Science.gov

Sample records for acid resistance mechanisms

  1. Mechanisms of acid resistance in enterohemorrhagic Escherichia coli.

    PubMed Central

    Lin, J; Smith, M P; Chapin, K C; Baik, H S; Bennett, G N; Foster, J W

    1996-01-01

    Enterohemorrhagic strains of Escherichia coli must pass through the acidic gastric barrier to cause gastrointestinal disease. Taking into account the apparent low infectious dose of enterohemorrhagic E. coli, 11 O157:H7 strains and 4 commensal strains of E. coli were tested for their abilities to survive extreme acid exposures (pH 3). Three previously characterized acid resistance systems were tested. These included an acid-induced oxidative system, an acid-induced arginine-dependent system, and a glutamate-dependent system. When challenged at pH 2.0, the arginine-dependent system provided more protection in the EHEC strains than in commensal strains. However, the glutamate-dependent system provided better protection than the arginine system and appeared equally effective in all strains. Because E. coli must also endure acid stress imposed by the presence of weak acids in intestinal contents at a pH less acidic than that of the stomach, the ability of specific acid resistance systems to protect against weak acids was examined. The arginine- and glutamate-dependent systems were both effective in protecting E. coli against the bactericidal effects of a variety of weak acids. The acids tested include benzoic acid (20 mM; pH 4.0) and a volatile fatty acid cocktail composed of acetic, propionic, and butyric acids at levels approximating those present in the intestine. The oxidative system was much less effective. Several genetic aspects of E. coli acid resistance were also characterized. The alternate sigma factor RpoS was shown to be required for oxidative acid resistance but was only partially involved with the arginine- and glutamate-dependent acid resistance systems. The arginine decarboxylase system (including adi and its regulators cysB and adiY) was responsible for arginine-dependent acid resistance. The results suggest that several acid resistance systems potentially contribute to the survival of pathogenic E. coli in the different acid stress environments of

  2. Overview on mechanisms of acetic acid resistance in acetic acid bacteria.

    PubMed

    Wang, Bin; Shao, Yanchun; Chen, Fusheng

    2015-02-01

    Acetic acid bacteria (AAB) are a group of gram-negative or gram-variable bacteria which possess an obligate aerobic property with oxygen as the terminal electron acceptor, meanwhile transform ethanol and sugar to corresponding aldehydes, ketones and organic acids. Since the first genus Acetobacter of AAB was established in 1898, 16 AAB genera have been recorded so far. As the main producer of a world-wide condiment, vinegar, AAB have evolved an elegant adaptive system that enables them to survive and produce a high concentration of acetic acid. Some researches and reviews focused on mechanisms of acid resistance in enteric bacteria and made the mechanisms thoroughly understood, while a few investigations did in AAB. As the related technologies with proteome, transcriptome and genome were rapidly developed and applied to AAB research, some plausible mechanisms conferring acetic acid resistance in some AAB strains have been published. In this review, the related mechanisms of AAB against acetic acid with acetic acid assimilation, transportation systems, cell morphology and membrane compositions, adaptation response, and fermentation conditions will be described. Finally, a framework for future research for anti-acid AAB will be provided. PMID:25575804

  3. A target-protection mechanism of antibiotic resistance at atomic resolution: insights into FusB-type fusidic acid resistance

    PubMed Central

    Tomlinson, Jennifer H.; Thompson, Gary S.; Kalverda, Arnout P.; Zhuravleva, Anastasia; O’Neill, Alex J.

    2016-01-01

    Antibiotic resistance in clinically important bacteria can be mediated by proteins that physically associate with the drug target and act to protect it from the inhibitory effects of an antibiotic. We present here the first detailed structural characterization of such a target protection mechanism mediated through a protein-protein interaction, revealing the architecture of the complex formed between the FusB fusidic acid resistance protein and the drug target (EF-G) it acts to protect. Binding of FusB to EF-G induces conformational and dynamic changes in the latter, shedding light on the molecular mechanism of fusidic acid resistance. PMID:26781961

  4. Plant resistance mechanisms to air pollutants: rhythms in ascorbic acid production during growth under ozone stress

    SciTech Connect

    Lee, E.H. )

    1991-01-01

    Relationships between ozone (O3) tolerance and leaf ascorbic acid concentrations in O3-susceptible (O3-S) 'Hark' and O3-resistant (O3-R) 'Hood' soybean, Glycine max (L.) Merr., cultivars were examined with high-performance liquid chromatography (HPLC). Leaf samples were analyzed at 4 intervals during a 24 h period. Soybean cultivars grown in the greenhouse with charcoal filtered (CF) and nonfiltered (NF) air showed daily oscillations in ascorbic acid production. Highest ascorbic acid levels in leaves during light coincided with highest concentrations of photochemical oxidants in the atmosphere at 2:00 p.m. The resistant genotype produced more ascorbic acid in its trifoliate leaves than did the corresponding susceptible genotype. Under CF air (an O3-reduced environment) O3-S and O3-R cultivars showed rhythms in ascorbic acid production. In NF air (an O3 stress environment) the O3-R cultivar alone showed rhythms in ascorbic acid production. Results indicated that superior O3 tolerance in the Hood soybean cultivar (compared with Hark) was associated with a greater increase in endogenous levels of ascorbic acid. Ascorbic acid may scavenge free radicals and thereby protect cells from injury by O3 or other oxyradical products. Plants defend themselves against photochemical oxidant stress, such as O3, by several mechanisms. Experimental evidence indicates that antioxidant defense systems existing in plant tissues may function to protect cellular components from deleterious effects of photochemical oxidants through endogenous and exogenous controls.

  5. The Pleiotropic Antibacterial Mechanisms of Ursolic Acid against Methicillin-Resistant Staphylococcus aureus (MRSA).

    PubMed

    Wang, Chao-Min; Jhan, Yun-Lian; Tsai, Shang-Jie; Chou, Chang-Hung

    2016-01-01

    (1) BACKGROUND: Several triterpenoids were found to act synergistically with classes of antibiotic, indicating that plant-derived chemicals have potential to be used as therapeutics to enhance the activity of antibiotics against multidrug-resistant pathogens. However, the mode of action of triterpenoids against bacterial pathogens remains unclear. The objective of this study is to evaluate the interaction between ursolic acid against methicillin-resistant Staphylococcus aureus (MRSA); (2) METHODS: The ability of ursolic acid to damage mammalian and bacterial membranes was examined. The proteomic response of methicillin-resistant S. aureus in ursolic acid treatment was investigated using two-dimensional (2D) proteomic analysis; (3) RESULTS: Ursolic acid caused the loss of staphylococcal membrane integrity without hemolytic activity. The comparison of the protein pattern of ursolic acid-treated and normal MRSA cells revealed that ursolic acid affected a variety of proteins involved in the translation process with translational accuracy, ribonuclease and chaperon subunits, glycolysis and oxidative responses; (4) CONCLUSION: The mode of action of ursolic acid appears to be the influence on the integrity of the bacterial membrane initially, followed by inhibition of protein synthesis and the metabolic pathway. These findings reflect that the pleiotropic effects of ursolic acid against MRSA make it a promising antibacterial agent in pharmaceutical research. PMID:27399657

  6. Redox control of retinoic acid receptor activity: a novel mechanism for retinoic acid resistance in melanoma cells.

    PubMed

    Demary, K; Wong, L; Liou, J S; Faller, D V; Spanjaard, R A

    2001-06-01

    Retinoic acid (RA) slows growth and induces differentiation of tumor cells through activation of RA receptors (RARs). However, melanoma cell lines display highly variable responsiveness to RA, which is a poorly understood phenomenon. By using Northern and Western blot analyses, we show that RA-resistant A375 and RA-responsive S91 melanoma cells express comparable levels of major components of RAR-signaling pathways. However, A375 cells have substantially higher intracellular reactive oxygen species (ROS) levels than S91 cells. Lowering ROS levels in A375 cells through hypoxic culture conditions restores RAR-dependent trans-activity, which could be further enhanced by addition of the antioxidant N-acetyl-cysteine. Hypoxia also enhances RAR activity in the moderately RA-responsive C32 cells, which have intermediate ROS levels. Conversely, increasing oxidative stress in highly RA-responsive S91 and B16 cells, which have low ROS levels, by treatment with H(2)O(2) impairs RAR activity. Consistent with these observations, RA more potently inhibited the proliferation of hypoxic A375 cells than that of normoxic cells. Oxidative states diminish, whereas reducing conditions enhance, DNA binding of retinoid X receptor/RAR heterodimers in vitro, providing a molecular basis for the observed inverse correlation between RAR activity and ROS levels. The redox state of melanoma cells provides a novel, epigenetic control mechanism of RAR activity and RA resistance. PMID:11356710

  7. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

    PubMed Central

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-01-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains. PMID:26691589

  8. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics.

    PubMed

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-01-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains. PMID:26691589

  9. Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

    NASA Astrophysics Data System (ADS)

    Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

    2015-12-01

    Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.

  10. RCY1, an Arabidopsis thaliana RPP8/HRT family resistance gene, conferring resistance to cucumber mosaic virus requires salicylic acid, ethylene and a novel signal transduction mechanism.

    PubMed

    Takahashi, Hideki; Miller, Jennifer; Nozaki, Yukine; Takeda, Megumi; Shah, Jyoti; Hase, Shu; Ikegami, Masato; Ehara, Yoshio; Dinesh-Kumar, S P

    2002-12-01

    The dominant locus, RCY1, in the Arabidopsis thaliana ecotype C24 confers resistance to the yellow strain of cucumber mosaic virus (CMV-Y). The RCY1 locus was mapped to a 150-kb region on chromosome 5. Sequence comparison of this region from C24 and a CMV-Y-susceptible C24 mutant predicts that the RCY1 gene encodes a 104-kDa CC-NBS-LRR-type protein. The RCY1 gene from C24, when expressed in the susceptible ecotype Wassilewskija (Ws), restricted the systemic spread of virus. RCY1 is allelic to the resistance genes RPP8 from the ecotype Landsberg erecta and HRT from the ecotype Dijon-17, which confer resistance to Peronospora parasitica biotype Emco5 and turnip crinkle virus (TCV), respectively. Examination of RCY1 plants defective in salicylic acid (SA), jasmonic acid (JA) and ethylene signaling revealed a requirement for SA and ethylene signaling in mounting a resistance response to CMV-Y. The RCY1 nahG etr1 double mutants exhibited an intermediate level of susceptibility to CMV-Y, compared to the resistant ecotype C24 and the susceptible ecotypes Columbia and Nossen. This suggests that in addition to SA and ethylene, a novel signaling mechanism is associated with the induction of resistance in CMV-Y-infected C24 plants. Moreover, our results suggest that the signaling pathways downstream of the RPP8, HRT, and RCY1 have evolved independently. PMID:12472683

  11. Acquired Resistance in Barley (The Resistance Mechanism Induced by 2,6-Dichloroisonicotinic Acid Is a Phenocopy of a Genetically Based Mechanism Governing Race-Specific Powdery Mildew Resistance).

    PubMed Central

    Kogel, K. H.; Beckhove, U.; Dreschers, J.; Munch, S.; Romme, Y.

    1994-01-01

    Treatment of susceptible barley (Hordeum vulgare) seedlings with 2,6-dichloroisonicotinic acid (DCINA) induces disease resistance against the powdery mildew fungus (Erysiphe graminis f. sp. hordei). A cytological analysis of the interaction reveals the hypersensitive cell collapse in attacked, short epidermal cells, along with the accumulation of fluorescent material in papillae, that appear at the time of fungal arrest. The cell-type-specific hypersensitive reaction occurs prior to formation of haustoria, reminiscent of the mechanism identified in genetically resistant barley plants containing the functionally active Mlg gene (R. Gorg, K. Hollricher, P. Schulze-Lefert [1993] Plant J 3: 857-866). This observation indicates that the mechanism of DCINA-induced resistance is a phenocopy of the mechanism governed by the Mlg locus. The onset of acquired resistance correlates with high-level transcript accumulation of barley defense-related genes encoding pathogenesis-related protein-1, peroxidase, and chitinase but not [beta]-1,3-glucanase. Subcellular localization of peroxidase activity shows an increase in enzyme activity in the epidermal cell layer and in the intercellular fluids of barley leaves. Four out of more than 10 identified extracellular isozymes are induced by DCINA. The epidermal cell layer contains a major constitutively formed isozyme, together with two isozymes specifically induced by DCINA. The data support the hypothesis that host cell death and high-level accumulation of defense-related gene transcripts are not only commonly controlled in certain types of race-specific resistance (A. Freialdenhoven, B. Scherag, K. Hollricher, D.B. Collinge, H. Thordal-Christensen, P. Schulze-Lefert [1994] Plant Cell 6: 983-994) but also in acquired resistance, which confers protection to a broad spectrum of different pathogens. PMID:12232407

  12. Deciphering the Mechanism of β-Aminobutyric Acid-Induced Resistance in Wheat to the Grain Aphid, Sitobion avenae

    PubMed Central

    Cao, He-He; Zhang, Meng; Zhao, Hui; Zhang, Yi; Wang, Xing-Xing; Guo, Shan-Shan; Zhang, Zhan-Feng; Liu, Tong-Xian

    2014-01-01

    The non-protein amino acid β-aminobutyric acid (BABA) can induce plant resistance to a broad spectrum of biotic and abiotic stresses. However, BABA-induced plant resistance to insects is less well-studied, especially its underlying mechanism. In this research, we applied BABA to wheat seedlings and tested its effects on Sitobion avenae (F.). When applied as a soil drench, BABA significantly reduced weights of S. avenae, whereas foliar spray and seed treatment had no such effects. BABA-mediated suppression of S. avenae growth was dose dependent and lasted at least for 7 days. The aminobutyric acid concentration in phloem sap of BABA-treated plants was higher and increased with BABA concentrations applied. Moreover, after 10 days of treatment, the aminobutyric acid content in BABA-treated plants was still higher than that in control treatment. Sitobion avenae could not discriminate artificial diet containing BABA from standard diet, indicating that BABA itself is not a deterrent to this aphid. Also S. avenae did not show preference for control plants or BABA-treated plants. Consistent with choice test results, S. avenae had similar feeding activities on control and BABA-treated plants, suggesting that BABA did not induce antifeedants in wheat seedlings. In addition, aminobutyric acid concentration in S. avenae feeding on BABA-treated plants was significantly higher than those feeding on control plants. Sitobion avenae growth rate was reduced on the artificial diet containing BABA, indicating that BABA had direct toxic effects on this aphid species. These results suggest that BABA application reduced S. avenae performance on wheat seedlings and the mechanism is possibly due to direct toxicity of high BABA contents in plant phloem. PMID:24651046

  13. N-Acetylneuraminic Acid Supplementation Prevents High Fat Diet-Induced Insulin Resistance in Rats through Transcriptional and Nontranscriptional Mechanisms.

