These pumps have broad substrate profiles that include quinolones as well as other antimicrobials, disinfectants, and dyes. Mutations of both types can accumulate with selection pressure and produce highly resistant strains. Resistance genes acquired on plasmids can confer low-level resistance that promotes the selection of mutational high-level resistance. Plasmid-encoded resistance is due to Qnr proteins that protect the target enzymes from quinolone action, one mutant aminoglycoside-modifying enzyme that also modifies certain quinolones, and mobile efflux pumps. Plasmids with these mechanisms often encode additional antimicrobial resistances and can transfer multidrug resistance that includes quinolones. Thus, the bacterial quinolone resistance armamentarium is large. PMID:26190223

  3. Sequence-Specific Peptide Nucleic Acid-Based Antisense Inhibitors of TEM-1 β-Lactamase and Mechanism of Adaptive Resistance.

    PubMed

    Courtney, Colleen M; Chatterjee, Anushree

    2015-06-12

    The recent surge of drug-resistant superbugs and shrinking antibiotic pipeline are serious challenges to global health. In particular, the emergence of β-lactamases has caused extensive resistance against the most frequently prescribed class of β-lactam antibiotics. Here, we develop novel synthetic peptide nucleic acid-based antisense inhibitors that target the start codon and ribosomal binding site of the TEM-1 β-lactamase transcript and act via translation inhibition mechanism. We show that these antisense inhibitors are capable of resensitizing drug-resistant Escherichia coli to β-lactam antibiotics exhibiting 10-fold reduction in the minimum inhibitory concentration (MIC). To study the mechanism of resistance, we adapted E. coli at MIC levels of the β-lactam/antisense inhibitor combination and observed a nonmutational, bet-hedging based adaptive antibiotic resistance response as evidenced by phenotypic heterogeneity as well as heterogeneous expression of key stress response genes. Our data show that both the development of new antimicrobials and an understanding of cellular response during the development of tolerance could aid in mitigating the impending antibiotic crisis. PMID:27622741

  4. Matrine cooperates with all-trans retinoic acid on differentiation induction of all-trans retinoic acid-resistant acute promyelocytic leukemia cells (NB4-LR1): possible mechanisms.

    PubMed

    Wu, Dijiong; Shao, Keding; Sun, Jie; Zhu, Fuyun; Ye, Baodong; Liu, Tingting; Shen, Yiping; Huang, He; Zhou, Yuhong

    2014-03-01

    Retinoic acid resistance results in refractory disease, and recovery in acute promyelocytic leukemia remains a challenge in clinical practice, with no ideal chemotherapeutic drug currently available. Here we report on the effect of an active compound of Sophora flavescens called matrine (0.1 mmol/L) combined with all-trans retinoic acid (1 µmol/L) in alleviating retinoic acid resistance in acute promyelocytic leukemia-derived NB4-LR1 cells by differentiation induction, as can be seen by an induced morphology change, increased CD11b expression, and nitro blue tetrazolium reduction activity, and a decreased expression of the promyelocytic leukemia-retinoic acid receptor α fusion gene and protein product. We further explored the probable mechanism of how matrine promotes the recovery of differentiation ability in NB4-LR1 cells when exposed to all-trans retinoic acid. We observed that the combination of all-trans retinoic acid and matrine can increase the level of cyclic adenosine monophosphate and protein kinase A activity, reduce telomerase activity, and downregulate the protein expression of topoisomerase II beta in NB4-LR1 cells. The results of this study suggest the possible clinical utility of matrine in the treatment of retinoic acid-resistant acute promyelocytic leukemia.

  5. Omega-3 fatty acids and brain resistance to ageing and stress: body of evidence and possible mechanisms.

    PubMed

    Denis, I; Potier, B; Vancassel, S; Heberden, C; Lavialle, M

    2013-03-01

    The increasing life expectancy in the populations of rich countries raises the pressing question of how the elderly can maintain their cognitive function. Cognitive decline is characterised by the loss of short-term memory due to a progressive impairment of the underlying brain cell processes. Age-related brain damage has many causes, some of which may be influenced by diet. An optimal diet may therefore be a practical way of delaying the onset of age-related cognitive decline. Nutritional investigations indicate that the ω-3 poyunsaturated fatty acid (PUFA) content of western diets is too low to provide the brain with an optimal supply of docosahexaenoic acid (DHA), the main ω-3 PUFA in cell membranes. Insufficient brain DHA has been associated with memory impairment, emotional disturbances and altered brain processes in rodents. Human studies suggest that an adequate dietary intake of ω-3 PUFA can slow the age-related cognitive decline and may also protect against the risk of senile dementia. However, despite the many studies in this domain, the beneficial impact of ω-3 PUFA on brain function has only recently been linked to specific mechanisms. This review examines the hypothesis that an optimal brain DHA status, conferred by an adequate ω-3 PUFA intake, limits age-related brain damage by optimizing endogenous brain repair mechanisms. Our analysis of the abundant literature indicates that an adequate amount of DHA in the brain may limit the impact of stress, an important age-aggravating factor, and influences the neuronal and astroglial functions that govern and protect synaptic transmission. This transmission, particularly glutamatergic neurotransmission in the hippocampus, underlies memory formation. The brain DHA status also influences neurogenesis, nested in the hippocampus, which helps maintain cognitive function throughout life. Although there are still gaps in our knowledge of the way ω-3 PUFA act, the mechanistic studies reviewed here indicate that

  6. Mechanisms of Drug Resistance: Daptomycin Resistance

    PubMed Central

    Tran, Truc T.; Munita, Jose M.; Arias, Cesar A.

    2016-01-01

    Daptomycin (DAP) is a cyclic lipopeptide with in vitro activity against a variety of Gram-positive pathogens, including multidrug-resistant organisms. Since its introduction in clinical practice in 2003, DAP has become an important key front-line antibiotic for severe or deep-seated infections caused by Gram-positive organisms. Unfortunately, DAP-resistance (R) has been extensively documented in clinically important organisms such as Staphylococcus aureus, Enterococcus spp, and Streptococcus spp. Studies on the mechanisms of DAP-R in Bacillus subtilis and other Gram-positive bacteria indicate that the genetic pathways of DAP resistance are diverse and complex. However, a common phenomenon emerging from these mechanistic studies is that DAP-R is associated with important adaptive changes in cell wall and cell membrane homeostasis with critical changes in cell physiology. Findings related to these adaptive changes have offered novel insights into the genetics and molecular mechanisms of bacterial cell envelope stress response and the manner in which Gram-positive bacteria cope with the antimicrobial peptide attack and protect vital structures of the cell envelope such as the cell membrane. In this review, we will examine the most recent findings related to the molecular mechanisms of resistance to DAP in relevant Gram-positive pathogens and discuss the clinical implications for therapy against these important bacteria. PMID:26495887

  7. Mechanisms of echinocandin antifungal drug resistance

    PubMed Central

    Perlin, David S.

    2015-01-01

    Fungal infections due to Candida and Aspergillus species cause extensive morbidity and mortality, especially among immunosuppressed patients, and antifungal therapy is critical to patient management. Yet only a few drug classes are available to treat invasive fungal diseases, and this problem is compounded by the emergence of antifungal resistance. Echinocandin drugs are the preferred choice to treat candidiasis. They are the first cell wall–active agents and target the fungal-specific enzyme glucan synthase, which catalyzes the biosynthesis of β-1,3-glucan, a key cell wall polymer. Therapeutic failures occur rarely among common Candida species, with the exception of Candida glabrata, which are frequently multidrug resistant. Echinocandin resistance in susceptible species is always acquired during therapy. The mechanism of resistance involves amino acid changes in hot-spot regions of Fks subunits of glucan synthase, which decrease the sensitivity of the enzyme to drug. Cellular stress response pathways lead to drug adaptation, which promote the formation of resistant fks strains. Clinical factors promoting echinocandin resistance include empiric therapy, prophylaxis, gastrointestinal reservoirs, and intra-abdominal infections. A better understanding of the echinocandin resistance mechanism, along with cellular and clinical factors promoting resistance, will promote more effective strategies to overcome and prevent echinocandin resistance. PMID:26190298

  8. Silicon-mediated resistance of Arabidopsis against powdery mildew involves mechanisms other than the salicylic acid (SA)-dependent defence pathway.

    PubMed

    Vivancos, Julien; Labbé, Caroline; Menzies, James G; Bélanger, Richard R

    2015-08-01

    On absorption by plants, silicon (Si) offers protection against many fungal pathogens, including powdery mildews. The mechanisms by which Si exerts its prophylactic role remain enigmatic, although a prevailing hypothesis suggests that Si positively influences priming. Attempts to decipher Si properties have been limited to plants able to absorb Si, which excludes the model plant Arabidopsis because it lacks Si influx transporters. In this work, we were able to engineer Arabidopsis plants with an Si transporter from wheat (TaLsi1) and to exploit mutants (pad4 and sid2) deficient in salicylic acid (SA)-dependent defence responses to study their phenotypic response and changes in defence expression against Golovinomyces cichoracearum (Gc) following Si treatment. Our results showed that TaLsi1 plants contained significantly more Si and were significantly more resistant to Gc infection than control plants when treated with Si, the first such demonstration in a plant transformed with a heterologous Si transporter. The resistant plants accumulated higher levels of SA and expressed higher levels of transcripts encoding defence genes, thus suggesting a role for Si in the process. However, TaLsi1 pad4 and TaLsi1 sid2 plants were also more resistant to Gc than were pad4 and sid2 plants following Si treatment. Analysis of the resistant phenotypes revealed a significantly reduced production of SA and expression of defence genes comparable with susceptible controls. These results indicate that Si contributes to Arabidopsis defence priming following pathogen infection, but highlight that Si will confer protection even when priming is altered. We conclude that Si-mediated protection involves mechanisms other than SA-dependent defence responses.

  9. Silicon-mediated resistance of Arabidopsis against powdery mildew involves mechanisms other than the salicylic acid (SA)-dependent defence pathway.

    PubMed

    Vivancos, Julien; Labbé, Caroline; Menzies, James G; Bélanger, Richard R

    2015-08-01

    On absorption by plants, silicon (Si) offers protection against many fungal pathogens, including powdery mildews. The mechanisms by which Si exerts its prophylactic role remain enigmatic, although a prevailing hypothesis suggests that Si positively influences priming. Attempts to decipher Si properties have been limited to plants able to absorb Si, which excludes the model plant Arabidopsis because it lacks Si influx transporters. In this work, we were able to engineer Arabidopsis plants with an Si transporter from wheat (TaLsi1) and to exploit mutants (pad4 and sid2) deficient in salicylic acid (SA)-dependent defence responses to study their phenotypic response and changes in defence expression against Golovinomyces cichoracearum (Gc) following Si treatment. Our results showed that TaLsi1 plants contained significantly more Si and were significantly more resistant to Gc infection than control plants when treated with Si, the first such demonstration in a plant transformed with a heterologous Si transporter. The resistant plants accumulated higher levels of SA and expressed higher levels of transcripts encoding defence genes, thus suggesting a role for Si in the process. However, TaLsi1 pad4 and TaLsi1 sid2 plants were also more resistant to Gc than were pad4 and sid2 plants following Si treatment. Analysis of the resistant phenotypes revealed a significantly reduced production of SA and expression of defence genes comparable with susceptible controls. These results indicate that Si contributes to Arabidopsis defence priming following pathogen infection, but highlight that Si will confer protection even when priming is altered. We conclude that Si-mediated protection involves mechanisms other than SA-dependent defence responses. PMID:25346281

  10. (Mechanisms of tolerance and resistance)

    SciTech Connect

    Waters, L.C.

    1990-08-28

    The traveler participated in the Seventh International Congress of Pesticide Chemistry by presenting a poster entitled Studies on the Expression of Insecticide Resistance-Associated Cytochrome P450 in Drosophila Using Cloned DNA'' and as an invited speaker in the Workshop Session on Insecticide Resistance. The Congress covered a wide range of topics, including studies of new syntheic compounds and natural products with crop protecting properties, modes of action of pesticides, mechanisms of pesticide resistance, environmental fate of pesticides and estimates of risk to pesticide exposure. Several presentations on the potential role of cytochrome P450 in resistance to insecticides and herbicides were relevant to our work at ORNL's Biology Division on molecular mechanisms of P450 expression.

  11. Antimicrobial Resistance Mechanisms among Campylobacter

    PubMed Central

    2013-01-01

    Campylobacter jejuni and Campylobacter coli are recognized as the most common causative agents of bacterial gastroenteritis in the world. Humans most often become infected by ingesting contaminated food, especially undercooked chicken, but also other sources of bacteria have been described. Campylobacteriosis is normally a self-limiting disease. Antimicrobial treatment is needed only in patients with more severe disease and in those who are immunologically compromised. The most common antimicrobial agents used in the treatment of Campylobacter infections are macrolides, such as erythromycin, and fluoroquinolones, such as ciprofloxacin. Tetracyclines have been suggested as an alternative choice in the treatment of clinical campylobacteriosis but in practice are not often used. However, during the past few decades an increasing number of resistant Campylobacter isolates have developed resistance to fluoroquinolones and other antimicrobials such as macrolides, aminoglycosides, and beta-lactams. Trends in antimicrobial resistance have shown a clear correlation between use of antibiotics in the veterinary medicine and animal production and resistant isolates of Campylobacter in humans. In this review, the patterns of emerging resistance to the antimicrobial agents useful in treatment of the disease are presented and the mechanisms of resistance to these drugs in Campylobacter are discussed. PMID:23865047

  12. Resistance mechanisms in Campylobacter jejuni.

    PubMed

    Iovine, Nicole M

    2013-04-01

    Campylobacter jejuni is a major cause of food-borne gastroenteritis worldwide. While mortality is low, morbidity imparted by post-infectious sequelae such as Guillain-Barré syndrome, Reiter syndrome/reactive arthritis and irritable bowel syndrome is significant. In addition, the economic cost is high due to lost productivity. Food animals, particularly poultry, are the main reservoirs of C. jejuni. The over-use of antibiotics in the human population and in animal husbandry has led to an increase in antibiotic-resistant infections, particularly with fluoroquinolones. This is problematic because C. jejuni gastroenteritis is clinically indistinguishable from that caused by other bacterial pathogens, and such illnesses are usually treated empirically with fluoroquinolones. Since C. jejuni is naturally transformable, acquisition of additional genes imparting antibiotic resistance is likely. Therefore, an understanding of the antibiotic resistance mechanisms in C. jejuni is needed to provide proper therapy both to the veterinary and human populations.

  13. The Mechanism of Fluid Resistance

    NASA Technical Reports Server (NTRS)

    Vonkarman, T.; Rubach, H.

    1979-01-01

    The mechanism of fluid resistance within the limit of the square law is presented. It was concluded that the investigations should be extended and completed in two directions, namely: by an investigation of stable vortex configurations in space, and by considering the perfect fluid as the limiting case of a viscous fluid and then limiting the law of vortex of formation with the condition that only those fluid particles which were in contact with the surface of the body can receive rotation.

  14. Acid soluble, pepsin resistant platelet aggregating material

    SciTech Connect

    Schneider, M.D.

    1982-08-31

    Disclosed is an acid soluble, pepsin resistant, platelet aggregating material isolated from equine arterial tissue by extraction with dilute aqueous acid. The method of isolation and use to control bleeding are described. 4 figs.

  15. Drug Resistance Mechanisms in Mycobacterium tuberculosis

    PubMed Central

    Palomino, Juan Carlos; Martin, Anandi

    2014-01-01

    Tuberculosis (TB) is a serious public health problem worldwide. Its situation is worsened by the presence of multidrug resistant (MDR) strains of Mycobacterium tuberculosis, the causative agent of the disease. In recent years, even more serious forms of drug resistance have been reported. A better knowledge of the mechanisms of drug resistance of M. tuberculosis and the relevant molecular mechanisms involved will improve the available techniques for rapid drug resistance detection and will help to explore new targets for drug activity and development. This review article discusses the mechanisms of action of anti-tuberculosis drugs and the molecular basis of drug resistance in M. tuberculosis. PMID:27025748

  16. Drug Resistance Mechanisms in Mycobacterium tuberculosis.

    PubMed

    Palomino, Juan Carlos; Martin, Anandi

    2014-01-01

    Tuberculosis (TB) is a serious public health problem worldwide. Its situation is worsened by the presence of multidrug resistant (MDR) strains of Mycobacterium tuberculosis, the causative agent of the disease. In recent years, even more serious forms of drug resistance have been reported. A better knowledge of the mechanisms of drug resistance of M. tuberculosis and the relevant molecular mechanisms involved will improve the available techniques for rapid drug resistance detection and will help to explore new targets for drug activity and development. This review article discusses the mechanisms of action of anti-tuberculosis drugs and the molecular basis of drug resistance in M. tuberculosis. PMID:27025748

  17. Antiviral Drug Resistance: Mechanisms and Clinical Implications

    PubMed Central

    Chou, Sunwen

    2010-01-01

    Summary Antiviral drug resistance is an increasing concern in immunocompromised patient populations, where ongoing viral replication and prolonged drug exposure lead to the selection of resistant strains. Rapid diagnosis of resistance can be made by associating characteristic viral mutations with resistance to various drugs as determined by phenotypic assays. Management of drug resistance includes optimization of host factors and drug delivery, selection of alternative therapies based on knowledge of mechanisms of resistance, and the development of new antivirals. This article discusses drug resistance in herpesviruses and hepatitis B. PMID:20466277

  18. Bile resistance mechanisms in Lactobacillus and Bifidobacterium

    PubMed Central

    Ruiz, Lorena; Margolles, Abelardo; Sánchez, Borja

    2013-01-01

    Probiotics are live microorganisms which when administered in adequate amounts confer a health benefit on the host. Most of the probiotic bacteria currently available in the market belong to the genera Lactobacillus and Bifidobacterium, and specific health-promoting activities, such as treatment of diarrhea or amelioration of gastrointestinal discomfort, have been attributed to them. In order to be able to survive the gastrointestinal transit and transiently colonize our gut, these bacteria must be able to counteract the deleterious action of bile salts, which are the main components of bile. Bile salts are detergent-like biological substances synthesized in the liver from cholesterol. Host enzymes conjugate the newly synthesized free bile acids in the liver with the amino acids glycine or taurine, generating conjugated bile salts. These compounds are stored in the gall bladder and they are released into the duodenum during digestion to perform their physiological function, which is the solubilization of fat coming from diet. These bile salts possess strong antimicrobial activity, since they are able to disorganize the structure of the cell membrane, as well as trigger DNA damage. This means that bacteria inhabiting our intestinal tract must have intrinsic resistance mechanisms to cope with bile salts. To do that, Lactobacillus and Bifidobacterium display a variety of proteins devoted to the efflux of bile salts or protons, to modify sugar metabolism or to prevent protein misfolding. In this manuscript, we review and discuss specific bile resistance mechanisms, as well as the processes responsible for the adaptation of bifidobacteria and lactobacilli to bile. PMID:24399996

  19. Morphological and mechanical characterization of the acid-base resistant zone at the adhesive-dentin interface of intact and caries-affected dentin.

    PubMed

    Inoue, Go; Tsuchiya, Satoko; Nikaido, Toru; Foxton, Richard M; Tagami, Junji

    2006-01-01

    This study examined the ultrastructure of both intact and caries affected dentin-adhesive interface after artificial secondary caries formation, using scanning electron microscopy and nanoindentation testing. Half of the prepared specimens were bonded with Clearfil SE Bond (Kuraray Medical, Japan) and a resin composite (Metafil Flo, Sun Medical, Japan) for the nanoindentation test. The other specimens were stored in a buffered demineralizing solution for 90 minutes, then observed using SEM. An acid-base resistant zone (ABRZ) was observed beneath the hybrid layer, distinguished by argon-ion etching. The ABRZ of caries-affected dentin was thicker than that of normal dentin, while its nanohardess was lower than normal dentin (p<0.05). It is suggested that the monomer of Clearfil SE Bond penetrated deeper than previously reported, creating a so-called "hybrid layer." However, its physical properties depended on the condition of the dentin.

  20. Mechanisms of Antimicrobial Resistance in ESKAPE Pathogens

    PubMed Central

    Santajit, Sirijan; Indrawattana, Nitaya

    2016-01-01

    The ESKAPE pathogens (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) are the leading cause of nosocomial infections throughout the world. Most of them are multidrug resistant isolates, which is one of the greatest challenges in clinical practice. Multidrug resistance is amongst the top three threats to global public health and is usually caused by excessive drug usage or prescription, inappropriate use of antimicrobials, and substandard pharmaceuticals. Understanding the resistance mechanisms of these bacteria is crucial for the development of novel antimicrobial agents or other alternative tools to combat these public health challenges. Greater mechanistic understanding would also aid in the prediction of underlying or even unknown mechanisms of resistance, which could be applied to other emerging multidrug resistant pathogens. In this review, we summarize the known antimicrobial resistance mechanisms of ESKAPE pathogens. PMID:27274985

  1. Resistance of yeasts to weak organic acid food preservatives.

    PubMed

    Piper, Peter W

    2011-01-01

    Carboxylate weak acids are invaluable for large-scale food and beverage preservation. However, in response to safety concerns, there is now desire to reduce the use of these additives. The resistance to these compounds displayed by spoilage yeasts and fungi is a major reason why these preservatives often have to be used in millimolar levels. This chapter summarizes the mechanisms whereby yeasts are rendered resistant to acetate, propionate, sorbate, and benzoate. In baker's yeast (Saccharomyces cerevisiae), resistance to high acetic acid is acquired partly by loss of the plasma membrane aquaglyceroporin that facilitates the passive diffusional entry of undissociated acid into cells (Fps1), and partly through a transcriptional response mediated by the transcription factor Haa1. Other carboxylate preservatives are too large to enter cells through the Fps1 channel but instead penetrate at appreciable rates by passive diffusion across the plasma membrane. In Saccharomyces and Candida albicans though not, it seems, in the Zygosaccharomyces, resistance to the latter acids involves activation of the War1 transcription factor, which in turn generates strong induction of a specific plasma membrane ATP-binding cassette transporter (Pdr12). The latter actively pumps the preservative anion from the cell. Other contributors to weak acid resistance include enzymes that allow preservative degradation, members of the Tpo family of major facilitator superfamily transporters, and changes to the cell envelope that minimize the diffusional entry of the preservative into the cell. PMID:22050823

  2. Resistance of yeasts to weak organic acid food preservatives.

    PubMed

    Piper, Peter W

    2011-01-01

    Carboxylate weak acids are invaluable for large-scale food and beverage preservation. However, in response to safety concerns, there is now desire to reduce the use of these additives. The resistance to these compounds displayed by spoilage yeasts and fungi is a major reason why these preservatives often have to be used in millimolar levels. This chapter summarizes the mechanisms whereby yeasts are rendered resistant to acetate, propionate, sorbate, and benzoate. In baker's yeast (Saccharomyces cerevisiae), resistance to high acetic acid is acquired partly by loss of the plasma membrane aquaglyceroporin that facilitates the passive diffusional entry of undissociated acid into cells (Fps1), and partly through a transcriptional response mediated by the transcription factor Haa1. Other carboxylate preservatives are too large to enter cells through the Fps1 channel but instead penetrate at appreciable rates by passive diffusion across the plasma membrane. In Saccharomyces and Candida albicans though not, it seems, in the Zygosaccharomyces, resistance to the latter acids involves activation of the War1 transcription factor, which in turn generates strong induction of a specific plasma membrane ATP-binding cassette transporter (Pdr12). The latter actively pumps the preservative anion from the cell. Other contributors to weak acid resistance include enzymes that allow preservative degradation, members of the Tpo family of major facilitator superfamily transporters, and changes to the cell envelope that minimize the diffusional entry of the preservative into the cell.

  3. Evolution of herbicide resistance mechanisms in grass weeds.

    PubMed

    Matzrafi, Maor; Gadri, Yaron; Frenkel, Eyal; Rubin, Baruch; Peleg, Zvi

    2014-12-01

    Herbicide resistant weeds are becoming increasingly common, threatening global food security. Here, we present BrIFAR: a new model system for the functional study of mechanisms of herbicide resistance in grass weeds. We have developed a large collection of Brachypodium accessions, the BrI collection, representing a wide range of habitats. Wide screening of the responses of the accessions to four major herbicide groups (PSII, ACCase, ALS/AHAS and EPSPS inhibitors) identified 28 herbicide-resistance candidate accessions. Target-site resistance to PSII inhibitors was found in accessions collected from habitats with a known history of herbicide applications. An amino acid substitution in the psbA gene (serine264 to glycine) conferred resistance and also significantly affected the flowering and shoot dry weight of the resistant accession, as compared to the sensitive accession. Non-target site resistance to ACCase inhibitors was found in accessions collected from habitats with a history of herbicide application and from a nature reserve. In-vitro enzyme activity tests and responses following pre-treatment with malathion (a cytochrome-P450 inhibitor) indicated sensitivity at the enzyme level, and give strong support to diclofop-methyl and pinoxaden enhanced detoxification as NTS resistance mechanism. BrIFAR can promote better understanding of the evolution of mechanisms of herbicide resistance and aid the implementation of integrative management approaches for sustainable agriculture.

  4. Evolution of herbicide resistance mechanisms in grass weeds.

    PubMed

    Matzrafi, Maor; Gadri, Yaron; Frenkel, Eyal; Rubin, Baruch; Peleg, Zvi

    2014-12-01

    Herbicide resistant weeds are becoming increasingly common, threatening global food security. Here, we present BrIFAR: a new model system for the functional study of mechanisms of herbicide resistance in grass weeds. We have developed a large collection of Brachypodium accessions, the BrI collection, representing a wide range of habitats. Wide screening of the responses of the accessions to four major herbicide groups (PSII, ACCase, ALS/AHAS and EPSPS inhibitors) identified 28 herbicide-resistance candidate accessions. Target-site resistance to PSII inhibitors was found in accessions collected from habitats with a known history of herbicide applications. An amino acid substitution in the psbA gene (serine264 to glycine) conferred resistance and also significantly affected the flowering and shoot dry weight of the resistant accession, as compared to the sensitive accession. Non-target site resistance to ACCase inhibitors was found in accessions collected from habitats with a history of herbicide application and from a nature reserve. In-vitro enzyme activity tests and responses following pre-treatment with malathion (a cytochrome-P450 inhibitor) indicated sensitivity at the enzyme level, and give strong support to diclofop-methyl and pinoxaden enhanced detoxification as NTS resistance mechanism. BrIFAR can promote better understanding of the evolution of mechanisms of herbicide resistance and aid the implementation of integrative management approaches for sustainable agriculture. PMID:25443832

  5. Influence of cyclopropane fatty acids on heat, high pressure, acid and oxidative resistance in Escherichia coli.

    PubMed

    Chen, Yuan Yao; Gänzle, Michael G

    2016-04-01

    Heat and high pressure resistant strains of Escherichia coli are a challenge to food safety. This study investigated effects of cyclopropane fatty acids (CFAs) on stress tolerance in the heat- and pressure-resistant strain E. coli AW1.7 and the sensitive strain E. coli MG1655. The role of CFAs was explored by disruption of cfa coding for CFA synthase with an in-frame, unmarked deletion method. Both wild-type strains consumed all the unsaturated fatty acids (C16:1 and C18:1) that were mostly converted to CFAs and a low proportion to saturated fatty acid (C16:0). Moreover, E. coli AW1.7 contained a higher proportion of membrane C19:0 cyclopropane fatty acid than E. coli MG1655 (P<0.05). The Δcfa mutant strains did not produce CFAs, and the corresponding substrates C16:1 and C18:1 accumulated in membrane lipids. The deletion of cfa did not alter resistance to H2O2 but increased the lethality of heat, high pressure and acid treatments in E. coli AW1.7, and E. coli MG1655. E. coli AW1.7 and its Δcfa mutant were more resistant to pressure and heat but less resistant to acid stress than E. coli MG1655. Heat resistance of wild-type strains and their Δcfa mutant was also assessed in beef patties grilled to an internal temperature of 71 °C. After treatment, cell counts of wild type strains were higher than those of the Δcfa mutant strains. In conclusion, CFA synthesis in E. coli increases heat, high pressure and acid resistance, and increases heat resistance in food. This knowledge on mechanisms of stress resistance will facilitate the design of intervention methods for improved pathogen control in food production.

  6. Disease resistance: Molecular mechanisms and biotechnological applications

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This special issue “Disease resistance: molecular mechanisms and biotechnological applications” contains 11 review articles and four original research papers. Research in the area of engineering for disease resistance continues to progress although only 10% of the transgenic plants registered for ...

  7. A branched-chain amino acid metabolite drives vascular fatty acid transport and causes insulin resistance.

    PubMed

    Jang, Cholsoon; Oh, Sungwhan F; Wada, Shogo; Rowe, Glenn C; Liu, Laura; Chan, Mun Chun; Rhee, James; Hoshino, Atsushi; Kim, Boa; Ibrahim, Ayon; Baca, Luisa G; Kim, Esl; Ghosh, Chandra C; Parikh, Samir M; Jiang, Aihua; Chu, Qingwei; Forman, Daniel E; Lecker, Stewart H; Krishnaiah, Saikumari; Rabinowitz, Joshua D; Weljie, Aalim M; Baur, Joseph A; Kasper, Dennis L; Arany, Zoltan

    2016-04-01

    Epidemiological and experimental data implicate branched-chain amino acids (BCAAs) in the development of insulin resistance, but the mechanisms that underlie this link remain unclear. Insulin resistance in skeletal muscle stems from the excess accumulation of lipid species, a process that requires blood-borne lipids to initially traverse the blood vessel wall. How this trans-endothelial transport occurs and how it is regulated are not well understood. Here we leveraged PPARGC1a (also known as PGC-1α; encoded by Ppargc1a), a transcriptional coactivator that regulates broad programs of fatty acid consumption, to identify 3-hydroxyisobutyrate (3-HIB), a catabolic intermediate of the BCAA valine, as a new paracrine regulator of trans-endothelial fatty acid transport. We found that 3-HIB is secreted from muscle cells, activates endothelial fatty acid transport, stimulates muscle fatty acid uptake in vivo and promotes lipid accumulation in muscle, leading to insulin resistance in mice. Conversely, inhibiting the synthesis of 3-HIB in muscle cells blocks the ability of PGC-1α to promote endothelial fatty acid uptake. 3-HIB levels are elevated in muscle from db/db mice with diabetes and from human subjects with diabetes, as compared to those without diabetes. These data unveil a mechanism in which the metabolite 3-HIB, by regulating the trans-endothelial flux of fatty acids, links the regulation of fatty acid flux to BCAA catabolism, providing a mechanistic explanation for how increased BCAA catabolic flux can cause diabetes. PMID:26950361

  8. Mechanisms of antibiotic resistance in enterococci

    PubMed Central

    Miller, William R; Munita, Jose M; Arias, Cesar A

    2015-01-01

    Multidrug-resistant (MDR) enterococci are important nosocomial pathogens and a growing clinical challenge. These organisms have developed resistance to virtually all antimicrobials currently used in clinical practice using a diverse number of genetic strategies. Due to this ability to recruit antibiotic resistance determinants, MDR enterococci display a wide repertoire of antibiotic resistance mechanisms including modification of drug targets, inactivation of therapeutic agents, overexpression of efflux pumps and a sophisticated cell envelope adaptive response that promotes survival in the human host and the nosocomial environment. MDR enterococci are well adapted to survive in the gastrointestinal tract and can become the dominant flora under antibiotic pressure, predisposing the severely ill and immunocompromised patient to invasive infections. A thorough understanding of the mechanisms underlying antibiotic resistance in enterococci is the first step for devising strategies to control the spread of these organisms and potentially establish novel therapeutic approaches. PMID:25199988

  9. Antibiotic resistance mechanisms of Myroides sp.

    PubMed

    Hu, Shao-hua; Yuan, Shu-xing; Qu, Hai; Jiang, Tao; Zhou, Ya-jun; Wang, Ming-xi; Ming, De-song

    2016-03-01

    Bacteria of the genus Myroides (Myroides spp.) are rare opportunistic pathogens. Myroides sp. infections have been reported mainly in China. Myroides sp. is highly resistant to most available antibiotics, but the resistance mechanisms are not fully elucidated. Current strain identification methods based on biochemical traits are unable to identify strains accurately at the species level. While 16S ribosomal RNA (rRNA) gene sequencing can accurately achieve this, it fails to give information on the status and mechanisms of antibiotic resistance, because the 16S rRNA sequence contains no information on resistance genes, resistance islands or enzymes. We hypothesized that obtaining the whole genome sequence of Myroides sp., using next generation sequencing methods, would help to clarify the mechanisms of pathogenesis and antibiotic resistance, and guide antibiotic selection to treat Myroides sp. infections. As Myroides sp. can survive in hospitals and the environment, there is a risk of nosocomial infections and pandemics. For better management of Myroides sp. infections, it is imperative to apply next generation sequencing technologies to clarify the antibiotic resistance mechanisms in these bacteria.

  10. Mechanisms of Candida biofilm drug resistance

    PubMed Central

    Taff, Heather T; Mitchell, Kaitlin F; Edward, Jessica A; Andes, David R

    2013-01-01

    Candida commonly adheres to implanted medical devices, growing as a resilient biofilm capable of withstanding extraordinarily high antifungal concentrations. As currently available antifungals have minimal activity against biofilms, new drugs to treat these recalcitrant infections are urgently needed. Recent investigations have begun to shed light on the mechanisms behind the profound resistance associated with the biofilm mode of growth. This resistance appears to be multifactorial, involving both mechanisms similar to conventional, planktonic antifungal resistance, such as increased efflux pump activity, as well as mechanisms specific to the biofilm lifestyle. A unique biofilm property is the production of an extracellular matrix. Two components of this material, β-glucan and extracellular DNA, promote biofilm resistance to multiple antifungals. Biofilm formation also engages several stress response pathways that impair the activity of azole drugs. Resistance within a biofilm is often heterogeneous, with the development of a subpopulation of resistant persister cells. In this article we review the molecular mechanisms underlying Candida biofilm antifungal resistance and their relative contributions during various growth phases. PMID:24059922

  11. Antibiotic resistance mechanisms of Myroides sp.*

    PubMed Central

    Hu, Shao-hua; Yuan, Shu-xing; Qu, Hai; Jiang, Tao; Zhou, Ya-jun; Wang, Ming-xi; Ming, De-song

    2016-01-01

    Bacteria of the genus Myroides (Myroides spp.) are rare opportunistic pathogens. Myroides sp. infections have been reported mainly in China. Myroides sp. is highly resistant to most available antibiotics, but the resistance mechanisms are not fully elucidated. Current strain identification methods based on biochemical traits are unable to identify strains accurately at the species level. While 16S ribosomal RNA (rRNA) gene sequencing can accurately achieve this, it fails to give information on the status and mechanisms of antibiotic resistance, because the 16S rRNA sequence contains no information on resistance genes, resistance islands or enzymes. We hypothesized that obtaining the whole genome sequence of Myroides sp., using next generation sequencing methods, would help to clarify the mechanisms of pathogenesis and antibiotic resistance, and guide antibiotic selection to treat Myroides sp. infections. As Myroides sp. can survive in hospitals and the environment, there is a risk of nosocomial infections and pandemics. For better management of Myroides sp. infections, it is imperative to apply next generation sequencing technologies to clarify the antibiotic resistance mechanisms in these bacteria. PMID:26984839

  12. Mechanisms of Resistance to Photodynamic Therapy

    PubMed Central

    Casas, Adriana; Di Venosa, Gabriela; Hasan, Tayyaba; Batlle, Alcira

    2013-01-01

    Photodynamic therapy (PDT) involves the administration of a photosensitizer (PS) followed by illumination with visible light, leading to generation of reactive oxygen species. The mechanisms of resistance to PDT ascribed to the PS may be shared with the general mechanisms of drug resistance, and are related to altered drug uptake and efflux rates or altered intracellular trafficking. As a second step, an increased inactivation of oxygen reactive species is also associated to PDT resistance via antioxidant detoxifying enzymes and activation of heat shock proteins. Induction of stress response genes also occurs after PDT, resulting in modulation of proliferation, cell detachment and inducing survival pathways among other multiple extracellular signalling events. In addition, an increased repair of induced damage to proteins, membranes and occasionally to DNA may happen. PDT-induced tissue hypoxia as a result of vascular damage and photochemical oxygen consumption may also contribute to the appearance of resistant cells. The structure of the PS is believed to be a key point in the development of resistance, being probably related to its particular subcellular localization. Although most of the features have already been described for chemoresistance, in many cases, no cross-resistance between PDT and chemotherapy has been reported. These findings are in line with the enhancement of PDT efficacy by combination with chemotherapy. The study of cross resistance in cells with developed resistance against a particular PS challenged against other PS is also highly complex and comprises different mechanisms. In this review we will classify the different features observed in PDT resistance, leading to a comparison with the mechanisms most commonly found in chemo resistant cells. PMID:21568910

  13. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria

    PubMed Central

    Olaitan, Abiola O.; Morand, Serge; Rolain, Jean-Marc

    2014-01-01

    Polymyxins are polycationic antimicrobial peptides that are currently the last-resort antibiotics for the treatment of multidrug-resistant, Gram-negative bacterial infections. The reintroduction of polymyxins for antimicrobial therapy has been followed by an increase in reports of resistance among Gram-negative bacteria. Some bacteria, such as Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii, develop resistance to polymyxins in a process referred to as acquired resistance, whereas other bacteria, such as Proteus spp., Serratia spp., and Burkholderia spp., are naturally resistant to these drugs. Reports of polymyxin resistance in clinical isolates have recently increased, including acquired and intrinsically resistant pathogens. This increase is considered a serious issue, prompting concern due to the low number of currently available effective antibiotics. This review summarizes current knowledge concerning the different strategies bacteria employ to resist the activities of polymyxins. Gram-negative bacteria employ several strategies to protect themselves from polymyxin antibiotics (polymyxin B and colistin), including a variety of lipopolysaccharide (LPS) modifications, such as modifications of lipid A with phosphoethanolamine and 4-amino-4-deoxy-L-arabinose, in addition to the use of efflux pumps, the formation of capsules and overexpression of the outer membrane protein OprH, which are all effectively regulated at the molecular level. The increased understanding of these mechanisms is extremely vital and timely to facilitate studies of antimicrobial peptides and find new potential drugs targeting clinically relevant Gram-negative bacteria. PMID:25505462

  14. Mechanisms of polymyxin resistance: acquired and intrinsic resistance in bacteria.

    PubMed

    Olaitan, Abiola O; Morand, Serge; Rolain, Jean-Marc

    2014-01-01

    Polymyxins are polycationic antimicrobial peptides that are currently the last-resort antibiotics for the treatment of multidrug-resistant, Gram-negative bacterial infections. The reintroduction of polymyxins for antimicrobial therapy has been followed by an increase in reports of resistance among Gram-negative bacteria. Some bacteria, such as Klebsiella pneumoniae, Pseudomonas aeruginosa, and Acinetobacter baumannii, develop resistance to polymyxins in a process referred to as acquired resistance, whereas other bacteria, such as Proteus spp., Serratia spp., and Burkholderia spp., are naturally resistant to these drugs. Reports of polymyxin resistance in clinical isolates have recently increased, including acquired and intrinsically resistant pathogens. This increase is considered a serious issue, prompting concern due to the low number of currently available effective antibiotics. This review summarizes current knowledge concerning the different strategies bacteria employ to resist the activities of polymyxins. Gram-negative bacteria employ several strategies to protect themselves from polymyxin antibiotics (polymyxin B and colistin), including a variety of lipopolysaccharide (LPS) modifications, such as modifications of lipid A with phosphoethanolamine and 4-amino-4-deoxy-L-arabinose, in addition to the use of efflux pumps, the formation of capsules and overexpression of the outer membrane protein OprH, which are all effectively regulated at the molecular level. The increased understanding of these mechanisms is extremely vital and timely to facilitate studies of antimicrobial peptides and find new potential drugs targeting clinically relevant Gram-negative bacteria.

  15. Nitroheterocyclic drug resistance mechanisms in Trypanosoma brucei

    PubMed Central

    Wyllie, Susan; Foth, Bernardo J.; Kelner, Anna; Sokolova, Antoaneta Y.; Berriman, Matthew; Fairlamb, Alan H.

    2016-01-01

    Objectives The objective of this study was to identify the mechanisms of resistance to nifurtimox and fexinidazole in African trypanosomes. Methods Bloodstream-form Trypanosoma brucei were selected for resistance to nifurtimox and fexinidazole by stepwise exposure to increasing drug concentrations. Clones were subjected to WGS to identify putative resistance genes. Transgenic parasites modulating expression of genes of interest were generated and drug susceptibility phenotypes determined. Results Nifurtimox-resistant (NfxR) and fexinidazole-resistant (FxR) parasites shared reciprocal cross-resistance suggestive of a common mechanism of action. Previously, a type I nitroreductase (NTR) has been implicated in nitro drug activation. WGS of resistant clones revealed that NfxR parasites had lost >100 kb from one copy of chromosome 7, rendering them hemizygous for NTR as well as over 30 other genes. FxR parasites retained both copies of NTR, but lost >70 kb downstream of one NTR allele, decreasing NTR transcription by half. A single knockout line of NTR displayed 1.6- and 1.9-fold resistance to nifurtimox and fexinidazole, respectively. Since NfxR and FxR parasites are ∼6- and 20-fold resistant to nifurtimox and fexinidazole, respectively, additional factors must be involved. Overexpression and knockout studies ruled out a role for a putative oxidoreductase (Tb927.7.7410) and a hypothetical gene (Tb927.1.1050), previously identified in a genome-scale RNAi screen. Conclusions NTR was confirmed as a key resistance determinant, either by loss of one gene copy or loss of gene expression. Further work is required to identify which of the many dozens of SNPs identified in the drug-resistant cell lines contribute to the overall resistance phenotype. PMID:26581221

  16. Mechanisms of resistance in castration-resistant prostate cancer (CRPC)

    PubMed Central

    Chandrasekar, Thenappan; Yang, Joy C.; Gao, Allen C.

    2015-01-01

    Despite advances in prostate cancer diagnosis and management, morbidity from prostate cancer remains high. Approximately 20% of men present with advanced or metastatic disease, while 29,000 men continue to die of prostate cancer each year. Androgen deprivation therapy (ADT) has been the standard of care for initial management of advanced or metastatic prostate cancer since Huggins and Hodges first introduced the concept of androgen-dependence in 1972, but progression to castration-resistant prostate cancer (CRPC) occurs within 2-3 years of initiation of ADT. CRPC, previously defined as hormone-refractory prostate cancer, is now understood to still be androgen dependent. Multiple mechanisms of resistance help contribute to the progression to castration resistant disease, and the androgen receptor (AR) remains an important driver in this progression. These mechanisms include AR amplification and hypersensitivity, AR mutations leading to promiscuity, mutations in coactivators/corepressors, androgen-independent AR activation, and intratumoral and alternative androgen production. More recently, identification of AR variants (ARVs) has been established as another mechanism of progression to CRPC. Docetaxel chemotherapy has historically been the first-line treatment for CRPC, but in recent years, newer agents have been introduced that target some of these mechanisms of resistance, thereby providing additional survival benefit. These include AR signaling inhibitors such as enzalutamide (Xtandi, ENZA, MDV-3100) and CYP17A1 inhibitors such as abiraterone acetate (Zytiga). Ultimately, these agents will also fail to suppress CRPC. While some of the mechanisms by which these agents fail are unique, many share similarities to the mechanisms contributing to CRPC progression. Understanding these mechanisms of resistance to ADT and currently approved CRPC treatments will help guide future research into targeted therapies. PMID:26814148

  17. Molecular mechanisms for tumour resistance to chemotherapy.

    PubMed

    Pan, Shu-Ting; Li, Zhi-Ling; He, Zhi-Xu; Qiu, Jia-Xuan; Zhou, Shu-Feng

    2016-08-01

    Chemotherapy is one of the prevailing methods used to treat malignant tumours, but the outcome and prognosis of tumour patients are not optimistic. Cancer cells gradually generate resistance to almost all chemotherapeutic drugs via a variety of distinct mechanisms and pathways. Chemotherapeutic resistance, either intrinsic or acquired, is caused and sustained by reduced drug accumulation and increased drug export, alterations in drug targets and signalling transduction molecules, increased repair of drug-induced DNA damage, and evasion of apoptosis. In order to better understand the mechanisms of chemoresistance, this review highlights our current knowledge of the role of altered drug metabolism and transport and deregulation of apoptosis and autophagy in the development of tumour chemoresistance. Reduced intracellular activation of prodrugs (e.g. thiotepa and tegafur) or enhanced drug inactivation by Phase I and II enzymes contributes to the development of chemoresistance. Both primary and acquired resistance can be caused by alterations in the transport of anticancer drugs which is mediated by a variety of drug transporters such as P-glycoprotein (P-gp), multidrug resistance associated proteins, and breast cancer resistance protein. Presently there is a line of evidence indicating that deregulation of programmed cell death including apoptosis and autophagy is also an important mechanism for tumour resistance to anticancer drugs. Reversal of chemoresistance is likely via pharmacological and biological approaches. Further studies are warranted to grasp the full picture of how each type of cancer cells develop resistance to anticancer drugs and to identify novel strategies to overcome it.

  18. Molecular mechanisms for tumour resistance to chemotherapy.

    PubMed

    Pan, Shu-Ting; Li, Zhi-Ling; He, Zhi-Xu; Qiu, Jia-Xuan; Zhou, Shu-Feng

    2016-08-01

    Chemotherapy is one of the prevailing methods used to treat malignant tumours, but the outcome and prognosis of tumour patients are not optimistic. Cancer cells gradually generate resistance to almost all chemotherapeutic drugs via a variety of distinct mechanisms and pathways. Chemotherapeutic resistance, either intrinsic or acquired, is caused and sustained by reduced drug accumulation and increased drug export, alterations in drug targets and signalling transduction molecules, increased repair of drug-induced DNA damage, and evasion of apoptosis. In order to better understand the mechanisms of chemoresistance, this review highlights our current knowledge of the role of altered drug metabolism and transport and deregulation of apoptosis and autophagy in the development of tumour chemoresistance. Reduced intracellular activation of prodrugs (e.g. thiotepa and tegafur) or enhanced drug inactivation by Phase I and II enzymes contributes to the development of chemoresistance. Both primary and acquired resistance can be caused by alterations in the transport of anticancer drugs which is mediated by a variety of drug transporters such as P-glycoprotein (P-gp), multidrug resistance associated proteins, and breast cancer resistance protein. Presently there is a line of evidence indicating that deregulation of programmed cell death including apoptosis and autophagy is also an important mechanism for tumour resistance to anticancer drugs. Reversal of chemoresistance is likely via pharmacological and biological approaches. Further studies are warranted to grasp the full picture of how each type of cancer cells develop resistance to anticancer drugs and to identify novel strategies to overcome it. PMID:27097837

  19. Mechanisms of resistance to paraquat in plants.

    PubMed

    Hawkes, Timothy R

    2014-09-01

    The aim of this brief review is to draw information from studies of the mechanism of evolved resistance in weeds, together with information from laboratory studies of paraquat tolerance in model plants. Plants having mutations that limit paraquat uptake into cytoplasm, that confer various stress tolerances or that have transgenes that co-express two or more of the chloroplast Halliwell-Asada cycle enzymes can all exhibit enhanced tolerance to paraquat. However, none of these mechanisms correspond to the high-level resistances that have evolved naturally in weeds. Most, but not all, of the evidence from studies of paraquat-resistant biotypes of weeds can reasonably be reconciled with the proposal of a single major gene mechanism that sequesters paraquat away from chloroplasts and into the vacuole. However, the molecular details of this putative mechanism remain ill-defined.

  20. Sulfate and acid resistant concrete and mortar

    DOEpatents

    Liskowitz, J.W.; Wecharatana, M.; Jaturapitakkul, C.; Cerkanowicz, A.E.

    1998-06-30

    The present invention relates to concrete, mortar and other hardenable mixtures comprising cement and fly ash for use in construction and other applications, which hardenable mixtures demonstrate significant levels of acid and sulfate resistance while maintaining acceptable compressive strength properties. The acid and sulfate hardenable mixtures of the invention containing fly ash comprise cementitious materials and a fine aggregate. The cementitous materials may comprise fly ash as well as cement. The fine aggregate may comprise fly ash as well as sand. The total amount of fly ash in the hardenable mixture ranges from about 60% to about 120% of the total amount of cement, by weight, whether the fly ash is included as a cementious material, fine aggregate, or an additive, or any combination of the foregoing. In specific examples, mortar containing 50% fly ash and 50% cement in cementitious materials demonstrated superior properties of corrosion resistance. 6 figs.

  1. Sulfate and acid resistant concrete and mortar

    DOEpatents

    Liskowitz, John W.; Wecharatana, Methi; Jaturapitakkul, Chai; Cerkanowicz, deceased, Anthony E.

    1998-01-01

    The present invention relates to concrete, mortar and other hardenable mixtures comprising cement and fly ash for use in construction and other applications, which hardenable mixtures demonstrate significant levels of acid and sulfate resistance while maintaining acceptable compressive strength properties. The acid and sulfate hardenable mixtures of the invention containing fly ash comprise cementitious materials and a fine aggregate. The cementitous materials may comprise fly ash as well as cement. The fine aggregate may comprise fly ash as well as sand. The total amount of fly ash in the hardenable mixture ranges from about 60% to about 120% of the total amount of cement, by weight, whether the fly ash is included as a cementious material, fine aggregate, or an additive, or any combination of the foregoing. In specific examples, mortar containing 50% fly ash and 50% cement in cementitious materials demonstrated superior properties of corrosion resistance.

  2. Pool of resistance mechanisms to glyphosate in Digitaria insularis.

    PubMed

    de Carvalho, Leonardo Bianco; Alves, Pedro Luis da Costa Aguiar; González-Torralva, Fidel; Cruz-Hipolito, Hugo Enrique; Rojano-Delgado, Antonia María; De Prado, Rafael; Gil-Humanes, Javier; Barro, Francisco; de Castro, María Dolores Luque

    2012-01-18

    Digitaria insularis biotypes resistant to glyphosate have been detected in Brazil. Studies were carried out in controlled conditions to determine the role of absorption, translocation, metabolism, and gene mutation as mechanisms of glyphosate resistance in D. insularis. The susceptible biotype absorbed at least 12% more (14)C-glyphosate up to 48 h after treatment (HAT) than resistant biotypes. High differential (14)C-glyphosate translocation was observed at 12 HAT, so that >70% of the absorbed herbicide remained in the treated leaf in resistant biotypes, whereas 42% remained in the susceptible biotype at 96 HAT. Glyphosate was degraded to aminomethylphosphonic acid (AMPA), glyoxylate, and sarcosine by >90% in resistant biotypes, whereas a small amount of herbicide (up to 11%) was degraded by the susceptible biotype up to 168 HAT. Two amino acid changes were found at positions 182 and 310 in EPSPS, consisting of a proline to threonine and a tyrosine to cysteine substitution, respectively, in resistant biotypes. Therefore, absorption, translocation, metabolism, and gene mutation play an important role in the D. insularis glyphosate resistance.

  3. Antibacterial Mechanisms of Polymyxin and Bacterial Resistance

    PubMed Central

    Qin, Wangrong; Fang, Shisong; Qiu, Juanping

    2015-01-01

    Multidrug resistance in pathogens is an increasingly significant threat for human health. Indeed, some strains are resistant to almost all currently available antibiotics, leaving very limited choices for antimicrobial clinical therapy. In many such cases, polymyxins are the last option available, although their use increases the risk of developing resistant strains. This review mainly aims to discuss advances in unraveling the mechanisms of antibacterial activity of polymyxins and bacterial tolerance together with the description of polymyxin structure, synthesis, and structural modification. These are expected to help researchers not only develop a series of new polymyxin derivatives necessary for future medical care, but also optimize the clinical use of polymyxins with minimal resistance development. PMID:25664322

  4. [Resistance risk, cross-resistance and biochemical resistance mechanism of Laodelphax striatellus to buprofezin].

    PubMed

    Mao, Xu-lian; Liu, Jin; Li, Xu-ke; Chi, Jia-jia; Liu, Yong-jie

    2016-01-01

    In order to investigate the resistance development law and biochemical resistance mechanism of Laodelphax striatellus to buprofezin, spraying rice seedlings was used to continuously screen resistant strains of L. striatellus and dipping rice seedlings was applied to determine the toxicity and cross-resistance of L. striatellus to insecticides. After 32-generation screening with buprofezin, L. striatellus developed 168.49 folds resistance and its reality heritability (h2) was 0.11. If the killing rate was 80%-90%, L. striatellus was expected to develop 10-fold resistance to buprofezin only after 5 to 6 generations breeding. Because the actual reality heritability of field populations was usually lower than that of the resistant strains, the production of field populations increasing with 10-fold resistance would need much longer time. The results of cross-resistance showed that resistant strain had high level cross-resistance with thiamethoxam and imidacloprid, low level cross-resistance with acetamiprid, and no cross-resistance with pymetrozine and chlorpyrifos. The activity of detoxification enzymes of different strains and the syergism of synergist were measured. The results showed that cytochrome P450 monooxygenase played a major role in the resistance of L. striatellus to buprofezin, the esterase played a minor role and the GSH-S-transferase had no effect. Therefore, L. striatellus would have high risk to develop resistance to buprofezin when used in the field and might be delayed by using pymetrozine and chlorpyrifos. PMID:27228617

  5. Plant adaptation to acid soils: the molecular basis for crop aluminum resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aluminum (Al) toxicity on acid soils is a significant limitation to crop production worldwide, as approximately 50% of the world’s potentially arable soils are acidic. Because acid soils are such an important constraint to agriculture, understanding the mechanisms and genes conferring resistance to ...

  6. Mechanisms of multidrug resistance in cancer.

    PubMed

    Gillet, Jean-Pierre; Gottesman, Michael M

    2010-01-01

    The development of multidrug resistance (MDR) to chemotherapy remains a major challenge in the treatment of cancer. Resistance exists against every effective anticancer drug and can develop by numerous mechanisms including decreased drug uptake, increased drug efflux, activation of detoxifying systems, activation of DNA repair mechanisms, evasion of drug-induced apoptosis, etc. In the first part of this chapter, we briefly summarize the current knowledge on individual cellular mechanisms responsible for MDR, with a special emphasis on ATP-binding cassette transporters, perhaps the main theme of this textbook. Although extensive work has been done to characterize MDR mechanisms in vitro, the translation of this knowledge to the clinic has not been crowned with success. Therefore, identifying genes and mechanisms critical to the development of MDR in vivo and establishing a reliable method for analyzing clinical samples could help to predict the development of resistance and lead to treatments designed to circumvent it. Our thoughts about translational research needed to achieve significant progress in the understanding of this complex phenomenon are therefore discussed in a third section. The pleotropic response of cancer cells to chemotherapy is summarized in a concluding diagram. PMID:19949920

  7. Studies of acid resistance characteristics in multiple drug resistant Salmonella species isolated from tomatoes.

    PubMed

    Naushad, Z; Mishra, S H; Musaddiq, M; Ali, Y A

    2013-04-01

    Salmonella species found to have a great potential of causing a variety of diseases ranging from gastroenteritis to enteric fever. Salmonella have been isolated from all food, animals and also found in the vegetables such as tomatoes, spinach etc. Several out breaks of Salmonellosis have been associated with the consumption of raw tomatoes. This is because of the fact that Salmonella attaches to the surface of tomatoes and also present in the interior part due to geotropic transmission via contaminated soil irrigated with contaminated water. .During the life cycle, Salmonella encounters the various environments such as acidic environment (low pH). To overcome such factors, Salmonella has certain adaptable mechanisms. In present 'study total 200 samples of tomatoes were analyzed out of which 10 samples were found to contain Salmonella. All the 10 isolates were then subjected to the antibiotic susceptibility testing and were found to be resistant against several antibiotics. These were subjected to acid resistant tolerance study.

  8. MECHANISMS OF ACQUIRED RESISTANCE IN MOUSE TYPHOID

    PubMed Central

    Blanden, R. V.; Mackaness, G. B.; Collins, F. M.

    1966-01-01

    Experiments in vitro comparing normal mouse peritoneal macrophages with cells from Salmonella typhimurium-infected mice have shown that the "immune" macrophages have conspicuously enhanced microbicidal properties. Whereas normal macrophages could inactivate only 50 to 60% of intracellular S. typhimurium pretreated with immune serum, cells from infected animals killed virtually all ingested organisms and did so at an accelerated rate. Macrophages from Listeria monocytogenes-infected mice were shown to possess similarly enhanced microbicidal activity against S. typhimurium. Furthermore, the growth of S. typhimurium in the liver and spleen was more effectively restricted in Listeria-infected mice than in animals vaccinated with heat-killed S. typhimurium, even though the Listeria-infected animals possessed no demonstrable cross-reacting antibody to S. typhimurium. The lack of resistance in the mice vaccinated with heat-killed organisms could not be attributed to any deficiency of humoral factors, since the serum from these animals was as effective at promoting phagocytosis and killing by macrophages as serum from actively infected (and demonstrably resistant) mice. Conversely, Salmonella-infected mice were totally resistant to intravenous challenge with L. monocytogenes. The level of resistance in individual animals was related to the numbers of residual Salmonellae remaining in the tissues; mice with heavier residual infections being the more resistant. Specific antiserum from mice vaccinated with heat-killed S. typhimurium was found to be significantly protective only when the intraperitoneal route of challenge was employed. The foregoing studies have been interpreted to mean that enhancement of the microbicidal ability of macrophages is the mechanism of major importance in acquired resistance to S. typhimurium infection in mice. PMID:4958757

  9. Resistant mechanisms to BRAF inhibitors in melanoma

    PubMed Central

    Layos, Laura; Bugés, Cristina; de los Llanos Gil, María; Vila, Laia; Martínez-Balibrea, Eva; Martínez-Cardús, Anna

    2016-01-01

    Patients with advanced melanoma have traditionally had very poor prognosis. However, since 2011 better understanding of the biology and epidemiology of this disease has revolutionized its treatment, with newer therapies becoming available. These newer therapies can be classified into immunotherapy and targeted therapy. The immunotherapy arsenal includes inhibitors of CTLA4, PD-1 and PDL-1, while targeted therapy focuses on BRAF and MEK. BRAF inhibitors (vemurafenib, dabrafenib) have shown benefit in terms of overall survival (OS) compared to chemotherapy, and their combination with MEK inhibitors has recently been shown to improve progression-free survival (PFS), compared with monotherapy with BRAF inhibitors. However, almost 20% of patients initially do not respond, due to intrinsic resistance to therapy and, of those who do, most eventually develop mechanisms of acquired resistance, including reactivation of the MAP kinase pathway, persistent activation of receptor tyrosine kinase (RTKS) receptor, activation of phosphatidyinositol-3OH kinase, overexpression of epidermal growth factor receptor (EGFR), and interactions with the tumor microenvironment. Herein we comment in detail on mechanisms of resistance to targeted therapy and discuss the strategies to overcome them. PMID:27429963

  10. Mechanisms Involved in the Improvement of Lipotoxicity and Impaired Lipid Metabolism by Dietary α-Linolenic Acid Rich Salvia hispanica L (Salba) Seed in the Heart of Dyslipemic Insulin-Resistant Rats.

    PubMed

    Creus, Agustina; Ferreira, María R; Oliva, María E; Lombardo, Yolanda B

    2016-01-28

    This study explores the mechanisms underlying the altered lipid metabolism in the heart of dyslipemic insulin-resistant (IR) rats fed a sucrose-rich diet (SRD) and investigates if chia seeds (rich in α-linolenic acid 18:3, n-3 ALA) improve/reverse cardiac lipotoxicity. Wistar rats received an SRD-diet for three months. Half of the animals continued with the SRD up to month 6. The other half was fed an SRD in which the fat source, corn oil (CO), was replaced by chia seeds from month 3 to 6 (SRD+chia). A reference group consumed a control diet (CD) all the time. Triglyceride, long-chain acyl CoA (LC ACoA) and diacylglycerol (DAG) contents, pyruvate dehydrogenase complex (PDHc) and muscle-type carnitine palmitoyltransferase 1 (M-CPT1) activities and protein mass levels of M-CPT1, membrane fatty acid transporter (FAT/CD36), peroxisome proliferator activated receptor α (PPARα) and uncoupling protein 2 (UCP2) were analyzed. Results show that: (a) the hearts of SRD-fed rats display lipotoxicity suggesting impaired myocardial lipid utilization; (b) Compared with the SRD group, dietary chia normalizes blood pressure; reverses/improves heart lipotoxicity, glucose oxidation, the increased protein mass level of FAT/CD36, and the impaired insulin stimulated FAT/CD36 translocation to the plasma membrane. The enhanced M-CPT1 activity is markedly reduced without similar changes in protein mass. PPARα slightly decreases, while the UCP2 protein level remains unchanged in all groups. Normalization of dyslipidemia and IR by chia reduces plasma fatty acids (FAs) availability, suggesting that a different milieu prevents the robust translocation of FAT/CD36. This could reduce the influx of FAs, decreasing the elevated M-CPT1 activity and lipid storage and improving glucose oxidation in cardiac muscles of SRD-fed rats.

  11. Mechanisms Involved in the Improvement of Lipotoxicity and Impaired Lipid Metabolism by Dietary α-Linolenic Acid Rich Salvia hispanica L (Salba) Seed in the Heart of Dyslipemic Insulin-Resistant Rats

    PubMed Central

    Creus, Agustina; Ferreira, María R.; Oliva, María E.; Lombardo, Yolanda B.

    2016-01-01

    This study explores the mechanisms underlying the altered lipid metabolism in the heart of dyslipemic insulin-resistant (IR) rats fed a sucrose-rich diet (SRD) and investigates if chia seeds (rich in α-linolenic acid 18:3, n-3 ALA) improve/reverse cardiac lipotoxicity. Wistar rats received an SRD-diet for three months. Half of the animals continued with the SRD up to month 6. The other half was fed an SRD in which the fat source, corn oil (CO), was replaced by chia seeds from month 3 to 6 (SRD+chia). A reference group consumed a control diet (CD) all the time. Triglyceride, long-chain acyl CoA (LC ACoA) and diacylglycerol (DAG) contents, pyruvate dehydrogenase complex (PDHc) and muscle-type carnitine palmitoyltransferase 1 (M-CPT1) activities and protein mass levels of M-CPT1, membrane fatty acid transporter (FAT/CD36), peroxisome proliferator activated receptor α (PPARα) and uncoupling protein 2 (UCP2) were analyzed. Results show that: (a) the hearts of SRD-fed rats display lipotoxicity suggesting impaired myocardial lipid utilization; (b) Compared with the SRD group, dietary chia normalizes blood pressure; reverses/improves heart lipotoxicity, glucose oxidation, the increased protein mass level of FAT/CD36, and the impaired insulin stimulated FAT/CD36 translocation to the plasma membrane. The enhanced M-CPT1 activity is markedly reduced without similar changes in protein mass. PPARα slightly decreases, while the UCP2 protein level remains unchanged in all groups. Normalization of dyslipidemia and IR by chia reduces plasma fatty acids (FAs) availability, suggesting that a different milieu prevents the robust translocation of FAT/CD36. This could reduce the influx of FAs, decreasing the elevated M-CPT1 activity and lipid storage and improving glucose oxidation in cardiac muscles of SRD-fed rats. PMID:26828527

  12. 30 CFR 7.48 - Acid resistance test.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Acid resistance test. 7.48 Section 7.48 Mineral... MINING PRODUCTS TESTING BY APPLICANT OR THIRD PARTY Battery Assemblies § 7.48 Acid resistance test. (a... solution of sulfuric acid (H2 SO4) by mixing 853 ml of water with 199 ml of sulfuric acid (H2 SO4) with...

  13. 30 CFR 7.48 - Acid resistance test.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Acid resistance test. 7.48 Section 7.48 Mineral... MINING PRODUCTS TESTING BY APPLICANT OR THIRD PARTY Battery Assemblies § 7.48 Acid resistance test. (a... solution of sulfuric acid (H2 SO4) by mixing 853 ml of water with 199 ml of sulfuric acid (H2 SO4) with...

  14. 30 CFR 7.48 - Acid resistance test.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Acid resistance test. 7.48 Section 7.48 Mineral... MINING PRODUCTS TESTING BY APPLICANT OR THIRD PARTY Battery Assemblies § 7.48 Acid resistance test. (a... solution of sulfuric acid (H2 SO4) by mixing 853 ml of water with 199 ml of sulfuric acid (H2 SO4) with...

  15. 30 CFR 7.48 - Acid resistance test.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Acid resistance test. 7.48 Section 7.48 Mineral... MINING PRODUCTS TESTING BY APPLICANT OR THIRD PARTY Battery Assemblies § 7.48 Acid resistance test. (a... solution of sulfuric acid (H2 SO4) by mixing 853 ml of water with 199 ml of sulfuric acid (H2 SO4) with...

  16. Mechanism of suppression of piperacillin resistance in enterobacteria by tazobactam.

    PubMed Central

    Kadima, T A; Weiner, J H

    1997-01-01

    Resistance to piperacillin in several isolates of Citrobacter freundii and Enterobacter cloacae was investigated and confirmed to occur at a frequency of 10(-7) to 10(-6). Development of resistance to piperacillin was significantly suppressed by tazobactam but not by clavulanic acid. To elucidate the mechanism by which resistance suppression occurs, the effect of piperacillin plus tazobactam on the induction of AmpC beta-lactamase was analyzed by monitoring the beta-galactosidase activity of an inducible ampC-lacZ gene fusion in Escherichia coli. The combination exerted no inhibitory effect on AmpC beta-lactamase induction. Tazobactam also had no effect on the accumulation of a key intermediate in the AmpC beta-lactamase induction pathway, 1,6-anhydromurotripeptide, in an ampD mutant strain of E. coli. However, the addition of tazobactam to liquid cultures of E. cloacae 40001 in the presence of piperacillin at four times the MIC caused a delay in the recovery of the culture to piperacillin-induced stress. At 16 times the MIC, a complete suppression of regrowth occurred. Analysis of culture viability on piperacillin plates showed that the culture recovery was due to growth by moderately resistant mutants preexisting in the cell population, which at 16 times the MIC became susceptible to the combination. Evidence from the kinetics of inhibition of the E. cloacae 40001 AmpC beta-lactamase by clavulanic acid, sulbactam, and tazobactam and from the effects of these drugs on the frequency of resistance to piperacillin suggests that the suppressive effect of tazobactam on the appearance of resistance is primarily mediated by the beta-lactamase inhibitory activity. PMID:9333044

  17. Influenza neuraminidase inhibitors: antiviral action and mechanisms of resistance

    PubMed Central

    McKimm‐Breschkin, Jennifer L.

    2012-01-01

    Please cite this paper as: McKimm‐Breschkin (2012) Influenza neuraminidase inhibitors: Antiviral action and mechanisms of resistance. Influenza and Other Respiratory Viruses 7(Suppl. 1), 25–36. There are two major classes of antivirals available for the treatment and prevention of influenza, the M2 inhibitors and the neuraminidase inhibitors (NAIs). The M2 inhibitors are cheap, but they are only effective against influenza A viruses, and resistance arises rapidly. The current influenza A H3N2 and pandemic A(H1N1)pdm09 viruses are already resistant to the M2 inhibitors as are many H5N1 viruses. There are four NAIs licensed in some parts of the world, zanamivir, oseltamivir, peramivir, and a long‐acting NAI, laninamivir. This review focuses on resistance to the NAIs. Because of differences in their chemistry and subtle differences in NA structures, resistance can be both NAI‐ and subtype specific. This results in different drug resistance profiles, for example, the H274Y mutation confers resistance to oseltamivir and peramivir, but not to zanamivir, and only in N1 NAs. Mutations at E119, D198, I222, R292, and N294 can also reduce NAI sensitivity. In the winter of 2007–2008, an oseltamivir‐resistant seasonal influenza A(H1N1) strain with an H274Y mutation emerged in the northern hemisphere and spread rapidly around the world. In contrast to earlier evidence of such resistant viruses being unfit, this mutant virus remained fully transmissible and pathogenic and became the major seasonal A(H1N1) virus globally within a year. This resistant A(H1N1) virus was displaced by the sensitive A(H1N1)pdm09 virus. Approximately 0·5–1·0% of community A(H1N1)pdm09 isolates are currently resistant to oseltamivir. It is now apparent that variation in non‐active site amino acids can affect the fitness of the enzyme and compensate for mutations that confer high‐level oseltamivir resistance resulting in minimal impact on enzyme function. PMID:23279894

  18. Analysis and modeling of resistive switching mechanisms oriented to resistive random-access memory

    NASA Astrophysics Data System (ADS)

    Huang, Da; Wu, Jun-Jie; Tang, Yu-Hua

    2013-03-01

    With the progress of the semiconductor industry, the resistive random-access memory (RAM) has drawn increasing attention. The discovery of the memristor has brought much attention to this study. Research has focused on the resistive switching characteristics of different materials and the analysis of resistive switching mechanisms. We discuss the resistive switching mechanisms of different materials in this paper and analyze the differences of those mechanisms from the view point of circuitry to establish their respective circuit models. Finally, simulations are presented. We give the prospect of using different materials in resistive RAM on account of their resistive switching mechanisms, which are applied to explain their resistive switchings.

  19. The multixenobiotic resistance mechanism in aquatic organisms

    SciTech Connect

    Kurelec, B. )

    1992-01-01

    Many aquatic organisms thrive and reproduce in polluted waters. This fact indicates that they are well equipped with a defense system(s) against several toxic xenobiotics simultaneously because water pollution is typically caused by a mixture of a number of pollutants. We have found that the biochemical mechanism underlying such multixenobiotic' resistance in freshwater and marine mussel, in several marine sponges, and in freshwater fish is similar to the mechanism of multidrug resistance (MDR) found in tumor cells that became refractory to treatment with a variety of chemotherapeutic agents. All these organisms possess a verapamil-sensitive potential to bind 2-acetylaminofluorene and vincristine onto membrane vesicles. They all express mRNA for mdr1 gene, and mdr1 protein product, the glycoprotein P170. Finally, in in vivo experiments, the accumulation of xenobiotics is enhanced in all investigated organisms in the presence of verapamil, the inhibitor of the P170 extrusion pump. The knowledge that the presence of one xenobiotic may block the pumping out, and hence accelerating accumulation, of others, may help us to understand and interpret our present and past data on different environmental parameters obtained using indicator organisms.99 references.

  20. Acid tolerance mechanisms utilized by Streptococcus mutans

    PubMed Central

    Matsui, Robert; Cvitkovitch, Dennis

    2010-01-01

    Since its discovery in 1924 by J Clarke, Streptococcus mutans has been the focus of rigorous research efforts due to its involvement in caries initiation and progression. Its ability to ferment a range of dietary carbohydrates can rapidly drop the external environmental pH, thereby making dental plaque inhabitable to many competing species and can ultimately lead to tooth decay. Acid production by this oral pathogen would prove suicidal if not for its remarkable ability to withstand the acid onslaught by utilizing a wide variety of highly evolved acid-tolerance mechanisms. The elucidation of these mechanisms will be discussed, serving as the focus of this review. PMID:20210551

  1. Metabolic engineering of acid resistance elements to improve acid resistance and propionic acid production of Propionibacterium jensenii.

    PubMed

    Guan, Ningzi; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian; Liu, Long

    2016-06-01

    Propionic acid (PA) and its salts are widely used in the food, pharmaceutical, and chemical industries. Microbial production of PA by propionibacteria is a typical product-inhibited process, and acid resistance is crucial in the improvement of PA titers and productivity. We previously identified two key acid resistance elements-the arginine deaminase and glutamate decarboxylase systems-that protect propionibacteria against PA stress by maintaining intracellular pH homeostasis. In this study, we attempted to improve the acid resistance and PA production of Propionibacterium jensenii ATCC 4868 by engineering these elements. Specifically, five genes (arcA, arcC, gadB, gdh, and ybaS) encoding components of the arginine deaminase and glutamate decarboxylase systems were overexpressed in P. jensenii. The activities of the five enzymes in the engineered strains were 26.7-489.0% higher than those in wild-type P. jensenii. The growth rates of the engineered strains decreased, whereas specific PA production increased significantly compared with those of the wild-type strain. Among the overexpressed genes, gadB (encoding glutamate decarboxylase) increased PA resistance and yield most effectively; the PA resistance of P. jensenii-gadB was more than 10-fold higher than that of the wild-type strain, and the production titer, yield, and conversion ratio of PA reached 10.81 g/L, 5.92 g/g cells, and 0.56 g/g glycerol, representing increases of 22.0%, 23.8%, and 21.7%, respectively. We also investigated the effects of introducing these acid resistance elements on the transcript levels of related enzymes. The results showed that the expression of genes in the engineered pathways affected the expression of the other genes. Additionally, the intracellular pools of amino acids were altered as different genes were overexpressed, which may further contribute to the enhanced PA production. This study provides an effective strategy for improving PA production in propionibacteria; this

  2. Antimicrobial Peptide Resistance Mechanisms of Gram-Positive Bacteria

    PubMed Central

    Nawrocki, Kathryn L.; Crispell, Emily K.; McBride, Shonna M.