    PubMed

    Yida, Zhang; Imam, Mustapha Umar; Ismail, Maznah; Ismail, Norsharina; Azmi, Nur Hanisah; Wong, Waiteng; Altine Adamu, Hadiza; Md Zamri, Nur Diyana; Ideris, Aini; Abdullah, Maizaton Atmadini

    2015-01-01

    N-Acetylneuraminic acid (Neu5Ac) is a biomarker of cardiometabolic diseases. In the present study, we tested the hypothesis that dietary Neu5Ac may improve cardiometabolic indices. A high fat diet (HFD) + Neu5Ac (50 or 400 mg/kg BW/day) was fed to rats and compared with HFD + simvastatin (10 mg/kg BW/day) or HFD alone for 12 weeks. Weights and serum biochemicals (lipid profile, oral glucose tolerance test, leptin, adiponectin, and insulin) were measured, and mRNA levels of insulin signaling genes were determined. The results indicated that low and high doses of sialic acid (SA) improved metabolic indices, although only the oral glucose tolerance test, serum triglycerides, leptin, and adiponectin were significantly better than those in the HFD and HFD + simvastatin groups (P < 0.05). Furthermore, the results showed that only high-dose SA significantly affected the transcription of hepatic and adipose tissue insulin signaling genes. The data suggested that SA prevented HFD-induced insulin resistance in rats after 12 weeks of administration through nontranscriptionally mediated biochemical changes that may have differentially sialylated glycoprotein structures at a low dose. At higher doses, SA induced transcriptional regulation of insulin signaling genes. These effects suggest that low and high doses of SA may produce similar metabolic outcomes in relation to insulin sensitivity through multiple mechanisms. These findings are worth studying further. PMID:26688813

  14. N-Acetylneuraminic Acid Supplementation Prevents High Fat Diet-Induced Insulin Resistance in Rats through Transcriptional and Nontranscriptional Mechanisms

    PubMed Central

    Yida, Zhang; Imam, Mustapha Umar; Ismail, Maznah; Ismail, Norsharina; Azmi, Nur Hanisah; Wong, Waiteng; Altine Adamu, Hadiza; Md Zamri, Nur Diyana; Ideris, Aini; Abdullah, Maizaton Atmadini

    2015-01-01

    N-Acetylneuraminic acid (Neu5Ac) is a biomarker of cardiometabolic diseases. In the present study, we tested the hypothesis that dietary Neu5Ac may improve cardiometabolic indices. A high fat diet (HFD) + Neu5Ac (50 or 400 mg/kg BW/day) was fed to rats and compared with HFD + simvastatin (10 mg/kg BW/day) or HFD alone for 12 weeks. Weights and serum biochemicals (lipid profile, oral glucose tolerance test, leptin, adiponectin, and insulin) were measured, and mRNA levels of insulin signaling genes were determined. The results indicated that low and high doses of sialic acid (SA) improved metabolic indices, although only the oral glucose tolerance test, serum triglycerides, leptin, and adiponectin were significantly better than those in the HFD and HFD + simvastatin groups (P < 0.05). Furthermore, the results showed that only high-dose SA significantly affected the transcription of hepatic and adipose tissue insulin signaling genes. The data suggested that SA prevented HFD-induced insulin resistance in rats after 12 weeks of administration through nontranscriptionally mediated biochemical changes that may have differentially sialylated glycoprotein structures at a low dose. At higher doses, SA induced transcriptional regulation of insulin signaling genes. These effects suggest that low and high doses of SA may produce similar metabolic outcomes in relation to insulin sensitivity through multiple mechanisms. These findings are worth studying further. PMID:26688813

  15. Mechanisms of Antibiotic Resistance.

    PubMed

    Munita, Jose M; Arias, Cesar A

    2016-04-01

    Emergence of resistance among the most important bacterial pathogens is recognized as a major public health threat affecting humans worldwide. Multidrug-resistant organisms have not only emerged in the hospital environment but are now often identified in community settings, suggesting that reservoirs of antibiotic-resistant bacteria are present outside the hospital. The bacterial response to the antibiotic "attack" is the prime example of bacterial adaptation and the pinnacle of evolution. "Survival of the fittest" is a consequence of an immense genetic plasticity of bacterial pathogens that trigger specific responses that result in mutational adaptations, acquisition of genetic material, or alteration of gene expression producing resistance to virtually all antibiotics currently available in clinical practice. Therefore, understanding the biochemical and genetic basis of resistance is of paramount importance to design strategies to curtail the emergence and spread of resistance and to devise innovative therapeutic approaches against multidrug-resistant organisms. In this chapter, we will describe in detail the major mechanisms of antibiotic resistance encountered in clinical practice, providing specific examples in relevant bacterial pathogens. PMID:27227291

  16. Flame and acid resistant polymide fibers

    NASA Technical Reports Server (NTRS)

    Stringham, R. S.; Toy, M. S.

    1977-01-01

    Economical process improves flame resistance and resistance to acids of polyamide fibers, without modifying colors of mechanical properties. Process improves general safety of garments and other items made from polyamide fibers and makes them suitable for applications requiring exposure to oxygen-rich atmosphere or corrosive acids. Halo-olefins are added to surface of fibers by photoadditon in sealed chamber. Process could be used with films and other forms of polyamide.

  17. Mechanisms of drug resistance: quinolone resistance

    PubMed Central

    Hooper, David C.; Jacoby, George A.

    2015-01-01

    Quinolone antimicrobials are synthetic and widely used in clinical medicine. Resistance emerged with clinical use and became common in some bacterial pathogens. Mechanisms of resistance include two categories of mutation and acquisition of resistance-conferring genes. Resistance mutations in one or both of the two drug target enzymes, DNA gyrase and DNA topoisomerase IV, are commonly in a localized domain of the GyrA and ParE subunits of the respective enzymes and reduce drug binding to the enzyme-DNA complex. Other resistance mutations occur in regulatory genes that control the expression of native efflux pumps localized in the bacterial membrane(s). These pumps have broad substrate profiles that include quinolones as well as other antimicrobials, disinfectants, and dyes. Mutations of both types can accumulate with selection pressure and produce highly resistant strains. Resistance genes acquired on plasmids can confer low-level resistance that promotes the selection of mutational high-level resistance. Plasmid-encoded resistance is due to Qnr proteins that protect the target enzymes from quinolone action, one mutant aminoglycoside-modifying enzyme that also modifies certain quinolones, and mobile efflux pumps. Plasmids with these mechanisms often encode additional antimicrobial resistances and can transfer multidrug resistance that includes quinolones. Thus, the bacterial quinolone resistance armamentarium is large. PMID:26190223

  18. Mechanisms of drug resistance: quinolone resistance.

    PubMed

    Hooper, David C; Jacoby, George A

    2015-09-01

    Quinolone antimicrobials are synthetic and widely used in clinical medicine. Resistance emerged with clinical use and became common in some bacterial pathogens. Mechanisms of resistance include two categories of mutation and acquisition of resistance-conferring genes. Resistance mutations in one or both of the two drug target enzymes, DNA gyrase and DNA topoisomerase IV, are commonly in a localized domain of the GyrA and ParE subunits of the respective enzymes and reduce drug binding to the enzyme-DNA complex. Other resistance mutations occur in regulatory genes that control the expression of native efflux pumps localized in the bacterial membrane(s). These pumps have broad substrate profiles that include quinolones as well as other antimicrobials, disinfectants, and dyes. Mutations of both types can accumulate with selection pressure and produce highly resistant strains. Resistance genes acquired on plasmids can confer low-level resistance that promotes the selection of mutational high-level resistance. Plasmid-encoded resistance is due to Qnr proteins that protect the target enzymes from quinolone action, one mutant aminoglycoside-modifying enzyme that also modifies certain quinolones, and mobile efflux pumps. Plasmids with these mechanisms often encode additional antimicrobial resistances and can transfer multidrug resistance that includes quinolones. Thus, the bacterial quinolone resistance armamentarium is large. PMID:26190223

  19. Bortezomib attenuates palmitic acid-induced ER stress, inflammation and insulin resistance in myotubes via AMPK dependent mechanism.

    PubMed

    Kwak, Hyun Jeong; Choi, Hye-Eun; Jang, Jinsun; Park, Soo Kyung; Bae, Young-An; Cheon, Hyae Gyeong

    2016-08-01

    Bortezomib is an anti-cancer agent that induces ER stress by inhibiting proteasomal degradation. However, the effects of bortezomib appear to be dependent on its concentration and cellular context. Since ER stress is closely related to type 2 diabetes, the authors examined the effects of bortezomib on palmitic acid (PA)-induced ER stress in C2C12 murine myotubes. At low concentrations (<20nM), bortezomib protected myotubes from PA (750μM)-induced ER stress and inflammation. Either tunicamycin or thapsigargin-induced ER stress was also reduced by bortezomib. In addition, reduced glucose uptake and Akt phosphorylation induced by PA were prevented by co-treating bortezomib (10nM) both in the presence or absence of insulin. These protective effects of bortezomib were found to be associated with reduced JNK phosphorylation. Furthermore, bortezomib-induced AMPK phosphorylation, and the protective effects of bortezomib were diminished by AMPK knockdown, suggesting that AMPK activation underlies the effects of bortezomib. The in vivo administration of bortezomib at nontoxic levels (at 50 or 200μg/kg, i.p.) twice weekly for 5weeks to ob/ob mice improved insulin resistance, increased AMPK phosphorylation, reduced ER stress marker levels, and JNK inhibition in skeletal muscle. The study shows that bortezomib reduces ER stress, inflammation, and insulin resistance in vitro and in vivo, and suggests that bortezomib has novel applications for the treatment of metabolic disorders. PMID:27049873

  20. Matrine cooperates with all-trans retinoic acid on differentiation induction of all-trans retinoic acid-resistant acute promyelocytic leukemia cells (NB4-LR1): possible mechanisms.

    PubMed

    Wu, Dijiong; Shao, Keding; Sun, Jie; Zhu, Fuyun; Ye, Baodong; Liu, Tingting; Shen, Yiping; Huang, He; Zhou, Yuhong

    2014-03-01

    Retinoic acid resistance results in refractory disease, and recovery in acute promyelocytic leukemia remains a challenge in clinical practice, with no ideal chemotherapeutic drug currently available. Here we report on the effect of an active compound of Sophora flavescens called matrine (0.1 mmol/L) combined with all-trans retinoic acid (1 µmol/L) in alleviating retinoic acid resistance in acute promyelocytic leukemia-derived NB4-LR1 cells by differentiation induction, as can be seen by an induced morphology change, increased CD11b expression, and nitro blue tetrazolium reduction activity, and a decreased expression of the promyelocytic leukemia-retinoic acid receptor α fusion gene and protein product. We further explored the probable mechanism of how matrine promotes the recovery of differentiation ability in NB4-LR1 cells when exposed to all-trans retinoic acid. We observed that the combination of all-trans retinoic acid and matrine can increase the level of cyclic adenosine monophosphate and protein kinase A activity, reduce telomerase activity, and downregulate the protein expression of topoisomerase II beta in NB4-LR1 cells. The results of this study suggest the possible clinical utility of matrine in the treatment of retinoic acid-resistant acute promyelocytic leukemia. PMID:24619838

  1. Sequestration of AS-DACA into Acidic Compartments of the Membrane Trafficking System as a Mechanism of Drug Resistance in Rhabdomyosarcoma

    PubMed Central

    Williams, Marissa; Catchpoole, Daniel

    2013-01-01

    The accumulation of weakly basic drugs into acidic organelles has recently been described as a contributor to resistance in childhood cancer rhabdomyosarcoma (RMS) cell lines with differential sensitivity to a novel topoisomerase II inhibitor, AS-DACA. The current study aims to explore the contribution of the endocytic pathway to AS-DACA sequestration in RMS cell lines. A 24-fold differential in AS-DACA cytotoxicity was detected between the RMS lines RD and Rh30. The effect of inhibitors of the endocytic pathway on AS-DACA sensitivity in RMS cell lines, coupled with the variations of endosomal marker expression, indicated the late endosomal/lysosomal compartment was implicated by confounding lines of evidence. Higher expression levels of Lysosomal-Associated Membrane Protein-1 (LAMP1) in the resistant RMS cell line, RD, provided correlations between the increased amount and activity of these compartments to AS-DACA resistance. The late endosomal inhibitor 3-methyladenine increased AS-DACA sensitivity solely in RD leading to the reduction of AS-DACA in membrane trafficking organelles. Acidification inhibitors did not produce an increase in AS-DACA sensitivity nor reduce its sequestration, indicating that the pH partitioning of weakly basic drugs into acidic compartments does not likely contribute to the AS-DACA sequestering resistance mechanism evident in RMS cells. PMID:23799359

  2. Mechanisms of Drug Resistance: Daptomycin Resistance

    PubMed Central

    Tran, Truc T.; Munita, Jose M.; Arias, Cesar A.

    2016-01-01

    Daptomycin (DAP) is a cyclic lipopeptide with in vitro activity against a variety of Gram-positive pathogens, including multidrug-resistant organisms. Since its introduction in clinical practice in 2003, DAP has become an important key front-line antibiotic for severe or deep-seated infections caused by Gram-positive organisms. Unfortunately, DAP-resistance (R) has been extensively documented in clinically important organisms such as Staphylococcus aureus, Enterococcus spp, and Streptococcus spp. Studies on the mechanisms of DAP-R in Bacillus subtilis and other Gram-positive bacteria indicate that the genetic pathways of DAP resistance are diverse and complex. However, a common phenomenon emerging from these mechanistic studies is that DAP-R is associated with important adaptive changes in cell wall and cell membrane homeostasis with critical changes in cell physiology. Findings related to these adaptive changes have offered novel insights into the genetics and molecular mechanisms of bacterial cell envelope stress response and the manner in which Gram-positive bacteria cope with the antimicrobial peptide attack and protect vital structures of the cell envelope such as the cell membrane. In this review, we will examine the most recent findings related to the molecular mechanisms of resistance to DAP in relevant Gram-positive pathogens and discuss the clinical implications for therapy against these important bacteria. PMID:26495887

  3. Silicon-mediated resistance of Arabidopsis against powdery mildew involves mechanisms other than the salicylic acid (SA)-dependent defence pathway.

    PubMed

    Vivancos, Julien; Labbé, Caroline; Menzies, James G; Bélanger, Richard R

    2015-08-01

    On absorption by plants, silicon (Si) offers protection against many fungal pathogens, including powdery mildews. The mechanisms by which Si exerts its prophylactic role remain enigmatic, although a prevailing hypothesis suggests that Si positively influences priming. Attempts to decipher Si properties have been limited to plants able to absorb Si, which excludes the model plant Arabidopsis because it lacks Si influx transporters. In this work, we were able to engineer Arabidopsis plants with an Si transporter from wheat (TaLsi1) and to exploit mutants (pad4 and sid2) deficient in salicylic acid (SA)-dependent defence responses to study their phenotypic response and changes in defence expression against Golovinomyces cichoracearum (Gc) following Si treatment. Our results showed that TaLsi1 plants contained significantly more Si and were significantly more resistant to Gc infection than control plants when treated with Si, the first such demonstration in a plant transformed with a heterologous Si transporter. The resistant plants accumulated higher levels of SA and expressed higher levels of transcripts encoding defence genes, thus suggesting a role for Si in the process. However, TaLsi1 pad4 and TaLsi1 sid2 plants were also more resistant to Gc than were pad4 and sid2 plants following Si treatment. Analysis of the resistant phenotypes revealed a significantly reduced production of SA and expression of defence genes comparable with susceptible controls. These results indicate that Si contributes to Arabidopsis defence priming following pathogen infection, but highlight that Si will confer protection even when priming is altered. We conclude that Si-mediated protection involves mechanisms other than SA-dependent defence responses. PMID:25346281

  4. Mechanisms of echinocandin antifungal drug resistance

    PubMed Central

    Perlin, David S.