    2014-01-01

    Antimicrobial peptides, or AMPs, play a significant role in many environments as a tool to remove competing organisms. In response, many bacteria have evolved mechanisms to resist these peptides and prevent AMP-mediated killing. The development of AMP resistance mechanisms is driven by direct competition between bacterial species, as well as host and pathogen interactions. Akin to the number of different AMPs found in nature, resistance mechanisms that have evolved are just as varied and may confer broad-range resistance or specific resistance to AMPs. Specific mechanisms of AMP resistance prevent AMP-mediated killing against a single type of AMP, while broad resistance mechanisms often lead to a global change in the bacterial cell surface and protect the bacterium from a large group of AMPs that have similar characteristics. AMP resistance mechanisms can be found in many species of bacteria and can provide a competitive edge against other bacterial species or a host immune response. Gram-positive bacteria are one of the largest AMP producing groups, but characterization of Gram-positive AMP resistance mechanisms lags behind that of Gram-negative species. In this review we present a summary of the AMP resistance mechanisms that have been identified and characterized in Gram-positive bacteria. Understanding the mechanisms of AMP resistance in Gram-positive species can provide guidelines in developing and applying AMPs as therapeutics, and offer insight into the role of resistance in bacterial pathogenesis. PMID:25419466

  3. Development of a SCAR (sequence-characterised amplified region) marker for acid resistance-related gene in Lactobacillus plantarum.

    PubMed

    Liu, Shu-Wen; Li, Kai; Yang, Shi-Ling; Tian, Shu-Fen; He, Ling

    2015-03-01

    A sequence characterised amplified region marker was developed to determine an acid resistance-related gene in Lactobacillus plantarum. A random amplified polymorphic DNA marker named S116-680 was reported to be closely related to the acid resistance of the strains. The DNA band corresponding to this marker was cloned and sequenced with the induction of specific designed PCR primers. The results of PCR test helped to amplify a clear specific band of 680 bp in the tested acid-resistant strains. S116-680 marker would be useful to explore the acid-resistant mechanism of L. plantarum and to screen desirable malolactic fermentation strains.

  4. Differential Costs of Two Distinct Resistance Mechanisms Induced by Different Herbivore Species in Arabidopsis.

    PubMed

    Onkokesung, Nawaporn; Reichelt, Michael; van Doorn, Arjen; Schuurink, Robert C; Dicke, Marcel

    2016-02-01

    Plants respond to herbivory with the induction of resistance, mediated by distinct phytohormonal signaling pathways and their interactions. Phloem feeders are known to induce plant resistance via the salicylic acid pathway, whereas biting-chewing herbivores induce plant resistance mainly via the jasmonate pathway. Here, we show that a specialist caterpillar (biting-chewing herbivore) and a specialist aphid (phloem feeder) differentially induce resistance against Pieris brassicae caterpillars in Arabidopsis (Arabidopsis thaliana) plants. Caterpillar feeding induces resistance through the jasmonate signaling pathway that is associated with the induction of kaempferol 3,7-dirhamnoside, whereas aphid feeding induces resistance via a novel mechanism involving sinapoyl malate. The role of sinapoyl malate is confirmed through the use of a mutant compromised in the biosynthesis of this compound. Caterpillar-induced resistance is associated with a lower cost in terms of plant growth reduction than aphid-induced resistance. A strong constitutive resistance against P. brassicae caterpillars in combination with a strong growth attenuation in plants of a transfer DNA (T-DNA) insertion mutant of WRKY70 (wrky70) suggest that the WRKY70 transcription factor, a regulator of downstream responses mediated by jasmonate-salicylic acid signaling cross talk, is involved in the negative regulation of caterpillar resistance and in the tradeoff between growth and defense. In conclusion, different mechanisms of herbivore-induced resistance come with different costs, and a functional WRKY70 transcription factor is required for the induction of low-cost resistance. PMID:26603653

  5. The flocculation mechanism of humic acid hydrosol

    SciTech Connect

    Xuo Xiaofen; Yu Hui

    1997-12-31

    Humic acid solution obtained by extraction from weathered coal, brown coal, and peat is a high molecular hydrosol. It can be flocculated by electrolytes. It is discovered that for monochloride and dichloride or trichloride, the flocculation value variation with humic acid hydrosol concentration has a different curve and different mechanism. For monochloride, the hydrosol is a hydrophilic colloid; it is flocculated by salting out of monochloride. For dichloride or trichloride, the hydrosol is converted into a hydrophilic colloid, and flocculated by compressing the electric double layer of the micellae. The flocculation value variation with humic acid hydrosol pH value is also discussed. The research is valuable for theory and application.

  6. Skin Commensal Staphylococci May Act as Reservoir for Fusidic Acid Resistance Genes

    PubMed Central

    Hung, Wei-Chun; Chen, Hsiao-Jan; Lin, Yu-Tzu; Tsai, Jui-Chang; Chen, Chiao-Wei; Lu, Hsiao-Hung; Tseng, Sung-Pin; Jheng, Yao-Yu; Leong, Kin Hong; Teng, Lee-Jene

    2015-01-01

    We analyzed the occurrence and mechanisms of fusidic acid resistance present in staphylococci isolated from 59 healthy volunteers. The fingers of the volunteers were screened for the presence of staphylococci, and the collected isolates were tested for resistance to fusidic acid. A total of 34 fusidic acid resistant staphylococcal strains (all were coagulase-negative) were isolated from 22 individuals (22/59, 37.3%). Examination of the resistance genes revealed that acquired fusB or fusC was present in Staphylococcus epidermidis, Staphylococcus capitis subsp. urealyticus, Staphylococcus hominis subsp. hominis, Staphylococcus warneri and Staphylococcus haemolyticus. Resistance islands (RIs) carrying fusB were found in S. epidermidis and S. capitis subsp. urealyticus, while staphylococcal chromosome cassette (SCC)-related structures harboring fusC were found in S. hominis subsp. hominis. Genotypic analysis of S. epidermidis and S. hominis subsp. hominis indicated that the fus elements were disseminated in diverse genetic strain backgrounds. The fusC elements in S. hominis subsp. hominis strains were highly homologous to SCCfusC in the epidemic sequence type (ST) 239/SCCmecIII methicillin-resistant S. aureus (MRSA) or the pseudo SCCmec in ST779 MRSA. The presence of acquired fusidic acid resistance genes and their genetic environment in commensal staphylococci suggested that the skin commensal staphylococci may act as reservoir for fusidic acid resistance genes. PMID:26581090

  7. Skin Commensal Staphylococci May Act as Reservoir for Fusidic Acid Resistance Genes.

    PubMed

    Hung, Wei-Chun; Chen, Hsiao-Jan; Lin, Yu-Tzu; Tsai, Jui-Chang; Chen, Chiao-Wei; Lu, Hsiao-Hung; Tseng, Sung-Pin; Jheng, Yao-Yu; Leong, Kin Hong; Teng, Lee-Jene

    2015-01-01

    We analyzed the occurrence and mechanisms of fusidic acid resistance present in staphylococci isolated from 59 healthy volunteers. The fingers of the volunteers were screened for the presence of staphylococci, and the collected isolates were tested for resistance to fusidic acid. A total of 34 fusidic acid resistant staphylococcal strains (all were coagulase-negative) were isolated from 22 individuals (22/59, 37.3%). Examination of the resistance genes revealed that acquired fusB or fusC was present in Staphylococcus epidermidis, Staphylococcus capitis subsp. urealyticus, Staphylococcus hominis subsp. hominis, Staphylococcus warneri and Staphylococcus haemolyticus. Resistance islands (RIs) carrying fusB were found in S. epidermidis and S. capitis subsp. urealyticus, while staphylococcal chromosome cassette (SCC)-related structures harboring fusC were found in S. hominis subsp. hominis. Genotypic analysis of S. epidermidis and S. hominis subsp. hominis indicated that the fus elements were disseminated in diverse genetic strain backgrounds. The fusC elements in S. hominis subsp. hominis strains were highly homologous to SCCfusC in the epidemic sequence type (ST) 239/SCCmecIII methicillin-resistant S. aureus (MRSA) or the pseudo SCCmec in ST779 MRSA. The presence of acquired fusidic acid resistance genes and their genetic environment in commensal staphylococci suggested that the skin commensal staphylococci may act as reservoir for fusidic acid resistance genes.

  8. Experimental Induction of Bacterial Resistance to the Antimicrobial Peptide Tachyplesin I and Investigation of the Resistance Mechanisms.

    PubMed

    Hong, Jun; Hu, Jianye; Ke, Fei

    2016-10-01

    Tachyplesin I is a 17-amino-acid cationic antimicrobial peptide (AMP) with a typical cyclic antiparallel β-sheet structure that is a promising therapeutic for infections, tumors, and viruses. To date, no bacterial resistance to tachyplesin I has been reported. To explore the safety of tachyplesin I as an antibacterial drug for wide clinical application, we experimentally induced bacterial resistance to tachyplesin I by using two selection procedures and studied the preliminary resistance mechanisms. Aeromonas hydrophila XS91-4-1, Pseudomonas aeruginosa CGMCC1.2620, and Escherichia coli ATCC 25922 and F41 showed resistance to tachyplesin I under long-term selection pressure with continuously increasing concentrations of tachyplesin I. In addition, P. aeruginosa and E. coli exhibited resistance to tachyplesin I under UV mutagenesis selection conditions. Cell growth and colony morphology were slightly different between control strains and strains with induced resistance. Cross-resistance to tachyplesin I and antimicrobial agents (cefoperazone and amikacin) or other AMPs (pexiganan, tachyplesin III, and polyphemusin I) was observed in some resistant mutants. Previous studies showed that extracellular protease-mediated degradation of AMPs induced bacterial resistance to AMPs. Our results indicated that the resistance mechanism of P. aeruginosa was not entirely dependent on extracellular proteolytic degradation of tachyplesin I; however, tachyplesin I could induce increased proteolytic activity in P. aeruginosa Most importantly, our findings raise serious concerns about the long-term risks associated with the development and clinical use of tachyplesin I.

  9. The molecular mechanisms of acquired proteasome inhibitor resistance

    PubMed Central

    Kale, Andrew J.; Moore, Bradley S.

    2012-01-01

    The development of proteasome inhibitors (PIs) has transformed the treatment of multiple myeloma and mantle cell lymphoma. To date, two PIs have been FDA approved, the boronate peptide bortezomib and, most recently, the epoxyketone peptide carfilzomib. However, intrinsic and acquired resistance to PIs, for which the underlying mechanisms are poorly understood, may limit their efficacy. In this perspective, we discuss recent advances in the molecular understanding of PI resistance through acquired bortezomib resistance in human cell lines to evolved saliniosporamide A (marizomib) resistance in nature. Resistance mechanisms discussed include the upregulation of proteasome subunits and mutations of the catalytic β-subunits. Additionally, we explore potential strategies to overcome PI resistance. PMID:22978849

  10. Arginine- and Polyamine-Induced Lactic Acid Resistance in Neisseria gonorrhoeae

    PubMed Central

    Gong, Zheng; Tang, M. Matt; Wu, Xueliang; Phillips, Nancy; Galkowski, Dariusz; Jarvis, Gary A.; Fan, Huizhou

    2016-01-01

    Microbe-derived lactic acid protects women from pathogens in their genital tract. The purpose of this study was to determine lactic acid susceptibility of Neisseria gonorrhoeae, and identify potential acid resistance mechanisms present in this pathogen. Tested in vitro, lactic acid killed all 10 gonococcal strains analyzed in a low pH-dependent manner. Full inactivation occurred at pH 4.5. At low pH, lactic acid treatment resulted in the entry of the DNA-binding fluorochrome propidium iodide into the microbial cells, suggesting that hydrogen ions from lactic acid compromise the integrity of the bacterial cell wall/membrane. Most likely, hydrogen ions also inactivate intracellular proteins since arginine rendered significant protection against lactic acid presumably through action of the gonococcal arginine decarboxylase, an enzyme located in the bacterial cytoplasm. Surprisingly, arginine also lessened lactic acid-mediated cell wall/membrane disruption. This effect is probably mediated by agmatine, a triamine product of arginine decarboxylase, since agmatine demonstrated a stronger protective effect on GC than arginine at equal molar concentration. In addition to agmatine, diamines cadaverine and putrescine, which are generated by bacterial vaginosis-associated microbes, also induced significant resistance to lactic acid-mediated GC killing and cell wall/membrane disruption. These findings suggest that the arginine-rich semen protects gonococci through both neutralization-dependent and independent mechanisms, whereas polyamine-induced acid resistance contributes to the increased risk of gonorrhea in women with bacterial vaginosis. PMID:26808268

  11. Arginine- and Polyamine-Induced Lactic Acid Resistance in Neisseria gonorrhoeae.

    PubMed

    Gong, Zheng; Tang, M Matt; Wu, Xueliang; Phillips, Nancy; Galkowski, Dariusz; Jarvis, Gary A; Fan, Huizhou

    2016-01-01

    Microbe-derived lactic acid protects women from pathogens in their genital tract. The purpose of this study was to determine lactic acid susceptibility of Neisseria gonorrhoeae, and identify potential acid resistance mechanisms present in this pathogen. Tested in vitro, lactic acid killed all 10 gonococcal strains analyzed in a low pH-dependent manner. Full inactivation occurred at pH 4.5. At low pH, lactic acid treatment resulted in the entry of the DNA-binding fluorochrome propidium iodide into the microbial cells, suggesting that hydrogen ions from lactic acid compromise the integrity of the bacterial cell wall/membrane. Most likely, hydrogen ions also inactivate intracellular proteins since arginine rendered significant protection against lactic acid presumably through action of the gonococcal arginine decarboxylase, an enzyme located in the bacterial cytoplasm. Surprisingly, arginine also lessened lactic acid-mediated cell wall/membrane disruption. This effect is probably mediated by agmatine, a triamine product of arginine decarboxylase, since agmatine demonstrated a stronger protective effect on GC than arginine at equal molar concentration. In addition to agmatine, diamines cadaverine and putrescine, which are generated by bacterial vaginosis-associated microbes, also induced significant resistance to lactic acid-mediated GC killing and cell wall/membrane disruption. These findings suggest that the arginine-rich semen protects gonococci through both neutralization-dependent and independent mechanisms, whereas polyamine-induced acid resistance contributes to the increased risk of gonorrhea in women with bacterial vaginosis.

  12. Arginine- and Polyamine-Induced Lactic Acid Resistance in Neisseria gonorrhoeae.

    PubMed

    Gong, Zheng; Tang, M Matt; Wu, Xueliang; Phillips, Nancy; Galkowski, Dariusz; Jarvis, Gary A; Fan, Huizhou

    2016-01-01

    Microbe-derived lactic acid protects women from pathogens in their genital tract. The purpose of this study was to determine lactic acid susceptibility of Neisseria gonorrhoeae, and identify potential acid resistance mechanisms present in this pathogen. Tested in vitro, lactic acid killed all 10 gonococcal strains analyzed in a low pH-dependent manner. Full inactivation occurred at pH 4.5. At low pH, lactic acid treatment resulted in the entry of the DNA-binding fluorochrome propidium iodide into the microbial cells, suggesting that hydrogen ions from lactic acid compromise the integrity of the bacterial cell wall/membrane. Most likely, hydrogen ions also inactivate intracellular proteins since arginine rendered significant protection against lactic acid presumably through action of the gonococcal arginine decarboxylase, an enzyme located in the bacterial cytoplasm. Surprisingly, arginine also lessened lactic acid-mediated cell wall/membrane disruption. This effect is probably mediated by agmatine, a triamine product of arginine decarboxylase, since agmatine demonstrated a stronger protective effect on GC than arginine at equal molar concentration. In addition to agmatine, diamines cadaverine and putrescine, which are generated by bacterial vaginosis-associated microbes, also induced significant resistance to lactic acid-mediated GC killing and cell wall/membrane disruption. These findings suggest that the arginine-rich semen protects gonococci through both neutralization-dependent and independent mechanisms, whereas polyamine-induced acid resistance contributes to the increased risk of gonorrhea in women with bacterial vaginosis. PMID:26808268

  13. Mechanisms of lichen resistance to metallic pollution

    SciTech Connect

    Sarret, C.; Manceau, A.; Eybert-Berard, L.; Cuny, D.; Haluwyn, C. van; Deruelle, S.; Hazemann, J.L.; Menthonnex, J.J. |; Soldo, Y.

    1998-11-01

    Some lichens have a unique ability to grow in heavily contaminated areas due to the development of adaptative mechanisms allowing a high tolerance to metals. Here the authors report on the chemical forms of Pb and Zn in the metal hyperaccumulator Diploschistes muscorum and of Pb in the metal tolerant lichen Xanthoria parietina. The speciation of Zn and Pb has been investigated by powder X-ray diffraction (XRD) and extended X-ray absorption fine structure (EXAFS) spectroscopy using the advanced third-generation synchrotron radiation source of the European synchrotron radiation facility (ESRF in Grenoble). This study reveals that in both lichens cells are protected from toxicity by complexation of heavy metals, but the strategies differ: in D. muscorum, Pb and Zn are accumulated through an enhanced synthesis of oxalate, which precipitates toxic elements as insoluble salts, whereas in X. parietina, Pb is complexed to carboxylic groups of the fungal cell walls. The authors conclude that hyperaccumulation of metals results from a reactive mechanism of organic acid production, whereas metallo-tolerance is achieved by a passive complexation to existing functional groups.

  14. Pyrolysis Mechanisms of Aromatic Carboxylic Acids

    SciTech Connect

    Britt, P.F.; Eskay, T.P.; Buchanan, A.C. III

    1997-12-31

    Although decarboxylation of carboxylic acids is widely used in organic synthesis, there is limited mechanistic information on the uncatalyzed reaction pathways of aromatic carboxylic acids at 300-400 {degrees} C. The pyrolysis mechanisms of 1,2-(3,3-dicarboxyphenyl)ethane, 1,2-(4,4-dicarboxylphenyl)ethane, 1-(3-carboxyphenyl)-2-(4- biphenyl)ethane, and substituted benzoic acids have been investigated at 325-425 {degrees} C neat and diluted in an inert solvent. Decarboxylation is the dominant pyrolysis path. Arrhenius parameters, substituent effects, and deuterium isotope effects are consistent with decarboxylation by an electrophilic aromatic substitution reaction. Pyrolysis of benzoic acid in naphthalene, as a solvent, produces significant amounts of 1- and 2-phenylnaphthalenes. The mechanistic pathways for decarboxylation and arylation with be presented.

  15. Role of hepatocyte S6K1 in palmitic acid-induced endoplasmic reticulum stress, lipotoxicity, insulin resistance and in oleic acid-induced protection.

    PubMed

    Pardo, Virginia; González-Rodríguez, Águeda; Muntané, Jordi; Kozma, Sara C; Valverde, Ángela M

    2015-06-01

    The excess of saturated free fatty acids, such as palmitic acid, that induces lipotoxicity in hepatocytes, has been implicated in the development of non-alcoholic fatty liver disease also associated with insulin resistance. By contrast, oleic acid, a monounsaturated fatty acid, attenuates the effects of palmitic acid. We evaluated whether palmitic acid is directly associated with both insulin resistance and lipoapoptosis in mouse and human hepatocytes and the impact of oleic acid in the molecular mechanisms that mediate both processes. In human and mouse hepatocytes palmitic acid at a lipotoxic concentration triggered early activation of endoplasmic reticulum (ER) stress-related kinases, induced the apoptotic transcription factor CHOP, activated caspase 3 and increased the percentage of apoptotic cells. These effects concurred with decreased IR/IRS1/Akt insulin pathway. Oleic acid suppressed the toxic effects of palmitic acid on ER stress activation, lipoapoptosis and insulin resistance. Besides, oleic acid suppressed palmitic acid-induced activation of S6K1. This protection was mimicked by pharmacological or genetic inhibition of S6K1 in hepatocytes. In conclusion, this is the first study highlighting the activation of S6K1 by palmitic acid as a common and novel mechanism by which its inhibition by oleic acid prevents ER stress, lipoapoptosis and insulin resistance in hepatocytes.

  16. Associations of erythrocyte fatty acid patterns with insulin resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Synergistic and/or additive effects on cardiometabolic risk may be missed by examining individual fatty acids (FA). A pattern analysis may be a more useful approach. As well, it remains unclear whether erythrocyte fatty acid composition relates to insulin resistance among Hispanic/Latino...

  17. Habituation to organic acid anions induces resistance to acid and bile in Listeria monocytogenes.

    PubMed

    Zhang, Yimin; Carpenter, Charles E; Broadbent, Jeff R; Luo, Xin

    2014-03-01

    We evaluated the intrinsic and inducible resistance of four human pathogenic strains of Listeria monocytogenes to acid and bile, factors associated with virulence. Cells were grown in media at pH 7.4, or in media at pH 6.0 containing 0 (HCl control) or 4.75 mM of different organic acids, harvested at stationary or mid log phase, and challenged for 1h in acid or bile. Stationary phase cells were intrinsically more resistant to either challenge than log phase cells, and large differences between strains were evident among the latter. Compared to the HCl control, habituation to log phase with organic acids induced significant (p<0.05) and meaningful (≥1 log) increases in acid resistance of three of four strains tested, and in bile resistance of two strains suggesting that exposure to organic acid anions may enhance virulence in L. monocytogenes.

  18. Altered Cultivar Resistance of Kimchi Cabbage Seedlings Mediated by Salicylic Acid, Jasmonic Acid and Ethylene

    PubMed Central

    Lee, Young Hee; Kim, Sang Hee; Yun, Byung-Wook; Hong, Jeum Kyu

    2014-01-01

    Two cultivars Buram-3-ho (susceptible) and CR-Hagwang (moderate resistant) of kimchi cabbage seedlings showed differential defense responses to anthracnose (Colletotrichum higginsianum), black spot (Alternaria brassicicola) and black rot (Xanthomonas campestris pv. campestris, Xcc) diseases in our previous study. Defense-related hormones salicylic acid (SA), jasmonic acid (JA) and ethylene led to different transcriptional regulation of pathogenesis-related (PR) gene expression in both cultivars. In this study, exogenous application of SA suppressed basal defenses to C. higginsianum in the 1st leaves of the susceptible cultivar and cultivar resistance of the 2nd leaves of the resistant cultivar. SA also enhanced susceptibility of the susceptible cultivar to A. brassicicola. By contrast, SA elevated disease resistance to Xcc in the resistant cultivar, but not in the susceptible cultivar. Methyl jasmonate (MJ) treatment did not affect the disease resistance to C. higginsianum and Xcc in either cultivar, but it compromised the disease resistance to A. brassicicola in the resistant cultivar. Treatment with 1-aminocyclopropane-1-carboxylic acid (ACC) ethylene precursor did not change resistance of the either cultivar to C. higginsianum and Xcc. Effect of ACC pretreatment on the resistance to A. brassicicola was not distinguished between susceptible and resistant cultivars, because cultivar resistance of the resistant cultivar was lost by prolonged moist dark conditions. Taken together, exogenously applied SA, JA and ethylene altered defense signaling crosstalk to three diseases of anthracnose, black spot and black rot in a cultivar-dependent manner. PMID:25289020

  19. Mechanisms of Resistance to Aminoglycoside Antibiotics: Overview and Perspectives

    PubMed Central

    Garneau-Tsodikova, Sylvie

    2015-01-01

    Aminoglycoside (AG) antibiotics are used to treat many Gram-negative and some Gram-positive infections and, importantly, multidrug-resistant tuberculosis. Among various bacterial species, resistance to AGs arises through a variety of intrinsic and acquired mechanisms. The bacterial cell wall serves as a natural barrier for small molecules such as AGs and may be further fortified via acquired mutations. Efflux pumps work to expel AGs from bacterial cells, and modifications here too may cause further resistance to AGs. Mutations in the ribosomal target of AGs, while rare, also contribute to resistance. Of growing clinical prominence is resistance caused by ribosome methyltransferases. By far the most widespread mechanism of resistance to AGs is the inactivation of these antibiotics by AG-modifying enzymes. We provide here an overview of these mechanisms by which bacteria become resistant to AGs and discuss their prevalence and potential for clinical relevance. PMID:26877861

  20. Helicobacter pylori's cholesterol uptake impacts resistance to docosahexaenoic acid.

    PubMed

    Correia, Marta; Casal, Susana; Vinagre, João; Seruca, Raquel; Figueiredo, Ceu; Touati, Eliette; Machado, José C

    2014-05-01

    Helicobacter pylori colonizes half of the world population and is associated with gastric cancer. We have previously demonstrated that docosahexaenoic acid (DHA), an n-3 polyunsaturated fatty acid known for its anti-inflammatory and antitumor effects, directly inhibits H. pylori growth in vitro and in mice. Nevertheless, the concentration of DHA shown to reduce H. pylori mice gastric colonization was ineffective in vitro. Related to the auxotrophy of H. pylori for cholesterol, we hypothesize that other mechanisms, in addition to DHA direct antibacterial effect, must be responsible for the reduction of the infection burden. In the present study we investigated if DHA affects also H. pylori growth, by reducing the availability of membrane cholesterol in the epithelial cell for H. pylori uptake. Levels of cholesterol in gastric epithelial cells and of cholesteryl glucosides in H. pylori were determined by thin layer chromatography and gas chromatography. The consequences of epithelial cells' cholesterol depletion on H. pylori growth were assessed in liquid cultures. We show that H. pylori uptakes cholesterol from epithelial cells. In addition, DHA lowers cholesterol levels in epithelial cells, decreases its de novo synthesis, leading to a lower synthesis of cholesteryl glucosides by H. pylori. A previous exposition of H. pylori to cholesterol influences the bacterium response to the direct inhibitory effect of DHA. Overall, our results suggest that a direct effect of DHA on H. pylori survival is modulated by its access to epithelial cell cholesterol, supporting the notion that cholesterol enhances the resistance of H. pylori. The cholesterol-dependent resistance of H. pylori to antimicrobial compounds raises new important aspects for the development of new anti-bacterial strategies. PMID:24447914

  1. Helicobacter pylori's cholesterol uptake impacts resistance to docosahexaenoic acid.

    PubMed

    Correia, Marta; Casal, Susana; Vinagre, João; Seruca, Raquel; Figueiredo, Ceu; Touati, Eliette; Machado, José C

    2014-05-01

    Helicobacter pylori colonizes half of the world population and is associated with gastric cancer. We have previously demonstrated that docosahexaenoic acid (DHA), an n-3 polyunsaturated fatty acid known for its anti-inflammatory and antitumor effects, directly inhibits H. pylori growth in vitro and in mice. Nevertheless, the concentration of DHA shown to reduce H. pylori mice gastric colonization was ineffective in vitro. Related to the auxotrophy of H. pylori for cholesterol, we hypothesize that other mechanisms, in addition to DHA direct antibacterial effect, must be responsible for the reduction of the infection burden. In the present study we investigated if DHA affects also H. pylori growth, by reducing the availability of membrane cholesterol in the epithelial cell for H. pylori uptake. Levels of cholesterol in gastric epithelial cells and of cholesteryl glucosides in H. pylori were determined by thin layer chromatography and gas chromatography. The consequences of epithelial cells' cholesterol depletion on H. pylori growth were assessed in liquid cultures. We show that H. pylori uptakes cholesterol from epithelial cells. In addition, DHA lowers cholesterol levels in epithelial cells, decreases its de novo synthesis, leading to a lower synthesis of cholesteryl glucosides by H. pylori. A previous exposition of H. pylori to cholesterol influences the bacterium response to the direct inhibitory effect of DHA. Overall, our results suggest that a direct effect of DHA on H. pylori survival is modulated by its access to epithelial cell cholesterol, supporting the notion that cholesterol enhances the resistance of H. pylori. The cholesterol-dependent resistance of H. pylori to antimicrobial compounds raises new important aspects for the development of new anti-bacterial strategies.

  2. Multiple resistance mechanisms among Aspergillus fumigatus mutants with high-level resistance to itraconazole.

    PubMed

    Nascimento, Adriana M; Goldman, Gustavo H; Park, Steven; Marras, Salvatore A E; Delmas, Guillaume; Oza, Uma; Lolans, Karen; Dudley, Michael N; Mann, Paul A; Perlin, David S

    2003-05-01

    A collection of Aspergillus fumigatus mutants highly resistant to itraconazole (RIT) at 100 micro g ml(-1) were selected in vitro (following UV irradiation as a preliminary step) to investigate mechanisms of drug resistance in this clinically important pathogen. Eight of the RIT mutants were found to have a mutation at Gly54 (G54E, -K, or -R) in the azole target gene CYP51A. Primers designed for highly conserved regions of multidrug resistance (MDR) pumps were used in reverse transcriptase PCR amplification reactions to identify novel genes encoding potential MDR efflux pumps in A. fumigatus. Two genes, AfuMDR3 and AfuMDR4, showed prominent changes in expression levels in many RIT mutants and were characterized in more detail. Analysis of the deduced amino acid sequence encoded by AfuMDR3 revealed high similarity to major facilitator superfamily transporters, while AfuMDR4 was a typical member of the ATP-binding cassette superfamily. Real-time quantitative PCR with molecular beacon probes was used to assess expression levels of AfuMDR3 and AfuMDR4. Most RIT mutants showed either constitutive high-level expression of both genes or induction of expression upon exposure to itraconazole. Our results suggest that overexpression of one or both of these newly identified drug efflux pump genes of A. fumigatus and/or selection of drug target site mutations are linked to high-level itraconazole resistance and are mechanistic considerations for the emergence of clinical resistance to itraconazole.

  3. What have the mechanisms of resistance to glyphosate taught us?

    PubMed

    Shaner, Dale L; Lindenmeyer, Richard Bradley; Ostlie, Michael H

    2012-01-01

    The intensive use of glyphosate alone to manage weeds has selected populations that are glyphosate resistant. The three mechanisms of glyphosate resistance that have been elucidated are (1) target-site mutations, (2) gene amplification and (3) altered translocation due to sequestration. What have we learned from the selection of these mechanisms, and how can we apply those lessons to future herbicide-resistant crops and new mechanisms of action? First, the diversity of glyphosate resistance mechanisms has helped further our understanding of the mechanism of action of glyphosate and advanced our knowledge of plant physiology. Second, the relatively rapid evolution of glyphosate-resistant weed populations provides further evidence that no herbicide is invulnerable to resistance. Third, as new herbicide-resistant crops are developed and new mechanisms of action are discovered, the weed science community needs to ensure that we apply the lessons we have learned on resistance management from the experience with glyphosate. Every new weed management system must be evaluated during development for its potential to select for resistance, and stewardship programs should be in place when the new program is introduced.

  4. Investigation of carbon storage regulation network (csr genes) and phenotypic differences between acid sensitive and resistant Escherichia coli O157:H7 strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Escherichia coli O157:H7 and related serotype strains have previously been shown to vary in acid resistance, however, little is known about strain specific mechanisms of acid resistance. We examined sensitive and resistant E. coli strains to determine the effects of growth in minimal and...

  5. Improved Acetic Acid Resistance in Saccharomyces cerevisiae by Overexpression of the WHI2 Gene Identified through Inverse Metabolic Engineering.

    PubMed

    Chen, Yingying; Stabryla, Lisa; Wei, Na

    2016-01-29

    Development of acetic acid-resistant Saccharomyces cerevisiae is important for economically viable production of biofuels from lignocellulosic biomass, but the goal remains a critical challenge due to limited information on effective genetic perturbation targets for improving acetic acid resistance in the yeast. This study employed a genomic-library-based inverse metabolic engineering approach to successfully identify a novel gene target, WHI2 (encoding a cytoplasmatic globular scaffold protein), which elicited improved acetic acid resistance in S. cerevisiae. Overexpression of WHI2 significantly improved glucose and/or xylose fermentation under acetic acid stress in engineered yeast. The WHI2-overexpressing strain had 5-times-higher specific ethanol productivity than the control in glucose fermentation with acetic acid. Analysis of the expression of WHI2 gene products (including protein and transcript) determined that acetic acid induced endogenous expression of Whi2 in S. cerevisiae. Meanwhile, the whi2Δ mutant strain had substantially higher susceptibility to acetic acid than the wild type, suggesting the important role of Whi2 in the acetic acid response in S. cerevisiae. Additionally, overexpression of WHI2 and of a cognate phosphatase gene, PSR1, had a synergistic effect in improving acetic acid resistance, suggesting that Whi2 might function in combination with Psr1 to elicit the acetic acid resistance mechanism. These results improve our understanding of the yeast response to acetic acid stress and provide a new strategy to breed acetic acid-resistant yeast strains for renewable biofuel production.

  6. Understanding the mechanisms and drivers of antimicrobial resistance.

    PubMed

    Holmes, Alison H; Moore, Luke S P; Sundsfjord, Arnfinn; Steinbakk, Martin; Regmi, Sadie; Karkey, Abhilasha; Guerin, Philippe J; Piddock, Laura J V

    2016-01-01

    To combat the threat to human health and biosecurity from antimicrobial resistance, an understanding of its mechanisms and drivers is needed. Emergence of antimicrobial resistance in microorganisms is a natural phenomenon, yet antimicrobial resistance selection has been driven by antimicrobial exposure in health care, agriculture, and the environment. Onward transmission is affected by standards of infection control, sanitation, access to clean water, access to assured quality antimicrobials and diagnostics, travel, and migration. Strategies to reduce antimicrobial resistance by removing antimicrobial selective pressure alone rely upon resistance imparting a fitness cost, an effect not always apparent. Minimising resistance should therefore be considered comprehensively, by resistance mechanism, microorganism, antimicrobial drug, host, and context; parallel to new drug discovery, broad ranging, multidisciplinary research is needed across these five levels, interlinked across the health-care, agriculture, and environment sectors. Intelligent, integrated approaches, mindful of potential unintended results, are needed to ensure sustained, worldwide access to effective antimicrobials. PMID:26603922

  7. Molecular and biochemical mechanisms of drug resistance in fungi.

    PubMed

    Yamaguchi, H

    1999-01-01

    This paper reviews the current status of our understanding of resistance mechanisms of three major classes of antifungal drugs for systemic use, amphotericin B (AMPH), flucytosine (5-FC) and several azole antifungals, in particular fluconazole (FLCZ), at the molecular and cellular levels. Although the number of reports of AMPH- or 5-FC-resistant fungal species and strains is limited, several mechanisms of resistance have been described. AMPH-resistant Candida have a marked decrease in ergosterol content compared with AMPH-susceptible control isolates. A lesion in the UMP-pyrophosphorylase is the most frequent determinant of 5-FC resistance in C. albicans. Recently resistance of C. albicans to azoles has become an increasing problem. Extensive biochemical studies have highlighted a significant diversity in mechanisms conferring resistance to FLCZ and other azoles, which include alterations in sterol biosynthesis, target site, uptake and efflux. Among them, the most important mechanism clinically is reduced access of the drug to the intracellular P450 14 DM target, probably because of the action of a multidrug resistance efflux pump, and overproduction of that target. However, other possible resistance mechanisms for azoles remain to be identified.

  8. Mechanical properties and corrosion resistance of Inconel alloy 617 for refinery service

    SciTech Connect

    Lipscomb, W.G.; Crum, J.R.; Ganesan, P. )

    1989-01-01

    Various factors affecting the performance of Inconel alloy 617 in refinery service are evaluated. The influence of long-term exposure at 1000-1400{degrees}F (538- 760{degrees}C) on mechanical properties and high-temperature low-cycle fatigue studies are reported. In addition the effects of various heat treatments and resulting microstructure on polythionic acid stress corrosion cracking resistance and intergranular attack resistance are determined.

  9. Does high serum uric acid level cause aspirin resistance?

    PubMed

    Yildiz, Bekir S; Ozkan, Emel; Esin, Fatma; Alihanoglu, Yusuf I; Ozkan, Hayrettin; Bilgin, Murat; Kilic, Ismail D; Ergin, Ahmet; Kaftan, Havane A; Evrengul, Harun

    2016-06-01

    In patients with coronary artery disease (CAD), though aspirin inhibits platelet activation and reduces atherothrombotic complications, it does not always sufficiently inhibit platelet function, thereby causing a clinical situation known as aspirin resistance. As hyperuricemia activates platelet turnover, aspirin resistance may be specifically induced by increased serum uric acid (SUA) levels. In this study, we thus investigated the association between SUA level and aspirin resistance in patients with CAD. We analyzed 245 consecutive patients with stable angina pectoris (SAP) who in coronary angiography showed more than 50% occlusion in a major coronary artery. According to aspirin resistance, two groups were formed: the aspirin resistance group (Group 1) and the aspirin-sensitive group (Group 2). Compared with those of Group 2, patients with aspirin resistance exhibited significantly higher white blood cell counts, neutrophil counts, neutrophil-to-lymphocyte ratios, SUA levels, high-sensitivity C-reactive protein levels, and fasting blood glucose levels. After multivariate analysis, a high level of SUA emerged as an independent predictor of aspirin resistance. The receiver-operating characteristic analysis provided a cutoff value of 6.45 mg/dl for SUA to predict aspirin resistance with 79% sensitivity and 65% specificity. Hyperuricemia may cause aspirin resistance in patients with CAD and high SUA levels may indicate aspirin-resistant patients. Such levels should thus recommend avoiding heart attack and stroke by adjusting aspirin dosage. PMID:26656902

  10. Transcriptome Analysis Reveals Mechanisms by Which Lactococcus lactis Acquires Nisin Resistance

    PubMed Central

    Kramer, Naomi E.; van Hijum, Sacha A. F. T.; Knol, Jan; Kok, Jan; Kuipers, Oscar P.

    2006-01-01

    Nisin, a posttranslationally modified antimicrobial peptide produced by Lactococcus lactis, is widely used as a food preservative. Yet, the mechanisms leading to the development of nisin resistance in bacteria are poorly understood. We used whole-genome DNA microarrays of L. lactis IL1403 to identify the factors underlying acquired nisin resistance mechanisms. The transcriptomes of L. lactis IL1403 and L. lactis IL1403 Nisr, which reached a 75-fold higher nisin resistance level, were compared. Differential expression was observed in genes encoding proteins that are involved in cell wall biosynthesis, energy metabolism, fatty acid and phospholipid metabolism, regulatory functions, and metal and/or peptide transport and binding. These results were further substantiated by showing that several knockout and overexpression mutants of these genes had strongly altered nisin resistance levels and that some knockout strains could no longer become resistant to the same level of nisin as that of the wild-type strain. The acquired nisin resistance mechanism in L. lactis is complex, involving various different mechanisms. The four major mechanisms are (i) preventing nisin from reaching the cytoplasmic membrane, (ii) reducing the acidity of the extracellular medium, thereby stimulating the binding of nisin to the cell wall, (iii) preventing the insertion of nisin into the membrane, and (iv) possibly transporting nisin across the membrane or extruding nisin out of the membrane. PMID:16641446

  11. Detecting mechanisms of acquired BRAF inhibitor resistance in melanoma.

    PubMed

    Lo, Roger S; Shi, Hubing

    2014-01-01

    (V600)BRAF mutation was identified as an ideal target for clinical therapy due to its indispensable roles in supporting melanoma initiation and progression. Despite the fact that BRAF inhibitors (BRAFi) can elicit anti-tumor responses in the majority of treated patients and confer overall survival benefits, acquired drug resistance is a formidable obstacle to long-term management of the disease. Several aberrant events including RTK upregulation, NRAS mutation, mutant BRAF amplification or alternative splicing, and MEK mutation have been reported as acquired BRAFi resistance mechanisms. Clinially, detection of these resistance mechanisms help understand drug response patterns and help guide combinatorial therapeutic strategies. Therefore, quick and accurate diagnosis of the resistant mechanisms in tumor biopsies has become an important starting point for personalized therapy. In this chapter, we review the major acquired BRAFi resistance mechanisms, highlight their therapeutic implications, and provide the diagnostic methods from clinical samples.

  12. Mechanisms Linking Inflammation to Insulin Resistance.

    PubMed

    Chen, Li; Chen, Rui; Wang, Hua; Liang, Fengxia

    2015-01-01

    Obesity is now widespread around the world. Obesity-associated chronic low-grade inflammation is responsible for the decrease of insulin sensitivity, which makes obesity a major risk factor for insulin resistance and related diseases such as type 2 diabetes mellitus and metabolic syndromes. The state of low-grade inflammation is caused by overnutrition which leads to lipid accumulation in adipocytes. Obesity might increase the expression of some inflammatory cytokines and activate several signaling pathways, both of which are involved in the pathogenesis of insulin resistance by interfering with insulin signaling and action. It has been suggested that specific factors and signaling pathways are often correlated with each other; therefore, both of the fluctuation of cytokines and the status of relevant signaling pathways should be considered during studies analyzing inflammation-related insulin resistance. In this paper, we discuss how these factors and signaling pathways contribute to insulin resistance and the therapeutic promise targeting inflammation in insulin resistance based on the latest experimental studies. PMID:26136779

  13. Resistance of geopolymer materials to acid attack

    SciTech Connect

    Bakharev, T

    2005-04-01

    This article presents an investigation into durability of geopolymer materials manufactured using a class F fly ash (FA) and alkaline activators when exposed to 5% solutions of acetic and sulfuric acids. The main parameters studied were the evolution of weight, compressive strength, products of degradation and microstructural changes. The degradation was studied using X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). The performance of geopolymer materials when exposed to acid solutions was superior to ordinary Portland cement (OPC) paste. However, significant degradation of strength was observed in some geopolymer materials prepared with sodium silicate and with a mixture of sodium hydroxide and potassium hydroxide as activators. The deterioration observed was connected to depolymerisation of the aluminosilicate polymers in acidic media and formation of zeolites, which in some cases lead to a significant loss of strength. The best performance was observed in the geopolymer material prepared with sodium hydroxide and cured at elevated temperature, which was attributed to a more stable cross-linked aluminosilicate polymer structure formed in this material.

  14. Molecular mechanisms of methicillin resistance in Staphylococcus aureus.

    PubMed

    Domínguez, M A; Liñares, J; Martín, R

    1997-09-01

    Methicillin-resistant Staphylococcus aureus (MRSA) strains are among the most common nosocomial pathogens. The most significant mechanism of resistance to methicillin in this-species is the acquisition of a genetic determinant (mecA gene). However, resistance seems to have a more complex molecular basis, since additional chromosomal material is involved in such resistance. Besides, overproduction of penicillinase and/or alterations in the PBPs can contribute to the formation of resistance phenotypes. Genetic and environmental factors leading to MRSA are reviewed.

  15. Mechanism of Escherichia coli Resistance to Pyrrhocoricin

    PubMed Central

    Narayanan, Shalini; Modak, Joyanta K.; Ryan, Catherine S.; Garcia-Bustos, Jose; Davies, John K.

    2014-01-01

    Due to their lack of toxicity to mammalian cells and good serum stability, proline-rich antimicrobial peptides (PR-AMPs) have been proposed as promising candidates for the treatment of infections caused by antimicrobial-resistant bacterial pathogens. It has been hypothesized that these peptides act on multiple targets within bacterial cells, and therefore the likelihood of the emergence of resistance was considered to be low. Here, we show that spontaneous Escherichia coli mutants resistant to pyrrhocoricin arise at a frequency of approximately 6 × 10−7. Multiple independently derived mutants all contained a deletion in a nonessential gene that encodes the putative peptide uptake permease SbmA. Sensitivity could be restored to the mutants by complementation with an intact copy of the sbmA gene. These findings question the viability of the development of insect PR-AMPs as antimicrobials. PMID:24590485

  16. Role of Chemotherapy and Mechanisms of Resistance to Chemotherapy in Metastatic Castration-Resistant Prostate Cancer

    PubMed Central

    Lohiya, Vipin; Aragon-Ching, Jeanny B.; Sonpavde, Guru

    2016-01-01

    Chemotherapy using the taxanes, docetaxel and cabazitaxel, remains an important therapeutic option in metastatic castration-resistant prostate cancer (CRPC). However, despite the survival benefits afforded by these agents, the survival increments are modest and resistance occurs universally. Efforts to overcome resistance to docetaxel by combining with biologic agents have heretofore been unsuccessful. Indeed, resistance to these taxanes is also associated with cross-resistance to the antiandrogen drugs, abiraterone and enzalutamide. Here, we discuss the various mechanisms of resistance to chemotherapy in metastatic CRPC and the potential role of emerging regimens and agents in varying clinical phases of development. PMID:27773999

  17. Mechanisms of Pyrazinamide Action and Resistance

    PubMed Central

    Zhang, Ying; Shi, Wanliang; Zhang, Wenhong; Mitchison, Denis

    2014-01-01

    PZA is a unique anti-tuberculosis drug that plays a key role in shortening the TB therapy. PZA kills non-replicating persisters that other TB drugs fail to kill, and thus making it an essential drug for inclusion in any drug combinations for treating drug susceptible and drug-resistant TB such as MDR-TB. PZA acts differently from common antibiotics by inhibiting multiple targets such as energy production, trans-translation and perhaps pantothenate /coenzyme A required for persister survival. Resistance to PZA is mostly caused by mutations in the pncA gene encoding pyrazinamidase involved in conversion of the prodrug PZA to the active form POA. Mutations in the drug target RpsA are also found in some PZA-resistant strains. The recent finding that panD mutations are found in some PZA-resistant strains without pncA or rpsA mutations may suggest a third PZA resistance gene and a potential new target of PZA. Current phenotype based PZA susceptibility testing is not reliable due to false resistance, and sequencing of the pncA gene represents a more rapid, cost-effective and more reliable molecular test for PZA susceptibility testing and should be used for guiding improved treatment of MDR/XDR-TB. Finally, the story of PZA has important implications for not only TB therapy but also chemotherapy in general. PZA serves as a model prototype persister drug and hopefully a ‘tipping point’ that inspires new efforts at developing a new type of antibiotics or drugs that target non-replicating persisters for improved treatment of not only TB but also other persistent bacterial infections. PMID:25530919

  18. Sphingolipids contribute to acetic acid resistance in Zygosaccharomyces bailii.

    PubMed

    Lindahl, Lina; Genheden, Samuel; Eriksson, Leif A; Olsson, Lisbeth; Bettiga, Maurizio

    2016-04-01

    Lignocellulosic raw material plays a crucial role in the development of sustainable processes for the production of fuels and chemicals. Weak acids such as acetic acid and formic acid are troublesome inhibitors restricting efficient microbial conversion of the biomass to desired products. To improve our understanding of weak acid inhibition and to identify engineering strategies to reduce acetic acid toxicity, the highly acetic-acid-tolerant yeast Zygosaccharomyces bailii was studied. The impact of acetic acid membrane permeability on acetic acid tolerance in Z. bailii was investigated with particular focus on how the previously demonstrated high sphingolipid content in the plasma membrane influences acetic acid tolerance and membrane permeability. Through molecular dynamics simulations, we concluded that membranes with a high content of sphingolipids are thicker and more dense, increasing the free energy barrier for the permeation of acetic acid through the membrane. Z. bailii cultured with the drug myriocin, known to decrease cellular sphingo-lipid levels, exhibited significant growth inhibition in the presence of acetic acid, while growth in medium without acetic acid was unaffected by the myriocin addition. Furthermore, following an acetic acid pulse, the intracellular pH decreased more in myriocin-treated cells than in control cells. This indicates a higher inflow rate of acetic acid and confirms that the reduction in growth of cells cultured with myriocin in the medium with acetic acid was due to an increase in membrane permeability, thereby demonstrating the importance of a high fraction of sphingolipids in the membrane of Z. bailii to facilitate acetic acid resistance; a property potentially transferable to desired production organisms suffering from weak acid stress. PMID:26416641

  19. Sphingolipids contribute to acetic acid resistance in Zygosaccharomyces bailii.

    PubMed

    Lindahl, Lina; Genheden, Samuel; Eriksson, Leif A; Olsson, Lisbeth; Bettiga, Maurizio

    2016-04-01

    Lignocellulosic raw material plays a crucial role in the development of sustainable processes for the production of fuels and chemicals. Weak acids such as acetic acid and formic acid are troublesome inhibitors restricting efficient microbial conversion of the biomass to desired products. To improve our understanding of weak acid inhibition and to identify engineering strategies to reduce acetic acid toxicity, the highly acetic-acid-tolerant yeast Zygosaccharomyces bailii was studied. The impact of acetic acid membrane permeability on acetic acid tolerance in Z. bailii was investigated with particular focus on how the previously demonstrated high sphingolipid content in the plasma membrane influences acetic acid tolerance and membrane permeability. Through molecular dynamics simulations, we concluded that membranes with a high content of sphingolipids are thicker and more dense, increasing the free energy barrier for the permeation of acetic acid through the membrane. Z. bailii cultured with the drug myriocin, known to decrease cellular sphingo-lipid levels, exhibited significant growth inhibition in the presence of acetic acid, while growth in medium without acetic acid was unaffected by the myriocin addition. Furthermore, following an acetic acid pulse, the intracellular pH decreased more in myriocin-treated cells than in control cells. This indicates a higher inflow rate of acetic acid and confirms that the reduction in growth of cells cultured with myriocin in the medium with acetic acid was due to an increase in membrane permeability, thereby demonstrating the importance of a high fraction of sphingolipids in the membrane of Z. bailii to facilitate acetic acid resistance; a property potentially transferable to desired production organisms suffering from weak acid stress.

  20. Microbial resistance to disinfectants: mechanisms and significance

    SciTech Connect

    Hoff, J.C.; Akin, E.W.

    1986-11-01

    Drinking water disinfection provides the final barrier to transmission of a wide variety of potentially waterborne infectious agents including pathogenic bacteria, viruses, and protozoa. These agents differ greatly in their innate resistance to inactivation by disinfectants, ranging from extremely sensitive bacteria to highly resistant protozoan cysts. The close similarity between microorganism inactivation rates and the kinetics of chemical reactions has long been recognized. Ideally, under carefully controlled conditions, microorganism inactivation rates simulate first-order chemical reaction rates, making it possible to predict the effectiveness of disinfection under specific conditions. In practice, changes in relative resistance and deviations from first-order kinetics are caused by a number of factors, including microbial growth conditions, aggregation, and association with particulate materials. The net effect of all these factors is a reduction in the effectiveness and predictability of disinfection processes. To ensure effective pathogen control, disinfectant concentrations and contact times greater than experimentally determined values may be required. Of the factors causing enhanced disinfection resistance, protection by association with particulate matter is the most significant. Therefore, removal of particulate matter is an important step in increasing the effectiveness of disinfection processes.

  1. Sphingolipids contribute to acetic acid resistance in Zygosaccharomyces bailii

    PubMed Central

    Lindahl, Lina; Genheden, Samuel; Eriksson, Leif A.; Olsson, Lisbeth

    2015-01-01

    ABSTRACT Lignocellulosic raw material plays a crucial role in the development of sustainable processes for the production of fuels and chemicals. Weak acids such as acetic acid and formic acid are troublesome inhibitors restricting efficient microbial conversion of the biomass to desired products. To improve our understanding of weak acid inhibition and to identify engineering strategies to reduce acetic acid toxicity, the highly acetic‐acid‐tolerant yeast Zygosaccharomyces bailii was studied. The impact of acetic acid membrane permeability on acetic acid tolerance in Z. bailii was investigated with particular focus on how the previously demonstrated high sphingolipid content in the plasma membrane influences acetic acid tolerance and membrane permeability. Through molecular dynamics simulations, we concluded that membranes with a high content of sphingolipids are thicker and more dense, increasing the free energy barrier for the permeation of acetic acid through the membrane. Z. bailii cultured with the drug myriocin, known to decrease cellular sphingo­lipid levels, exhibited significant growth inhibition in the presence of acetic acid, while growth in medium without acetic acid was unaffected by the myriocin addition. Furthermore, following an acetic acid pulse, the intracellular pH decreased more in myriocin‐treated cells than in control cells. This indicates a higher inflow rate of acetic acid and confirms that the reduction in growth of cells cultured with myriocin in the medium with acetic acid was due to an increase in membrane permeability, thereby demonstrating the importance of a high fraction of sphingolipids in the membrane of Z. bailii to facilitate acetic acid resistance; a property potentially transferable to desired production organisms suffering from weak acid stress. Biotechnol. Bioeng. 2016;113: 744–753. © 2015 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. PMID:26416641

  2. Novel Nickel Resistance Genes from the Rhizosphere Metagenome of Plants Adapted to Acid Mine Drainage▿ †

    PubMed Central

    Mirete, Salvador; de Figueras, Carolina G.; González-Pastor, Jose E.

    2007-01-01

    Metal resistance determinants have traditionally been found in cultivated bacteria. To search for genes involved in nickel resistance, we analyzed the bacterial community of the rhizosphere of Erica andevalensis, an endemic heather which grows at the banks of the Tinto River, a naturally metal-enriched and extremely acidic environment in southwestern Spain. 16S rRNA gene sequence analysis of rhizosphere DNA revealed the presence of members of five phylogenetic groups of Bacteria and the two main groups of Archaea mostly associated with sites impacted by acid mine drainage (AMD). The diversity observed and the presence of heavy metals in the rhizosphere led us to construct and screen five different metagenomic libraries hosted in Escherichia coli for searching novel nickel resistance determinants. A total of 13 positive clones were detected and analyzed. Insights about their possible mechanisms of resistance were obtained from cellular nickel content and sequence similarities. Two clones encoded putative ABC transporter components, and a novel mechanism of metal efflux is suggested. In addition, a nickel hyperaccumulation mechanism is proposed for a clone encoding a serine O-acetyltransferase. Five clones encoded proteins similar to well-characterized proteins but not previously reported to be related to nickel resistance, and the remaining six clones encoded hypothetical or conserved hypothetical proteins of uncertain functions. This is the first report documenting nickel resistance genes recovered from the metagenome of an AMD environment. PMID:17675438

  3. Mechanism of Insect Resistance to the Microbial Insecticide Bacillus thuringiensis

    NASA Astrophysics Data System (ADS)

    van Rie, J.; McGaughey, W. H.; Johnson, D. E.; Barnett, B. D.; van Mellaert, H.

    1990-01-01

    Receptor binding studies show that resistance of a laboratory-selected Plodia interpunctella strain to a Bacillus thuringiensis insecticidal crystal protein (ICP) is correlated with a 50-fold reduction in affinity of the membrane receptor for this protein. The strain is sensitive to a second type of ICP that apparently recognizes a different receptor. Understanding the mechanism of resistance will provide strategies to prevent or delay resistance and hence prolong the usefulness of B. thuringiensis ICPs as environmentally safe insecticides.

  4. What have the mechanisms of resistance to glyphosate taught us?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The intensive use of glyphosate alone to manage weeds has selected populations that are glyphosate resistant. The three mechanisms of glyphosate resistance that have been elucidated are 1) target site mutations; 2) gene amplification; and 3) altered translocation due to sequestration. What have we...

  5. Herbicide resistance in weeds: Survey, characterization, and mechanisms

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The goal of this paper is to present a systematic diagnostic approach towards the characterization of herbicide resistance in a given weed population with regards to profile (single, multiple, cross resistance), magnitude (fold level), mechanism, and related bio-physiological aspects. Diagnosing her...

  6. Roles of the major, small, acid-soluble spore proteins and spore-specific and universal DNA repair mechanisms in resistance of Bacillus subtilis spores to ionizing radiation from X rays and high-energy charged-particle bombardment.

    PubMed

    Moeller, Ralf; Setlow, Peter; Horneck, Gerda; Berger, Thomas; Reitz, Günther; Rettberg, Petra; Doherty, Aidan J; Okayasu, Ryuichi; Nicholson, Wayne L

    2008-02-01

    The role of DNA repair by nonhomologous end joining (NHEJ), homologous recombination, spore photoproduct lyase, and DNA polymerase I and genome protection via alpha/beta-type small, acid-soluble spore proteins (SASP) in Bacillus subtilis spore resistance to accelerated heavy ions (high-energy charged [HZE] particles) and X rays has been studied. Spores deficient in NHEJ and alpha/beta-type SASP were significantly more sensitive to HZE particle bombardment and X-ray irradiation than were the recA, polA, and splB mutant and wild-type spores, indicating that NHEJ provides an efficient DNA double-strand break repair pathway during spore germination and that the loss of the alpha/beta-type SASP leads to a significant radiosensitivity to ionizing radiation, suggesting the essential function of these spore proteins as protectants of spore DNA against ionizing radiation.

  7. Mechanism of action of 5-arninosalicylic acid

    PubMed Central

    Greenfield, S. M.; Thompson, R. P. H.

    1992-01-01

    5-Aminosalicylic Acid (5-ASA) has been used for over 50 years in the treatment of inflammatory bowel disease in the pro-drug form sulphasalazine (SASP). SASP is also used to treat rheumatoid arthritis. However whether the therapeutic properties of SASP are due to the intact molecule, the 5-ASA or sulphapyridine components is unknown. Several mechanisms of action have been proposed for 5-ASA and SASP including interference in the metabolism of arachidonic acid to prostaglandins and leukotrienes, scavenging,of reactive oxygen species, effects on leucocyte function and production of cytokines. However, it is unlikely that the anti-inflammatory properties of SASP and 5-ASA are due to several different properties but more likely that a single property of 5-ASA explains the theraapeutic effects of 5-ASA and SASP. Reactive oxygen species (ROS) are involved in the metabolism of prostaglandins and leukotrienes and can act as second messengers, and so the scavenging of ROS may be the single mechanism of action of 5-ASA that gives rise to its antiinflammatory effects in both inflammatory bowel disease and rheumatoid arthritis. PMID:18475455

  8. Anthelmintic Resistance in Haemonchus contortus: History, Mechanisms and Diagnosis.

    PubMed

    Kotze, A C; Prichard, R K

    2016-01-01

    Haemonchus contortus has shown a great ability to develop resistance to anthelmintic drugs. In many instances, resistance has appeared less than 10years after the introduction of a new drug class. Field populations of this species now show resistance to all major anthelmintic drug classes, including benzimidazoles (BZs), imidazothiazoles and macrocyclic lactones. In addition, resistance to the recently introduced amino-acetonitrile derivative class (monepantel) has already been reported. The existence of field populations showing resistance to all three major drug classes, and the early appearance of resistance to monepantel, threatens the sustainability of sheep and goat production systems worldwide. This chapter reviews the history of the development of resistance to the various anthelmintics in H. contortus and examines the mechanisms utilized by this species to resist the effects of these drugs. Some of these mechanisms are well understood, particularly for BZ drugs, while our knowledge and understanding of others are increasing. Finally, we summarize methods available for the diagnosis of resistance. While such diagnosis currently relies largely on the faecal egg count reduction test, which suffers from issues of expense and sensitivity, we describe past and current efforts to utilize cheaper and less laborious phenotypic assays with free-living life stages, and then describe progress on the development of molecular assays to provide sensitive resistance-detection tests. PMID:27238009

  9. Mechanisms of naturally evolved ethanol resistance in Drosophila melanogaster.

    PubMed

    Fry, James D

    2014-11-15

    The decaying fruit in which Drosophila melanogaster feed and breed can contain ethanol in concentrations as high as 6-7%. In this cosmopolitan species, populations from temperate regions are consistently more resistant to ethanol poisoning than populations from the tropics, but little is known about the physiological basis of this difference. I show that when exposed to low levels of ethanol vapor, flies from a tropical African population accumulated 2-3 times more internal ethanol than flies from a European population, giving evidence that faster ethanol catabolism by European flies contributes to the resistance difference. Using lines differing only in the origin of their third chromosome, however, I show that faster ethanol elimination cannot fully explain the resistance difference, because relative to African third chromosomes, European third chromosomes confer substantially higher ethanol resistance, while having little effect on internal ethanol concentrations. European third chromosomes also confer higher resistance to acetic acid, a metabolic product of ethanol, than African third chromosomes, suggesting that the higher ethanol resistance conferred by the former might be due to increased resistance to deleterious effects of ethanol-derived acetic acid. In support of this hypothesis, when ethanol catabolism was blocked with an Alcohol dehydrogenase mutant, there was no difference in ethanol resistance between flies with European and African third chromosomes. PMID:25392459

  10. 30 CFR 7.48 - Acid resistance test.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... MINING PRODUCTS TESTING BY APPLICANT OR THIRD PARTY Battery Assemblies § 7.48 Acid resistance test. (a) Test procedures. (1) Prepare one sample each of the insulated surfaces of the battery box and of the... insulation plus the battery cover or box material. The insulation thickness shall be representative of...

  11. Myocardial fatty acid metabolism and lipotoxicity in the setting of insulin resistance.

    PubMed

    Kok, Bernard P C; Brindley, David N

    2012-10-01

    Management of diabetes and insulin resistance in the setting of cardiovascular disease has become an important issue in an increasingly obese society. Besides the development of hypertension and buildup of atherosclerotic plaques, the derangement of fatty acid and lipid metabolism in the heart plays an important role in promoting cardiac dysfunction and oxidative stress. This review discusses the mechanisms by which metabolic inflexibility in the use of fatty acids as the preferred cardiac substrate in diabetes produces detrimental effects on mechanical efficiency, mitochondrial function, and recovery from ischemia. Lipid accumulation and the consequences of toxic lipid metabolites are also discussed. PMID:22999246

  12. Rapid vacuolar sequestration: the horseweed glyphosate resistance mechanism

    PubMed Central

    Ge, Xia; Avignon, D André d’; Ackerman, Joseph JH; Sammons, R Douglas

    2010-01-01

    BACKGROUND Glyphosate-resistant (GR) weed species are now found with increasing frequency and threaten the critically importantGR weed management system. RESULTS The reported 31P NMR experiments on glyphosate-sensitive (S) and glyphosate-resistant (R) horseweed, Conyza canadensis (L.) Cronq., show significantly more accumulation of glyphosate within the R biotype vacuole. CONCLUSIONS Selective sequestration of glyphosate into the vacuole confers the observed horseweed resistance to glyphosate. This observation represents the first clear evidence for the glyphosate resistance mechanism in C. canadensis. PMID:20063320

  13. Mechanisms of Drug Resistance in Relapse and Refractory Multiple Myeloma.

    PubMed

    Yang, Wen-Chi; Lin, Sheng-Fung

    2015-01-01

    Multiple myeloma (MM) is a hematological malignancy that remains incurable because most patients eventually relapse or become refractory to current treatments. Although the treatments have improved, the major problem in MM is resistance to therapy. Clonal evolution of MM cells and bone marrow microenvironment changes contribute to drug resistance. Some mechanisms affect both MM cells and microenvironment, including the up- and downregulation of microRNAs and programmed death factor 1 (PD-1)/PD-L1 interaction. Here, we review the pathogenesis of MM cells and bone marrow microenvironment and highlight possible drug resistance mechanisms. We also review a potential molecular targeting treatment and immunotherapy for patients with refractory or relapse MM.

  14. The role of abscisic acid and water stress in root herbivore-induced leaf resistance.

    PubMed

    Erb, Matthias; Köllner, Tobias G; Degenhardt, Jörg; Zwahlen, Claudia; Hibbard, Bruce E; Turlings, Ted C J

    2011-01-01

    • Herbivore-induced systemic resistance occurs in many plants and is commonly assumed to be adaptive. The mechanisms triggered by leaf-herbivores that lead to systemic resistance are largely understood, but it remains unknown how and why root herbivory also increases resistance in leaves. • To resolve this, we investigated the mechanism by which the root herbivore Diabrotica virgifera induces resistance against lepidopteran herbivores in the leaves of Zea mays. • Diabrotica virgifera infested plants suffered less aboveground herbivory in the field and showed reduced growth of Spodoptera littoralis caterpillars in the laboratory. Root herbivory did not lead to a jasmonate-dependent response in the leaves, but specifically triggered water loss and abscisic acid (ABA) accumulation. The induction of ABA by itself was partly responsible for the induction of leaf defenses, but not for the resistance against S. littoralis. Root-herbivore induced hydraulic changes in the leaves, however, were crucial for the increase in insect resistance. • We conclude that the induced leaf resistance after root feeding is the result of hydraulic changes, which reduce the quality of the leaves for chewing herbivores. This finding calls into question whether root-herbivore induced leaf-resistance is an evolved response.

  15. Targeting bacterial topoisomerases: how to counter mechanisms of resistance.

    PubMed

    Tse-Dinh, Yuk-Ching

    2016-06-01

    DNA gyrase and topoisomerase IV are type IIA bacterial topoisomerases that are targeted by highly effective antibiotics. However, resistance via multiple mechanisms arises to limit the efficacies of these drugs. Continued research on type IIA bacterial topoisomerases has provided novel approaches to counter the most common resistance mechanism for utilization of these proven targets in antibacterial therapy. Bacterial topoisomerase I is being explored as an alternative target that is not expected to show cross-resistance. Dual targeting or combination therapy could be strategies for circumventing the development of resistance to topoisomerase-targeting antibiotics. Bacterial topoisomerases are high-value bactericidal targets that could continue to be exploited for antibacterial therapy, if new tactics to counter resistance can be adopted. PMID:27285067

  16. Targeting bacterial topoisomerases: how to counter mechanisms of resistance.

    PubMed

    Tse-Dinh, Yuk-Ching

    2016-06-01

    DNA gyrase and topoisomerase IV are type IIA bacterial topoisomerases that are targeted by highly effective antibiotics. However, resistance via multiple mechanisms arises to limit the efficacies of these drugs. Continued research on type IIA bacterial topoisomerases has provided novel approaches to counter the most common resistance mechanism for utilization of these proven targets in antibacterial therapy. Bacterial topoisomerase I is being explored as an alternative target that is not expected to show cross-resistance. Dual targeting or combination therapy could be strategies for circumventing the development of resistance to topoisomerase-targeting antibiotics. Bacterial topoisomerases are high-value bactericidal targets that could continue to be exploited for antibacterial therapy, if new tactics to counter resistance can be adopted.

  17. Electropolymerization mechanisms of hydroxyphenylacetic acid isomers

    NASA Astrophysics Data System (ADS)

    Rodrigues, Luciano P.; Ferreira, Deusmaque C.; Sonoda, Milton Taidi; Madurro, Ana Graci B.; Abrahão, Odonírio; Madurro, João M.

    2014-08-01

    Three different films of conducting polymers with free carboxylic functional groups were obtained from 2,3 and 4-hydroxyphenylacetic acid isomers (HPA) and the respective electropolymerization mechanisms were elucidated by DFT calculations. The different properties observed at these new material characterizations, obtained by means of cyclic voltammetry on graphite, are in agreement with theoretical interpretation presented for each reaction mechanisms, which involves the different radical cation coupling and formation of aromatic polyethers with free carboxyl groups, characterized by FTIR spectrometry and electrochemical tests. The computational chemistry analysis of the radical cations spin densities and partial atomic charges variation during the monomer oxidations, indicates the most probably reactive sites for their coupling, allowing the proposition of HPA electropolymerization mechanisms. The poly(2-HPA) had the largest yield in the electropolymerization reaction and the lowest electron transfer. The poly(4-HPA) displayed the lowest yield and the largest electron transfer coefficient, with poly(3-HPA) presenting intermediate values between the former two. Therefore, poly(3-HPA) is a very promising polymer for the platform development for electronic systems, which require materials with good electronic conductivity allied to intrinsic flexibility of polymeric materials.

  18. Electrical resistance response of polyaniline films to water, ethanol, and nitric acid solution

    NASA Astrophysics Data System (ADS)

    Yin, Hong-Xing; Li, Meng-Meng; Yang, H.; Long, Yun-Ze; Sun, Xin

    2010-08-01

    This paper reports on electrical resistance vs. aging time for the response of polyaniline films under exposure to water, ethanol and nitric acid (HNO3) solution. Camphor sulfonic acid-doped polyaniline films were prepared by a “doping-dedoping-redoping" method, the morphology and microstructures of the films were characterized by a scanning electron microscope and an x-ray diffractometer, the electrical resistance was measured by a four-probe method. It was found that a lower amount of water molecules infiltrating the film can decrease the film's resistance possibly due to an enhancement of charge carrier transfer between polyaniline chains, whereas excessive water molecules can swell inter-chain distances and result in a quick increase of resistance. The resistance of the film under exposure to ethanol increases and becomes much larger than the original value. However, HNO3 solution can decrease the film's resistance sharply possibly owing to doping effect of protonic acid. These results can help to understand the conduction mechanism in polyaniline films, and also indicate that the films have potential application in chemical sensors.

  19. Glutamine, glutamate, and arginine-based acid resistance in Lactobacillus reuteri.

    PubMed

    Teixeira, Januana S; Seeras, Arisha; Sanchez-Maldonado, Alma Fernanda; Zhang, Chonggang; Su, Marcia Shu-Wei; Gänzle, Michael G

    2014-09-01

    This study aimed to determine whether glutamine deamidation improves acid resistance of Lactobacillus reuteri, and to assess whether arginine, glutamine, and glutamate-mediated acid resistance are redundant or complementary mechanisms of acid resistance. Three putative glutaminase genes, gls1, gls2, and gls3, were identified in L. reuteri 100-23. All three genes were expressed during growth in mMRS and wheat sourdough. L. reuteri consistently over-expressed gls3 and the glutamate decarboxylase gadB. L. reuteri 100-23ΔgadB over-expressed gls3 and the arginine deiminase gene adi. Analysis of the survival of L. reuteri in acidic conditions revealed that arginine conversion is effective at pH of 3.5 while glutamine or glutamate conversion were effective at pH of 2.5. Arginine conversion increased the pHin but not ΔΨ; glutamate decarboxylation had only a minor effect on the pHin but increased the ΔΨ. This study demonstrates that glutamine deamidation increases the acid resistance of L. reuteri independent of glutamate decarboxylase activity. Arginine and glutamine/glutamate conversions confer resistance to lactate at pH of 3.5 and phosphate at pH of 2.5, respectively. Knowledge of L. reuteri's acid resistance improves the understanding of the adaptation of L. reuteri to intestinal ecosystems, and facilitates the selection of probiotic and starter cultures.

  20. Topoisomerase Inhibitors: Fluoroquinolone Mechanisms of Action and Resistance.

    PubMed

    Hooper, David C; Jacoby, George A

    2016-01-01

    Quinolone antimicrobials are widely used in clinical medicine and are the only current class of agents that directly inhibit bacterial DNA synthesis. Quinolones dually target DNA gyrase and topoisomerase IV binding to specific domains and conformations so as to block DNA strand passage catalysis and stabilize DNA-enzyme complexes that block the DNA replication apparatus and generate double breaks in DNA that underlie their bactericidal activity. Resistance has emerged with clinical use of these agents and is common in some bacterial pathogens. Mechanisms of resistance include mutational alterations in drug target affinity and efflux pump expression and acquisition of resistance-conferring genes. Resistance mutations in one or both of the two drug target enzymes are commonly in a localized domain of the GyrA and ParC subunits of gyrase and topoisomerase IV, respectively, and reduce drug binding to the enzyme-DNA complex. Other resistance mutations occur in regulatory genes that control the expression of native efflux pumps localized in the bacterial membrane(s). These pumps have broad substrate profiles that include other antimicrobials as well as quinolones. Mutations of both types can accumulate with selection pressure and produce highly resistant strains. Resistance genes acquired on plasmids confer low-level resistance that promotes the selection of mutational high-level resistance. Plasmid-encoded resistance is because of Qnr proteins that protect the target enzymes from quinolone action, a mutant aminoglycoside-modifying enzyme that also modifies certain quinolones, and mobile efflux pumps. Plasmids with these mechanisms often encode additional antimicrobial resistances and can transfer multidrug resistance that includes quinolones. PMID:27449972

  1. Antibiotic resistance mechanisms in M. tuberculosis: an update.

    PubMed

    Nguyen, Liem

    2016-07-01

    Treatment of tuberculosis (TB) has been a therapeutic challenge because of not only the naturally high resistance level of Mycobacterium tuberculosis to antibiotics but also the newly acquired mutations that confer further resistance. Currently standardized regimens require patients to daily ingest up to four drugs under direct observation of a healthcare worker for a period of 6-9 months. Although they are quite effective in treating drug susceptible TB, these lengthy treatments often lead to patient non-adherence, which catalyzes for the emergence of M. tuberculosis strains that are increasingly resistant to the few available anti-TB drugs. The rapid evolution of M. tuberculosis, from mono-drug-resistant to multiple drug-resistant, extensively drug-resistant and most recently totally drug-resistant strains, is threatening to make TB once again an untreatable disease if new therapeutic options do not soon become available. Here, I discuss the molecular mechanisms by which M. tuberculosis confers its profound resistance to antibiotics. This knowledge may help in developing novel strategies for weakening drug resistance, thus enhancing the potency of available antibiotics against both drug susceptible and resistant M. tuberculosis strains. PMID:27161440

  2. Accumulation of Phosphatidic Acid Increases Vancomycin Resistance in Escherichia coli

    PubMed Central

    Sutterlin, Holly A.; Zhang, Sisi

    2014-01-01

    In Gram-negative bacteria, lipopolysaccharide (LPS) contributes to the robust permeability barrier of the outer membrane, preventing entry of toxic molecules such as antibiotics. Mutations in lptD, the beta-barrel component of the LPS transport and assembly machinery, compromise LPS assembly and result in increased antibiotic sensitivity. Here, we report rare vancomycin-resistant suppressors that improve barrier function of a subset of lptD mutations. We find that all seven suppressors analyzed mapped to the essential gene cdsA, which is responsible for the conversion of phosphatidic acid to CDP-diacylglycerol in phospholipid biosynthesis. These cdsA mutations cause a partial loss of function and, as expected, accumulate phosphatidic acid. We show that this suppression is not confined to mutations that cause defects in outer membrane biogenesis but rather that these cdsA mutations confer a general increase in vancomycin resistance, even in a wild-type cell. We use genetics and quadrupole time of flight (Q-TOF) liquid chromatography-mass spectrometry (LC-MS) to show that accumulation of phosphatidic acid by means other than cdsA mutations also increases resistance to vancomycin. We suggest that increased levels of phosphatidic acid change the physical properties of the outer membrane to impede entry of vancomycin into the periplasm, hindering access to its target, an intermediate required for the synthesis of the peptidoglycan cell wall. PMID:24957626

  3. Insecticide resistance in vector Chagas disease: evolution, mechanisms and management.

    PubMed

    Mougabure-Cueto, Gastón; Picollo, María Inés

    2015-09-01

    Chagas disease is a chronic parasitic infection restricted to America. The disease is caused by the protozoa Trypanosoma cruzi, which is transmitted to human through the feces of infected triatomine insects. Because no treatment is available for the chronic forms of the disease, vector chemical control represents the best way to reduce the incidence of the disease. Chemical control has been based principally on spraying dwellings with insecticide formulations and led to the reduction of triatomine distribution and consequent interruption of disease transmission in several areas from endemic region. However, in the last decade it has been repeatedly reported the presence triatomnes, mainly Triatoma infestans, after spraying with pyrethroid insecticides, which was associated to evolution to insecticide resistance. In this paper the evolution of insecticide resistance in triatomines is reviewed. The insecticide resistance was detected in 1970s in Rhodnius prolixus and 1990s in R. prolixus and T. infestans, but not until the 2000s resistance to pyrthroids in T. infestans associated to control failures was described in Argentina and Bolivia. The main resistance mechanisms (i.e. enhanced metabolism, altered site of action and reduced penetration) were described in the T. infestans resistant to pyrethrods. Different resistant profiles were demonstrated suggesting independent origin of the different resistant foci of Argentina and Bolivia. The deltamethrin resistance in T. infestans was showed to be controlled by semi-dominant, autosomally inherited factors. Reproductive and developmental costs were also demonstrated for the resistant T. infestans. A discussion about resistance and tolerance concepts and the persistence of T. infestans in Gran Chaco region are presented. In addition, theoretical concepts related to toxicological, evolutionary and ecological aspects of insecticide resistance are discussed in order to understand the particular scenario of pyrethroid

  4. Insecticide resistance in vector Chagas disease: evolution, mechanisms and management.

    PubMed

    Mougabure-Cueto, Gastón; Picollo, María Inés

    2015-09-01

    Chagas disease is a chronic parasitic infection restricted to America. The disease is caused by the protozoa Trypanosoma cruzi, which is transmitted to human through the feces of infected triatomine insects. Because no treatment is available for the chronic forms of the disease, vector chemical control represents the best way to reduce the incidence of the disease. Chemical control has been based principally on spraying dwellings with insecticide formulations and led to the reduction of triatomine distribution and consequent interruption of disease transmission in several areas from endemic region. However, in the last decade it has been repeatedly reported the presence triatomnes, mainly Triatoma infestans, after spraying with pyrethroid insecticides, which was associated to evolution to insecticide resistance. In this paper the evolution of insecticide resistance in triatomines is reviewed. The insecticide resistance was detected in 1970s in Rhodnius prolixus and 1990s in R. prolixus and T. infestans, but not until the 2000s resistance to pyrthroids in T. infestans associated to control failures was described in Argentina and Bolivia. The main resistance mechanisms (i.e. enhanced metabolism, altered site of action and reduced penetration) were described in the T. infestans resistant to pyrethrods. Different resistant profiles were demonstrated suggesting independent origin of the different resistant foci of Argentina and Bolivia. The deltamethrin resistance in T. infestans was showed to be controlled by semi-dominant, autosomally inherited factors. Reproductive and developmental costs were also demonstrated for the resistant T. infestans. A discussion about resistance and tolerance concepts and the persistence of T. infestans in Gran Chaco region are presented. In addition, theoretical concepts related to toxicological, evolutionary and ecological aspects of insecticide resistance are discussed in order to understand the particular scenario of pyrethroid

  5. Production of Siderophores Increases Resistance to Fusaric Acid in Pseudomonas protegens Pf-5

    PubMed Central

    Ruiz, Jimena A.; Bernar, Evangelina M.; Jung, Kirsten

    2015-01-01

    Fusaric acid is produced by pathogenic fungi of the genus Fusarium, and is toxic to plants and rhizobacteria. Many fluorescent pseudomonads can prevent wilt diseases caused by these fungi. This study was undertaken to evaluate the effect of fusaric acid on P. protegens Pf-5 and elucidate the mechanisms that enable the bacterium to survive in the presence of the mycotoxin. The results confirm that fusaric acid negatively affects growth and motility of P. protegens. Moreover, a notable increase in secretion of the siderophore pyoverdine was observed when P. protegens was grown in the presence of fusaric acid. Concomitantly, levels of enzymes involved in the biosynthesis of pyoverdine and enantio-pyochelin, the second siderophore encoded by P. protegens, increased markedly. Moreover, while similar levels of resistance to fusaric acid were observed for P. protegens mutants unable to synthesize either pyoverdine or enanto-pyochelin and the wild type strain, a double mutant unable to synthesize both kinds of siderophores showed a dramatically reduced resistance to this compound. This reduced resistance was not observed when this mutant was grown under conditions of iron excess. Spectrophotometric titrations revealed that fusaric acid binds not only Fe2+ and Fe3+, but also Zn2+, Mn2+ and Cu2+, with high affinity. Our results demonstrate that iron sequestration accounts at least in part for the deleterious effect of the mycotoxin on P. protegens. PMID:25569682

  6. Production of siderophores increases resistance to fusaric acid in Pseudomonas protegens Pf-5.

    PubMed

    Ruiz, Jimena A; Bernar, Evangelina M; Jung, Kirsten

    2015-01-01

    Fusaric acid is produced by pathogenic fungi of the genus Fusarium, and is toxic to plants and rhizobacteria. Many fluorescent pseudomonads can prevent wilt diseases caused by these fungi. This study was undertaken to evaluate the effect of fusaric acid on P. protegens Pf-5 and elucidate the mechanisms that enable the bacterium to survive in the presence of the mycotoxin. The results confirm that fusaric acid negatively affects growth and motility of P. protegens. Moreover, a notable increase in secretion of the siderophore pyoverdine was observed when P. protegens was grown in the presence of fusaric acid. Concomitantly, levels of enzymes involved in the biosynthesis of pyoverdine and enantio-pyochelin, the second siderophore encoded by P. protegens, increased markedly. Moreover, while similar levels of resistance to fusaric acid were observed for P. protegens mutants unable to synthesize either pyoverdine or enanto-pyochelin and the wild type strain, a double mutant unable to synthesize both kinds of siderophores showed a dramatically reduced resistance to this compound. This reduced resistance was not observed when this mutant was grown under conditions of iron excess. Spectrophotometric titrations revealed that fusaric acid binds not only Fe2+ and Fe3+, but also Zn2+, Mn2+ and Cu2+, with high affinity. Our results demonstrate that iron sequestration accounts at least in part for the deleterious effect of the mycotoxin on P. protegens. PMID:25569682

  7. Hypoglycemic effects and mechanisms of electroacupuncture on insulin resistance.

    PubMed

    Yin, Jieyun; Kuang, Jian; Chandalia, Manisha; Tuvdendorj, Demidmaa; Tumurbaatar, Batbayar; Abate, Nicola; Chen, Jiande D Z

    2014-08-01

    The aim of this study was to investigate effects and mechanisms of electroacupuncture (EA) on blood glucose and insulin sensitivity in mice fed a high-fat diet. Both wild-type (WT) and adipose ectonucleotide pyrophosphate phosphodiesterase (ENPP1) transgenic (TG) mice were fed a high-fat diet for 12 wk; for each mouse, an intraperitoneal glucose tolerance test (IPGTT) and insulin tolerance test (ITT) were performed with or without EA at abdomen or auricular areas. A high-fat diet-induced insulin resistance in both WT and TG mice. In the WT mice, EA at 3 Hz and 15 Hz, but not at 1 Hz or 100 Hz, via CV4+CV12 significantly reduced postprandial glucose levels; EA at 3 Hz was most potent. The glucose level was reduced by 61.7% at 60 min and 74.5% at 120 min with EA at 3 Hz (all P < 0.001 vs. control). Similar hypoglycemic effect was noted in the TG mice. On the contrary, EA at auricular points increased postprandial glucose level (P < 0.03). 4). EA at 3 Hz via CV4+CV12 significantly enhanced the decrease of blood glucose after insulin injection, suggesting improvement of insulin sensitivity. Plasma free fatty acid was significantly suppressed by 42.5% at 15 min and 50.8% at 30 min with EA (P < 0.01) in both WT and TG mice. EA improves glucose tolerance in both WT and TG mice fed a high-fat diet, and the effect is associated with stimulation parameters and acupoints and is probably attributed to the reduction of free fatty acid. PMID:24848362

  8. Different mechanisms of resistance modulate sulfite tolerance in wine yeasts.

    PubMed

    Nadai, Chiara; Treu, Laura; Campanaro, Stefano; Giacomini, Alessio; Corich, Viviana

    2016-01-01

    From a technological point of view, yeast resistance to sulfite is of great interest and represents an important technological character for winemaking. Several mechanisms are involved, and strain-dependent strategies to obtain SO2 resistance can deeply influence wine quality, although this choice is less relevant in determining the technological performance of the strain during fermentation. In this study, to better understand the strain-specific mechanisms of resistance, 11 Saccharomyces cerevisiae strains, whose genomes have been previously sequenced, were selected. Their attitude towards sulfites, in terms of resistance and production, was evaluated, and RNA-sequencing of four selected strains was performed during fermentation process in synthetic grape must in the presence of SO2. Results demonstrated that at molecular level, the physical effect of SO2 triggered multiple stress responses in the cell and high tolerance to general enological stressing condition increased SO2 resistance. Adaptation mechanism due to high basal gene expression level rather than specific gene induction in the presence of sulfite seemed to be responsible in modulating strain resistance. This mechanism involved higher basal gene expression level of specific cell wall proteins, enzymes for lipid biosynthesis, and enzymes directly involved in SO2 assimilation pathway and efflux. PMID:26615396

  9. Different mechanisms of resistance modulate sulfite tolerance in wine yeasts.

    PubMed

    Nadai, Chiara; Treu, Laura; Campanaro, Stefano; Giacomini, Alessio; Corich, Viviana

    2016-01-01

    From a technological point of view, yeast resistance to sulfite is of great interest and represents an important technological character for winemaking. Several mechanisms are involved, and strain-dependent strategies to obtain SO2 resistance can deeply influence wine quality, although this choice is less relevant in determining the technological performance of the strain during fermentation. In this study, to better understand the strain-specific mechanisms of resistance, 11 Saccharomyces cerevisiae strains, whose genomes have been previously sequenced, were selected. Their attitude towards sulfites, in terms of resistance and production, was evaluated, and RNA-sequencing of four selected strains was performed during fermentation process in synthetic grape must in the presence of SO2. Results demonstrated that at molecular level, the physical effect of SO2 triggered multiple stress responses in the cell and high tolerance to general enological stressing condition increased SO2 resistance. Adaptation mechanism due to high basal gene expression level rather than specific gene induction in the presence of sulfite seemed to be responsible in modulating strain resistance. This mechanism involved higher basal gene expression level of specific cell wall proteins, enzymes for lipid biosynthesis, and enzymes directly involved in SO2 assimilation pathway and efflux.

  10. Molecular mechanisms associated with Fluconazole resistance in clinical Candida albicans isolates from India.

    PubMed

    Mane, Arati; Vidhate, Pallavi; Kusro, Chanchal; Waman, Vaishali; Saxena, Vandana; Kulkarni-Kale, Urmila; Risbud, Arun

    2016-02-01

    Resistance to azole antifungals is a significant problem in Candida albicans. An understanding of resistance at molecular level is essential for the development of strategies to tackle resistance and rationale design of newer antifungals and target-based molecular approaches. This study presents the first evaluation of molecular mechanisms associated with fluconazole resistance in clinical C.albicans isolates from India. Target site (ERG11) alterations were determined by DNA sequencing, whereas real-time PCRs were performed to quantify target and efflux pump genes (CDR1, CDR2, MDR1) in 87 [Fluconazole susceptible (n = 30), susceptible-dose dependent (n = 30) and resistant (n = 27)] C.albicans isolates. Cross-resistance to fluconazole, ketoconazole and itraconazole was observed in 74.1% isolates. Six amino acid substitutions were identified, including 4 (E116D, F145L, E226D, I437V) previously reported ones and 2 (P406L, Q474H) new ones. CDR1 over-expression was seen in 77.7% resistant isolates. CDR2 was exclusively expressed with CDR1 and their concomitant over-expression was associated with azole cross-resistance. MDR1 and ERG11 over-expression did not seem to be associated with resistance. Our results show that drug efflux mediated by Adenosine-5'-triphosphate (ATP)-binding cassette transporters, especially CDR1 is the predominant mechanism of fluconazole resistance and azole cross-resistance in C. albicans and indicate the need for research directed towards developing strategies to tackle efflux mediated resistance to salvage azoles.

  11. New insights in leptin resistance mechanisms in mice.

    PubMed

    Balland, Eglantine; Cowley, Michael A

    2015-10-01

    Leptin resistance is one of the main challenges of obesity. To date, two levels of resistance have been identified, first a decreased rate of leptin uptake into the brain and secondly a diminished central response to leptin. New findings have identified the mechanisms of leptin transport and demonstrated that it can be rescued in obesity, but it did not overcome the problem of central resistance. Alteration in the actions of leptin following diet-induced obesity (DIO) appears to be a multifactorial condition. Several phosphatases are inhibiting leptin signaling pathways in a pathological way. Besides, hypothalamic inflammation alters the neuronal circuits that control metabolism. Recent studies describing both mechanisms (inhibition of leptin signaling and inflammation), have provided key insights to potential new targets for treatment. However, recent data showing that DIO mice may conserve a cellular and physiological response to endogenous leptin, highlights the need to redefine the concept of "leptin resistance".

  12. The mechanism of resistance to sulfa drugs in Plasmodium falciparum.

    PubMed

    Triglia, Tony; Cowman, Alan F.

    1999-02-01

    The sulfonamide and sulfone (sulfa) group of antimalarials has been used extensively throughout malaria endemic regions of the world to control this important infectious disease of humans. Sulfadoxine is the most extensively used drug of this group of drugs and is usually combined with pyrimethamine (Fansidar), particularly for the control of Plasmodium falciparum, the causative agent of the most lethal form of malaria. Resistance to the sulfadoxine/pyrimethamine combination is widespread. Analysis using molecular, genetic and biochemical approaches has shown that the mechanism of resistance to sulfadoxine involves mutation of dihydropteroate synthase, the enzyme target of this group of drugs. Understanding the mechanism of resistance of P. falciparum to sulfa drugs has allowed detailed analysis of the epidemiology of the spread of drug resistance alleles in the field(1)and, in the future, opens the way to the development of novel antimalarials to this target enzyme. Copyright 1999 Harcourt Publishers Ltd.

  13. Resistance to herbicides inhibiting the biosynthesis of very-long-chain fatty acids.

    PubMed

    Busi, Roberto

    2014-09-01

    Herbicides that act by inhibiting the biosynthesis of very-long-chain fatty acids (VLCFAs) have been used to control grass weeds in major crops throughout the world for the past 60 years. VLCFA-inhibiting herbicides are generally highly selective in crops, induce similar symptoms in susceptible grasses and can be found within the herbicide groups classified by the HRAC as K3 and N. Even after many years of continuous use, only 12 grass weed species have evolved resistance to VLCFA-inhibiting herbicides. Here, the cases of resistance that have evolved in major grass weed species belonging to the Avena, Echinochloa and Lolium genera in three different agricultural systems are reviewed. In particular we explore the possible reasons why VLCFA herbicides have been slow to select resistant weeds, outline the herbicide mode of action and discuss the resistance mechanisms that are most likely to have been selected.

  14. [Macrolides, lincosamides, streptogramines (MLS): mechanisms of action and resistance].

    PubMed

    Ungureanu, Vasilica

    2010-01-01

    Macrolides, lincosamides and streptogramines are distinct antibiotic (AB) families, with different chemical structure, but with similar antibacterial spectre and mechanisms. Macrolides are natural products of secondary metabolism of several species of actynomyces; they represent a group of compounds with a lactonic ring of variable dimensions (12-22 atoms of C) that can bind, by means of glycosidic bonds, sacharridic and/or amino-sacharridic structures. Most of the MLS antibiotics are bacteriostatic. Their mechanisms consist in inhibiting protein synthesis. the target being 50 S subunit of the bacterial ribosome, the binding sites being different for the different MLS classes. Erythromycin (E) was introduced in therapy in 1952; quickly, several bacterial genera started developing resistance to E. Strains resistant to E were as well resistant to all macrolides and other antibiotics with different structures--lincosamides and streptogramines B--resistance phenotype called MLSB. The main molecular mechanisms for bacterial resistance to MLS are: (1) Target modification, coded by erm genes (>12 classes). In Gram-positive cocii MLSB resistance, regardless of erm gene, can be: inducible (i MLSB)--when the presence of the inductor AB is necessary for methylation enzyme production; constitutive (c MLSB)--when the methylation enzyme is continuously produced Distinction between iMLSB and cMLSB can be easily appreciated based on the phenotypic expression of bacteria. In streptococci--all MLSB antibiotics can act as methylase inductors. (2) The decrease of AB intracellular concentration by active efflux, coded by mef genes--also called M resistance phenotype, low level resistance (LLR). (3) AB inactivation (enzymatic modification of AB); there are different resistance phenotypes: MLSB +SA and L phenotype (in staphyilococci) or SA4 phenotype and L phenotype (in enterococci).

  15. Mechanisms responsible for nilotinib resistance in human chronic myeloid leukemia cells and reversal of resistance.

    PubMed

    Camgoz, Aylin; Gencer, Emel Basak; Ural, Ali Ugur; Baran, Yusuf

    2013-06-01

    Multidrug resistance remains a significant obstacle to successful chemotherapy. The ability to determine the possible resistance mechanisms and surmount the resistance is likely to improve chemotherapy. Nilotinib is a very effective drug in the treatment of imatinib-sensitive or -resistant patients. Although very successful hematologic and cytogenetic responses have been obtained in nilotinib-treated patients, in recent years cases showing resistance to nilotinib have been observed. We aimed to examine the mechanisms underlying nilotinib resistance and to provide new targets for the treatment of chronic myeloid leukemia (CML). There was an up-regulation of antiapoptotic BCR/ABL, GCS and SK-1 genes and MRP1 transporter gene and down-regulation of apoptotic Bax and CerS1 genes in nilotinib-resistant cells. There was no mutation in the nilotinib-binding region of BCR/ABL in resistant cells. Inhibiton of GCS and SK-1 restored nilotinib sensitivity. Targeting the proteins that are involved in nilotinib resistance in addition to the inhibition of BCR/ABL could be a better method of treatment in CML.

  16. Drug resistance. Population transcriptomics of human malaria parasites reveals the mechanism of artemisinin resistance.

    PubMed

    Mok, Sachel; Ashley, Elizabeth A; Ferreira, Pedro E; Zhu, Lei; Lin, Zhaoting; Yeo, Tomas; Chotivanich, Kesinee; Imwong, Mallika; Pukrittayakamee, Sasithon; Dhorda, Mehul; Nguon, Chea; Lim, Pharath; Amaratunga, Chanaki; Suon, Seila; Hien, Tran Tinh; Htut, Ye; Faiz, M Abul; Onyamboko, Marie A; Mayxay, Mayfong; Newton, Paul N; Tripura, Rupam; Woodrow, Charles J; Miotto, Olivo; Kwiatkowski, Dominic P; Nosten, François; Day, Nicholas P J; Preiser, Peter R; White, Nicholas J; Dondorp, Arjen M; Fairhurst, Rick M; Bozdech, Zbynek

    2015-01-23

    Artemisinin resistance in Plasmodium falciparum threatens global efforts to control and eliminate malaria. Polymorphisms in the kelch domain-carrying protein K13 are associated with artemisinin resistance, but the underlying molecular mechanisms are unknown. We analyzed the in vivo transcriptomes of 1043 P. falciparum isolates from patients with acute malaria and found that artemisinin resistance is associated with increased expression of unfolded protein response (UPR) pathways involving the major PROSC and TRiC chaperone complexes. Artemisinin-resistant parasites also exhibit decelerated progression through the first part of the asexual intraerythrocytic development cycle. These findings suggest that artemisinin-resistant parasites remain in a state of decelerated development at the young ring stage, whereas their up-regulated UPR pathways mitigate protein damage caused by artemisinin. The expression profiles of UPR-related genes also associate with the geographical origin of parasite isolates, further suggesting their role in emerging artemisinin resistance in the Greater Mekong Subregion.

  17. Drug resistance. Population transcriptomics of human malaria parasites reveals the mechanism of artemisinin resistance.

    PubMed

    Mok, Sachel; Ashley, Elizabeth A; Ferreira, Pedro E; Zhu, Lei; Lin, Zhaoting; Yeo, Tomas; Chotivanich, Kesinee; Imwong, Mallika; Pukrittayakamee, Sasithon; Dhorda, Mehul; Nguon, Chea; Lim, Pharath; Amaratunga, Chanaki; Suon, Seila; Hien, Tran Tinh; Htut, Ye; Faiz, M Abul; Onyamboko, Marie A; Mayxay, Mayfong; Newton, Paul N; Tripura, Rupam; Woodrow, Charles J; Miotto, Olivo; Kwiatkowski, Dominic P; Nosten, François; Day, Nicholas P J; Preiser, Peter R; White, Nicholas J; Dondorp, Arjen M; Fairhurst, Rick M; Bozdech, Zbynek

    2015-01-23

    Artemisinin resistance in Plasmodium falciparum threatens global efforts to control and eliminate malaria. Polymorphisms in the kelch domain-carrying protein K13 are associated with artemisinin resistance, but the underlying molecular mechanisms are unknown. We analyzed the in vivo transcriptomes of 1043 P. falciparum isolates from patients with acute malaria and found that artemisinin resistance is associated with increased expression of unfolded protein response (UPR) pathways involving the major PROSC and TRiC chaperone complexes. Artemisinin-resistant parasites also exhibit decelerated progression through the first part of the asexual intraerythrocytic development cycle. These findings suggest that artemisinin-resistant parasites remain in a state of decelerated development at the young ring stage, whereas their up-regulated UPR pathways mitigate protein damage caused by artemisinin. The expression profiles of UPR-related genes also associate with the geographical origin of parasite isolates, further suggesting their role in emerging artemisinin resistance in the Greater Mekong Subregion. PMID:25502316

  18. Priming of plant resistance by natural compounds. Hexanoic acid as a model

    PubMed Central

    Aranega-Bou, Paz; de la O Leyva, Maria; Finiti, Ivan; García-Agustín, Pilar; González-Bosch, Carmen

    2014-01-01

    Some alternative control strategies of currently emerging plant diseases are based on the use of resistance inducers. This review highlights the recent advances made in the characterization of natural compounds that induce resistance by a priming mechanism. These include vitamins, chitosans, oligogalacturonides, volatile organic compounds, azelaic and pipecolic acid, among others. Overall, other than providing novel disease control strategies that meet environmental regulations, natural priming agents are valuable tools to help unravel the complex mechanisms underlying the induced resistance (IR) phenomenon. The data presented in this review reflect the novel contributions made from studying these natural plant inducers, with special emphasis placed on hexanoic acid (Hx), proposed herein as a model tool for this research field. Hx is a potent natural priming agent of proven efficiency in a wide range of host plants and pathogens. It can early activate broad-spectrum defenses by inducing callose deposition and the salicylic acid (SA) and jasmonic acid (JA) pathways. Later it can prime pathogen-specific responses according to the pathogen’s lifestyle. Interestingly, Hx primes redox-related genes to produce an anti-oxidant protective effect, which might be critical for limiting the infection of necrotrophs. Our Hx-IR findings also strongly suggest that it is an attractive tool for the molecular characterization of the plant alarmed state, with the added advantage of it being a natural compound. PMID:25324848

  19. Resistant mechanisms and molecular epidemiology of imipenem-resistant Acinetobacter baumannii

    PubMed Central

    Xiao, Shu-Zhen; Chu, Hai-Qing; Han, Li-Zhong; Zhang, Zhe-Min; Li, Bing; Zhao, Lan; Xu, Liyun

    2016-01-01

    The aim of the study was to investigate the resistant mechanisms and homology of imipenem-resistant Acinetobacter baumannii (A. baumannii). A total of 46 non-duplicate imipenem-resistant A. baumannii clinical isolates were collected from three tertiary hospitals between July, 2011 and June, 2012. The minimal inhibitory concentrations (MICs) of antimicrobial agents were determined using the agar dilution method. Phenylalanine-arginine β-naphthylamide was used to detect the presence of the efflux pump-mediated resistant mechanism. Polymerase chain reaction was employed to amplify genes associated with drug resistance, including β-lactamase genes, efflux pump genes and outer membrane protein gene CarO. A few amplicons were randomly selected and sequenced. Multilocus sequence analysis (MLST) was employed in typing A. baumanni. A. baumannii was resistant to imipenem, simultaneously showing resistance to several other antimicrobials. In addition, 13 A. baumannii were found to mediate drug resistance through operation of the efflux pump. Of the various drug resistance genes tested, blaOXA-51 was present in 46 isolates, blaOXA-23 gene was present in 44 isolates and blaNDM gene was found in only one strain. Other drug resistant-associated genes, including blaKPC, blaIMP, blaOXA-24, blaOXA-58, blaSHV, blaGIM and blaVIM were not detected. Mutation of adeS and outer membrane protein gene CarO were found in a few of the imipenem-resistant isolates. The MLST analysis revealed that all 46 clinical isolates were clustered into 11 genotypes and the most frequent genotype was ST208. In conclusion, β-lactamase genes, genes involved in efflux pump and mutation of outer membrane protein encoding gene may be important in mediating imipenem resistance in A. baumannii. Of the 11 different genotypes, ST11 was shared by the majority of A. baumannii, which may be due to horizontal transfer of patients from hospitals. PMID:27485638

  20. Pathophysiological mechanisms of death resistance in colorectal carcinoma

    PubMed Central

    Huang, Ching-Ying; Yu, Linda Chia-Hui

    2015-01-01

    Colon cancers develop adaptive mechanisms to survive under extreme conditions and display hallmarks of unlimited proliferation and resistance to cell death. The deregulation of cell death is a key factor that contributes to chemoresistance in tumors. In a physiological context, balance between cell proliferation and death, and protection against cell damage are fundamental processes for maintaining gut epithelial homeostasis. The mechanisms underlying anti-death cytoprotection and tumor resistance often bear common pathways, and although distinguishing them would be a challenge, it would also provide an opportunity to develop advanced anti-cancer therapeutics. This review will outline cell death pathways (i.e., apoptosis, necrosis, and necroptosis), and discuss cytoprotective strategies in normal intestinal epithelium and death resistance mechanisms of colon tumor. In colorectal cancers, the intracellular mechanisms of death resistance include the direct alteration of apoptotic and necroptotic machinery and the upstream events modulating death effectors such as tumor suppressor gene inactivation and pro-survival signaling pathways. The autocrine, paracrine and exogenous factors within a tumor microenvironment can also instigate resistance against apoptotic and necroptotic cell death in colon cancers through changes in receptor signaling or transporter uptake. The roles of cyclooxygenase-2/prostaglandin E2, growth factors, glucose, and bacterial lipopolysaccharides in colorectal cancer will be highlighted. Targeting anti-death pathways in the colon cancer tissue might be a promising approach outside of anti-proliferation and anti-angiogenesis strategies for developing novel drugs to treat refractory tumors. PMID:26557002

  1. Aging mechanisms and service life of lead-acid batteries

    NASA Astrophysics Data System (ADS)

    Ruetschi, Paul

    In lead-acid batteries, major aging processes, leading to gradual loss of performance, and eventually to the end of service life, are: Anodic corrosion (of grids, plate-lugs, straps or posts). Positive active mass degradation and loss of adherence to the grid (shedding, sludging). Irreversible formation of lead sulfate in the active mass (crystallization, sulfation). Short-circuits. Loss of water. Aging mechanisms are often inter-dependent. For example, corrosion of the grids will lead to increased resistance to current flow, which will in turn impede proper charge of certain parts of the active mass, resulting in sulfation. Active mass degradation may lead to short-circuits. Sulfation may be the result of a loss of water, and so forth. The rates of the different aging processes strongly depend on the type of use (or misuse) of the battery. Over-charge will lead to accelerated corrosion and also to accelerated loss of water. With increasing depth-of-discharge during cycling, positive active mass degradation is accelerated. Some aging mechanisms are occurring only upon misuse. Short-circuits across the separators, due to the formation of metallic lead dendrites, for example, are usually formed only after (excessively) deep discharge. Stationary batteries, operated under float-charge conditions, will age typically by corrosion of the positive grids. On the other hand, service life of batteries subject to cycling regimes, will typically age by degradation of the structure of the positive active mass. Starter batteries are usually aging by grid corrosion, for instance in normal passenger car use. However, starter batteries of city buses, making frequent stops, may age (prematurely) by positive active mass degradation, because the batteries are subject to numerous shallow discharge cycles. Valve-regulated batteries often fail as a result of negative active mass sulfation, or water loss. For each battery design, and type of use, there is usually a characteristic

  2. Antibiotic resistance of lactic acid bacteria isolated from Chinese yogurts.

    PubMed

    Zhou, N; Zhang, J X; Fan, M T; Wang, J; Guo, G; Wei, X Y

    2012-09-01

    The aim of this study was to evaluate the susceptibility of 43 strains of lactic acid bacteria, isolated from Chinese yogurts made in different geographical areas, to 11 antibiotics (ampicillin, penicillin G, roxithromycin, chloramphenicol, tetracycline, chlortetracycline, lincomycin, kanamycin, streptomycin, neomycin, and gentamycin). The 43 isolates (18 Lactobacillus bulgaricus and 25 Streptococcus thermophilus) were identified at species level and were typed by random amplified polymorphic DNA analysis. Thirty-five genotypically different strains were detected and their antimicrobial resistance to 11 antibiotics was determined using the agar dilution method. Widespread resistance to ampicillin, chloramphenicol, chlortetracycline, tetracyclines, lincomycin, streptomycin, neomycin, and gentamycin was found among the 35 strains tested. All of the Strep. thermophilus strains tested were susceptible to penicillin G and roxithromycin, whereas 23.5 and 64.7% of Lb. bulgaricus strains, respectively, were resistant. All of the Strep. thermophilus and Lb. bulgaricus strains were found to be resistant to kanamycin. The presence of the corresponding resistance genes in the resistant isolates was investigated through PCR, with the following genes detected: tet(M) in 1 Lb. bulgaricus and 2 Strep. thermophilus isolates, ant(6) in 2 Lb. bulgaricus and 2 Strep. thermophilus isolates, and aph(3')-IIIa in 5 Lb. bulgaricus and 2 Strep. thermophilus isolates. The main threat associated with these bacteria is that they may transfer resistance genes to pathogenic bacteria, which has been a major cause of concern to human and animal health. To our knowledge, the aph(3')-IIIa and ant(6) genes were found in Lb. bulgaricus and Strep. thermophilus for the first time. Further investigations are required to analyze whether the genes identified in Lb. bulgaricus and Strep. thermophilus isolates might be horizontally transferred to other species.

  3. Mechanism of resistance of evolved glyphosate-resistant Palmer amaranth (Amaranthus palmeri).

    PubMed

    Gaines, Todd A; Shaner, Dale L; Ward, Sarah M; Leach, Jan E; Preston, Christopher; Westra, Philip

    2011-06-01

    Evolved glyphosate resistance in weedy species represents a challenge for the continued success and utility of glyphosate-resistant crops. Glyphosate functions by inhibiting the plant enzyme 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS). The resistance mechanism was determined in a population of glyphosate-resistant Palmer amaranth from Georgia (U.S.). Within this population, glyphosate resistance correlates with increases in (a) genomic copy number of EPSPS, (b) expression of the EPSPS transcript, (c) EPSPS protein level, and (d) EPSPS enzymatic activity. Dose response results from the resistant and an F(2) population suggest that between 30 and 50 EPSPS genomic copies are necessary to survive glyphosate rates between 0.5 and 1.0 kg ha(-1). These results further confirm the role of EPSPS gene amplification in conferring glyphosate resistance in this population of Palmer amaranth. Questions remain related to how the EPSPS amplification initially occurred and the occurrence of this mechanism in other Palmer amaranth populations and other glyphosate-resistant species.

  4. Overcoming ABC transporter-mediated multidrug resistance: Molecular mechanisms and novel therapeutic drug strategies.

    PubMed

    Li, Wen; Zhang, Han; Assaraf, Yehuda G; Zhao, Kun; Xu, Xiaojun; Xie, Jinbing; Yang, Dong-Hua; Chen, Zhe-Sheng

    2016-07-01

    Multidrug resistance is a key determinant of cancer chemotherapy failure. One of the major causes of multidrug resistance is the enhanced efflux of drugs by membrane ABC transporters. Targeting ABC transporters projects a promising approach to eliminating or suppressing drug resistance in cancer treatment. To reveal the functional mechanisms of ABC transporters in drug resistance, extensive studies have been conducted from identifying drug binding sites to elucidating structural dynamics. In this review article, we examined the recent crystal structures of ABC proteins to depict the functionally important structural elements, such as domains, conserved motifs, and critical amino acids that are involved in ATP-binding and drug efflux. We inspected the drug-binding sites on ABC proteins and the molecular mechanisms of various substrate interactions with the drug binding pocket. While our continuous battle against drug resistance is far from over, new approaches and technologies have emerged to push forward our frontier. Most recent developments in anti-MDR strategies include P-gp inhibitors, RNA-interference, nano-medicines, and delivering combination strategies. With the advent of the 'Omics' era - genomics, epigenomics, transcriptomics, proteomics, and metabolomics - these disciplines play an important role in fighting the battle against chemoresistance by further unraveling the molecular mechanisms of drug resistance and shed light on medical therapies that specifically target MDR. PMID:27449595

  5. Overcoming ABC transporter-mediated multidrug resistance: Molecular mechanisms and novel therapeutic drug strategies.

    PubMed

    Li, Wen; Zhang, Han; Assaraf, Yehuda G; Zhao, Kun; Xu, Xiaojun; Xie, Jinbing; Yang, Dong-Hua; Chen, Zhe-Sheng

    2016-07-01

    Multidrug resistance is a key determinant of cancer chemotherapy failure. One of the major causes of multidrug resistance is the enhanced efflux of drugs by membrane ABC transporters. Targeting ABC transporters projects a promising approach to eliminating or suppressing drug resistance in cancer treatment. To reveal the functional mechanisms of ABC transporters in drug resistance, extensive studies have been conducted from identifying drug binding sites to elucidating structural dynamics. In this review article, we examined the recent crystal structures of ABC proteins to depict the functionally important structural elements, such as domains, conserved motifs, and critical amino acids that are involved in ATP-binding and drug efflux. We inspected the drug-binding sites on ABC proteins and the molecular mechanisms of various substrate interactions with the drug binding pocket. While our continuous battle against drug resistance is far from over, new approaches and technologies have emerged to push forward our frontier. Most recent developments in anti-MDR strategies include P-gp inhibitors, RNA-interference, nano-medicines, and delivering combination strategies. With the advent of the 'Omics' era - genomics, epigenomics, transcriptomics, proteomics, and metabolomics - these disciplines play an important role in fighting the battle against chemoresistance by further unraveling the molecular mechanisms of drug resistance and shed light on medical therapies that specifically target MDR.

  6. Monitoring and identifying antibiotic resistance mechanisms in bacteria.

    PubMed

    Roe, M T; Pillai, S D

    2003-04-01

    Sub-therapeutic administration of antibiotics to animals is under intense scrutiny because they contribute to the dissemination of antibiotic-resistant bacteria into the food chain. Studies suggest that there is a link between the agricultural use of antibiotics and antibiotic-resistant human infections. Antibiotic-resistant organisms from animal and human wastes reenter the human and animal populations through a number of pathways including natural waters, irrigation water, drinking water, and vegetables and foods. Antibiotic usage in the United States for animal production (disease prevention and growth promotion) is estimated to be 18 million pounds annually. As much as 25 to 75% of the antibiotics administered to feedlot animals are excreted unaltered in feces. Because about 180 million dry tons of livestock and poultry waste is generated annually in the United States, it is not surprising that animal-derived antibiotic-resistant organisms are found contaminating groundwater, surface water, and food crops. It is extremely important to clearly understand the molecular mechanisms that could potentially cause lateral or horizontal gene transfer of antibiotic resistance genes among bacteria. Once the mechanisms and magnitude of resistance gene transfer are clearly understood and quantified, strategies can be instituted to reduce the potential for dissemination of these genes.

  7. Effect of mechanical surface and heat treatments on erosion resistance

    NASA Technical Reports Server (NTRS)

    Salik, J.; Buckley, D. H.

    1980-01-01

    The effects of mechanical surface treatments as well as heat treatments on the erosion resistance of 6061 aluminum alloy and 1045 steel were studied. Mechanical surface treatments were found to have little or no effect on the erosion resistance. This is due to the formation by particle impact of a work hardened surface layer regardless of the initial surface condition. The erosion resistance of Al single crystals is found to be independent of orientation. This is due to destruction of the surface microstructure and formation of a polycrystalline surface layer by the impact of erodant particles as observed by X-ray diffraction. While upon solution treatment of annealed 6061 aluminum the increase in hardness is accompanied by an increase in erosion resistance, precipitation treatment which causes a further increase in hardness results in slightly lower erosion resistance. Using two types of erodant particles, glass beads and crushed glass, the erosion rate is found to be strongly dependent on erodant particle shape, being an order of magnitude higher for erosion with crushed glass as compared to glass beads. While for erosion with glass beads heat treatment of 1045 steel had a profound effect on its erosion resistance, little or no such effect was observed for erosion with crushed glass.

  8. Resistive switching characteristics and mechanisms in silicon oxide memory devices

    NASA Astrophysics Data System (ADS)

    Chang, Yao-Feng; Fowler, Burt; Chen, Ying-Chen; Zhou, Fei; Wu, Xiaohan; Chen, Yen-Ting; Wang, Yanzhen; Xue, Fei; Lee, Jack C.

    2016-05-01

    Intrinsic unipolar SiOx-based resistance random access memories (ReRAM) characterization, switching mechanisms, and applications have been investigated. Device structures, material compositions, and electrical characteristics are identified that enable ReRAM cells with high ON/OFF ratio, low static power consumption, low switching power, and high readout-margin using complementary metal-oxide semiconductor transistor (CMOS)-compatible SiOx-based materials. These ideas are combined with the use of horizontal and vertical device structure designs, composition optimization, electrical control, and external factors to help understand resistive switching (RS) mechanisms. Measured temperature effects, pulse response, and carrier transport behaviors lead to compact models of RS mechanisms and energy band diagrams in order to aid the development of computer-aided design for ultralarge-v scale integration. This chapter presents a comprehensive investigation of SiOx-based RS characteristics and mechanisms for the post-CMOS device era.

  9. Use of Ekibastuzsk coal ash as a filler for acid resistant plaster

    SciTech Connect

    Korsakov, F.F.; Isichenko, I.I.; Kabanov, G.A.

    1981-01-01

    Acid resistant plasters are used extensively at thermal power plants for protection of gas conduits, ash traps with spouts and hydraulic valves, and the internal surfaces of smoke pump housings. The surface being protected is preliminarily cleaned and a No. 16-20 steel grid attached to the surface by electrial welding. In producing the acid resistant plaster, 14-17 parts by weight of sodium silicofluoride are added to 100 parts by weight of sodium water glass; the remainder consists of andesite or diabase meal to the required consistency. The water glass fulfills the role of a binder; the sodium silicofluoride accelerates solidification of the water glass and the andesite and diabase meal serve as fillers. We found, tested in the laboratory and used successfully (under experimental-industrial conditions) a substitute for andesite and diabase meal. This substitute was ash of Ekibastuzsk coal, which was not only comparable to the meal in regard to quality of the acid resistant plaster, but even exceeded andesite and diabase meal in regard to several qualitative indicators. At the present time, a formula is being developed for an acid resistant plaster produced on the basis of water glass, sodium silicofluoride and ash of Ekibastuzsk coal. In order to verify the possibility of using other ashes instead of andesite and diabase meal, we also tested, under laboratory conditions, acid resistant plasters using ash from thermal power plants (TPP's) also burning Karagandinsk, Kuuchekinsk, Kuznetsk and Kansko-Achinsk coals. In compositions produced with polymer binders, Kansko-Achinsk coal ash was one of the best fillers, providing the most favorable physico-mechanical properties of the composition.

  10. Production of amino acids by analog-resistant mutants of the cyanobacterium Spirulina platensis.

    PubMed Central

    Riccardi, G; Sora, S; Ciferri, O

    1981-01-01

    Mutants of Spirulina platensis resistant to 5-fluorotryptophan, beta-3-thienyl-alanine, ethionine, p-fluorophenylalanine, or azetidine-2-carboxylic acid were isolated. Some of these mutants appeared to be resistant to more than one analog and to overproduce the corresponding amino acids. A second group was composed of mutants that were resistant to one analog only. Of the latter mutants, one resistant to azetidine-2-carboxylic acid was found to overproduce proline only, whereas one resistant to fluorotryptophan and one resistant to ethionine did not overproduce any of the tested amino acids. PMID:6792182

  11. Tumor resistance to vascular disrupting agents: mechanisms, imaging, and solutions

    PubMed Central

    Liang, Wenjie; Ni, Yicheng; Chen, Feng

    2016-01-01

    The emergence of vascular disrupting agents (VDAs) is a significant advance in the treatment of solid tumors. VDAs induce rapid and selective shutdown of tumor blood flow resulting in massive necrosis. However, a viable marginal tumor rim always remains after VDA treatment and is a major cause of recurrence. In this review, we discuss the mechanisms involved in the resistance of solid tumors to VDAs. Hypoxia, tumor-associated macrophages, and bone marrow-derived circulating endothelial progenitor cells all may contribute to resistance. Resistance can be monitored using magnetic resonance imaging markers. The various solutions proposed to manage tumor resistance to VDAs emphasize combining these agents with other approaches including antiangiogenic agents, chemotherapy, radiotherapy, radioimmunotherapy, and sequential dual-targeting internal radiotherapy. PMID:26812886

  12. Effect of mechanical surface and heat treatments on erosion resistance

    NASA Technical Reports Server (NTRS)

    Salik, J.; Buckley, D. H.

    1981-01-01

    The effect of erosion by glass beads and crushed glass and by heat treatments on the erosional resistance of 6061 aluminum alloy and 1045 steel were studied. The aluminum alloy's erosion resistance was found to be insensitive to mechanical surface treatment applied before testing, and was determined to depend on the properties of the work-hardened surface layer; this was also demonstrated for aluminum alloy single crystals. The aluminum alloy heat treatments included annealing, solution, and precipitation. Solution was found to increase erosion resistance but precipitation had the opposite effect. Hardness showed no correlation with erosion resistance for either aluminum alloy steel. The steel tests showed that crushed glass provides an order of magnitude more erosion than glass beads.

  13. Antifungal drug resistance among Candida species: mechanisms and clinical impact.

    PubMed

    Sanguinetti, Maurizio; Posteraro, Brunella; Lass-Flörl, Cornelia

    2015-06-01

    The epidemiology of Candida infections has changed in recent years. Although Candida albicans is still the main cause of invasive candidiasis in most clinical settings, a substantial proportion of patients is now infected with non-albicans Candida species. The various Candida species vary in their susceptibility to the most commonly used antifungal agents, and the intrinsic resistance to antifungal therapy seen in some species, along with the development of acquired resistance during treatment in others, is becoming a major problem in the management of Candida infection. A better understanding of the mechanisms and clinical impact of antifungal drug resistance is essential for the efficient treatment of patients with Candida infection and for improving treatment outcomes. Herein, we report resistance to the azoles and echinocandins among Candida species.

  14. Mechanisms of Linezolid Resistance among Staphylococci in a Tertiary Hospital

    PubMed Central

    Quiles-Melero, Inmaculada; Gómez-Gil, Rosa; Romero-Gómez, María Pilar; Sánchez-Díaz, Ana María; de Pablos, Manuela; García-Rodriguez, Julio; Gutiérrez, Avelino

    2013-01-01

    The mechanisms of linezolid resistance among 86 staphylococcal isolates from two intensive care units were investigated. The most frequent was the G2576T mutation in the 23S rRNA (82%). The cfr gene was found in 17% of the isolates, seven S. aureus and eight S. epidermidis isolates. Four of the S. epidermidis isolates had the G2576T mutation and the cfr gene. In four S. haemolyticus isolates, the mechanism could not be identified. PMID:23269737

  15. Polyoxometalate ionic liquids as self-repairing acid-resistant corrosion protection.

    PubMed

    Herrmann, Sven; Kostrzewa, Monika; Wierschem, Andreas; Streb, Carsten

    2014-12-01

    Corrosion is a global problem for any metallic structure or material. Herein we show how metals can easily be protected against acid corrosion using hydrophobic polyoxometalate-based ionic liquids (POM-ILs). Copper metal disks were coated with room-temperature POM-ILs composed of transition-metal functionalized Keggin anions [SiW11 O39 TM(H2 O)](n-) (TM=Cu(II) , Fe(III) ) and quaternary alkylammonium cations (Cn H2 n+1 )4 N(+) (n=7-8). The corrosion resistance against acetic acid vapors and simulated "acid rain" was significantly improved compared with commercial ionic liquids or solid polyoxometalate coatings. Mechanical damage to the POM-IL coating is self-repaired in less than one minute with full retention of the acid protection properties. The coating can easily be removed and recovered by rinsing with organic solvents.

  16. Pipecolic acid enhances resistance to bacterial infection and primes salicylic acid and nicotine accumulation in tobacco.

    PubMed

    Vogel-Adghough, Drissia; Stahl, Elia; Návarová, Hana; Zeier, Juergen

    2013-11-01

    Distinct amino acid metabolic pathways constitute integral parts of the plant immune system. We have recently identified pipecolic acid (Pip), a lysine-derived non-protein amino acid, as a critical regulator of systemic acquired resistance (SAR) and basal immunity to bacterial infection in Arabidopsis thaliana. In Arabidopsis, Pip acts as an endogenous mediator of defense amplification and priming. For instance, Pip conditions plants for effective biosynthesis of the phenolic defense signal salicylic acid (SA), accumulation of the phytoalexin camalexin, and expression of defense-related genes. Here, we show that tobacco plants respond to leaf infection by the compatible bacterial pathogen Pseudomonas syringae pv tabaci (Pstb) with a significant accumulation of several amino acids, including Lys, branched-chain, aromatic, and amide group amino acids. Moreover, Pstb strongly triggers, alongside the biosynthesis of SA and increases in the defensive alkaloid nicotine, the production of the Lys catabolites Pip and α-aminoadipic acid. Exogenous application of Pip to tobacco plants provides significant protection to infection by adapted Pstb or by non-adapted, hypersensitive cell death-inducing P. syringae pv maculicola. Pip thereby primes tobacco for rapid and strong accumulation of SA and nicotine following bacterial infection. Thus, our study indicates that the role of Pip as an amplifier of immune responses is conserved between members of the rosid and asterid groups of eudicot plants and suggests a broad practical applicability for Pip as a natural enhancer of plant disease resistance.

  17. Mechanisms of resistance to HER2 target therapy.

    PubMed

    Tortora, Giampaolo

    2011-01-01

    In the past years, several agents targeting signaling proteins critical for breast cancer growth and dissemination entered clinical evaluation. They include drugs directed against the HER/ErbB family of receptor tyrosine kinases, especially HER2; several downstream signal transducers; and proteins involved in tumor angiogenesis and dissemination. Unfortunately, resistance to targeted agents is a quite common feature, and understanding of the molecular mechanisms predicting response or failure has become a crucial issue to optimize treatment and select patients who are the best candidates to respond. The neoadjuvant setting offers unique opportunities allowing tumor sampling and search for molecular determinants of response. A variety of tumor and host factors may account for the onset of resistance. Major progress has been made in the understanding of the mechanisms involved in the primary and acquired resistance to targeted agents, especially the anti-HER2 drugs, which play a pivotal role in the weaponry against breast cancer.

  18. Mechanisms of Drug Resistance in Relapse and Refractory Multiple Myeloma

    PubMed Central

    Yang, Wen-Chi; Lin, Sheng-Fung

    2015-01-01

    Multiple myeloma (MM) is a hematological malignancy that remains incurable because most patients eventually relapse or become refractory to current treatments. Although the treatments have improved, the major problem in MM is resistance to therapy. Clonal evolution of MM cells and bone marrow microenvironment changes contribute to drug resistance. Some mechanisms affect both MM cells and microenvironment, including the up- and downregulation of microRNAs and programmed death factor 1 (PD-1)/PD-L1 interaction. Here, we review the pathogenesis of MM cells and bone marrow microenvironment and highlight possible drug resistance mechanisms. We also review a potential molecular targeting treatment and immunotherapy for patients with refractory or relapse MM. PMID:26649299

  19. Mechanisms of resistance to EGFR tyrosine kinase inhibitors.

    PubMed

    Huang, Lihua; Fu, Liwu

    2015-09-01

    Since the discovery that non-small cell lung cancer (NSCLC) is driven by epidermal growth factor receptor (EGFR) mutations, the EGFR tyrosine kinase inhibitors (EGFR-TKIs, e.g., gefitinib and elrotinib) have been effectively used for clinical treatment. However, patients eventually develop drug resistance. Resistance to EGFR-TKIs is inevitable due to various mechanisms, such as the secondary mutation (T790M), activation of alternative pathways (c-Met, HGF, AXL), aberrance of the downstream pathways (K-RAS mutations, loss of PTEN), impairment of the EGFR-TKIs-mediated apoptosis pathway (BCL2-like 11/BIM deletion polymorphism), histologic transformation, ATP binding cassette (ABC) transporter effusion, etc. Here we review and summarize the known resistant mechanisms to EGFR-TKIs and provide potential targets for development of new therapeutic strategies.

  20. Mechanisms and consequences of bacterial resistance to antimicrobial peptides.

    PubMed

    Andersson, D I; Hughes, D; Kubicek-Sutherland, J Z

    2016-05-01

    Cationic antimicrobial peptides (AMPs) are an intrinsic part of the human innate immune system. Over 100 different human AMPs are known to exhibit broad-spectrum antibacterial activity. Because of the increased frequency of resistance to conventional antibiotics there is an interest in developing AMPs as an alternative antibacterial therapy. Several cationic peptides that are derivatives of AMPs from the human innate immune system are currently in clinical development. There are also ongoing clinical studies aimed at modulating the expression of AMPs to boost the human innate immune response. In this review we discuss the potential problems associated with these therapeutic approaches. There is considerable experimental data describing mechanisms by which bacteria can develop resistance to AMPs. As for any type of drug resistance, the rate by which AMP resistance would emerge and spread in a population of bacteria in a natural setting will be determined by a complex interplay of several different factors, including the mutation supply rate, the fitness of the resistant mutant at different AMP concentrations, and the strength of the selective pressure. Several studies have already shown that AMP-resistant bacterial mutants display broad cross-resistance to a variety of AMPs with different structures and modes of action. Therefore, routine clinical administration of AMPs to treat bacterial infections may select for resistant bacterial pathogens capable of better evading the innate immune system. The ramifications of therapeutic levels of exposure on the development of AMP resistance and bacterial pathogenesis are not yet understood. This is something that needs to be carefully studied and monitored if AMPs are used in clinical settings. PMID:27180309

  1. Mechanisms and consequences of bacterial resistance to antimicrobial peptides.

    PubMed

    Andersson, D I; Hughes, D; Kubicek-Sutherland, J Z

    2016-05-01

    Cationic antimicrobial peptides (AMPs) are an intrinsic part of the human innate immune system. Over 100 different human AMPs are known to exhibit broad-spectrum antibacterial activity. Because of the increased frequency of resistance to conventional antibiotics there is an interest in developing AMPs as an alternative antibacterial therapy. Several cationic peptides that are derivatives of AMPs from the human innate immune system are currently in clinical development. There are also ongoing clinical studies aimed at modulating the expression of AMPs to boost the human innate immune response. In this review we discuss the potential problems associated with these therapeutic approaches. There is considerable experimental data describing mechanisms by which bacteria can develop resistance to AMPs. As for any type of drug resistance, the rate by which AMP resistance would emerge and spread in a population of bacteria in a natural setting will be determined by a complex interplay of several different factors, including the mutation supply rate, the fitness of the resistant mutant at different AMP concentrations, and the strength of the selective pressure. Several studies have already shown that AMP-resistant bacterial mutants display broad cross-resistance to a variety of AMPs with different structures and modes of action. Therefore, routine clinical administration of AMPs to treat bacterial infections may select for resistant bacterial pathogens capable of better evading the innate immune system. The ramifications of therapeutic levels of exposure on the development of AMP resistance and bacterial pathogenesis are not yet understood. This is something that needs to be carefully studied and monitored if AMPs are used in clinical settings.

  2. Precision microbiome restoration of bile acid-mediated resistance to Clostridium difficile

    PubMed Central

    Buffie, Charlie G.; Bucci, Vanni; Stein, Richard R.; McKenney, Peter T.; Ling, Lilan; Gobourne, Asia; No, Daniel; Liu, Hui; Kinnebrew, Melissa; Viale, Agnes; Littmann, Eric; van den Brink, Marcel R. M.; Jenq, Robert R.; Taur, Ying; Sander, Chris; Cross, Justin; Toussaint, Nora C.; Xavier, Joao B.; Pamer, Eric G.

    2015-01-01

    The gastrointestinal tracts of mammals are colonized by hundreds of microbial species that contribute to health, including colonization resistance against intestinal pathogens1. Many antibiotics destroy intestinal microbial communities and increase susceptibility to intestinal pathogens2. Among these, Clostridium difficile, a major cause of antibiotic-induced diarrhea, greatly increases morbidity and mortality in hospitalized patients3. Which intestinal bacteria provide resistance to C. difficile infection and their in vivo inhibitory mechanisms remain unclear. By treating mice with different antibiotics that result in distinct microbiota changes and lead to varied susceptibility to C. difficile, we correlated loss of specific bacterial taxa with development of infection. Mathematical modeling augmented by microbiota analyses of hospitalized patients identified resistance-associated bacteria common to mice and humans. Using these platforms, we determined that Clostridium scindens, a bile acid 7-dehydroxylating intestinal bacterium, is associated with resistance to C. difficile infection and, upon administration, enhances resistance to infection in a secondary bile acid-dependent fashion. Using a workflow involving mouse models, clinical studies, metagenomic analyses and mathematical modeling, we identified a probiotic candidate that corrects a clinically relevant microbiome deficiency. These findings have implications for rational design of targeted antimicrobials as well as microbiome-based diagnostics and therapeutics for individuals at risk for C. difficile infection. PMID:25337874

  3. Precision microbiome reconstitution restores bile acid mediated resistance to Clostridium difficile.

    PubMed

    Buffie, Charlie G; Bucci, Vanni; Stein, Richard R; McKenney, Peter T; Ling, Lilan; Gobourne, Asia; No, Daniel; Liu, Hui; Kinnebrew, Melissa; Viale, Agnes; Littmann, Eric; van den Brink, Marcel R M; Jenq, Robert R; Taur, Ying; Sander, Chris; Cross, Justin R; Toussaint, Nora C; Xavier, Joao B; Pamer, Eric G

    2015-01-01

    The gastrointestinal tracts of mammals are colonized by hundreds of microbial species that contribute to health, including colonization resistance against intestinal pathogens. Many antibiotics destroy intestinal microbial communities and increase susceptibility to intestinal pathogens. Among these, Clostridium difficile, a major cause of antibiotic-induced diarrhoea, greatly increases morbidity and mortality in hospitalized patients. Which intestinal bacteria provide resistance to C. difficile infection and their in vivo inhibitory mechanisms remain unclear. Here we correlate loss of specific bacterial taxa with development of infection, by treating mice with different antibiotics that result in distinct microbiota changes and lead to varied susceptibility to C. difficile. Mathematical modelling augmented by analyses of the microbiota of hospitalized patients identifies resistance-associated bacteria common to mice and humans. Using these platforms, we determine that Clostridium scindens, a bile acid 7α-dehydroxylating intestinal bacterium, is associated with resistance to C. difficile infection and, upon administration, enhances resistance to infection in a secondary bile acid dependent fashion. Using a workflow involving mouse models, clinical studies, metagenomic analyses, and mathematical modelling, we identify a probiotic candidate that corrects a clinically relevant microbiome deficiency. These findings have implications for the rational design of targeted antimicrobials as well as microbiome-based diagnostics and therapeutics for individuals at risk of C. difficile infection.

  4. Precision microbiome reconstitution restores bile acid mediated resistance to Clostridium difficile

    NASA Astrophysics Data System (ADS)

    Buffie, Charlie G.; Bucci, Vanni; Stein, Richard R.; McKenney, Peter T.; Ling, Lilan; Gobourne, Asia; No, Daniel; Liu, Hui; Kinnebrew, Melissa; Viale, Agnes; Littmann, Eric; van den Brink, Marcel R. M.; Jenq, Robert R.; Taur, Ying; Sander, Chris; Cross, Justin R.; Toussaint, Nora C.; Xavier, Joao B.; Pamer, Eric G.

    2015-01-01

    The gastrointestinal tracts of mammals are colonized by hundreds of microbial species that contribute to health, including colonization resistance against intestinal pathogens. Many antibiotics destroy intestinal microbial communities and increase susceptibility to intestinal pathogens. Among these, Clostridium difficile, a major cause of antibiotic-induced diarrhoea, greatly increases morbidity and mortality in hospitalized patients. Which intestinal bacteria provide resistance to C. difficile infection and their in vivo inhibitory mechanisms remain unclear. Here we correlate loss of specific bacterial taxa with development of infection, by treating mice with different antibiotics that result in distinct microbiota changes and lead to varied susceptibility to C. difficile. Mathematical modelling augmented by analyses of the microbiota of hospitalized patients identifies resistance-associated bacteria common to mice and humans. Using these platforms, we determine that Clostridium scindens, a bile acid 7α-dehydroxylating intestinal bacterium, is associated with resistance to C. difficile infection and, upon administration, enhances resistance to infection in a secondary bile acid dependent fashion. Using a workflow involving mouse models, clinical studies, metagenomic analyses, and mathematical modelling, we identify a probiotic candidate that corrects a clinically relevant microbiome deficiency. These findings have implications for the rational design of targeted antimicrobials as well as microbiome-based diagnostics and therapeutics for individuals at risk of C. difficile infection.

  5. Antibacterial-Resistant Pseudomonas aeruginosa: Clinical Impact and Complex Regulation of Chromosomally Encoded Resistance Mechanisms

    PubMed Central

    Lister, Philip D.; Wolter, Daniel J.; Hanson, Nancy D.

    2009-01-01

    Summary: Treatment of infectious diseases becomes more challenging with each passing year. This is especially true for infections caused by the opportunistic pathogen Pseudomonas aeruginosa, with its ability to rapidly develop resistance to multiple classes of antibiotics. Although the import of resistance mechanisms on mobile genetic elements is always a concern, the most difficult challenge we face with P. aeruginosa is its ability to rapidly develop resistance during the course of treating an infection. The chromosomally encoded AmpC cephalosporinase, the outer membrane porin OprD, and the multidrug efflux pumps are particularly relevant to this therapeutic challenge. The discussion presented in this review highlights the clinical significance of these chromosomally encoded resistance mechanisms, as well as the complex mechanisms/pathways by which P. aeruginosa regulates their expression. Although a great deal of knowledge has been gained toward understanding the regulation of AmpC, OprD, and efflux pumps in P. aeruginosa, it is clear that we have much to learn about how this resourceful pathogen coregulates different resistance mechanisms to overcome the antibacterial challenges it faces. PMID:19822890

  6. Contribution of mdr1b-type P-glycoprotein to okadaic acid resistance in rat pituitary GH3 cells.

    PubMed

    Ritz, V; Marwitz, J; Sieder, S; Ziemann, C; Hirsch-Ernst, K I; Quentin, I; Steinfelder, H J

    1999-08-01

    Okadaic acid as well as other, structurally different, inhibitors of serine/threonine phosphatases 1 and 2A induce apoptosis in pituitary GH3 cells. Incubation with stepwise raised concentrations of okadaic acid resulted in the isolation of cells that were increasingly less sensitive to the cytotoxic effect of this agent. After about 18 months cells were selected that survived at 300 nM okadaic acid, which is about 30 times the initially lethal concentration. This study revealed that a major pharmacokinetic mechanism underlying cell survival was the development of a P-glycoprotein-mediated multidrug resistance (MDR) phenotype. The increase in mRNA levels of the mdr1b P-glycoprotein isoform correlated with the extent of drug resistance. Functional assays revealed that increasing drug resistance was paralleled by a decreased accumulation of rhodamine 123, a fluorescent dye which is a substrate of mdr1-mediated efflux activity. Resistance could be abolished by structurally different chemosensitizers of P-glycoprotein function like verapamil and reserpine but not by the leukotriene receptor antagonist MK571 which is a modulator of the multidrug resistance-associated protein (MRP). Okadaic acid resistance included cross-resistance to other cytotoxic agents that are substrates of mdr1-type P-glycoproteins, like doxorubicin and actinomycin D, but not to non-substrates of mdr1, e.g. cytosine arabinoside. Thus, functional as well as biochemical features support the conclusion that okadaic acid is a substrate of the mdr1-mediated efflux activity in rat pituitary GH3 cells. Maintenance of resistance after withdrawal of okadaic acid as well as metaphase spreads of 100 nM okadaic acid-resistant cells suggested a stable MDR genotype without indications for the occurrence of extrachromosomal amplifications, e.g. double minute chromosomes.

  7. Jasmonic acid involves in grape fruit ripening and resistant against Botrytis cinerea.

    PubMed

    Jia, Haifeng; Zhang, Cheng; Pervaiz, Tariq; Zhao, Pengcheng; Liu, Zhongjie; Wang, Baoju; Wang, Chen; Zhang, Lin; Fang, Jinggui; Qian, Jianpu

    2016-01-01

    Fruit ripening is a complex process that is regulated by a signal network. Whereas the regulatory mechanism of abscisic acid has been studied extensively in non-climacteric fruit, little is know about other signaling pathways involved in this process. In this study, we performed that plant hormone jasmonic acid plays an important role in grape fruit coloring and softening by increasing the transcription levels of several ripening-related genes, such as the color-related genes PAL1, DFR, CHI, F3H, GST, CHS, and UFGT; softening-related genes PG, PL, PE, Cell, EG1, and XTH1; and aroma-related genes Ecar, QR, and EGS. Lastly, the fruit anthocyanin, phenol, aroma, and cell wall materials were changed. Jasmonic acid positively regulated its biosynthesis pathway genes LOS, AOS, and 12-oxophytodienoate reductase (OPR) and signal pathway genes COI1 and JMT. RNA interference of grape jasmonic acid pathway gene VvAOS in strawberry fruit appeared fruit un-coloring phenotypes; exogenous jasmonic acid rescued this phenotypes. On the contrary, overexpression of grape jasmonic acid receptor VvCOI1 in the strawberry fruit accelerated the fruit-ripening process and induced some plant defense-related gene expression level. Furthermore, jasmonic acid treatment or strong jasmonic acid signal pathway in strawberry fruit make the fruit resistance against Botrytis cinerea. PMID:26498957

  8. Jasmonic acid involves in grape fruit ripening and resistant against Botrytis cinerea.

    PubMed

    Jia, Haifeng; Zhang, Cheng; Pervaiz, Tariq; Zhao, Pengcheng; Liu, Zhongjie; Wang, Baoju; Wang, Chen; Zhang, Lin; Fang, Jinggui; Qian, Jianpu

    2016-01-01

    Fruit ripening is a complex process that is regulated by a signal network. Whereas the regulatory mechanism of abscisic acid has been studied extensively in non-climacteric fruit, little is know about other signaling pathways involved in this process. In this study, we performed that plant hormone jasmonic acid plays an important role in grape fruit coloring and softening by increasing the transcription levels of several ripening-related genes, such as the color-related genes PAL1, DFR, CHI, F3H, GST, CHS, and UFGT; softening-related genes PG, PL, PE, Cell, EG1, and XTH1; and aroma-related genes Ecar, QR, and EGS. Lastly, the fruit anthocyanin, phenol, aroma, and cell wall materials were changed. Jasmonic acid positively regulated its biosynthesis pathway genes LOS, AOS, and 12-oxophytodienoate reductase (OPR) and signal pathway genes COI1 and JMT. RNA interference of grape jasmonic acid pathway gene VvAOS in strawberry fruit appeared fruit un-coloring phenotypes; exogenous jasmonic acid rescued this phenotypes. On the contrary, overexpression of grape jasmonic acid receptor VvCOI1 in the strawberry fruit accelerated the fruit-ripening process and induced some plant defense-related gene expression level. Furthermore, jasmonic acid treatment or strong jasmonic acid signal pathway in strawberry fruit make the fruit resistance against Botrytis cinerea.

  9. Molecular mechanism of resistance of Fusarium fujikuroi to benzimidazole fungicides.

    PubMed

    Chen, Zihao; Gao, Tao; Liang, Shuping; Liu, Kexue; Zhou, Mingguo; Chen, Changjun

    2014-08-01

    Although carbendazim (MBC) and other benzimidazole fungicides have effectively controlled bakanae disease of rice (which is caused by Fusarium fujikuroi, F. proliferatum, and F. verticillioides) in the past, MBC resistance has become common. Previous research has shown that MBC resistance results from a mutation in the β1 -tubulin (β1 tub) gene in F. verticillioides. However, MBC resistance in F. fujikuroi, a predominant species in China, does not result from a mutation in the β1 tub. The molecular mechanism of F. fujikuroi resistance against benzimidazole fungicides is poorly understood. In this study, we determined that although β1 tub and β2 -tubulin (β2 tub) in F. fujikuroi have high homology with β1 tub and β2 tub in F. verticillioides, MBC resistance in F. fujikuroi results from mutations in β2 tub [GAG(Glu)→GTG(Val) at codon 198, TTC(Phe)→TAC(Tyr) at codon 200, and GGC(Gly)→GGT(Gly) at codon 235] but not in β1 tub. Δβ2 tub (β2 tub deletion) mutants were highly sensitive to MBC, produced fewer conidia and were less virulent than parental strains. Complementation of the Δβ2 tub mutants with a copy of the whole β2 tub locus from their parental strains restored the level of MBC resistance (or sensitivity) to that of the parental strain.

  10. MIG1 Regulates Resistance of Candida albicans against the Fungistatic Effect of Weak Organic Acids.

    PubMed

    Cottier, Fabien; Tan, Alrina Shin Min; Xu, Xiaoli; Wang, Yue; Pavelka, Norman

    2015-10-01

    Candida albicans is the leading cause of fungal infections; but it is also a member of the human microbiome, an ecosystem of thousands of microbial species potentially influencing the outcome of host-fungal interactions. Accordingly, antibacterial therapy raises the risk of candidiasis, yet the underlying mechanism is currently not fully understood. We hypothesize the existence of bacterial metabolites that normally control C. albicans growth and of fungal resistance mechanisms against these metabolites. Among the most abundant microbiota-derived metabolites found on human mucosal surfaces are weak organic acids (WOAs), such as acetic, propionic, butyric, and lactic acid. Here, we used quantitative growth assays to investigate the dose-dependent fungistatic properties of WOAs on C. albicans growth and found inhibition of growth to occur at physiologically relevant concentrations and pH values. This effect was conserved across distantly related fungal species both inside and outside the CTG clade. We next screened a library of transcription factor mutants and identified several genes required for the resistance of C. albicans to one or more WOAs. A single gene, MIG1, previously known for its role in glucose repression, conferred resistance against all four acids tested. Consistent with glucose being an upstream activator of Mig1p, the presence of this carbon source was required for WOA resistance in wild-type C. albicans. Conversely, a MIG1-complemented strain completely restored the glucose-dependent resistance against WOAs. We conclude that Mig1p plays a central role in orchestrating a transcriptional program to fight against the fungistatic effect of this class of highly abundant metabolites produced by the gastrointestinal tract microbiota. PMID:26297702

  11. The Landscape of Pancreatic Cancer Therapeutic Resistance Mechanisms.

    PubMed

    Chand, Saswati; O'Hayer, Kevin; Blanco, Fernando F; Winter, Jordan M; Brody, Jonathan R

    2016-01-01

    Pancreatic cancer (pancreatic ductal adenocarcinoma, PDA) is infamously moving to the top of the list as one of the most lethal cancers with an overall 5 year survival rate of 7%. Multiple genomic-based and molecular characterization studies of PDA specimens and established animal models have provided the field with multiple targets and a progression model of this disease. Still, to date, the best therapeutic options are surgery and combination cytotoxic therapies. In general, even in the best case scenario (i.e., an early stage diagnosis and a response to a specific therapy), most of these fortunate patients' PDA cells acquire or exert resistance mechanisms and eventually kill the patient. Herein, we touch on a growing field of investigation that focuses on PDA cell therapeutic resistance mechanisms. We examine extrinsic elements (i.e., the tumor microenvironment, hypoxia) to the intrinsic processes within the cell (i.e., post-transcriptional gene regulation and somatic mutations) that are important for therapeutic efficacy and resistance. Even as better targeted and personalized approaches move through the clinical trial pipeline the discussed resistance mechanisms will most likely play a role in the management of this deadly disease.

  12. The Landscape of Pancreatic Cancer Therapeutic Resistance Mechanisms

    PubMed Central

    Chand, Saswati; O'Hayer, Kevin; Blanco, Fernando F.; Winter, Jordan M.; Brody, Jonathan R.

    2016-01-01

    Pancreatic cancer (pancreatic ductal adenocarcinoma, PDA) is infamously moving to the top of the list as one of the most lethal cancers with an overall 5 year survival rate of 7%. Multiple genomic-based and molecular characterization studies of PDA specimens and established animal models have provided the field with multiple targets and a progression model of this disease. Still, to date, the best therapeutic options are surgery and combination cytotoxic therapies. In general, even in the best case scenario (i.e., an early stage diagnosis and a response to a specific therapy), most of these fortunate patients' PDA cells acquire or exert resistance mechanisms and eventually kill the patient. Herein, we touch on a growing field of investigation that focuses on PDA cell therapeutic resistance mechanisms. We examine extrinsic elements (i.e., the tumor microenvironment, hypoxia) to the intrinsic processes within the cell (i.e., post-transcriptional gene regulation and somatic mutations) that are important for therapeutic efficacy and resistance. Even as better targeted and personalized approaches move through the clinical trial pipeline the discussed resistance mechanisms will most likely play a role in the management of this deadly disease. PMID:26929734

  13. Glycation & Insulin Resistance: Novel Mechanisms and Unique Targets?

    PubMed Central

    Song, Fei; Schmidt, Ann Marie

    2012-01-01

    Objectives Multiple biochemical, metabolic and signal transduction pathways contribute to insulin resistance. In this review, we present the evidence that the post-translational process of protein glycation may play role in insulin resistance. The post-translational modifications, the advanced glycation endproducts (AGEs), are formed and accumulate by endogenous and exogenous mechanisms. Methods and Results AGEs may contribute to insulin resistance by a variety of mechanisms, including generation of tumor necrosis factor-alpha, direct modification of the insulin molecule thereby leading to its impaired action, generation of oxidative stress, and impairment of mitochondrial function, as examples. AGEs may stimulate signal transduction via engagement of cellular receptors, such as RAGE, or receptor for AGE. AGE-RAGE interaction perpetuates AGE formation and cellular stress via induction of inflammation, oxidative stress and reduction in the expression and activity of the enzyme, glyoxalase I that detoxifies the AGE precursor, methylglyoxal, or MG. Conclusions Once set in motion, glycation-promoting mechanisms may stimulate ongoing AGE production and target tissue stresses that reduce insulin responsiveness. Strategies to limit AGE accumulation and action may contribute to prevention of insulin resistance and its consequences. PMID:22815341

  14. Recognition of mechanisms involved in bile resistance important to halting antimicrobial resistance in nontyphoidal Salmonella.

    PubMed

    Tsai, Ming-Han; Wu, Sih-Ru; Lee, Hao-Yuan; Chen, Chyi-Liang; Lin, Tzou-Yien; Huang, Yhu-Chering; Chiu, Cheng-Hsun

    2012-08-01

    Increasing antimicrobial resistance in nontyphoidal Salmonella (NTS) is a global public health problem that complicates antimicrobial therapy. As an enteric pathogen, Salmonella must endure the presence of bile in the intestinal tract during the course of infection. In this study, we sought to identify Salmonella genes necessary for bile resistance and to investigate their association with antimicrobial resistance. Four genes related to bile resistance were identified, namely rfaP, rfbK, dam and tolC. The first three genes are involved in lipopolysaccharide synthesis, and tolC is associated with an efflux pump. Antimicrobial susceptibility testing showed increased susceptibility to polymyxin B and ciprofloxacin in rfaP and tolC mutants of Salmonella, respectively. Genetic analysis of 45 clinical isolates of NTS revealed that all isolates with reduced susceptibility to fluoroquinolones (minimum inhibitory concentration ≥0.125 mg/L) were associated with point mutations in the quinolone resistance-determining regions of the gyrA and parC genes. The efflux pump also played a role, as evidenced by the reduction in fluoroquinolone resistance when the TolC efflux pump was inhibited by Phe-Arg-β-naphthylamide, a competitive efflux pump inhibitor. Based on these results, we conclude that an intact membrane structure and the efflux pump system provide mechanisms enabling NTS to resist bile. Caution should be taken when using ciprofloxacin and polymyxin B to treat Salmonella enteric infection, as resistance to these agents involves the same mechanisms. Addition of an efflux pump inhibitor to fluoroquinolones may be an effective strategy to deal with the increasing resistance in NTS.