    2015-01-01

    Fungal infections due to Candida and Aspergillus species cause extensive morbidity and mortality, especially among immunosuppressed patients, and antifungal therapy is critical to patient management. Yet only a few drug classes are available to treat invasive fungal diseases, and this problem is compounded by the emergence of antifungal resistance. Echinocandin drugs are the preferred choice to treat candidiasis. They are the first cell wall–active agents and target the fungal-specific enzyme glucan synthase, which catalyzes the biosynthesis of β-1,3-glucan, a key cell wall polymer. Therapeutic failures occur rarely among common Candida species, with the exception of Candida glabrata, which are frequently multidrug resistant. Echinocandin resistance in susceptible species is always acquired during therapy. The mechanism of resistance involves amino acid changes in hot-spot regions of Fks subunits of glucan synthase, which decrease the sensitivity of the enzyme to drug. Cellular stress response pathways lead to drug adaptation, which promote the formation of resistant fks strains. Clinical factors promoting echinocandin resistance include empiric therapy, prophylaxis, gastrointestinal reservoirs, and intra-abdominal infections. A better understanding of the echinocandin resistance mechanism, along with cellular and clinical factors promoting resistance, will promote more effective strategies to overcome and prevent echinocandin resistance. PMID:26190298

  5. Mechanisms of resistance to cabazitaxel.

    PubMed

    Duran, George E; Wang, Yan C; Francisco, E Brian; Rose, John C; Martinez, Francisco J; Coller, John; Brassard, Diana; Vrignaud, Patricia; Sikic, Branimir I

    2015-01-01

    We studied mechanisms of resistance to the novel taxane cabazitaxel in established cellular models of taxane resistance. We also developed cabazitaxel-resistant variants from MCF-7 breast cancer cells by stepwise selection in drug alone (MCF-7/CTAX) or drug plus the transport inhibitor PSC-833 (MCF-7/CTAX-P). Among multidrug-resistant (MDR) variants, cabazitaxel was relatively less cross-resistant than paclitaxel and docetaxel (15- vs. 200-fold in MES-SA/Dx5 and 9- vs. 60-fold in MCF-7/TxT50, respectively). MCF-7/TxTP50 cells that were negative for MDR but had 9-fold resistance to paclitaxel were also 9-fold resistant to cabazitaxel. Selection with cabazitaxel alone (MCF-7/CTAX) yielded 33-fold resistance to cabazitaxel, 52-fold resistance to paclitaxel, activation of ABCB1, and 3-fold residual resistance to cabazitaxel with MDR inhibition. The MCF-7/CTAX-P variant did not express ABCB1, nor did it efflux rhodamine-123, BODIPY-labeled paclitaxel, and [(3)H]-docetaxel. These cells are hypersensitive to depolymerizing agents (vinca alkaloids and colchicine), have reduced baseline levels of stabilized microtubules, and impaired tubulin polymerization in response to taxanes (cabazitaxel or docetaxel) relative to MCF-7 parental cells. Class III β-tubulin (TUBB3) RNA and protein were elevated in both MCF-7/CTAX and MCF-7/CTAX-P. Decreased BRCA1 and altered epithelial-mesenchymal transition (EMT) markers are also associated with cabazitaxel resistance in these MCF-7 variants, and may serve as predictive biomarkers for its activity in the clinical setting. In summary, cabazitaxel resistance mechanisms include MDR (although at a lower level than paclitaxel and docetaxel), and alterations in microtubule dynamicity, as manifested by higher expression of TUBB3, decreased BRCA1, and by the induction of EMT. PMID:25416788

  6. (Mechanisms of tolerance and resistance)

    SciTech Connect

    Waters, L.C.

    1990-08-28

    The traveler participated in the Seventh International Congress of Pesticide Chemistry by presenting a poster entitled Studies on the Expression of Insecticide Resistance-Associated Cytochrome P450 in Drosophila Using Cloned DNA'' and as an invited speaker in the Workshop Session on Insecticide Resistance. The Congress covered a wide range of topics, including studies of new syntheic compounds and natural products with crop protecting properties, modes of action of pesticides, mechanisms of pesticide resistance, environmental fate of pesticides and estimates of risk to pesticide exposure. Several presentations on the potential role of cytochrome P450 in resistance to insecticides and herbicides were relevant to our work at ORNL's Biology Division on molecular mechanisms of P450 expression.

  7. Acid evaporation property in chemically amplified resists

    NASA Astrophysics Data System (ADS)

    Hashimoto, Shuichi; Itani, Toshiro; Yoshino, Hiroshi; Yamana, Mitsuharu; Samoto, Norihiko; Kasama, Kunihiko

    1997-07-01

    The lithographic performance of a chemically amplified resist system very much depends on the photo-generated acid structure. In a previous paper, we reported the molecular structure dependence of two typical photo-generated acids (aromatic sulfonic acid and alkyl sulfonic acid) from the viewpoints of lithographic performance and acid characteristics such as acid generation efficiency, acid diffusion behavior and acid evaporation property. In this paper, we evaluate the effect of the remaining solvent in a resist film on the acid evaporation property. Four types of two-component chemically amplified positive KrF resists were prepared consisting of tert-butoxycarbonyl (t-BOC) protected polyhydroxystyrene and sulfonic acid derivative photo-acid generator (PAG). Here, a different combination of two types of PAGs [2,4-dimethylbenzenesulfonic acid (aromatic sulfonic acid) derivative PAG and cyclohexanesulfonic acid (alkyl sulfonic acid) derivative PAG] and two types of solvents (propylene glycol monomethyl ether acetate; PGMEA and ethyl lactate; EL) were evaluated. The aromatic sulfonic acid was able to evaporate easily during post exposure bake (PEB) treatment, but the alkyl sulfonic acid was not. The higher evaporation property of aromatic sulfonic acid might be due to the higher vapor pressure and the longer acid diffusion length. Furthermore, the amount of aromatic sulfonic acid in the PGMEA resist was reduced by more than that in the EL resist. The amount of acid loss also became smaller at a higher prebake temperature. The concentration of the remaining solvent in the resist film decreased with the increasing prebake temperature. We think that the acid evaporation property was affected by the remaining solvent in the resist, film; the large amount of remaining solvent promoted the acid diffusion and eventually accelerated the acid evaporation from the resist film surface in the PGMEA resist. In summary, the acid evaporation property depends on both the acid

  8. Antimicrobial Resistance Mechanisms among Campylobacter

    PubMed Central

    2013-01-01

    Campylobacter jejuni and Campylobacter coli are recognized as the most common causative agents of bacterial gastroenteritis in the world. Humans most often become infected by ingesting contaminated food, especially undercooked chicken, but also other sources of bacteria have been described. Campylobacteriosis is normally a self-limiting disease. Antimicrobial treatment is needed only in patients with more severe disease and in those who are immunologically compromised. The most common antimicrobial agents used in the treatment of Campylobacter infections are macrolides, such as erythromycin, and fluoroquinolones, such as ciprofloxacin. Tetracyclines have been suggested as an alternative choice in the treatment of clinical campylobacteriosis but in practice are not often used. However, during the past few decades an increasing number of resistant Campylobacter isolates have developed resistance to fluoroquinolones and other antimicrobials such as macrolides, aminoglycosides, and beta-lactams. Trends in antimicrobial resistance have shown a clear correlation between use of antibiotics in the veterinary medicine and animal production and resistant isolates of Campylobacter in humans. In this review, the patterns of emerging resistance to the antimicrobial agents useful in treatment of the disease are presented and the mechanisms of resistance to these drugs in Campylobacter are discussed. PMID:23865047

  9. Acid soluble, pepsin resistant platelet aggregating material

    SciTech Connect

    Schneider, M.D.

    1982-08-31

    Disclosed is an acid soluble, pepsin resistant, platelet aggregating material isolated from equine arterial tissue by extraction with dilute aqueous acid. The method of isolation and use to control bleeding are described. 4 figs.

  10. Increased D-alanylation of lipoteichoic acid and a thickened septum are main determinants in the nisin resistance mechanism of Lactococcus lactis.

    PubMed

    Kramer, Naomi E; Hasper, Hester E; van den Bogaard, Patrick T C; Morath, Siegfried; de Kruijff, Ben; Hartung, Thomas; Smid, Eddy J; Breukink, Eefjan; Kok, Jan; Kuipers, Oscar P

    2008-06-01

    Nisin is a post-translationally modified antimicrobial peptide produced by Lactococcus lactis which binds to lipid II in the membrane to form pores and inhibit cell-wall synthesis. A nisin-resistant (Nis(R)) strain of L. lactis, which is able to grow at a 75-fold higher nisin concentration than its parent strain, was investigated with respect to changes in the cell wall. Direct binding studies demonstrated that less nisin was able to bind to lipid II in the membranes of L. lactis Nis(R) than in the parent strain. In contrast to vancomycin binding, which showed ring-like binding, nisin was observed to bind in patches close to cell-division sites in both the wild-type and the Nis(R) strains. Comparison of modifications in lipoteichoic acid of the L. lactis strains revealed an increase in d-alanyl esters and galactose as substituents in L. lactis Nis(R), resulting in a less negatively charged cell wall. Moreover, the cell wall displays significantly increased thickness at the septum. These results indicate that shielding the membrane and thus the lipid II molecule, thereby decreasing abduction of lipid II and subsequent pore-formation, is a major defence mechanism of L. lactis against nisin. PMID:18524930

  11. Intrinsic and acquired resistance mechanisms in enterococcus

    PubMed Central

    Hollenbeck, Brian L.; Rice, Louis B.

    2012-01-01

    Enterococci have the potential for resistance to virtually all clinically useful antibiotics. Their emergence as important nosocomial pathogens has coincided with increased expression of antimicrobial resistance by members of the genus. The mechanisms underlying antibiotic resistance in enterococci may be intrinsic to the species or acquired through mutation of intrinsic genes or horizontal exchange of genetic material encoding resistance determinants. This paper reviews the antibiotic resistance mechanisms in Enterococcus faecium and Enterococcus faecalis and discusses treatment options. PMID:23076243

  12. Polyunsaturated fatty acids and insulin resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We have reviewed results from published studies regarding the effects of polyunsaturated fatty acids (PUFA) intake on insulin resistance (IR) in human subjects. Evidence has been gathered from epidemiological, cross-sectional and interventions studies. Increased intake of trans fatty acids (TFA) inc...

  13. Drug Resistance Mechanisms in Mycobacterium tuberculosis

    PubMed Central

    Palomino, Juan Carlos; Martin, Anandi

    2014-01-01

    Tuberculosis (TB) is a serious public health problem worldwide. Its situation is worsened by the presence of multidrug resistant (MDR) strains of Mycobacterium tuberculosis, the causative agent of the disease. In recent years, even more serious forms of drug resistance have been reported. A better knowledge of the mechanisms of drug resistance of M. tuberculosis and the relevant molecular mechanisms involved will improve the available techniques for rapid drug resistance detection and will help to explore new targets for drug activity and development. This review article discusses the mechanisms of action of anti-tuberculosis drugs and the molecular basis of drug resistance in M. tuberculosis. PMID:27025748

  14. Antiviral Drug Resistance: Mechanisms and Clinical Implications

    PubMed Central

    Chou, Sunwen

    2010-01-01

    Summary Antiviral drug resistance is an increasing concern in immunocompromised patient populations, where ongoing viral replication and prolonged drug exposure lead to the selection of resistant strains. Rapid diagnosis of resistance can be made by associating characteristic viral mutations with resistance to various drugs as determined by phenotypic assays. Management of drug resistance includes optimization of host factors and drug delivery, selection of alternative therapies based on knowledge of mechanisms of resistance, and the development of new antivirals. This article discusses drug resistance in herpesviruses and hepatitis B. PMID:20466277

  15. An Inducible Fusaric Acid Tripartite Efflux Pump Contributes to the Fusaric Acid Resistance in Stenotrophomonas maltophilia

    PubMed Central

    Hu, Rouh-Mei; Liao, Sih-Ting; Huang, Chiang-Ching; Huang, Yi-Wei; Yang, Tsuey-Ching

    2012-01-01

    Background Fusaric acid (5-butylpicolinic acid), a mycotoxin, is noxious to some microorganisms. Stenotrophomonas maltophilia displays an intrinsic resistance to fusaric acid. This study aims to elucidate the mechanism responsible for the intrinsic fusaric acid resistance in S. maltophilia. Methodology A putative fusaric acid resistance-involved regulon fuaR-fuaABC was identified by the survey of the whole genome sequence of S. maltophilia K279a. The fuaABC operon was verified by reverse transcriptase-PCR. The contribution of the fuaABC operon to the antimicrobial resistance was evaluated by comparing the antimicrobials susceptibility between the wild-type strain and fuaABC knock-out mutant. The regulatory role of fuaR in the expression of the fuaABC operon was assessed by promoter transcription fusion assay. Results The fuaABC operon was inducibly expressed by fusaric acid and the inducibility was fuaR dependent. FuaR functioned as a repressor of the fuaABC operon in absence of a fusaric acid inducer and as an activator in its presence. Overexpression of the fuaABC operon contributed to the fusaric acid resistance. Significance A novel tripartite fusaric acid efflux pump, FuaABC, was identified in this study. Distinct from the formally classification, the FuaABC may constitute a new type of subfamily of the tripartite efflux pump. PMID:23236431

  16. Reaction Mechanism of Extreme Ultraviolet Resists

    NASA Astrophysics Data System (ADS)

    Toriumi, Minoru; Kaneyama, Koji; Itani, Toshiro

    2008-06-01

    Molecular resist of polyphenol was evaluated as an extreme-ultraviolet resist compared with a polymer resist of poly(tert-butoxycarbonylhydroxystyrene). X-ray reflectometry was used to determine the resist-film density and measurement accuracy was improved. The molecular resist shows higher sensitivity of 3 mJ/cm2 than the polymer resist of 4 mJ/cm2. The deprotection mechanism was approximated by simple reaction equations and Fourier-transform infrared spectra was interpreted to give the products of a quantum yield and a deprotection rate constant as 9.7×10-8 and 8.1×10-8 cm3 molecule-1 s-1 for molecular and polymer resists. The higher sensitivity of the molecular resist is due to the larger efficiency of the reaction mechanism.