  15. Abscisic acid perception and signaling: structural mechanisms and applications

    PubMed Central

    Ng, Ley Moy; Melcher, Karsten; Teh, Bin Tean; Xu, H Eric

    2014-01-01

    Adverse environmental conditions are a threat to agricultural yield and therefore exert a global effect on livelihood, health and the economy. Abscisic acid (ABA) is a vital plant hormone that regulates abiotic stress tolerance, thereby allowing plants to cope with environmental stresses. Previously, attempts to develop a complete understanding of the mechanisms underlying ABA signaling have been hindered by difficulties in the identification of bona fide ABA receptors. The discovery of the PYR/PYL/RCAR family of ABA receptors therefore represented a major milestone in the effort to overcome these roadblocks; since then, many structural and functional studies have provided detailed insights into processes ranging from ABA perception to the activation of ABA-responsive gene transcription. This understanding of the mechanisms of ABA perception and signaling has served as the basis for recent, preliminary developments in the genetic engineering of stress-resistant crops as well as in the design of new synthetic ABA agonists, which hold great promise for the agricultural enhancement of stress tolerance. PMID:24786231

  16. Molecular mechanisms of cisplatin resistance in cervical cancer

    PubMed Central

    Zhu, Haiyan; Luo, Hui; Zhang, Wenwen; Shen, Zhaojun; Hu, Xiaoli; Zhu, Xueqiong

    2016-01-01

    Patients with advanced or recurrent cervical cancer have poor prognosis, and their 1-year survival is only 10%–20%. Chemotherapy is considered as the standard treatment for patients with advanced or recurrent cervical cancer, and cisplatin appears to treat the disease effectively. However, resistance to cisplatin may develop, thus substantially compromising the efficacy of cisplatin to treat advanced or recurrent cervical cancer. In this article, we systematically review the recent literature and summarize the recent advances in our understanding of the molecular mechanisms underlying cisplatin resistance in cervical cancer. PMID:27354763

  17. Upconversion nanoparticles with a strong acid-resistant capping

    NASA Astrophysics Data System (ADS)

    Recalde, Ileana; Estebanez, Nestor; Francés-Soriano, Laura; Liras, Marta; González-Béjar, María; Pérez-Prieto, Julia

    2016-03-01

    Water-dispersible upconversion nanoparticles (β-NaYF4:Yb3+,Er3+, UCNP) coated with a thin shell of a biocompatible copolymer comprising 2-hydroxyethylmethacrylate (HEMA) and 2-acrylamido-2-methyl-1-propanesulphonsulphonic acid (AMPS), which we will term COP, have been prepared by multidentate grafting. This capping is remarkably resistant to strong acidic conditions as low as pH 2. The additional functionality of the smart UCNP@COP nanosystem has been proved by its association to a well-known photosensitizer (namely, methylene blue, MB). The green-to-red emission ratio of the UC@COP@MB nanohybrid exhibits excellent linear dependence in the 7 to 2 pH range as a consequence of the release of the dye as the pH decreases.Water-dispersible upconversion nanoparticles (β-NaYF4:Yb3+,Er3+, UCNP) coated with a thin shell of a biocompatible copolymer comprising 2-hydroxyethylmethacrylate (HEMA) and 2-acrylamido-2-methyl-1-propanesulphonsulphonic acid (AMPS), which we will term COP, have been prepared by multidentate grafting. This capping is remarkably resistant to strong acidic conditions as low as pH 2. The additional functionality of the smart UCNP@COP nanosystem has been proved by its association to a well-known photosensitizer (namely, methylene blue, MB). The green-to-red emission ratio of the UC@COP@MB nanohybrid exhibits excellent linear dependence in the 7 to 2 pH range as a consequence of the release of the dye as the pH decreases. Electronic supplementary information (ESI) available: Additional spectra and data of HEMA, AMPS, COP, UCNP@oleate, UCNP@COP, and UCNP@COP@MB. See DOI: 10.1039/c5nr06653k

  18. A molecular mechanism of artemisinin resistance in Plasmodium falciparum malaria.

    PubMed

    Mbengue, Alassane; Bhattacharjee, Souvik; Pandharkar, Trupti; Liu, Haining; Estiu, Guillermina; Stahelin, Robert V; Rizk, Shahir S; Njimoh, Dieudonne L; Ryan, Yana; Chotivanich, Kesinee; Nguon, Chea; Ghorbal, Mehdi; Lopez-Rubio, Jose-Juan; Pfrender, Michael; Emrich, Scott; Mohandas, Narla; Dondorp, Arjen M; Wiest, Olaf; Haldar, Kasturi

    2015-04-30

    Artemisinins are the cornerstone of anti-malarial drugs. Emergence and spread of resistance to them raises risk of wiping out recent gains achieved in reducing worldwide malaria burden and threatens future malaria control and elimination on a global level. Genome-wide association studies (GWAS) have revealed parasite genetic loci associated with artemisinin resistance. However, there is no consensus on biochemical targets of artemisinin. Whether and how these targets interact with genes identified by GWAS, remains unknown. Here we provide biochemical and cellular evidence that artemisinins are potent inhibitors of Plasmodium falciparum phosphatidylinositol-3-kinase (PfPI3K), revealing an unexpected mechanism of action. In resistant clinical strains, increased PfPI3K was associated with the C580Y mutation in P. falciparum Kelch13 (PfKelch13), a primary marker of artemisinin resistance. Polyubiquitination of PfPI3K and its binding to PfKelch13 were reduced by the PfKelch13 mutation, which limited proteolysis of PfPI3K and thus increased levels of the kinase, as well as its lipid product phosphatidylinositol-3-phosphate (PI3P). We find PI3P levels to be predictive of artemisinin resistance in both clinical and engineered laboratory parasites as well as across non-isogenic strains. Elevated PI3P induced artemisinin resistance in absence of PfKelch13 mutations, but remained responsive to regulation by PfKelch13. Evidence is presented for PI3P-dependent signalling in which transgenic expression of an additional kinase confers resistance. Together these data present PI3P as the key mediator of artemisinin resistance and the sole PfPI3K as an important target for malaria elimination.

  19. A molecular mechanism of artemisinin resistance in Plasmodium falciparum malaria

    PubMed Central

    Mbengue, Alassane; Bhattacharjee, Souvik; Pandharkar, Trupti; Liu, Haining; Estiu, Guillermina; Stahelin, Robert V.; Rizk, Shahir; Njimoh, Dieudonne L.; Ryan, Yana; Chotivanich, Kesinee; Nguon, Chea; Ghorbal, Mehdi; Lopez-Rubio, Jose-Juan; Pfrender, Michael; Emrich, Scott; Mohandas, Narla; Dondorp, Arjen M.; Wiest, Olaf; Haldar, Kasturi

    2015-01-01

    Artemisinins are the corner stone of anti-malarial drugs1. Emergence and spread of resistance to them2–4 raises risk of wiping out recent gains achieved in reducing world-wide malaria burden and threatens future malaria control and elimination on a global level. Genome wide association studies (GWAS) have revealed parasite genetic loci associated with artemisinin resistance5–10. However, there is no consensus on biochemical targets of artemisinin. Whether and how these targets interact with genes identified by GWAS, remains unknown. Here we provide biochemical and cellular evidence that artemisinins are potent inhibitors of Plasmodium falciparum phosphatidylinositol-3-kinase (PfPI3K), revealing an unexpected mechanism of action. In resistant clinical strains, increased PfPI3K was associated with the C580Y mutation in P. falciparum Kelch13 (PfKelch13), a primary marker of artemisinin resistance. Polyubiquitination of PfPI3K and its binding to PfKelch13 were reduced by PfKelch13 mutation, which limited proteolysis of PfPI3K and thus increased levels of the kinase as well as its lipid product phosphatidylinositol 3-phosphate (PI3P). We find PI3P levels to be predictive of artemisinin resistance in both clinical and engineered laboratory parasites as well as across non-isogenic strains. Elevated PI3P induced artemisinin resistance in absence of PfKelch13 mutations, but remained responsive to regulation by PfKelch13. Evidence is presented for PI3P-dependent signaling, where transgenic expression of an additional kinase confers resistance. Together these data present PI3P as the key mediator of artemisinin resistance and the sole PfPI3K as an important target for malaria elimination. PMID:25874676

  20. Epidemiological and Genomic Landscape of Azole Resistance Mechanisms in Aspergillus Fungi

    PubMed Central

    Hagiwara, Daisuke; Watanabe, Akira; Kamei, Katsuhiko; Goldman, Gustavo H.

    2016-01-01

    Invasive aspergillosis is a life-threatening mycosis caused by the pathogenic fungus Aspergillus. The predominant causal species is Aspergillus fumigatus, and azole drugs are the treatment of choice. Azole drugs approved for clinical use include itraconazole, voriconazole, posaconazole, and the recently added isavuconazole. However, epidemiological research has indicated that the prevalence of azole-resistant A. fumigatus isolates has increased significantly over the last decade. What is worse is that azole-resistant strains are likely to have emerged not only in response to long-term drug treatment but also because of exposure to azole fungicides in the environment. Resistance mechanisms include amino acid substitutions in the target Cyp51A protein, tandem repeat sequence insertions at the cyp51A promoter, and overexpression of the ABC transporter Cdr1B. Environmental azole-resistant strains harboring the association of a tandem repeat sequence and punctual mutation of the Cyp51A gene (TR34/L98H and TR46/Y121F/T289A) have become widely disseminated across the world within a short time period. The epidemiological data also suggests that the number of Aspergillus spp. other than A. fumigatus isolated has risen. Some non-fumigatus species intrinsically show low susceptibility to azole drugs, imposing the need for accurate identification, and drug susceptibility testing in most clinical cases. Currently, our knowledge of azole resistance mechanisms in non-fumigatus Aspergillus species such as A. flavus, A. niger, A. tubingensis, A. terreus, A. fischeri, A. lentulus, A. udagawae, and A. calidoustus is limited. In this review, we present recent advances in our understanding of azole resistance mechanisms particularly in A. fumigatus. We then provide an overview of the genome sequences of non-fumigatus species, focusing on the proteins related to azole resistance mechanisms. PMID:27708619

  1. Metabolic and target-site mechanisms combine to confer strong DDT resistance in Anopheles gambiae.

    PubMed

    Mitchell, Sara N; Rigden, Daniel J; Dowd, Andrew J; Lu, Fang; Wilding, Craig S; Weetman, David; Dadzie, Samuel; Jenkins, Adam M; Regna, Kimberly; Boko, Pelagie; Djogbenou, Luc; Muskavitch, Marc A T; Ranson, Hilary; Paine, Mark J I; Mayans, Olga; Donnelly, Martin J

    2014-01-01

    The development of resistance to insecticides has become a classic exemplar of evolution occurring within human time scales. In this study we demonstrate how resistance to DDT in the major African malaria vector Anopheles gambiae is a result of both target-site resistance mechanisms that have introgressed between incipient species (the M- and S-molecular forms) and allelic variants in a DDT-detoxifying enzyme. Sequencing of the detoxification enzyme, Gste2, from DDT resistant and susceptible strains of An. gambiae, revealed a non-synonymous polymorphism (I114T), proximal to the DDT binding domain, which segregated with strain phenotype. Recombinant protein expression and DDT metabolism analysis revealed that the proteins from the susceptible strain lost activity at higher DDT concentrations, characteristic of substrate inhibition. The effect of I114T on GSTE2 protein structure was explored through X-ray crystallography. The amino acid exchange in the DDT-resistant strain introduced a hydroxyl group nearby the hydrophobic DDT-binding region. The exchange does not result in structural alterations but is predicted to facilitate local dynamics and enzyme activity. Expression of both wild-type and 114T alleles the allele in Drosophila conferred an increase in DDT tolerance. The 114T mutation was significantly associated with DDT resistance in wild caught M-form populations and acts in concert with target-site mutations in the voltage gated sodium channel (Vgsc-1575Y and Vgsc-1014F) to confer extreme levels of DDT resistance in wild caught An. gambiae.

  2. Towards the understanding of resistance mechanisms in clinically isolated trimethoprim-resistant, methicillin-resistant Staphylococcus aureus dihydrofolate reductase.

    PubMed

    Frey, Kathleen M; Lombardo, Michael N; Wright, Dennis L; Anderson, Amy C

    2010-04-01

    Resistance to therapeutics such as trimethoprim-sulfamethoxazole has become an increasing problem in strains of methicillin-resistant Staphylococcus aureus (MRSA). Clinically isolated trimethoprim-resistant strains reveal a double mutation, H30N/F98Y, in dihydrofolate reductase (DHFR). In order to develop novel and effective therapeutics against these resistant strains, we evaluated a series of propargyl-linked antifolate lead compounds for inhibition of the mutant enzyme. For the propargyl-linked antifolates, the F98Y mutation generates minimal (between 1.2- and 6-fold) losses of affinity and the H30N mutation generates greater losses (between 2.4- and 48-fold). Conversely, trimethoprim affinity is largely diminished by the F98Y mutation (36-fold) and is not affected by the H30N mutation. In order to elucidate a mechanism of resistance, we determined a crystal structure of a complex of this double mutant with a lead propargyl-linked antifolate. This structure suggests a resistance mechanism consistent both for the propargyl-linked class of antifolates and for trimethoprim that is based on the loss of a conserved water-mediated hydrogen bond.

  3. Towards the Understanding of Resistance Mechanisms in Clinically Isolated Trimethoprim-resistant, Methicillin-resistant Staphylococcus aureus Dihydrofolate Reductase

    SciTech Connect

    Frey, K.; Lombardo, M; Wright, D; Anderson, A

    2010-01-01

    Resistance to therapeutics such as trimethoprim-sulfamethoxazole has become an increasing problem in strains of methicillin-resistant Staphylococcus aureus (MRSA). Clinically isolated trimethoprim-resistant strains reveal a double mutation, H30N/F98Y, in dihydrofolate reductase (DHFR). In order to develop novel and effective therapeutics against these resistant strains, we evaluated a series of propargyl-linked antifolate lead compounds for inhibition of the mutant enzyme. For the propargyl-linked antifolates, the F98Y mutation generates minimal (between 1.2- and 6-fold) losses of affinity and the H30N mutation generates greater losses (between 2.4- and 48-fold). Conversely, trimethoprim affinity is largely diminished by the F98Y mutation (36-fold) and is not affected by the H30N mutation. In order to elucidate a mechanism of resistance, we determined a crystal structure of a complex of this double mutant with a lead propargyl-linked antifolate. This structure suggests a resistance mechanism consistent both for the propargyl-linked class of antifolates and for trimethoprim that is based on the loss of a conserved water-mediated hydrogen bond.

  4. Mechanisms and evolution of plant resistance to aphids.

    PubMed

    Züst, Tobias; Agrawal, Anurag A

    2016-01-01

    Aphids are important herbivores of both wild and cultivated plants. Plants rely on unique mechanisms of recognition, signalling and defence to cope with the specialized mode of phloem feeding by aphids. Aspects of the molecular mechanisms underlying aphid-plant interactions are beginning to be understood. Recent advances include the identification of aphid salivary proteins involved in host plant manipulation, and plant receptors involved in aphid recognition. However, a complete picture of aphid-plant interactions requires consideration of the ecological outcome of these mechanisms in nature, and the evolutionary processes that shaped them. Here we identify general patterns of resistance, with a special focus on recognition, phytohormonal signalling, secondary metabolites and induction of plant resistance. We discuss how host specialization can enable aphids to co-opt both the phytohormonal responses and defensive compounds of plants for their own benefit at a local scale. In response, systemically induced resistance in plants is common and often involves targeted responses to specific aphid species or even genotypes. As co-evolutionary adaptation between plants and aphids is ongoing, the stealthy nature of aphid feeding makes both the mechanisms and outcomes of these interactions highly distinct from those of other herbivore-plant interactions. PMID:27250753

  5. ERECTA, salicylic acid, abscisic acid, and jasmonic acid modulate quantitative disease resistance of Arabidopsis thaliana to Verticillium longisporum

    PubMed Central

    2014-01-01

    Background Verticillium longisporum is a soil-borne vascular pathogen infecting cruciferous hosts such as oilseed rape. Quantitative disease resistance (QDR) is the major control means, but its molecular basis is poorly understood so far. Quantitative trait locus (QTL) mapping was performed using a new (Bur×Ler) recombinant inbred line (RIL) population of Arabidopsis thaliana. Phytohormone measurements and analyses in defined mutants and near-isogenic lines (NILs) were used to identify genes and signalling pathways that underlie different resistance QTL. Results QTL for resistance to V. longisporum-induced stunting, systemic colonization by the fungus and for V. longisporum-induced chlorosis were identified. Stunting resistance QTL were contributed by both parents. The strongest stunting resistance QTL was shown to be identical with Erecta. A functional Erecta pathway, which was present in Bur, conferred partial resistance to V. longisporum-induced stunting. Bur showed severe stunting susceptibility in winter. Three stunting resistance QTL of Ler origin, two co-localising with wall-associated kinase-like (Wakl)-genes, were detected in winter. Furthermore, Bur showed a much stronger induction of salicylic acid (SA) by V. longisporum than Ler. Systemic colonization was controlled independently of stunting. The vec1 QTL on chromosome 2 had the strongest effect on systemic colonization. The same chromosomal region controlled the level of abscisic acid (ABA) and jasmonic acid (JA) in response to V. longisporum: The level of ABA was higher in colonization-susceptible Ler than in colonization-resistant Bur after V. longisporum infection. JA was down-regulated in Bur after infection, but not in Ler. These differences were also demonstrated in NILs, varying only in the region containing vec1. All phytohormone responses were shown to be independent of Erecta. Conclusions Signalling systems with a hitherto unknown role in the QDR of A. thaliana against V. longisporum were

  6. Eco-friendly Rot and Crease Resistance Finishing of Jute Fabric using Citric Acid and Chitosan

    NASA Astrophysics Data System (ADS)

    Samanta, A. K.; Bagchi, A.

    2013-03-01

    Citric acid (CA) along with chitosan was used on bleached jute fabrics to impart anti crease and rot resistance properties in one step. The treatment was carried out by pad-dry-cure method in presence of sodium hypophosphite monohydrate catalyst. Curing at 150° Centigrade for 5 min delivered good crease resistant property (dry crease recovery angle is 244°) and high rot resistance simultaneously by a single treatment, which are durable for five washings with distilled water. Strength retention of jute fabric after 21 days soil burial was found to be 81 % and the loss (%) in strength due to this treatment was 15-18 %. The results showed that chitosan and CA treated-fabric exhibited higher rot resistance (as indicated by soil burial test) when compared to either CA or chitosan by individual treatment. The effect of CA and chitosan combination on the resistance to rotting of jute fabric was found to be synergistic which is higher than the sum of the effects of individual chemicals. CA possibly reacts with hydroxyl groups in cellulose or chitosan to form ester. The CA and chitosan finished fabric has adverse effect on stiffness. Thermal studies showed that final residue left at 500° C was much higher for CA and chitosan treated fabric than untreated jute fabric. FTIR spectroscopy suggested the formation of ester cross-linkage between the jute fibre, CA and chitosan and hence it is understood that this rot resistant finish on jute fabric become durable by this mechanism.

  7. A novel mechanism for poisoning of metal oxide SCR catalysts: base-acid explanation correlated with redox properties.

    PubMed

    Chang, Huazhen; Li, Junhua; Su, Wenkang; Shao, Yuankai; Hao, Jiming

    2014-09-11

    A novel mechanism is proposed for the poisoning effect of acid gases and N2O formation on SCR catalysts involving base-acid properties correlated with redox ability of M-O or M-OH (M = Ce or V) of metal oxides and the strength of their basicity responsible for resistance to HCl and SO2 at medium and low temperatures.

  8. Mechanisms of Klebsiella pneumoniae resistance to complement-mediated killing.

    PubMed Central

    Merino, S; Camprubí, S; Albertí, S; Benedí, V J; Tomás, J M

    1992-01-01

    The different mechanisms of Klebsiella pneumoniae resistance to complement-mediated killing were investigated by using different strains and isogenic mutants previously characterized for their surface components. We found that strains from serotypes whose K antigen masks the lipopolysaccharide (LPS) molecules (such as serotypes K1, K10, and K16) fail to activate complement, while strains with smooth LPS exposed at the cell surface (with or without K antigen) activate complement but are resistant to complement-mediated killing. The reasons for this resistance are that C3b binds far from the cell membrane and that the lytic final complex C5b-9 (membrane attack complex) is not formed. Isogenic rough mutants (K+ or K-) are serum sensitive because they bind C3b close to the cell membrane and the lytic complex (C5b-9) is formed. Images PMID:1587619

  9. Mechanisms of drug resistance that target the androgen axis in castration resistant prostate cancer (CRPC).

    PubMed

    Penning, Trevor M

    2015-09-01

    Castrate resistant prostate cancer (CRPC) is the fatal-form of prostate cancer and remains androgen dependent. The reactivation of the androgen axis occurs due to adaptive intratumoral androgen biosynthesis which can be driven by adrenal androgens and/or by changes in the androgen receptor (AR) including AR gene amplification. These mechanisms are targeted with P450c17 inhibitors e.g., abiraterone acetate and AR super-antagonists e.g., enzalutamide, respectively. Clinical experience indicates that with either agent an initial response is followed by drug resistance and the patient clinically progresses on these agents. This article reviews the mechanisms of intrinsic and acquired drug resistance that target the androgen axis and how this might be surmounted.

  10. Increased thymidylate synthase in L1210 cells possessing acquired resistance to N10-propargyl-5,8-dideazafolic acid (CB3717): development, characterization, and cross-resistance studies

    SciTech Connect

    Jackman, A.L.; Alison, D.L.; Calvert, A.H.; Harrap, K.R.

    1986-06-01

    The properties are described of a mutant L1210 cell line (L1210:C15) with acquired resistance (greater than 200-fold) to the thymidylate synthase (TS) inhibitor N10-propargyl-5,8-dideazafolic acid. TS was overproduced 45-fold and was accompanied by a small increase in the activity of dihydrofolate reductase (2.6-fold). Both the level of resistance and enzyme activities were maintained in drug-free medium (greater than 300 generations). Failure of N10-propargyl-5,8-dideazafolic acid to suppress the (/sup 3/H)-2'-deoxyuridine incorporation into the acid-precipitable material of the resistant line supported the evidence that TS overproduction was the mechanism of resistance; consequently the L1210:C15 cells were largely cross-resistant to another (but weaker) TS inhibitor, 5,8-dideazafolic acid. Minimal cross-resistance was observed to the dihydrofolate reductase inhibitors methotrexate and 5-methyl-5,8-dideazaaminopterin (5- and 2-fold, respectively). L1210 and L1210:C15 cells were, however, equally sensitive to 5-fluorodeoxyuridine (FdUrd), an unexpected finding since a metabolite, 5-fluorodeoxyuridine monophosphate, is a potent TS inhibitor; however, this cytotoxicity against the L1210:C15 cells was antagonized by coincubation with 5 microM folinic acid although folinic acid potentiated the cytotoxicity of FdUrd to the N10-propargyl-5,8-dideazafolic acid-sensitive L1210 line. Thymidine was much less effective as a FdUrd protecting agent in the L1210:C15 when compared with the L1210 cells; however, a combination of thymidine plus hypoxanthine was without any additional effect (compared with thymidine alone) against the sensitive line but effectively protected L1210:C15 cells.

  11. Trastuzumab emtansine: mechanisms of action and drug resistance

    PubMed Central

    2014-01-01

    Trastuzumab emtansine (T-DM1) is an antibody-drug conjugate that is effective and generally well tolerated when administered as a single agent to treat advanced breast cancer. Efficacy has now been demonstrated in randomized trials as first line, second line, and later than the second line treatment of advanced breast cancer. T-DM1 is currently being evaluated as adjuvant treatment for early breast cancer. It has several mechanisms of action consisting of the anti-tumor effects of trastuzumab and those of DM1, a cytotoxic anti-microtubule agent released within the target cells upon degradation of the human epidermal growth factor receptor-2 (HER2)-T-DM1 complex in lysosomes. The cytotoxic effect of T-DM1 likely varies depending on the intracellular concentration of DM1 accumulated in cancer cells, high intracellular levels resulting in rapid apoptosis, somewhat lower levels in impaired cellular trafficking and mitotic catastrophe, while the lowest levels lead to poor response to T-DM1. Primary resistance of HER2-positive metastatic breast cancer to T-DM1 appears to be relatively infrequent, but most patients treated with T-DM1 develop acquired drug resistance. The mechanisms of resistance are incompletely understood, but mechanisms limiting the binding of trastuzumab to cancer cells may be involved. The cytotoxic effect of T-DM1 may be impaired by inefficient internalization or enhanced recycling of the HER2-T-DM1 complex in cancer cells, or impaired lysosomal degradation of trastuzumab or intracellular trafficking of HER2. The effect of T-DM1 may also be compromised by multidrug resistance proteins that pump DM1 out of cancer cells. In this review we discuss the mechanism of action of T-DM1 and the key clinical results obtained with it, the combinations of T-DM1 with other cytotoxic agents and anti-HER drugs, and the potential resistance mechanisms and the strategies to overcome resistance to T-DM1. PMID:24887180

  12. [MOLECULAR MECHANISMS OF DRUG RESISTANCE NEISSERIA GONORRHOEAE HISTORY AND PROSPECTS].

    PubMed

    Bodoev, I N; Il'ina, E N

    2015-01-01

    Neisseria gonorrhoeae (gonococcus) is a strict human pathogen, which causes gonorrhea--an infectious disease, whose origin dates back to more than two thousand years. Due to the unique plasticity of the genetic material, these bacteria have acquired the capacity to adapt to the host immune system, cause repeated infections, as well as withstand antimicrobials. Since the introduction of antibiotics in 1930s, gonococcus has displayed its propensity to develop resistance to all clinically useful antibiotics. It is important to note that the known resistance determinants of N. gonorrhoeae were acquired through horizontal gene transfer, recombination and spontaneous mutagenesis, and may be located both in the chromosome and on the plasmid. After introduction of a new antimicrobial drug, gonococcus becomes resistant within two decades and replaces sensitive bacterial population. Currently Ceftriaxone is the last remaining antibiotic for first-line treatment of gonorrhea. However, the first gonococcus displaying high-level resistance to Ceftriaxone was isolated in Japan a few years ago. Therefore, in the near future, gonorrhea may become untreatable. In the present review, we discuss the chronology of the anti-gonorrhea drugs (antibiotics) replacement, the evolution of resistance mechanisms emergence and future perspectives of N. gonorrhoeae treatment.

  13. Mechanisms of resistance to HER family targeting antibodies

    SciTech Connect

    Kruser, Tim J.; Wheeler, Deric L.

    2010-04-15

    The epidermal growth factor (EGF) family of receptor tyrosine kinases consists of four members: EGFR (HER1/ErbB1), HER2/neu (ErbB2), HER3 (ErbB3) and HER4 (ErbB4). Receptor activation via ligand binding leads to downstream signaling that influence cell proliferation, angiogenesis, invasion and metastasis. Aberrant expression or activity of EGFR and HER2 have been strongly linked to the etiology of several human epithelial cancers including but not limited to head and neck squamous cell carcinoma (HNSCC), non-small cell lung cancer (NSCLC), colorectal cancer (CRC), and breast cancer. With this, intense efforts have been made to inhibit the activity of the EGFR and HER2 by designing antibodies against the ligand binding domains (cetuximab, panitumumab and trastuzumab) or small molecules against the tyrosine kinase domains (erlotinib, gefitinib, and lapatinib). Both approaches have shown considerable clinical promise. However, increasing evidence suggests that the majority of patients do not respond to these therapies, and those who show initial response ultimately become refractory to treatment. While mechanisms of resistance to tyrosine kinase inhibitors have been extensively studied, resistance to monoclonal antibodies is less well understood, both in the laboratory and in the clinical setting. In this review, we discuss resistance to antibody-based therapies against the EGFR and HER2, similarities between these resistance profiles, and strategies to overcome resistance to HER family targeting monoclonal antibody therapy.

  14. Mechanisms of Resistance in Bacteria: An Evolutionary Approach

    PubMed Central

    Martins, Ana; Hunyadi, Attila; Amaral, Leonard

    2013-01-01

    Acquisition of resistance is one of the major causes of failure in therapy of bacterial infections. According to the World Health Organization (WHO), thousands of deaths caused by Salmonella sp., Escherichia coli, Staphylococcus aureus or Mycobacteria tuberculosis are due to failure in therapy caused by resistance to the chemotherapeutic agents. Understanding the mechanisms of resistance acquisition by the bacterial strains is therefore essential to prevent and overcome resistance. However, it is very difficult to extrapolate from in vitro studies, where the variables are far less and under constant control, as compared to what happens in vivo where the chosen chemotherapeutic, its effective dose, and the patient’s immune system are variables that differ substantially case-by-case. The aim of this review is to provide a new perspective on the possible ways by which resistance is acquired by the bacterial strains within the patient, with a special emphasis on the adaptive response of the infecting bacteria to the administered antibiotic. PMID:23560029

  15. Mechanisms of antimicrobial resistance in finfish aquaculture environments.

    PubMed

    Miranda, Claudio D; Tello, Alfredo; Keen, Patricia L

    2013-01-01

    Consumer demand for affordable fish drives the ever-growing global aquaculture industry. The intensification and expansion of culture conditions in the production of several finfish species has been coupled with an increase in bacterial fish disease and the need for treatment with antimicrobials. Understanding the molecular mechanisms of antimicrobial resistance prevalent in aquaculture environments is important to design effective disease treatment strategies, to prioritize the use and registration of antimicrobials for aquaculture use, and to assess and minimize potential risks to public health. In this brief article we provide an overview of the molecular mechanisms of antimicrobial resistance in genes found in finfish aquaculture environments and highlight specific research that should provide the basis of sound, science-based policies for the use of antimicrobials in aquaculture.

  16. Molecular mechanisms of primary resistance to flucytosine in Candida albicans.

    PubMed

    Hope, William W; Tabernero, Lydia; Denning, David W; Anderson, Michael J

    2004-11-01

    Primary resistance in Candida albicans to flucytosine (5-FC) was investigated in 25 strains by identifying and sequencing the genes FCA1, FUR1, FCY21, and FCY22, which code for cytosine deaminase, uracil phosphoribosyltransferase (UPRT), and two purine-cytosine permeases, respectively. These proteins are involved in pyrimidine salvage and 5-FC metabolism. An association between a polymorphic nucleotide and resistance to 5-FC was found within FUR1 where the substitution of cytidylate for thymidylate at nucleotide position 301 results in the replacement of arginine with cysteine at amino acid position 101 in UPRT. Isolates that are homozygous for this mutation display increased levels of resistance to 5-FC, whereas heterozygous isolates have reduced susceptibility. Three-dimensional protein modeling of UPRT suggests that the Arg101Cys mutation disturbs the quaternary structure of the enzyme, which is postulated to compromise optimal enzyme activity. A single resistant isolate, lacking the above polymorphism in FUR1, has a homozygous polymorphism in FCA1 that results in a glycine-to-aspartate substitution at position 28 in cytosine deaminase.

  17. Current perspectives on tigecycline resistance in Enterobacteriaceae: susceptibility testing issues and mechanisms of resistance.

    PubMed

    Pournaras, Spyros; Koumaki, Vasiliki; Spanakis, Nicholas; Gennimata, Vasiliki; Tsakris, Athanassios

    2016-07-01

    During the past decades, rates of multidrug-resistant (MDR) and carbapenem-resistant (CR) Enterobacteriaceae clinical isolates, mainly Klebsiella spp., Escherichia coli, Enterobacter spp., Proteus spp. and Serratia marcescens, have increased, considerably restricting effective antimicrobial treatments. Tigecycline, the first member of the glycylcyclines, has been approved by the US Food and Drug Administration (FDA) for the treatment of complicated skin and soft-tissue, complicated intra-abdominal and community-acquired bacterial respiratory infections and is increasingly administered against MDR Enterobacteriaceae. Although resistance has gradually appeared, tigecycline still remains relatively active among Enterobacteriaceae, with resistance rates largely <10% in most wide-scale surveillance studies. Tigecycline resistance has been reported in some studies to be elevated among extended-spectrum β-lactamase (ESBL)-producing, MDR, extensively drug-resistant and CR isolates. Broth microdilution (BMD) is the reference method for tigecycline susceptibility testing, but disagreements have been reported between the methods applied for routine tigecycline susceptibility testing. Therefore, confirmation of daily tigecycline susceptibility testing with BMD appears important in order to avoid misclassification of isolates. Various mechanisms have been reported to confer tigecycline resistance, with RND-type transporters, mainly the AcrAB efflux pump, playing an important role. Other pumps and various control pathways are also implicated in tigecycline resistance. Overall, tigecycline is a potent therapeutic option for enterobacterial infections. Accurate detection of tigecycline susceptibility status and surveillance of resistant organisms in the hospital environment is necessary in order to optimise its use and to preserve tigecycline in our therapeutic arsenal.

  18. An insight into the drug resistance profile & mechanism of drug resistance in Neisseria gonorrhoeae.

    PubMed

    Patel, Achchhe Lal; Chaudhry, Uma; Sachdev, Divya; Sachdeva, Poonam Nagpal; Bala, Manju; Saluja, Daman

    2011-10-01

    Among the aetiological agents of treatable sexually transmitted diseases (STDs), Neissseria gonorrhoeae is considered to be most important because of emerging antibiotic resistant strains that compromise the effectiveness of treatment of the disease - gonorrhoea. In most of the developing countries, treatment of gonorrhoea relies mainly on syndromic management rather than the aetiological based therapy. Gonococcal infections are usually treated with single-dose therapy with an agent found to cure > 95 per cent of cases. Unfortunately during the last few decades, N. gonorrhoeae has developed resistance not only to less expensive antimicrobials such as sulphonamides, penicillin and tetracyclines but also to fluoroquinolones. The resistance trend of N. gonorrhoeae towards these antimicrobials can be categorised into pre-quinolone, quinolone and post-quinolone era. Among the antimicrobials available so far, only the third-generation cephalosporins could be safely recommended as first-line therapy for gonorrhoea globally. However, resistance to oral third-generation cephalosporins has also started emerging in some countries. Therefore, it has become imperative to initiate sustained national and international efforts to reduce infection and misuse of antibiotics so as to prevent further emergence and spread of antimicrobial resistance. It is necessary not only to monitor drug resistance and optimise treatment regimens, but also to gain insight into how gonococcus develops drug resistance. Knowledge of mechanism of resistance would help us to devise methods to prevent the occurrence of drug resistance against existing and new drugs. Such studies could also help in finding out new drug targets in N. gonorrhoeae and also a possibility of identification of new drugs for treating gonorrhoea. PMID:22089602

  19. Drug Resistance Characteristics and Macrolide-Resistant Mechanisms of Streptococcus pneumoniae in Wenzhou City, China

    PubMed Central

    Hu, Dakang; Sun, Zheng; Luo, Xinhua; Liu, Shuangchun; Yu, Lianhua; Qu, Ying; Yang, Jinhong; Yu, Jian; Li, Xiangyang; Zhang, Jin

    2016-01-01

    Background Streptococcus pneumoniae (SP) is a Gram-positive, alpha-hemolytic, facultative anaerobic member of the genus Streptococcus. The erythromycin-resistant methylase (erm) gene and macrolide efflux (mef) gene are the 2 main genes that can mediate SP. Transposon (Tn) also plays an important role in the collection and metastasis of the gene. In the present study we investigated the drug resistance characteristics and the macrolide-resistant mechanisms of SP in Wenzhou City, China. Material/Methods Sixty-eight strains of SP were isolated from sputum samples of hospitalized children in the Second Affiliated Hospital of Wenzhou Medical University. These strains were analyzed using antimicrobial susceptibility tests to determine their drug resistance to 10 kinds of antibacterials. Macrolide-resistant phenotypes were identified using K-B method. PCR method was used to analyze the erm B gene, mef A gene, and int Tn gene. Results Drug resistance rates of 68 strains of SP were 98.5%, 100.0%, 63.2%, 52.9%, 94.1%, 89.7%, 0.0%, 0.0%, 16.2%, and 14.7% for clindamycin, erythromycin, penicillin G, cefotaxime, tetracycline, sulfamethoxazole/trimethoprim, levofloxacin, vancomycin, chloramphenicol, and amoxicillin, respectively. Total detection rates of the erm B gene, mef A gene, and int Tn gene were 98.5%, 91.2%, and 100.0%, respectively. Conclusions SP shows significant multi-drug resistance in Wenzhou City, whereas there is no clinical value of macrolides antibiotics for SP. cMLSB mediated by erm B gene is the most predominant phenotype among macrolide-resistant SP. The int Tn gene may play an important role in horizontal transfer and clonal dissemination of SP drug resistance genes in Wenzhou City. PMID:27483416

  20. Drug Resistance Characteristics and Macrolide-Resistant Mechanisms of Streptococcus pneumoniae in Wenzhou City, China.

    PubMed

    Hu, Dakang; Sun, Zheng; Luo, Xinhua; Liu, Shuangchun; Yu, Lianhua; Qu, Ying; Yang, Jinhong; Yu, Jian; Li, Xiangyang; Zhang, Jin

    2016-01-01

    BACKGROUND Streptococcus pneumoniae (SP) is a Gram-positive, alpha-hemolytic, facultative anaerobic member of the genus Streptococcus. The erythromycin-resistant methylase (erm) gene and macrolide efflux (mef) gene are the 2 main genes that can mediate SP. Transposon (Tn) also plays an important role in the collection and metastasis of the gene. In the present study we investigated the drug resistance characteristics and the macrolide-resistant mechanisms of SP in Wenzhou City, China. MATERIAL AND METHODS Sixty-eight strains of SP were isolated from sputum samples of hospitalized children in the Second Affiliated Hospital of Wenzhou Medical University. These strains were analyzed using antimicrobial susceptibility tests to determine their drug resistance to 10 kinds of antibacterials. Macrolide-resistant phenotypes were identified using K-B method. PCR method was used to analyze the erm B gene, mef A gene, and int Tn gene. RESULTS Drug resistance rates of 68 strains of SP were 98.5%, 100.0%, 63.2%, 52.9%, 94.1%, 89.7%, 0.0%, 0.0%, 16.2%, and 14.7% for clindamycin, erythromycin, penicillin G, cefotaxime, tetracycline, sulfamethoxazole/trimethoprim, levofloxacin, vancomycin, chloramphenicol, and amoxicillin, respectively. Total detection rates of the erm B gene, mef A gene, and int Tn gene were 98.5%, 91.2%, and 100.0%, respectively. CONCLUSIONS SP shows significant multi-drug resistance in Wenzhou City, whereas there is no clinical value of macrolides antibiotics for SP. cMLSB mediated by erm B gene is the most predominant phenotype among macrolide-resistant SP. The int Tn gene may play an important role in horizontal transfer and clonal dissemination of SP drug resistance genes in Wenzhou City. PMID:27483416

  1. Combined staurosporine and retinoic acid induces differentiation in retinoic acid resistant acute promyelocytic leukemia cell lines

    PubMed Central

    Ge, Dong-zheng; Sheng, Yan; Cai, Xun

    2014-01-01

    All-trans retinoic acid (ATRA) resistance has been a critical problem in acute promyelocytic leukemia (APL) relapsed patients. In ATRA resistant APL cell lines NB4-R1 and NB4-R2, the combination of staurosporine and ATRA synergized to trigger differentiation accompanied by significantly enhanced protein level of CCAAT/enhancer binding protein ε (C/EBPε) and C/EBPβ as well as the phosphorylation of mitogen-activated protein (MEK) and extracellular signal-regulated kinase (ERK). Furthermore, attenuation of the MEK activation blocked not only the differentiation but also the increased protein level of C/EBPε and C/EBPβ. Taken together, we concluded that the combination of ATRA and staurosporine could overcome differentiation block via MEK/ERK signaling pathway in ATRA-resistant APL cell lines. PMID:24769642

  2. Eicosapentaenoic acid reduces high-fat diet-induced insulin resistance by altering adipose tissue glycolytic and inflammatory function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We previously reported Eicosapentaenoic Acid (EPA)'s ability to prevent high-fat (HF) diet-induced obesity, insulin resistance, and inflammation. In this study, we dissected mechanisms mediating anti-inflammatory and anti-lipogenic actions of EPA, using histology/ immunohistochemistry, transcriptomi...

  3. Skeletal muscle fatty acid handling in insulin resistant men.

    PubMed

    van Hees, Anneke M J; Jans, Anneke; Hul, Gabby B; Roche, Helen M; Saris, Wim H M; Blaak, Ellen E

    2011-07-01

    Disturbances in skeletal muscle lipid metabolism may precede or contribute to the development of whole body insulin resistance. In this study, we examined fasting and postprandial skeletal muscle fatty acid (FA) handling in insulin resistant (IR) men. Thirty men with the metabolic syndrome (MetS) (National Cholesterol Education Program-Adult Treatment Panel III) were included in this sub-study to the LIPGENE study, and divided in two groups (IR and control) based on the median of insulin sensitivity (S(I) = 2.06 (mU/l(-1))·min(-1)·10(-4)). Fasting and postprandial skeletal muscle FA handling were examined by combining the forearm balance technique with stable isotopes of palmitate. [(2)H(2)]-palmitate was infused intravenously to label endogenous triacylglycerol (TAG) and free FAs (FFAs) in the circulation and [U-(13)C]-palmitate was incorporated in a high-fat mixed meal (2.6 MJ, 61 E% fat) to label chylomicron-TAG. Muscle biopsies were taken to determine muscle TAG, diacylglycerol (DAG), FFA, and phospholipid (PL) content, their fractional synthetic rates (FSRs) and degree of saturation, as well as messenger RNA (mRNA) expression of genes involved in lipid metabolism. In the first 2 h after meal consumption, forearm muscle [(2)H(2)]-labeled TAG extraction was higher in IR vs. control (P = 0.05). Fasting percentage saturation of muscle DAG was higher in IR vs. control (P = 0.016). No differences were observed for intramuscular TAG, DAG, FFA, and PL content, FSR, and muscle mRNA expression. In conclusion, increased muscle (hepatically derived) TAG extraction during postprandial conditions and increased saturation of intramuscular DAG are associated with insulin resistance, suggesting that disturbances in skeletal muscle FA handling could play a role in the development of whole body insulin resistance and type 2 diabetes. PMID:21331063

  4. β-Lactam Resistance Mechanisms: Gram-Positive Bacteria and Mycobacterium tuberculosis.

    PubMed

    Fisher, Jed F; Mobashery, Shahriar

    2016-01-01

    The value of the β-lactam antibiotics for the control of bacterial infection has eroded with time. Three Gram-positive human pathogens that were once routinely susceptible to β-lactam chemotherapy-Streptococcus pneumoniae, Enterococcus faecium, and Staphylococcus aureus-now are not. Although a fourth bacterium, the acid-fast (but not Gram-positive-staining) Mycobacterium tuberculosis, has intrinsic resistance to earlier β-lactams, the emergence of strains of this bacterium resistant to virtually all other antibiotics has compelled the evaluation of newer β-lactam combinations as possible contributors to the multidrug chemotherapy required to control tubercular infection. The emerging molecular-level understanding of these resistance mechanisms used by these four bacteria provides the conceptual framework for bringing forward new β-lactams, and new β-lactam strategies, for the future control of their infections. PMID:27091943

  5. Azole fungicides - understanding resistance mechanisms in agricultural fungal pathogens.

    PubMed

    Price, Claire L; Parker, Josie E; Warrilow, Andrew G S; Kelly, Diane E; Kelly, Steven L

    2015-08-01

    Plant fungal pathogens can have devastating effects on a wide range of crops, including cereals and fruit (such as wheat and grapes), causing losses in crop yield, which are costly to the agricultural economy and threaten food security. Azole antifungals are the treatment of choice; however, resistance has arisen against these compounds, which could lead to devastating consequences. Therefore, it is important to understand how these fungicides are used and how the resistance arises in order to tackle the problem fully. Here, we give an overview of the problem and discuss the mechanisms that mediate azole resistance in agriculture (point mutations in the CYP51 amino acid sequence, overexpression of the CYP51 enzyme and overexpression of genes encoding efflux pump proteins). © 2015 Society of Chemical Industry.

  6. Extreme resistance to weak-acid preservatives in the spoilage yeast Zygosaccharomyces bailii.

    PubMed

    Stratford, Malcolm; Steels, Hazel; Nebe-von-Caron, Gerhard; Novodvorska, Michaela; Hayer, Kimran; Archer, David B

    2013-08-16

    Weak-acid preservatives, such as sorbic acid and acetic acid, are used in many low pH foods to prevent spoilage by fungi. The spoilage yeast Zygosaccharomyces bailii is notorious for its extreme resistance to preservatives and ability to grow in excess of legally-permitted concentrations of preservatives. Extreme resistance was confirmed in 38 strains of Z. bailii to several weak-acid preservatives. Using the brewing yeast Saccharomyces cerevisiae as a control, tests showed that Z. bailii was ~3-fold more resistant to a variety of weak-acids but was not more resistant to alcohols, aldehydes, esters, ethers, ketones, or hydrophilic chelating acids. The weak acids were chemically very diverse in structure, making it improbable that the universal resistance was caused by degradation or metabolism. Examination of Z. bailii cell populations showed that extreme resistance to sorbic acid, benzoic acid and acetic acid was limited to a few cells within the population, numbers decreasing with concentration of weak acid to <1 in 1000. Re-inoculation of resistant sub-populations into weak-acid-containing media showed that all cells now possessed extreme resistance. Resistant sub-populations grown in any weak-acid preservative also showed ~100% cross-resistance to other weak-acid preservatives. Tests using (14)C-acetic acid showed that weak-acid accumulation was much lower in the resistant sub-populations. Acid accumulation is caused by acid dissociation in the higher pH of the cytoplasm. Tests on intracellular pH (pHi) in the resistant sub-population showed that the pH was much lower, ~ pH5.6, than in the sensitive bulk population. The hypothesis is proposed that extreme resistance to weak-acid preservatives in Z. bailii is due to population heterogeneity, with a small proportion of cells having a lower intracellular pH. This reduces the level of accumulation of any weak acid in the cytoplasm, thus conferring resistance to all weak acids, but not to other inhibitors.

  7. Implementation of In Vitro Drug Resistance Assays: Maximizing the Potential for Uncovering Clinically Relevant Resistance Mechanisms

    PubMed Central

    Korpal, Manav; Feala, Jacob; Puyang, Xiaoling; Zou, Jian; Ramos, Alex H.; Wu, Jeremy; Baumeister, Timm; Yu, Lihua; Warmuth, Markus; Zhu, Ping

    2015-01-01

    Although targeted therapies are initially effective, resistance inevitably emerges. Several methods, such as genetic analysis of resistant clinical specimens, have been applied to uncover these resistance mechanisms to facilitate follow-up care. Although these approaches have led to clinically relevant discoveries, difficulties in attaining the relevant patient material or in deconvoluting the genomic data collected from these specimens have severely hampered the path towards a cure. To this end, we here describe a tool for expeditious discovery that may guide improvement in first-line therapies and alternative clinical management strategies. By coupling preclinical in vitro or in vivo drug selection with next-generation sequencing, it is possible to identify genomic structural variations and/or gene expression alterations that may serve as functional drivers of resistance. This approach facilitates the spontaneous emergence of alterations, enhancing the probability that these mechanisms may be observed in the patients. In this protocol we provide guidelines to maximize the potential for uncovering single nucleotide variants that drive resistance using adherent lines. PMID:26710000

  8. A branched chain amino acid metabolite drives vascular transport of fat and causes insulin resistance

    PubMed Central

    Jang, Cholsoon; Oh, Sungwhan F; Wada, Shogo; Rowe, Glenn C; Liu, Laura; Chan, Mun Chun; Rhee, James; Hoshino, Atsushi; Kim, Boa; Ibrahim, Ayon; Baca, Luisa G; Kim, Esl; Ghosh, Chandra C; Parikh, Samir M; Jiang, Aihua; Chu, Qingwei; Forman, Daniel E.; Lecker, Stewart H.; Krishnaiah, Saikumari; Rabinowitz, Joshua D; Weljie, Aalim M; Baur, Joseph A; Kasper, Dennis L; Arany, Zoltan

    2016-01-01

    Epidemiological and experimental data implicate branched chain amino acids (BCAAs) in the development of insulin resistance, but the mechanisms underlying this link remain unclear.1–3 Insulin resistance in skeletal muscle stems from excess accumulation of lipid species4, a process that requires blood-borne lipids to first traverse the blood vessel wall. Little is known, however, of how this trans-endothelial transport occurs or is regulated. Here, we leverage PGC-1α, a transcriptional coactivator that regulates broad programs of FA consumption, to identify 3-hydroxy-isobutyrate (3-HIB), a catabolic intermediate of the BCAA valine, as a novel paracrine regulator of trans-endothelial fatty acids (FA) transport. 3-HIB is secreted from muscle cells, activates endothelial FA transport, stimulates muscle FA uptake in vivo, and promotes muscle lipid accumulation and insulin resistance in animals. Conversely, inhibiting the synthesis of 3-HIB in muscle cells blocks the promotion of endothelial FA uptake. 3-HIB levels are elevated in muscle from db/db mice and from subjects with diabetes. These data thus unveil a novel mechanism that regulates trans-endothelial flux of FAs, revealing 3-HIB as a new bioactive signaling metabolite that links the regulation of FA flux to BCAA catabolism and provides a mechanistic explanation for how increased BCAA catabolic flux can cause diabetes. PMID:26950361

  9. The Emerging Role of Branched-Chain Amino Acids in Insulin Resistance and Metabolism

    PubMed Central

    Yoon, Mee-Sup

    2016-01-01

    Insulin is required for maintenance of glucose homeostasis. Despite the importance of insulin sensitivity to metabolic health, the mechanisms that induce insulin resistance remain unclear. Branched-chain amino acids (BCAAs) belong to the essential amino acids, which are both direct and indirect nutrient signals. Even though BCAAs have been reported to improve metabolic health, an increased BCAA plasma level is associated with a high risk of metabolic disorder and future insulin resistance, or type 2 diabetes mellitus (T2DM). The activation of mammalian target of rapamycin complex 1 (mTORC1) by BCAAs has been suggested to cause insulin resistance. In addition, defective BCAA oxidative metabolism might occur in obesity, leading to a further accumulation of BCAAs and toxic intermediates. This review provides the current understanding of the mechanism of BCAA-induced mTORC1 activation, as well as the effect of mTOR activation on metabolic health in terms of insulin sensitivity. Furthermore, the effects of impaired BCAA metabolism will be discussed in detail. PMID:27376324

  10. The Emerging Role of Branched-Chain Amino Acids in Insulin Resistance and Metabolism.

    PubMed

    Yoon, Mee-Sup

    2016-01-01

    Insulin is required for maintenance of glucose homeostasis. Despite the importance of insulin sensitivity to metabolic health, the mechanisms that induce insulin resistance remain unclear. Branched-chain amino acids (BCAAs) belong to the essential amino acids, which are both direct and indirect nutrient signals. Even though BCAAs have been reported to improve metabolic health, an increased BCAA plasma level is associated with a high risk of metabolic disorder and future insulin resistance, or type 2 diabetes mellitus (T2DM). The activation of mammalian target of rapamycin complex 1 (mTORC1) by BCAAs has been suggested to cause insulin resistance. In addition, defective BCAA oxidative metabolism might occur in obesity, leading to a further accumulation of BCAAs and toxic intermediates. This review provides the current understanding of the mechanism of BCAA-induced mTORC1 activation, as well as the effect of mTOR activation on metabolic health in terms of insulin sensitivity. Furthermore, the effects of impaired BCAA metabolism will be discussed in detail. PMID:27376324

  11. Silylated Acid Hardened Resist [SAHR] Technology: Positive, Dry Developable Deep UV Resists

    NASA Astrophysics Data System (ADS)

    Thackeray, James W.; Bohland, John F.; Pavelchek, , Edward K.; Orsula, George W.; McCullough, Andrew W.; Jones, Susan K.; Bobbio, Stephen M.

    1990-01-01

    This paper describes continuing efforts in the development of Acid Hardened Resist (AHR) systems for use in deep UV photolithography. The Silylated AHR (SAHR) process treats a highly absorbing resist, such as XP-8928, with trimethylsilyldiethylamine. The exposed, crosslinked areas show virtually no reactivity with the silylating agent, and the unexposed areas incorporate 10 to 12% by weight silicon in the film. The silicon appears to incorporate from the exterior in a constant concentration, consistent with Case II diffusion. Subsequent dry etching leads to a positive tone image. The contrast is 5, and the photospeed is ~10 mJ/cm2. Resolution of 0.5 μm line/space pairs has been demonstrated, although substantial proximity effects are encountered.

  12. Embryo mechanics: balancing force production with elastic resistance during morphogenesis.

    PubMed

    Davidson, Lance A

    2011-01-01

    Morphogenesis requires the spatial and temporal control of embryo mechanics, including force production and mechanical resistance to those forces, to coordinate tissue deformation and large-scale movements. Thus, biomechanical processes play a key role in directly shaping the embryo. Additional roles for embryo mechanics during development may include the patterning of positional information and to provide feedback to ensure the success of morphogenetic movements in shaping the larval body and organs. To understand the multiple roles of mechanics during development requires familiarity with engineering principles of the mechanics of structures, the viscoelastic properties of biomaterials, and the integration of force and stress within embryonic structures as morphogenesis progresses. In this chapter, we review the basic engineering principles of biomechanics as they relate to morphogenesis, introduce methods for quantifying embryo mechanics and the limitations of these methods, and outline a formalism for investigating the role of embryo mechanics in birth defects. We encourage the nascent field of embryo mechanics to adopt standard engineering terms and test methods so that studies of diverse organisms can be compared and universal biomechanical principles can be revealed.

  13. Genome Sequence Analysis of the Naphthenic Acid Degrading and Metal Resistant Bacterium Cupriavidus gilardii CR3

    PubMed Central

    Xiao, Jingfa; Hao, Lirui; Crowley, David E.; Zhang, Zhewen; Yu, Jun; Huang, Ning; Huo, Mingxin; Wu, Jiayan

    2015-01-01

    Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals. PMID:26301592

  14. Genome Sequence Analysis of the Naphthenic Acid Degrading and Metal Resistant Bacterium Cupriavidus gilardii CR3.

    PubMed

    Wang, Xiaoyu; Chen, Meili; Xiao, Jingfa; Hao, Lirui; Crowley, David E; Zhang, Zhewen; Yu, Jun; Huang, Ning; Huo, Mingxin; Wu, Jiayan

    2015-01-01

    Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals. PMID:26301592

  15. Insecticides resistance in the Culex quinquefasciatus populations from northern Thailand and possible resistance mechanisms.

    PubMed

    Yanola, Jintana; Chamnanya, Saowanee; Lumjuan, Nongkran; Somboon, Pradya

    2015-09-01

    The mosquito vector Culex quinquefasciatus is known to be resistant to insecticides worldwide, including Thailand. This study was the first investigation of the insecticide resistance mechanisms, involving metabolic detoxification and target site insensitivity in C. quinquefasciatus from Thailand. Adult females reared from field-caught larvae from six provinces of northern Thailand were determined for resistant status by exposing to 0.05% deltamethrin, 0.75% permethrin and 5% malathion papers using the standard WHO susceptibility test. The overall mortality rates were 45.8%, 11.4% and 80.2%, respectively. A fragment of voltage-gated sodium channel gene was amplified and sequenced to identify the knock down resistance (kdr) mutation. The ace-1 gene mutation was determined by using PCR-RFLP. The L1014F kdr mutation was observed in all populations, but the homozygous mutant F/F1014 genotype was found only in two of the six provinces where the kdr mutation was significantly correlated with deltamethrin resistance. However, none of mosquitoes had the G119S mutation in the ace-1 gene. A laboratory deltamethrin resistant strain, Cq_CM_R, has been established showing a highly resistant level after selection for a few generations. The mutant F1014 allele frequency was significantly increased after one generation of selection. A synergist assay was performed to assess the metabolic detoxifying enzymes. Addition of bis(4-nitrophenyl)-phosphate (BNPP) and diethyl maleate (DEM), inhibitors of esterases and glutathione S-transferases (GST), respectively, into the larval bioassay of the Cq_CM strain with deltamethrin showed no significant reduction. By contrast, addition of piperonyl butoxide (PBO), an inhibitor of cytochrome P450 monooxygenases, showed a 9-fold reduction of resistance. Resistance to pyrethroids in C. quinquefasciatus is widely distributed in northern Thailand. This study reports for the first time for the detection of the L1014F kdr mutation in wild populations

  16. Novel mechanism of resistance to glycopeptide antibiotics in Enterococcus faecium

    PubMed Central

    Cremniter, Julie; Mainardi, Jean-Luc; Josseaume, Nathalie; Quincampoix, Jean-Charles; Dubost, Lionel; Hugonnet, Jean-Emmanuel; Marie, Arul; Gutmann, Laurent; Rice, Louis B.; Arthur, Michel

    2006-01-01

    Glycopeptides and β-lactams are the major antibiotics available for the treatment of infections due to Gram-positive bacteria. Emergence of cross-resistance to these drugs by a single mechanism has been considered as unlikely since they inhibit peptidoglycan polymerization by different mechanisms. The glycopeptides bind to the peptidyl-D-Ala4-D-Ala5 extremity of peptidoglycan precursors and block by steric hindrance the essential glycosyltransferase and D,D-transpeptidase activities of the penicillin-binding proteins (PBPs). The β-lactams are structural analogues of D-Ala4-D-Ala5 and act as suicide substrates of the D,D-transpeptidase module of the PBPs. Here we show that bypass of the PBPs by the recently described β-lactam-insensitive L,D-transpeptidase from Enterococcus faecium (Ldtfm) can lead to high-level resistance to glycopeptides and β-lactams. Cross-resistance was selected by glycopeptides alone or serially by β-lactams and glycopeptides. In the corresponding mutants, UDP-MurNAc-pentapeptide was extensively converted to UDP-MurNAc-tetrapeptide following hydrolysis of D-Ala5, thereby providing the substrate of Ldtfm. Complete elimination of D-Ala5, a residue essential for glycopeptide binding, was possible since Ldtfm uses the energy of the L-Lys3-D-Ala4 peptide bond for cross-link formation in contrast to PBPs which use the energy of the D-Ala4-D-Ala5 bond. This novel mechanism of glycopeptide resistance was unrelated to the previously identified replacement of D-Ala5 by D-Ser or D-lactate. PMID:16943188

  17. Mechanisms of acid tolerance in bacteria and prospects in biotechnology and bioremediation.

    PubMed

    Liu, Yuping; Tang, Hongzhi; Lin, Zhanglin; Xu, Ping

    2015-11-15

    Acidogenic and aciduric bacteria have developed several survival systems in various acidic environments to prevent cell damage due to acid stress such as that on the human gastric surface and in the fermentation medium used for industrial production of acidic products. Common mechanisms for acid resistance in bacteria are proton pumping by F1-F0-ATPase, the glutamate decarboxylase system, formation of a protective cloud of ammonia, high cytoplasmic urease activity, repair or protection of macromolecules, and biofilm formation. The field of synthetic biology has rapidly advanced and generated an ever-increasing assortment of genetic devices and biological modules for applications in biofuel and novel biomaterial productions. Better understanding of aspects such as overproduction of general shock proteins, molecular mechanisms, and responses to cell density adopted by microorganisms for survival in low pH conditions will prove useful in synthetic biology for potential industrial and environmental applications.

  18. Insecticide Resistance Status of United States Populations of Aedes albopictus and Mechanisms Involved

    PubMed Central

    Marcombe, Sébastien; Farajollahi, Ary; Healy, Sean P.; Clark, Gary G.; Fonseca, Dina M.

    2014-01-01

    Aedes albopictus (Skuse) is an invasive mosquito that has become an important vector of chikungunya and dengue viruses. Immature Ae. albopictus thrive in backyard household containers that require treatment with larvicides and when adult populations reach pest levels or disease transmission is ongoing, adulticiding is often required. To assess the feasibility of control of USA populations, we tested the susceptibility of Ae. albopictus to chemicals representing the main insecticide classes with different modes of action: organochlorines, organophosphates, carbamates, pyrethroids, insect growth regulators (IGR), naturalytes, and biolarvicides. We characterized a susceptible reference strain of Ae. albopictus, ATM95, and tested the susceptibility of eight USA populations to five adulticides and six larvicides. We found that USA populations are broadly susceptible to currently available larvicides and adulticides. Unexpectedly, however, we found significant resistance to dichlorodiphenyltrichloroethane (DDT) in two Florida populations and in a New Jersey population. We also found resistance to malathion, an organophosphate, in Florida and New Jersey and reduced susceptibility to the IGRs pyriproxyfen and methoprene. All populations tested were fully susceptible to pyrethroids. Biochemical assays revealed a significant up-regulation of GSTs in DDT-resistant populations in both larval and adult stages. Also, β-esterases were up-regulated in the populations with suspected resistance to malathion. Of note, we identified a previously unknown amino acid polymorphism (Phe → Leu) in domain III of the VGSC, in a location known to be associated with pyrethroid resistance in another container-inhabiting mosquito, Aedes aegypti L. The observed DDT resistance in populations from Florida may indicate multiple introductions of this species into the USA, possibly from tropical populations. In addition, the mechanisms underlying DDT resistance often result in pyrethroid resistance

  19. Insecticide resistance status of United States populations of Aedes albopictus and mechanisms involved.

    PubMed

    Marcombe, Sébastien; Farajollahi, Ary; Healy, Sean P; Clark, Gary G; Fonseca, Dina M

    2014-01-01

    Aedes albopictus (Skuse) is an invasive mosquito that has become an important vector of chikungunya and dengue viruses. Immature Ae. albopictus thrive in backyard household containers that require treatment with larvicides and when adult populations reach pest levels or disease transmission is ongoing, adulticiding is often required. To assess the feasibility of control of USA populations, we tested the susceptibility of Ae. albopictus to chemicals representing the main insecticide classes with different modes of action: organochlorines, organophosphates, carbamates, pyrethroids, insect growth regulators (IGR), naturalytes, and biolarvicides. We characterized a susceptible reference strain of Ae. albopictus, ATM95, and tested the susceptibility of eight USA populations to five adulticides and six larvicides. We found that USA populations are broadly susceptible to currently available larvicides and adulticides. Unexpectedly, however, we found significant resistance to dichlorodiphenyltrichloroethane (DDT) in two Florida populations and in a New Jersey population. We also found resistance to malathion, an organophosphate, in Florida and New Jersey and reduced susceptibility to the IGRs pyriproxyfen and methoprene. All populations tested were fully susceptible to pyrethroids. Biochemical assays revealed a significant up-regulation of GSTs in DDT-resistant populations in both larval and adult stages. Also, β-esterases were up-regulated in the populations with suspected resistance to malathion. Of note, we identified a previously unknown amino acid polymorphism (Phe → Leu) in domain III of the VGSC, in a location known to be associated with pyrethroid resistance in another container-inhabiting mosquito, Aedes aegypti L. The observed DDT resistance in populations from Florida may indicate multiple introductions of this species into the USA, possibly from tropical populations. In addition, the mechanisms underlying DDT resistance often result in pyrethroid resistance

  20. Salvianolic acids: small compounds with multiple mechanisms for cardiovascular protection

    PubMed Central

    2011-01-01

    Salvianolic acids are the most abundant water-soluble compounds extracted from Radix Salvia miltiorrhiza (Danshen). In China, Danshen has been wildly used to treat cardiovascular diseases for hundreds of years. Salvianolic acids, especially salvianolic acid A (Sal A) and salvianolic acid B (Sal B), have been found to have potent anti-oxidative capabilities due to their polyphenolic structure. Recently, intracellular signaling pathways regulated by salvianolic acids in vascular endothelial cells, aortic smooth muscle cells, as well as cardiomyocytes, have been investigated both in vitro and in vivo upon various cardiovascular insults. It is discovered that the cardiovascular protection of salvianolic acids is not only because salvianolic acids act as reactive oxygen species scavengers, but also due to the reduction of leukocyte-endothelial adherence, inhibition of inflammation and metalloproteinases expression from aortic smooth muscle cells, and indirect regulation of immune function. Competitive binding of salvianolic acids to target proteins to interrupt protein-protein interactions has also been found to be a mechanism of cardiovascular protection by salvianolic acids. In this article, we review a variety of studies focusing on the above mentioned mechanisms. Besides, the target proteins of salvianolic acids are also described. These results of recent advances have shed new light to the development of novel therapeutic strategies for salvianolic acids to treat cardiovascular diseases. PMID:21569331

  1. Arabidopsis YAK1 regulates abscisic acid response and drought resistance.

    PubMed

    Kim, Dongjin; Ntui, Valentine Otang; Xiong, Liming

    2016-07-01

    Abscisic acid (ABA) is an important phytohormone that controls several plant processes such as seed germination, seedling growth, and abiotic stress response. Here, we report that AtYak1 plays an important role in ABA signaling and postgermination growth in Arabidopsis. AtYak1 knockout mutant plants were hyposensitive to ABA inhibition of seed germination, cotyledon greening, seedling growth, and stomatal movement. atyak1-1 mutant plants display reduced drought stress resistance, as evidenced by water loss rate and survival rate. Molecular genetic analysis revealed that AtYak1 deficiency led to elevated expression of stomatal-related gene, MYB60, and down-regulation of several stress-responsive genes. Altogether, these results indicate that AtYak1 plays a role as a positive regulator in ABA-mediated drought response in Arabidopsis. PMID:27264339

  2. Corrosion-resistant catalyst supports for phosphoric acid fuel cells

    SciTech Connect

    Kosek, J.A.; Cropley, C.C.; LaConti, A.B.

    1990-01-01

    High-surface-area carbon blacks such as Vulcan XC-72 (Cabot Corp.) and graphitized carbon blacks such as 2700{degree}C heat-treated Black Pearls 2000 (HTBP) (Cabot Corp.) have found widespread applications as catalyst supports in phosphoric acid fuel cells (PAFCs). However, due to the operating temperatures and pressures being utilized in PAFCs currently under development, the carbon-based cathode catalyst supports suffer from corrosion, which decreases the performance and life span of a PAFC stack. The feasibility of using alternative, low-cost, corrosion-resistant catalyst support (CRCS) materials as replacements for the cathode carbon support materials was investigated. The objectives of the program were to prepare high-surface-area alternative supports and to evaluate the physical characteristics and the electrochemical stability of these materials. The O{sub 2} reduction activity of the platinized CRCS materials was also evaluated. 2 refs., 3 figs.

  3. Mechanisms of Nuclear Export in Cancer and Resistance to Chemotherapy.

    PubMed

    El-Tanani, Mohamed; Dakir, El-Habib; Raynor, Bethany; Morgan, Richard

    2016-03-14

    Tumour suppressor proteins, such as p53, BRCA1, and ABC, play key roles in preventing the development of a malignant phenotype, but those that function as transcriptional regulators need to enter the nucleus in order to function. The export of proteins between the nucleus and cytoplasm is complex. It occurs through nuclear pores and exported proteins need a nuclear export signal (NES) to bind to nuclear exportin proteins, including CRM1 (Chromosomal Region Maintenance protein 1), and the energy for this process is provided by the RanGTP/RanGDP gradient. Due to the loss of DNA repair and cell cycle checkpoints, drug resistance is a major problem in cancer treatment, and often an initially successful treatment will fail due to the development of resistance. An important mechanism underlying resistance is nuclear export, and a number of strategies that can prevent nuclear export may reverse resistance. Examples include inhibitors of CRM1, antibodies to the nuclear export signal, and alteration of nuclear pore structure. Each of these are considered in this review.

  4. An amino acid substitution (L925V) associated with resistance to pyrethroids in Varroa destructor.

    PubMed

    González-Cabrera, Joel; Davies, T G Emyr; Field, Linda M; Kennedy, Peter J; Williamson, Martin S

    2013-01-01

    The Varroa mite, Varroa destructor, is an important pest of honeybees and has played a prominent role in the decline in bee colony numbers over recent years. Although pyrethroids such as tau-fluvalinate and flumethrin can be highly effective in removing the mites from hives, their intensive use has led to many reports of resistance. To investigate the mechanism of resistance in UK Varroa samples, the transmembrane domain regions of the V. destructor voltage-gated sodium channel (the main target site for pyrethroids) were PCR amplified and sequenced from pyrethroid treated/untreated mites collected at several locations in Central/Southern England. A novel amino acid substitution, L925V, was identified that maps to a known hot spot for resistance within the domain IIS5 helix of the channel protein; a region that has also been proposed to form part of the pyrethroid binding site. Using a high throughput diagnostic assay capable of detecting the mutation in individual mites, the L925V substitution was found to correlate well with resistance, being present in all mites that had survived tau-fluvalinate treatment but in only 8 % of control, untreated samples. The potential for using this assay to detect and manage resistance in Varroa-infected hives is discussed.

  5. Molecular and cellular mechanisms of cadmium resistance in cultured cells

    SciTech Connect

    Grady, D.L.; Moyzis, R.K.; Hildebrand, C.E.

    1985-01-01

    Heavy metal induction of the synthesis of metallothioneins (MTs) provides an ideal model system for basic mechanistic studies of gene expression. Cell lines varying in their resistance to heavy metals have been isolated through a regime of exposure to serially increasing levels of Cd followed by clonal isolation. These cell lines have been used to examine the role of methylation and amplification in the Cd-resistant (Cd/sup r/) phenotype. It is suggested that regulation of expression of the MT genes in Cd/sup r/ Chinese hamster cells is modulated at both the transcriptional and translational levels. An analysis of the MT2 gene sequence has uncovered a potential alternative splice site in the first intron. Usage of this site would insert 3 or 12 additional amino acids between amino acids 9 and 10. Analysis of the splicing pattern of the MT2 gene transcript in cultured cells has indicated that the second intron is preferentially removed prior to first intron excision. 34 refs., 2 figs., 1 tab.

  6. Neurobiological Mechanisms Supporting Experience-Dependent Resistance to Social Stress

    PubMed Central

    Cooper, Matthew A.; Clinard, Catherine T.; Morrison, Kathleen E.

    2015-01-01

    Humans and other animals show a remarkable capacity for resilience following traumatic, stressful events. Resilience is thought to be an active process related to coping with stress, although the cellular and molecular mechanisms that support active coping and stress resistance remain poorly understood. In this review, we focus on the neurobiological mechanisms by which environmental and social experiences promote stress resistance. In male Syrian hamsters, exposure to a brief social defeat stressor leads to increased avoidance of novel opponents, which we call conditioned defeat. Also, hamsters that have achieved dominant social status show reduced conditioned defeat as well as cellular and molecular changes in the neural circuits controlling the conditioned defeat response. We propose that experience-dependent neural plasticity occurs in the prelimbic (PL) cortex, infralimbic (IL) cortex, and ventral medial amygdala (vMeA) during the maintenance of dominance relationships, and that adaptions in these neural circuits support stress resistance in dominant individuals. Overall, behavioral treatments that promote success in competitive interactions may represent valuable interventions for instilling resilience. PMID:25677096

  7. Mechanisms underlying the antidepressant response and treatment resistance

    PubMed Central

    Levinstein, Marjorie R.; Samuels, Benjamin A.

    2014-01-01

    Depression is a complex and heterogeneous disorder affecting millions of Americans. There are several different medications and other treatments that are available and effective for many patients with depression. However, a substantial percentage of patients fail to achieve remission with these currently available interventions, and relapse rates are high. Therefore, it is necessary to determine both the mechanisms underlying the antidepressant response and the differences between responders and non-responders to treatment. Delineation of these mechanisms largely relies on experiments that utilize animal models. Therefore, this review provides an overview of the various mouse models that are currently used to assess the antidepressant response, such as chronic mild stress, social defeat, and chronic corticosterone. We discuss how these mouse models can be used to advance our understanding of the differences between responders and non-responders to antidepressant treatment. We also provide an overview of experimental treatment modalities that are used for treatment-resistant depression, such as deep brain stimulation and ketamine administration. We will then review the various genetic polymorphisms and transgenic mice that display resistance to antidepressant treatment. Finally, we synthesize the published data to describe a potential neural circuit underlying the antidepressant response and treatment resistance. PMID:25018708

  8. Mechanisms of Induced Resistance in Barley Against Drechslera teres.

    PubMed

    Lyngs Jørgensen, H J; Lübeck, P S; Thordal-Christensen, H; de Neergaard, E; Smedegaard-Petersen, V

    1998-07-01

    ABSTRACT Quantitative and qualitative histopathological methods and molecular analyses were used to study the mechanisms by which preinoculation with either of the nonbarley pathogens, Bipolaris maydis and Septoria nodorum, inhibited growth of Drechslera teres. Collectively, our data suggest that induced resistance is the principal mechanism responsible for impeding the pathogen. The enhancement of resistance in the host was primarily manifested during penetration by D. teres, and after penetration, where growth of D. teres ceased soon after development of infection vesicles. Thus, 24 h after pretreatment with B. maydis or S. nodorum, the penetration frequency from D. teres appressoria was reduced from 42.7% in the controls to 9.5 and 14.8%, respectively. The reductions were associated with increased formation of fluorescent papillae in induced cells (early defense reaction). The postpenetrational inhibition of D. teres completely stopped fungal growth and was apparently linked to an enhancement of multicellular hypersensitive responses in inducer-treated leaves (late defense reaction). Papillae formation and multicellular hypersensitive reactions were also observed in fully susceptible, noninduced control leaves, but they were inadequate to stop fungal progress. Northern blots from leaves treated with either inducer alone support the conclusion that induced resistance is involved in suppression of D. teres by increased formation of papillae and hypersensitive reactions. Thus, the blots showed strong expression of several defense response genes that are involved in these reactions in barley attacked by Erysiphe graminis f. sp. hordei.