  17. Bile resistance mechanisms in Lactobacillus and Bifidobacterium

    PubMed Central

    Ruiz, Lorena; Margolles, Abelardo; Sánchez, Borja

    2013-01-01

    Probiotics are live microorganisms which when administered in adequate amounts confer a health benefit on the host. Most of the probiotic bacteria currently available in the market belong to the genera Lactobacillus and Bifidobacterium, and specific health-promoting activities, such as treatment of diarrhea or amelioration of gastrointestinal discomfort, have been attributed to them. In order to be able to survive the gastrointestinal transit and transiently colonize our gut, these bacteria must be able to counteract the deleterious action of bile salts, which are the main components of bile. Bile salts are detergent-like biological substances synthesized in the liver from cholesterol. Host enzymes conjugate the newly synthesized free bile acids in the liver with the amino acids glycine or taurine, generating conjugated bile salts. These compounds are stored in the gall bladder and they are released into the duodenum during digestion to perform their physiological function, which is the solubilization of fat coming from diet. These bile salts possess strong antimicrobial activity, since they are able to disorganize the structure of the cell membrane, as well as trigger DNA damage. This means that bacteria inhabiting our intestinal tract must have intrinsic resistance mechanisms to cope with bile salts. To do that, Lactobacillus and Bifidobacterium display a variety of proteins devoted to the efflux of bile salts or protons, to modify sugar metabolism or to prevent protein misfolding. In this manuscript, we review and discuss specific bile resistance mechanisms, as well as the processes responsible for the adaptation of bifidobacteria and lactobacilli to bile. PMID:24399996

  18. Bile resistance mechanisms in Lactobacillus and Bifidobacterium.

    PubMed

    Ruiz, Lorena; Margolles, Abelardo; Sánchez, Borja

    2013-01-01

    Probiotics are live microorganisms which when administered in adequate amounts confer a health benefit on the host. Most of the probiotic bacteria currently available in the market belong to the genera Lactobacillus and Bifidobacterium, and specific health-promoting activities, such as treatment of diarrhea or amelioration of gastrointestinal discomfort, have been attributed to them. In order to be able to survive the gastrointestinal transit and transiently colonize our gut, these bacteria must be able to counteract the deleterious action of bile salts, which are the main components of bile. Bile salts are detergent-like biological substances synthesized in the liver from cholesterol. Host enzymes conjugate the newly synthesized free bile acids in the liver with the amino acids glycine or taurine, generating conjugated bile salts. These compounds are stored in the gall bladder and they are released into the duodenum during digestion to perform their physiological function, which is the solubilization of fat coming from diet. These bile salts possess strong antimicrobial activity, since they are able to disorganize the structure of the cell membrane, as well as trigger DNA damage. This means that bacteria inhabiting our intestinal tract must have intrinsic resistance mechanisms to cope with bile salts. To do that, Lactobacillus and Bifidobacterium display a variety of proteins devoted to the efflux of bile salts or protons, to modify sugar metabolism or to prevent protein misfolding. In this manuscript, we review and discuss specific bile resistance mechanisms, as well as the processes responsible for the adaptation of bifidobacteria and lactobacilli to bile. PMID:24399996

  19. Mechanisms of Antimicrobial Resistance in ESKAPE Pathogens

    PubMed Central

    Santajit, Sirijan; Indrawattana, Nitaya

    2016-01-01

    The ESKAPE pathogens (Enterococcus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species) are the leading cause of nosocomial infections throughout the world. Most of them are multidrug resistant isolates, which is one of the greatest challenges in clinical practice. Multidrug resistance is amongst the top three threats to global public health and is usually caused by excessive drug usage or prescription, inappropriate use of antimicrobials, and substandard pharmaceuticals. Understanding the resistance mechanisms of these bacteria is crucial for the development of novel antimicrobial agents or other alternative tools to combat these public health challenges. Greater mechanistic understanding would also aid in the prediction of underlying or even unknown mechanisms of resistance, which could be applied to other emerging multidrug resistant pathogens. In this review, we summarize the known antimicrobial resistance mechanisms of ESKAPE pathogens. PMID:27274985

  20. Novel acid resistance genes from the metagenome of the Tinto River, an extremely acidic environment.

    PubMed

    Guazzaroni, María-Eugenia; Morgante, Verónica; Mirete, Salvador; González-Pastor, José E

    2013-04-01

    Microorganisms that thrive in acidic environments are endowed with specialized molecular mechanisms to survive under this extremely harsh condition. In this work, we performed functional screening of six metagenomic libraries from planktonic and rhizosphere microbial communities of the Tinto River, an extremely acidic environment, to identify genes involved in acid resistance. This approach has revealed 15 different genes conferring acid resistance to Escherichia coli, most of which encoding putative proteins of unknown function or previously described proteins not known to be related to acid resistance. Moreover, we were able to assign function to one unknown and three hypothetical proteins. Among the recovered genes were the ClpXP protease, the transcriptional repressor LexA and nucleic acid-binding proteins such as an RNA-binding protein, HU and Dps. Furthermore, nine of the retrieved genes were cloned and expressed in Pseudomonas putida and Bacillus subtilis and, remarkably, most of them were able to expand the capability of these bacteria to survive under severe acid stress. From this set of genes, four presented a broad-host range as they enhance the acid resistance of the three different organisms tested. These results expand our knowledge about the different strategies used by microorganisms to survive under extremely acid conditions. PMID:23145860

  1. Influence of cyclopropane fatty acids on heat, high pressure, acid and oxidative resistance in Escherichia coli.

    PubMed

    Chen, Yuan Yao; Gänzle, Michael G

    2016-04-01

    Heat and high pressure resistant strains of Escherichia coli are a challenge to food safety. This study investigated effects of cyclopropane fatty acids (CFAs) on stress tolerance in the heat- and pressure-resistant strain E. coli AW1.7 and the sensitive strain E. coli MG1655. The role of CFAs was explored by disruption of cfa coding for CFA synthase with an in-frame, unmarked deletion method. Both wild-type strains consumed all the unsaturated fatty acids (C16:1 and C18:1) that were mostly converted to CFAs and a low proportion to saturated fatty acid (C16:0). Moreover, E. coli AW1.7 contained a higher proportion of membrane C19:0 cyclopropane fatty acid than E. coli MG1655 (P<0.05). The Δcfa mutant strains did not produce CFAs, and the corresponding substrates C16:1 and C18:1 accumulated in membrane lipids. The deletion of cfa did not alter resistance to H2O2 but increased the lethality of heat, high pressure and acid treatments in E. coli AW1.7, and E. coli MG1655. E. coli AW1.7 and its Δcfa mutant were more resistant to pressure and heat but less resistant to acid stress than E. coli MG1655. Heat resistance of wild-type strains and their Δcfa mutant was also assessed in beef patties grilled to an internal temperature of 71 °C. After treatment, cell counts of wild type strains were higher than those of the Δcfa mutant strains. In conclusion, CFA synthesis in E. coli increases heat, high pressure and acid resistance, and increases heat resistance in food. This knowledge on mechanisms of stress resistance will facilitate the design of intervention methods for improved pathogen control in food production. PMID:26828814

  2. Evolution of herbicide resistance mechanisms in grass weeds.

    PubMed

    Matzrafi, Maor; Gadri, Yaron; Frenkel, Eyal; Rubin, Baruch; Peleg, Zvi

    2014-12-01

    Herbicide resistant weeds are becoming increasingly common, threatening global food security. Here, we present BrIFAR: a new model system for the functional study of mechanisms of herbicide resistance in grass weeds. We have developed a large collection of Brachypodium accessions, the BrI collection, representing a wide range of habitats. Wide screening of the responses of the accessions to four major herbicide groups (PSII, ACCase, ALS/AHAS and EPSPS inhibitors) identified 28 herbicide-resistance candidate accessions. Target-site resistance to PSII inhibitors was found in accessions collected from habitats with a known history of herbicide applications. An amino acid substitution in the psbA gene (serine264 to glycine) conferred resistance and also significantly affected the flowering and shoot dry weight of the resistant accession, as compared to the sensitive accession. Non-target site resistance to ACCase inhibitors was found in accessions collected from habitats with a history of herbicide application and from a nature reserve. In-vitro enzyme activity tests and responses following pre-treatment with malathion (a cytochrome-P450 inhibitor) indicated sensitivity at the enzyme level, and give strong support to diclofop-methyl and pinoxaden enhanced detoxification as NTS resistance mechanism. BrIFAR can promote better understanding of the evolution of mechanisms of herbicide resistance and aid the implementation of integrative management approaches for sustainable agriculture. PMID:25443832

  3. Disease resistance: Molecular mechanisms and biotechnological applications

    Technology Transfer Automated Retrieval System (TEKTRAN)

    This special issue “Disease resistance: molecular mechanisms and biotechnological applications” contains 11 review articles and four original research papers. Research in the area of engineering for disease resistance continues to progress although only 10% of the transgenic plants registered for ...

  4. Mechanisms of antibiotic resistance in enterococci

    PubMed Central

    Miller, William R; Munita, Jose M; Arias, Cesar A

    2015-01-01

    Multidrug-resistant (MDR) enterococci are important nosocomial pathogens and a growing clinical challenge. These organisms have developed resistance to virtually all antimicrobials currently used in clinical practice using a diverse number of genetic strategies. Due to this ability to recruit antibiotic resistance determinants, MDR enterococci display a wide repertoire of antibiotic resistance mechanisms including modification of drug targets, inactivation of therapeutic agents, overexpression of efflux pumps and a sophisticated cell envelope adaptive response that promotes survival in the human host and the nosocomial environment. MDR enterococci are well adapted to survive in the gastrointestinal tract and can become the dominant flora under antibiotic pressure, predisposing the severely ill and immunocompromised patient to invasive infections. A thorough understanding of the mechanisms underlying antibiotic resistance in enterococci is the first step for devising strategies to control the spread of these organisms and potentially establish novel therapeutic approaches. PMID:25199988

  5. Antibiotic resistance mechanisms of Myroides sp.*

    PubMed Central

    Hu, Shao-hua; Yuan, Shu-xing; Qu, Hai; Jiang, Tao; Zhou, Ya-jun; Wang, Ming-xi; Ming, De-song

    2016-01-01

    Bacteria of the genus Myroides (Myroides spp.) are rare opportunistic pathogens. Myroides sp. infections have been reported mainly in China. Myroides sp. is highly resistant to most available antibiotics, but the resistance mechanisms are not fully elucidated. Current strain identification methods based on biochemical traits are unable to identify strains accurately at the species level. While 16S ribosomal RNA (rRNA) gene sequencing can accurately achieve this, it fails to give information on the status and mechanisms of antibiotic resistance, because the 16S rRNA sequence contains no information on resistance genes, resistance islands or enzymes. We hypothesized that obtaining the whole genome sequence of Myroides sp., using next generation sequencing methods, would help to clarify the mechanisms of pathogenesis and antibiotic resistance, and guide antibiotic selection to treat Myroides sp. infections. As Myroides sp. can survive in hospitals and the environment, there is a risk of nosocomial infections and pandemics. For better management of Myroides sp. infections, it is imperative to apply next generation sequencing technologies to clarify the antibiotic resistance mechanisms in these bacteria. PMID:26984839

  6. Sulfate and acid resistant concrete and mortar

    DOEpatents

    Liskowitz, John W.; Wecharatana, Methi; Jaturapitakkul, Chai; Cerkanowicz, deceased, Anthony E.

    1998-01-01

    The present invention relates to concrete, mortar and other hardenable mixtures comprising cement and fly ash for use in construction and other applications, which hardenable mixtures demonstrate significant levels of acid and sulfate resistance while maintaining acceptable compressive strength properties. The acid and sulfate hardenable mixtures of the invention containing fly ash comprise cementitious materials and a fine aggregate. The cementitous materials may comprise fly ash as well as cement. The fine aggregate may comprise fly ash as well as sand. The total amount of fly ash in the hardenable mixture ranges from about 60% to about 120% of the total amount of cement, by weight, whether the fly ash is included as a cementious material, fine aggregate, or an additive, or any combination of the foregoing. In specific examples, mortar containing 50% fly ash and 50% cement in cementitious materials demonstrated superior properties of corrosion resistance.

  7. Sulfate and acid resistant concrete and mortar

    DOEpatents

    Liskowitz, J.W.; Wecharatana, M.; Jaturapitakkul, C.; Cerkanowicz, A.E.

    1998-06-30

    The present invention relates to concrete, mortar and other hardenable mixtures comprising cement and fly ash for use in construction and other applications, which hardenable mixtures demonstrate significant levels of acid and sulfate resistance while maintaining acceptable compressive strength properties. The acid and sulfate hardenable mixtures of the invention containing fly ash comprise cementitious materials and a fine aggregate. The cementitous materials may comprise fly ash as well as cement. The fine aggregate may comprise fly ash as well as sand. The total amount of fly ash in the hardenable mixture ranges from about 60% to about 120% of the total amount of cement, by weight, whether the fly ash is included as a cementious material, fine aggregate, or an additive, or any combination of the foregoing. In specific examples, mortar containing 50% fly ash and 50% cement in cementitious materials demonstrated superior properties of corrosion resistance. 6 figs.

  8. Mechanisms of Resistance to Photodynamic Therapy

    PubMed Central

    Casas, Adriana; Di Venosa, Gabriela; Hasan, Tayyaba; Batlle, Alcira

    2013-01-01

    Photodynamic therapy (PDT) involves the administration of a photosensitizer (PS) followed by illumination with visible light, leading to generation of reactive oxygen species. The mechanisms of resistance to PDT ascribed to the PS may be shared with the general mechanisms of drug resistance, and are related to altered drug uptake and efflux rates or altered intracellular trafficking. As a second step, an increased inactivation of oxygen reactive species is also associated to PDT resistance via antioxidant detoxifying enzymes and activation of heat shock proteins. Induction of stress response genes also occurs after PDT, resulting in modulation of proliferation, cell detachment and inducing survival pathways among other multiple extracellular signalling events. In addition, an increased repair of induced damage to proteins, membranes and occasionally to DNA may happen. PDT-induced tissue hypoxia as a result of vascular damage and photochemical oxygen consumption may also contribute to the appearance of resistant cells. The structure of the PS is believed to be a key point in the development of resistance, being probably related to its particular subcellular localization. Although most of the features have already been described for chemoresistance, in many cases, no cross-resistance between PDT and chemotherapy has been reported. These findings are in line with the enhancement of PDT efficacy by combination with chemotherapy. The study of cross resistance in cells with developed resistance against a particular PS challenged against other PS is also highly complex and comprises different mechanisms. In this review we will classify the different features observed in PDT resistance, leading to a comparison with the mechanisms most commonly found in chemo resistant cells. PMID:21568910

  9. Mechanisms of biofilm resistance to antimicrobial agents.

    PubMed

    Mah, T F; O'Toole, G A

    2001-01-01

    Biofilms are communities of microorganisms attached to a surface. It has become clear that biofilm-grown cells express properties distinct from planktonic cells, one of which is an increased resistance to antimicrobial agents. Recent work has indicated that slow growth and/or induction of an rpoS-mediated stress response could contribute to biocide resistance. The physical and/or chemical structure of exopolysaccharides or other aspects of biofilm architecture could also confer resistance by exclusion of biocides from the bacterial community. Finally, biofilm-grown bacteria might develop a biofilm-specific biocide-resistant phenotype. Owing to the heterogeneous nature of the biofilm, it is likely that there are multiple resistance mechanisms at work within a single community. Recent research has begun to shed light on how and why surface-attached microbial communities develop resistance to antimicrobial agents. PMID:11166241

  10. Nitroheterocyclic drug resistance mechanisms in Trypanosoma brucei

    PubMed Central

    Wyllie, Susan; Foth, Bernardo J.; Kelner, Anna; Sokolova, Antoaneta Y.; Berriman, Matthew; Fairlamb, Alan H.

    2016-01-01

    Objectives The objective of this study was to identify the mechanisms of resistance to nifurtimox and fexinidazole in African trypanosomes. Methods Bloodstream-form Trypanosoma brucei were selected for resistance to nifurtimox and fexinidazole by stepwise exposure to increasing drug concentrations. Clones were subjected to WGS to identify putative resistance genes. Transgenic parasites modulating expression of genes of interest were generated and drug susceptibility phenotypes determined. Results Nifurtimox-resistant (NfxR) and fexinidazole-resistant (FxR) parasites shared reciprocal cross-resistance suggestive of a common mechanism of action. Previously, a type I nitroreductase (NTR) has been implicated in nitro drug activation. WGS of resistant clones revealed that NfxR parasites had lost >100 kb from one copy of chromosome 7, rendering them hemizygous for NTR as well as over 30 other genes. FxR parasites retained both copies of NTR, but lost >70 kb downstream of one NTR allele, decreasing NTR transcription by half. A single knockout line of NTR displayed 1.6- and 1.9-fold resistance to nifurtimox and fexinidazole, respectively. Since NfxR and FxR parasites are ∼6- and 20-fold resistant to nifurtimox and fexinidazole, respectively, additional factors must be involved. Overexpression and knockout studies ruled out a role for a putative oxidoreductase (Tb927.7.7410) and a hypothetical gene (Tb927.1.1050), previously identified in a genome-scale RNAi screen. Conclusions NTR was confirmed as a key resistance determinant, either by loss of one gene copy or loss of gene expression. Further work is required to identify which of the many dozens of SNPs identified in the drug-resistant cell lines contribute to the overall resistance phenotype. PMID:26581221

  11. Mechanisms of resistance in castration-resistant prostate cancer (CRPC).

    PubMed

    Chandrasekar, Thenappan; Yang, Joy C; Gao, Allen C; Evans, Christopher P

    2015-06-01

    Despite advances in prostate cancer diagnosis and management, morbidity from prostate cancer remains high. Approximately 20% of men present with advanced or metastatic disease, while 29,000 men continue to die of prostate cancer each year. Androgen deprivation therapy (ADT) has been the standard of care for initial management of advanced or metastatic prostate cancer since Huggins and Hodges first introduced the concept of androgen-dependence in 1972, but progression to castration-resistant prostate cancer (CRPC) occurs within 2-3 years of initiation of ADT. CRPC, previously defined as hormone-refractory prostate cancer, is now understood to still be androgen dependent. Multiple mechanisms of resistance help contribute to the progression to castration resistant disease, and the androgen receptor (AR) remains an important driver in this progression. These mechanisms include AR amplification and hypersensitivity, AR mutations leading to promiscuity, mutations in coactivators/corepressors, androgen-independent AR activation, and intratumoral and alternative androgen production. More recently, identification of AR variants (ARVs) has been established as another mechanism of progression to CRPC. Docetaxel chemotherapy has historically been the first-line treatment for CRPC, but in recent years, newer agents have been introduced that target some of these mechanisms of resistance, thereby providing additional survival benefit. These include AR signaling inhibitors such as enzalutamide (Xtandi, ENZA, MDV-3100) and CYP17A1 inhibitors such as abiraterone acetate (Zytiga). Ultimately, these agents will also fail to suppress CRPC. While some of the mechanisms by which these agents fail are unique, many share similarities to the mechanisms contributing to CRPC progression. Understanding these mechanisms of resistance to ADT and currently approved CRPC treatments will help guide future research into targeted therapies. PMID:26814148

  12. Mechanisms of resistance in castration-resistant prostate cancer (CRPC)

    PubMed Central

    Chandrasekar, Thenappan; Yang, Joy C.; Gao, Allen C.

    2015-01-01

    Despite advances in prostate cancer diagnosis and management, morbidity from prostate cancer remains high. Approximately 20% of men present with advanced or metastatic disease, while 29,000 men continue to die of prostate cancer each year. Androgen deprivation therapy (ADT) has been the standard of care for initial management of advanced or metastatic prostate cancer since Huggins and Hodges first introduced the concept of androgen-dependence in 1972, but progression to castration-resistant prostate cancer (CRPC) occurs within 2-3 years of initiation of ADT. CRPC, previously defined as hormone-refractory prostate cancer, is now understood to still be androgen dependent. Multiple mechanisms of resistance help contribute to the progression to castration resistant disease, and the androgen receptor (AR) remains an important driver in this progression. These mechanisms include AR amplification and hypersensitivity, AR mutations leading to promiscuity, mutations in coactivators/corepressors, androgen-independent AR activation, and intratumoral and alternative androgen production. More recently, identification of AR variants (ARVs) has been established as another mechanism of progression to CRPC. Docetaxel chemotherapy has historically been the first-line treatment for CRPC, but in recent years, newer agents have been introduced that target some of these mechanisms of resistance, thereby providing additional survival benefit. These include AR signaling inhibitors such as enzalutamide (Xtandi, ENZA, MDV-3100) and CYP17A1 inhibitors such as abiraterone acetate (Zytiga). Ultimately, these agents will also fail to suppress CRPC. While some of the mechanisms by which these agents fail are unique, many share similarities to the mechanisms contributing to CRPC progression. Understanding these mechanisms of resistance to ADT and currently approved CRPC treatments will help guide future research into targeted therapies. PMID:26814148

  13. Antimicrobial resistance profiles and mechanisms of resistance in Campylobacter jejuni isolates from pets.

    PubMed

    Acke, Els; McGill, Kevina; Quinn, Teresa; Jones, Boyd R; Fanning, Seamus; Whyte, Paul

    2009-01-01

    The presence of antimicrobial resistance in 51 Campylobacter jejuni isolates obtained from cats and dogs was determined by E-testing. Resistance to nalidixic acid (37.3% of isolates), ciprofloxacin (19.6%), tetracycline (13.7%), ampicillin (13.7%), erythromycin (11.8%), and chloramphenicol (5.9%) was detected. Resistance to two antimicrobials or more was present in 31.4% of isolates, and one isolate was resistant to all six antimicrobials. Of the isolates with ciprofloxacin and/or nalidixic acid resistance, 54.5% had the gyrA substitution Thr-86-Ile on sequencing. The tet o gene was detected in 75.0% isolates with high-level resistance to tetracycline. With the observed antimicrobial resistance in C. jejuni isolates from pets in this study, and the detection of identical mechanisms for quinolone and tetracycline resistance in pets and humans, pets should be considered a potential source of (multi)resistant C. jejuni infections in humans. PMID:19580444

  14. Molecular mechanisms for tumour resistance to chemotherapy.

    PubMed

    Pan, Shu-Ting; Li, Zhi-Ling; He, Zhi-Xu; Qiu, Jia-Xuan; Zhou, Shu-Feng

    2016-08-01

    Chemotherapy is one of the prevailing methods used to treat malignant tumours, but the outcome and prognosis of tumour patients are not optimistic. Cancer cells gradually generate resistance to almost all chemotherapeutic drugs via a variety of distinct mechanisms and pathways. Chemotherapeutic resistance, either intrinsic or acquired, is caused and sustained by reduced drug accumulation and increased drug export, alterations in drug targets and signalling transduction molecules, increased repair of drug-induced DNA damage, and evasion of apoptosis. In order to better understand the mechanisms of chemoresistance, this review highlights our current knowledge of the role of altered drug metabolism and transport and deregulation of apoptosis and autophagy in the development of tumour chemoresistance. Reduced intracellular activation of prodrugs (e.g. thiotepa and tegafur) or enhanced drug inactivation by Phase I and II enzymes contributes to the development of chemoresistance. Both primary and acquired resistance can be caused by alterations in the transport of anticancer drugs which is mediated by a variety of drug transporters such as P-glycoprotein (P-gp), multidrug resistance associated proteins, and breast cancer resistance protein. Presently there is a line of evidence indicating that deregulation of programmed cell death including apoptosis and autophagy is also an important mechanism for tumour resistance to anticancer drugs. Reversal of chemoresistance is likely via pharmacological and biological approaches. Further studies are warranted to grasp the full picture of how each type of cancer cells develop resistance to anticancer drugs and to identify novel strategies to overcome it. PMID:27097837

  15. Dominant mechanisms of primary resistance differ from dominant mechanisms of secondary resistance to targeted therapies.

    PubMed

    Asić, Ksenija

    2016-01-01

    The effectiveness of targeted therapies is currently limited, as almost all patients eventually acquire resistance within year/year and a half from therapy initiation and a small subset of a patients fail to respond at all, demonstrating intrinsic resistance. The aim of this review was to determine the potential common features and differences between the mechanisms of intrinsic and acquired resistance to targeted therapies by analyzing established resistance-generating alterations for ten FDA-approved targeted drugs. The frequency of alterations underlying intrinsic and acquired resistance shows distinctive pattern, where dominant mechanisms of intrinsic resistance include aberrations of signals downstream or upstream of the targeted protein and dominant mechanisms of acquired resistance refer to lesions in the target itself or alterations of signals at target-level that can mimic or compensate for target function. It appears that during the evolution of acquired resistance, the tumor cell is inclined to preserve the same oncogene addiction on a targeted protein it had prior to drug administration. On the other hand, intrinsic resistance develops early in tumorogenesis and is based on randomly selected mutated signals between targeted and non-targeted signaling pathways, leading to the acquisition of cancer hallmarks. In general, there is an overlap between the mechanisms of intrinsic and acquired resistance, but the occurrence frequency and distribution of alterations underlying intrinsic and acquired resistance to targeted therapies are significantly different. Focus should be placed on different group of genes in pursuing predictive markers for intrinsic and acquired resistance to targeted therapies. PMID:26364890

  16. Carbapenem Resistance Mechanisms in Pseudomonas aeruginosa Clinical Isolates

    PubMed Central

    Pai, Hyunjoo; Kim, Jong-Won; Kim, Jungmin; Lee, Ji Hyang; Choe, Kang Won; Gotoh, Naomasa

    2001-01-01

    In order to define the contributions of the mechanisms for carbapenem resistance in clinical strains of Pseudomonas aeruginosa, we investigated the presence of OprD, the expressions of the MexAB-OprM and MexEF-OprN systems, and the production of the β-lactamases for 44 clinical strains. All of the carbapenem-resistant isolates showed the loss of or decreased levels of OprD. Three strains overexpressed the MexAB-OprM efflux system by carrying mutations in mexR. These three strains had the amino acid substitution in MexR protein, Arg (CGG) → Gln (CAG), at the position of amino acid 70. None of the isolates, however, expressed the MexEF-OprN efflux system. For the characterization of β-lactamases, at least 13 isolates were the depressed mutants, and 12 strains produced secondary β-lactamases. Based on the above resistance mechanisms, the MICs of carbapenem for the isolates were analyzed. The MICs of carbapenem were mostly determined by the expression of OprD. The MICs of meropenem were two- to four-fold increased for the isolates which overexpressed MexAB-OprM in the background of OprD loss. However, the elevated MICs of meropenem for some individual isolates could not be explained. These findings suggested that other resistance mechanisms would play a role in meropenem resistance in clinical isolates of P. aeruginosa. PMID:11158744

  17. Insulin Resistance and Heart Failure: Molecular Mechanisms

    PubMed Central

    Aroor, Annayya R.; Mandavia, Chirag H.; Sowers, James R.

    2012-01-01

    Insulin resistance and associated reductions in cardiac insulin metabolic signaling is emerging as a major factor for the development of heart failure and assumes more importance because of an epidemic increase in obesity and the cardiorenal metabolic syndrome and our aging population. Major factors contributing to the development of cardiac insulin resistance are oxidative stress, hyperglycemia, hyperlipidemia, dysregulated secretion of adipokines/cytokines and inappropriate activation of renin-angiotensin II-aldosterone system (RAAS) and the sympathetic nervous system. The effects of cardiac insulin resistance are exacerbated by metabolic, endocrine and cytokine alterations associated with systemic insulin resistance. The aggregate of these various alterations leads to an insulin resistant phenotype with metabolic inflexibility, impaired calcium handling, mitochondrial dysfunction and oxidative stress, dysregulated myocardial-endothelial interactions resulting in energy deficiency, impaired diastolic dysfunction, myocardial cell death and cardiac fibrosis. Therefore, understanding the molecular mechanisms linking insulin resistance and heart failure may help to design new and more effective mechanism-based drugs to improve myocardial and systemic insulin resistance. PMID:22999243

  18. Complement resistance mechanisms of Klebsiella pneumoniae.

    PubMed

    Doorduijn, Dennis J; Rooijakkers, Suzan H M; van Schaik, Willem; Bardoel, Bart W

    2016-10-01

    The current emergence of antibiotic-resistant bacteria causes major problems in hospitals worldwide. To survive within the host, bacterial pathogens exploit several escape mechanisms to prevent detection and killing by the immune system. As a major player in immune defense, the complement system recognizes and destroys bacteria via different effector mechanisms. The complement system can label bacteria for phagocytosis or directly kill Gram-negative bacteria via insertion of a pore-forming complex in the bacterial membrane. The multi-drug resistant pathogen Klebsiella pneumoniae exploits several mechanisms to resist complement. In this review, we present an overview of strategies used by K. pneumoniae to prevent recognition and killing by the complement system. Understanding these complement evasion strategies is crucial for the development of innovative strategies to combat K. pneumoniae. PMID:27364766

  19. Plant adaptation to acid soils: the molecular basis for crop aluminum resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aluminum (Al) toxicity on acid soils is a significant limitation to crop production worldwide, as approximately 50% of the world’s potentially arable soils are acidic. Because acid soils are such an important constraint to agriculture, understanding the mechanisms and genes conferring resistance to ...

  20. Mechanism of action of and resistance to quinolones

    PubMed Central

    Fàbrega, Anna; Madurga, Sergi; Giralt, Ernest; Vila, Jordi

    2009-01-01

    Summary Fluoroquinolones are an important class of wide‐spectrum antibacterial agents. The first quinolone described was nalidixic acid, which showed a narrow spectrum of activity. The evolution of quinolones to more potent molecules was based on changes at positions 1, 6, 7 and 8 of the chemical structure of nalidixic acid. Quinolones inhibit DNA gyrase and topoisomerase IV activities, two enzymes essential for bacteria viability. The acquisition of quinolone resistance is frequently related to (i) chromosomal mutations such as those in the genes encoding the A and B subunits of the protein targets (gyrA, gyrB, parC and parE), or mutations causing reduced drug accumulation, either by a decreased uptake or by an increased efflux, and (ii) quinolone resistance genes associated with plasmids have been also described, i.e. the qnr gene that encodes a pentapeptide, which blocks the action of quinolones on the DNA gyrase and topoisomerase IV; the aac(6′)‐Ib‐cr gene that encodes an acetylase that modifies the amino group of the piperazin ring of the fluoroquinolones and efflux pump encoded by the qepA gene that decreases intracellular drug levels. These plasmid‐mediated mechanisms of resistance confer low levels of resistance but provide a favourable background in which selection of additional chromosomally encoded quinolone resistance mechanisms can occur. PMID:21261881

  1. Quinolone Resistance Mechanisms Among Salmonella enterica in Malaysia.

    PubMed

    Thong, Kwai Lin; Ngoi, Soo Tein; Chai, Lay Ching; Teh, Cindy Shuan Ju

    2016-06-01

    The prevalence of quinolone-resistant Salmonella enterica is on the rise worldwide. Salmonella enterica is one of the major foodborne pathogens in Malaysia. Therefore, we aim to investigate the occurrence and mechanisms of quinolone resistance among Salmonella strains isolated in Malaysia. A total of 283 Salmonella strains isolated from food, humans, and animals were studied. The disk diffusion method was used to examine the quinolone susceptibility of the strains, and the minimum inhibitory concentration (MIC) values of nalidixic acid and ciprofloxacin were also determined. DNA sequencing of the quinolone resistance-determining regions (QRDRs) of gyrase and topoisomerase IV genes and the plasmid-borne qnr genes was performed. The transfer of the qnr gene was examined through transconjugation experiment. A total of 101 nalidixic acid-resistant Salmonella strains were identified. In general, all strains were highly resistant to nalidixic acid (average MICNAL, 170 μg/ml). Resistance to ciprofloxacin was observed in 30.7% of the strains (1 ≤ MICCIP ≤ 2 μg/ml). Majority of the strains contained missense mutations in the QRDR of gyrA (69.3%). Silent mutations were frequently detected in gyrB (75.2%), parC (27.7%), and parE (51.5%) within and beyond the QRDRs. Novel mutations were detected in parC and parE. The plasmid-borne qnrS1 variant was found in 36.6% of the strains, and two strains were found to be able to transfer the qnrS1 gene. Overall, mutations in gyrA and the presence of qnrS1 genes might have contributed to the high level of quinolone resistance among the strains. Our study provided a better understanding on the status of quinolone resistance among Salmonella strains circulating in Malaysia. PMID:26683630

  2. Nanoscale resistive switching devices: mechanisms and modeling

    NASA Astrophysics Data System (ADS)

    Yang, Yuchao; Lu, Wei

    2013-10-01

    Resistive switching devices (also termed memristive devices or memristors) are two-terminal nonlinear dynamic electronic devices that can have broad applications in the fields of nonvolatile memory, reconfigurable logic, analog circuits, and neuromorphic computing. Current rapid advances in memristive devices in turn demand better understanding of the switching mechanism and the development of physics-based as well as simplified device models to guide future device designs and circuit-level applications. In this article, we review the physical processes behind resistive switching (memristive) phenomena and discuss the experimental and modeling efforts to explain these effects. In this article three categories of devices, in which the resistive switching effects are driven by cation migration, anion migration, and electronic effects, will be discussed. The fundamental driving forces and the stochastic nature of resistive switching will also be discussed.