  9. Abscisic acid enhances resistance to Alternaria solani in tomato seedlings.

    PubMed

    Song, Weiwei; Ma, Xinrong; Tan, Hong; Zhou, Jinyan

    2011-07-01

    The plant hormone abscisic acid (ABA) is an important regulator in many aspects of plant growth and development, as well as stress resistance. Here, we investigated the effects of exogenous ABA application on the interaction between tomato (Solanum lycopersicon L.) and Alternaria solani (early blight). Foliar spraying of 7.58 μM ABA was effective in reducing disease severity in tomato plants. Previously, increased activities of phenylalanine ammonia-lyase (PAL), polyphenol oxidase (PPO) and peroxidase (POD) were observed in exogenous ABA-treated tomato leaves. Moreover, these enzyme activities were maintained at higher levels in ABA-pretreated and A. solani challenged tomato plants. Tomato defense genes, such as PR1, β-1, 3-glucanase (GLU), PPO, POD, and superoxide dismutase (SOD), were rapidly and significantly up-regulated by exogenous ABA treatment. Furthermore, a subsequent challenge of ABA-pretreated plants with the pathogen A. solani resulted in higher expression of defense genes, compared to water-treated or A. solani inoculated plants. Therefore, our results suggest that exogenous ABA could enhance disease resistance against A. solani infection in tomato through the activation of defense genes and via the enhancement of defense-related enzymatic activities.

  10. Eradication of Drug Resistant Staphylococcus aureus by Liposomal Oleic Acids

    PubMed Central

    Huang, Chun-Ming; Chen, Chao-Hsuan; Pornpattananangkul, Dissaya; Zhang, Li; Chan, Michael; Hsieh, Ming-Fa; Zhang, Liangfang

    2010-01-01

    Staphylococcus aureus (S. aureus) represents a major threat to a broad range of healthcare and community associated infections. This bacterium has rapidly evolved resistance to multiple drugs throughout its antibiotic history and thus it is imperative to develop novel antimicrobial strategies to enrich the currently shrinking therapeutic options against S. aureus. This study evaluated the antimicrobial activity and therapeutic efficacy of oleic acid (OA) in a liposomal formulation as an innate bactericide against methicillin-resistant S. aureus (MRSA). In vitro studies showed that these OA-loaded liposomes (LipoOA) could rapidly fuse into the bacterial membranes, thereby significantly improving the potency of OA to kill MRSA compared with the use of free OA. Further in vivo tests demonstrated that LipoOA were highly effective in curing skin infections caused by MRSA bacteria and preserving the integrity of the infected skin using a mouse skin model. Moreover, a preliminary skin toxicity study proved high biocompatibility of LipoOA to normal skin tissues. These findings suggest that LipoOA hold great potential to become a new, effective, and safe antimicrobial agent for the treatment of MRSA infections. PMID:20880576

  11. Engineering Porous Organic Cage Crystals with Increased Acid Gas Resistance.

    PubMed

    Zhu, Guanghui; Hoffman, Christopher D; Liu, Yang; Bhattacharyya, Souryadeep; Tumuluri, Uma; Jue, Melinda L; Wu, Zili; Sholl, David S; Nair, Sankar; Jones, Christopher W; Lively, Ryan P

    2016-07-25

    Both known and new CC3-based porous organic cages are prepared and exposed to acidic SO2 in vapor and liquid conditions. Distinct differences in the stability of the CC3 cages exist depending on the chirality of the diamine linkers used. The acid catalyzed CC3 degradation mechanism is probed via in situ IR and a degradation pathway is proposed and supported with computational results. CC3 crystals synthesized with racemic mixtures of diaminocyclohexane exhibited enhanced stability compared to CC3-R and CC3-S. Confocal fluorescent microscope images reveal that the stability difference in CC3 species originates from an abundance of mesoporous grain boundaries in CC3-R and CC3-S, allowing facile access of aqueous SO2 throughout the crystal, promoting decomposition. These grain boundaries are absent from CC3 crystals made with racemic linkers. PMID:27253350

  12. Antimicrobial Combinations against Pan-Resistant Acinetobacter baumannii Isolates with Different Resistance Mechanisms

    PubMed Central

    Leite, Gleice Cristina; Oliveira, Maura Salaroli; Perdigão-Neto, Lauro Vieira; Rocha, Cristiana Kamia Dias; Guimarães, Thais; Rizek, Camila; Levin, Anna Sara; Costa, Silvia Figueiredo

    2016-01-01

    The study investigated the effect of antibiotic combinations against 20 clinical isolates of A. baumannii (seven colistin-resistant and 13 colistin-susceptible) with different resistance mechanisms. Clinical data, treatment, and patient mortality were evaluated. The following methods were used: MIC, PCRs, and outer membrane protein (OMP) analysis. Synergy was investigated using the checkerboard and time-kill methods. Clonality was evaluated by PFGE. Based on clonality, the whole genome sequence of six A. baumannii isolates was analyzed. All isolates were resistant to meropenem, rifampicin, and fosfomycin. OXA-23 and OXA-143 were the most frequent carbapenemases found. Four isolates showed loss of a 43kDa OMP. The colistin-susceptible isolates belonged to different clones and showed the highest synergistic effect with fosfomycin-amikacin. Among colistin-resistant isolates, the highest synergistic effect was observed with the combinations of colistin-rifampicin followed by colistin-vancomycin. All colistin-resistant isolates harbored blaOXA-23-like and belonged to CC113. Clinical and demographic data were available for 18 of 20 patients. Fourteen received treatment and eight patients died during treatment. The most frequent site of infection was the blood in 13 of 14 patients. Seven patients received vancomycin plus an active drug against A. baumannii; however, mortality did not differ in this group. The synergistic effect was similar for colistin-susceptible isolates of distinct clonal origin presenting with the same resistance mechanism. Overall mortality and death during treatment was high, and despite the high synergism in vitro with vancomycin, death did not differ comparing the use or not of vancomycin plus an active drug against A. baumannii. PMID:26998609

  13. Cell biological mechanisms of multidrug resistance in tumors.

    PubMed

    Simon, S M; Schindler, M

    1994-04-26

    Multidrug resistance (MDR) is a generic term for the variety of strategies tumor cells use to evade the cytotoxic effects of anticancer drugs. MDR is characterized by a decreased sensitivity of tumor cells not only to the drug employed for chemotherapy but also to a broad spectrum of drugs with neither obvious structural homology nor common targets. This pleiotropic resistance is one of the major obstacles to the successful treatment of tumors. MDR may result from structural or functional changes at the plasma membrane or within the cytoplasm, cellular compartments, or nucleus. Molecular mechanisms of MDR are discussed in terms of modifications in detoxification and DNA repair pathways, changes in cellular sites of drug sequestration, decreases in drug-target affinity, synthesis of specific drug inhibitors within cells, altered or inappropriate targeting of proteins, and accelerated removal or secretion of drugs.

  14. Mechanisms of reef coral resistance to future climate change.

    PubMed

    Palumbi, Stephen R; Barshis, Daniel J; Traylor-Knowles, Nikki; Bay, Rachael A

    2014-05-23

    Reef corals are highly sensitive to heat, yet populations resistant to climate change have recently been identified. To determine the mechanisms of temperature tolerance, we reciprocally transplanted corals between reef sites experiencing distinct temperature regimes and tested subsequent physiological and gene expression profiles. Local acclimatization and fixed effects, such as adaptation, contributed about equally to heat tolerance and are reflected in patterns of gene expression. In less than 2 years, acclimatization achieves the same heat tolerance that we would expect from strong natural selection over many generations for these long-lived organisms. Our results show both short-term acclimatory and longer-term adaptive acquisition of climate resistance. Adding these adaptive abilities to ecosystem models is likely to slow predictions of demise for coral reef ecosystems.

  15. Cell Biological Mechanisms of Multidrug Resistance in Tumors

    NASA Astrophysics Data System (ADS)

    Simon, Sanford M.; Schindler, Melvin

    1994-04-01

    Multidrug resistance (MDR) is a generic term for the variety of strategies tumor cells use to evade the cytotoxic effects of anticancer drugs. MDR is characterized by a decreased sensitivity of tumor cells not only to the drug employed for chemotherapy but also to a broad spectrum of drugs with neither obvious structural homology nor common targets. This pleotropic resistance is one of the major obstacles to the successful treatment of tumors. MDR may result from structural or functional changes at the plasma membrane or within the cytoplasm, cellular compartments, or nucleus. Molecular mechanisms of MDR are discussed in terms of modifications in detoxification and DNA repair pathways, changes in cellular sites of drug sequestration, decreases in drug-target affinity, synthesis of specific drug inhibitors within cells, altered or inappropriate targeting of proteins, and accelerated removal or secretion of drugs.

  16. Mycoplasma bovis: Mechanisms of Resistance and Trends in Antimicrobial Susceptibility

    PubMed Central

    Lysnyansky, Inna; Ayling, Roger D.

    2016-01-01

    Mycoplasma bovis is a cell-wall-less bacterium and belongs to the class Mollicutes. It is the most important etiological agent of bovine mycoplasmoses in North America and Europe, causing respiratory disease, mastitis, otitis media, arthritis, and reproductive disease. Clinical disease associated with M. bovis is often chronic, debilitating, and poorly responsive to antimicrobial therapy, resulting in significant economic loss, the full extent of which is difficult to estimate. Until M. bovis vaccines are universally available, sanitary control measures and antimicrobial treatment are the only approaches that can be used in attempts to control M. bovis infections. However, in vitro studies show that many of the current M. bovis isolates circulating in Europe have high minimum inhibitory concentrations (MIC) for many of the commercially available antimicrobials. In this review we summarize the current MIC trends indicating the development of antimicrobial resistance in M. bovis as well as the known molecular mechanisms by which resistance is acquired. PMID:27199926

  17. Mechanism of single-layer 193-nm dissolution inhibition resist

    NASA Astrophysics Data System (ADS)

    Yan, Zhenglin; Houlihan, Francis M.; Reichmanis, Elsa; Nalamasu, Omkaram; Reiser, Arnost; Dabbagh, Gary; Hutton, Richard S.; Osei, Dan; Sousa, Jose; Bolan, Kevin J.

    2000-06-01

    We have found that the progress of developer base into films of terpolymers of norbornene (NB)-maleic anhydride (MA) and acrylic acid (AA) is a percolation process with a critical site concentration of x(c) equals 0.084 which suggests that every acrylic acid site in the terpolymer of norbornene-maleic anhydride-acrylic acid can make 12 monomer units of the polymer water compatible. In practice these systems are being used with various tert-butyl esters of cholic acid as dissolution inhibitors. The cholates differ very much in their dissolution inhibition factors (lowest t-butyl cholate (1.3) to highest t-butyl lithocholate glutarate dimer (7.4). The change in these factors corrected for molarity follow the hydrophobic character of the dissolution as measured by log(p). A quick screening method has also been established to evaluate dissolution inhibitors based on our observation that the cloud point (the volume % acetone in a water/acetone which gives persistent cloudiness) parallels the dissolution inhibiting power as measured by the dissolution inhibition factor. For dissolution promotion, optimal results are obtained with t-butyl 1,3,5-cyclohexanetricarboxylate (f equals -6.3) and poorest results with t-butyl lithocholate (f equals -2.8); this appears to track with the number of carboxyl groups and the hydrophobicity of the carboxylic acids. The Rmax found for resist formulations tracks well with these findings. Another factor in determining the ultimate achievable contrast is the degree of acidolytic deprotection achieved by the material. It appears that acidolyticaly cleaveable carboxylate esters with a higher concentration of electron withdrawing groups such as t-butyl 1,3,5-cyclohexanetricarboxylate are more effective.

  18. Molecular genetics of para-aminosalicylic acid resistance in clinical isolates and spontaneous mutants of Mycobacterium tuberculosis.

    PubMed

    Mathys, Vanessa; Wintjens, René; Lefevre, Philippe; Bertout, Julie; Singhal, Amit; Kiass, Mehdi; Kurepina, Natalia; Wang, Xiao-Ming; Mathema, Barun; Baulard, Alain; Kreiswirth, Barry N; Bifani, Pablo

    2009-05-01

    The emergence of Mycobacterium tuberculosis resistant to first-line antibiotics has renewed interest in second-line antitubercular agents. Here, we aimed to extend our understanding of the mechanisms underlying para-aminosalicylic acid (PAS) resistance by analysis of six genes of the folate metabolic pathway and biosynthesis of thymine nucleotides (thyA, dfrA, folC, folP1, folP2, and thyX) and three N-acetyltransferase genes [nhoA, aac(1), and aac(2)] among PAS-resistant clinical isolates and spontaneous mutants. Mutations in thyA were identified in only 37% of the clinical isolates and spontaneous mutants. Overall, 24 distinct mutations were identified in the thyA gene and 3 in the dfrA coding region. Based on structural bioinformatics techniques, the altered ThyA proteins were predicted to generate an unfolded or dysfunctional polypeptide. The MIC was determined by Bactec/Alert and dilution assay. Sixty-three percent of the PAS-resistant isolates had no mutations in the nine genes considered in this study, revealing that PAS resistance in M. tuberculosis involves mechanisms or targets other than those pertaining to the biosynthesis of thymine nucleotides. The alternative mechanism(s) or pathway(s) associated with PAS resistance appears to be PAS concentration dependent, in marked contrast to thyA-mutated PAS-resistant isolates.

  19. Eubacterium rangiferina, a novel usnic acid-resistant bacterium from the reindeer rumen

    NASA Astrophysics Data System (ADS)

    Sundset, Monica A.; Kohn, Alexandra; Mathiesen, Svein D.; Præsteng, Kirsti E.

    2008-08-01

    Reindeer are able to eat and utilize lichens as an important source of energy and nutrients. In the current study, the activities of antibiotic secondary metabolites including usnic, antranoric, fumarprotocetraric, and lobaric acid commonly found in lichens were tested against a collection of 26 anaerobic rumen bacterial isolates from reindeer ( Rangifer tarandus tarandus) using the agar diffusion method. The isolates were identified based on their 16S ribosomal ribonucleic acid (rRNA) gene sequences. Usnic acid had a potent antimicrobial effect against 25 of the isolates, belonging to Clostridiales, Enterococci, and Streptococci. Isolates of Clostridia and Streptococci were also susceptible to atranoric and lobaric acid. However, one isolate (R3_91_1) was found to be resistant to usnic, antranoric, fumarprotocetraric, and lobaric acid. R3_91_1 was also seen invading and adhering to lichen particles when grown in a liquid anaerobic culture as demonstrated by transmission electron microscopy. This was a Gram-negative, nonmotile rod (0.2-0.7 × 2.0-3.5 μm) with a deoxyribonucleic acid G + C content of 47.0 mol% and main cellular fatty acids including 15:0 anteiso-dimethyl acetal (DMA), 16:0 iso-fatty acid methyl ester (FAME), 13:0 iso-3OH FAME, and 17:0 anteiso-FAME, not matching any of the presently known profiles in the MIDI database. Combined, the phenotypic and genotypic traits including the 16S rRNA gene sequence show that R3_91_1 is a novel species inside the order Clostridiales within the family Lachnospiraceae, for which we propose the name Eubacterium rangiferina. This is the first record of a rumen bacterium able to tolerate and grow in the presence of usnic acid, indicating that the rumen microorganisms in these animals have adapted mechanisms to deal with lichen secondary metabolites, well known for their antimicrobial and toxic effects.

  20. Nanoparticle mechanics: deformation detection via nanopore resistive pulse sensing

    NASA Astrophysics Data System (ADS)

    Darvish, Armin; Goyal, Gaurav; Aneja, Rachna; Sundaram, Ramalingam V. K.; Lee, Kidan; Ahn, Chi Won; Kim, Ki-Bum; Vlahovska, Petia M.; Kim, Min Jun

    2016-07-01

    Solid-state nanopores have been widely used in the past for single-particle analysis of nanoparticles, liposomes, exosomes and viruses. The shape of soft particles, particularly liposomes with a bilayer membrane, can greatly differ inside the nanopore compared to bulk solution as the electric field inside the nanopores can cause liposome electrodeformation. Such deformations can compromise size measurement and characterization of particles, but are often neglected in nanopore resistive pulse sensing. In this paper, we investigated the deformation of various liposomes inside nanopores. We observed a significant difference in resistive pulse characteristics between soft liposomes and rigid polystyrene nanoparticles especially at higher applied voltages. We used theoretical simulations to demonstrate that the difference can be explained by shape deformation of liposomes as they translocate through the nanopores. Comparing our results with the findings from electrodeformation experiments, we demonstrated that the rigidity of liposomes can be qualitatively compared using resistive pulse characteristics. This application of nanopores can provide new opportunities to study the mechanics at the nanoscale, to investigate properties of great value in fundamental biophysics and cellular mechanobiology, such as virus deformability and fusogenicity, and in applied sciences for designing novel drug/gene delivery systems.Solid-state nanopores have been widely used in the past for single-particle analysis of nanoparticles, liposomes, exosomes and viruses. The shape of soft particles, particularly liposomes with a bilayer membrane, can greatly differ inside the nanopore compared to bulk solution as the electric field inside the nanopores can cause liposome electrodeformation. Such deformations can compromise size measurement and characterization of particles, but are often neglected in nanopore resistive pulse sensing. In this paper, we investigated the deformation of various

  1. [Evolution as resistance to entropy. I. Mechanisms of species homeostasis].

    PubMed

    Shcherbakov, V P

    2005-01-01

    The idea is discussed that the common output of any evolution is creation of the entities that are increasingly resistant to further evolution. The moving force of evolution is entropy, the tendency to disorder. This general aspiration for chaos is a cause of the mortality of organisms and species, however, being prerequisite for any movement, it creates (by chance) novelties, which may occur (by chance) more resistant to further decay and thus survive. The surviving of those who survive is the most general principle of evolution discovered by Darwin for particular case of biological evolution. The second law of thermodynamics states that our Universe is perishing but its ontology is such that it creates resistance to destruction. The evolution is a history of this resistance. Not only those who die do not survive but also those who evolve. The entities that change (evolve) rapidly disappear rapidly and by this reason they are not observed among both the fossils and now-living organisms. We know only about long-living species. All the existing organisms are endowed with an ability to resist other changing. The following main achievements of the species homeostasis are discussed: high fidelity of DNA replication and effective mechanisms of DNA repair; diploidy; normalizing selection; truncated selection; heterozygote superiority; ability to change phenotype adaptively without changing genotype; parental care and the K-strategy of reproduction; behavior that provides independence of the environment. The global resistance of the living systems to entropy is provided the state that all the essential in biology is determined not by physical-chemical interactions but could semantic rules. A conception of "potential zygotic information" that determines the rules of ontogenesis is proposed. A zygote does not contain this information in explicit form. It is created de novo step by step during ontogenesis and it could not be decoded beforehand. The experimental data on the

  2. D-Erythroascorbic acid activates cyanide-resistant respiration in Candida albicans.

    PubMed

    Huh, Won-Ki; Song, Yong Bhum; Lee, Young-Seok; Ha, Cheol Woong; Kim, Seong-Tae; Kang, Sa-Ouk

    2008-05-01

    Higher plants, protists and fungi possess cyanide-resistant respiratory pathway, which is mediated by alternative oxidase (AOX). The activity of AOX has been found to be dependent on several regulatory mechanisms including gene expression and posttranslational regulation. In the present study, we report that the presence of cyanide in culture medium remarkably retarded the growth of alo1/alo1 mutant of Candida albicans, which lacks d-arabinono-1,4-lactone oxidase (ALO) that catalyzes the final step of d-erythroascorbic acid (EASC) biosynthesis. Measurement of respiratory activity and Western blot analysis revealed that increase in the intracellular EASC level induces the expression of AOX in C. albicans. AOX could still be induced by antimycin A, a respiratory inhibitor, in the absence of EASC, suggesting that several factors may act in parallel pathways to induce the expression of AOX. Taken together, our results suggest that EASC plays important roles in activation of cyanide-resistant respiration in C. albicans.

  3. Development, stability, and molecular mechanisms of macrolide resistance in Campylobacter jejuni.

    PubMed

    Caldwell, Dave Bryson; Wang, Ying; Lin, Jun

    2008-11-01

    Previous studies of macrolide resistance in Campylobacter were primarily focused on strains from various origins or used in vitro systems. In this study, we conducted both in vitro and in vivo experiments to examine the development, stability, and genetic basis of macrolide resistance in Campylobacter jejuni using erythromycin-resistant (Ery(r)) mutants derived from the same parent strain. Chickens inoculated with low-level Ery(r) mutants (MIC = 32 or 64 microg/ml) at 15 days old did not shed highly Ery(r) mutants (MIC > 512 microg/ml) after prolonged exposure to a low dose of tylosin. The low-level Ery resistance was not stable in vitro or in vivo in the absence of macrolide selection pressure. However, high-level Ery resistance displayed remarkable stability in vitro and in vivo. Ribosomal sequence analysis of 69 selected Ery(r) mutants showed that specific point mutations (A2074G or A2074C) occurred in all highly Ery(r) mutants. No mutations in ribosomal protein L4 were observed in any of the in vitro-selected Ery(r) mutants. However, three specific mutations in L4, G74D, G57D, and G57V, were widely found among in vivo-selected Ery(r) mutants. Insertion of three amino acids, TSH, at position 98 in ribosomal protein L22 was observed only in mutants selected in vitro. Inactivation of the CmeABC efflux pump dramatically reduced Ery MICs in Ery(r) mutants. Together, these findings suggest that multiple factors contribute to the emergence of highly Ery(r) Campylobacter in chicken, reveal resistance level-dependent stability of macrolide resistance in C. jejuni, and indicate that C. jejuni utilizes complex and different mechanisms to develop Ery resistance in vitro and in vivo. PMID:18779354

  4. Resistance to butyrate impairs bile acid-induced apoptosis in human colon adenocarcinoma cells via up-regulation of Bcl-2 and inactivation of Bax.

    PubMed

    Barrasa, Juan I; Santiago-Gómez, Angélica; Olmo, Nieves; Lizarbe, María Antonia; Turnay, Javier

    2012-12-01

    A critical risk factor in colorectal carcinogenesis and tumor therapy is the resistance to the apoptotic effects of different compounds from the intestinal lumen, among them butyrate (main regulator of colonic epithelium homeostasis). Insensitivity to butyrate-induced apoptosis yields resistance to other agents, as bile acids or chemotherapy drugs, allowing the selective growth of malignant cell subpopulations. Here we analyze bile acid-induced apoptosis in a butyrate-resistant human colon adenocarcinoma cell line (BCS-TC2.BR2) to determine the mechanisms that underlay the resistance to these agents in comparison with their parental butyrate-sensitive BCS-TC2 cells. This study demonstrates that DCA and CDCA still induce apoptosis in butyrate-resistant cells through increased ROS production by activation of membrane-associated enzymes and subsequent triggering of the intrinsic mitochondrial apoptotic pathway. Although this mechanism is similar to that described in butyrate-sensitive cells, cell viability is significantly higher in resistant cells. Moreover, butyrate-resistant cells show higher Bcl-2 levels that confer resistance to bile acid-induced apoptosis sequestering Bax and avoiding Bax-dependent pore formation in the mitochondria. We have confirmed that this resistance is reverted using the Bcl-2 inhibitor ABT-263, thus demonstrating that the lower sensitivity of butyrate-resistant cells to the apoptotic effects of bile acids is mainly due to increased Bcl-2 levels.

  5. Modeling spray/puddle dissolution processes for deep-ultraviolet acid-hardened resists

    NASA Astrophysics Data System (ADS)

    Hutchinson, John M.; Das, Siddhartha; Qian, Qi-De; Gaw, Henry T.

    1993-10-01

    A study of the dissolution behavior of acid-hardened resists (AHR) was undertaken for spray and spray/puddle development processes. The Site Services DSM-100 end-point detection system is used to measure both spray and puddle dissolution data for a commercially available deep-ultraviolet AHR resist, Shipley SNR-248. The DSM allows in situ measurement of dissolution rate on the wafer chuck and hence allows parameter extraction for modeling spray and puddle processes. The dissolution data for spray and puddle processes was collected across a range of exposure dose and postexposure bake temperature. The development recipe was varied to decouple the contribution of the spray and puddle modes to the overall dissolution characteristics. The mechanisms involved in spray versus puddle dissolution and the impact of spray versus puddle dissolution on process performance metrics has been investigated. We used the effective-dose-modeling approach and the measurement capability of the DSM-100 and developed a lumped parameter model for acid-hardened resists that incorporates the effects of exposure, postexposure bake temperature and time, and development condition. The PARMEX photoresist-modeling program is used to determine parameters for the spray and for the puddle process. The lumped parameter AHR model developed showed good agreement with experimental data.

  6. Resistance mechanisms and drug susceptibility testing of nontuberculous mycobacteria.

    PubMed

    van Ingen, Jakko; Boeree, Martin J; van Soolingen, Dick; Mouton, Johan W

    2012-06-01

    Nontuberculous mycobacteria (NTM) are increasingly recognized as causative agents of opportunistic infections in humans. For most NTM infections the therapy of choice is drug treatment, but treatment regimens differ by species, in particular between slow (e.g. Mycobacterium avium complex, Mycobacterium kansasii) and rapid growers (e.g. Mycobacterium abscessus, Mycobacterium fortuitum). In general, drug treatment is long, costly, and often associated with drug-related toxicities; outcome of drug treatment is poor and is likely related to the high levels of natural antibiotic resistance in NTM. The role of drug susceptibility testing (DST) in the choice of agents for antimicrobial treatment of NTM disease, mainly that by slow growers, remains subject of debate. There are important discrepancies between drug susceptibility measured in vitro and the activity of the drug observed in vivo. In part, these discrepancies derive from laboratory technical issues. There is still no consensus on a standardized method. With the increasing clinical importance of NTM disease, DST of NTM is again in the spotlight. This review provides a comprehensive overview of the mechanisms of drug resistance in NTM, phenotypic methods for testing susceptibility in past and current use for DST of NTM, as well as molecular approaches to assess drug resistance.

  7. The tokamak density limit: A thermo-resistive disruption mechanism

    SciTech Connect

    Gates, D. A.; Brennan, D. P.; Delgado-Aparicio, L.; White, R. B.

    2015-06-15

    The behavior of magnetic islands with 3D electron temperature and the corresponding 3D resistivity effects on growth are examined for islands with near-zero net heating in the island interior. We refer to the resulting class of non-linearities as thermo-resistive effects. In particular, the effects of varying impurity mix on the previously proposed local island onset threshold [Gates and Delgado-Aparicio, Phys. Rev. Lett. 108, 165004 (2012)] are examined and shown to be consistent with the well established experimental scalings for tokamaks at the density limit. A surprisingly simple semi-analytic theory is developed which imposes the effects of heating/cooling in the island interior as well as the effects of island geometry. For the class of current profiles considered, it is found that a new term that accounts for the thermal effects of island asymmetry is required in the modified Rutherford equation. The resultant model is shown to exhibit a robust onset of a rapidly growing tearing mode—consistent with the disruption mechanism observed at the density limit in tokamaks. A fully non-linear 3D cylindrical calculation is performed that simulates the effect of net island heating/cooling by raising/suppressing the temperature in the core of the island. In both the analytic theory and the numerical simulation, the sudden threshold for rapid growth is found to be due to an interaction between three distinct thermal non-linearities which affect the island resistivity, thereby modifying the growth dynamics.

  8. Strengthening mechanisms and mechanical properties of high interstitial stainless steel for drill collar and its corrosion resistance

    NASA Astrophysics Data System (ADS)

    Lee, Eunkyung

    Two types (CN66, CN71) of high interstitial stainless steels (HISSs) were investigated for down-hole application in sour gas well environments. Experiments were designed to identify factors that have a significant effect on mechanical properties. The three factors examined in the study were carbon + nitrogen content (0.66 or 0.71 mass %), cooling rate in quenching (air or water), and heat treatment time (2 or 4 hours). The results showed that the cooling rate, C+N content, and the two-factor interaction of these variables have a significant effect on the mechanical properties of HISSs. Based on the statistical analysis results on mechanical properties, extensive analyses were undertaken to understand the strengthening mechanisms of HISSs. Microstructure analysis revealed that a pearlite phase with a high carbide and/or nitride content is dissolved in the matrix by heat treatment at 1,200 ºC which is considered the dissolution to increase the concentration of interstitial elements in steels. The distribution of elements in HISSs was investigated by quantitative mapping using EPMA, which showed that the high carbon concentration (carbide/cementite) area was decreased by increases in both the cooling rate and C+N content. The ferrite volume fraction of each specimen is increased by an increase in cooling rate, because there is insufficient time to form austenite from retained ferrite. The lattice expansion of HISS was investigated by the calculation of lattice parameters under various conditions, and these investigations confirm the solid solution strengthening effect on HISSs. CN66 with heat treatment at fast cooling has the highest wear resistance; a finding that was consistent with hardening mechanisms that occur due to an increased ferrite volume fraction. In addition, precipitates on the surface and the chemical bonding of chromium were investigated. As the amount of CrN bonding increased, the wear resistance also increased. This study also assessed the

  9. Intestinal regeneration as an insect resistance mechanism to entomopathogenic bacteria.

    PubMed

    Castagnola, Anaïs; Jurat-Fuentes, Juan Luis

    2016-06-01

    The intestinal epithelium of insects is exposed to xenobiotics and entomopathogens during the feeding developmental stages. In these conditions, an effective enterocyte turnover mechanism is highly desirable to maintain integrity of the gut epithelial wall. As in other insects, the gut of lepidopteran larvae have stem cells that are capable of proliferation, which occurs during molting and pathogenic episodes. While much is known on the regulation of gut stem cell division during molting, there is a current knowledge gap on the molecular regulation of gut healing processes after entomopathogen exposure. Relevant information on this subject is emerging from studies of the response to exposure to insecticidal proteins from the bacterium Bacillus thuringiensis (Bt) as model intoxicants. In this work we discuss currently available data on the molecular cues involved in gut stem cell proliferation, insect gut healing, and the implications of enhanced healing as a potential mechanism of resistance against Bt toxins. PMID:27436739

  10. Nucleotide precursors prevent folic acid-resistant neural tube defects in the mouse.

    PubMed

    Leung, Kit-Yi; De Castro, Sandra C P; Savery, Dawn; Copp, Andrew J; Greene, Nicholas D E

    2013-09-01

    Closure of the neural tube during embryogenesis is a crucial step in development of the central nervous system. Failure of this process results in neural tube defects, including spina bifida and anencephaly, which are among the most common birth defects worldwide. Maternal use of folic acid supplements reduces risk of neural tube defects but a proportion of cases are not preventable. Folic acid is thought to act through folate one-carbon metabolism, which transfers one-carbon units for methylation reactions and nucleotide biosynthesis. Hence suboptimal performance of the intervening reactions could limit the efficacy of folic acid. We hypothesized that direct supplementation with nucleotides, downstream of folate metabolism, has the potential to support neural tube closure. Therefore, in a mouse model that exhibits folic acid-resistant neural tube defects, we tested the effect of specific combinations of pyrimidine and purine nucleotide precursors and observed a significant protective effect. Labelling in whole embryo culture showed that nucleotides are taken up by the neurulating embryo and incorporated into genomic DNA. Furthermore, the mitotic index was elevated in neural folds and hindgut of treated embryos, consistent with a proposed mechanism of neural tube defect prevention through stimulation of cellular proliferation. These findings may provide an impetus for future investigations of supplemental nucleotides as a means to prevent a greater proportion of human neural tube defects than can be achieved by folic acid alone.

  11. Nucleotide precursors prevent folic acid-resistant neural tube defects in the mouse.

    PubMed

    Leung, Kit-Yi; De Castro, Sandra C P; Savery, Dawn; Copp, Andrew J; Greene, Nicholas D E

    2013-09-01

    Closure of the neural tube during embryogenesis is a crucial step in development of the central nervous system. Failure of this process results in neural tube defects, including spina bifida and anencephaly, which are among the most common birth defects worldwide. Maternal use of folic acid supplements reduces risk of neural tube defects but a proportion of cases are not preventable. Folic acid is thought to act through folate one-carbon metabolism, which transfers one-carbon units for methylation reactions and nucleotide biosynthesis. Hence suboptimal performance of the intervening reactions could limit the efficacy of folic acid. We hypothesized that direct supplementation with nucleotides, downstream of folate metabolism, has the potential to support neural tube closure. Therefore, in a mouse model that exhibits folic acid-resistant neural tube defects, we tested the effect of specific combinations of pyrimidine and purine nucleotide precursors and observed a significant protective effect. Labelling in whole embryo culture showed that nucleotides are taken up by the neurulating embryo and incorporated into genomic DNA. Furthermore, the mitotic index was elevated in neural folds and hindgut of treated embryos, consistent with a proposed mechanism of neural tube defect prevention through stimulation of cellular proliferation. These findings may provide an impetus for future investigations of supplemental nucleotides as a means to prevent a greater proportion of human neural tube defects than can be achieved by folic acid alone. PMID:23935126

  12. Role of volatile fatty acids in colonization resistance to Clostridium difficile in gnotobiotic mice.

    PubMed Central

    Su, W J; Waechter, M J; Bourlioux, P; Dolegeal, M; Fourniat, J; Mahuzier, G

    1987-01-01

    Clostridium difficile is an agent involved in the development of antibiotic-associated pseudomembranous colitis. The purpose of this work was to investigate the role of volatile fatty acids (VFAs) in resistance to colonization by C. difficile by using a gnotobiotic animal model. Accordingly, germfree mice were associated with different hamster flora, and the VFAs in their cecal contents were measured by gas chromatography. The results showed that VFAs were produced mainly by the intestinal flora, especially by the strictly anaerobic bacteria. In these associated mice, the concentrations of acetic, propionic, and butyric acids were higher than those of other acids, but at pH 6.8 the MICs of these three acids in vitro for C. difficile were more than 200 mu eq/ml. In gnotobiotic mice monoassociated with C. difficile and in the isolated ceca of these mice, VFAs did not inhibit the growth of C. difficile. In gnotobiotic mice which were diassociated with C. difficile and C. butyricum and given drinking water with a lactose concentration of 20%, the cecal contents included about the same amount of butyric acid as did those of the monoassociated mice, although the population of C. difficile remained the same. Therefore, it is suggested that VFAs alone cannot inhibit intestinal colonization by C. difficile and that, consequently, other inhibitory mechanisms are also present. PMID:3596806

  13. Characterization of Spectinomycin Resistance in Streptococcus suis Leads to Two Novel Insights into Drug Resistance Formation and Dissemination Mechanism.

    PubMed

    Huang, Kaisong; Zhang, Qiang; Song, Yajing; Zhang, Zhewen; Zhang, Anding; Xiao, Jingfa; Jin, Meilin

    2016-10-01

    Spectinomycin is an aminocyclitol antibiotic used clinically to treat a variety of infections in animals. Here, we characterized drug resistance prevalence in clinical Streptococcus suis isolates and discovered a novel resistance mechanism in which the s5 mutation (Gly26Asp) results in high spectinomycin resistance. Additionally, a novel integrative and conjugative element encompassing a multidrug resistance spw_like-aadE-lnu(B)-lsa(E) cluster and a cadmium resistance operon were identified, suggesting a possible cause for the wide dissemination of spectinomycin resistance in S. suis.

  14. Contribution of cell walls, nonprotein thiols, and organic acids to cadmium resistance in two cabbage varieties.

    PubMed

    Sun, Jianyun; Cui, Jin; Luo, Chunling; Gao, Lu; Chen, Yahua; Shen, Zhenguo

    2013-02-01

    To study possible cadmium (Cd) resistance mechanisms in cabbage (Brassica oleracea L.), several parameters of metal uptake, distribution, and complexation were compared between two varieties Chunfeng [CF (Cd-tolerant)] and Lvfeng [LF (Cd-sensitive)]. Results showed that CF contained significantly lower Cd concentrations in leaves and higher Cd concentrations in roots than LF. Approximately 70 to 74 % and 66 to 68 % of Cd taken up by LF and CF, respectively, was transported to shoots. More Cd was bound to the cell walls of leaves, stems, and roots in CF than in LF. The higher capacity of CF to limit Cd uptake into shoots could be explained by immobilization of Cd in root cell walls. Compared with control groups, Cd treatment also significantly increased concentrations of nonprotein thiols, phytochelatins (PCs), and citric acid in the leaves and roots of the two varieties; the increases were more pronounced in CF than in LF. Taken together, the results suggest that the greater Cd resistance in CF than in LF may be attributable to the greater capacity of CF to limit Cd uptake into shoots and complex Cd in cell walls and metal binding ligands, such as PCs and citric acid. However, the contributions of PCs and citric acid to Cd detoxification might be smaller than those in cell walls.

  15. Resistance to antiplatelet drugs: molecular mechanisms and laboratory detection.

    PubMed

    Cattaneo, M

    2007-07-01

    The definition 'resistance to antiplatelet drugs' should be limited to situations in which failure of the drug to hit its pharmacological target has been documented by specific laboratory tests. Aspirin resistance, as determined by specific tests (e.g. serum thromboxane B(2)), appears to be rare (1-2%) and, in most instances, is caused by poor compliance. In contrast to aspirin, studies that used specific tests to measure the pharmacological effect of thienopyridines [e.g. vasodilator-stimulated phosphoprotein (VASP)] showed a wide variability of responses to these drugs, with significant proportions of subjects (15-30%) who are very poor responders. Inter-individual differences in the extent of metabolism of thienopyridines to their active metabolites is the most plausible mechanism for the observed inter-individual variability in platelet inhibition. The demonstration that some patients may be 'resistant' or 'poor responders' to the pharmacological effect of antiplatelet drugs, has prompted the need of laboratory monitoring of antiplatelet therapy. However, many published studies have been performed using unspecific tests of platelet function, which identify patients on antiplatelet treatment with high residual platelet reactivity, which is not necessarily because of resistance to antiplatelet drugs. Despite this drawback, identification of patients with high residual platelet reactivity may be useful to predict their risk of atherothrombotic events. However, many studies still need to be carried out to identify the ideal laboratory test and to answer basic questions on its clinical utility and cost-effectiveness, before monitoring antiplatelet therapy can be recommended in the clinical practise. Until then, monitoring of antiplatelet therapy should be considered for investigational purposes only. PMID:17635731

  16. [Insulin resistance as a mechanism of adaptation during human evolution].

    PubMed

    Ricart, W; Fernández-Real, J M

    2010-10-01

    The recent application of concepts of evolution to human disease is proving useful to understand certain pathophysiological mechanisms of different entities that span genomic alterations of immunity, respiratory and hormone function, and the circulatory and neural systems. However, effort has concentrated on explaining the keys to adaptation that define human metabolism and, since the early 1960s, several theories have been developed. This article reviews some of the hypotheses postulated in recent years on the potential benefit of insulin resistance and discusses the most recent knowledge. The concept of the thrifty gene seems to have been definitively refuted by current knowledge. The current paradigm describes an interaction between the metabolic and the immune systems resulting from their coevolution, promoted by evolutionary pressures triggered by fasting, infection and intake of different foods. The activation and regulation of these ancient mechanisms in integrated and interdependent areas defines insulin resistance as a survival strategy that is critical during fasting and in the fight against infection. The relationship with some components of the diet and, particularly, with the symbiotic intestinal microflora points to new paradigms in understanding the pathophysiology of obesity, metabolic syndrome and type 2 diabetes mellitus.

  17. [Insulin resistance as a mechanism of adaptation during human evolution].

    PubMed

    Ricart, W; Fernández-Real, J M

    2010-10-01

    The recent application of concepts of evolution to human disease is proving useful to understand certain pathophysiological mechanisms of different entities that span genomic alterations of immunity, respiratory and hormone function, and the circulatory and neural systems. However, effort has concentrated on explaining the keys to adaptation that define human metabolism and, since the early 1960s, several theories have been developed. This article reviews some of the hypotheses postulated in recent years on the potential benefit of insulin resistance and discusses the most recent knowledge. The concept of the thrifty gene seems to have been definitively refuted by current knowledge. The current paradigm describes an interaction between the metabolic and the immune systems resulting from their coevolution, promoted by evolutionary pressures triggered by fasting, infection and intake of different foods. The activation and regulation of these ancient mechanisms in integrated and interdependent areas defines insulin resistance as a survival strategy that is critical during fasting and in the fight against infection. The relationship with some components of the diet and, particularly, with the symbiotic intestinal microflora points to new paradigms in understanding the pathophysiology of obesity, metabolic syndrome and type 2 diabetes mellitus. PMID:20675202

  18. Hypergravity experiments to evaluate gravity resistance mechanisms in plants.

    PubMed

    Soga, Kouichi; Yano, Sachiko; Matsumoto, Shouhei; Hoson, Takayuki

    2015-01-01

    Hypergravity generated by centrifugal acceleration is the only practical method to modify the magnitude of gravitational acceleration for a sufficient duration on Earth and has been used to analyze the nature and mechanism of graviresponse, particularly gravity resistance, in plants. Plant organs are generally resistant to gravitational acceleration. Hypergravity produced from centrifugation speeds in the range of 10-300 × g, which is easily produced by a benchtop centrifuge, is often used during plant experiments. After centrifugation, the plant material is fixed with suitable fixatives in appropriate sample storage containers such as the Chemical Fixation Bag. The material is then analyzed with a variety of methods, depending on the purpose of the experiment. Plant material fixed with the RNAlater(®) solution can be sequentially used for determining the mechanical properties of the cell wall, for RNA extraction (which is necessary for gene expression analysis), for estimating the enzyme activity of the cell wall proteins, and for determining the levels as well as the compositions of cell wall polysaccharides. The plant material can also be used directly for microscopic observation of cellular components such as cortical microtubules.

  19. Candida parapsilosis Resistance to Fluconazole: Molecular Mechanisms and In Vivo Impact in Infected Galleria mellonella Larvae

    PubMed Central

    Souza, Ana Carolina R.; Fuchs, Beth Burgwyn; Pinhati, Henrique M. S.; Siqueira, Ricardo A.; Hagen, Ferry; Meis, Jacques F.

    2015-01-01

    Candida parapsilosis is the main non-albicans Candida species isolated from patients in Latin America. Mutations in the ERG11 gene and overexpression of membrane transporter proteins have been linked to fluconazole resistance. The aim of this study was to evaluate the molecular mechanisms in fluconazole-resistant strains of C. parapsilosis isolated from critically ill patients. The identities of the nine collected C. parapsilosis isolates at the species level were confirmed through molecular identification with a TaqMan qPCR assay. The clonal origin of the strains was checked by microsatellite typing. The Galleria mellonella infection model was used to confirm in vitro resistance. We assessed the presence of ERG11 mutations, as well as the expression of ERG11 and two additional genes that contribute to antifungal resistance (CDR1 and MDR1), by using real-time quantitative PCR. All of the C. parapsilosis (sensu stricto) isolates tested exhibited fluconazole MICs between 8 and 16 μg/ml. The in vitro data were confirmed by the failure of fluconazole in the treatment of G. mellonella infected with fluconazole-resistant strains of C. parapsilosis. Sequencing of the ERG11 gene revealed a common mutation leading to a Y132F amino acid substitution in all of the isolates, a finding consistent with their clonal origin. After fluconazole exposure, overexpression was noted for ERG11, CDR1, and MDR1 in 9/9, 9/9, and 2/9 strains, respectively. We demonstrated that a combination of molecular mechanisms, including the presence of point mutations in the ERG11 gene, overexpression of ERG11, and genes encoding efflux pumps, are involved in fluconazole resistance in C. parapsilosis. PMID:26259795

  20. Candida parapsilosis Resistance to Fluconazole: Molecular Mechanisms and In Vivo Impact in Infected Galleria mellonella Larvae.

    PubMed

    Souza, Ana Carolina R; Fuchs, Beth Burgwyn; Pinhati, Henrique M S; Siqueira, Ricardo A; Hagen, Ferry; Meis, Jacques F; Mylonakis, Eleftherios; Colombo, Arnaldo L

    2015-10-01

    Candida parapsilosis is the main non-albicans Candida species isolated from patients in Latin America. Mutations in the ERG11 gene and overexpression of membrane transporter proteins have been linked to fluconazole resistance. The aim of this study was to evaluate the molecular mechanisms in fluconazole-resistant strains of C. parapsilosis isolated from critically ill patients. The identities of the nine collected C. parapsilosis isolates at the species level were confirmed through molecular identification with a TaqMan qPCR assay. The clonal origin of the strains was checked by microsatellite typing. The Galleria mellonella infection model was used to confirm in vitro resistance. We assessed the presence of ERG11 mutations, as well as the expression of ERG11 and two additional genes that contribute to antifungal resistance (CDR1 and MDR1), by using real-time quantitative PCR. All of the C. parapsilosis (sensu stricto) isolates tested exhibited fluconazole MICs between 8 and 16 μg/ml. The in vitro data were confirmed by the failure of fluconazole in the treatment of G. mellonella infected with fluconazole-resistant strains of C. parapsilosis. Sequencing of the ERG11 gene revealed a common mutation leading to a Y132F amino acid substitution in all of the isolates, a finding consistent with their clonal origin. After fluconazole exposure, overexpression was noted for ERG11, CDR1, and MDR1 in 9/9, 9/9, and 2/9 strains, respectively. We demonstrated that a combination of molecular mechanisms, including the presence of point mutations in the ERG11 gene, overexpression of ERG11, and genes encoding efflux pumps, are involved in fluconazole resistance in C. parapsilosis.

  1. Molecular mechanisms of fluconazole resistance in Candida parapsilosis isolates from a U.S. surveillance system.

    PubMed

    Grossman, Nina T; Pham, Cau D; Cleveland, Angela A; Lockhart, Shawn R

    2015-02-01

    Candida parapsilosis is the second or third most common cause of candidemia in many countries. The Infectious Diseases Society of America recommends fluconazole as the primary therapy for C. parapsilosis candidemia. Although the rate of fluconazole resistance among C. parapsilosis isolates is low in most U.S. institutions, the resistance rate can be as high as 7.5%. This study was designed to assess the mechanisms of fluconazole resistance in 706 incident bloodstream isolates from U.S. hospitals. We sequenced the ERG11 and MRR1 genes of 122 C. parapsilosis isolates with resistant (30 isolates; 4.2%), susceptible dose-dependent (37 isolates; 5.2%), and susceptible (55 isolates) fluconazole MIC values and used real-time PCR of RNA from 17 isolates to investigate the regulation of MDR1. By comparing these isolates to fully fluconazole-susceptible isolates, we detected at least two mechanisms of fluconazole resistance: an amino acid substitution in the 14-α-demethylase gene ERG11 and overexpression of the efflux pump MDR1, possibly due to point mutations in the MRR1 transcription factor that regulates MDR1. The ERG11 single nucleotide polymorphism (SNP) was found in 57% of the fluconazole-resistant isolates and in no susceptible isolates. The MRR1 SNPs were more difficult to characterize, as not all resulted in overexpression of MDR1 and not all MDR1 overexpression was associated with an SNP in MRR1. Further work to characterize the MRR1 SNPs and search for overexpression of other efflux pumps is needed.

  2. Molecular level understanding of resistance to nalidixic acid in Salmonella enteric serovar typhimurium associates with the S83F sequence type.

    PubMed

    Preethi, B; Ramanathan, K

    2016-01-01

    Nalidixic acid is an antibiotic drug used for treatment of Salmonellosis, a gastrointestinal infection. DNA gyrase subunit A (GyrA) of Salmonella typhimurium is the drug target for nalidixic acid. Resistance of GyrA to nalidixic acid, because of a point mutation in S. typhimurium, was recently reported. Substitution of Phe in place of Ser at locus 83 in GyrA of S. typhimurium has been experimentally associated with nalidixic acid resistance. Despite recent efforts, the mechanism of this resistance is not well understood. In this investigation we used computational techniques to address this shortcoming. Our results showed that contact with residue Arg 91 is certainly important for efficient binding of nalidixic acid to the target protein, and that mutation of this residue results in 180° rotation of the antibiotic in its binding pocket, around its own long axis. It is hoped these findings may enable development of new antibiotics against resistant forms of Salmonella. PMID:26329667

  3. Mycobacterium tuberculosis folate metabolism and the mechanistic basis for para-aminosalicylic acid susceptibility and resistance.

    PubMed

    Minato, Yusuke; Thiede, Joshua M; Kordus, Shannon Lynn; McKlveen, Edward J; Turman, Breanna J; Baughn, Anthony D

    2015-09-01

    para-Aminosalicylic acid (PAS) entered clinical use in 1946 as the second exclusive drug for the treatment of tuberculosis (TB). While PAS was initially a first-line TB drug, the introduction of more potent antitubercular agents relegated PAS to the second-line tier of agents used for the treatment of drug-resistant Mycobacterium tuberculosis infections. Despite the long history of PAS usage, an understanding of the molecular and biochemical mechanisms governing the susceptibility and resistance of M. tuberculosis to this drug has lagged behind that of most other TB drugs. Herein, we discuss previous studies that demonstrate PAS-mediated disruption of iron acquisition, as well as recent genetic, biochemical, and metabolomic studies that have revealed that PAS is a prodrug that ultimately corrupts one-carbon metabolism through inhibition of the formation of reduced folate species. We also discuss findings from laboratory and clinical isolates that link alterations in folate metabolism to PAS resistance. These advancements in our understanding of the basis of the susceptibility and resistance of M. tuberculosis to PAS will enable the development of novel strategies to revitalize this and other antimicrobial agents for use in the global effort to eradicate TB.

  4. Mycobacterium tuberculosis Folate Metabolism and the Mechanistic Basis for para-Aminosalicylic Acid Susceptibility and Resistance

    PubMed Central

    Minato, Yusuke; Thiede, Joshua M.; Kordus, Shannon Lynn; McKlveen, Edward J.; Turman, Breanna J.

    2015-01-01

    para-Aminosalicylic acid (PAS) entered clinical use in 1946 as the second exclusive drug for the treatment of tuberculosis (TB). While PAS was initially a first-line TB drug, the introduction of more potent antitubercular agents relegated PAS to the second-line tier of agents used for the treatment of drug-resistant Mycobacterium tuberculosis infections. Despite the long history of PAS usage, an understanding of the molecular and biochemical mechanisms governing the susceptibility and resistance of M. tuberculosis to this drug has lagged behind that of most other TB drugs. Herein, we discuss previous studies that demonstrate PAS-mediated disruption of iron acquisition, as well as recent genetic, biochemical, and metabolomic studies that have revealed that PAS is a prodrug that ultimately corrupts one-carbon metabolism through inhibition of the formation of reduced folate species. We also discuss findings from laboratory and clinical isolates that link alterations in folate metabolism to PAS resistance. These advancements in our understanding of the basis of the susceptibility and resistance of M. tuberculosis to PAS will enable the development of novel strategies to revitalize this and other antimicrobial agents for use in the global effort to eradicate TB. PMID:26033719

  5. Non-Invasive Methods to Monitor Mechanisms of Resistance to Tyrosine Kinase Inhibitors in Non-Small-Cell Lung Cancer: Where Do We Stand?

    PubMed Central

    Ulivi, Paola

    2016-01-01

    The induction of resistance mechanisms represents an important problem for the targeted therapy of patients with non-small-cell lung cancer (NSCLC). The best-known resistance mechanism induced during treatment with epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitors (TKIs) is EGFR T790M mutation for which specific drugs are have been developed. However, other molecular alterations have also been reported as induced resistance mechanisms to EGFR-TKIs. Similarly, there is growing evidence of acquired resistance mechanisms to anaplastic lymphoma kinase (ALK)-TKI treatment. A better understanding of these acquired resistance mechanisms is essential in clinical practice as patients could be treated with specific drugs that are active against the induced alterations. The use of free circulating tumor nucleic acids or circulating tumor cells (CTCs) enables resistance mechanisms to be characterized in a non-invasive manner and reduces the need for tumor re-biopsy. This review discusses the main resistance mechanisms to TKIs and provides a comprehensive overview of innovative strategies to evaluate known resistance mechanisms in free circulating nucleic acids or CTCs and potential future orientations for these non-invasive approaches. PMID:27455248

  6. Putative ABC transporter responsible for acetic acid resistance in Acetobacter aceti.

    PubMed

    Nakano, Shigeru; Fukaya, Masahiro; Horinouchi, Sueharu

    2006-01-01

    Two-dimensional gel electrophoretic analysis of the membrane fraction of Acetobacter aceti revealed the presence of several proteins that were produced in response to acetic acid. A 60-kDa protein, named AatA, which was mostly induced by acetic acid, was prepared; aatA was cloned on the basis of its NH2-terminal amino acid sequence. AatA, consisting of 591 amino acids and containing ATP-binding cassette (ABC) sequences and ABC signature sequences, belonged to the ABC transporter superfamily. The aatA mutation with an insertion of the neomycin resistance gene within the aatA coding region showed reduced resistance to acetic acid, formic acid, propionic acid, and lactic acid, whereas the aatA mutation exerted no effects on resistance to various drugs, growth at low pH (adjusted with HCl), assimilation of acetic acid, or resistance to citric acid. Introduction of plasmid pABC101 containing aatA under the control of the Escherichia coli lac promoter into the aatA mutant restored the defect in acetic acid resistance. In addition, pABC101 conferred acetic acid resistance on E. coli. These findings showed that AatA was a putative ABC transporter conferring acetic acid resistance on the host cell. Southern blot analysis and subsequent nucleotide sequencing predicted the presence of aatA orthologues in a variety of acetic acid bacteria belonging to the genera Acetobacter and Gluconacetobacter. The fermentation with A. aceti containing aatA on a multicopy plasmid resulted in an increase in the final yield of acetic acid.

  7. Corrosion resistance and mechanical properties of alloy 803 for heat resisting applications

    SciTech Connect

    Ganesan, P.; Tassen, C.S.

    1997-08-01

    Alloy 803 was developed for applications as straight and twisted ID finned tubing in the petrochemical and chemical process industries, such as ethylene pyrolysis, that require enhanced resistance to oxidation and carburization in addition to adequate stress rupture strength. This paper presents the mechanical properties characterized for the alloy produced in other forms, such as plate, sheet and bar products, for applications in the heat treatment, chemical and petrochemical industries. The mechanical properties covered include room and high temperature tensile test results, impact strength, creep and stress rupture data for temperatures up to 2,000 F (1,093 C) at various stress levels. The preliminary results of the room and high temperature tensile and impact properties after long term exposures at intermediate temperatures are also presented. In addition to mechanical properties, the corrosion performance of alloy 803 in oxidation, sulfidation and carburization environments are presented.

  8. Survival mechanism of Escherichia coli O157:H7 against combined treatment with acetic acid and sodium chloride.

    PubMed

    Lee, Sun-Young; Kang, Dong-Hyun

    2016-05-01

    The combination of salt and acid is commonly used in the production of many foods, including pickles and fermented foods. However, in our previous studies, the addition of salt significantly reduced the inhibitory effect of acetic acid on Escherichia coli O157:H7 in laboratory media and pickled cucumbers. Therefore, this study was conducted to determine the mechanism by which salt confers resistance against acetic acid in E. coli O157:H7. The addition of high concentrations (up to 9% or 15% [w/v]) of salt increased the resistance of E. coli O157:H7 to acetic acid treatment. Combined treatment with acetic acid and salt showed varying results among different bacterial strains (an antagonistic effect for E. coli O157:H7 and Shigella and a synergistic effect for Listeria monocytogenes and Staphylococcus aureus). The addition of salt increased the cytoplasmic pH of E. coli O157:H7, but decreased the cytoplasmic pH of L. monocytogenes and S. aureus on treatment with acetic acid. Therefore, the addition of salt increases the acid resistance of E. coli O157:H7 possibly by increasing its acid resistance response and consequently preventing the acidification of its cytoplasm by organic acids.

  9. Increased amoxicillin-clavulanic acid resistance in Escherichia coli blood isolates, Spain.

    PubMed

    Oteo, Jesús; Campos, José; Lázaro, Edurne; Cuevas, Oscar; García-Cobos, Silvia; Pérez-Vázquez, María; de Abajo, F J

    2008-08-01

    To determine the evolution and trends of amoxicillin-clavulanic acid resistance among Escherichia coli isolates in Spain, we tested 9,090 blood isolates from 42 Spanish hospitals and compared resistance with trends in outpatient consumption. These isolates were collected by Spanish hospitals that participated in the European Antimicrobial Resistance Surveillance System network from April 2003 through December 2006. PMID:18680650

  10. Virulence factors and mechanisms of antimicrobial resistance in Shigella strains from periurban areas of Lima (Peru)

    PubMed Central

    Lluque, Angela; Mosquito, Susan; Gomes, Cláudia; Riveros, Maribel; Durand, David; Tilley, Drake H.; Bernal, María; Prada, Ana; Ochoa, Theresa J.; Ruiz, Joaquim

    2015-01-01

    The study was aimed to describe the serotype, mechanisms of antimicrobial resistance, and virulence determinants in Shigella spp. isolated from Peruvian children. Eighty three Shigella spp. were serogrouped and serotyped being established the antibiotic susceptibility. The presence of 12 virulence factors (VF) and integrase 1 and 2, along with commonly found antibiotic resistance genes was established by PCR. S. flexneri was the most relevant serogroup (55 isolates, 66%), with serotype 2a most frequently detected (27 of 55, 49%), followed by S. boydii and S. sonnei at 12 isolates each (14%) and S. dysenteriae (4 isolates, 5%). Fifty isolates (60%) were multi-drug resistant (MDR) including 100% of S. sonnei and 64% of S. flexneri. Resistance levels were high to trimethoprim-sulfamethoxazole (86%), tetracycline (74%), ampicillin (67%), and chloramphenicol (65%). Six isolates showed decreased azithromycin susceptibility. No isolate was resistant to nalidixic acid, ciprofloxacin, nitrofurantoin, or ceftriaxone. The most frequent resistance genes were sul2 (95%), tet(B) (92%), cat (80%), dfrA1 (47%), blaOXA-1 like (40%), with intl1 and intl2 detected in 51 and 52% of the isolates, respectively. Thirty-one different VF profiles were observed, being the ipaH (100%), sen (77%), virA and icsA (75%) genes the most frequently found. Differences in the prevalence of VF were observed between species with S. flexneri isolates, particularly serotype 2a, possessing high numbers of VF. In conclusion, this study highlights the high heterogeneity of Shigella VF and resistance genes, and prevalence of MDR organisms within this geographic region. PMID:25998616

  11. Renal clearance of uric acid is linked to insulin resistance and lower excretion of sodium in gout patients.

    PubMed

    Perez-Ruiz, Fernando; Aniel-Quiroga, Maria Angeles; Herrero-Beites, Ana María; Chinchilla, Sandra Pamela; Erauskin, Gorka Garcia; Merriman, Toni

    2015-09-01

    Inefficient renal excretion of uric acid is the main pathophysiological mechanism for hyperuricemia in gout patients. Polymorphisms of renal tubular transporters linked with sodium and monosaccharide transport have yet to be demonstrated. We intended to evaluate the impact of insulin resistance, evaluated with the homeostasis model assessment (HOMA), through a transversal study of non-diabetic patients with gout, with normal renal function, not treated with any medication but colchicine as prophylaxis. One hundred and thirty-three patients were evaluated. Clearance of uric acid was inversely correlated with insulin resistance and directly correlated with fractional excretion of sodium. In multivariate analysis, hypertension and hyperlipidemia, in addition to insulin resistance and fractional excretion of sodium, were associated with renal clearance of uric acid. HOMA cutoff for efficient versus inefficient renal handling of uric acid was 2.72, close to that observed in studies of reference population. The impact of insulin resistance and renal handling of sodium on renal clearance of uric acid may help to explain why hyperuricemia is more commonly associated with diabetes and hypertension. PMID:25763991

  12. Effects of sarA inactivation on the intrinsic multidrug resistance mechanism of Staphylococcus aureus.

    PubMed

    O'Leary, Jessica O; Langevin, Mark J; Price, Christopher T D; Blevins, Jon S; Smeltzer, Mark S; Gustafson, John E

    2004-08-15

    The sarA locus of Staphylococccus aureus regulates the synthesis of over 100 genes on the S. aureus chromosome. We now report the effects of sarA inactivation on intrinsic multidrug resistance expression by S. aureus. In a strain-dependent fashion, sarA::kan mutants of three unrelated strains of S. aureus demonstrated significantly increased susceptibility to five or more of the following substances: the antibiotics ciprofloxacin, fusidic acid, and vancomycin; the DNA-intercalating agent ethidium; and four common household cleaner formulations. In addition, all three sarA::kan mutants demonstrated significantly increased accumulation of ciprofloxacin and one sarA::kan mutant demonstrated increased ethidium accumulation. Our data therefore indicate that sarA plays a role in the intrinsic multidrug resistance mechanism expressed by S. aureus, in part by regulating drug accumulation.

  13. Molecular Mechanisms for Sweet-suppressing Effect of Gymnemic Acids*

    PubMed Central

    Sanematsu, Keisuke; Kusakabe, Yuko; Shigemura, Noriatsu; Hirokawa, Takatsugu; Nakamura, Seiji; Imoto, Toshiaki; Ninomiya, Yuzo

    2014-01-01

    Gymnemic acids are triterpene glycosides that selectively suppress taste responses to various sweet substances in humans but not in mice. This sweet-suppressing effect of gymnemic acids is diminished by rinsing the tongue with γ-cyclodextrin (γ-CD). However, little is known about the molecular mechanisms underlying the sweet-suppressing effect of gymnemic acids and the interaction between gymnemic acids versus sweet taste receptor and/or γ-CD. To investigate whether gymnemic acids directly interact with human (h) sweet receptor hT1R2 + hT1R3, we used the sweet receptor T1R2 + T1R3 assay in transiently transfected HEK293 cells. Similar to previous studies in humans and mice, gymnemic acids (100 μg/ml) inhibited the [Ca2+]i responses to sweet compounds in HEK293 cells heterologously expressing hT1R2 + hT1R3 but not in those expressing the mouse (m) sweet receptor mT1R2 + mT1R3. The effect of gymnemic acids rapidly disappeared after rinsing the HEK293 cells with γ-CD. Using mixed species pairings of human and mouse sweet receptor subunits and chimeras, we determined that the transmembrane domain of hT1R3 was mainly required for the sweet-suppressing effect of gymnemic acids. Directed mutagenesis in the transmembrane domain of hT1R3 revealed that the interaction site for gymnemic acids shared the amino acid residues that determined the sensitivity to another sweet antagonist, lactisole. Glucuronic acid, which is the common structure of gymnemic acids, also reduced sensitivity to sweet compounds. In our models, gymnemic acids were predicted to dock to a binding pocket within the transmembrane domain of hT1R3. PMID:25056955

  14. Development Induction Mechanism In Novolak Based Resist Systems For Submicron Optical Lithography

    NASA Astrophysics Data System (ADS)

    Toukhy, Medhat A.

    1987-08-01

    Novolaks are phenolic polymers prepared by the condensation of phenols or substituted phenols with aldehydes in acidic reaction medium. Because of their many favorable characteristics, novolaks are the polymer most widely used in commercial positive photoresists. The non-swelling aqueous alkali solubility behavior of novolaks is a key property required to produce high resolution resist images. Novolak dissolution rates and development induction can be altered by changes made in their chemical composition, structure and molecular weight. The relationship of some novolak chemical compositions and their aqueous alkali solubility behavior is discussed in this paper. Positive photoresist solutions formulated with relatively high dissolution rate novolaks resolved submicron images with unique profiles, provided higher photosensitivities and plasma etch resistance than lower dissolution rate systems. Although this conclusion was confined to specific cresol novolaks investigated in this work, it is believed that many other novolak compositions show similar correlations. This behavior was attributed to the presence of a protective surface layer or "skin" on top of the resist film. This "skin" was formed during the softbaking of the resist coating and has a sufficiently different dissolution rate than the resist bulk. Detailed DRM studies provided evidence of development induction on the resist surface caused by the "skin". This effect may also be viewed as a surface contrast enhancement effect during the development. Resist systems requiring more aggressive developers due to their lower dissolution rates exhibited total or partial removal of the "skin" or micro peeling in some cases as observed by scanning electron microscopy. The resist thickness and softbaking conditions were found to affect the thickness of the "skin". On the other hand, the removal or preservation of that layer depended largely on the resist composition and the developing process. The exact chemical

  15. Expression of Efflux Pumps and Fatty Acid Activator One Genes in Azole Resistant Candida Glabrata Isolated From Immunocompromised Patients.

    PubMed

    Farahyar, Shirin; Zaini, Farideh; Kordbacheh, Parivash; Rezaie, Sassan; Falahati, Mehraban; Safara, Mahin; Raoofian, Reza; Hatami, Kamran; Mohebbi, Masoumeh; Heidari, Mansour

    2016-07-01

    Acquired azole resistance in opportunistic fungi causes severe clinical problems in immunosuppressed individuals. This study investigated the molecular mechanisms of azole resistance in clinical isolates of Candida glabrata. Six unmatched strains were obtained from an epidemiological survey of candidiasis in immunocompromised hosts that included azole and amphotericin B susceptible and azole resistant clinical isolates. Candida glabrata CBS 138 was used as reference strain. Antifungal susceptibility testing of clinical isolates was evaluated using Clinical and Laboratory Standards Institute (CLSI) methods. Complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) technology, semi-quantitative RT-PCR, and sequencing were employed for identification of potential genes involved in azole resistance. Candida glabrata Candida drug resistance 1 (CgCDR1) and Candida glabrata Candida drug resistance 2 (CgCDR2) genes, which encode for multidrug transporters, were found to be upregulated in azole-resistant isolates (≥2-fold). Fatty acid activator 1 (FAA1) gene, belonging to Acyl-CoA synthetases, showed expression in resistant isolates ≥2-fold that of the susceptible isolates and the reference strain. This study revealed overexpression of the CgCDR1, CgCDR2, and FAA1 genes affecting biological pathways, small hydrophobic compounds transport, and lipid metabolism in the resistant clinical C.glabrata isolates. PMID:27424018

  16. Interaction of sulfuric acid corrosion and mechanical wear of iron

    NASA Technical Reports Server (NTRS)

    Rengstorff, G. W. P.; Miyoshi, K.; Buckley, D. H.

    1984-01-01

    Friction and wear experiments were conducted with elemental iron sliding on aluminum oxide in aerated sulfuric acid at concentrations ranging from very dilute (0.00007 N; i.e., 4 ppm) to very concentrated (96 percent acid). Load and reciprocating sliding speed were kept constant. With the most dilute acid concentration of 0.00007 to 0.0002 N, a complex corrosion product formed that was friable and often increased friction and wear. At slightly higher concentrations of 0.001 N, metal losses were essentially by wear alone. Because no buildup of corrosion products occurred, this acid concentration became the standard from which to separate metal loss from direct corrosion and mechanical wear losses. When the acid concentration was increased to 5 percent (1 N), the well-established high corrosion rate of iron in sulfuric acid strongly dominated the total wear loss. This strong corrosion increased to 30 percent acid and decreased somewhat to 50 percent acid in accordance with expectations. However, the low corrosion of iron expected at acid concentrations of 65 to 96 percent was not observed in the wear area. It was apparent that the normal passivating film was being worn away and a galvanic cell established that rapidly attacked the wear area. Under the conditions where direct corrosion losses were highest, the coefficient of friction was the lowest.

  17. Interaction of sulfuric acid corrosion and mechanical wear of iron

    NASA Technical Reports Server (NTRS)

    Rengstorff, G. W. P.; Miyoshi, K.; Buckley, D. H.

    1986-01-01

    Friction and wear experiment were conducted with elemental iron sliding on aluminum oxide in aerated sulfuric acid at concentrations ranging from very dilute (0.00007 N; i.e., 4 ppm) to very concentrated (96 percent acid). Load and reciprocating sliding speed were kept constant. With the most dilute acid concentration of 0.00007 to 0.0002 N, a complex corrosion product formed that was friable and often increased friction and wear. At slightly higher concentrations of 0.001 N, metal losses were essentially by wear alone. Because no buildup of corrosion products occurred, this acid concentration became the standard from which to separate metal loss from direct corrosion and mechanical wear losses. When the acid concentration was increased to 5 percent (1 N), the well-established high corrosion rate of iron in sulfuric acid strongly dominated the total wear loss. This strong corrosion increased to 30 percent acid and decreased somewhat to 50 percent acid in accordance with expectations. However, the low corrosion of iron expected at acid concentrations of 65 to 96 percent was not observed in the wear area. It was apparent that the normal passivating film was being worn away and a galvanic cell established that rapidly attacked the wear area. Under the conditions where direct corrosion losses were highest, the coefficient of friction was the lowest.

  18. Mechanisms of Resistance to an Azole Fungicide in the Grapevine Powdery Mildew Fungus, Erysiphe necator.

    PubMed

    Frenkel, Omer; Cadle-Davidson, Lance; Wilcox, Wayne F; Milgroom, Michael G

    2015-03-01

    We studied the mechanisms of azole resistance in Erysiphe necator by quantifying the sensitivity to myclobutanil (EC50) in 65 isolates from the eastern United States and 12 from Chile. From each isolate, we sequenced the gene for sterol 14α-demethylase (CYP51), and measured the expression of CYP51 and homologs of four putative efflux transporter genes, which we identified in the E. necator transcriptome. Sequence variation in CYP51 was relatively low, with sequences of 40 U.S. isolates identical to the reference sequence. Nine U.S. isolates and five from Chile carried a previously identified A to T nucleotide substitution in position 495 (A495T), which results in an amino acid substitution in codon 136 (Y136F) and correlates with high levels of azole resistance. We also found a nucleotide substitution in position 1119 (A1119C) in 15 U.S. isolates, whose mean EC50 value was equivalent to that for the Y136F isolates. Isolates carrying mutation A1119C had significantly greater CYP51 expression, even though A1119C does not affect the CYP51 amino acid sequence. Regression analysis showed no significant effects of the expression of efflux transporter genes on EC50. Both the Y136F mutation in CYP51 and increased CYP51 expression appear responsible for azole resistance in eastern U.S. populations of E. necator.

  19. Hydrofluoric acid-resistant composite window and method for its fabrication

    DOEpatents

    Ostenak, C.A.; Mackay, H.A.

    1985-07-18

    A hydrofluoric acid-resistant composite window and method for its fabrication are disclosed. The composite window comprises a window having first and second sides. The first side is oriented towards an environment containing hydrofluoric acid. An adhesive is applied to the first side. A layer of transparent hydrofluoric acid-resistant material, such as Mylar, is applied to the adhesive and completely covers the first side. The adhesive is then cured.

  20. Hydrofluoric acid-resistant composite window and method for its fabrication

    DOEpatents

    Ostenak, Carl A.; Mackay, Harold A.

    1987-01-01

    A hydrofluoric acid-resistant composite window and method for its fabrication are disclosed. The composite window comprises a window having first and second sides. The first side is oriented towards an environment containing hydrofluoric acid. An adhesive is applied to the first side. A layer of transparent hydrofluoric acid-resistant material, such as Mylar, is applied to the adhesive and completely covers the first side. The adhesive is then cured.

  1. Docosahexaenoic Acid (DHA) But Not Eicosapentaenoic Acid (EPA) Reverses Trans-10, Cis-12 Conjugated Linoleic Acid Induced Insulin Resistance in Mice1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Objective: t10, c12-Conjugated linoleic acid (CLA) induces insulin resistance and fatty liver in mice which can be reversed by fish oils. We determined if it is eicospentaenoic acid (20:5n-3, EPA) or docoshexaenoic acid (22:6n-3, DHA) that reverses these adverse effects of CLA. Research Design and M...

  2. Acid resistance and response to pH-induced stress in two Lactobacillus plantarum strains with probiotic potential.

    PubMed

    Šeme, H; Gjuračić, K; Kos, B; Fujs, Š; Štempelj, M; Petković, H; Šušković, J; Bogovič Matijašić, B; Kosec, G

    2015-01-01

    Two new Lactobacillus plantarum strains, KR6-DSM 28780 and M5 isolated from sour turnip and traditional dried fresh cheese, respectively, were evaluated for species identity, antibiotic susceptibility, resistance to gastrointestinal conditions and adaptive response to low pH. Resistance mechanisms involved in the adaptation to acid-induced stress in these two strains were investigated by quantitative PCR of the atpA, cfa1, mleS and hisD genes. In addition to absence of antibiotic resistance, the two L. plantarum strains showed excellent survival rates at pH values as low as 2.4. Adaptive response to low pH was clearly observed in both strains; strain KR6 was superior to M5, as demonstrated by its ability to survive during 3 h incubation at pH 2.0 upon adaptation to moderately acidic conditions. In contrast, acid adaptation did not significantly affect the survival rate during simulated passage through the gastrointestinal tract. In both strains, induction of histidine biosynthesis (hisD) was upregulated during the acid adaptation response. In addition, significant upregulation of the cfa1 gene, involved in modulation of membrane fatty acid composition, was observed during the adaptation phase in strain KR6 but not in strain M5. Cells adapted to moderately acidic conditions also showed a significantly increased viability after the lyophilisation procedure, a cross-protection phenomenon providing additional advantage in probiotic application. PMID:25380802

  3. Acid resistance and response to pH-induced stress in two Lactobacillus plantarum strains with probiotic potential.

    PubMed

    Šeme, H; Gjuračić, K; Kos, B; Fujs, Š; Štempelj, M; Petković, H; Šušković, J; Bogovič Matijašić, B; Kosec, G

    2015-01-01

    Two new Lactobacillus plantarum strains, KR6-DSM 28780 and M5 isolated from sour turnip and traditional dried fresh cheese, respectively, were evaluated for species identity, antibiotic susceptibility, resistance to gastrointestinal conditions and adaptive response to low pH. Resistance mechanisms involved in the adaptation to acid-induced stress in these two strains were investigated by quantitative PCR of the atpA, cfa1, mleS and hisD genes. In addition to absence of antibiotic resistance, the two L. plantarum strains showed excellent survival rates at pH values as low as 2.4. Adaptive response to low pH was clearly observed in both strains; strain KR6 was superior to M5, as demonstrated by its ability to survive during 3 h incubation at pH 2.0 upon adaptation to moderately acidic conditions. In contrast, acid adaptation did not significantly affect the survival rate during simulated passage through the gastrointestinal tract. In both strains, induction of histidine biosynthesis (hisD) was upregulated during the acid adaptation response. In addition, significant upregulation of the cfa1 gene, involved in modulation of membrane fatty acid composition, was observed during the adaptation phase in strain KR6 but not in strain M5. Cells adapted to moderately acidic conditions also showed a significantly increased viability after the lyophilisation procedure, a cross-protection phenomenon providing additional advantage in probiotic application.