  3. Nanoscale resistive switching devices: mechanisms and modeling.

    PubMed

    Yang, Yuchao; Lu, Wei

    2013-11-01

    Resistive switching devices (also termed memristive devices or memristors) are two-terminal nonlinear dynamic electronic devices that can have broad applications in the fields of nonvolatile memory, reconfigurable logic, analog circuits, and neuromorphic computing. Current rapid advances in memristive devices in turn demand better understanding of the switching mechanism and the development of physics-based as well as simplified device models to guide future device designs and circuit-level applications. In this article, we review the physical processes behind resistive switching (memristive) phenomena and discuss the experimental and modeling efforts to explain these effects. In this article three categories of devices, in which the resistive switching effects are driven by cation migration, anion migration, and electronic effects, will be discussed. The fundamental driving forces and the stochastic nature of resistive switching will also be discussed. PMID:24057010

  4. Antibacterial Mechanisms of Polymyxin and Bacterial Resistance

    PubMed Central

    Qin, Wangrong; Fang, Shisong; Qiu, Juanping

    2015-01-01

    Multidrug resistance in pathogens is an increasingly significant threat for human health. Indeed, some strains are resistant to almost all currently available antibiotics, leaving very limited choices for antimicrobial clinical therapy. In many such cases, polymyxins are the last option available, although their use increases the risk of developing resistant strains. This review mainly aims to discuss advances in unraveling the mechanisms of antibacterial activity of polymyxins and bacterial tolerance together with the description of polymyxin structure, synthesis, and structural modification. These are expected to help researchers not only develop a series of new polymyxin derivatives necessary for future medical care, but also optimize the clinical use of polymyxins with minimal resistance development. PMID:25664322

  5. [Resistance risk, cross-resistance and biochemical resistance mechanism of Laodelphax striatellus to buprofezin].

    PubMed

    Mao, Xu-lian; Liu, Jin; Li, Xu-ke; Chi, Jia-jia; Liu, Yong-jie

    2016-01-01

    In order to investigate the resistance development law and biochemical resistance mechanism of Laodelphax striatellus to buprofezin, spraying rice seedlings was used to continuously screen resistant strains of L. striatellus and dipping rice seedlings was applied to determine the toxicity and cross-resistance of L. striatellus to insecticides. After 32-generation screening with buprofezin, L. striatellus developed 168.49 folds resistance and its reality heritability (h2) was 0.11. If the killing rate was 80%-90%, L. striatellus was expected to develop 10-fold resistance to buprofezin only after 5 to 6 generations breeding. Because the actual reality heritability of field populations was usually lower than that of the resistant strains, the production of field populations increasing with 10-fold resistance would need much longer time. The results of cross-resistance showed that resistant strain had high level cross-resistance with thiamethoxam and imidacloprid, low level cross-resistance with acetamiprid, and no cross-resistance with pymetrozine and chlorpyrifos. The activity of detoxification enzymes of different strains and the syergism of synergist were measured. The results showed that cytochrome P450 monooxygenase played a major role in the resistance of L. striatellus to buprofezin, the esterase played a minor role and the GSH-S-transferase had no effect. Therefore, L. striatellus would have high risk to develop resistance to buprofezin when used in the field and might be delayed by using pymetrozine and chlorpyrifos. PMID:27228617

  6. [Obesity and fatty acids in the etiology of insulin resistance].

    PubMed

    Galgani, J; Díaz, E

    2000-12-01

    Fatty acids, obesity and insulin resistance relationship are discussed. In the last decades fatty acids (FA) have been implicated in the etiology of insulin resistance. Initially, this process was related to FA inhibitory effects on glucose uptake mediated by the FA oxidation metabolites. This mechanism known as the Randle cycle has been presently discarded based on recent evidence for FA effects on glucose metabolism. Now is known that cytosolic lipid content and FA molecular structure determines higher or lower storage and oxidation capacity. Another factor is given by Tumor Necrosis Factor-alpha, which is overexpressed in animal and human obesity, producing insulin signaling and glucose uptake inhibition. This paper discuss the role played by FA and obesity on insulin resistance, mainly in relation to FA effects on glucose metabolism in the liver, muscle and adipose tissues. In the obesity condition adipose tissue releases higher levels of free FA which in turn stimulates hepatic glucose production. Adipose tissue also, increase TNF-alpha secretion impairing glucose utilization and insulin signaling. In muscle, cytosolic lipid content activate a Protein Kinase that inhibits the insulin signaling and reduce GLUT-4 translocation. The study of cellular and metabolic changes associated to weight gain and its relationship with insulin resistance etiology are encouraged. PMID:11227245

  7. Glioblastoma Multiforme Therapy and Mechanisms of Resistance

    PubMed Central

    Ramirez, Yulian P.; Weatherbee, Jessica L.; Wheelhouse, Richard T.; Ross, Alonzo H.

    2013-01-01

    Glioblastoma multiforme (GBM) is a grade IV brain tumor characterized by a heterogeneous population of cells that are highly infiltrative, angiogenic and resistant to chemotherapy. The current standard of care, comprised of surgical resection followed by radiation and the chemotherapeutic agent temozolomide, only provides patients with a 12–14 month survival period post-diagnosis. Long-term survival for GBM patients remains uncommon as cells with intrinsic or acquired resistance to treatment repopulate the tumor. In this review we will describe the mechanisms of resistance, and how they may be overcome to improve the survival of GBM patients by implementing novel chemotherapy drugs, new drug combinations and new approaches relating to DNA damage, angiogenesis and autophagy. PMID:24287492

  8. Drug resistance in castration resistant prostate cancer: resistance mechanisms and emerging treatment strategies

    PubMed Central

    Armstrong, Cameron M; Gao, Allen C

    2015-01-01

    Several mechanisms facilitate the progression of hormone-sensitive prostate cancer to castration-resistant prostate cancer (CRPC). At present, the approved chemotherapies for CRPC include systemic drugs (docetaxel and cabazitaxel) and agents that target androgen signaling, including enzalutamide and abiraterone. While up to 30% of patients have primary resistance to these treatments, each of these drugs confers a significant survival benefit for many. Over time, however, all patients inevitably develop resistance to treatment and their disease will continue to progress. Several key mechanisms have been identified that give rise to drug resistance. Expression of constitutively active variants of the androgen receptor, such as AR-V7, intracrine androgens and overexpression of androgen synthesis enzymes like AKR1C3, and increased drug efflux through ABCB1 are just some of the many discovered mechanisms of drug resistance. Treatment strategies are being developed to target these pathways and reintroduce drug sensitivity. Niclosamide has been discovered to reduce AR-V7 activity and synergized to enzalutamide. Indomethacin has been explored to inhibit AKR1C3 activity and showed to be able to reverse resistance to enzalutamide. ABCB1 transport activity can be mitigated by the phytochemical apigenin and by antiandrogens such as bicalutamide, with each improving cellular response to chemotherapeutics. By better understanding the mechanisms by which drug resistance develops improved treatment strategies will be made possible. Herein, we review the existing knowledge of CRPC therapies and resistance mechanisms as well as methods that have been identified which may improve drug sensitivity. PMID:26309896

  9. Antifungals: Mechanism of Action and Drug Resistance.

    PubMed

    Prasad, Rajendra; Shah, Abdul Haseeb; Rawal, Manpreet Kaur

    2016-01-01

    There are currently few antifungals in use which show efficacy against fungal diseases. These antifungals mostly target specific components of fungal plasma membrane or its biosynthetic pathways. However, more recent class of antifungals in use is echinocandins which target the fungal cell wall components. The availability of mostly fungistatic antifungals in clinical use, often led to the development of tolerance to these very drugs by the pathogenic fungal species. Thus, the development of clinical multidrug resistance (MDR) leads to higher tolerance to drugs and its emergence is helped by multiple mechanisms. MDR is indeed a multifactorial phenomenon wherein a resistant organism possesses several mechanisms which contribute to display reduced susceptibility to not only single drug in use but also show collateral resistance to several drugs. Considering the limited availability of antifungals in use and the emergence of MDR in fungal infections, there is a continuous need for the development of novel broad spectrum antifungal drugs with better efficacy. Here, we briefly present an overview of the current understanding of the antifungal drugs in use, their mechanism of action and the emerging possible novel antifungal drugs with great promise. PMID:26721281

  10. 30 CFR 7.48 - Acid resistance test.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... solution of sulfuric acid (H2 SO4) by mixing 853 ml of water with 199 ml of sulfuric acid (H2 SO4) with a... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Acid resistance test. 7.48 Section 7.48 Mineral... MINING PRODUCTS TESTING BY APPLICANT OR THIRD PARTY Battery Assemblies § 7.48 Acid resistance test....

  11. 30 CFR 7.48 - Acid resistance test.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Acid resistance test. 7.48 Section 7.48 Mineral... MINING PRODUCTS TESTING BY APPLICANT OR THIRD PARTY Battery Assemblies § 7.48 Acid resistance test. (a... solution of sulfuric acid (H2 SO4) by mixing 853 ml of water with 199 ml of sulfuric acid (H2 SO4) with...

  12. 30 CFR 7.48 - Acid resistance test.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Acid resistance test. 7.48 Section 7.48 Mineral... MINING PRODUCTS TESTING BY APPLICANT OR THIRD PARTY Battery Assemblies § 7.48 Acid resistance test. (a... solution of sulfuric acid (H2 SO4) by mixing 853 ml of water with 199 ml of sulfuric acid (H2 SO4) with...

  13. Resistance mechanisms in fluconazole-resistant Candida albicans isolates from vaginal candidiasis.

    PubMed

    Cernicka, Jana; Subik, Julius

    2006-05-01

    Candida albicans is the most frequently identified yeast species causing mycotic vaginitis. A significant number of vaginal yeast isolates are resistant to azole antifungal agents in vitro. Here we investigated the molecular mechanisms of resistance in 22 randomly selected fluconazole-resistant vaginal C. albicans isolates. Twelve isolates in this collection were found to be cross-resistant to itraconazole and 15 to voriconazole. Most of them also displayed decreased susceptibility to terbinafine. Northern blot analyses revealed overexpression of the MDR1 gene in all isolates, which in some isolates was accompanied by elevated levels of CDR1/CDR2 and ERG11 expression. Sequence analysis of the polymerase chain reaction-amplified ERG11 gene of selected azole-resistant isolates identified D116E and V488I amino acid alterations in Erg11p that are known to be conserved in fluconazole-resistant strains. The results demonstrate that decreased susceptibilities of vaginal yeast isolates to clinically used azole derivatives are the result of a combination of several molecular mechanisms involving drug efflux and alterations in the structure or cellular amount of 14-alpha-lanosterol demethylase. PMID:16621465

  14. Mechanisms of Antibiotic Resistance Determined by Resistance-Transfer Factors1

    PubMed Central

    Unowsky, Joel; Rachmeler, Martin

    1966-01-01

    Unowsky, Joel (Northwestern University Medical School, Chicago, Ill.), and Martin Rachmeler. Mechanisms of antibiotic resistance determined by resistance-transfer factors. J. Bacteriol. 92:358–365. 1966.—This study was concerned with the mechanism of expression of drug resistance carried by resistance-transfer (R) factors of two types: fi− (negative fertility inhibition) and fi+ (positive fertility inhibition). The levels of drug resistance determined by R factors used in this study were similar to those reported by other investigators. A new finding was that Escherichia coli carrying the fi− episome was resistant to 150 to 200 μg/ml of streptomycin. The growth kinetics of R factor-containing cells were similar in the presence or absence of streptomycin, chloramphenicol, and tetracycline, but a period of adaptation was necessary before cells began exponential growth in the presence of tetracycline. By use of radioactive antibiotics, it was shown that cells containing the fi− episome were impermeable to tetracycline and streptomycin, whereas cells containing the fi+ episome were impermeable only to chloramphenicol. Cell-free extracts from fi+ and fi− cells were sensitive to the antibiotics tested in the polyuridylic acid-stimulated incorporation of phenylalanine into protein. PMID:16562121

  15. Mechanisms Involved in the Improvement of Lipotoxicity and Impaired Lipid Metabolism by Dietary α-Linolenic Acid Rich Salvia hispanica L (Salba) Seed in the Heart of Dyslipemic Insulin-Resistant Rats

    PubMed Central

    Creus, Agustina; Ferreira, María R.; Oliva, María E.; Lombardo, Yolanda B.

    2016-01-01

    This study explores the mechanisms underlying the altered lipid metabolism in the heart of dyslipemic insulin-resistant (IR) rats fed a sucrose-rich diet (SRD) and investigates if chia seeds (rich in α-linolenic acid 18:3, n-3 ALA) improve/reverse cardiac lipotoxicity. Wistar rats received an SRD-diet for three months. Half of the animals continued with the SRD up to month 6. The other half was fed an SRD in which the fat source, corn oil (CO), was replaced by chia seeds from month 3 to 6 (SRD+chia). A reference group consumed a control diet (CD) all the time. Triglyceride, long-chain acyl CoA (LC ACoA) and diacylglycerol (DAG) contents, pyruvate dehydrogenase complex (PDHc) and muscle-type carnitine palmitoyltransferase 1 (M-CPT1) activities and protein mass levels of M-CPT1, membrane fatty acid transporter (FAT/CD36), peroxisome proliferator activated receptor α (PPARα) and uncoupling protein 2 (UCP2) were analyzed. Results show that: (a) the hearts of SRD-fed rats display lipotoxicity suggesting impaired myocardial lipid utilization; (b) Compared with the SRD group, dietary chia normalizes blood pressure; reverses/improves heart lipotoxicity, glucose oxidation, the increased protein mass level of FAT/CD36, and the impaired insulin stimulated FAT/CD36 translocation to the plasma membrane. The enhanced M-CPT1 activity is markedly reduced without similar changes in protein mass. PPARα slightly decreases, while the UCP2 protein level remains unchanged in all groups. Normalization of dyslipidemia and IR by chia reduces plasma fatty acids (FAs) availability, suggesting that a different milieu prevents the robust translocation of FAT/CD36. This could reduce the influx of FAs, decreasing the elevated M-CPT1 activity and lipid storage and improving glucose oxidation in cardiac muscles of SRD-fed rats. PMID:26828527

  16. Mechanisms Involved in the Improvement of Lipotoxicity and Impaired Lipid Metabolism by Dietary α-Linolenic Acid Rich Salvia hispanica L (Salba) Seed in the Heart of Dyslipemic Insulin-Resistant Rats.