  4. Resistance to β-Lactamase Inhibitor Protein Does Not Parallel Resistance to Clavulanic Acid in TEM β-Lactamase Mutants

    PubMed Central

    Schroeder, William A.; Locke, Troy R.; Jensen, Susan E.

    2002-01-01

    In order to compare patterns of resistance to inhibition by clavulanic acid with patterns of resistance to inhibition by a β-lactamase inhibitor protein (BLIP), R164S, R244S, and R164S/R244S mutant forms of TEM β-lactamase were prepared by site-directed mutagenesis. When kinetic parameters were determined for these mutant and wild-type forms of TEM, the single mutants showed properties that were similar to those in the literature but the double mutant showed properties that were very different. The R164S/R244S double mutant form of TEM retained its resistance to inhibition by clavulanic acid (characteristic of the R244S mutation) but lost all its ability to hydrolyze ceftazidime (characteristic of the R164S mutation). While these characteristics are contrary to those previously reported for an R164S/R244S double mutant, this discrepancy resulted from the use of a defective mutant in the earlier study. Both the single and double mutant forms of TEM remained highly sensitive when tested for inhibition by BLIP, showing only slightly increased resistance compared to that of the wild type; this pattern of resistance is quite different from the pattern of clavulanic acid resistance. The slight increases in resistance to inhibition by BLIP seen in the mutants may have been related to the fact that all of the mutations effected changes in the net charge on the TEM protein that could impede interactions with BLIP. PMID:12384366

  5. Nutrient enrichment affects the mechanical resistance of aquatic plants

    PubMed Central

    Puijalon, Sara

    2012-01-01

    For many plant species, nutrient availability induces important anatomical responses, particularly the production of low-density tissues to the detriment of supporting tissues. Due to the contrasting biomechanical properties of plant tissues, these anatomical responses may induce important modifications in the biomechanical properties of plant organs. The aim of this study was to determine the effects of nutrient enrichment on the anatomical traits of two freshwater plant species and its consequences on plant biomechanical performance. Two plant species were grown under controlled conditions in low versus high nutrient levels. The anatomical and biomechanical traits of the plant stems were measured. Both species produced tissues with lower densities under nutrient-rich conditions, accompanied by modifications in the structure of the aerenchyma for one species. As expected, nutrient enrichment also led to important modifications in the biomechanical properties of the stem for both species. In particular, mechanical resistance (breaking force and strength) and stiffness of stems were significantly reduced under nutrient rich conditions. The production of weaker stem tissues as a result of nutrient enrichment may increase the risk of plants to mechanical failure, thus challenging plant maintenance in mechanically stressful or disturbed habitats. PMID:23028018

  6. Nutrient enrichment affects the mechanical resistance of aquatic plants.

    PubMed

    Lamberti-Raverot, Barbara; Puijalon, Sara

    2012-10-01

    For many plant species, nutrient availability induces important anatomical responses, particularly the production of low-density tissues to the detriment of supporting tissues. Due to the contrasting biomechanical properties of plant tissues, these anatomical responses may induce important modifications in the biomechanical properties of plant organs. The aim of this study was to determine the effects of nutrient enrichment on the anatomical traits of two freshwater plant species and its consequences on plant biomechanical performance. Two plant species were grown under controlled conditions in low versus high nutrient levels. The anatomical and biomechanical traits of the plant stems were measured. Both species produced tissues with lower densities under nutrient-rich conditions, accompanied by modifications in the structure of the aerenchyma for one species. As expected, nutrient enrichment also led to important modifications in the biomechanical properties of the stem for both species. In particular, mechanical resistance (breaking force and strength) and stiffness of stems were significantly reduced under nutrient rich conditions. The production of weaker stem tissues as a result of nutrient enrichment may increase the risk of plants to mechanical failure, thus challenging plant maintenance in mechanically stressful or disturbed habitats. PMID:23028018

  7. Mechanisms underlying obesity resistance associated with high spontaneous physical activity.

    PubMed

    Teske, J A; Billington, C J; Kotz, C M

    2014-01-01

    Obesity resistance due to elevated orexin signaling is accompanied by high levels of spontaneous physical activity (SPA). The behavioral and neural mechanisms underlying this observation have not been fully worked out. We determined the contribution of hypothalamic orexin receptors (OXRs) to SPA stimulated by orexin A (OXA), whether OXA-stimulated SPA was secondary to arousal and whether voluntary wheel running led to compensations in 24-h SPA. We further tested whether orexin action on dopamine one receptors (DA1R) in the substantia nigra (SN) plays an important role in the generation of SPA. To test this, SPA response was determined in lean and obese rats with cannulae targeted toward the rostral lateral hypothalamus (rLH) or SN. Sleep/wake states were also measured in rats with rLH cannula and electroencephalogram/electromyogram radiotelemetry transmitters. SPA in lean rats was more sensitive to antagonism of the OX1R and in the early response to the orexin 2 agonist. OXA increased arousal equally in lean and obese rodents, which is discordant from the greater SPA response in lean rats. Obesity-resistant rats ran more and wheel running was directly related to 24-h SPA levels. The OX1R antagonist, SB-334867-A, and the DA1R antagonist, SCH3390, in SN more effectively reduced SPA stimulated by OXA in obesity-resistant rats. These data suggest OXA-stimulated SPA is not secondary to enhanced arousal, propensity for SPA parallels inclination to run and that orexin action on dopaminergic neurons in SN may participate in the mediation of SPA and running wheel activity.

  8. [Molecular mechanisms of plant resistance to cadmium toxicity].

    PubMed

    Xu, Zhenghao; Shen, Guojun; Zhu, Changqing; Xu, Linjuan; He, Yong; Yu, Gusong

    2006-06-01

    Cadmium (Cd) is a non-essential trace element for plants, and has strong toxicity at low concentrations. It can suppress the elongation growth of plant cell, inhibit oxidative mitochondrial phosphorylation, induce oxidative stress, inhibit the activities of several antioxidative enzymes, affect photosynthesis by inhibiting ferrous reductase or damaging photosynthesis apparatus, and cause the alteration of chromatin and the change of plasma membrane ATPase activity. In response to Cd stress, the cells of cadmium-resistant plant species can produce a number of proteins such as phytochelatins, metallothioneins and stress proteins to detoxify Cd ions, and efficiently repair Cd damage. The plant cells can also resort to other defense systems to detoxify Cd ions, e.g., the immobilization of Cd by cell wall, exclusion of Cd through the action of plasma membrane, compartmentalization of Cd by vacuolar, and release of plant glands. The phytochelatin synthase (PCS) genes of Arabidopsin, wheat and Schizosaccharomyces pombe had been identified by using different approaches, and the metallothioneins (MT) in plants was also identified recently. By introducing animal MT genes, transgenic plants could increase the resistant ability to Cd toxicity. Subjected to Cd, plant cells often start to synthesize stress proteins such as heat shock proteins, and the plants having been transformed the stress protein genes could enhance their resistant capacity to Cd ions. It was reported that zinc (Zn) ion-transporting proteins could also transport Cd ion. Some minor genes not conferring tolerance on their own could modify the major gene (s), and enhance Cd tolerance. Cd detoxification in wild type plants could be a complex phenomenon, probably under polygenic control to Cd, while acute Cd stress seemed to be a simpler mechanism, apparently involving only one or a few specific major genes.

  9. Mutational and acquired carbapenem resistance mechanisms in multidrug resistant Pseudomonas aeruginosa clinical isolates from Recife, Brazil.

    PubMed

    Cavalcanti, Felipe Lira de Sá; Mirones, Cristina Rodríguez; Paucar, Elena Román; Montes, Laura Álvarez; Leal-Balbino, Tereza Cristina; Morais, Marcia Maria Camargo de; Martínez-Martínez, Luis; Ocampo-Sosa, Alain Antonio

    2015-12-01

    An investigation was carried out into the genetic mechanisms responsible for multidrug resistance in nine carbapenem-resistant Pseudomonas aeruginosa isolates from different hospitals in Recife, Brazil. Susceptibility to antimicrobial agents was determined by broth microdilution. Polymerase chain reaction (PCR) was employed to detect the presence of genes encoding β-lactamases, aminoglycoside-modifying enzymes (AMEs), 16S rRNA methylases, integron-related genes and OprD. Expression of genes coding for efflux pumps and AmpC cephalosporinase were assessed by quantitative PCR. The outer membrane proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The blaSPM-1, blaKPC-2 and blaGES-1 genes were detected in P. aeruginosa isolates in addition to different AME genes. The loss of OprD in nine isolates was mainly due to frameshift mutations, premature stop codons and point mutations. An association of loss of OprD with the overexpression of MexAB-OprM and MexXY-OprM was observed in most isolates. Hyper-production of AmpC was also observed in three isolates. Clonal relationship of the isolates was determined by repetitive element palindromic-PCR and multilocus sequence typing. Our results show that the loss of OprD along with overexpression of efflux pumps and β-lactamase production were responsible for the multidrug resistance in the isolates analysed.

  10. Mutational and acquired carbapenem resistance mechanisms in multidrug resistant Pseudomonas aeruginosa clinical isolates from Recife, Brazil

    PubMed Central

    Cavalcanti, Felipe Lira de Sá; Mirones, Cristina Rodríguez; Paucar, Elena Román; Montes, Laura Álvarez; Leal-Balbino, Tereza Cristina; de Morais, Marcia Maria Camargo; Martínez-Martínez, Luis; Ocampo-Sosa, Alain Antonio

    2015-01-01

    An investigation was carried out into the genetic mechanisms responsible for multidrug resistance in nine carbapenem-resistant Pseudomonas aeruginosaisolates from different hospitals in Recife, Brazil. Susceptibility to antimicrobial agents was determined by broth microdilution. Polymerase chain reaction (PCR) was employed to detect the presence of genes encoding β-lactamases, aminoglycoside-modifying enzymes (AMEs), 16S rRNA methylases, integron-related genes and OprD. Expression of genes coding for efflux pumps and AmpC cephalosporinase were assessed by quantitative PCR. The outer membrane proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The blaSPM-1, blaKPC-2 and blaGES-1 genes were detected in P. aeruginosaisolates in addition to different AME genes. The loss of OprD in nine isolates was mainly due to frameshift mutations, premature stop codons and point mutations. An association of loss of OprD with the overexpression of MexAB-OprM and MexXY-OprM was observed in most isolates. Hyper-production of AmpC was also observed in three isolates. Clonal relationship of the isolates was determined by repetitive element palindromic-PCR and multilocus sequence typing. Our results show that the loss of OprD along with overexpression of efflux pumps and β-lactamase production were responsible for the multidrug resistance in the isolates analysed. PMID:26676375

  11. Mechanically-induced resistive switching in ferroelectric tunnel junctions.

    PubMed

    Lu, H; Kim, D J; Bark, C-W; Ryu, S; Eom, C B; Tsymbal, E Y; Gruverman, A

    2012-12-12

    Recent advances in atomic-precision processing of oxide ferroelectrics-materials with a stable polarization that can be switched by an external electric field-have generated considerable interest due to rich physics associated with their fundamental properties and high potential for application in devices with enhanced functionality. One of the particularly promising phenomena is the tunneling electroresistance (TER) effect-polarization-dependent bistable resistance behavior of ferroelectric tunnel junctions (FTJ). Conventionally, the application of an electric field above the coercive field of the ferroelectric barrier is required to observe this phenomenon. Here, we report a mechanically induced TER effect in ultrathin ferroelectric films of BaTiO(3) facilitated by a large strain gradient induced by a tip of a scanning probe microscope (SPM). The obtained results represent a new paradigm for voltage-free control of electronic properties of nanoscale ferroelectrics and, more generally, complex oxide materials. PMID:23181389

  12. L-Ascorbic acid can abrogate SVCT-2-dependent cetuximab resistance mediated by mutant KRAS in human colon cancer cells.

    PubMed

    Jung, Soo-A; Lee, Dae-Hee; Moon, Jai-Hee; Hong, Seung-Woo; Shin, Jae-Sik; Hwang, Ih Yeon; Shin, Yu Jin; Kim, Jeong Hee; Gong, Eun-Yeung; Kim, Seung-Mi; Lee, Eun Young; Lee, Seul; Kim, Jeong Eun; Kim, Kyu-Pyo; Hong, Yong Sang; Lee, Jung Shin; Jin, Dong-Hoon; Kim, TaeWon; Lee, Wang Jae

    2016-06-01

    Colon cancer patients with mutant KRAS are resistant to cetuximab, an antibody directed against the epidermal growth factor receptor, which is an effective clinical therapy for patients with wild-type KRAS. Numerous combinatorial therapies have been tested to overcome the resistance to cetuximab. However, no combinations have been found that can be used as effective therapeutic strategies. In this study, we demonstrate that L-ascorbic acid partners with cetuximab to induce killing effects, which are influenced by sodium-dependent vitamin C transporter 2 (SVCT-2) in human colon cancer cells with a mutant KRAS. L-Ascorbic acid treatment of human colon cancer cells that express a mutant KRAS differentially and synergistically induced cell death with cetuximab in a SVCT-2-dependent manner. The ectopic expression of SVCT-2 induced sensitivity to L-ascorbic acid treatment in human colon cancer cells that do not express SVCT-2, whereas the knockdown of endogenous SVCT-2 induced resistance to L-ascorbic acid treatment in SVCT-2-positive cells. Moreover, tumor regression via the administration of L-ascorbic acid and cetuximab in mice bearing tumor cell xenografts corresponded to SVCT-2 protein levels. Interestingly, cell death induced by the combination of L-ascorbic acid and cetuximab resulted in both apoptotic and necrotic cell death. These cell death mechanisms were related to a disruption of the ERK pathway and were represented by the impaired activation of RAFs and the activation of the ASK-1-p38 pathway. Taken together, these results suggest that resistance to cetuximab in human colon cancer patients with a mutant KRAS can be bypassed by L-ascorbic acid in an SVCT-2-dependent manner. Furthermore, SVCT-2 in mutant KRAS colon cancer may act as a potent marker for potentiating L-ascorbic acid co-treatment with cetuximab.

  13. Avidity Mechanism of Dendrimer–Folic Acid Conjugates

    PubMed Central

    2015-01-01

    Multivalent conjugation of folic acid has been employed to target cells overexpressing folate receptors. Such polymer conjugates have been previously demonstrated to have high avidity to folate binding protein. However, the lack of a monovalent folic acid–polymer material has prevented a full binding analysis of these conjugates, as multivalent binding mechanisms and polymer-mass mechanisms are convoluted in samples with broad distributions of folic acid-to-dendrimer ratios. In this work, the synthesis of a monovalent folic acid–dendrimer conjugate allowed the elucidation of the mechanism for increased binding between the folic acid–polymer conjugate and a folate binding protein surface. The increased avidity is due to a folate-keyed interaction between the dendrimer and protein surfaces that fits into the general framework of slow-onset, tight-binding mechanisms of ligand/protein interactions. PMID:24725205

  14. Resistance Mechanisms and Molecular Docking Studies of Four Novel QoI Fungicides in Peronophythora litchii

    PubMed Central

    Zhou, Yuxin; Chen, Lei; Hu, Jian; Duan, Hongxia; Lin, Dong; Liu, Pengfei; Meng, Qingxiao; Li, Bin; Si, Naiguo; Liu, Changling; Liu, Xili

    2015-01-01

    Peronophythora litchii is the causal agent of litchi downy blight. Enestroburin, SYP-1620, SYP-2815 and ZJ0712 are four novel QoI fungicides developed by China. Eight mutants of P. litchii resistant to these QoI fungicides and azoxystrobin (as a known QoI fungicide) were obtained in our preliminary work. In this study, the full length of the cytochrome b gene in P. litchii, which has a full length of 382 amino acids, was cloned from both sensitive isolates and resistant mutants, and single-site mutations G142A, G142S, Y131C, or F128S were found in resistant mutants. Molecular docking was used to predict how the mutations alter the binding of the five QoI fungicides to the Qo-binding pockets. The results have increased our understanding of QoI fungicide-resistance mechanisms and may help in the development of more potent inhibitors against plant diseases in the fields. PMID:26657349

  15. Resistance Mechanisms and Molecular Docking Studies of Four Novel QoI Fungicides in Peronophythora litchii.

    PubMed

    Zhou, Yuxin; Chen, Lei; Hu, Jian; Duan, Hongxia; Lin, Dong; Liu, Pengfei; Meng, Qingxiao; Li, Bin; Si, Naiguo; Liu, Changling; Liu, Xili

    2015-12-14

    Peronophythora litchii is the causal agent of litchi downy blight. Enestroburin, SYP-1620, SYP-2815 and ZJ0712 are four novel QoI fungicides developed by China. Eight mutants of P. litchii resistant to these QoI fungicides and azoxystrobin (as a known QoI fungicide) were obtained in our preliminary work. In this study, the full length of the cytochrome b gene in P. litchii, which has a full length of 382 amino acids, was cloned from both sensitive isolates and resistant mutants, and single-site mutations G142A, G142S, Y131C, or F128S were found in resistant mutants. Molecular docking was used to predict how the mutations alter the binding of the five QoI fungicides to the Qo-binding pockets. The results have increased our understanding of QoI fungicide-resistance mechanisms and may help in the development of more potent inhibitors against plant diseases in the fields.

  16. Clarithromycin Resistance Mechanisms of Epidemic β-Lactamase-Nonproducing Ampicillin-Resistant Haemophilus influenzae Strains in Japan.

    PubMed

    Seyama, Shoji; Wajima, Takeaki; Nakaminami, Hidemasa; Noguchi, Norihisa

    2016-05-01

    The aim of this study was to clarify the clarithromycin resistance mechanisms of β-lactamase-nonproducing ampicillin-resistant Haemophilus influenzae strains. In all clarithromycin-resistant strains, the transcript level of acrB was significantly elevated, and these strains had a frameshift mutation in acrR Introduction of the acrR mutation into H. influenzae Rd generated a clarithromycin-resistant transformant with the same MIC as the donor strain. Our results indicate that the acrR mutation confers clarithromycin resistance by the increasing the transcription of acrB.

  17. Mechanisms Of The Dissolution Inhibition Effect And Their Application To Designing Novel Deep-UV Resists

    NASA Astrophysics Data System (ADS)

    Murata, Makoto; Koshiba, Mitsunobu; Harita, Yoshiyuki

    1989-08-01

    The dissolution inhibition effect and alkaline solubility were investigated for naphthoquinone diazides like 1,2-naphthoquinone diazide (NQD), its 5-sulfonylchloride (NQD-C) and 5-sulfonyloxybenzene (DAM), and for other compounds like sulfonylchlorides, sulfonyl esters, sulfones and a ketone which do not contain a naphthoquinone diazide moiety. As a result, it has turned out that the dissolution inhibition effect does not depend on the specific structure; namely, the naphthoquinone diazide moiety itself, but largely on the alkaline solubility of the compounds added to a novolak resin. An XPS study for the films consisting of a novolak resin and a dissolution inhibitor indicates a formation of an inhibitor-rich protective thin layer on the film surface after immersion of the film in an alkaline developer. In this paper is proposed a new third dissolution inhibition mechanism in addition to the previously reported chemical crosslinking and dipolar interaction; i.e., the alkaline insoluble protective layer inhibits the dissolution of novolak resin at the interface between the film and the developer. A new three-component type deep-UV resist has been also developed as an application of the new mechanism. The resist consists of a novolak resin, 5-diazo Meldrum's acid and a new dissolution inhibitors like phenyltosylate and p-phenylene ditosylate, which successfully improve the residual resist thickness.

  18. Applications of hydroxy acids: classification, mechanisms, and photoactivity

    PubMed Central

    Kornhauser, Andrija; Coelho, Sergio G; Hearing, Vincent J

    2010-01-01

    Hydroxy acids (HAs) represent a class of compounds which have been widely used in a number of cosmetic and therapeutic formulations in order to achieve a variety of beneficial effects for the skin. We review and discuss the most frequently used classes of these compounds, such as α-hydroxy acids, β-hydroxy acids, polyhydroxy acids, and bionic acids, and describe their applications as cosmetic and therapeutic agents. Special emphasis is devoted to the safety evaluation of these formulations, in particular on the effects of their prolonged use on sun-exposed skin. Furthermore, we summarize the very limited number of studies dealing with the modifications evoked by topical application of products containing HAs on photocarcinogenesis. In spite of the large number of reports on the cosmetic and clinical effects of HAs, their biological mechanism(s) of action still require more clarification. Some of these mechanisms are discussed in this article along with important findings on the effect of HAs on melanogenesis and on tanning. We also emphasize the important contribution of cosmetic vehicles in these types of studies. Thus, HAs play an important role in cosmetic formulations, as well as in many dermatologic applications, such as in treating photoaging, acne, ichthyosis, rosacea, pigmentation disorders, and psoriasis. PMID:21437068

  19. Analysis of acid-generating action of PAG in an EUV resist using acid-sensitive dyes

    NASA Astrophysics Data System (ADS)

    Sekiguchi, Atsushi; Matsumoto, Yoko; Biafore, John J.

    2013-03-01

    Researchers are currently examining various methods for determining the quantity of acid generated by a photoacid generator (PAG) and for analyzing acid-generating reactions using acid-sensitive dyes that react with acid and generate a color. Adding an acid-sensitive dye to the resist gives a clear grasp of the acid-generating action. The process involves applying a resist containing an acid-sensitive dye to a quartz substrate; exposing the substrate; and measuring and evaluating the absorbance of a chromogenic substance near 530 nm using a spectroscope. The method determines the rate constant for acid generation (Dill C parameter) during exposure based on the relationship between transmissivity at 530 nm and exposure dose. Using this method, we obtained and compared rate constants for acid generation (C parameters) as part of our study of dependence on the quantity of quencher in the EUV resist. Our results indicate a new model that accounts for the quencher concentration parameter would be useful in analyzing dependence on the quantity of quencher. This paper presents these findings, together with the results of studies of profile simulations using the quencher concentration parameter obtained in the experiments.

  20. Salicylic acid confers enhanced resistance to Glomerella leaf spot in apple.

    PubMed

    Zhang, Ying; Shi, Xiangpeng; Li, Baohua; Zhang, Qingming; Liang, Wenxing; Wang, Caixia

    2016-09-01

    Glomerella leaf spot (GLS) caused by Glomerella cingulata is a newly emergent disease that results in severe defoliation and fruit spots in apple. Currently, there are no effective means to control this disease except for the traditional fungicide sprays. Induced resistance by elicitors against pathogens infection is a widely accepted eco-friendly strategy. In the present study, we investigated whether exogenous application of salicylic acid (SA) could improve resistance to GLS in a highly susceptible apple cultivar (Malus domestica Borkh. cv. 'Gala') and the underlying mechanisms. The results showed that pretreatment with SA, at 0.1-1.0 mM, induced strong resistance against GLS in 'Gala' apple leaves, with SA treated leaves showing significant reduction in lesion numbers and disease index. Concurrent with the enhanced disease resistance, SA treatment markedly increased the total antioxidant capacity (T-AOC) and defence-related enzyme activities, including catalase (CAT), superoxide dismutase (SOD), peroxidase (POD), phenylalanine ammonia-lyase (PAL) and polyphenol oxidase (PPO). As expected, SA treatment also induced the expression levels of five pathogenesis-related (PR) genes including PR1, PR5, PR8, Chitinase and β-1,3-glucanase. Furthermore, the most pronounced and/or rapid increase was observed in leaves treated with SA and subsequently inoculated with G. cingulata compared to the treatment with SA or inoculation with the pathogen. Together, these results suggest that exogenous SA triggered increase in reactive oxygen species levels and the antioxidant system might be responsible for enhanced resistance against G. cingulata in 'Gala' apple leaves. PMID:27139585

  1. The acid-base resistant zone in three dentin bonding systems.

    PubMed

    Inoue, Go; Nikaido, Toru; Foxton, Richard M; Tagami, Junji

    2009-11-01

    An acid-base resistant zone has been found to exist after acid-base challenge adjacent to the hybrid layer using SEM. The aim of this study was to examine the acid-base resistant zone using three different bonding systems. Dentin disks were applied with three different bonding systems, and then a resin composite was light-cured to make dentin disk sandwiches. After acid-base challenge, the polished surfaces were observed using SEM. For both one- and two-step self-etching primer systems, an acid-base resistant zone was clearly observed adjacent to the hybrid layer - but with differing appearances. For the wet bonding system, the presence of an acid-base resistant zone was unclear. This was because the self-etching primer systems etched the dentin surface mildly, such that the remaining mineral phase of dentin and the bonding agent yielded clear acid-base resistant zones. In conclusion, the acid-base resistant zone was clearly observed when self-etching primer systems were used, but not so for the wet bonding system.

  2. Ferulic acid reverses ABCB1-mediated paclitaxel resistance in MDR cell lines.

    PubMed

    Muthusamy, Ganesan; Balupillai, Agilan; Ramasamy, Karthikeyan; Shanmugam, Mohana; Gunaseelan, Srithar; Mary, Beaulah; Prasad, N Rajendra

    2016-09-01

    Multidrug resistance (MDR) remains a major obstacle in cancer chemotherapy. The use of the dietary phytochemicals as chemosensitizing agents to enhance the efficacy of conventional cytostatic drugs has recently gained the attention as a plausible approach for overcoming the drug resistance. The aim of this study was to investigate whether a naturally occurring diet-based phenolic acid, ferulic acid, could sensitize paclitaxel efficacy in ABCB1 overexpressing (P-glycoprotein) colchicine selected KB Ch(R)8-5 cell line. In vitro drug efflux assays demonstrated that ferulic acid inhibits P-glycoprotein transport function in drug resistant KB Ch(R)8-5 cell lines. However, ferulic acid significantly downregulates ABCB1 expression in a concentration dependent manner. Cytotoxicity assay reveals that ferulic acid decreased paclitaxel resistance in KBCh(R)8-5 and HEK293/ABCB1 cells, which indicates its chemosensitizing potential. Clonogenic cell survival assay and apoptotic morphological staining further confirm the chemosensitizing potential of ferulic acid in drug resistant KB Ch(R)8-5 cell lines. Ferulic acid treatment enhances paclitaxel mediated cell cycle arrest and upregulates paclitaxel-induced apoptotic signaling in KB resistant cells. Hence, it has been concluded that downregulation of ABCB1 and subsequent induction of paclitaxel-mediated cell cycle arrest and apoptotic signaling may be the cause for the chemosensitizing potential of ferulic acid in P-gp overexpressing cell lines. PMID:27262378

  3. Acid and neutral sphingomyelinases: roles and mechanisms of regulation.

    PubMed

    Marchesini, Norma; Hannun, Yusuf A

    2004-02-01

    Ceramide, an emerging bioactive lipid and second messenger, is mainly generated by hydrolysis of sphingomyelin through the action of sphingomyelinases. At least two sphingomyelinases, neutral and acid sphingomyelinases, are activated in response to many extracellular stimuli. Despite extensive studies, the precise cellular function of each of these sphingomyelinases in sphingomyelin turnover and in the regulation of ceramide-mediated responses is not well understood. Therefore, it is essential to elucidate the factors and mechanisms that control the activation of acid and neutral sphingomyelinases to understand their the roles in cell regulation. This review will focus on the molecular mechanisms that regulate these enzymes in vivo and in vitro, especially the roles of oxidants (glutathione, peroxide, nitric oxide), proteins (saposin, caveolin 1, caspases), and lipids (diacylglycerol, arachidonic acid, and ceramide).

  4. Mechanism of resistance to macrolide-lincosamide-streptogramin antibiotics in Streptococcus thermophilus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance to macrolide-lincosamide-streptogramin (MLS) group antibiotics in the dairy bacterium Streptococcus thermophilus (ST) is documented but the mechanism of resistance has not been elucidated. MIC values for erythromycin (Erm), azithromycin (Azm), tylosin (Tyl), spiramycin (Spm), pristinamyci...

  5. Nicotiflorin, rutin and chlorogenic acid: phenylpropanoids involved differently in quantitative resistance of potato tubers to biotrophic and necrotrophic pathogens.

    PubMed

    Kröner, Alexander; Marnet, Nathalie; Andrivon, Didier; Val, Florence

    2012-08-01

    Physiological and molecular mechanisms underlying quantitative resistance of plants to pathogens are still poorly understood, but could depend upon differences in the intensity or timing of general defense responses. This may be the case for the biosynthesis of phenolics which are known to increase after elicitation by pathogens. We thus tested the hypothesis that differences in quantitative resistance were related to differential induction of phenolics by pathogen-derived elicitors. Five potato cultivars (Solanum tuberosum, L.) spanning a range of quantitative resistance were treated with a concentrated culture filtrate (CCF) of Phytophthora infestans or purified lipopolysaccharides (LPS) from Pectobacterium atrosepticum. The kinetic of phenolics accumulation was followed and a set of typical phenolics was identified: chlorogenic acid, phenolamides and flavonols including rutin (quercetin-3-O-rutinoside) and nicotiflorin (kaempferol-3-O-rutinoside). Our results showed that CCF but not LPS induced differential accumulation of major phenolics among cultivars. Total phenolics were related with resistance to P. atrosepticum but not to P. infestans. However, nicotiflorin was inversely related with resistance to both pathogens. Rutin, but not nicotiflorin, inhibited pathogen growth in vitro at physiological concentrations. These data therefore suggest that (i) several phenolics are candidate markers for quantitative resistance in potato, (ii) some of these are pathogen specific although they are produced by a general defense pathway, (iii) resistance marker molecules do not necessarily have antimicrobial activity, and (iv) the final content of these target molecules-either constitutive or induced-is a better predictor of resistance than their inducibility by pathogen elicitors.

  6. Insulin resistance is associated with altered amino acid metabolism and adipose tissue dysfunction in normoglycemic women

    PubMed Central

    Wiklund, Petri; Zhang, Xiaobo; Pekkala, Satu; Autio, Reija; Kong, Lingjia; Yang, Yifan; Keinänen-Kiukaanniemi, Sirkka; Alen, Markku; Cheng, Sulin

    2016-01-01

    Insulin resistance is associated adiposity, but the mechanisms are not fully understood. In this study, we aimed to identify early metabolic alterations associated with insulin resistance in normoglycemic women with varying degree of adiposity. One-hundred and ten young and middle-aged women were divided into low and high IR groups based on their median HOMA-IR (0.9 ± 0.4 vs. 2.8 ± 1.2). Body composition was assessed using DXA, skeletal muscle and liver fat by proton magnetic resonance spectroscopy, serum metabolites by nuclear magnetic resonance spectroscopy and adipose tissue and skeletal muscle gene expression by microarrays. High HOMA-IR subjects had higher serum branched-chain amino acid concentrations (BCAA) (p < 0.05 for both). Gene expression analysis of subcutaneous adipose tissue revealed significant down-regulation of genes related to BCAA catabolism and mitochondrial energy metabolism and up-regulation of several inflammation-related pathways in high HOMA-IR subjects (p < 0.05 for all), but no differentially expressed genes in skeletal muscle were found. In conclusion, in normoglycemic women insulin resistance was associated with increased serum BCAA concentrations, down-regulation of mitochondrial energy metabolism and increased expression of inflammation-related genes in the adipose tissue. PMID:27080554

  7. Significant effect of Ca2+ on improving the heat resistance of lactic acid bacteria.

    PubMed

    Huang, Song; Chen, Xiao Dong

    2013-07-01

    The heat resistance of lactic acid bacteria (LAB) has been extensively investigated due to its highly practical significance. Reconstituted skim milk (RSM) has been found to be one of the most effective protectant wall materials for microencapsulating microorganisms during convective drying, such as spray drying. In addition to proteins and carbohydrate, RSM is rich in calcium. It is not clear which component is critical in the RSM protection mechanism. This study investigated the independent effect of calcium. Ca(2+) was added to lactose solution to examine its influence on the heat resistance of Lactobacillus rhamnosus ZY, Lactobacillus casei Zhang, Lactobacillus plantarum P8 and Streptococcus thermophilus ND03. The results showed that certain Ca(2+) concentrations enhanced the heat resistance of the LAB strains to different extents, that is produced higher survival and shorter regrowth lag times of the bacterial cells. In some cases, the improvements were dramatic. More scientifically insightful and more intensive instrumental study of the Ca(2+) behavior around and in the cells should be carried out in the near future. In the meantime, this work may lead to the development of more cost-effective wall materials with Ca(2+) added as a prime factor. PMID:23617813

  8. Biochemical Mechanism of HIV-1 Resistance to Rilpivirine*

    PubMed Central

    Singh, Kamalendra; Marchand, Bruno; Rai, Devendra K.; Sharma, Bechan; Michailidis, Eleftherios; Ryan, Emily M.; Matzek, Kayla B.; Leslie, Maxwell D.; Hagedorn, Ariel N.; Li, Zhe; Norden, Pieter R.; Hachiya, Atsuko; Parniak, Michael A.; Xu, Hong-Tao; Wainberg, Mark A.; Sarafianos, Stefan G.

    2012-01-01

    Rilpivirine (RPV) is a second generation nonnucleoside reverse transcriptase (RT) inhibitor (NNRTI) that efficiently inhibits HIV-1 resistant to first generation NNRTIs. Virological failure during therapy with RPV and emtricitabine is associated with the appearance of E138K and M184I mutations in RT. Here we investigate the biochemical mechanism of RT inhibition and resistance to RPV. We used two transient kinetics approaches (quench-flow and stopped-flow) to determine how subunit-specific mutations in RT p66 or p51 affect association and dissociation of RPV to RT as well as their impact on binding of dNTP and DNA and the catalytic incorporation of nucleotide. We compared WT with four subunit-specific RT mutants, p66M184I/p51WT, p66E138K/p51E138K, p66E138K/M184I/p51E138K, and p66M184I/p51E138K. Ile-184 in p66 (p66184I) decreased the catalytic efficiency of RT (kpol/Kd.dNTP), primarily through a decrease in dNTP binding (Kd.dNTP). Lys-138 either in both subunits or in p51 alone abrogated the negative effect of p66184I by restoring dNTP binding. Furthermore, p51138K reduced RPV susceptibility by altering the ratio of RPV dissociation to RPV association, resulting in a net reduction in RPV equilibrium binding affinity (Kd.RPV = koff.RPV/kon.RPV). Quantum mechanics/molecular mechanics hybrid molecular modeling revealed that p51E138K affects access to the RPV binding site by disrupting the salt bridge between p51E138 and p66K101. p66184I caused repositioning of the Tyr-183 active site residue and decreased the efficiency of RT, whereas the addition of p51138K restored Tyr-183 to a WT-like conformation, thus abrogating the Ile-184-induced functional defects. PMID:22955279

  9. Biochemical mechanism of HIV-1 resistance to rilpivirine.

    PubMed

    Singh, Kamalendra; Marchand, Bruno; Rai, Devendra K; Sharma, Bechan; Michailidis, Eleftherios; Ryan, Emily M; Matzek, Kayla B; Leslie, Maxwell D; Hagedorn, Ariel N; Li, Zhe; Norden, Pieter R; Hachiya, Atsuko; Parniak, Michael A; Xu, Hong-Tao; Wainberg, Mark A; Sarafianos, Stefan G

    2012-11-01

    Rilpivirine (RPV) is a second generation nonnucleoside reverse transcriptase (RT) inhibitor (NNRTI) that efficiently inhibits HIV-1 resistant to first generation NNRTIs. Virological failure during therapy with RPV and emtricitabine is associated with the appearance of E138K and M184I mutations in RT. Here we investigate the biochemical mechanism of RT inhibition and resistance to RPV. We used two transient kinetics approaches (quench-flow and stopped-flow) to determine how subunit-specific mutations in RT p66 or p51 affect association and dissociation of RPV to RT as well as their impact on binding of dNTP and DNA and the catalytic incorporation of nucleotide. We compared WT with four subunit-specific RT mutants, p66(M184I)/p51(WT), p66(E138K)/p51(E138K), p66(E138K/M184I)/p51(E138K), and p66(M184I)/p51(E138K). Ile-184 in p66 (p66(184I)) decreased the catalytic efficiency of RT (k(pol)/K(d)(.dNTP)), primarily through a decrease in dNTP binding (K(d)(.dNTP)). Lys-138 either in both subunits or in p51 alone abrogated the negative effect of p66(184I) by restoring dNTP binding. Furthermore, p51(138K) reduced RPV susceptibility by altering the ratio of RPV dissociation to RPV association, resulting in a net reduction in RPV equilibrium binding affinity (K(d)(.RPV) = k(off.RPV)/k(on.RPV)). Quantum mechanics/molecular mechanics hybrid molecular modeling revealed that p51(E138K) affects access to the RPV binding site by disrupting the salt bridge between p51(E138) and p66(K101). p66(184I) caused repositioning of the Tyr-183 active site residue and decreased the efficiency of RT, whereas the addition of p51(138K) restored Tyr-183 to a WT-like conformation, thus abrogating the Ile-184-induced functional defects. PMID:22955279

  10. The tokamak density limit: A thermo-resistive disruption mechanism

    NASA Astrophysics Data System (ADS)

    Gates, David

    2015-11-01

    A magnetic island growth mechanism based on radiative cooling of the internal island flux surfaces is shown to produce the correct physical scaling to explain one of the long standing mysteries of tokamak physics - the empirical Greenwald density limit. In this presentation we will review the phenomenology of the density limit and the correlation between the Greenwald limit and the onset threshold for radiation-driven tearing modes. The behavior of magnetic islands with a 3D electron temperature distribution which is consistent with a large ratio of radial to parallel heat conductivity - and a corresponding 3D resistivity profile - is examined for islands with near-zero net heating in the island interior. The effect of varying impurity mix on the local island onset threshold is consistent with the established experimental scalings for tokamaks at the density limit. A simple analytic theory is developed which reveals the effect of heating and cooling in the island interior as well as the effect of island asymmetry. It is shown that a new term accounting for the thermal effects of island asymmetry is a crucial addition to the Modified Rutherford Equation. The resultant model exhibits a robust onset of a rapidly growing tearing mode - consistent with the disruption mechanism observed at the density limit in tokamaks. Additionally, a fully non-linear 3D cylindrical calculation is performed that simulates the effect of net island heating / cooling by raising / suppressing the temperature in the core of the island. In both the analytic theory and the numerical simulation a sudden threshold for explosive growth is found to be due to the interaction between three distinct thermal non-linearities, which affect the island resistivity, thereby modifying the growth dynamics. Expanding on the model presented, we speculate that the mechanism described may be applicable to a much wider range of tokamak disruptions than just those near the Greenwald limit. This work is supported

  11. Plurality of anxiety and depression alteration mechanism by oleanolic acid.

    PubMed

    Fajemiroye, James O; Galdino, Pablinny M; Florentino, Iziara F; Da Rocha, Fabio F; Ghedini, Paulo C; Polepally, Prabhakar R; Zjawiony, Jordan K; Costa, Elson A

    2014-10-01

    Our study sought to evaluate the anxiolytic and antidepressant activities of oleanolic acid as well as the neural mechanisms involved. Animal models such as barbiturate sleep-induction, light-dark box, elevated plus maze, forced swimming test, tail suspension test and open field test were conducted. Male Albino Swiss mice were treated orally with vehicle 10 mL/kg, fluoxetine 20 mg/kg, imipramine 15 mg/kg, diazepam 1 mg/kg or oleanolic acid 5-40 mg/kg. Pretreatment (intraperitoneal) of animals with pentylenetetrazole (PTZ) 20 mg/kg, 1-(2-methoxyphenyl)-4-[4- (2-phthalimido) butyl]piperazine hydrobromide (NAN-190) 0.5 mg/kg, p-chlorophenylalanine methyl ester (PCPA) 100 mg/kg or α-methyl-p-tyrosine (AMPT) 100 mg/kg, WAY100635 (WAY) 0.3 mg/kg, prazosin (PRAZ) 1 mg/kg, yohimbine 2 mg/kg as well as monoamine oxidase assay and hippocampal brain-derived neurotrophic factor (BDNF) quantification were carried out. Oleanolic acid potentiated the hypnotic effect of barbiturate and demonstrated an anxiolytic effect in both the light-dark box and elevated plus maze. This effect was not reversed by PTZ. Acute and/or chronic oral treatment of mice with oleanolic acid (5-20 mg/kg) elicited an antidepressant effect in the forced swimming test and the tail suspension test without interfering with the locomotor activity. The antidepressant effect of oleanolic acid was attenuated by NAN-190, AMPT, PCPA, WAY and PRAZ. Although monoamine oxidase activity remained unaltered by oleanolic acid, chronic administration of oleanolic acid augmented hippocampal BDNF level. These findings demonstrate multiple mechanisms of the anxiolytic and antidepressant effect of oleanolic acid.

  12. Colistin and Fusidic Acid, a Novel Potent Synergistic Combination for Treatment of Multidrug-Resistant Acinetobacter baumannii Infections

    PubMed Central

    Betts, Jonathan W.; Bharathan, Binutha

    2015-01-01

    The spread of multidrug-resistant Acinetobacter baumannii (MDRAB) has led to the renaissance of colistin (COL), often the only agent to which MDRAB remains susceptible. Effective therapy with COL is beset with problems due to unpredictable pharmacokinetics, toxicity, and the rapid selection of resistance. Here, we describe a potent synergistic interaction when COL was combined with fusidic acid (FD) against A. baumannii. Synergy in vitro was assessed against 11 MDRAB isolates using disc diffusion, checkerboard methodology (fractional inhibitory concentration index [FICI] of ≤ 0.5, susceptibility breakpoint index [SBPI] of >2), and time-kill methodology (≥2 log10 CFU/ml reduction). The ability of FD to limit the emergence of COL resistance was assessed in the presence and absence of each drug alone and in combination. Synergy was demonstrated against all strains, with an average FICI and SBPI of 0.064 and 78.85, respectively. In time-kill assays, COL-FD was synergistic and rapidly bactericidal, including against COL-resistant strains. Fusidic acid prevented the emergence of COL resistance, which was readily selected with COL alone. This is the first description of a novel COL-FD regimen for the treatment of MDRAB. The combination was effective at low concentrations, which should be therapeutically achievable while limiting toxicity. Further studies are warranted to determine the mechanism underlying the interaction and the suitability of COL-FD as an unorthodox therapy for the treatment of multidrug-resistant Gram-negative infections. PMID:25987639

  13. Glycolic acid modulates the mechanical property and degradation of poly(glycerol, sebacate, glycolic acid).

    PubMed

    Sun, Zhi-Jie; Wu, Lan; Huang, Wei; Chen, Chang; Chen, Yan; Lu, Xi-Li; Zhang, Xiao-Lan; Yang, Bao-Feng; Dong, De-Li

    2010-01-01

    The development of biodegradable materials with controllable degradation properties is beneficial for a variety of applications. Poly(glycerol-sebacate) (PGS) is a promising candidate of biomaterials; so we synthesize a series of poly(glycerol, sebacate, glycolic acid) (PGSG) with 1:2:0, 1:2:0.2, 1:2:0.4, 1:2:0.6, 1:2:1 mole ratio of glycerol, sebacate, and glycolic acid to elucidate the relation of doped glycolic acid to the degradation rate and mechanical properties. The microstructures of the polymers with different doping of glycolic acid were dissimilar. PGSG with glycolic acid in the ratio of 0.2 displayed an integral degree of ordering, different to those with glycolic acid in the ratio of 0, 0.4, 0.6, and 1, which showed mild phase separation structure. The number, DeltaH(m), and temperature of the PGSG melting peaks tended to decrease with the increasing ratio of doped glycolic acid. In vitro and in vivo degradation tests showed that the degradation rate of PGSG with glycolic acid in the ratio of 0.2 was slowest, but in the ratio range of 0, 0.4, and 0.6, the degradation rate increased with the increase of glycolic acid. All PGSG samples displayed good tissue response and anticoagulant effects. Our data suggest that doping glycolic acid can modulate the microstructure and degree of crosslinking of PGS, thereby control the degradation rate of PGS.

  14. Fatty acids regulate CREBh via transcriptional mechanisms that are dependent on proteasome activity and insulin

    PubMed Central

    Gentile, CL; Wang, D; Pfaffenbach, KT; Cox, R; Wei, Y; Pagliassotti, MJ

    2011-01-01

    Excess fatty acids are closely associated with metabolic dysfunction. The deleterious effects of fatty acids relate, in part, to their ability to up-regulate proinflammatory cytokines and propagate a state of systemic inflammation. CREBh is a recently identified transcription factor that appears to be required for hepatic synthesis of C-reactive protein (CRP). Recent data suggest that fatty acids can up-regulate CREBh, thus establishing a potential molecular link between fatty acids and inflammation. The aim of the current study was to examine the nature and mechanisms of fatty acid-mediated regulation of CREBh. H4IIE liver cells were incubated in the absence or presence of varying concentrations (50–500 μM) of albumin-bound, long-chain saturated (palmitate, stearate) or unsaturated (oleate, linoleate) fatty acids (1–16 hours). All fatty acids significantly increased CREBh gene expression via transcriptional mechanisms, at concentrations as low as 50 μM. Palmitate- or oleate-mediated upregulation of CREBh was not inhibited by triacsin C, an inhibitor of long-chain fatty acyl CoA synthetase, or by the PPARα antagonist, MK886. Inhibition of proteasome activity with MG132 or lactacystin, or inclusion of insulin reduced palmitate- and oleate-mediated increases in CREBh mRNA. Finally, we examined fatty acid regulation of CREBh in vivo. Male Wistar rats were exposed to a 4-hour pancreatic clamp combined with infusion of saline or a mixed lipid emulsion. CREBh mRNA and protein were significantly increased in rats exposed to the lipid infusion compared to the saline group. Collectively, these results may have important implications for metabolic diseases characterized by excess fatty acids, insulin resistance and inflammation. PMID:20607591

  15. Diversity of acid stress resistant variants of Listeria monocytogenes and the potential role of ribosomal protein S21 encoded by rpsU

    PubMed Central

    Metselaar, Karin I.; den Besten, Heidy M. W.; Boekhorst, Jos; van Hijum, Sacha A. F. T.; Zwietering, Marcel H.; Abee, Tjakko

    2015-01-01

    The dynamic response of microorganisms to environmental conditions depends on the behavior of individual cells within the population. Adverse environments can select for stable stress resistant subpopulations. In this study, we aimed to get more insight in the diversity within Listeria monocytogenes LO28 populations, and the genetic basis for the increased resistance of stable resistant fractions isolated after acid exposure. Phenotypic cluster analysis of 23 variants resulted in three clusters and four individual variants and revealed multiple-stress resistance, with both unique and overlapping features related to stress resistance, growth, motility, biofilm formation, and virulence indicators. A higher glutamate decarboxylase activity correlated with increased acid resistance. Whole genome sequencing revealed mutations in rpsU, encoding ribosomal protein S21 in the largest phenotypic cluster, while mutations in ctsR, which were previously shown to be responsible for increased resistance of heat and high hydrostatic pressure resistant variants, were not found in the acid resistant variants. This underlined that large population diversity exists within one L. monocytogenes strain and that different adverse conditions drive selection for different variants. The finding that acid stress selects for rpsU variants provides potential insights in the mechanisms underlying population diversity of L. monocytogenes. PMID:26005439

  16. Acid ceramidase in prostate cancer radiation therapy resistance and relapse

    NASA Astrophysics Data System (ADS)

    Cheng, Joseph C.

    Prostate tumor cell escape from ionizing radiation (IR)-induced killing can lead to disease progression and relapse. Sphingolipids such as ceramide and sphingosine 1-phosphate influence signal transduction pathways that regulate stress response in cancer cells. In particular, metabolism of apoptotic ceramide constitutes an important survival adaptation. Assessments of enzyme activity, mRNA, and protein demonstrated preferential upregulation of the ceramide deacylating enzyme acid ceramidase (AC) in irradiated cancer cells. Promoter-reporter and ChIP-qPCR assays revealed AC transcription by activator protein 1 (AP-1) is sensitive to pharmacological inhibition of de novo ceramide biosynthesis, identifying a protective feedback mechanism that mitigates the effects of IR-induced ceramide. Deregulation of c-Jun, in particular, induced marked radiosensitization in vitro and in vivo, which was rescued by ectopic AC over-expression. AC over-expression in prostate cancer clonogens surviving 80 Gray fractionated irradiation was associated with increased radioresistance and proliferation, suggesting a role in radiotherapy failure and relapse. Indeed, immunohistochemical analysis of human prostate cancer tissues revealed higher levels of AC after radiotherapy failure than therapy-naive adenocarcinoma, PIN, or benign tissues. By genetically downregulating AC with small interfering RNA (siRNA), we observed radiosensitization of cells using clonogenic and cytotoxicity assays. Finally, treatment with lysosomotropic small molecule inhibitors of AC, LCL385 or LCL521, induced prostate cancer xenograft radiosensitization and long-term suppression, suggesting AC is a tractable target for adjuvant radiotherapy.

  17. Mechanically robust superhydrophobic steel surface with anti-icing, UV-durability, and corrosion resistance properties.

    PubMed

    Wang, Nan; Xiong, Dangsheng; Deng, Yaling; Shi, Yan; Wang, Kun

    2015-03-25

    A superhydrophobic steel surface was prepared through a facile method: combining hydrogen peroxide and an acid (hydrochloric acid or nitric acid) to obtain hierarchical structures on steel, followed by a surface modification treatment. Empirical grid maps based on different volumes of H2O2/acid were presented, revealing a wettability gradient from "hydrophobic" to "rose effect" and finally to "lotus effect". Surface grafting has been demonstrated to be realized only on the oxidized area. As-prepared superhydrophobic surfaces exhibited excellent anti-icing properties according to the water-dripping test under overcooled conditions and the artificial "steam-freezing" (from 50 °C with 90% humidity to the -20 °C condition) test. In addition, the surfaces could withstand peeling with 3M adhesive tape at least 70 times with an applied pressure of 31.2 kPa, abrasion by 400 grid SiC sandpaper for 110 cm under 16 kPa, or water impacting for 3 h without losing superhydrophobicity, suggesting superior mechanical durability. Moreover, outstanding corrosion resistance and UV-durability were obtained on the prepared surface. This successful fabrication of a robust, anti-icing, UV-durable, and anticorrosion superhydrophobic surface could yield a prospective candidate for various practical applications. PMID:25749123

  18. Mechanisms of Acid and Base Secretion by the Airway Epithelium

    PubMed Central

    Fischer, Horst; Widdicombe, Jonathan H.

    2010-01-01

    SUMMARY One of the main functions of the airway epithelium is to inactivate and remove infectious particles from inhaled air and thereby prevent infection of the distal lung. This function is achieved by mucociliary and cough clearance and by antimicrobial factors present in the airway surface liquid (ASL). There are indications that airway defenses are affected by the pH of the ASL and historically, acidification of the airway surfaces has been suggested as a measure of airway disease. However, even in health, the ASL is slightly acidic, and this acidity might be part of normal airway defense. Only recently research has focused on the mechanisms responsible for acid and base secretion into the ASL. Advances resulted from research into the airway disease associated with cystic fibrosis (CF) after it was found that the CFTR C1- channel conducts HCO3- and, therefore, may contribute to ASL pH. However, the acidity of the ASL indicated parallel mechanisms for H+ secretion. Recent investigations identified several H+ transporters in the apical membrane of the airway epithelium. These include H+ channels and ATP-driven H+ pumps, including a non-gastric isoform of the H+-K+ ATPase and a vacuolar-type H+ ATPase. Current knowledge of acid and base transporters and their potential roles in airway mucosal pH regulation is reviewed here. PMID:17091214

  19. Development of trastuzumab-resistant human gastric carcinoma cell lines and mechanisms of drug resistance

    PubMed Central

    Zuo, Qiang; Liu, Jing; Zhang, Jingwen; Wu, Mengwan; Guo, Lihong; Liao, Wangjun

    2015-01-01

    Trastuzumab has been successfully employed for the treatment of Her-2-positive gastric cancer. However, there are problems with both primary and secondary resistance to trastuzumab. In this study, we employed the human gastric carcinoma cell line NCI-N87 with high Her-2 expression to create trastuzumab-resistant NCI-N87/TR cells by stepwise exposure to increasing doses of trastuzumab. Western blotting and Real-time PCR were conducted to detect protein and gene levels. Compared with NCI-N87 cells, the expression of P-IGF-1R and P-AKT proteins was significantly increased in NCI-N87/TR cells (both P = 0.000), while PTEN gene and protein expression showed a significant decrease (both P = 0.000). In addition, mutations of the PTEN gene were detected at exons 5, 7, and 8. The sensitivity of NCI-N87/TR cells to trastuzumab was increased by transfection with the PTEN gene, or by incubation with a PI3K inhibitor (LY294002) or an IGF-IR inhibitor (AG1024), as well as siRNA targeting PI3K p110 or IGF-1R. Taken together, our findings showed that activation of the PI3K-AKT signaling pathway was one of the major mechanisms leading to resistance of NCI-N87/TR gastric cancer cells to trastuzumab, which was probably associated with PTEN gene down-regulation and mutation, as well as with over-activity of the IGF-1R signaling pathway. PMID:26108989

  20. Clinical epidemiology and resistance mechanisms of carbapenem-resistant Acinetobacter baumannii, French Guiana, 2008-2014.

    PubMed

    Mahamat, Aba; Bertrand, Xavier; Moreau, Brigitte; Hommel, Didier; Couppie, Pierre; Simonnet, Christine; Kallel, Hatem; Demar, Magalie; Djossou, Felix; Nacher, Mathieu

    2016-07-01

    This study investigated the clinical epidemiology and resistance mechanisms of Acinetobacter baumannii and characterised the clonal diversity of carbapenem-resistant A. baumannii (CRAB) during an ICU-associated outbreak at Cayenne Hospital, French Guiana. All non-duplicate A. baumannii isolates from 2008 to 2014 were tested for antibiotic susceptibility by disk diffusion. Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on CRAB. Of the 441 A. baumannii isolates, most were from males (54.0%) and were detected mainly from the ICU (30.8%) and medicine wards (21.8%). In the ICU, strains were mainly isolated from the respiratory tract (44.1%) and bloodstream (14.0%), whereas in medicine wards they mainly were from wound/drainage (36.5%) and bloodstream (25.0%). A. baumannii showed the greatest susceptibility to piperacillin/tazobactam (92.7%), imipenem (92.5%), colistin (95.6%) and amikacin (97.2%), being lower in the ICU and medicine wards compared with other wards. An outbreak of OXA-23-producing CRAB occurred in the 13-bed ICU in 2010. CRAB strains were more co-resistant to other antimicrobials compared with non-CRAB. Molecular genetics analysis revealed five sequence types [ST78, ST107 and ST642 and two new STs (ST830 and ST831)]. Analysis of PFGE profiles indicated cross-transmissions of CRAB within the ICU, between the ICU and one medicine ward during transfer of patients, and within that medicine ward. This study provides the first clinical and molecular data of A. baumannii from French Guiana and the Amazon basin. The ICU was the highest risk unit of this nosocomial outbreak of OXA-23-producing CRAB, which could subsequently disseminate within the hospital.

  1. Characterization of resistance mechanisms to powdery mildew (Erysiphe betae) in beet (Beta vulgaris).

    PubMed

    Fernández-Aparicio, Mónica; Prats, Elena; Emeran, Amero A; Rubiales, Diego

    2009-04-01

    Beet powdery mildew incited by Erysiphe betae is a serious foliar fungal disease of worldwide distribution causing losses of up to 30%. In the present work, we searched for resistance in a germplasm collection of 184 genotypes of Beta vulgaris including fodder (51 genotypes), garden (60 genotypes), leaf (51 genotypes), and sugar (22 genotypes) beet types. Resistant genotypes were identified in the four beet types under study. In addition, mechanisms underlying resistance were dissected through histological studies. These revealed different resistance mechanisms acting at different fungal developmental stages, i.e., penetration resistance, early and late cell death, or posthaustorial resistance. Most genotypes were able to hamper fungal development at several stages. The later are interesting for breeding aiming to resistance durability. Furthermore, characterization of defense mechanisms will be useful for further cellular and molecular studies to unravel the bases of resistance in this species.

  2. A novel P106L mutation in EPSPS and an unknown mechanism(s) act additively to confer resistance to glyphosate in a South African Lolium rigidum population.

    PubMed

    Kaundun, Shiv S; Dale, Richard P; Zelaya, Ian A; Dinelli, Giovanni; Marotti, Ilaria; McIndoe, Eddie; Cairns, Andrew

    2011-04-13

    Glyphosate resistance evolution in weeds is a growing problem in world agriculture. Here, we have investigated the mechanism(s) of glyphosate resistance in a Lolium rigidum population (DAG1) from South Africa. Nucleotide sequencing revealed the existence of at least three EPSPS homologues in the L. rigidum genome and identified a novel proline 106 to leucine substitution (P106L) in 52% DAG1 individuals. This mutation conferred a 1.7-fold resistance increase to glyphosate at the whole plant level. Additionally, a 3.1-fold resistance increase, not linked to metabolism or translocation, was estimated between wild-type P106-DAG1 and P106-STDS sensitive plants. Point accepted mutation analysis suggested that other amino acid substitutions at EPSPS position 106 are likely to be found in nature besides the P106/S/A/T/L point mutations reported to date. This study highlights the importance of minor mechanisms acting additively to confer significant levels of resistance to commercial field rates of glyphosate in weed populations subjected to high selection pressure.

  3. Obesity, insulin resistance and comorbidities – Mechanisms of association

    PubMed Central

    Castro, Ana Valeria B.; Kolka, Cathryn M.; Kim, Stella P.; Bergman, Richard N.

    2015-01-01

    Overall excess of fat, usually defined by the body mass index, is associated with metabolic (e.g. glucose intolerance, type 2 diabetes mellitus (T2DM), dyslipidemia) and non-metabolic disorders (e.g. neoplasias, polycystic ovary syndrome, non-alcoholic fat liver disease, glomerulopathy, bone fragility etc.). However, more than its total amount, the distribution of adipose tissue throughout the body is a better predictor of the risk to the development of those disorders. Fat accumulation in the abdominal area and in non-adipose tissue (ectopic fat), for example, is associated with increased risk to develop metabolic and non-metabolic derangements. On the other hand, observations suggest that individuals who present peripheral adiposity, characterized by large hip and thigh circumferences, have better glucose tolerance, reduced incidence of T2DM and of metabolic syndrome. Insulin resistance (IR) is one of the main culprits in the association between obesity, particularly visceral, and metabolic as well as non-metabolic diseases. In this review we will highlight the current pathophysiological and molecular mechanisms possibly involved in the link between increased VAT, ectopic fat, IR and comorbidities. We will also provide some insights in the identification of these abnormalities. PMID:25211442

  4. Phosphatidic acid enhances mTOR signaling and resistance exercise induced hypertrophy

    PubMed Central

    2014-01-01

    Introduction The lipid messenger phosphatidic acid (PA) plays a critical role in the stimulation of mTOR signaling. However, the mechanism by which PA stimulates mTOR is currently unknown. Therefore, the purpose of this study was to compare the effects of various PA precursors and phospholipids on their ability to stimulate mTOR signaling and its ability to augment resistance training-induced changes in body composition and performance. Methods In phase one, C2C12 myoblasts cells were stimulated with different phospholipids and phospholipid precursors derived from soy and egg sources. The ratio of phosphorylated p70 (P-p70-389) to total p70 was then used as readout for mTOR signaling. In phase two, resistance trained subjects (n = 28, 21 ± 3 years, 77 ± 4 kg, 176 ± 9 cm) consumed either 750 mg PA daily or placebo and each took part in an 8 week periodized resistance training program. Results In phase one, soy-phosphatidylserine, soy-Lyso-PA, egg-PA, and soy-PA stimulated mTOR signaling, and the effects of soy-PA (+636%) were significantly greater than egg-PA (+221%). In phase two, PA significantly increased lean body mass (+2.4 kg), cross sectional area (+1.0 cm), and leg press strength (+51.9 kg) over placebo. Conclusion PA significantly activates mTOR and significantly improved responses in skeletal muscle hypertrophy, lean body mass, and maximal strength to resistance exercise. PMID:24959196

  5. Mechanisms of daptomycin resistance in Staphylococcus aureus: role of the cell membrane and cell wall

    PubMed Central

    Bayer, Arnold S.; Schneider, Tanja; Sahl, Hans-Georg

    2012-01-01

    The bactericidal, cell membrane-targeting lipopeptide antibiotic daptomycin (DAP) is an important agent in treating invasive Staphylococcus aureus infections. However, there have been numerous recent reports of development of daptomycin-resistance (DAP-R) during therapy with this agent. The mechanisms of DAP-R in S. aureus appear to be quite diverse. DAP-R strains often exhibit progressive accumulation of single nucleotide polymorphisms in the multipeptide resistance factor gene (mprF) and the yycFG components of the yycFGHI operon. Both loci are involved in key cell membrane (CM) events, with mprF being responsible for the synthesis and outer CM translocation of the positively-charged phospholipid, lysyl-phosphotidylglycerol (L-PG), while the yyc operon is involved in the generalized response to stressors such as antimicrobials. In addition, other perturbations of the CM have been identified in DAP-R strains including: extremes in CM order; resistance to CM depolarization and permeabilization; and reduced surface binding of DAP. Moreover, modifications of the cell wall (CW) appear to also contribute to DAP-R, including enhanced expression of the dlt operon (involved in D-alanylation of CW teichoic acids) and progressive CW thickening. PMID:23215859

  6. ENHANCED DISEASE SUSCEPTIBILITY 1 and SALICYLIC ACID act redundantly to regulate resistance gene-mediated signaling

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance (R) protein–associated pathways are well known to participate in defense against a variety of microbial pathogens. Salicylic acid (SA) and its associated proteinaceous signaling components, including enhanced disease susceptibility 1 (EDS1), non–race-specific disease resistance 1 (NDR1), ...

  7. Response to oxalic acid as a resistance assay for Sclerotinia minor in peanut

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Response to oxalic acid was evaluated as a potential assay for screening peanut breeding lines for resistance to Sclerotinia blight caused by Sclerotinia minor. Detached stems of seven Spanish- and six runner-type peanut cultivars and advanced breeding lines, varying in resistance to Sclerotinia bl...

  8. Photodegradation and inhibition of drug-resistant influenza virus neuraminidase using anthraquinone-sialic acid hybrids.

    PubMed

    Aoki, Yusuke; Tanimoto, Shuho; Takahashi, Daisuke; Toshima, Kazunobu

    2013-02-11

    The anthraquinone-sialic acid hybrids designed effectively degraded not only non-drug-resistant neuraminidase but also drug-resistant neuraminidase, which is an important target of anti-influenza therapy. Degradation was achieved using long-wavelength UV radiation in the absence of any additives and under neutral conditions. Moreover, the hybrids efficiently inhibited neuraminidase activities upon photo-irradiation. PMID:23282898

  9. Resistance to antivirals in human cytomegalovirus: mechanisms and clinical significance.

    PubMed

    Pérez, J L

    1997-09-01

    Long term therapies needed for managing human cytomegalovirus (HCMV) infections in immunosupressed patients provided the background for the emergence of the resistance to antivirals active against HCMV. In addition, laboratory selected mutants have also been readily achieved. Both clinical and laboratory resistant strains share the same determinants of resistance. Ganciclovir resistance may be due to a few mutations in the HCMV UL97 gene and/or viral DNA pol gene, the former being responsible for about 70% of clinical resistant isolates. Among them, V464, V594, S595 and F595 are the most frequent mutations. Because of their less extensive clinical use, much less is known about resistance to foscarnet and cidofovir (formerly, HPMPC) but in both cases, it has been associated to mutations in the DNA pol. Ganciclovir resistant strains showing DNA pol mutations are cross-resistant to cidofovir and their corresponding IC50 are normally higher than those from strains harboring only mutations at the UL97 gene. To date, foscarnet resistance seems to be independent of both ganciclovir and cidofovir resistance.

  10. Plants on constant alert: elevated levels of jasmonic acid and jasmonate-induced transcripts in caterpillar-resistant maize.

    PubMed

    Shivaji, Renuka; Camas, Alberto; Ankala, Arunkanth; Engelberth, Jurgen; Tumlinson, James H; Williams, W Paul; Wilkinson, Jeff R; Luthe, Dawn Sywassink

    2010-02-01

    This study was conducted to determine if constitutive levels of jasmonic acid (JA) and other octadecanoid compounds were elevated prior to herbivory in a maize genotype with documented resistance to fall armyworm (Spodoptera frugiperda) and other lepidopteran pests. The resistant inbred Mp708 had approximately 3-fold higher levels of jasmonic acid (JA) prior to herbivore feeding than the susceptible inbred Tx601. Constitutive levels of cis-12-oxo-phytodienoic acid (OPDA) also were higher in Mp708 than Tx601. In addition, the constitutive expression of JA-inducible genes, including those in the JA biosynthetic pathway, was higher in Mp708 than Tx601. In response to herbivory, Mp708 generated comparatively higher levels of hydrogen peroxide, and had a greater abundance of NADPH oxidase transcripts before and after caterpillar feeding. Before herbivore feeding, low levels of transcripts encoding the maize insect resistance cysteine protease (Mir1-CP) and the Mir1-CP protein were detected consistently. Thus, Mp708 appears to have a portion of its defense pathway primed, which results in constitutive defenses and the ability to mount a stronger defense when caterpillars attack. Although the molecular mechanisms that regulate the constitutive accumulation of JA in Mp708 are unknown, it might account for its enhanced resistance to lepidopteran pests. This genotype could be valuable in studying the signaling pathways that maize uses to response to insect herbivores.

  11. Genetic resistance in experimental autoimmune encephalomyelitis. I. Analysis of the mechanism of LeR resistance using radiation chimeras

    SciTech Connect

    Pelfrey, C.M.; Waxman, F.J.; Whitacre, C.C. )

    1989-09-01

    Experimental autoimmune encephalomyelitis (EAE) is a cell-mediated autoimmune disease of the central nervous system that has been extensively studied in the rat. The Lewis rat is highly susceptible to the induction of EAE, while the Lewis resistant (LeR) rat is known to be resistant. In this paper, we demonstrate that the LeR rat, which was derived from the Lewis strain by inbreeding of fully resistant animals, is histocompatible with the Lewis strain. Radiation chimeras, a tool for distinguishing between immunologic and nonimmunologic resistance mechanisms, were utilized to analyze the cellular mechanisms involved in genetic resistance to EAE. By transplanting bone marrow cells from LeR rats into irradiated Lewis recipients, Lewis rats were rendered resistant to EAE induction. Likewise, transplanting Lewis bone marrow cells into irradiated LeR recipients rendered LeR rats susceptible. Mixed lymphoid cell chimeras using bone marrow, spleen, and thymus cells in Lewis recipient rats revealed individual lymphoid cell types and cell interactions that significantly affected the incidence and severity of EAE. Our results suggest that LeR resistance is mediated by hematopoietic/immune cells, and that cells located in the spleen appear to play a critical role in the resistance/susceptibility to EAE induction. Depletion of splenic adherent cells did not change the patterns of EAE resistance. In vivo cell mixing studies suggested the presence of a suppressor cell population in the LeR spleen preparations which exerted an inhibitory effect on Lewis autoimmune responses. Thus, the mechanism of LeR resistance appears to be different from that in other EAE-resistant animals.

  12. Antibiotic resistance and multidrug-resistant efflux pumps expression in lactic acid bacteria isolated from pozol, a nonalcoholic Mayan maize fermented beverage.

    PubMed

    Wacher-Rodarte, Maria Del Carmen; Trejo-Muñúzuri, Tanya Paulina; Montiel-Aguirre, Jesús Fernando; Drago-Serrano, Maria Elisa; Gutiérrez-Lucas, Raúl L; Castañeda-Sánchez, Jorge Ismael; Sainz-Espuñes, Teresita

    2016-05-01

    Pozol is a handcrafted nonalcoholic Mayan beverage produced by the spontaneous fermentation of maize dough by lactic acid bacteria. Lactic acid bacteria (LAB) are carriers of chromosomal encoded multidrug-resistant efflux pumps genes that can be transferred to pathogens and/or confer resistance to compounds released during the fermentation process causing food spoiling. The aim of this study was to evaluate the antibiotic sensibility and the transcriptional expression of ABC-type efflux pumps in LAB isolated from pozol that contributes to multidrug resistance. Analysis of LAB and Staphylococcus (S.) aureus ATCC 29213 and ATCC 6538 control strains to antibiotic susceptibility, minimal inhibitory concentration (MIC), and minimal bactericidal concentration (MBC) to ethidium bromide were based in "standard methods" whereas the ethidium bromide efflux assay was done by fluorometric assay. Transcriptional expression of efflux pumps was analyzed by RT-PCR. LAB showed antibiotic multiresistance profiles, moreover, Lactococcus (L.) lactis and Lactobacillus (L.) plantarum displayed higher ethidium bromide efflux phenotype than S. aureus control strains. Ethidium bromide resistance and ethidium bromide efflux phenotypes were unrelated with the overexpression of lmrD in L. lactics, or the underexpression of lmrA in L. plantarum and norA in S. aureus. These findings suggest that, moreover, the analyzed efflux pumps genes, other unknown redundant mechanisms may underlie the antibiotic resistance and the ethidium bromide efflux phenotype in L. lactis and L. plantarum. Phenotypic and molecular drug multiresistance assessment in LAB may improve a better selection of the fermentation starter cultures used in pozol, and to control the antibiotic resistance widespread and food spoiling for health safety.

  13. Antibiotic resistance and multidrug-resistant efflux pumps expression in lactic acid bacteria isolated from pozol, a nonalcoholic Mayan maize fermented beverage.

    PubMed

    Wacher-Rodarte, Maria Del Carmen; Trejo-Muñúzuri, Tanya Paulina; Montiel-Aguirre, Jesús Fernando; Drago-Serrano, Maria Elisa; Gutiérrez-Lucas, Raúl L; Castañeda-Sánchez, Jorge Ismael; Sainz-Espuñes, Teresita

    2016-05-01

    Pozol is a handcrafted nonalcoholic Mayan beverage produced by the spontaneous fermentation of maize dough by lactic acid bacteria. Lactic acid bacteria (LAB) are carriers of chromosomal encoded multidrug-resistant efflux pumps genes that can be transferred to pathogens and/or confer resistance to compounds released during the fermentation process causing food spoiling. The aim of this study was to evaluate the antibiotic sensibility and the transcriptional expression of ABC-type efflux pumps in LAB isolated from pozol that contributes to multidrug resistance. Analysis of LAB and Staphylococcus (S.) aureus ATCC 29213 and ATCC 6538 control strains to antibiotic susceptibility, minimal inhibitory concentration (MIC), and minimal bactericidal concentration (MBC) to ethidium bromide were based in "standard methods" whereas the ethidium bromide efflux assay was done by fluorometric assay. Transcriptional expression of efflux pumps was analyzed by RT-PCR. LAB showed antibiotic multiresistance profiles, moreover, Lactococcus (L.) lactis and Lactobacillus (L.) plantarum displayed higher ethidium bromide efflux phenotype than S. aureus control strains. Ethidium bromide resistance and ethidium bromide efflux phenotypes were unrelated with the overexpression of lmrD in L. lactics, or the underexpression of lmrA in L. plantarum and norA in S. aureus. These findings suggest that, moreover, the analyzed efflux pumps genes, other unknown redundant mechanisms may underlie the antibiotic resistance and the ethidium bromide efflux phenotype in L. lactis and L. plantarum. Phenotypic and molecular drug multiresistance assessment in LAB may improve a better selection of the fermentation starter cultures used in pozol, and to control the antibiotic resistance widespread and food spoiling for health safety. PMID:27247772

  14. Characterization of Pseudomonas aeruginosa isolates from dogs and cats in Japan: current status of antimicrobial resistance and prevailing resistance mechanisms.

    PubMed

    Harada, Kazuki; Arima, Sayuri; Niina, Ayaka; Kataoka, Yasushi; Takahashi, Toshio

    2012-02-01

    Seventy-three Pseudomonas aeruginosa isolates were collected from dogs and cats in Japan to investigate antimicrobial susceptibility and resistance mechanisms to anti-pseudomonal agents. Resistance rates against orbifloxacin, enrofloxacin, ciprofloxacin, cefotaxime, aztreonam and gentamicin were 34.2, 31.5, 20.5, 17.8, 12.3 and 4.1%, respectively. The degree of resistance to cefotaxime, orbifloxacin, and enrofloxacin was greatly affected by efflux pump inhibitors, indicating overexpression of efflux pump contributes to these resistances. Notably, orbifloxacin and enrofloxacin resistance was observed even in isolates without mutations in the target sites. This is the first report on cephalosporin- and fluoroquinolone-resistant isolates of P. aeruginosa from Japanese companion animals.