    PubMed

    Creus, Agustina; Ferreira, María R; Oliva, María E; Lombardo, Yolanda B

    2016-01-01

    This study explores the mechanisms underlying the altered lipid metabolism in the heart of dyslipemic insulin-resistant (IR) rats fed a sucrose-rich diet (SRD) and investigates if chia seeds (rich in α-linolenic acid 18:3, n-3 ALA) improve/reverse cardiac lipotoxicity. Wistar rats received an SRD-diet for three months. Half of the animals continued with the SRD up to month 6. The other half was fed an SRD in which the fat source, corn oil (CO), was replaced by chia seeds from month 3 to 6 (SRD+chia). A reference group consumed a control diet (CD) all the time. Triglyceride, long-chain acyl CoA (LC ACoA) and diacylglycerol (DAG) contents, pyruvate dehydrogenase complex (PDHc) and muscle-type carnitine palmitoyltransferase 1 (M-CPT1) activities and protein mass levels of M-CPT1, membrane fatty acid transporter (FAT/CD36), peroxisome proliferator activated receptor α (PPARα) and uncoupling protein 2 (UCP2) were analyzed. Results show that: (a) the hearts of SRD-fed rats display lipotoxicity suggesting impaired myocardial lipid utilization; (b) Compared with the SRD group, dietary chia normalizes blood pressure; reverses/improves heart lipotoxicity, glucose oxidation, the increased protein mass level of FAT/CD36, and the impaired insulin stimulated FAT/CD36 translocation to the plasma membrane. The enhanced M-CPT1 activity is markedly reduced without similar changes in protein mass. PPARα slightly decreases, while the UCP2 protein level remains unchanged in all groups. Normalization of dyslipidemia and IR by chia reduces plasma fatty acids (FAs) availability, suggesting that a different milieu prevents the robust translocation of FAT/CD36. This could reduce the influx of FAs, decreasing the elevated M-CPT1 activity and lipid storage and improving glucose oxidation in cardiac muscles of SRD-fed rats. PMID:26828527

  17. A paradoxical teratogenic mechanism for retinoic acid.

    PubMed

    Lee, Leo M Y; Leung, Chun-Yin; Tang, Walfred W C; Choi, Heung-Ling; Leung, Yun-Chung; McCaffery, Peter J; Wang, Chi-Chiu; Woolf, Adrian S; Shum, Alisa S W

    2012-08-21

    Retinoic acid, an active metabolite of vitamin A, plays essential signaling roles in mammalian embryogenesis. Nevertheless, it has long been recognized that overexposure to vitamin A or retinoic acid causes widespread teratogenesis in rodents as well as humans. Although it has a short half-life, exposure to high levels of retinoic acid can disrupt development of yet-to-be formed organs, including the metanephros, the embryonic organ which normally differentiates into the mature kidney. Paradoxically, it is known that either an excess or a deficiency of retinoic acid results in similar malformations in some organs, including the mammalian kidney. Accordingly, we hypothesized that excess retinoic acid is teratogenic by inducing a longer lasting, local retinoic acid deficiency. This idea was tested in an established in vivo mouse model in which exposure to excess retinoic acid well before metanephric rudiments exist leads to failure of kidney formation several days later. Results showed that teratogen exposure was followed by decreased levels of Raldh transcripts encoding retinoic acid-synthesizing enzymes and increased levels of Cyp26a1 and Cyp26b1 mRNAs encoding enzymes that catabolize retinoic acid. Concomitantly, there was significant reduction in retinoic acid levels in whole embryos and kidney rudiments. Restoration of retinoic acid levels by maternal supplementation with low doses of retinoic acid following the teratogenic insult rescued metanephric kidney development and abrogated several extrarenal developmental defects. This previously undescribed and unsuspected mechanism provides insight into the molecular pathway of retinoic acid-induced teratogenesis. PMID:22869719

  18. Resistant mechanisms to BRAF inhibitors in melanoma.

    PubMed

    Manzano, José Luís; Layos, Laura; Bugés, Cristina; de Los Llanos Gil, María; Vila, Laia; Martínez-Balibrea, Eva; Martínez-Cardús, Anna

    2016-06-01

    Patients with advanced melanoma have traditionally had very poor prognosis. However, since 2011 better understanding of the biology and epidemiology of this disease has revolutionized its treatment, with newer therapies becoming available. These newer therapies can be classified into immunotherapy and targeted therapy. The immunotherapy arsenal includes inhibitors of CTLA4, PD-1 and PDL-1, while targeted therapy focuses on BRAF and MEK. BRAF inhibitors (vemurafenib, dabrafenib) have shown benefit in terms of overall survival (OS) compared to chemotherapy, and their combination with MEK inhibitors has recently been shown to improve progression-free survival (PFS), compared with monotherapy with BRAF inhibitors. However, almost 20% of patients initially do not respond, due to intrinsic resistance to therapy and, of those who do, most eventually develop mechanisms of acquired resistance, including reactivation of the MAP kinase pathway, persistent activation of receptor tyrosine kinase (RTKS) receptor, activation of phosphatidyinositol-3OH kinase, overexpression of epidermal growth factor receptor (EGFR), and interactions with the tumor microenvironment. Herein we comment in detail on mechanisms of resistance to targeted therapy and discuss the strategies to overcome them. PMID:27429963

  19. Resistant mechanisms to BRAF inhibitors in melanoma

    PubMed Central

    Layos, Laura; Bugés, Cristina; de los Llanos Gil, María; Vila, Laia; Martínez-Balibrea, Eva; Martínez-Cardús, Anna

    2016-01-01

    Patients with advanced melanoma have traditionally had very poor prognosis. However, since 2011 better understanding of the biology and epidemiology of this disease has revolutionized its treatment, with newer therapies becoming available. These newer therapies can be classified into immunotherapy and targeted therapy. The immunotherapy arsenal includes inhibitors of CTLA4, PD-1 and PDL-1, while targeted therapy focuses on BRAF and MEK. BRAF inhibitors (vemurafenib, dabrafenib) have shown benefit in terms of overall survival (OS) compared to chemotherapy, and their combination with MEK inhibitors has recently been shown to improve progression-free survival (PFS), compared with monotherapy with BRAF inhibitors. However, almost 20% of patients initially do not respond, due to intrinsic resistance to therapy and, of those who do, most eventually develop mechanisms of acquired resistance, including reactivation of the MAP kinase pathway, persistent activation of receptor tyrosine kinase (RTKS) receptor, activation of phosphatidyinositol-3OH kinase, overexpression of epidermal growth factor receptor (EGFR), and interactions with the tumor microenvironment. Herein we comment in detail on mechanisms of resistance to targeted therapy and discuss the strategies to overcome them. PMID:27429963

  20. Acid tolerance mechanisms utilized by Streptococcus mutans

    PubMed Central

    Matsui, Robert; Cvitkovitch, Dennis

    2010-01-01

    Since its discovery in 1924 by J Clarke, Streptococcus mutans has been the focus of rigorous research efforts due to its involvement in caries initiation and progression. Its ability to ferment a range of dietary carbohydrates can rapidly drop the external environmental pH, thereby making dental plaque inhabitable to many competing species and can ultimately lead to tooth decay. Acid production by this oral pathogen would prove suicidal if not for its remarkable ability to withstand the acid onslaught by utilizing a wide variety of highly evolved acid-tolerance mechanisms. The elucidation of these mechanisms will be discussed, serving as the focus of this review. PMID:20210551

  1. Role of insulin resistance in uric acid nephrolithiasis

    PubMed Central

    Li, Hanhan; Klett, Dane E; Littleton, Raymond; Elder, Jack S; Sammon, Jesse D

    2014-01-01

    Metabolic syndrome has been implicated in the pathogenesis of uric acid stones. Although not completely understood, its role is supported by many studies demonstrating increased prevalence of uric acid stones in patients with metabolic syndrome and in particular insulin resistance, a major component of metabolic syndrome. This review presents epidemiologic studies demonstrating the association between metabolic syndrome and nephrolithiasis in general as well as the relationship between insulin resistance and uric acid stone formation, in particular. We also review studies that explore the pathophysiologic relationship between insulin resistance and uric acid nephrolithiasis. PMID:25374817

  2. The role of fatty acids in insulin resistance.

    PubMed

    Sears, Barry; Perry, Mary

    2015-01-01

    Insulin resistance is a multi-faceted disruption of the communication between insulin and the interior of a target cell. The underlying cause of insulin appears to be inflammation that can either be increased or decreased by the fatty acid composition of the diet. However, the molecular basis for insulin resistance can be quite different in various organs. This review deals with various types of inflammatory inputs mediated by fatty acids, which affect the extent of insulin resistance in various organs. PMID:26415887

  3. Mechanism of suppression of piperacillin resistance in enterobacteria by tazobactam.

    PubMed Central

    Kadima, T A; Weiner, J H

    1997-01-01

    Resistance to piperacillin in several isolates of Citrobacter freundii and Enterobacter cloacae was investigated and confirmed to occur at a frequency of 10(-7) to 10(-6). Development of resistance to piperacillin was significantly suppressed by tazobactam but not by clavulanic acid. To elucidate the mechanism by which resistance suppression occurs, the effect of piperacillin plus tazobactam on the induction of AmpC beta-lactamase was analyzed by monitoring the beta-galactosidase activity of an inducible ampC-lacZ gene fusion in Escherichia coli. The combination exerted no inhibitory effect on AmpC beta-lactamase induction. Tazobactam also had no effect on the accumulation of a key intermediate in the AmpC beta-lactamase induction pathway, 1,6-anhydromurotripeptide, in an ampD mutant strain of E. coli. However, the addition of tazobactam to liquid cultures of E. cloacae 40001 in the presence of piperacillin at four times the MIC caused a delay in the recovery of the culture to piperacillin-induced stress. At 16 times the MIC, a complete suppression of regrowth occurred. Analysis of culture viability on piperacillin plates showed that the culture recovery was due to growth by moderately resistant mutants preexisting in the cell population, which at 16 times the MIC became susceptible to the combination. Evidence from the kinetics of inhibition of the E. cloacae 40001 AmpC beta-lactamase by clavulanic acid, sulbactam, and tazobactam and from the effects of these drugs on the frequency of resistance to piperacillin suggests that the suppressive effect of tazobactam on the appearance of resistance is primarily mediated by the beta-lactamase inhibitory activity. PMID:9333044

  4. Metabolic engineering of acid resistance elements to improve acid resistance and propionic acid production of Propionibacterium jensenii.

    PubMed

    Guan, Ningzi; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian; Liu, Long

    2016-06-01

    Propionic acid (PA) and its salts are widely used in the food, pharmaceutical, and chemical industries. Microbial production of PA by propionibacteria is a typical product-inhibited process, and acid resistance is crucial in the improvement of PA titers and productivity. We previously identified two key acid resistance elements-the arginine deaminase and glutamate decarboxylase systems-that protect propionibacteria against PA stress by maintaining intracellular pH homeostasis. In this study, we attempted to improve the acid resistance and PA production of Propionibacterium jensenii ATCC 4868 by engineering these elements. Specifically, five genes (arcA, arcC, gadB, gdh, and ybaS) encoding components of the arginine deaminase and glutamate decarboxylase systems were overexpressed in P. jensenii. The activities of the five enzymes in the engineered strains were 26.7-489.0% higher than those in wild-type P. jensenii. The growth rates of the engineered strains decreased, whereas specific PA production increased significantly compared with those of the wild-type strain. Among the overexpressed genes, gadB (encoding glutamate decarboxylase) increased PA resistance and yield most effectively; the PA resistance of P. jensenii-gadB was more than 10-fold higher than that of the wild-type strain, and the production titer, yield, and conversion ratio of PA reached 10.81 g/L, 5.92 g/g cells, and 0.56 g/g glycerol, representing increases of 22.0%, 23.8%, and 21.7%, respectively. We also investigated the effects of introducing these acid resistance elements on the transcript levels of related enzymes. The results showed that the expression of genes in the engineered pathways affected the expression of the other genes. Additionally, the intracellular pools of amino acids were altered as different genes were overexpressed, which may further contribute to the enhanced PA production. This study provides an effective strategy for improving PA production in propionibacteria; this

  5. Influenza neuraminidase inhibitors: antiviral action and mechanisms of resistance

    PubMed Central

    McKimm‐Breschkin, Jennifer L.

    2012-01-01

    Please cite this paper as: McKimm‐Breschkin (2012) Influenza neuraminidase inhibitors: Antiviral action and mechanisms of resistance. Influenza and Other Respiratory Viruses 7(Suppl. 1), 25–36. There are two major classes of antivirals available for the treatment and prevention of influenza, the M2 inhibitors and the neuraminidase inhibitors (NAIs). The M2 inhibitors are cheap, but they are only effective against influenza A viruses, and resistance arises rapidly. The current influenza A H3N2 and pandemic A(H1N1)pdm09 viruses are already resistant to the M2 inhibitors as are many H5N1 viruses. There are four NAIs licensed in some parts of the world, zanamivir, oseltamivir, peramivir, and a long‐acting NAI, laninamivir. This review focuses on resistance to the NAIs. Because of differences in their chemistry and subtle differences in NA structures, resistance can be both NAI‐ and subtype specific. This results in different drug resistance profiles, for example, the H274Y mutation confers resistance to oseltamivir and peramivir, but not to zanamivir, and only in N1 NAs. Mutations at E119, D198, I222, R292, and N294 can also reduce NAI sensitivity. In the winter of 2007–2008, an oseltamivir‐resistant seasonal influenza A(H1N1) strain with an H274Y mutation emerged in the northern hemisphere and spread rapidly around the world. In contrast to earlier evidence of such resistant viruses being unfit, this mutant virus remained fully transmissible and pathogenic and became the major seasonal A(H1N1) virus globally within a year. This resistant A(H1N1) virus was displaced by the sensitive A(H1N1)pdm09 virus. Approximately 0·5–1·0% of community A(H1N1)pdm09 isolates are currently resistant to oseltamivir. It is now apparent that variation in non‐active site amino acids can affect the fitness of the enzyme and compensate for mutations that confer high‐level oseltamivir resistance resulting in minimal impact on enzyme function. PMID:23279894

  6. Analysis and modeling of resistive switching mechanisms oriented to resistive random-access memory

    NASA Astrophysics Data System (ADS)

    Huang, Da; Wu, Jun-Jie; Tang, Yu-Hua

    2013-03-01

    With the progress of the semiconductor industry, the resistive random-access memory (RAM) has drawn increasing attention. The discovery of the memristor has brought much attention to this study. Research has focused on the resistive switching characteristics of different materials and the analysis of resistive switching mechanisms. We discuss the resistive switching mechanisms of different materials in this paper and analyze the differences of those mechanisms from the view point of circuitry to establish their respective circuit models. Finally, simulations are presented. We give the prospect of using different materials in resistive RAM on account of their resistive switching mechanisms, which are applied to explain their resistive switchings.