  15. Diets Containing α-Linolenic (ω3) or Oleic (ω9) Fatty Acids Rescues Obese Mice From Insulin Resistance.

    PubMed

    Oliveira, V; Marinho, R; Vitorino, D; Santos, G A; Moraes, J C; Dragano, N; Sartori-Cintra, A; Pereira, L; Catharino, R R; da Silva, A S R; Ropelle, E R; Pauli, J R; De Souza, C T; Velloso, L A; Cintra, D E

    2015-11-01

    Subclinical systemic inflammation is a hallmark of obesity and insulin resistance. The results obtained from a number of experimental studies suggest that targeting different components of the inflammatory machinery may result in the improvement of the metabolic phenotype. Unsaturated fatty acids exert antiinflammatory activity through several distinct mechanisms. Here, we tested the capacity of ω3 and ω9 fatty acids, directly from their food matrix, to exert antiinflammatory activity through the G protein-coupled receptor (GPR)120 and GPR40 pathways. GPR120 was activated in liver, skeletal muscle, and adipose tissues, reverting inflammation and insulin resistance in obese mice. Part of this action was also mediated by GPR40 on muscle, as a novel mechanism described. Pair-feeding and immunoneutralization experiments reinforced the pivotal role of GPR120 as a mediator in the response to the nutrients. The improvement in insulin sensitivity in the high-fat substituted diets was associated with a marked reduction in tissue inflammation, decreased macrophage infiltration, and increased IL-10 levels. Furthermore, improved glucose homeostasis was accompanied by the reduced expression of hepatic gluconeogenic enzymes and reduced body mass. Thus, our data indicate that GPR120 and GPR40 play a critical role as mediators of the beneficial effects of dietary unsaturated fatty acids in the context of obesity-induced insulin resistance. PMID:26280128

  16. Molecular mechanisms of quinolone resistance in clinical isolates of Aeromonas caviae and Aeromonas veronii bv. sobria.

    PubMed

    Arias, Antonina; Seral, Cristina; Gude, M José; Castillo, F Javier

    2010-09-01

    Mutations in quinolone targets were studied together with quinolone efflux pump activation and plasmid-mediated quinolone resistance determinants in nalidixic-acid-resistant isolates of Aeromonas caviae and Aeromonas veronii. Among 135 clinical Aeromonas spp. isolated from stools of patients with gastrointestinal symptoms, 40 nalidixic acid-resistant strains belonging to A. caviae and A. veronii were selected and their susceptibility to different quinolones (ciprofloxacin, norfloxacin, ofloxacin) further evaluated. Susceptibility to nalidixic acid and ciprofloxacin in the presence/absence of Phe- Arg-β-naphthylamide was also determined. The 16 nalidixic-acid-resistant strains identified as A. caviae were more resistant than the 24 A. veronii bv. sobria strains to ciprofloxacin, norfloxacin, and ofloxacin. All strains showed a mutation (single or double) at position 83 of the QRDR sequence of gyrA, with Ser-83 → Ile as the most frequent substitution. By contrast, no mutations were found at position 87 of gyrA. Double substitutions (GyrA-ParC) were detected in 50% of A. veronii bv. sobria isolates and in 43.75% of A. caviae strains. Both species showed decreases in the MICs of ciprofloxacin. A qnrS gene was found in an A. caviae strain. Thus, in the two species of nalidixic-acid-resistant Aeromonas isolates examined, resistance mediated by efflux pumps contributed only slightly to ciprofloxacin resistance. While two isolates were positive for the aac(6')-Ib gene, no -cr variants were detected.

  17. Structure-dependent effects of pyridine derivatives on mechanisms of intestinal fatty acid uptake: regulation of nicotinic acid receptor and fatty acid transporter expression.

    PubMed

    Riedel, Annett; Lang, Roman; Rohm, Barbara; Rubach, Malte; Hofmann, Thomas; Somoza, Veronika

    2014-07-01

    Pyridines are widely distributed in foods. Nicotinic acid (NA), a carboxylated pyridine derivative, inhibits lipolysis in adipocytes by activation of the orphan NA receptor (HM74A) and is applied to treat hyperlipidemia. However, knowledge on the impact of pyridine derivatives on intestinal lipid metabolism is scarce. This study was performed to identify the structural determinants of pyridines for their effects on fatty acid uptake in enterocyte-like Caco-2 cells and to elucidate the mechanisms of action. The impact of 17 pyridine derivatives on fatty acid uptake was tested. Multiple regression analysis revealed the presence of a methyl group to be the structural determinant at 0.1 mM, whereas at 1 mM, the presence of a carboxylic group and the N-methylation presented further structural characteristics to affect the fatty acid uptake. NA, showing a stimulating effect on FA uptake, and N-methyl-4-phenylpyridinium (MPP), inhibiting FA uptake, were selected for mechanistic studies. Gene expression of the fatty acid transporters CD36, FATP2 and FATP4, and the lipid metabolism regulating transcription factors peroxisome proliferator-activated receptor (PPAR) α and PPARγ was up-regulated upon NA treatment. Caco-2 cells were demonstrated to express the low-affinity NA receptor HM74 of which the gene expression was up-regulated upon NA treatment. We hypothesize that the NA-induced fatty acid uptake might result from NA receptor activation and related intracellular signaling cascades. In contrast, MPP increased transepithelial electrical resistance. We therefore conclude that NA and MPP, both sharing the pyridine motif core, exhibit their contrary effects on intestinal FA uptake by activation of different mechanisms.

  18. Structure-dependent effects of pyridine derivatives on mechanisms of intestinal fatty acid uptake: regulation of nicotinic acid receptor and fatty acid transporter expression.

    PubMed

    Riedel, Annett; Lang, Roman; Rohm, Barbara; Rubach, Malte; Hofmann, Thomas; Somoza, Veronika

    2014-07-01

    Pyridines are widely distributed in foods. Nicotinic acid (NA), a carboxylated pyridine derivative, inhibits lipolysis in adipocytes by activation of the orphan NA receptor (HM74A) and is applied to treat hyperlipidemia. However, knowledge on the impact of pyridine derivatives on intestinal lipid metabolism is scarce. This study was performed to identify the structural determinants of pyridines for their effects on fatty acid uptake in enterocyte-like Caco-2 cells and to elucidate the mechanisms of action. The impact of 17 pyridine derivatives on fatty acid uptake was tested. Multiple regression analysis revealed the presence of a methyl group to be the structural determinant at 0.1 mM, whereas at 1 mM, the presence of a carboxylic group and the N-methylation presented further structural characteristics to affect the fatty acid uptake. NA, showing a stimulating effect on FA uptake, and N-methyl-4-phenylpyridinium (MPP), inhibiting FA uptake, were selected for mechanistic studies. Gene expression of the fatty acid transporters CD36, FATP2 and FATP4, and the lipid metabolism regulating transcription factors peroxisome proliferator-activated receptor (PPAR) α and PPARγ was up-regulated upon NA treatment. Caco-2 cells were demonstrated to express the low-affinity NA receptor HM74 of which the gene expression was up-regulated upon NA treatment. We hypothesize that the NA-induced fatty acid uptake might result from NA receptor activation and related intracellular signaling cascades. In contrast, MPP increased transepithelial electrical resistance. We therefore conclude that NA and MPP, both sharing the pyridine motif core, exhibit their contrary effects on intestinal FA uptake by activation of different mechanisms. PMID:24767308

  19. Arginine-dependent acid-resistance pathway in Shigella boydii

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ability to survive the low pH of the human stomach is considered be an important virulent determinant. Acid tolerance of Shigella boydii 18 CDPH, the strain implicated in an outbreak may have played an important role in surviving the acidic food (bean salad). The strain was capable of inducing arg...

  20. The Epoxyeicosatrienoic Acid Pathway Enhances Hepatic Insulin Signaling and is Repressed in Insulin-Resistant Mouse Liver.

    PubMed

    Schäfer, Alexander; Neschen, Susanne; Kahle, Melanie; Sarioglu, Hakan; Gaisbauer, Tobias; Imhof, Axel; Adamski, Jerzy; Hauck, Stefanie M; Ueffing, Marius

    2015-10-01

    Although it is widely accepted that ectopic lipid accumulation in the liver is associated with hepatic insulin resistance, the underlying molecular mechanisms have not been well characterized.Here we employed time resolved quantitative proteomic profiling of mice fed a high fat diet to determine which pathways were affected during the transition of the liver to an insulin-resistant state. We identified several metabolic pathways underlying altered protein expression. In order to test the functional impact of a critical subset of these alterations, we focused on the epoxyeicosatrienoic acid (EET) eicosanoid pathway, whose deregulation coincided with the onset of hepatic insulin resistance. These results suggested that EETs may be positive modulators of hepatic insulin signaling. Analyzing EET activity in primary hepatocytes, we found that EETs enhance insulin signaling on the level of Akt. In contrast, EETs did not influence insulin receptor or insulin receptor substrate-1 phosphorylation. This effect was mediated through the eicosanoids, as overexpression of the deregulated enzymes in absence of arachidonic acid had no impact on insulin signaling. The stimulation of insulin signaling by EETs and depression of the pathway in insulin resistant liver suggest a likely role in hepatic insulin resistance. Our findings support therapeutic potential for inhibiting EET degradation.

  1. A single amino acid substitution in isozyme GST mu in Triclabendazole resistant Fasciola hepatica (Sligo strain) can substantially influence the manifestation of anthelmintic resistance.

    PubMed

    Fernández, V; Estein, S; Ortiz, P; Luchessi, P; Solana, V; Solana, H

    2015-12-01

    The helminth parasite Fasciola hepatica causes fascioliasis in human and domestic ruminants. Economic losses due to this infection are estimated in U$S 2000-3000 million yearly. The most common method of control is the use of anthelmintic drugs. However, there is an increased concern about the growing appearance of F. hepatica resistance to Triclabendazole (TCBZ), an anthelmintic with activity over adult and young flukes. F. hepatica has eight Glutathione S-Transferase (GST) isozymes, which are enzymes involved in the detoxification of a wide range of substrates through chemical conjugation with glutathione. In the present work we identified and characterized the GST mu gene isolated from the TCBZ-susceptible and TCBZ-resistant F. hepatica strains. Total RNA was transcribed into cDNA by reverse transcription and a 657 bp amplicon corresponding to the GST mu gene was obtained. The comparative genetic analysis of the GST mu gene of the TCBZ susceptible strain (Cullompton) and TCBZ resistant strain (Sligo) showed three nucleotide changes and one amino acid change at position 143 in the GST mu isozyme of the TCBZ-resistant strain. These results have potential relevance as they contribute better understand the mechanisms that generate resistance to anthelmintics. PMID:26542261

  2. A single amino acid substitution in isozyme GST mu in Triclabendazole resistant Fasciola hepatica (Sligo strain) can substantially influence the manifestation of anthelmintic resistance.

    PubMed

    Fernández, V; Estein, S; Ortiz, P; Luchessi, P; Solana, V; Solana, H

    2015-12-01

    The helminth parasite Fasciola hepatica causes fascioliasis in human and domestic ruminants. Economic losses due to this infection are estimated in U$S 2000-3000 million yearly. The most common method of control is the use of anthelmintic drugs. However, there is an increased concern about the growing appearance of F. hepatica resistance to Triclabendazole (TCBZ), an anthelmintic with activity over adult and young flukes. F. hepatica has eight Glutathione S-Transferase (GST) isozymes, which are enzymes involved in the detoxification of a wide range of substrates through chemical conjugation with glutathione. In the present work we identified and characterized the GST mu gene isolated from the TCBZ-susceptible and TCBZ-resistant F. hepatica strains. Total RNA was transcribed into cDNA by reverse transcription and a 657 bp amplicon corresponding to the GST mu gene was obtained. The comparative genetic analysis of the GST mu gene of the TCBZ susceptible strain (Cullompton) and TCBZ resistant strain (Sligo) showed three nucleotide changes and one amino acid change at position 143 in the GST mu isozyme of the TCBZ-resistant strain. These results have potential relevance as they contribute better understand the mechanisms that generate resistance to anthelmintics.

  3. The rib1 Mutant Is Resistant to Indole-3-Butyric Acid, an Endogenous Auxin in Arabidopsis1

    PubMed Central

    Poupart, Julie; Waddell, Candace S.

    2000-01-01

    The presence of indole-3-butyric acid (IBA) as an endogenous auxin in Arabidopsis has been recently demonstrated. However, the in vivo role of IBA remains to be elucidated. We present the characterization of a semi-dominant mutant that is affected in its response to IBA, but shows a wild-type response to indole-3-acetic acid (IAA), the predominant and most studied form of auxin. We have named this mutant rib1 for resistant to IBA. Root elongation assays show that rib1 is specifically resistant to IBA, to the synthetic auxin 2,4-dichlorophenoxyacetic acid, and to auxin transport inhibitors. rib1 does not display increased resistance to IAA, to the synthetic auxin naphthalene acetic acid, or to other classes of plant hormones. rib1 individuals also have other root specific phenotypes including a shortened primary root, an increased number of lateral roots, and a more variable response than wild type to a change in gravitational vector. Adult rib1 plants are morphologically indistinguishable from wild-type plants. These phenotypes suggest that rib1 alters IBA activity in the root, thereby affecting root development and response to environmental stimuli. We propose models in which RIB1 has a function in either IBA transport or response. Our experiments also suggest that IBA does not use the same mechanism to exit cells as does IAA and we propose a model for IBA transport. PMID:11115890

  4. Acid diffusion, standing waves, and information theory: a molecular-scale model of chemically amplified resist

    NASA Astrophysics Data System (ADS)

    Trefonas, Peter, III; Allen, Mary T.

    1992-06-01

    Shannon's information theory is adapted to analyze the photolithographic process, defining the mask pattern as the prior state. Definitions and constraints to the general theory are developed so that the information content at various stages of the lithographic process can be described. Its application is illustrated by exploring the information content within projected aerial images and resultant latent images. Next, a 3-dimensional molecular scale model of exposure, acid diffusion, and catalytic crosslinking in acid-hardened resists (AHR) is presented. In this model, initial positions of photogenerated acids are determined by probability functions generated from the aerial images and the local light intensity in the film. In order to simulate post-exposure baking processes, acids are diffused in a random walk manner, for which the catalytic chain length and the average distance between crosslinks can be set. Crosslink locations are defined in terms of the topologically minimized number required to link different chains. The size and location of polymer chains involved in a larger scale crosslinked network is established and related to polymer solubility. In this manner, the nature of the crosslinked latent image can be established. Good correlation with experimental data is found for the calculated percent insolubilization as a function of dose when the rms acid diffusion length is about 500 angstroms. Information analysis is applied in detail to the specific example of AHR chemistry. The information contained within the 3-D crosslinked latent image is explored as a function of exposure dose, catalytic chain length, average distance between crosslinks. Eopt (the exposure dose which optimizes the information contained within the latent image) was found to vary with catalytic chain length in a manner similar to that observed experimentally in a plot of E90 versus post-exposure bake time. Surprisingly, the information content of the crosslinked latent image remains

  5. Mechanisms of self-resistance in the platensimycin and platencin producing Streptomyces platensis MA7327 and MA7339 strains

    PubMed Central

    Rudolf, Jeffrey D.; Smanski, Michael J.; Shen, Ben

    2014-01-01

    Summary Platensimycin (PTM) and platencin (PTN) are potent inhibitors of bacterial fatty acid synthases and have emerged as promising antibacterial drug leads. We previously characterized the PTM and PTN biosynthetic machineries in the Streptomyces platensis producers. We now identify two mechanisms for PTM and PTN resistance in the S. platensis producers - the ptmP3 or ptnP3 gene within the PTM-PTN or PTN biosynthetic cluster and the fabF gene within the fatty acid synthase locus. PtmP3/PtnP3 and FabF confer PTM and PTN resistance by target replacement and target modification, respectively. PtmP3/PtnP3 also represents an unprecedented mechanism for fatty acid biosynthesis in which FabH and FabF are functionally replaced by a single condensing enzyme. These findings challenge the current paradigm for fatty acid biosynthesis and should be considered in future development of effective therapeutics targeting fatty acid synthase. PMID:24560608

  6. Role of sialic acid in insulin action and the insulin resistance of diabetes mellitus

    SciTech Connect

    Salhanick, A.I.; Amatruda, J.M. )

    1988-08-01

    Adipocytes treated with neuraminidase show markedly reduced responsiveness to insulin without any alteration in insulin binding. In addition, several studies have separately demonstrated both insulin resistance and decreases in membrane sialic acid content and associated biosynthetic enzymes in diabetes mellitus. In the present study, the authors investigated the role that sialic acid residues may play in insulin action and in the hepatic insulin resistance associated with nonketotic diabetes. Primary cultures of hepatocytes from normal rats treated with neuraminidase demonstrated a dose-dependent decrease in insulin-stimulated lipogenesis. At a concentration of neuraminidase that decreases insulin action by 50%, 23% of total cellular sialic acid content was released. Neuraminidase-releasable sialic acid was significantly decreased in hepatocytes from diabetic rats and this was associated with significant insulin resistance. Treatment of hepatocytes from diabetic rats with cytidine 5{prime}-monophospho-N-acetylneuraminic acid (CMP-NANA) enhanced insulin responsiveness 39%. The enhanced insulin responsiveness induced by CMP-NANA was blocked by cytidine 5{prime}-monophosphate (CMP) suggesting that the CMP-NANA effect was catalyzed by a cell surface sialyl-transferase. CMP reduced neuraminidase-releasable ({sup 14}C)sialic acid incorporation into hepatocytes by 43%. The data demonstrate a role for cell surface sialic acid residues in hepatic insulin action and support a role for decreased cell surface sialic acid residues in the insulin resistance of diabetes mellitus.

  7. PROTEOMIC ANALYSIS OF B-AMINOBUTYRIC ACID-PRIMED DROUGHT RESISTANCE IN CRABAPPLE SEEDLINGS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a variety of annual crops and some model plant species, the non-protein, amino acid, DL-B-aminobutyric acid (BABA), has been shown to enhance disease resistance and increase salt and drought tolerance, through sensitization, and not direct induction of defense genes. This process is referred to a...

  8. Antimicrobial Drug Resistance of Salmonella enterica Serovar Typhi in Asia and Molecular Mechanism of Reduced Susceptibility to the Fluoroquinolones▿

    PubMed Central

    Chau, Tran Thuy; Campbell, James Ian; Galindo, Claudia M.; Van Minh Hoang, Nguyen; Diep, To Song; Nga, Tran Thu Thi; Van Vinh Chau, Nguyen; Tuan, Phung Quoc; Page, Anne Laure; Ochiai, R. Leon; Schultsz, Constance; Wain, John; Bhutta, Zulfiqar A.; Parry, Christopher M.; Bhattacharya, Sujit K.; Dutta, Shanta; Agtini, Magdarina; Dong, Baiqing; Honghui, Yang; Anh, Dang Duc; Canh, Do Gia; Naheed, Aliya; Albert, M. John; Phetsouvanh, Rattanaphone; Newton, Paul N.; Basnyat, Buddha; Arjyal, Amit; La, Tran Thi Phi; Rang, Nguyen Ngoc; Phuong, Le Thi; Van Be Bay, Phan; von Seidlein, Lorenz; Dougan, Gordon; Clemens, John D.; Vinh, Ha; Hien, Tran Tinh; Chinh, Nguyen Tran; Acosta, Camilo J.; Farrar, Jeremy; Dolecek, Christiane

    2007-01-01

    This study describes the pattern and extent of drug resistance in 1,774 strains of Salmonella enterica serovar Typhi isolated across Asia between 1993 and 2005 and characterizes the molecular mechanisms underlying the reduced susceptibilities to fluoroquinolones of these strains. For 1,393 serovar Typhi strains collected in southern Vietnam, the proportion of multidrug resistance has remained high since 1993 (50% in 2004) and there was a dramatic increase in nalidixic acid resistance between 1993 (4%) and 2005 (97%). In a cross-sectional sample of 381 serovar Typhi strains from 8 Asian countries, Bangladesh, China, India, Indonesia, Laos, Nepal, Pakistan, and central Vietnam, collected in 2002 to 2004, various rates of multidrug resistance (16 to 37%) and nalidixic acid resistance (5 to 51%) were found. The eight Asian countries involved in this study are home to approximately 80% of the world's typhoid fever cases. These results document the scale of drug resistance across Asia. The Ser83→Phe substitution in GyrA was the predominant alteration in serovar Typhi strains from Vietnam (117/127 isolates; 92.1%). No mutations in gyrB, parC, or parE were detected in 55 of these strains. In vitro time-kill experiments showed a reduction in the efficacy of ofloxacin against strains harboring a single-amino-acid substitution at codon 83 or 87 of GyrA; this effect was more marked against a strain with a double substitution. The 8-methoxy fluoroquinolone gatifloxacin showed rapid killing of serovar Typhi harboring both the single- and double-amino-acid substitutions. PMID:17908946

  9. Mechanisms of group A Streptococcus resistance to reactive oxygen species.

    PubMed

    Henningham, Anna; Döhrmann, Simon; Nizet, Victor; Cole, Jason N

    2015-07-01

    Streptococcus pyogenes, also known as group A Streptococcus (GAS), is an exclusively human Gram-positive bacterial pathogen ranked among the 'top 10' causes of infection-related deaths worldwide. GAS commonly causes benign and self-limiting epithelial infections (pharyngitis and impetigo), and less frequent severe invasive diseases (bacteremia, toxic shock syndrome and necrotizing fasciitis). Annually, GAS causes 700 million infections, including 1.8 million invasive infections with a mortality rate of 25%. In order to establish an infection, GAS must counteract the oxidative stress conditions generated by the release of reactive oxygen species (ROS) at the infection site by host immune cells such as neutrophils and monocytes. ROS are the highly reactive and toxic byproducts of oxygen metabolism, including hydrogen peroxide (H2O2), superoxide anion (O2•(-)), hydroxyl radicals (OH•) and singlet oxygen (O2*), which can damage bacterial nucleic acids, proteins and cell membranes. This review summarizes the enzymatic and regulatory mechanisms utilized by GAS to thwart ROS and survive under conditions of oxidative stress. PMID:25670736

  10. Mechanisms of group A Streptococcus resistance to reactive oxygen species.

    PubMed

    Henningham, Anna; Döhrmann, Simon; Nizet, Victor; Cole, Jason N

    2015-07-01

    Streptococcus pyogenes, also known as group A Streptococcus (GAS), is an exclusively human Gram-positive bacterial pathogen ranked among the 'top 10' causes of infection-related deaths worldwide. GAS commonly causes benign and self-limiting epithelial infections (pharyngitis and impetigo), and less frequent severe invasive diseases (bacteremia, toxic shock syndrome and necrotizing fasciitis). Annually, GAS causes 700 million infections, including 1.8 million invasive infections with a mortality rate of 25%. In order to establish an infection, GAS must counteract the oxidative stress conditions generated by the release of reactive oxygen species (ROS) at the infection site by host immune cells such as neutrophils and monocytes. ROS are the highly reactive and toxic byproducts of oxygen metabolism, including hydrogen peroxide (H2O2), superoxide anion (O2•(-)), hydroxyl radicals (OH•) and singlet oxygen (O2*), which can damage bacterial nucleic acids, proteins and cell membranes. This review summarizes the enzymatic and regulatory mechanisms utilized by GAS to thwart ROS and survive under conditions of oxidative stress.

  11. Mechanisms of group A Streptococcus resistance to reactive oxygen species

    PubMed Central

    Henningham, Anna; Döhrmann, Simon; Nizet, Victor; Cole, Jason N.

    2015-01-01

    Streptococcus pyogenes, also known as group A Streptococcus (GAS), is an exclusively human Gram-positive bacterial pathogen ranked among the ‘top 10’ causes of infection-related deaths worldwide. GAS commonly causes benign and self-limiting epithelial infections (pharyngitis and impetigo), and less frequent severe invasive diseases (bacteremia, toxic shock syndrome and necrotizing fasciitis). Annually, GAS causes 700 million infections, including 1.8 million invasive infections with a mortality rate of 25%. In order to establish an infection, GAS must counteract the oxidative stress conditions generated by the release of reactive oxygen species (ROS) at the infection site by host immune cells such as neutrophils and monocytes. ROS are the highly reactive and toxic byproducts of oxygen metabolism, including hydrogen peroxide (H2O2), superoxide anion (O2•−), hydroxyl radicals (OH•) and singlet oxygen (O2*), which can damage bacterial nucleic acids, proteins and cell membranes. This review summarizes the enzymatic and regulatory mechanisms utilized by GAS to thwart ROS and survive under conditions of oxidative stress. PMID:25670736

  12. Resistance to spiromesifen in Trialeurodes vaporariorum is associated with a single amino acid replacement in its target enzyme acetyl-coenzyme A carboxylase.

    PubMed

    Karatolos, N; Williamson, M S; Denholm, I; Gorman, K; ffrench-Constant, R; Nauen, R

    2012-06-01

    Spiromesifen is a novel insecticide and is classed as a tetronic acid derivative. It targets the insects' acetyl-coenzyme A carboxylase (ACCase) enzyme, causing a reduction in lipid biosynthesis. At the time of this publication, there are no reports of resistance to this class of insecticides in insects although resistance has been observed in several mite species. The greenhouse whitefly Trialeurodes vaporariorum (Westwood) is a serious pest of protected vegetable and ornamental crops in temperate regions of the world and spiromesifen is widely used in its control. Mortality rates of UK and European populations of T. vaporariorum to spiromesifen were calculated and up to 26-fold resistance was found. We therefore sought to examine the molecular mechanism underlying spiromesifen resistance in this important pest. Pre-treatment with piperonyl butoxide did not synergize spiromesifen, suggesting a target-site resistance mechanism. The full length ACCase gene was sequenced for a range of T. vaporariorum strains and a strong association was found between spiromesifen resistance and a glutamic acid substitution with lysine in position 645 (E645K) of this gene. A TaqMan allelic discrimination assay confirmed these findings. Although this resistance is not considered sufficient to compromise the field performance of spiromesifen, this association of E645K with resistance is the first report of a potential target site mechanism affecting an ACCase inhibitor in an arthropod species.

  13. Effect of soil acidity, soil strength and macropores on root growth and morphology of perennial grass species differing in acid-soil resistance.

    PubMed

    Haling, Rebecca E; Simpson, Richard J; Culvenor, Richard A; Lambers, Hans; Richardson, Alan E

    2011-03-01

    It is unclear whether roots of acid-soil resistant plants have significant advantages, compared with acid-soil sensitive genotypes, when growing in high-strength, acid soils or in acid soils where macropores may allow the effects of soil acidity and strength to be avoided. The responses of root growth and morphology to soil acidity, soil strength and macropores by seedlings of five perennial grass genotypes differing in acid-soil resistance were determined, and the interaction of soil acidity and strength for growth and morphology of roots was investigated. Soil acidity and strength altered root length and architecture, root hair development, and deformed the root tip, especially in acid-soil sensitive genotypes. Root length was restricted to some extent by soil acidity in all genotypes, but the adverse impact of soil acidity on root growth by acid-soil resistant genotypes was greater at high levels of soil strength. Roots reacted to soil acidity when growing in macropores, but elongation through high-strength soil was improved. Soil strength can confound the effect of acidity on root growth, with the sensitivity of acid-resistant genotypes being greater in high-strength soils. This highlights the need to select for genotypes that resist both acidity and high soil strength.

  14. Characterization of an Arabidopsis-Phytophthora pathosystem: resistance requires a functional PAD2 gene and is independent of salicylic acid, ethylene and jasmonic acid signalling.

    PubMed

    Roetschi, A; Si-Ammour, A; Belbahri, L; Mauch, F; Mauch-Mani, B

    2001-11-01

    Arabidopsis accessions were screened with isolates of Phytophthora porri originally isolated from other crucifer species. The described Arabidopsis-Phytophthora pathosystem shows the characteristics of a facultative biotrophic interaction similar to that seen in agronomically important diseases caused by Phytophthora species. In susceptible accessions, extensive colonization of the host tissue occurred and sexual and asexual spores were formed. In incompatible combinations, the plants reacted with a hypersensitive response (HR) and the formation of papillae at the sites of attempted penetration. Defence pathway mutants such as jar1 (jasmonic acid-insensitive), etr1 (ethylene receptor mutant) and ein2 (ethylene-insensitive) remained resistant towards P. porri. However, pad2, a mutant with reduced production of the phytoalexin camalexin, was hyper-susceptible. The accumulation of salicylic acid (SA) and PR1 protein was strongly reduced in pad2. Surprisingly, this lack of SA accumulation does not appear to be the cause of the hyper-susceptibility because interference with SA signalling in nahG plants or sid2 or npr1 mutants had only a minor effect on resistance. In addition, the functional SA analogue benzothiadiazol (BTH) did not induce resistance in susceptible plants including pad2. Similarly, the complete blockage of camalexin biosynthesis in pad3 did not cause susceptibility. Resistance of Arabidopsis against P. porri appears to depend on unknown defence mechanisms that are under the control of PAD2.

  15. Amino acid substitution in Cryptococcus neoformans lanosterol 14-α-demethylase involved in fluconazole resistance in clinical isolates.

    PubMed

    Bosco-Borgeat, María E; Mazza, Mariana; Taverna, Constanza G; Córdoba, Susana; Murisengo, Omar A; Vivot, Walter; Davel, Graciela

    2016-01-01

    The molecular basis of fluconazole resistance in Cryptococcus neoformans has been poorly studied. A common azole resistance mechanism in Candida species is the acquisition of point mutations in the ERG11 gene encoding the enzyme lanosterol 14-α-demethylase, target of the azole class of drugs. In C. neoformans only two mutations were described in this gene. In order to evaluate other mutations that could be implicated in fluconazole resistance in C. neoformans we studied the genomic sequence of the ERG11 gene in 11 clinical isolates with minimal inhibitory concentration (MIC) values to fluconazole of ≥16μg/ml. The sequencing revealed the G1855A mutation in 3 isolates, resulting in the enzyme amino acid substitution G484S. These strains were isolated from two fluconazole-treated patients. This mutation would not intervene in the susceptibility to itraconazole and voriconazole. PMID:27311753

  16. Defense mechanisms involved in disease resistance of grafted vegetables

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Vegetable grafting with resistant rootstocks is an effective strategy to control a variety of soil-borne diseases and root-knot nematodes in the Cucurbitaceae and Solanaceae. In addition, improved resistance to some foliar diseases and viruses has also been reported in grafted plants. Hence, graft...

  17. Creatine Loading, Resistance Exercise Performance, and Muscle Mechanics.

    ERIC Educational Resources Information Center

    Stevenson, Scott W.; Dudley, Gary A.

    2001-01-01

    Examined whether creatine (CR) monohydrate loading would alter resistance exercise performance, isometric strength, or in vivo contractile properties of the quadriceps femoris muscle compared with placebo loading in resistance-trained athletes. Overall, CR loading did not provide an ergogenic benefit for the unilateral dynamic knee extension…

  18. The role of uric acid in the insulin resistance in children and adolescents with obesity

    PubMed Central

    de Miranda, Josiane Aparecida; Almeida, Guilherme Gomide; Martins, Raissa Isabelle Leão; Cunha, Mariana Botrel; Belo, Vanessa Almeida; dos Santos, José Eduardo Tanus; Mourão-Júnior, Carlos Alberto; Lanna, Carla Márcia Moreira

    2015-01-01

    Objective: To investigate the association between serum uric acid levels and insulin resistance in children and adolescents with obesity. Methods: Cross-sectional study with 245 children and adolescents (134 obese and 111 controls), aged 8-18 years. The anthropometric variables (weight, height and waist circumference), blood pressure and biochemical parameters were collected. The clinical characteristics of the groups were analyzed by t-test or chi-square test. To evaluate the association between uric acid levels and insulin resistance the Pearson's test and logistic regression were applied. Results: The prevalence of insulin resistance was 26.9%. The anthropometric variables, systolic and diastolic blood pressure and biochemical variables were significantly higher in the obese group (p<0.001), except for the high-density-lipoprotein cholesterol. There was a positive and significant correlation between anthropometric variables and uric acid with HOMA-IR in the obese and in the control groups, which was higher in the obese group and in the total sample. The logistic regression model that included age, gender and obesity, showed an odds ratio of uric acid as a variable associated with insulin resistance of 1.91 (95%CI 1.40-2.62; p<−0.001). Conclusions: The increase in serum uric acid showed a positive statistical correlation with insulin resistance and it is associated with and increased risk of insulin resistance in obese children and adolescents. PMID:26300523

  19. Mechanism Of Resistance Of Evolved Glyphosate-Resistant Palmer Amaranth (Amaranthus Palmeri L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Evolved glyphosate resistance in weedy species represents a challenge for the continued success and utility of glyphosate-resistant crops. The first case of evolved glyphosate resistance in Palmer amaranth was a population from the U.S. state of Georgia, which was previously reported to have amplif...

  20. Folic acid utilisation related to sulfa drug resistance in Saccharomyces cerevisiae.

    PubMed

    Bayly, A M; Berglez, J M; Patel, O; Castelli, L A; Hankins, E G; Coloe, P; Hopkins Sibley, C; Macreadie, I G

    2001-11-13

    Saccharomyces cerevisiae mutants deficient in folate synthesis have been constructed and employed to study the utilisation of exogenous folates in yeast. One mutant specifically lacked dihydropteroate synthase while the second lacked dihydrofolate synthase. Exogenous folinic acid restored optimal growth to both strains. Folic acid did not generally rescue growth but spontaneous isolates capable of utilising folic acid were selected. The folic acid synthesis pathway in the folate utilising isolates was restored via transformation with FOL1 or FOL3 expression plasmids and transformants were tested for resistance to sulfamethoxazole (SMX). The presence of elevated levels of folic acid led to greatly reduced SMX sensitivity regardless of whether strains were folate utilisers or not.

  1. Effects of Peracetic Acid on the Corrosion Resistance of Commercially Pure Titanium (grade 4).

    PubMed

    Raimundo, Lariça B; Orsi, Iara A; Kuri, Sebastião E; Rovere, Carlos Alberto D; Busquim, Thaís P; Borie, Eduardo

    2015-01-01

    The aim of this study was to evaluate the corrosion resistance of pure titanium grade 4 (cp-Ti-4), subjected to disinfection with 0.2% and 2% peracetic acid during different immersion periods using anodic potentiodynamic polarization test in acid and neutral artificial saliva. Cylindrical samples of cp-Ti-4 (5 mm x 5 mm) were used to fabricate 24 working electrodes, which were mechanically polished and divided into eight groups (n=3) for disinfection in 2% and 0.2% peracetic acid for 30 and 120 min. After disinfection, anodic polarization was performed in artificial saliva with pH 4.8 and 6.8 to assess the electrochemical behavior of the electrodes. A conventional electrochemical cell, constituting a reference electrode, a platinum counter electrode, and the working electrode (cp-Ti specimens) were used with a scanning rate of 1 mV/s. Three curves were obtained for each working electrode, and corrosion was characterized by using scanning electron microscopy (SEM) and energy dispersive x-ray spectrometry (EDS). Data of corrosion potential (Ecorr) and passive current (Ipass) obtained by the polarization curves were analyzed statistically by Student's t-test (a=0.05). The statistical analysis showed no significant differences (p>0.05) between artificial saliva types at different concentrations and periods of disinfection, as well as between control and experimental groups. No surface changes were observed in all groups evaluated. In conclusion, disinfection with 0.2% and 2% peracetic acid concentrations did not cause corrosion in samples manufactured with cp-Ti-4. PMID:26963213

  2. A brief review on the mechanisms of aspirin resistance.

    PubMed

    Du, Gang; Lin, Qiang; Wang, Jinhua

    2016-10-01

    Aspirin is the most widely prescribed drug for the primary and secondary prevention of cardiovascular and cerebrovascular diseases. However, a large number of patients continue to experience thromboembolic events despite aspirin therapy, a phenomenon referred to as aspirin resistance or treatment failure. Aspirin resistance is often observed along with a high incidence of unstable plaque, cardiovascular events and cerebrovascular accident. Studies have shown that aspirin reduces the production of TXA2, but not totally inhibits the activation of platelets. In this review, we analyze current and past research on aspirin resistance, presenting important summaries of results regarding the potential contributive roles of single nucleotide polymorphisms, inflammation, metabolic syndrome and miRNAs. The aim of this article is to provide a brief review on aspirin resistance and platelet function, which will provide important insights into the research of aspirin resistance. PMID:27372038

  3. Molecular mechanism of glucocorticoid resistance in inflammatory bowel disease

    PubMed Central

    De Iudicibus, Sara; Franca, Raffaella; Martelossi, Stefano; Ventura, Alessandro; Decorti, Giuliana

    2011-01-01

    Natural and synthetic glucocorticoids (GCs) are widely employed in a number of inflammatory, autoimmune and neoplastic diseases, and, despite the introduction of novel therapies, remain the first-line treatment for inducing remission in moderate to severe active Crohn’s disease and ulcerative colitis. Despite their extensive therapeutic use and the proven effectiveness, considerable clinical evidence of wide inter-individual differences in GC efficacy among patients has been reported, in particular when these agents are used in inflammatory diseases. In recent years, a detailed knowledge of the GC mechanism of action and of the genetic variants affecting GC activity at the molecular level has arisen from several studies. GCs interact with their cytoplasmic receptor, and are able to repress inflammatory gene expression through several distinct mechanisms. The glucocorticoid receptor (GR) is therefore crucial for the effects of these agents: mutations in the GR gene (NR3C1, nuclear receptor subfamily 3, group C, member 1) are the primary cause of a rare, inherited form of GC resistance; in addition, several polymorphisms of this gene have been described and associated with GC response and toxicity. However, the GR is not self-standing in the cell and the receptor-mediated functions are the result of a complex interplay of GR and many other cellular partners. The latter comprise several chaperonins of the large cooperative hetero-oligomeric complex that binds the hormone-free GR in the cytosol, and several factors involved in the transcriptional machinery and chromatin remodeling, that are critical for the hormonal control of target genes transcription in the nucleus. Furthermore, variants in the principal effectors of GCs (e.g. cytokines and their regulators) have also to be taken into account for a comprehensive evaluation of the variability in GC response. Polymorphisms in genes involved in the transport and/or metabolism of these hormones have also been

  4. Oxidation resistance of selected mechanical carbons at 650 deg C in dry flowing air

    NASA Technical Reports Server (NTRS)

    Allen, G. P.; Wisander, D. W.

    1973-01-01

    Oxidation experiments were conducted with several experimental mechanical carbons at 650 C in air flowing at 28 cu cm/sec (STP). Experiments indicate that boron carbide addition and zinc phosphate treatment definitely improved oxidation resistance. Impregnation with coal tar pitch before final graphitization had some beneficial effect on oxidation resistance and it markedly improved flexure strength and hardness. Graphitization temperature alone did not affect oxidation resistance, but with enough added boron carbide the oxidation resistance was increased although the hardness greatly decreased.

  5. Acetolactate Synthase-Inhibiting Herbicide-Resistant Rice Flatsedge (Cyperus iria): Cross Resistance and Molecular Mechanism of Resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Overuse of acetolactate synthase (ALS) –inhibiting herbicides in rice has led to evolution of halosulfuron-resistant rice flatsedge (Cyperus iria L.) in Arkansas (AR) and Mississippi (MS), USA. Resistant accessions were cross-resistant to labeled field rates of ALS-inhibiting herbicides from four d...

  6. Influence of cadmium on water relations, stomatal resistance, and abscisic acid content in expanding bean leaves

    SciTech Connect

    Poschenrieder, C.; Gunse, B.; Barcelo, J. )

    1989-08-01

    Ten day old bush bean plants (Phaseolus vulgaris L. cv Contender) were used to analyze the effects of 3 micromolar Cd on the time courses of expansion growth, dry weight, leaf water relations, stomatal resistance, and abscisic acid (ABA) levels in roots and leaves. Control and Cd-treated plants were grown for 144 hours in nutrient solution. Samples were taken at 24 hour intervals. At the 96 and 144 hour harvests, additional measurements were made on excised leaves which were allowed to dry for 2 hours. From the 48 hour harvest, Cd-treated plants showed lower leaf relative water contents and higher stomatal resistances than controls. At the same time, root and leaf expansion growth, but not dry weight, was significantly reduced. The turgor potentials of leaves from Cd-treated plants were nonsignificantly higher than those of control leaves. A significant increase (almost 400%) of the leaf ABA concentration was detected after 120 hours exposure to Cd. But Cd was found to inhibit ABA accumulation during drying of excised leaves. It is concluded that Cd-induced decrease of expansion growth is not due to turgor decrease. The possible mechanisms of Cd-induced stomatal closure are discussed.

  7. Enhanced expression of aconitase raises acetic acid resistance in Acetobacter aceti.

    PubMed

    Nakano, Shigeru; Fukaya, Masahiro; Horinouchi, Sueharu

    2004-06-15

    Acetobacter spp. are used for industrial vinegar production because of their high ability to oxidize ethanol to acetic acid and high resistance to acetic acid. Two-dimensional gel electrophoretic analysis of a soluble fraction of Acetobacter aceti revealed the presence of several proteins whose production was enhanced, to various extents, in response to acetic acid in the medium. A protein with an apparent molecular mass of 100 kDa was significantly enhanced in amount by acetic acid and identified to be aconitase by NH2-terminal amino acid sequencing and subsequent gene cloning. Amplification of the aconitase gene by use of a multicopy plasmid in A. aceti enhanced the enzymatic activity and acetic acid resistance. These results showed that aconitase is concerned with acetic acid resistance. Enhancement of the aconitase activity turned out to be practically useful for acetic acid fermentation, because the A. aceti transformant harboring multiple copies of the aconitase gene produced a higher concentration of acetic acid with a reduced growth lag-time.

  8. Oxidation-Resistant Coating For Bipolar Lead/Acid Battery

    NASA Technical Reports Server (NTRS)

    Bolstad, James J.

    1993-01-01

    Cathode side of bipolar substrate coated with nonoxidizable conductive layer. Coating prepared as water slurry of aqueous dispersion of polyethylene copolymer plus such conductive fillers as tin oxide, titanium, tantalum, or tungsten oxide. Applied easily to substrate of polyethylene carbon plastic. As slurry dries, conductive, oxidation-resistant coating forms on positive side of substrate.

  9. The role of dietary acid load and mild metabolic acidosis in insulin resistance in humans.

    PubMed

    Williams, Rebecca S; Kozan, Pinar; Samocha-Bonet, Dorit

    2016-05-01

    Type 2 diabetes is increasingly being recognised as a global health crisis (World Health Organisation). Insulin resistance is closely associated with obesity and precedes the development of type 2 diabetes. However, there is now increasing evidence to suggest that diet itself may independently be associated with type 2 diabetes risk. A diet with a high acid load (or high potential renal net acid load, PRAL) can result in a decrease in pH towards the lower end of the normal physiological range, which may in turn lead to the development of insulin resistance. Conversely, reducing dietary acid load (the so called 'alkaline diet') may be protective and prevent the onset of type 2 diabetes. Here, we explore the influence of dietary acid load on the development of mild metabolic acidosis and induction of insulin resistance. Whilst large prospective cohort studies link high dietary acid load or low serum bicarbonate with the development of type 2 diabetes, the effect of a diet with a low acid (or high alkaline) load remains unclear. Further interventional studies are required to investigate the influence of dietary composition on the body's acid/base balance, insulin resistance and incidence of type 2 diabetes. PMID:26363101

  10. Effect of folic acid on homocysteine and insulin resistance of overweight and obese children and adolescents

    PubMed Central

    Dehkordi, Elham Hashemi; Sedehi, Morteza; Shahraki, Zohre Gholipour; Najafi, Reza

    2016-01-01

    Background: Considering the increasing trend of childhood obesity and subsequent burden of the disease in Iran and other countries and importance of early life intervention for achieving sustained effect on health of children and adolescents, this study aimed to investigate the effect of two different dose of folic acid on homocysteine (Hcy) level and insulin resistance of obese children. Materials and Methods: In this randomized, double-blind controlled clinical trial study, 60 obese and overweight children aged 5–12 years were enrolled. Selected obese children randomly allocated in two interventional (1 mg/day folic acid and 5 mg/day folic acid, for 8 weeks) and one control groups. Biochemical measurements including folic acid, Hcy, insulin and insulin resistance were measured between and within groups before and after trial. Results: In each group, 20 obese children were studied. The three groups were age and sex matched. After folic acid administration, mean of Hcy, insulin resistance and insulin decreased significantly in two groups which folic acid administrated with two different doses (P < 0.05). The reduction in studied biochemical variables was similar in two interventional groups (1 and 5 mg folic acid daily) (P > 0.05). Mean differences for Hcy, insulin resistance and insulin, in two intervention groups were significantly higher than the control group (P < 0.0001). Mean differences of Hcy, insulin resistance and insulin, in two intervention groups were not different significantly (P > 0.05). Conclusion: The findings of current trial showed that folic acid in two studied doses could be a safe and effective supplement for obese children to reduce Hcy level and insulin resistance, which consequently could prevent obesity-related complications including cardiovascular and metabolic disorders. PMID:27274503

  11. Gambogic acid sensitizes resistant breast cancer cells to doxorubicin through inhibiting P-glycoprotein and suppressing survivin expression.

    PubMed

    Wang, Shengpeng; Wang, Lu; Chen, Meiwan; Wang, Yitao

    2015-06-25

    The development of resistance to chemotherapeutic agents remains a major challenge to breast cancer chemotherapy. Overexpression of drug efflux transporters like P-glycoprotein (P-gp) and resistance to apoptosis are the two key factors that confer cancer drug resistance. Gambogic acid (GA), a major component of Gamboge resin, has potent anticancer effects and can inhibit the growth of several types of human cancers. However, the potential and underlying mechanisms of GA in reversing cancer resistance remain poorly understood. In the present study, we found that GA can markedly sensitize doxorubicin (DOX)-resistant breast cancer cells to DOX-mediated cell death. GA increased the intracellular accumulation of DOX by inhibiting both P-gp expression and activity. Meanwhile, the combination effect was associated with the generation of intracellular reactive oxygen species (ROS) and the suppression of anti-apoptotic protein survivin. Scavenging intracellular ROS or overexpression of survivin blocked the sensitizing effects of GA in DOX-induced apoptosis. Furthermore, ROS-mediated activation of p38 MAPK was revealed in GA-mediated suppression of survivin expression. This study gives rise to the possibility of applying GA as an anticancer agent for the purpose of combating DOX-resistant breast cancer.

  12. Target and Non-target Site Mechanisms Developed by Glyphosate-Resistant Hairy beggarticks (Bidens pilosa L.) Populations from Mexico

    PubMed Central

    Alcántara-de la Cruz, Ricardo; Fernández-Moreno, Pablo T.; Ozuna, Carmen V.; Rojano-Delgado, Antonia M.; Cruz-Hipolito, Hugo E.; Domínguez-Valenzuela, José A.; Barro, Francisco; De Prado, Rafael

    2016-01-01

    In 2014 hairy beggarticks (Bidens pilosa L.) has been identified as being glyphosate-resistant in citrus orchards from Mexico. The target and non-target site mechanisms involved in the response to glyphosate of two resistant populations (R1 and R2) and one susceptible (S) were studied. Experiments of dose-response, shikimic acid accumulation, uptake-translocation, enzyme activity and 5-enolpyruvyl shikimate-3-phosphate synthase (EPSPS) gene sequencing were carried out in each population. The R1 and R2 populations were 20.4 and 2.8-fold less glyphosate sensitive, respectively, than the S population. The resistant populations showed a lesser shikimic acid accumulation than the S population. In the latter one, 24.9% of 14C-glyphosate was translocated to the roots at 96 h after treatment; in the R1 and R2 populations only 12.9 and 15.5%, respectively, was translocated. Qualitative results confirmed the reduced 14C-glyphosate translocation in the resistant populations. The EPSPS enzyme activity of the S population was 128.4 and 8.5-fold higher than the R1 and R2 populations of glyphosate-treated plants, respectively. A single (Pro-106-Ser), and a double (Thr-102-Ile followed by Pro-106-Ser) mutations were identified in the EPSPS2 gene conferred high resistance in R1 population. Target-site mutations associated with a reduced translocation were responsible for the higher glyphosate resistance in the R1 population. The low-intermediate resistance of the R2 population was mediated by reduced translocation. This is the first glyphosate resistance case confirmed in hairy beggarticks in the world. PMID:27752259

  13. Mechanisms of Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor Resistance and Strategies to Overcome Resistance in Lung Adenocarcinoma

    PubMed Central

    Chang, Yoon Soo; Choi, Chang-Min

    2016-01-01

    Somatic mutations that lead to hyperactivation of epidermal growth factor receptor (EGFR) signaling are detected in approximately 50% of lung adenocarcinoma in people from the Far East population and tyrosine kinase inhibitors are now the standard first line treatment for advanced disease. They have led to a doubling of progression-free survival and an increase in overall survival by more than 2 years. However, emergence of resistant clones has become the primary cause for treatment failure, and has created a new challenge in the daily management of patients with EGFR mutations. Identification of mechanisms leading to inhibitor resistance has led to new therapeutic modalities, some of which have now been adapted for patients with unsuccessful tyrosine kinase inhibitor treatment. In this review, we describe mechanisms of tyrosine kinase inhibitor resistance and the available strategies to overcoming resistance. PMID:27790276

  14. A novel mechanism of insect resistance engineered into tobacco

    NASA Astrophysics Data System (ADS)

    Hilder, Vaughan A.; Gatehouse, Angharad M. R.; Sheerman, Suzanne E.; Barker, Richard F.; Boulter, Donald

    1987-11-01

    A major goal of plant genetic engineering is the introduction of agronomically desirable phenotypic traits into crop plants in situations where conventional breeding methods have been unsuccessful. One such target is enhanced resistance to insect pests which, in view of the estimated production losses world-wide and the heavy costs of protective treatments, is very important. We report here that a gene encoding a cowpea trypsin inhibitor, which has been shown to give some measure of field resistance to insect pests1, confers, when transferred to tobacco, enhanced resistance to this species' own herbivorous insect pests.

  15. Cardioprotective mechanism of omega-3 polyunsaturated fatty acids.

    PubMed

    Endo, Jin; Arita, Makoto

    2016-01-01

    Omega-3 polyunsaturated fatty acids (PUFAs), such as eicosapentaenoic acid and docosahexaenoic acid, are widely regarded as cardioprotective. Several large-scale, randomized clinical trials have shown that dietary intake of omega-3 PUFAs improves the prognosis of patients with symptomatic heart failure or recent myocardial infarction. Therefore, dietary consumption of omega-3 PUFA is recommended in international guidelines for the general population to prevent the occurrence of cardiovascular diseases (CVDs). However, the precise mechanisms underlying the cardioprotective effects of omega-3 PUFAs are not fully understood. Omega-3 PUFAs can be incorporated into the phospholipid bilayer of cell membranes and can affect membrane fluidity, lipid microdomain formation, and signaling across membranes. Omega-3 PUFAs also modulate the function of membrane ion channels, such as Na and L-type Ca channels, to prevent lethal arrhythmias. Moreover, omega-3 PUFAs also prevent the conversion of arachidonic acid into pro-inflammatory eicosanoids by serving as an alternative substrate for cyclooxygenase or lipoxygenase, resulting in the production of less potent products. In addition, a number of enzymatically oxygenated metabolites derived from omega-3 PUFAs were recently identified as anti-inflammatory mediators. These omega-3 metabolites may contribute to the beneficial effects against CVDs that are attributed to omega-3 PUFAs.

  16. Plasmids for heavy metal resistance in Alcaligenes eutrophus CH34: mechanisms and applications.

    PubMed

    Collard, J M; Corbisier, P; Diels, L; Dong, Q; Jeanthon, C; Mergeay, M; Taghavi, S; van der Lelie, D; Wilmotte, A; Wuertz, S

    1994-08-01

    Alcaligenes eutrophus CH34 is the main representative of a group of strongly related strains (mostly facultative chemolithotrophs) that are well adapted to environments containing high levels of heavy metals. It harbors the megaplasmids pMOL28 and pMOL30 which carry resistance determinants to Co2+, Ni2+, CrO(4)2-, Hg2+, Tl+, Cd2+, Cu2+ and Zn2+. Among the best characterized determinants are the cnr operon (resistance to Co, Ni) on pMOL28 and the czc operon on pMOL30 (resistance to Co, Cd and Zn). Although the two systems reveal a significant degree of amino acid similarity in the structural genes, the regulation of the operons is different. The resistance mechanism in both cases is based on efflux. The efflux mechanism leads to a pH increase outside of the cytoplasmic membrane. Metals are sequestered from the external medium through the bioprecipitation of metal carbonates formed in the saturated zone around the cell. This latter phenomenon can be exploited in bioreactors designed to remove metals from effluents. The bacteria are immobilized on composite membranes in a continuous tubular membrane reactor (CTMR). The effluent continuously circulates through the intertubular space, while the external surface of the tubes is in contact with the growth medium. Metal crystals are eventually removed by the effluent stream and collected on a glass bead column. The system has been applied to effluents containing Cd, Zn, Co, Ni and Cu. By introducing catabolic plasmids involved in the aerobic degradation of PCBs and 2,4-D into metal-resistant A. eutrophus strains, the application range was widened to include effluents polluted with both organic and inorganic substances. Biosensors have been developed which are based on the fusion of genes induced by metals to a reporter system, the lux operon of Vibrio fischeri. Bacterial luciferases produce light through the oxidation of fatty aldehydes. The gene fusions are useful both for the study of regulatory genes and for the

  17. Ultrasound-Induced New Cellular Mechanism Involved in Drug Resistance

    PubMed Central

    Hassan, Mariame A.; Furusawa, Yukihiro; Minemura, Masami; Rapoport, Natalya; Sugiyama, Toshiro; Kondo, Takashi

    2012-01-01

    The acoustic effects in a biological milieu offer several scenarios for the reversal of multidrug resistance. In this study, we have observed higher sensitivity of doxorubicin-resistant uterine sarcoma MES-SA/DX5 cells to ultrasound exposure compared to its parent counterpart MES-SA cells; however, the results showed that the acoustic irradiation was genotoxic and could promote neotic division in exposed cells that was more pronounced in the resistant variant. The neotic progeny, imaged microscopically 24 hr post sonication, could contribute in modulating the final cell survival when an apoptotic dose of doxorubicin was combined with ultrasound applied either simultaneously or sequentially in dual-treatment protocols. Depending on the time and order of application of ultrasound and doxorubicin in combination treatments, there was either desensitization of the parent cells or sensitization of the resistant cells to doxorubicin action. PMID:23284614

  18. Antibiotic Methylation: A New Mechanism of Antimicrobial Resistance.

    PubMed

    Malone, Kerri M; Gordon, Stephen V

    2016-10-01

    In new research on Mycobacterium tuberculosis, the causative agent of tuberculosis, Warrier and colleagues have discovered a novel mode of bacterial drug resistance, namely antibiotic inactivation via N-methylation.

  19. Antibiotic Methylation: A New Mechanism of Antimicrobial Resistance.

    PubMed

    Malone, Kerri M; Gordon, Stephen V

    2016-10-01

    In new research on Mycobacterium tuberculosis, the causative agent of tuberculosis, Warrier and colleagues have discovered a novel mode of bacterial drug resistance, namely antibiotic inactivation via N-methylation. PMID:27593675

  20. Colistin and tigecycline resistance in carbapenemase-producing Gram-negative bacteria: emerging resistance mechanisms and detection methods.

    PubMed

    Osei Sekyere, J; Govinden, U; Bester, L A; Essack, S Y

    2016-09-01

    A literature review was undertaken to ascertain the molecular basis for tigecycline and colistin resistance mechanisms and the experimental basis for the detection and delineation of this resistance particularly in carbapenemase-producing Gram-negative bacteria. Pubmed, Google Scholar and Science Direct were searched with the keywords colistin, tigecycline, resistance mechanisms and detection methods. Trans-complementation and comparative MIC studies, mass spectrometry, chromatography, spectrofluorometry, PCR, qRT-PCR and whole genome sequencing (WGS) were commonly used to determine tigecycline and colistin resistance mechanisms, specifically modifications in the structural and regulatory efflux (acrAB, OqxAB, kpgABC adeABC-FGH-IJK, mexAB-XY-oprJM and soxS, rarA robA, ramRAB marRABC, adeLRS, mexRZ and nfxb) and lipid A (pmrHFIJFKLM, lpxA, lpxC lpxD and mgrB, pmrAB, phoPQ,) genes respectively. Mutations in the ribosomal 16S rRNA operon rrnBC, also yielded resistance to tigecycline through target site modifications. The mcr-1 gene conferring resistance to colistin was identified via WGS, trans-complementation and a murine thigh infection model studies. Common detection methods are mainly antibiotic sensitivity testing with broth microdilution while molecular identification tools are mostly PCR and WGS. Spectrofluorometry, MALDI-TOF MS, micro-array and real-time multiplex PCR hold much promise for the future as new detection tools.

  1. Mechanisms of powdery mildew resistance in the Vitaceae family.

    PubMed

    Feechan, Angela; Kabbara, Samuela; Dry, Ian B

    2011-04-01

    The cultivated grapevine, Vitis vinifera, is a member of the Vitaceae family, which comprises over 700 species in 14 genera. Vitis vinifera is highly susceptible to the powdery mildew pathogen Erysiphe necator. However, other species within the Vitaceae family have been reported to show resistance to this fungal pathogen, but little is known about the mechanistic basis of this resistance. Therefore, the frequency of successful E. necator penetration events, in addition to programmed cell death (PCD) responses, were investigated in a representative genotype from a range of different species within the Vitaceae family. The results revealed that penetration resistance and PCD-associated responses, or combinations of both, are employed by the different Vitaceae genera to limit E. necator infection. In order to further characterize the cellular processes involved in the observed penetration resistance, specific inhibitors of the actin cytoskeleton and secretory/endocytic vesicle trafficking function were employed. These inhibitors were demonstrated to successfully break the penetration resistance in V. vinifera against the nonadapted powdery mildew E. cichoracearum. However, the use of these inhibitors with the adapted powdery mildew E. necator unexpectedly revealed that, although secretory and endocytic vesicle trafficking pathways play a crucial role in nonhost penetration resistance, the adapted powdery mildew species may actually require these pathways to successfully penetrate the plant host. PMID:21355998

  2. Functional Genome Screening to Elucidate the Colistin Resistance Mechanism

    PubMed Central

    Kumar, Mohit; Gupta, Ashutosh; Sahoo, Rajesh Kumar; Jena, Jayanti; Debata, Nagen Kumar; Subudhi, Enketeswara

    2016-01-01

    Antibiogram profile of 1590 clinical bacterial isolates based on thirteen different antimicrobial compounds showed that 1.6% of the bacterial isolates are multidrug resistant. Distribution pattern based on 16S rRNA sequence analysis showed that Pseudomonas aeruginosa constituted the largest group (83.6%) followed by Burkholderia pseudomallei sp. A191 (5.17%), Staphylococcus sp. A261 (3.45%). Among the various antibiotics used, colistin appeared to be the most effective against the Gram negative bacteria. Burkholderia pseudomallei sp. A191 and Pseudomonas aeruginosa sp. A111 showed resistance to 1500 μg/ml and 750 μg/ml of colistin respectively which constitutes 7.7% of the bacterial population. A functional genomics strategy was employed to discover the molecular support for colistin resistance in Burkholderia pseudomallei sp. A191. A pUC plasmid-based genomic expression library was constructed with an estimated library size of 2.1 × 107bp. Five colistin resistant clones were obtained after functional screening of the library. Analysis of DNA sequence of five colistin resistant clones showed homology to two component regularity systems (TCRS) encoding for a histidine kinase (mrgS) and its regulatory component (mrgR). Cross complementation assay showed that mutations in mrgS were sufficient enough to confer colistin resistant phenotype in a sensitive strain. PMID:26988670

  3. Antibiotic resistance in Enterobacteriaceae: mechanisms and clinical implications.

    PubMed

    Iredell, Jon; Brown, Jeremy; Tagg, Kaitlin

    2016-02-08

    Resistance of the Enterobacteriaceae to antibiotics, especially of the β lactam type, is increasingly dominated by the mobilization of continuously expressed single genes that encode efficient drug modifying enzymes. Strong and ubiquitous selection pressure has seemingly been accompanied by a shift from "natural" resistance, such as inducible chromosomal enzymes, membrane impermeability, and drug efflux, to the modern paradigm of mobile gene pools that largely determine the epidemiology of modern antibiotic resistance. In this way, antibiotic resistance is more available than ever before to organisms such as Escherichia coli and Klebsiella pneumoniae that are important causes of major sepsis. Modulation of the phenotype by host bacteria makes gene transmission less obvious and may in part explain why tracking and control of carbapenem resistance has been particularly problematic in the Enterobacteriaceae. This review discusses the underlying principles and clinical implications of the mobility and fixation of resistance genes and the exploitable opportunities and potential threats arising from apparent limitations on diversity in these mobile gene pools. It also provides some illustrative paradoxes and clinical corollaries, as well as a summary of future options.

  4. Functional Genome Screening to Elucidate the Colistin Resistance Mechanism.

    PubMed

    Kumar, Mohit; Gupta, Ashutosh; Sahoo, Rajesh Kumar; Jena, Jayanti; Debata, Nagen Kumar; Subudhi, Enketeswara

    2016-01-01

    Antibiogram profile of 1590 clinical bacterial isolates based on thirteen different antimicrobial compounds showed that 1.6% of the bacterial isolates are multidrug resistant. Distribution pattern based on 16S rRNA sequence analysis showed that Pseudomonas aeruginosa constituted the largest group (83.6%) followed by Burkholderia pseudomallei sp. A191 (5.17%), Staphylococcus sp. A261 (3.45%). Among the various antibiotics used, colistin appeared to be the most effective against the Gram negative bacteria. Burkholderia pseudomallei sp. A191 and Pseudomonas aeruginosa sp. A111 showed resistance to 1500 μg/ml and 750 μg/ml of colistin respectively which constitutes 7.7% of the bacterial population. A functional genomics strategy was employed to discover the molecular support for colistin resistance in Burkholderia pseudomallei sp. A191. A pUC plasmid-based genomic expression library was constructed with an estimated library size of 2.1 × 10(7)bp. Five colistin resistant clones were obtained after functional screening of the library. Analysis of DNA sequence of five colistin resistant clones showed homology to two component regularity systems (TCRS) encoding for a histidine kinase (mrgS) and its regulatory component (mrgR). Cross complementation assay showed that mutations in mrgS were sufficient enough to confer colistin resistant phenotype in a sensitive strain. PMID:26988670

  5. A review of control methods and resistance mechanisms in stored-product insects.

    PubMed

    Boyer, S; Zhang, H; Lempérière, G

    2012-04-01

    This review describes the major stored-product insect species and their resistance to insecticides. The economic importance of the control of those pests is highlighted with a loss of more than one billion US dollars per year worldwide. A detailed common description of species resistance throughout the world has been developed, and we observed 28 recurrent studied species involved in resistance cases disseminated on the five continents. The different mechanisms, including behavioral resistance, were studied particularly on Oryzaephilus surinamensis. The role of detoxifying enzymes and studies on the genetic resistance, involving the kdr mutation mechanisms and the transmission of the genes of resistance, are also described. A chapter clarifying definitions on cross and multiple resistance is enclosed.

  6. A review of control methods and resistance mechanisms in stored-product insects.

    PubMed

    Boyer, S; Zhang, H; Lempérière, G

    2012-04-01

    This review describes the major stored-product insect species and their resistance to insecticides. The economic importance of the control of those pests is highlighted with a loss of more than one billion US dollars per year worldwide. A detailed common description of species resistance throughout the world has been developed, and we observed 28 recurrent studied species involved in resistance cases disseminated on the five continents. The different mechanisms, including behavioral resistance, were studied particularly on Oryzaephilus surinamensis. The role of detoxifying enzymes and studies on the genetic resistance, involving the kdr mutation mechanisms and the transmission of the genes of resistance, are also described. A chapter clarifying definitions on cross and multiple resistance is enclosed. PMID:22126937

  7. Mycolic Acid Cyclopropanation is Essential for Viability, Drug Resistance, and Cell Wall Integrity of Mycobacterium tuberculosis

    SciTech Connect

    Barkan, Daniel; Liu, Zhen; Sacchettini, James C.; Glickman, Michael S.

    2009-12-01

    Mycobacterium tuberculosis infection remains a major global health problem complicated by escalating rates of antibiotic resistance. Despite the established role of mycolic acid cyclopropane modification in pathogenesis, the feasibility of targeting this enzyme family for antibiotic development is unknown. We show through genetics and chemical biology that mycolic acid methyltransferases are essential for M. tuberculosis viability, cell wall structure, and intrinsic resistance to antibiotics. The tool compound dioctylamine, which we show acts as a substrate mimic, directly inhibits the function of multiple mycolic acid methyltransferases, resulting in loss of cyclopropanation, cell death, loss of acid fastness, and synergistic killing with isoniazid and ciprofloxacin. These results demonstrate that mycolic acid methyltransferases are a promising antibiotic target and that a family of virulence factors can be chemically inhibited with effects not anticipated from studies of each individual enzyme.

  8. Potential mechanisms for low uric acid in Parkinson disease.

    PubMed

    Sampat, Radhika; Young, Sarah; Rosen, Ami; Bernhard, Douglas; Millington, David; Factor, Stewart; Jinnah, H A

    2016-04-01

    Several epidemiologic studies have described an association between low serum uric acid (UA) and Parkinson disease (PD). Uric acid is a known antioxidant, and one proposed mechanism of neurodegeneration in PD is oxidative damage of dopamine neurons. However, other complex metabolic pathways may contribute. The purpose of this study is to elucidate potential mechanisms of low serum UA in PD. Subjects who met diagnostic criteria for definite or probable PD (n = 20) and controls (n = 20) aged 55-80 years were recruited. Twenty-four hour urine samples were collected from all participants, and both uric acid and allantoin were measured and corrected for body mass index (BMI). Urinary metabolites were compared using a twoway ANOVA with diagnosis and sex as the explanatory variables. There were no significant differences between PD and controls for total UA (p = 0.60), UA corrected for BMI (p = 0.37), or in the interaction of diagnosis and sex on UA (p = 0.24). Similarly, there were no significant differences between PD and controls for allantoin (p = 0.47), allantoin corrected for BMI (p = 0.57), or in the interaction of diagnosis and sex on allantoin (p = 0.78). Allantoin/UA ratios also did not significantly differ by diagnosis (p = 0.99). Our results imply that low serum UA in PD may be due to an intrinsic mechanism that alters the homeostatic set point for serum UA in PD, and may contribute to relatively lower protection against oxidative damage. These findings provide indirect support for neuroprotection trials aimed at raising serum UA.

  9. Acid-base chemical mechanism of aspartase from Hafnia alvei.

    PubMed

    Yoon, M Y; Thayer-Cook, K A; Berdis, A J; Karsten, W E; Schnackerz, K D; Cook, P F

    1995-06-20

    An acid-base chemical mechanism is proposed for Hafnia alvei aspartase in which a proton is abstracted from C-3 of the monoanionic form of L-aspartate by an enzyme general base with a pK of 6.3-6.6 in the absence and presence of Mg2+. The resulting carbanion is presumably stabilized by delocalization of electrons into the beta-carboxyl with the assistance of a protonated enzyme group in the vicinity of the beta-carboxyl. Ammonia is then expelled with the assistance of a general acid group that traps an initially expelled NH3 as the final NH4+ product. In agreement with the function of the general acid group, potassium, an analog of NH4+, binds optimally when the group is unprotonated. The pK for the general acid is about 7 in the absence of Mg2+, but is increased by about a pH unit in the presence of Mg2+. Since the same pK values are observed in the pKi(succinate) and V/K pH profile, both enzyme groups must be in their optimum protonation state for efficient binding of reactant in the presence of Mg2+. At the end of a catalytic cycle, both the general base and general acid groups are in a protonation state opposite that in which they started when aspartate was bound. The presence of Mg2+ causes a pH-dependent activation of aspartase exhibited as a partial change in the V and V/Kasp pH profiles. When the aspartase reaction is run in D2O to greater than 50% completion no deuterium is found in the remaining aspartate, indicating that the site is inaccessible to solvent during the catalytic cycle.

  10. Mechanisms of abscisic acid-mediated control of stomatal aperture.

    PubMed

    Munemasa, Shintaro; Hauser, Felix; Park, Jiyoung; Waadt, Rainer; Brandt, Benjamin; Schroeder, Julian I

    2015-12-01

    Drought stress triggers an increase in the level of the plant hormone abscisic acid (ABA), which initiates a signaling cascade to close stomata and reduce water loss. Recent studies have revealed that guard cells control cytosolic ABA concentration through the concerted actions of biosynthesis, catabolism as well as transport across membranes. Substantial progress has been made at understanding the molecular mechanisms of how the ABA signaling core module controls the activity of anion channels and thereby stomatal aperture. In this review, we focus on our current mechanistic understanding of ABA signaling in guard cells including the role of the second messenger Ca(2+) as well as crosstalk with biotic stress responses. PMID:26599955

  11. Origin and Evolution of Antibiotic Resistance: The Common Mechanisms of Emergence and Spread in Water Bodies

    PubMed Central

    Lupo, Agnese; Coyne, Sébastien; Berendonk, Thomas Ulrich

    2011-01-01

    The environment, and especially freshwater, constitutes a reactor where the evolution and the rise of new resistances occur. In water bodies such as waste water effluents, lakes, and rivers or streams, bacteria from different sources, e.g., urban, industrial, and agricultural waste, probably selected by intensive antibiotic usage, are collected and mixed with environmental species. This may cause two effects on the development of antibiotic resistances: first, the contamination of water by antibiotics or other pollutants lead to the rise of resistances due to selection processes, for instance, of strains over-expressing broad range defensive mechanisms, such as efflux pumps. Second, since environmental species are provided with intrinsic antibiotic resistance mechanisms, the mixture with allochthonous species is likely to cause genetic exchange. In this context, the role of phages and integrons for the spread of resistance mechanisms appears significant. Allochthonous species could acquire new resistances from environmental donors and introduce the newly acquired resistance mechanisms into the clinics. This is illustrated by clinically relevant resistance mechanisms, such as the fluoroquinolones resistance genes qnr. Freshwater appears to play an important role in the emergence and in the spread of antibiotic resistances, highlighting the necessity for strategies of water quality improvement. We assume that further knowledge is needed to better understand the role of the environment as reservoir of antibiotic resistances and to elucidate the link between environmental pollution by anthropogenic pressures and emergence of antibiotic resistances. Only an integrated vision of these two aspects can provide elements to assess the risk of spread of antibiotic resistances via water bodies and suggest, in this context, solutions for this urgent health issue. PMID:22303296

  12. Insecticide Resistance Mechanisms in the Green Peach Aphid Myzus persicae (Hemiptera: Aphididae) I: A Transcriptomic Survey

    PubMed Central

    Silva, Andrea X.; Jander, Georg; Samaniego, Horacio; Ramsey, John S; Figueroa, Christian C.

    2012-01-01

    Background Insecticide resistance is one of the best examples of rapid micro-evolution found in nature. Since the development of the first synthetic insecticide in 1939, humans have invested considerable effort to stay ahead of resistance phenotypes that repeatedly develop in insects. Aphids are a group of insects that have become global pests in agriculture and frequently exhibit insecticide resistance. The green peach aphid, Myzus persicae, has developed resistance to at least seventy different synthetic compounds, and different insecticide resistance mechanisms have been reported worldwide. Methodology/Principal Findings To further characterize this resistance, we analyzed genome-wide transcriptional responses in three genotypes of M. persicae, each exhibiting different resistance mechanisms, in response to an anti-cholinesterase insecticide. The sensitive genotype (exhibiting no resistance mechanism) responded to the insecticide by up-regulating 183 genes primarily ones related to energy metabolism, detoxifying enzymes, proteins of extracellular transport, peptidases and cuticular proteins. The second genotype (resistant through a kdr sodium channel mutation), up-regulated 17 genes coding for detoxifying enzymes, peptidase and cuticular proteins. Finally, a multiply resistant genotype (carrying kdr and a modified acetylcholinesterase), up-regulated only 7 genes, appears not to require induced insecticide detoxification, and instead down-regulated many genes. Conclusions/Significance This study suggests strongly that insecticide resistance in M. persicae is more complex that has been described, with the participation of a broad array of resistance mechanisms. The sensitive genotype exhibited the highest transcriptional plasticity, accounting for the wide range of potential adaptations to insecticides that this species can evolve. In contrast, the multiply resistant genotype exhibited a low transcriptional plasticity, even for the expression of genes encoding

  13. Withaferin A protects against palmitic acid-induced endothelial insulin resistance and dysfunction through suppression of oxidative stress and inflammation

    PubMed Central

    Batumalaie, Kalaivani; Amin, Muhammad Arif; Murugan, Dharmani Devi; Sattar, Munavvar Zubaid Abdul; Abdullah, Nor Azizan

    2016-01-01

    Activation of inflammatory pathways via reactive oxygen species (ROS) by free fatty acids (FFA) in obesity gives rise to insulin resistance and endothelial dysfunction. Withaferin A (WA), possesses both antioxidant and anti-inflammatory properties and therefore would be a good strategy to suppress palmitic acid (PA)-induced oxidative stress and inflammation and hence, insulin resistance and dysfunction in the endothelium. Effect of WA on PA-induced insulin resistance in human umbilical vein endothelial cells (HUVECs) was determined by evaluating insulin signaling mechanisms whilst effect of this drug on PA-induced endothelial dysfunction was determined in acetylcholine-mediated relaxation in isolated rat aortic preparations. WA significantly inhibited ROS production and inflammation induced by PA. Furthermore, WA significantly decreased TNF-α and IL-6 production in endothelial cells by specifically suppressing IKKβ/NF-κβ phosphorylation. WA inhibited inflammation-stimulated IRS-1 serine phosphorylation and improved the impaired insulin PI3-K signaling, and restored the decreased nitric oxide (NO) production triggered by PA. WA also decreased endothelin-1 and plasminogen activator inhibitor type-1 levels, and restored the impaired endothelium-mediated vasodilation in isolated aortic preparations. These findings suggest that WA inhibited both ROS production and inflammation to restore impaired insulin resistance in cultured endothelial cells and improve endothelial dysfunction in rat aortic rings. PMID:27250532

  14. Withaferin A protects against palmitic acid-induced endothelial insulin resistance and dysfunction through suppression of oxidative stress and inflammation.

    PubMed

    Batumalaie, Kalaivani; Amin, Muhammad Arif; Murugan, Dharmani Devi; Sattar, Munavvar Zubaid Abdul; Abdullah, Nor Azizan

    2016-01-01

    Activation of inflammatory pathways via reactive oxygen species (ROS) by free fatty acids (FFA) in obesity gives rise to insulin resistance and endothelial dysfunction. Withaferin A (WA), possesses both antioxidant and anti-inflammatory properties and therefore would be a good strategy to suppress palmitic acid (PA)-induced oxidative stress and inflammation and hence, insulin resistance and dysfunction in the endothelium. Effect of WA on PA-induced insulin resistance in human umbilical vein endothelial cells (HUVECs) was determined by evaluating insulin signaling mechanisms whilst effect of this drug on PA-induced endothelial dysfunction was determined in acetylcholine-mediated relaxation in isolated rat aortic preparations. WA significantly inhibited ROS production and inflammation induced by PA. Furthermore, WA significantly decreased TNF-α and IL-6 production in endothelial cells by specifically suppressing IKKβ/NF-κβ phosphorylation. WA inhibited inflammation-stimulated IRS-1 serine phosphorylation and improved the impaired insulin PI3-K signaling, and restored the decreased nitric oxide (NO) production triggered by PA. WA also decreased endothelin-1 and plasminogen activator inhibitor type-1 levels, and restored the impaired endothelium-mediated vasodilation in isolated aortic preparations. These findings suggest that WA inhibited both ROS production and inflammation to restore impaired insulin resistance in cultured endothelial cells and improve endothelial dysfunction in rat aortic rings. PMID:27250532

  15. Salicylic acid-induced resistance to Fusarium oxysporum f. sp. lycopersici in tomato.

    PubMed

    Mandal, Sudhamoy; Mallick, Nirupama; Mitra, Adinpunya

    2009-07-01

    We demonstrated that exogenous application of 200 microM salicylic acid through root feeding and foliar spray could induce resistance against Fusarium oxysporum f. sp. Lycopersici (Fol) in tomato. Endogenous accumulation of free salicylic acid in tomato roots was detected by HPLC and identification was confirmed by LC-MS/MS analysis. At 168h of salicylic acid treatment through roots, the endogenous salicylic acid level in the roots increased to 1477ngg(-1) FW which was 10 times higher than control plants. Similarly, the salicylic acid content was 1001ngg(-1) FW at 168h of treatment by foliar spray, which was 8.7 times higher than control plants. The activities of phenylalanine ammonia lyase (PAL, EC 4.3.1.5) and peroxidase (POD, EC 1.11.1.7) were 5.9 and 4.7 times higher, respectively than the control plants at 168h of salicylic acid feeding through the roots. The increase in PAL and POD activities was 3.7 and 3.3 times higher, respectively at 168h of salicylic acid treatments through foliar spray than control plants. The salicylic acid-treated tomato plants challenged with Fol exhibited significantly reduced vascular browning and leaf yellowing wilting. The mycelial growth of Fol was not significantly affected by salicylic acid. Significant increase in basal level of salicylic acid in noninoculated plants indicated that tomato root system might have the capacity to assimilate and distribute salicylic acid throughout the plant. The results indicated that the induced resistance observed in tomato against Fol might be a case of salicylic acid-dependent systemic acquired resistance.

  16. D538G mutation in estrogen receptor-α: A novel mechanism for acquired endocrine resistance in breast cancer.

    PubMed

    Merenbakh-Lamin, Keren; Ben-Baruch, Noa; Yeheskel, Adva; Dvir, Addie; Soussan-Gutman, Lior; Jeselsohn, Rinath; Yelensky, Roman; Brown, Myles; Miller, Vincent A; Sarid, David; Rizel, Shulamith; Klein, Baruch; Rubinek, Tami; Wolf, Ido

    2013-12-01

    Resistance to endocrine therapy occurs in virtually all patients with estrogen receptor α (ERα)-positive metastatic breast cancer, and is attributed to various mechanisms including loss of ERα expression, altered activity of coregulators, and cross-talk between the ERα and growth factor signaling pathways. To our knowledge, acquired mutations of the ERα have not been described as mediating endocrine resistance. Samples of 13 patients with metastatic breast cancer were analyzed for mutations in cancer-related genes. In five patients who developed resistance to hormonal therapy, a mutation of A to G at position 1,613 of ERα, resulting in a substitution of aspartic acid at position 538 to glycine (D538G), was identified in liver metastases. Importantly, the mutation was not detected in the primary tumors obtained prior to endocrine treatment. Structural modeling indicated that D538G substitution leads to a conformational change in the ligand-binding domain, which mimics the conformation of activated ligand-bound receptor and alters binding of tamoxifen. Indeed, experiments in breast cancer cells indicated constitutive, ligand-independent transcriptional activity of the D538G receptor, and overexpression of it enhanced proliferation and conferred resistance to tamoxifen. These data indicate a novel mechanism of acquired endocrine resistance in breast cancer. Further studies are needed to assess the frequency of D538G-ERα among patients with breast cancer and explore ways to inhibit its activity and restore endocrine sensitivity.

  17. Bypassing Mechanisms of Mitochondria-Mediated Cancer Stem Cells Resistance to Chemo- and Radiotherapy

    PubMed Central

    Lyakhovich, Alex; Lleonart, Matilde E.

    2016-01-01

    Cancer stem cells (CSCs) are highly resistant to conventional chemo- and radiotherapeutic regimes. Therefore, the multiple drug resistance (MDR) of cancer is most likely due to the resistance of CSCs. Such resistance can be attributed to some bypassing pathways including detoxification mechanisms of reactive oxygen and nitrogen species (RO/NS) formation or enhanced autophagy. Unlike in normal cells, where RO/NS concentration is maintained at certain threshold required for signal transduction or immune response mechanisms, CSCs may develop alternative pathways to diminish RO/NS levels leading to cancer survival. In this minireview, we will focus on elaborated mechanisms developed by CSCs to attenuate high RO/NS levels. Gaining a better insight into the mechanisms of stem cell resistance to chemo- or radiotherapy may lead to new therapeutic targets thus serving for better anticancer strategies. PMID:26697128

  18. Understanding the Genetic Mechanisms of Cancer Drug Resistance Using Genomic Approaches.

    PubMed

    Hu, Xueda; Zhang, Zemin

    2016-02-01

    A major obstacle in precision cancer medicine is the inevitable resistance to targeted therapies. Tremendous effort and progress has been made over the past few years to understand the biochemical and genetic mechanisms underlying drug resistance, with the goal to eventually overcome such daunting challenges. Diverse mechanisms, such as secondary mutations, oncogene bypass, and epigenetic alterations, can all lead to drug resistance, and the number of known involved genes is growing rapidly, thus providing many possibilities to overcome resistance. The finding of these mechanisms and genes invariably requires the application of genomic and functional genomic approaches to tumors or cancer models. In this review, we briefly highlight the major drug-resistance mechanisms known today, and then focus primarily on the technological approaches leading to the advancement of this field. PMID:26689126

  19. Understanding the Genetic Mechanisms of Cancer Drug Resistance Using Genomic Approaches.

    PubMed

    Hu, Xueda; Zhang, Zemin

    2016-02-01

    A major obstacle in precision cancer medicine is the inevitable resistance to targeted therapies. Tremendous effort and progress has been made over the past few years to understand the biochemical and genetic mechanisms underlying drug resistance, with the goal to eventually overcome such daunting challenges. Diverse mechanisms, such as secondary mutations, oncogene bypass, and epigenetic alterations, can all lead to drug resistance, and the number of known involved genes is growing rapidly, thus providing many possibilities to overcome resistance. The finding of these mechanisms and genes invariably requires the application of genomic and functional genomic approaches to tumors or cancer models. In this review, we briefly highlight the major drug-resistance mechanisms known today, and then focus primarily on the technological approaches leading to the advancement of this field.

  20. Excited-State Proton Transfer in Resveratrol and Proposed Mechanism for Plant Resistance to Fungal Infection.

    PubMed

    Simkovitch, Ron; Huppert, Dan

    2015-09-01

    Steady-state and time-resolved fluorescence techniques were employed to study the photophysics and photochemistry of trans-resveratrol. trans-Resveratrol is found in large quantities in fungi-infected grapevine-leaf tissue and plays a direct role in the resistance to plant disease. We found that trans-resveratrol in liquid solution undergoes a trans-cis isomerization process in the excited state at a rate that depends partially on the solvent viscosity, as was found in previous studies on trans-stilbene. The hydroxyl groups of the phenol moieties in resveratrol are weak photoacids. In water and methanol solutions containing weak bases such as acetate, a proton is transferred to the base within the lifetime of the excited state. When resveratrol is adsorbed on cellulose (also a component of the plant's cell wall), the cis-trans process is slow and the lifetime of the excited state increases from several tens of picoseconds in ethanol to about 1.5 ns. Excited-state proton transfer occurs when resveratrol is adsorbed on cellulose and acetate ions are in close proximity to the phenol moieties. We propose that proton transfer from excited resveratrol to the fungus acid-sensing chemoreceptor is one of the plant's resistance mechanisms to fungal infection.

  1. A new detection method for a newly revealed mechanism of pyrethroid resistance development in Varroa destructor.

    PubMed

    Strachecka, Aneta; Borsuk, Grzegorz; Olszewski, Krzysztof; Paleolog, Jerzy

    2015-11-01

    The Varroa destructor mite has recently displayed an ever increasing resistance to new drugs, contributing to CCD proliferation. This work was aimed at determining new viable methods for identifying the pyrethroid resistance of V. destructor and DNA methylation in resistant and sensitive mites. DNA was extracted from Varroa mites. Nucleotide changes in the DNA of pyrethroid-resistant, pyrethroid-sensitive, and control mites were identified with polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) in the case of five mitochondrial gene fragments. More bands were observed in the drug-resistant mites than in the other two groups. Sequencing confirmed these observations. Decreased global DNA methylation levels were observed in the pyrethroid-resistant mites. There exists a previously undescribed mechanism of pyrethroid resistance development in Varroa mites. The PCR-SSCP methods can be considered and further developed as useful tools for detecting V. destructor resistance. PMID:26210302

  2. Micro-electro-mechanical systems phosphoric acid fuel cell

    DOEpatents

    Sopchak, David A.; Morse, Jeffrey D.; Upadhye, Ravindra S.; Kotovsky, Jack; Graff, Robert T.

    2010-08-17

    A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

  3. Micro-electro-mechanical systems phosphoric acid fuel cell

    DOEpatents

    Sopchak, David A.; Morse, Jeffrey D.; Upadhye, Ravindra S.; Kotovsky, Jack; Graff, Robert T.

    2010-12-21

    A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

  4. Mechanisms of antimicrobial resistance and genetic relatedness among enterococci isolated from dogs and cats in the United States

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aims: In this study, mechanisms of antimicrobial resistance and genetic relatedness among resistant enterococci from dogs and cats in the United States were determined. Methods and Results: Enterococci resistant to chloramphenicol, ciprofloxacin, erythromycin, gentamicin, kanamycin, streptomycin,...

  5. Membrane fouling in a membrane bioreactor: High filtration resistance of gel layer and its underlying mechanism.

    PubMed

    Chen, Jianrong; Zhang, Meijia; Li, Fengquan; Qian, Lei; Lin, Hongjun; Yang, Lining; Wu, Xilin; Zhou, Xiaoling; He, Yiming; Liao, Bao-Qiang

    2016-10-01

    A membrane bioreactor (MBR) was continuously operated to investigate mechanisms of fouling caused by the gel layer in this study. Agar was used as a model foulant for gel layer formation, and filtration resistance of gel layers was systematically assessed. The results showed that gel layer possessed unusually high specific filtration resistance (SFR) and high measured porosity as compared with cake layer. Current knowledge cannot explain the contradiction between high filtration resistance and high porosity of gel layer. A new fouling mechanism based on Flory-Huggins theory was then proposed. Filtration resistance of agar gel layer was found to be independent of pH and ionic strength, but linearly increase with gel thickness. The results are accordant with the mechanism deductions. Simulation of the mechanism model showed that the filtration resistance induced by mixing chemical potential variation was comparable to the experimental data of filtration resistance of agar gel layer, indicating that the proposed mechanism is the predominant mechanism responsible for the high filtration resistance of gel layer. The proposed mechanism was further verified from the bound water viewpoint.

  6. Antioxidant enzymes and fatty acid composition as related to disease resistance in postharvest loquat fruit.

    PubMed

    Cao, Shifeng; Yang, Zhenfeng; Cai, Yuting; Zheng, Yonghua

    2014-11-15

    Two cultivars of loquat fruit were stored at 20°C for 10days to investigate the relationship between disease resistance, and fatty acid composition and activities of endogenous antioxidant enzymes. The results showed that decay incidence increased with storage time in both cultivars. A significantly lower disease incidence was observed in 'Qingzhong' fruit than in 'Fuyang', suggesting 'Qingzhong' had increased disease resistance. Meanwhile, 'Qingzhong' fruit also had lower levels of superoxide radical and hydrogen peroxide, and lower lipoxygenase activity, but higher levels of linolenic and linoleic acids and higher activities of catalase (CAT) and ascorbate peroxidase (APX) compared with 'Fuyang'. These results suggest that the higher levels of linolenic and linoleic acids and the higher activity of CAT and APX have a role in disease resistance of postharvest loquat fruit.

  7. A review on the mechanisms of blood-flow restriction resistance training-induced muscle hypertrophy.

    PubMed

    Pearson, Stephen John; Hussain, Syed Robiul

    2015-02-01

    It has traditionally been believed that resistance training can only induce muscle growth when the exercise intensity is greater than 65% of the 1-repetition maximum (RM). However, more recently, the use of low-intensity resistance exercise with blood-flow restriction (BFR) has challenged this theory and consistently shown that hypertrophic adaptations can be induced with much lower exercise intensities (<50% 1-RM). Despite the potent hypertrophic effects of BFR resistance training being demonstrated by numerous studies, the underlying mechanisms responsible for such effects are not well defined. Metabolic stress has been suggested to be a primary factor responsible, and this is theorised to activate numerous other mechanisms, all of which are thought to induce muscle growth via autocrine and/or paracrine actions. However, it is noteworthy that some of these mechanisms do not appear to be mediated to any great extent by metabolic stress but rather by mechanical tension (another primary factor of muscle hypertrophy). Given that the level of mechanical tension is typically low with BFR resistance exercise (<50% 1-RM), one may question the magnitude of involvement of these mechanisms aligned to the adaptations reported with BFR resistance training. However, despite the low level of mechanical tension, it is plausible that the effects induced by the primary factors (mechanical tension and metabolic stress) are, in fact, additive, which ultimately contributes to the adaptations seen with BFR resistance training. Exercise-induced mechanical tension and metabolic stress are theorised to signal a number of mechanisms for the induction of muscle growth, including increased fast-twitch fibre recruitment, mechanotransduction, muscle damage, systemic and localised hormone production, cell swelling, and the production of reactive oxygen species and its variants, including nitric oxide and heat shock proteins. However, the relative extent to which these specific mechanisms are

  8. Mechanisms of triglyceride metabolism in patients with bile acid diarrhea

    PubMed Central

    Sagar, Nidhi Midhu; McFarlane, Michael; Nwokolo, Chuka; Bardhan, Karna Dev; Arasaradnam, Ramesh Pulendran

    2016-01-01

    Bile acids (BAs) are essential for the absorption of lipids. BA synthesis is inhibited through intestinal farnesoid X receptor (FXR) activity. BA sequestration is known to influence BA metabolism and control serum lipid concentrations. Animal data has demonstrated a regulatory role for the FXR in triglyceride metabolism. FXR inhibits hepatic lipogenesis by inhibiting the expression of sterol regulatory element binding protein 1c via small heterodimer primer activity. Conversely, FXR promotes free fatty acids oxidation by inducing the expression of peroxisome proliferator-activated receptor α. FXR can reduce the expression of microsomal triglyceride transfer protein, which regulates the assembly of very low-density lipoproteins (VLDL). FXR activation in turn promotes the clearance of circulating triglycerides by inducing apolipoprotein C-II, very low-density lipoproteins receptor (VLDL-R) and the expression of Syndecan-1 together with the repression of apolipoprotein C-III, which increases lipoprotein lipase activity. There is currently minimal clinical data on triglyceride metabolism in patients with bile acid diarrhoea (BAD). Emerging data suggests that a third of patients with BAD have hypertriglyceridemia. Further research is required to establish the risk of hypertriglyceridaemia in patients with BAD and elicit the mechanisms behind this, allowing for targeted treatment. PMID:27570415

  9. Mechanisms of triglyceride metabolism in patients with bile acid diarrhea.

    PubMed

    Sagar, Nidhi Midhu; McFarlane, Michael; Nwokolo, Chuka; Bardhan, Karna Dev; Arasaradnam, Ramesh Pulendran

    2016-08-14

    Bile acids (BAs) are essential for the absorption of lipids. BA synthesis is inhibited through intestinal farnesoid X receptor (FXR) activity. BA sequestration is known to influence BA metabolism and control serum lipid concentrations. Animal data has demonstrated a regulatory role for the FXR in triglyceride metabolism. FXR inhibits hepatic lipogenesis by inhibiting the expression of sterol regulatory element binding protein 1c via small heterodimer primer activity. Conversely, FXR promotes free fatty acids oxidation by inducing the expression of peroxisome proliferator-activated receptor α. FXR can reduce the expression of microsomal triglyceride transfer protein, which regulates the assembly of very low-density lipoproteins (VLDL). FXR activation in turn promotes the clearance of circulating triglycerides by inducing apolipoprotein C-II, very low-density lipoproteins receptor (VLDL-R) and the expression of Syndecan-1 together with the repression of apolipoprotein C-III, which increases lipoprotein lipase activity. There is currently minimal clinical data on triglyceride metabolism in patients with bile acid diarrhoea (BAD). Emerging data suggests that a third of patients with BAD have hypertriglyceridemia. Further research is required to establish the risk of hypertriglyceridaemia in patients with BAD and elicit the mechanisms behind this, allowing for targeted treatment. PMID:27570415

  10. Etoxazole resistance in predatory mite Phytoseiulus persimilis A.-H. (Acari: Phytoseiidae): Cross-resistance, inheritance and biochemical resistance mechanisms.

    PubMed

    Yorulmaz Salman, Sibel; Aydınlı, Fatma; Ay, Recep

    2015-07-01

    Phytoseiulus persimilis of the family Phytoseiidae is an effective predatory mite species that is used to control pest mites. The LC50 and LC60 values of etoxazole were determined on P. persimilis using a leaf-disc method and spraying tower. A laboratory selection population designated ETO6 was found to have a 111.63-fold resistance to etoxazole following 6 selection cycles. This population developed low cross-resistance to spinosad, spiromesifen, acetamiprid, indoxacarb, chlorantraniliprole, milbemectin and moderate cross-resistance to deltamethrin. PBO, IBP and DEM synergised resistance 3.17-, 2.85- and 3.60-fold respectively. Crossing experiments revealed that etoxazole resistance in the ETO6 population was an intermediately dominant and polygenic. In addition, detoxifying enzyme activities were increased 2.71-fold for esterase, 3.09-fold for glutathione S-transferase (GST) and 2.76-fold for cytochrome P450 monooxygenase (P450) in the ETO6 population. Selection for etoxazole under laboratory conditions resulted in the development of etoxazole resistance in the predatory mite P. persimilis that are resistant to pesticides are considered valuable for use in resistance management programmes within integrated pest control strategies. PMID:26071813

  11. Loss of N-glycolylneuraminic acid in humans: Mechanisms, consequences, and implications for hominid evolution.

    PubMed

    Varki, A

    2001-01-01

    The surface of all mammalian cells is covered with a dense and complex array of sugar chains, which are frequently terminated by members of a family of molecules called sialic acids. One particular sialic acid called N-glycolylneuraminic acid (Neu5Gc) is widely expressed on most mammalian tissues, but is not easily detectable on human cells. In fact, it provokes an immune response in adult humans. The human deficiency of Neu5Gc is explained by an inactivating mutation in the gene encoding CMP-N-acetylneuraminic acid hydroxylase, the rate-limiting enzyme in generating Neu5Gc in cells of other mammals. This deficiency also results in an excess of the precursor sialic acid N-acetylneuraminic acid (Neu5Ac) in humans. This mutation appears universal to modern humans, occurred sometime after our last common ancestor with the great apes, and happens to be one of the first known human-great ape genetic differences with an obvious biochemical readout. While the original selection mechanisms and major biological consequences of this human-specific mutation remain uncertain, several interesting clues are currently being pursued. First, there is evidence that the human condition can explain differences in susceptibility or resistance to certain microbial pathogens. Second, the functions of some endogenous receptors for sialic acids in the immune system may be altered by this difference. Third, despite the lack of any obvious alternate pathway for synthesis, Neu5Gc has been reported in human tumors and possibly in human fetal tissues, and traces have even been detected in normal human tissues. One possible explanation is that this represents accumulation of Neu5Gc from dietary sources of animal origin. Finally, a markedly reduced expression of hydroxylase in the brains of other mammals raises the possibility that the human-specific mutation of this enzyme could have played a role in human brain evolution.

  12. Boric acid inhibits embryonic histone deacetylases: A suggested mechanism to explain boric acid-related teratogenicity

    SciTech Connect

    Di Renzo, Francesca; Cappelletti, Graziella; Broccia, Maria L.; Giavini, Erminio; Menegola, Elena . E-mail: elena.menegola@unimi.it

    2007-04-15

    Histone deacetylases (HDAC) control gene expression by changing histonic as well as non histonic protein conformation. HDAC inhibitors (HDACi) are considered to be among the most promising drugs for epigenetic treatment for cancer. Recently a strict relationship between histone hyperacetylation in specific tissues of mouse embryos exposed to two HDACi (valproic acid and trichostatin A) and specific axial skeleton malformations has been demonstrated. The aim of this study is to verify if boric acid (BA), that induces in rodents malformations similar to those valproic acid and trichostatin A-related, acts through similar mechanisms: HDAC inhibition and histone hyperacetylation. Pregnant mice were treated intraperitoneally with a teratogenic dose of BA (1000 mg/kg, day 8 of gestation). Western blot analysis and immunostaining were performed with anti hyperacetylated histone 4 (H4) antibody on embryos explanted 1, 3 or 4 h after treatment and revealed H4 hyperacetylation at the level of somites. HDAC enzyme assay was performed on embryonic nuclear extracts. A significant HDAC inhibition activity (compatible with a mixed type partial inhibition mechanism) was evident with BA. Kinetic analyses indicate that BA modifies substrate affinity by a factor {alpha} = 0.51 and maximum velocity by a factor {beta} = 0.70. This work provides the first evidence for HDAC inhibition by BA and suggests such a molecular mechanism for the induction of BA-related malformations.

  13. Prebiotically plausible mechanisms increase compositional diversity of nucleic acid sequences

    PubMed Central

    Derr, Julien; Manapat, Michael L.; Rajamani, Sudha; Leu, Kevin; Xulvi-Brunet, Ramon; Joseph, Isaac; Nowak, Martin A.; Chen, Irene A.

    2012-01-01

    During the origin of life, the biological information of nucleic acid polymers must have increased to encode functional molecules (the RNA world). Ribozymes tend to be compositionally unbiased, as is the vast majority of possible sequence space. However, ribonucleotides vary greatly in synthetic yield, reactivity and degradation rate, and their non-enzymatic polymerization results in compositionally biased sequences. While natural selection could lead to complex sequences, molecules with some activity are required to begin this process. Was the emergence of compositionally diverse sequences a matter of chance, or could prebiotically plausible reactions counter chemical biases to increase the probability of finding a ribozyme? Our in silico simulations using a two-letter alphabet show that template-directed ligation and high concatenation rates counter compositional bias and shift the pool toward longer sequences, permitting greater exploration of sequence space and stable folding. We verified experimentally that unbiased DNA sequences are more efficient templates for ligation, thus increasing the compositional diversity of the pool. Our work suggests that prebiotically plausible chemical mechanisms of nucleic acid polymerization and ligation could predispose toward a diverse pool of longer, potentially structured molecules. Such mechanisms could have set the stage for the appearance of functional activity very early in the emergence of life. PMID:22319215

  14. Multiple Mechanisms Increase Levels of Resistance in Rapistrum rugosum to ALS Herbicides

    PubMed Central

    Hatami, Zahra M.; Gherekhloo, Javid; Rojano-Delgado, Antonia M.; Osuna, Maria D.; Alcántara, Ricardo; Fernández, Pablo; Sadeghipour, Hamid R.; De Prado, Rafael

    2016-01-01

    Rapistrum rugosum (turnip weed) is a common weed of wheat fields in Iran, which is most often controlled by tribenuron-methyl (TM), a sulfonylurea (SU) belonging to the acetolactate synthase (ALS) inhibiting herbicides group. Several cases of unexplained control failure of R. rugosum by TM have been seen, especially in Golestan province-Iran. Hence, there is lack of research in evaluation of the level of resistance of the R. rugosum populations to TM, using whole plant dose-response and enzyme assays, then investigating some potential resistance mechanisms Results revealed that the resistance factor (RF) for resistant (R) populations was 2.5–6.6 fold higher than susceptible (S) plant. Neither foliar retention, nor 14C-TM absorption and translocation were the mechanisms responsible for resistance in turnip weed. Metabolism of TM was the second resistant mechanism in two populations (Ag-R5 and G-1), in which three metabolites were found. The concentration of TM for 50% inhibition of ALS enzyme activity in vitro showed a high level of resistance to the herbicide (RFs were from 28 to 38) and cross-resistance to sulfonyl-aminocarbonyl-triazolinone (SCT), pyrimidinyl-thiobenzoate (PTB) and triazolopyrimidine (TP), with no cross-resistance to imidazolinone (IMI). Substitution Pro 197 to Ser 197 provided resistance to four of five ALS-inhibiting herbicides including SU, TP, PTB, and SCT with no resistance to IMI. These results documented the first case of R. rugosum resistant population worldwide and demonstrated that both RST and NRST mechanisms are involved to the resistance level to TM. PMID:26941749

  15. Environmental fatty acids enable emergence of infectious Staphylococcus aureus resistant to FASII-targeted antimicrobials

    PubMed Central

    Morvan, Claire; Halpern, David; Kénanian, Gérald; Hays, Constantin; Anba-Mondoloni, Jamila; Brinster, Sophie; Kennedy, Sean; Trieu-Cuot, Patrick; Poyart, Claire; Lamberet, Gilles; Gloux, Karine; Gruss, Alexandra

    2016-01-01

    The bacterial pathway for fatty acid biosynthesis, FASII, is a target for development of new anti-staphylococcal drugs. This strategy is based on previous reports indicating that self-synthesized fatty acids appear to be indispensable for Staphylococcus aureus growth and virulence, although other bacteria can use exogenous fatty acids to compensate FASII inhibition. Here we report that staphylococci can become resistant to the FASII-targeted inhibitor triclosan via high frequency mutations in fabD, one of the FASII genes. The fabD mutants can be conditional for FASII and not require exogenous fatty acids for normal growth, and can use diverse fatty acid combinations (including host fatty acids) when FASII is blocked. These mutants show cross-resistance to inhibitors of other FASII enzymes and are infectious in mice. Clinical isolates bearing fabD polymorphisms also bypass FASII inhibition. We propose that fatty acid-rich environments within the host, in the presence of FASII inhibitors, might favour the emergence of staphylococcal strains displaying resistance to multiple FASII inhibitors. PMID:27703138

  16. Retinoic acid receptor alpha is associated with tamoxifen resistance in breast cancer

    PubMed Central

    Johansson, Henrik J.; Sanchez, Betzabe C.; Mundt, Filip; Forshed, Jenny; Kovacs, Aniko; Panizza, Elena; Hultin-Rosenberg, Lina; Lundgren, Bo; Martens, Ulf; Máthé, Gyöngyvér; Yakhini, Zohar; Helou, Khalil; Krawiec, Kamilla; Kanter, Lena; Hjerpe, Anders; Stål, Olle; Linderholm, Barbro K.; Lehtiö, Janne

    2013-01-01

    About one-third of oestrogen receptor alpha-positive breast cancer patients treated with tamoxifen relapse. Here we identify the nuclear receptor retinoic acid receptor alpha as a marker of tamoxifen resistance. Using quantitative mass spectrometry-based proteomics, we show that retinoic acid receptor alpha protein networks and levels differ in a tamoxifen-sensitive (MCF7) and a tamoxifen-resistant (LCC2) cell line. High intratumoural retinoic acid receptor alpha protein levels also correlate with reduced relapse-free survival in oestrogen receptor alpha-positive breast cancer patients treated with adjuvant tamoxifen solely. A similar retinoic acid receptor alpha expression pattern is seen in a comparable independent patient cohort. An oestrogen receptor alpha and retinoic acid receptor alpha ligand screening reveals that tamoxifen-resistant LCC2 cells have increased sensitivity to retinoic acid receptor alpha ligands and are less sensitive to oestrogen receptor alpha ligands compared with MCF7 cells. Our data indicate that retinoic acid receptor alpha may be a novel therapeutic target and a predictive factor for oestrogen receptor alpha-positive breast cancer patients treated with adjuvant tamoxifen. PMID:23868472

  17. Anti-Plasmodial Polyvalent Interactions in Artemisia annua L. Aqueous Extract – Possible Synergistic and Resistance Mechanisms

    PubMed Central

    Suberu, John O.; Gorka, Alexander P.; Jacobs, Lauren; Roepe, Paul D.; Sullivan, Neil

    2013-01-01

    Artemisia annua hot water infusion (tea) has been used in in vitro experiments against P. falciparum malaria parasites to test potency relative to equivalent pure artemisinin. High performance liquid chromatography (HPLC) and mass spectrometric analyses were employed to determine the metabolite profile of tea including the concentrations of artemisinin (47.5±0.8 mg L-1), dihydroartemisinic acid (70.0±0.3 mg L-1), arteannuin B (1.3±0.0 mg L-1), isovitexin (105.0±7.2 mg L-1) and a range of polyphenolic acids. The tea extract, purified compounds from the extract, and the combination of artemisinin with the purified compounds were tested against chloroquine sensitive and chloroquine resistant strains of P. falciparum using the DNA-intercalative SYBR Green I assay. The results of these in vitro tests and of isobologram analyses of combination effects showed mild to strong antagonistic interactions between artemisinin and the compounds (9-epi-artemisinin and artemisitene) extracted from A. annua with significant (IC50 <1 μM) anti-plasmodial activities for the combination range evaluated. Mono-caffeoylquinic acids, tri-caffeoylquinic acid, artemisinic acid and arteannuin B showed additive interaction while rosmarinic acid showed synergistic interaction with artemisinin in the chloroquine sensitive strain at a combination ratio of 1:3 (artemisinin to purified compound). In the chloroquine resistant parasite, using the same ratio, these compounds strongly antagonised artemisinin anti-plasmodial activity with the exception of arteannuin B, which was synergistic. This result would suggest a mechanism targeting parasite resistance defenses for arteannuin B’s potentiation of artemisinin. PMID:24244716

  18. Mechanism of DMI resistance in field isolates of Cercospora beticola

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leaf spot, caused by the fungus Cercospora beticola, is an endemic disease of sugarbeets in the North Dakota and Minnesota growing regions. Control measures against the fungus include resistant sugarbeet varieties and crop rotation, but the disease is managed effectively only when combined with tim...

  19. Autoimmune mechanisms in antibiotic treatment-resistant lyme arthritis.

    PubMed

    Steere, A C; Gross, D; Meyer, A L; Huber, B T

    2001-05-01

    In about 10% of patients with Lyme arthritis in the United States, joint inflammation persists for months or even several years after the apparent eradication of the spirochete, Borrelia burgdorferi, from the joint with antibiotic treatment. We propose a model of molecular mimicry affecting genetically susceptible individuals to explain this treatment-resistant course. The majority of patients with treatment-resistant Lyme arthritis have HLA-DRB1*0401 or related alleles, and the severity and duration of their arthritis correlate with cellular and humoral immune responses to outer-surface protein A OspA) of the spirochete. Using an algorithm, the immunodominant epitope of OspA presented by the DRB1*0401 molecule was predicted to be located at aa 165-173. In a search of the Genetics Computer Group gene bank, only one human protein was identified, lymphocyte function associated antigen-1 (hLFA-1), that had sequence homology with OspA(165-173)and predicted binding in the DRB1*0401 molecule. Synovial fluid T cells from most patients with treatment-resistant arthritis responded to both OspA and hLFA-1, whereas those from patients with other forms of chronic inflammatory arthritis did not. Molecular mimicry between a dominant T cell epitope of OspA and hLFA-1 may be an important factor in the persistence of joint inflammation in genetically susceptible patients with treatment-resistant Lyme arthritis.

  20. Insights into molecular mechanism of blast resistance in weedy rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Weedy rice is a serious pest in direct-seeded rice fields in the U.S. and worldwide. Under suitable conditions, weedy rice can reduce crop yields up to 70%. However, weedy rice may carry novel disease resistance genes. Rice blast disease caused by the fungus Magnaporthe oryzae is a major disease wo...

  1. Amplification of the IMP dehydrogenase gene in Chinese hamster cells resistant to mycophenolic acid.

    PubMed Central

    Collart, F R; Huberman, E

    1987-01-01

    The regulation of IMP dehydrogenase (IMPDH) was analyzed in Chinese hamster V79 cell variants that exhibit different degrees of resistance to the cytotoxic effect of mycophenolic acid, a specific inhibitor of IMPDH. Western blot (immunoblot) analysis with an IMPDH antiserum revealed a 14- to 27-fold increase in the amount of enzyme in the mycophenolic acid-resistant cells. The antiserum was also used to screen for a phage containing the IMPDH cDNA sequence from a lambda gt11 expression library. Northern blot (RNA blot) analyses of total cellular and poly(A)+ RNA showed that an IMPDH cDNA probe hybridized to a 2.2-kilobase transcript, the amount of which was associated with increased resistance. Southern blotting with the probe indicated an amplification of the IMPDH gene in the mycophenolic acid-resistant cells. Our findings suggest that the acquired mycophenolic acid resistance of the V79 cell variants is associated with increases in the amount and activity of IMPDH and the number of IMPDH gene copies. Images PMID:2890098

  2. Characterization of the epidemic European fusidic acid-resistant impetigo clone of Staphylococcus aureus.

    PubMed

    O'Neill, A J; Larsen, A R; Skov, R; Henriksen, A S; Chopra, I

    2007-05-01

    Resistance to the antibiotic fusidic acid in European strains of Staphylococcus aureus causing impetigo has increased in recent years. This increase appears to have resulted from clonal expansion of a strain we have designated the epidemic European fusidic acid-resistant impetigo clone (EEFIC), which carries the fusidic acid resistance determinant fusB on its chromosome. To understand better the properties of the EEFIC responsible for its success, we have performed detailed phenotypic and genotypic characterization of this clone. Molecular typing revealed the EEFIC to be ST123, spa type t171, and agr type IV and therefore unrelated to earlier prevalent fusB(+) strains found in the United Kingdom. EEFIC strains exhibited resistance to fusidic acid, penicillin, and, in some cases, erythromycin, which are all used in the treatment of impetigo. PCR analysis of the EEFIC and complete DNA sequencing of the 39.3 Kb plasmid it harbors identified genes encoding several toxins previously implicated in impetigo (exfoliative toxins A and B and EDIN-C). The location of fusB was mapped on the chromosome and found to be associated with a novel 16.6-kb genomic island integrated downstream of groEL. Although this element is related to classical staphylococcal pathogenicity islands, it does not encode any known virulence factors and consequently has been designated SaRI(fusB) (for "S. aureus resistance island carrying fusB").

  3. Identification of New Drug Targets and Resistance Mechanisms in Mycobacterium tuberculosis

    PubMed Central

    Ioerger, Thomas R.; O’Malley, Theresa; Liao, Reiling; Guinn, Kristine M.; Hickey, Mark J.; Mohaideen, Nilofar; Murphy, Kenan C.; Boshoff, Helena I. M.; Mizrahi, Valerie; Rubin, Eric J.; Sassetti, Christopher M.; Barry, Clifton E.; Sherman, David R.; Parish, Tanya; Sacchettini, James C.

    2013-01-01

    Identification of new drug targets is vital for the advancement of drug discovery against Mycobacterium tuberculosis, especially given the increase of resistance worldwide to first- and second-line drugs. Because traditional target-based screening has largely proven unsuccessful for antibiotic discovery, we have developed a scalable platform for target identification in M. tuberculosis that is based on whole-cell screening, coupled with whole-genome sequencing of resistant mutants and recombineering to confirm. The method yields targets paired with whole-cell active compounds, which can serve as novel scaffolds for drug development, molecular tools for validation, and/or as ligands for co-crystallization. It may also reveal other information about mechanisms of action, such as activation or efflux. Using this method, we identified resistance-linked genes for eight compounds with anti-tubercular activity. Four of the genes have previously been shown to be essential: AspS, aspartyl-tRNA synthetase, Pks13, a polyketide synthase involved in mycolic acid biosynthesis, MmpL3, a membrane transporter, and EccB3, a component of the ESX-3 type VII secretion system. AspS and Pks13 represent novel targets in protein translation and cell-wall biosynthesis. Both MmpL3 and EccB3 are involved in membrane transport. Pks13, AspS, and EccB3 represent novel candidates not targeted by existing TB drugs, and the availability of whole-cell active inhibitors greatly increases their potential for drug discovery. PMID:24086479

  4. Evolution of amoxicillin resistance of Helicobacter pylori in vitro: characterization of resistance mechanisms.

    PubMed

    Qureshi, Nadia N; Gallaher, Brandon; Schiller, Neal L

    2014-12-01

    Helicobacter pylori is the major cause of peptic ulcers and gastric cancer in humans. Treatment involves a two or three drug cocktail, typically including amoxicillin. Increasing levels of resistance to amoxicillin contribute to treatment failures, and higher levels of resistance are believed to be due to multiple genetic mutations. In this study, we examined the progression of spontaneous genetic mutations that contribute to amoxicillin resistance in H. pylori when exposed to increasing concentrations of amoxicillin in vitro. During the selection process, we isolated five strains each of which had progressively higher levels of resistance. Using a whole genome sequencing approach, we identified mutations in a number of genes, notably pbp1, pbp2, hefC, hopC, and hofH, and by sequencing these genes in each isolate we were able to map the order and gradual accumulation of mutations in these isolates. These five isolates, each expressing multiple mutated genes and four transformed strains expressing individually mutated pbp1, hefC, or hofH, were characterized using minimum inhibitory concentrations, amoxicillin uptake, and efflux studies. Our results indicate that mutations in pbp1, hefC, hopC, hofH, and possibly pbp2 contribute to H. pylori high-level amoxicillin resistance. The data also provide evidence for the complexity of the evolution of amoxicillin resistance in H. pylori and indicate that certain families of genes might be more susceptible to amoxicillin resistance mutations than others. PMID:24901497

  5. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  6. Mechanisms of resistance to DDT and pyrethroids in Patagonian populations of Simulium blackflies.

    PubMed

    Montagna, C M; Anguiano, O L; Gauna, L E; Pechen de d-Angelo, A M

    2003-03-01

    Mixed populations of the pest blackflies Simulium bonaerense Coscarón & Wygodzinsky, S. wolffhuegeli (Enderlein) and S. nigristrigatum Wygodzinsky & Coscarón (Diptera: Simuliidae) are highly resistant to DDT and pyrethroids in the Neuquén Valley, a fruit-growing area of northern Patagonia, Argentina. As these insecticides have not been used for blackfly control, resistance is attributed to exposure to agricultural insecticides. Pre-treatment with the synergist piperonyl butoxide (PBO) reduced both DDT and fenvalerate resistance, indicating that resistance was partly due to monooxygenase inhibition. Pre-treatment with the synergist tribufos to inhibit esterases slightly increased fenvalerate toxicity in the resistant population. Even so, biochemical studies indicated almost three-fold higher esterase activity in the resistant population, compared to the susceptible. Starch gel electrophoresis confirmed higher frequency and staining intensity of esterase electromorphs in the resistant population. Incomplete synergism against metabolic resistance indicates additional involvement of a non-metabolic resistance mechanism, such as target site insensitivity, assumed to be kdr-like in this case. Glutathione S-transferase activities were low and inconsistent, indicating no role in Simulium resistance. Knowing these spectra of insecticide activity and resistance mechanisms facilitates the choice of more effective products for Simulium control and permits better coordination with agrochemical operations.

  7. Cisplatin Resistant Spheroids Model Clinically Relevant Survival Mechanisms in Ovarian Tumors

    PubMed Central

    Miller, Daniel H.; Medina, Jamie E.; Hamilton, Joshua W.; Messerli, Mark A.; Brodsky, Alexander S.

    2016-01-01

    The majority of ovarian tumors eventually recur in a drug resistant form. Using cisplatin sensitive and resistant cell lines assembled into 3D spheroids we profiled gene expression and identified candidate mechanisms and biological pathways associated with cisplatin resistance. OVCAR-8 human ovarian carcinoma cells were exposed to sub-lethal concentrations of cisplatin to create a matched cisplatin-resistant cell line, OVCAR-8R. Genome-wide gene expression profiling of sensitive and resistant ovarian cancer spheroids identified 3,331 significantly differentially expressed probesets coding for 3,139 distinct protein-coding genes (Fc >2, FDR < 0.05) (S2 Table). Despite significant expression changes in some transporters including MDR1, cisplatin resistance was not associated with differences in intracellular cisplatin concentration. Cisplatin resistant cells were significantly enriched for a mesenchymal gene expression signature. OVCAR-8R resistance derived gene sets were significantly more biased to patients with shorter survival. From the most differentially expressed genes, we derived a 17-gene expression signature that identifies ovarian cancer patients with shorter overall survival in three independent datasets. We propose that the use of cisplatin resistant cell lines in 3D spheroid models is a viable approach to gain insight into resistance mechanisms relevant to ovarian tumors in patients. Our data support the emerging concept that ovarian cancers can acquire drug resistance through an epithelial-to-mesenchymal transition. PMID:26986722

  8. Acid-Responsive Therapeutic Polymer for Prolonging Nanoparticle Circulation Lifetime and Destroying Drug-Resistant Tumors.

    PubMed

    Piao, Ji-Gang; Gao, Feng; Yang, Lihua

    2016-01-13

    How to destroy drug-resistant tumor cells remains an ongoing challenge for cancer treatment. We herein report on a therapeutic nanoparticle, aHLP-PDA, which has an acid-activated hemolytic polymer (aHLP) grafted onto photothermal polydopamine (PDA) nanosphere via boronate ester bond, in efforts to ablate drug-resistant tumors. Upon exposure to oxidative stress and/or near-infrared laser irradiation, aHLP-PDA nanoparticle responsively releases aHLP, likely via responsive cleavage of boronate ester bond, and thus responsively exhibits acid-facilitated mammalian-membrane-disruptive activity. In vitro cell studies with drug-resistant and/or thermo-tolerant cancer cells show that the aHLP-PDA nanoparticle demonstrates preferential cytotoxicity at acidic pH over physiological pH. When administered intravenously, the aHLP-PDA nanoparticle exhibits significantly prolonged blood circulation lifetime and enhanced tumor uptake compared to bare PDA nanosphere, likely owing to aHLP's stealth effects conferred by its zwitterionic nature at blood pH. As a result, the aHLP-PDA nanoparticle effectively ablates drug-resistant tumors, leading to 100% mouse survival even on the 32nd day after suspension of photothermal treatment, as demonstrated with the mouse model. This work suggests that a combination of nanotechnology with lessons learned in bacterial antibiotic resistance may offer a feasible and effective strategy for treating drug-resistant cancers often found in relapsing patients. PMID:26654626

  9. The High Level of Aluminum Resistance in Signalgrass Is Not Associated with Known Mechanisms of External Aluminum Detoxification in Root Apices1

    PubMed Central

    Wenzl, Peter; Patiño, Gloria M.; Chaves, Alba L.; Mayer, Jorge E.; Rao, Idupulapati M.

    2001-01-01

    Al resistance of signalgrass (Brachiaria decumbens Stapf cv Basilisk), a widely sown tropical forage grass, is outstanding compared with the closely related ruzigrass (Brachiaria ruziziensis Germain and Evrard cv Common) and Al-resistant genotypes of graminaceous crops such as wheat, triticale, and maize. Secretion of organic acids and phosphate by root apices and alkalinization of the apical rhizosphere are commonly believed to be important mechanisms of Al resistance. However, root apices of signalgrass secreted only moderately larger quantities of organic acids than did those of ruzigrass, and efflux from signalgrass apices was three to 30 times smaller than from apices of Al-resistant genotypes of buckwheat, maize, and wheat (all much more sensitive to Al than signalgrass). In the presence, but not absence, of Al, root apices of signalgrass alkalinized the rhizosphere more than did those of ruzigrass. The latter was associated with a shortening of the alkalinizing zone in Al-intoxicated apices of ruzigrass, indicating that differences in alkalinizing power were a consequence, not a cause of, differential Al resistance. These data indicate that the main mechanism of Al resistance in signalgrass does not involve external detoxification of Al. Therefore, highly effective resistance mechanisms based on different physiological strategies appear to operate in this species. PMID:11244126

  10. Observations on high levels of fusidic acid resistant Staphylococcus aureus in Harrogate, North Yorkshire, UK.

    PubMed

    Ravenscroft, J C; Layton, A; Barnham, M

    2000-06-01

    A retrospective study was carried out to investigate possible reasons for a marked increase in fusidic acid-resistant Staphylococcus aureus (FusR S. aureus) identified by our routine hospital microbiology service. Information was obtained on a sample of 64 consecutive patients from whom resistant S. aureus had been cultured. The source of isolates was found to be diffuse within the hospital and community. The site of sample was most frequently chronic cutaneous infections (68%). All the S. aureus isolates were resistant to both fusidic acid and penicillin and many were resistant to multiple antibiotics. Topical fusidic acid had been used by 40% of patients in the preceding 6 months and none had received oral fusidic acid (sodium fusidate). Most (80%) had received an oral antibiotic in the preceding 2 years. Information from the Prescriptions Pricing Authority revealed that the total number of prescriptions for fusidic acid-containing preparations for the period September 1997 to August 1998 was markedly higher in Harrogate than in five other local areas where increases in (FusR) S. aureus have not been observed.

  11. Mechanisms of 5-aminolevulic acid ester uptake in mammalian cells

    PubMed Central

    Rodriguez, Lorena; Batlle, Alcira; Di Venosa, Gabriela; Battah, Sinan; Dobbin, Paul; MacRobert, Alexander J; Casas, Adriana

    2006-01-01

    The porphyrin precursor 5-aminolevulinic acid (ALA) is being widely used in photodynamic therapy of cancer. Improvement in ALA delivery has been sought through the use of ALA derivatives, in particular the esterification of ALA with aliphatic alcohols, which in certain cases can improve cellular penetration and selectivity. ALA uptake systems appear to be distinctive for each cell type. The LM3 mammary adenocarcinoma cell line takes ALA up by BETA transporters. In this work, we investigated ALA derivative transport systems through the inhibition of radiolabelled ALA uptake in the LM3 cells. We also performed inhibition studies of γ-aminobutyric acid (GABA) uptake. The more lipohilic ALA derivatives hexyl-ALA and undecanoyl-ALA inhibit ALA uptake, whereas methyl-ALA, R, S-ALA-2-(hydroxymethyl)tetrahydropyranyl ester and the dendron aminomethane tris methyl 5-ALA does not inhibit ALA uptake. A similar pattern was found for GABA, except that the dendron inhibited GABA uptake. However, hexyl-ALA and undecanoyl-ALA are not taken up by BETA transporters, but by simple diffusion, although they still inhibit ALA uptake by binding to the cell membrane. These results show that different modifications to the ALA molecule lead to different uptake mechanisms. Whereas ALA is taken up by BETA transporters, none of the ALA derivatives shares the same mechanism. Knowledge of the mechanisms of ALA derivatives entry into the cells is essential to understand and improve ALA-mediated PDT and to the design of new ALA derivatives that may be taken up at a higher rate than ALA. PMID:16432502

  12. Fatty acid composition analyses of the DCMU resistant mutants of Nannochloropsis oculata (eustigmatophyceae)

    NASA Astrophysics Data System (ADS)

    Jimin, Zhang; Shuang, Liu; Xue, Sun; Guanpin, Yang; Xuecheng, Zhang; Zhenhui, Gao

    2003-04-01

    Ultraviolet mutagenesis was applied to Nannochloropsis oculata and three mutants resistant to 3-(3, 4-dichlorophenyl)-1,1-dimethylurea (DCMU) were isolated. The cellular chlorophyll a and total lipid content of the wild are higher in the medium supplemented with DCMU than in the control without DCMU. Without DCMU, the growth rates and chlorophyll a contents of the mutants are similar to those of the wild. Significant changes of fatty acid content and composition have occurred in DCMU-resistant mutants growing in the medium supplemented with DCMU. The total lipid, palmitic acid (16:0), palmitoleic acid (16:1ω9) and oleic (18:1ω9) contents decrease significantly, while the vaccenic acid (18:1ω11) increases significantly and the EPA content of dried powder increases slightly in the mutants. The study may provide a basis to improve EPA content in Nannochloropsis oculata in the future.

  13. Electrochemical and Mechanical Behavior of Lead-Silver and Lead-Bismuth Casting Alloys for Lead-Acid Battery Components

    NASA Astrophysics Data System (ADS)

    Osório, Wislei R.; Peixoto, Leandro C.; Garcia, Amauri

    2015-09-01

    The present study focuses on the interrelation of microstructure, mechanical properties, and corrosion resistance of Pb-Ag and Pb-Bi casting alloys, which can be used in the manufacture of lead-acid battery components, as potential alternatives to alloys currently used. A water-cooled solidification system is used, in which vertical upward directional solidification is promoted permitting a wide range of microstructures to be investigated. Correlations between microstructural arrays, tensile strengths, and corrosion resistances of Pb-1 wt pct Ag, Pb-2.5 wt pct Ag, Pb-1 wt pct Bi, and Pb-2.5 wt pct Bi alloys are envisaged. It is shown that a compromise between corrosion resistance (represented by the corrosion current density) and mechanical properties (represented by the ultimate tensile strength) can be obtained. Comparisons between specific strengths and mechanical/corrosion ratios are also made. It is also shown that, for microstructures solidified under cooling rates higher than 10 K/s, the Pb-Ag alloys exhibit higher specific strength and mechanical/corrosion ratio. In contrast, for casting processes in which the cooling rates are lower than 5 K/s, the dilute Pb-Bi alloy ( i.e., 1 wt pct Bi) is shown to have more appropriate requirements for lead-acid battery components. Comparisons between specific strengths, mechanical/corrosion ratio, and relative weight and cost with Pb-Sn and Pb-Sb alloys are also made.

  14. Long-Term Control of Human Immunodeficiency Virus-1 Replication Despite Extensive Resistance to Current Antiretroviral Regimens: Clonal Analysis of Resistance Mutations in Proviral Deoxyribonucleic Acid

    PubMed Central

    Stella-Ascariz, Natalia; Montejano, Rocio; Martin-Vicente, María; Mingorance, Jesús; Pérez-Valero, Ignacio; Bernardino, José I.; Arribas, Jose R.

    2016-01-01

    Archived resistance mutations compromise antiretroviral treatment. We have investigated 3 selected aviremic patients who had extensive historical resistance to their current regimen. All 3 patients underwent unstructured treatment interruptions associated to the re-emergence of wild-type virus before starting their current suppressive regimes. Almost all historical resistance mutations detected in plasma were found in circulating proviral deoxyribonucleic acid. None of the clones analyzed was fully resistant to the current antiretroviral regimen. PMID:27006965

  15. Thiamethoxam Resistance in the House Fly, Musca domestica L.: Current Status, Resistance Selection, Cross-Resistance Potential and Possible Biochemical Mechanisms

    PubMed Central

    Khan, Hafiz Azhar Ali; Akram, Waseem; Iqbal, Javaid; Naeem-Ullah, Unsar

    2015-01-01

    The house fly, Musca domestica L., is an important ectoparasite with the ability to develop resistance to insecticides used for their control. Thiamethoxam, a neonicotinoid, is a relatively new insecticide and effectively used against house flies with a few reports of resistance around the globe. To understand the status of resistance to thiamethoxam, eight adult house fly strains were evaluated under laboratory conditions. In addition, to assess the risks of resistance development, cross-resistance potential and possible biochemical mechanisms, a field strain of house flies was selected with thiamethoxam in the laboratory. The results revealed that the field strains showed varying level of resistance to thiamethoxam with resistance ratios (RR) at LC50 ranged from 7.66-20.13 folds. Continuous selection of the field strain (Thia-SEL) for five generations increased the RR from initial 7.66 fold to 33.59 fold. However, resistance declined significantly when the Thia-SEL strain reared for the next five generations without exposure to thiamethoxam. Compared to the laboratory susceptible reference strain (Lab-susceptible), the Thia-SEL strain showed cross-resistance to imidacloprid. Synergism tests revealed that S,S,S-tributylphosphorotrithioate (DEF) and piperonyl butoxide (PBO) produced synergism of thiamethoxam effects in the Thia-SEL strain (2.94 and 5.00 fold, respectively). In addition, biochemical analyses revealed that the activities of carboxylesterase (CarE) and mixed function oxidase (MFO) in the Thia-SEL strain were significantly higher than the Lab-susceptible strain. It seems that metabolic detoxification by CarE and MFO was a major mechanism for thiamethoxam resistance in the Thia-SEL strain of house flies. The results could be helpful in the future to develop an improved control strategy against house flies. PMID:25938578

  16. Thiamethoxam Resistance in the House Fly, Musca domestica L.: Current Status, Resistance Selection, Cross-Resistance Potential and Possible Biochemical Mechanisms.

    PubMed

    Khan, Hafiz Azhar Ali; Akram, Waseem; Iqbal, Javaid; Naeem-Ullah, Unsar

    2015-01-01

    The house fly, Musca domestica L., is an important ectoparasite with the ability to develop resistance to insecticides used for their control. Thiamethoxam, a neonicotinoid, is a relatively new insecticide and effectively used against house flies with a few reports of resistance around the globe. To understand the status of resistance to thiamethoxam, eight adult house fly strains were evaluated under laboratory conditions. In addition, to assess the risks of resistance development, cross-resistance potential and possible biochemical mechanisms, a field strain of house flies was selected with thiamethoxam in the laboratory. The results revealed that the field strains showed varying level of resistance to thiamethoxam with resistance ratios (RR) at LC50 ranged from 7.66-20.13 folds. Continuous selection of the field strain (Thia-SEL) for five generations increased the RR from initial 7.66 fold to 33.59 fold. However, resistance declined significantly when the Thia-SEL strain reared for the next five generations without exposure to thiamethoxam. Compared to the laboratory susceptible reference strain (Lab-susceptible), the Thia-SEL strain showed cross-resistance to imidacloprid. Synergism tests revealed that S,S,S-tributylphosphorotrithioate (DEF) and piperonyl butoxide (PBO) produced synergism of thiamethoxam effects in the Thia-SEL strain (2.94 and 5.00 fold, respectively). In addition, biochemical analyses revealed that the activities of carboxylesterase (CarE) and mixed function oxidase (MFO) in the Thia-SEL strain were significantly higher than the Lab-susceptible strain. It seems that metabolic detoxification by CarE and MFO was a major mechanism for thiamethoxam resistance in the Thia-SEL strain of house flies. The results could be helpful in the future to develop an improved control strategy against house flies.

  17. Polyacrylic acid-coated iron oxide nanoparticles for targeting drug resistance in mycobacteria.

    PubMed

    Padwal, Priyanka; Bandyopadhyaya, Rajdip; Mehra, Sarika

    2014-12-23

    The emergence of drug resistance is a major problem faced in current tuberculosis (TB) therapy, representing a global health concern. Mycobacterium is naturally resistant to most drugs due to export of the latter outside bacterial cells by active efflux pumps, resulting in a low intracellular drug concentration. Thus, development of agents that can enhance the effectiveness of drugs used in TB treatment and bypass the efflux mechanism is crucial. In this study, we present a new nanoparticle-based strategy for enhancing the efficacy of existing drugs. To that end, we have developed poly(acrylic acid) (PAA)-coated iron oxide (magnetite) nanoparticles (PAA-MNPs) as efflux inhibitors and used it together with rifampicin (a first line anti-TB drug) on Mycobacterium smegmatis. PAA-MNPs of mean diameter 9 nm interact with bacterial cells via surface attachment and are then internalized by cells. Although PAA-MNP alone does not inhibit cell growth, treatment of cells with a combination of PAA-MNP and rifampicin exhibits a synergistic 4-fold-higher growth inhibition compared to rifampicin alone. This is because the combination of PAA-MNP and rifampicin results in up to a 3-fold-increased accumulation of rifampicin inside the cells. This enhanced intracellular drug concentration has been explained by real-time transport studies on a common efflux pump substrate, ethidium bromide (EtBr). It is seen that PAA-MNP increases the accumulation of EtBr significantly and also minimizes the EtBr efflux in direct proportion to the PAA-MNP concentration. Our results thus illustrate that the addition of PAA-MNP with rifampicin may bypass the innate drug resistance mechanism of M. smegmatis. This generic strategy is also found to be successful for other anti-TB drugs, such as isoniazid and fluoroquinolones (e.g., norfloxacin), only when stabilized, coated nanoparticles (such as PAA-MNP) are used, not PAA or MNP alone. We hence establish coated nanoparticles as a new class of efflux

  18. Resistance to sunitinib in renal cell carcinoma: From molecular mechanisms to predictive markers and future perspectives.

    PubMed

    Joosten, S C; Hamming, L; Soetekouw, P M; Aarts, M J; Veeck, J; van Engeland, M; Tjan-Heijnen, V C

    2015-01-01

    The introduction of agents that inhibit tumor angiogenesis by targeting vascular endothelial growth factor (VEGF) signaling has made a significant impact on the survival of patients with metastasized renal cell carcinoma (RCC). Sunitinib, a tyrosine kinase inhibitor of the VEGF receptor, has become the mainstay of treatment for these patients. Although treatment with sunitinib substantially improved patient outcome, the initial success is overshadowed by the occurrence of resistance. The mechanisms of resistance are poorly understood. Insight into the molecular mechanisms of resistance will help to better understand the biology of RCC and can ultimately aid the development of more effective therapies for patients with this infaust disease. In this review we comprehensively discuss molecular mechanisms of resistance to sunitinib and the involved biological processes, summarize potential biomarkers that predict response and resistance to treatment with sunitinib, and elaborate on future perspectives in the treatment of metastasized RCC. PMID:25446042

  19. Integrated Metabolo-Proteomic Approach to Decipher the Mechanisms by Which Wheat QTL (Fhb1) Contributes to Resistance against Fusarium graminearum

    PubMed Central

    Gunnaiah, Raghavendra; Kushalappa, Ajjamada C.; Duggavathi, Raj; Fox, Stephen; Somers, Daryl J.

    2012-01-01

    Background Resistance in plants to pathogen attack can be qualitative or quantitative. For the latter, hundreds of quantitative trait loci (QTLs) have been identified, but the mechanisms of resistance are largely unknown. Integrated non-target metabolomics and proteomics, using high resolution hybrid mass spectrometry, were applied to identify the mechanisms of resistance governed by the fusarium head blight resistance locus, Fhb1, in the near isogenic lines derived from wheat genotype Nyubai. Findings The metabolomic and proteomic profiles were compared between the near isogenic lines (NIL) with resistant and susceptible alleles of Fhb1 upon F. graminearum or mock-inoculation. The resistance-related metabolites and proteins identified were mapped to metabolic pathways. Metabolites of the shunt phenylpropanoid pathway such as hydroxycinnamic acid amides, phenolic glucosides and flavonoids were induced only in the resistant NIL, or induced at higher abundances in resistant than in susceptible NIL, following pathogen inoculation. The identities of these metabolites were confirmed, with fragmentation patterns, using the high resolution LC-LTQ-Orbitrap. Concurrently, the enzymes of phenylpropanoid biosynthesis such as cinnamyl alcohol dehydrogenase, caffeoyl-CoA O-methyltransferase, caffeic acid O-methyltransferase, flavonoid O-methyltransferase, agmatine coumaroyltransferase and peroxidase were also up-regulated. Increased cell wall thickening due to deposition of hydroxycinnamic acid amides and flavonoids was confirmed by histo-chemical localization of the metabolites using confocal microscopy. Conclusion The present study demonstrates that the resistance in Fhb1 derived from the wheat genotype Nyubai is mainly associated with cell wall thickening due to deposition of hydroxycinnamic acid amides, phenolic glucosides and flavonoids, but not with the conversion of deoxynivalenol to less toxic deoxynivalenol 3-O-glucoside. PMID:22866179

  20. Effect of chlorine purification on oxidation resistance of some mechanical carbons

    NASA Technical Reports Server (NTRS)

    Wisander, D. W.; Allen, G. P.

    1974-01-01

    Oxidation experiments were conducted with some experimental and commercial mechanical carbons at 650 C in dry air flowing at 28 cc/sec (STP). In general, purification of these carbon-graphites with chlorine at 2800 C improved oxidation resistance. Additional improvements in oxidation resistance were obtained from purification followed by an antioxidant (zinc phosphate) treatment. For the commercial materials, purification alone gave greater oxidation resistance than the antioxidant treatment alone. The reverse, however, was the case for the experimental materials.

  1. Systematic investigation of the synthesis, characterization and switching mechanism of metal oxide nanoparticle resists

    NASA Astrophysics Data System (ADS)

    Siauw, Meiliana; Du, Ke; Valade, David; Trefonas, Peter; Thackeray, James W.; Whittaker, Andrew; Blakey, Idriss

    2016-03-01

    Metal oxide nanoparticle resists have recently emerged as next generation photoresist materials which exhibit promising performance for extreme ultraviolet lithography. In this present work, we are able to show our ability to synthesize and well characterize small uniform metal oxide nanoparticles, to present stability study of the nanoparticles in the resist solvent over time, to pattern ~20 nm features by electron beam lithography, and to provide an insight into the insolubilization mechanism of the resist system.

  2. The Helicobacter pylori homologue of the ferric uptake regulator is involved in acid resistance.

    PubMed

    Bijlsma, Jetta J E; Waidner, Barbara; Vliet, Arnoud H M van; Hughes, Nicky J; Häg, Stephanie; Bereswill, Stefan; Kelly, David J; Vandenbroucke-Grauls, Christina M J E; Kist, Manfred; Kusters, Johannes G

    2002-02-01

    The only known niche of the human pathogen Helicobacter pylori is the gastric mucosa, where large fluctuations of pH occur, indicating that the bacterial response and resistance to acid are important for successful colonization. One of the few regulatory proteins in the H. pylori genome is a homologue of the ferric uptake regulator (Fur). In most bacteria, the main function of Fur is the regulation of iron homeostasis. However, in Salmonella enterica serovar Typhimurium, Fur also plays an important role in acid resistance. In this study, we determined the role of the H. pylori Fur homologue in acid resistance. Isogenic fur mutants were generated in three H. pylori strains (1061, 26695, and NCTC 11638). At pH 7 there was no difference between the growth rates of mutants and the parent strains. Under acidic conditions, growth of the fur mutants was severely impaired. No differences were observed between the survival of the fur mutant and parent strain 1061 after acid shock. Addition of extra iron or removal of iron from the growth medium did not improve the growth of the fur mutant at acidic pH. This indicates that the phenotype of the fur mutant at low pH was not due to increased iron sensitivity. Transcription of fur was repressed in response to low pH. From this we conclude that Fur is involved in the growth at acidic pH of H. pylori; as such, it is the first regulatory protein implicated in the acid resistance of this important human pathogen. PMID:11796589

  3. Activation of the Glutamic Acid-Dependent Acid Resistance System in Escherichia coli BL21(DE3) Leads to Increase of the Fatty Acid Biotransformation Activity

    PubMed Central

    Woo, Ji-Min; Kim, Ji-Won; Song, Ji-Won; Blank, Lars M.; Park, Jin-Byung

    2016-01-01

    The biosynthesis of carboxylic acids including fatty acids from biomass is central in envisaged biorefinery concepts. The productivities are often, however, low due to product toxicity that hamper whole-cell biocatalyst performance. Here, we have investigated factors that influence the tolerance of Escherichia coli to medium chain carboxylic acid (i.e., n-heptanoic acid)-induced stress. The metabolic and genomic responses of E. coli BL21(DE3) and MG1655 grown in the presence of n-heptanoic acid indicated that the GadA/B-based glutamic acid-dependent acid resistance (GDAR) system might be critical for cellular tolerance. The GDAR system, which is responsible for scavenging intracellular protons by catalyzing decarboxylation of glutamic acid, was inactive in E. coli BL21(DE3). Activation of the GDAR system in this strain by overexpressing the rcsB and dsrA genes, of which the gene products are involved in the activation of GadE and RpoS, respectively, resulted in acid tolerance not only to HCl but also to n-heptanoic acid. Furthermore, activation of the GDAR system allowed the recombinant E. coli BL21(DE3) expressing the alcohol dehydrogenase of Micrococcus luteus and the Baeyer-Villiger monooxygenase of Pseudomonas putida to reach 60% greater product concentration in the biotransformation of ricinoleic acid (i.e., 12-hydroxyoctadec-9-enoic acid (1)) into n-heptanoic acid (5) and 11-hydroxyundec-9-enoic acid (4). This study may contribute to engineering E. coli-based biocatalysts for the production of carboxylic acids from renewable biomass. PMID:27681369

  4. Impact of the rpoS genotype for acid resistance patterns of pathogenic and probiotic Escherichia coli

    PubMed Central

    Coldewey, Sina M; Hartmann, Maike; Schmidt, Dorothea S; Engelking, Uta; Ukena, Sya N; Gunzer, Florian

    2007-01-01

    Background Enterohemorrhagic E. coli (EHEC), a subgroup of Shiga toxin (Stx) producing E. coli (STEC), may cause severe enteritis and hemolytic uremic syndrome (HUS) and is transmitted orally via contaminated foods or from person to person. The infectious dose is known to be very low, which requires most of the bacteria to survive the gastric acid barrier. Acid resistance therefore is an important mechanism of EHEC virulence. It should also be a relevant characteristic of E. coli strains used for therapeutic purposes such as the probiotic E. coli Nissle 1917 (EcN). In E. coli and related enteric bacteria it has been extensively demonstrated, that the alternative sigma factor σS, encoded by the rpoS gene, acts as a master regulator mediating resistance to various environmental stress factors. Methods Using rpoS deletion mutants of a highly virulent EHEC O26:H11 patient isolate and the sequenced prototype EHEC EDL933 (ATCC 700927) of serotype O157:H7 we investigated the impact of a functional rpoS gene for orchestrating a satisfactory response to acid stress in these strains. We then functionally characterized rpoS of probiotic EcN and five rpoS genes selected from STEC isolates pre-investigated for acid resistance. Results First, we found out that ATCC isolate 700927 of EHEC EDL933 has a point mutation in rpoS, not present in the published sequence, leading to a premature stop codon. Moreover, to our surprise, one STEC strain as well as EcN was acid sensitive in our test environment, although their cloned rpoS genes could effectively complement acid sensitivity of an rpoS deletion mutant. Conclusion The attenuation of sequenced EHEC EDL933 might be of importance for anyone planning to do either in vitro or in vivo studies with this prototype strain. Furthermore our data supports recently published observations, that individual E. coli isolates are able to significantly modulate their acid resistance phenotype independent of their rpoS genotype. PMID:17386106

  5. Mechanisms of action of systemic antibiotics used in periodontal treatment and mechanisms of bacterial resistance to these drugs

    PubMed Central

    SOARES, Geisla Mary Silva; FIGUEIREDO, Luciene Cristina; FAVERI, Marcelo; CORTELLI, Sheila Cavalca; DUARTE, Poliana Mendes; FERES, Magda

    2012-01-01

    Antibiotics are important adjuncts in the treatment of infectious diseases, including periodontitis. The most severe criticisms to the indiscriminate use of these drugs are their side effects and, especially, the development of bacterial resistance. The knowledge of the biological mechanisms involved with the antibiotic usage would help the medical and dental communities to overcome these two problems. Therefore, the aim of this manuscript was to review the mechanisms of action of the antibiotics most commonly used in the periodontal treatment (i.e. penicillin, tetracycline, macrolide and metronidazole) and the main mechanisms of bacterial resistance to these drugs. Antimicrobial resistance can be classified into three groups: intrinsic, mutational and acquired. Penicillin, tetracycline and erythromycin are broad-spectrum drugs, effective against gram-positive and gram-negative microorganisms. Bacterial resistance to penicillin may occur due to diminished permeability of the bacterial cell to the antibiotic; alteration of the penicillin-binding proteins, or production of β-lactamases. However, a very small proportion of the subgingival microbiota is resistant to penicillins. Bacteria become resistant to tetracyclines or macrolides by limiting their access to the cell, by altering the ribosome in order to prevent effective binding of the drug, or by producing tetracycline/macrolide-inactivating enzymes. Periodontal pathogens may become resistant to these drugs. Finally, metronidazole can be considered a prodrug in the sense that it requires metabolic activation by strict anaerobe microorganisms. Acquired resistance to this drug has rarely been reported. Due to these low rates of resistance and to its high activity against the gram-negative anaerobic bacterial species, metronidazole is a promising drug for treating periodontal infections. PMID:22858695

  6. Chronic Myeloid Leukemia – Mechanisms of Resistance and Treatment

    PubMed Central

    Jabbour, Elias; Parikh, Sameer A.; Kantarjian, Hagop; Cortes, Jorge

    2015-01-01

    Imatinib mesylate has revolutionized the treatment landscape for patients with newly diagnosed chronic myeloid leukemia (CML). Imatinib at a dose of 400 mg/day is considered the standard treatment for all newly diagnosed chronic phase CML. Follow-up on the pivotal International Randomized Study of Interfreron versus STI571 (IRIS) study has shown excellent response rates, progression-free survival and overall survival after 8 years of follow-up. However, some patients will develop resistance to imatinib treatment due to a multitude of reasons. Numerous strategies to overcome resistance are available including dose escalation of imatinib, switching to a second generation tyrosine kinase inhibitor or to one of the newer non-tyrosine kinase inhibitors. This review guides the treating physician with a rational approach in the management of CML patients who fail initial treatment with imatinib or lose response while on therapy with imatinib. PMID:22054730

  7. Effectiveness of Antipseudomonal Antibiotics and Mechanisms of Multidrug Resistance in Pseudomonas aeruginosa.

    PubMed

    El ZOWALATYl, Mohamed E; Gyetvaii, Bpla

    2016-01-01

    Pseudomonas aeruginosa is a leading human pathogen that causes serious infections at various tissues and organs leading to life threatening health problems and possible deadly outcomes. Resistance patterns vary widely whether it is from hospitals or community acquired infections. Reporting resistance profiles to a certain antibiotics provide valuable information in a given setting, but may be extrapolated outside the sampling location. In the present study, P. aeruginosa isolates were screened to determine their susceptibilities against anti-pseudomonal antimicrobial agents and possible existing mechanisms of resistance were determined. Eighty-six isolates of P. aeruginosa were recovered. Isolates representing different resistance profiles were screened for the existence of three different resistance mechanisms including drug inactivation due to metallo-β-lactamases, drug impermeability by outer membrane proteins and drug efflux. All tested isolates showed uniform susceptibility (100%, n = 86/86) to piperacillin, meropenem, amikacin, and polymyxin B. A single isolate was found to be imipenem resistant (99%, n = 85/86). The possible mechanisms of resistance of P. aeruginosa to imipenem involve active drug efflux pumps, outer membrane impermeability as well as drug inactivating enzymes. These findings demonstrate the fundamental importance of the in vitro susceptibility testing of antibiotics prior to antipseudomonal therapy and highlight the need for a continuous antimicrobial resistance surveillance programs to monitor the changing resistance patterns so that clinicians and health care officials are updated as to the most effective therapeutic agents to combat the serious outcomes of P. aeruginosa infections.

  8. Effect of citric acid irrigation on the fracture resistance of endodontically treated roots

    PubMed Central

    Arslan, Hakan; Barutcigil, Cagatay; Karatas, Ertugrul; Topcuoglu, Huseyin Sinan; Yeter, Kubra Yesildal; Ersoy, Ibrahim; Ayrancı, Leyla Benan

    2014-01-01

    Objective: The aim of this study was to evaluate the effect of citric acid irrigation on root fracture in different concentrations and at various time exposures on root fracture. Materials and Methods: Forty-eight human mandibular incisors with similar dimensions were selected. The specimens were decoronated, then divided into 6 groups as follows: A group without instrumentation and filling (G1) and the 5 other groups with can