  7. The multixenobiotic resistance mechanism in aquatic organisms

    SciTech Connect

    Kurelec, B. )

    1992-01-01

    Many aquatic organisms thrive and reproduce in polluted waters. This fact indicates that they are well equipped with a defense system(s) against several toxic xenobiotics simultaneously because water pollution is typically caused by a mixture of a number of pollutants. We have found that the biochemical mechanism underlying such multixenobiotic' resistance in freshwater and marine mussel, in several marine sponges, and in freshwater fish is similar to the mechanism of multidrug resistance (MDR) found in tumor cells that became refractory to treatment with a variety of chemotherapeutic agents. All these organisms possess a verapamil-sensitive potential to bind 2-acetylaminofluorene and vincristine onto membrane vesicles. They all express mRNA for mdr1 gene, and mdr1 protein product, the glycoprotein P170. Finally, in in vivo experiments, the accumulation of xenobiotics is enhanced in all investigated organisms in the presence of verapamil, the inhibitor of the P170 extrusion pump. The knowledge that the presence of one xenobiotic may block the pumping out, and hence accelerating accumulation, of others, may help us to understand and interpret our present and past data on different environmental parameters obtained using indicator organisms.99 references.

  8. Drug Resistance Reversal Potential of Ursolic Acid Derivatives against Nalidixic Acid- and Multidrug-resistant Escherichia coli.

    PubMed

    Dwivedi, Gaurav Raj; Maurya, Anupam; Yadav, Dharmendra Kumar; Khan, Feroz; Darokar, Mahendra P; Srivastava, Santosh Kumar

    2015-09-01

    As a part of our drug discovery program, ursolic acid was chemically transformed into six semi-synthetic derivatives, which were evaluated for their antibacterial and drug resistance reversal potential in combination with conventional antibiotic nalidixic acid against the nalidixic acid-sensitive and nalidixic acid-resistant strains of Escherichia coli. Although ursolic acid and its all semi-synthetic derivatives did not show antibacterial activity of their own, but in combination, they significantly reduced the minimum inhibitory concentration of nalidixic acid up to eightfold. The 3-O-acetyl-urs-12-en-28-isopropyl ester (UA-4) and 3-O-acetyl-urs-12-en-28-n-butyl ester (UA-5) derivatives of ursolic acid reduced the minimum inhibitory concentration of nalidixic acid by eightfold against nalidixic acid-resistant and four and eightfold against nalidixic acid-sensitive, respectively. The UA-4 and UA-5 were further evaluated for their synergy potential with another antibiotic tetracycline against the multidrug-resistant clinical isolate of Escherichia coli-KG4. The results showed that both these derivatives in combination with tetracycline reduced the cell viability in concentration-dependent manner by significantly inhibiting efflux pump. This was further supported by the in silico binding affinity of UA-4 and UA-5 with efflux pump proteins. These ursolic acid derivatives may find their potential use as synergistic agents in the treatment of multidrug-resistant Gram-negative infections. PMID:25476148

  9. Skin Commensal Staphylococci May Act as Reservoir for Fusidic Acid Resistance Genes

    PubMed Central

    Hung, Wei-Chun; Chen, Hsiao-Jan; Lin, Yu-Tzu; Tsai, Jui-Chang; Chen, Chiao-Wei; Lu, Hsiao-Hung; Tseng, Sung-Pin; Jheng, Yao-Yu; Leong, Kin Hong; Teng, Lee-Jene

    2015-01-01

    We analyzed the occurrence and mechanisms of fusidic acid resistance present in staphylococci isolated from 59 healthy volunteers. The fingers of the volunteers were screened for the presence of staphylococci, and the collected isolates were tested for resistance to fusidic acid. A total of 34 fusidic acid resistant staphylococcal strains (all were coagulase-negative) were isolated from 22 individuals (22/59, 37.3%). Examination of the resistance genes revealed that acquired fusB or fusC was present in Staphylococcus epidermidis, Staphylococcus capitis subsp. urealyticus, Staphylococcus hominis subsp. hominis, Staphylococcus warneri and Staphylococcus haemolyticus. Resistance islands (RIs) carrying fusB were found in S. epidermidis and S. capitis subsp. urealyticus, while staphylococcal chromosome cassette (SCC)-related structures harboring fusC were found in S. hominis subsp. hominis. Genotypic analysis of S. epidermidis and S. hominis subsp. hominis indicated that the fus elements were disseminated in diverse genetic strain backgrounds. The fusC elements in S. hominis subsp. hominis strains were highly homologous to SCCfusC in the epidemic sequence type (ST) 239/SCCmecIII methicillin-resistant S. aureus (MRSA) or the pseudo SCCmec in ST779 MRSA. The presence of acquired fusidic acid resistance genes and their genetic environment in commensal staphylococci suggested that the skin commensal staphylococci may act as reservoir for fusidic acid resistance genes. PMID:26581090

  10. Suppression of Acid Diffusion in Chemical Amplification Resists by Molecular Control of Base Matrix Polymers

    NASA Astrophysics Data System (ADS)

    Yoshimura, Toshiyuki; Shiraishi, Hiroshi; Okazaki, Shinji

    1995-12-01

    Suppression of acid diffusion during post-exposure baking (PEB) of chemical amplification resists is investigated from the standpoint of molecular control of base matrix polymers. Negative-type chemical amplification resists composed of cresol novolak-based matrix polymers, acid-catalyzed crosslinkers of melamine resins, and acid generators of onium salts are prepared. The molecular weight distributions of the base matrix polymers are controlled by means of a precipitation method. The resists are exposed with electron beams in isolated lines to evaluate the acid diffusion characteristics. Dependence of pattern sizes on the PEB time clearly shows that acid diffusion determines the resist pattern sizes based on Fick's law. The diffusion coefficients of resists with base matrix polymers with small polydispersities are smaller than those of resists with base matrix polymers with large polydispersities. Acid diffusion can still be suppressed by applying base matrix polymers with small weight-average molecular weights and small polydispersities. Diffusion coefficients can be further decreased by using base matrix polymers with more p-cresol components. A diffusion mechanism is proposed based on acid diffusion channels composed of active OH-groups and vacancies in the base matrix polymers.

  11. Aluminum resistance mechanisms in oat (Avena sativa L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Enhanced aluminum (Al) resistance has been observed in several dicots over-expressing enzymes involved in organic acid synthesis; however, this method for improving Al resistance has not been investigated in cereal crops such as oat (Avena sativa L.). Oat is considered among the most Al resistant ce...

  12. Arginine- and Polyamine-Induced Lactic Acid Resistance in Neisseria gonorrhoeae.

    PubMed

    Gong, Zheng; Tang, M Matt; Wu, Xueliang; Phillips, Nancy; Galkowski, Dariusz; Jarvis, Gary A; Fan, Huizhou

    2016-01-01

    Microbe-derived lactic acid protects women from pathogens in their genital tract. The purpose of this study was to determine lactic acid susceptibility of Neisseria gonorrhoeae, and identify potential acid resistance mechanisms present in this pathogen. Tested in vitro, lactic acid killed all 10 gonococcal strains analyzed in a low pH-dependent manner. Full inactivation occurred at pH 4.5. At low pH, lactic acid treatment resulted in the entry of the DNA-binding fluorochrome propidium iodide into the microbial cells, suggesting that hydrogen ions from lactic acid compromise the integrity of the bacterial cell wall/membrane. Most likely, hydrogen ions also inactivate intracellular proteins since arginine rendered significant protection against lactic acid presumably through action of the gonococcal arginine decarboxylase, an enzyme located in the bacterial cytoplasm. Surprisingly, arginine also lessened lactic acid-mediated cell wall/membrane disruption. This effect is probably mediated by agmatine, a triamine product of arginine decarboxylase, since agmatine demonstrated a stronger protective effect on GC than arginine at equal molar concentration. In addition to agmatine, diamines cadaverine and putrescine, which are generated by bacterial vaginosis-associated microbes, also induced significant resistance to lactic acid-mediated GC killing and cell wall/membrane disruption. These findings suggest that the arginine-rich semen protects gonococci through both neutralization-dependent and independent mechanisms, whereas polyamine-induced acid resistance contributes to the increased risk of gonorrhea in women with bacterial vaginosis. PMID:26808268

  13. Arginine- and Polyamine-Induced Lactic Acid Resistance in Neisseria gonorrhoeae

    PubMed Central

    Gong, Zheng; Tang, M. Matt; Wu, Xueliang; Phillips, Nancy; Galkowski, Dariusz; Jarvis, Gary A.; Fan, Huizhou

    2016-01-01

    Microbe-derived lactic acid protects women from pathogens in their genital tract. The purpose of this study was to determine lactic acid susceptibility of Neisseria gonorrhoeae, and identify potential acid resistance mechanisms present in this pathogen. Tested in vitro, lactic acid killed all 10 gonococcal strains analyzed in a low pH-dependent manner. Full inactivation occurred at pH 4.5. At low pH, lactic acid treatment resulted in the entry of the DNA-binding fluorochrome propidium iodide into the microbial cells, suggesting that hydrogen ions from lactic acid compromise the integrity of the bacterial cell wall/membrane. Most likely, hydrogen ions also inactivate intracellular proteins since arginine rendered significant protection against lactic acid presumably through action of the gonococcal arginine decarboxylase, an enzyme located in the bacterial cytoplasm. Surprisingly, arginine also lessened lactic acid-mediated cell wall/membrane disruption. This effect is probably mediated by agmatine, a triamine product of arginine decarboxylase, since agmatine demonstrated a stronger protective effect on GC than arginine at equal molar concentration. In addition to agmatine, diamines cadaverine and putrescine, which are generated by bacterial vaginosis-associated microbes, also induced significant resistance to lactic acid-mediated GC killing and cell wall/membrane disruption. These findings suggest that the arginine-rich semen protects gonococci through both neutralization-dependent and independent mechanisms, whereas polyamine-induced acid resistance contributes to the increased risk of gonorrhea in women with bacterial vaginosis. PMID:26808268

  14. Differential Costs of Two Distinct Resistance Mechanisms Induced by Different Herbivore Species in Arabidopsis.

    PubMed

    Onkokesung, Nawaporn; Reichelt, Michael; van Doorn, Arjen; Schuurink, Robert C; Dicke, Marcel

    2016-02-01

    Plants respond to herbivory with the induction of resistance, mediated by distinct phytohormonal signaling pathways and their interactions. Phloem feeders are known to induce plant resistance via the salicylic acid pathway, whereas biting-chewing herbivores induce plant resistance mainly via the jasmonate pathway. Here, we show that a specialist caterpillar (biting-chewing herbivore) and a specialist aphid (phloem feeder) differentially induce resistance against Pieris brassicae caterpillars in Arabidopsis (Arabidopsis thaliana) plants. Caterpillar feeding induces resistance through the jasmonate signaling pathway that is associated with the induction of kaempferol 3,7-dirhamnoside, whereas aphid feeding induces resistance via a novel mechanism involving sinapoyl malate. The role of sinapoyl malate is confirmed through the use of a mutant compromised in the biosynthesis of this compound. Caterpillar-induced resistance is associated with a lower cost in terms of plant growth reduction than aphid-induced resistance. A strong constitutive resistance against P. brassicae caterpillars in combination with a strong growth attenuation in plants of a transfer DNA (T-DNA) insertion mutant of WRKY70 (wrky70) suggest that the WRKY70 transcription factor, a regulator of downstream responses mediated by jasmonate-salicylic acid signaling cross talk, is involved in the negative regulation of caterpillar resistance and in the tradeoff between growth and defense. In conclusion, different mechanisms of herbivore-induced resistance come with different costs, and a functional WRKY70 transcription factor is required for the induction of low-cost resistance. PMID:26603653

  15. Protection of NdFeB magnets by corrosion resistance phytic acid conversion film

    NASA Astrophysics Data System (ADS)

    Nan, Haiyang; Zhu, Liqun; Liu, Huicong; Li, Weiping

    2015-11-01

    Phytic acid conversion film was prepared on NdFeB magnets by dipping the NdFeB into phytic acid solution. The morphology, composition, structure and corrosion resistance of the film were systematically investigated. The results showed that the phytic acid film was effective in improving the corrosion resistance of NdFeB magnets. XRD, TEM and FT-IR analyses revealed that the film was amorphous and had a strong peak of phosphate radical (PO43-). The formation mechanism of the film was also explored by XPS and the potential of zero charge (Epzc) measurement at the solution-metal interface.

  16. Molecular mechanisms of drug resistance and its reversal in cancer.

    PubMed

    Kartal-Yandim, Melis; Adan-Gokbulut, Aysun; Baran, Yusuf

    2016-08-01

    Chemotherapy is the main strategy for the treatment of cancer. However, the main problem limiting the success of chemotherapy is the development of multidrug resistance. The resistance can be intrinsic or acquired. The resistance phenotype is associated with the tumor cells that gain a cross-resistance to a large range of drugs that are structurally and functionally different. Multidrug resistance arises via many unrelated mechanisms, such as overexpression of energy-dependent efflux proteins, decrease in uptake of the agents, increase or alteration in drug targets, modification of cell cycle checkpoints, inactivation of the agents, compartmentalization of the agents, inhibition of apoptosis and aberrant bioactive sphingolipid metabolism. Exact elucidation of resistance mechanisms and molecular and biochemical approaches to overcome multidrug resistance have been a major goal in cancer research. This review comprises the mechanisms guiding multidrug resistance in cancer chemotherapy and also touches on approaches for reversing the resistance. PMID:25757878

  17. Leveraging the Mechanism of Oxidative Decay for Adenylate Kinase to Design Structural and Functional Resistances

    PubMed Central

    Howell, Stanley C.; Richards, David H.; Mitch, William A.; Wilson, Corey J.

    2016-01-01

    Characterization of the mechanisms underlying hypohalous acid (i.e., hypochlorous acid or hypobromous acid) degradation of proteins is important for understanding how the immune system deactivates pathogens during infections, and damages human tissues during inflammatory diseases. Proteins are particularly important hypohalous acid reaction targets in pathogens and in host tissues, as evidenced by the detection of chlorinated and brominated oxidizable residues. While a significant amount of work has been conducted for reactions of hypohalous acids with a range of individual amino acids and small peptides, the assessment of oxidative decay in full-length proteins has lagged in comparison. The most rigorous test of our understanding of oxidative decay of proteins is the rational redesign of proteins with conferred resistances to the decay of structure and function. Toward this end, in this study we experimentally determined a putative mechanism of oxidative decay using adenylate kinase as the model system. In turn, we leveraged this mechanism to rationally design new proteins and experimentally test each system for oxidative resistance to loss of structure and function. From our extensive assessment of secondary-structure, protein hydrodynamics and enzyme activity upon hypochlorous acid or hypobromous acid challenge, we have identified two key strategies for conferring structural and functional resistance. Namely, the design of proteins (adenylate kinase enzymes) that are resistant to oxidation requires complementary consideration of protein stability and the modification (elimination) of certain oxidizable residues proximal to catalytic sites. PMID:26266833

  18. Leveraging the Mechanism of Oxidative Decay for Adenylate Kinase to Design Structural and Functional Resistances.

    PubMed

    Howell, Stanley C; Richards, David H; Mitch, William A; Wilson, Corey J

    2015-10-16

    Characterization of the mechanisms underlying hypohalous acid (i.e., hypochlorous acid or hypobromous acid) degradation of proteins is important for understanding how the immune system deactivates pathogens during infections and damages human tissues during inflammatory diseases. Proteins are particularly important hypohalous acid reaction targets in pathogens and in host tissues, as evidenced by the detection of chlorinated and brominated oxidizable residues. While a significant amount of work has been conducted for reactions of hypohalous acids with a range of individual amino acids and small peptides, the assessment of oxidative decay in full-length proteins has lagged in comparison. The most rigorous test of our understanding of oxidative decay of proteins is the rational redesign of proteins with conferred resistances to the decay of structure and function. Toward this end, in this study, we experimentally determined a putative mechanism of oxidative decay using adenylate kinase as the model system. In turn, we leveraged this mechanism to rationally design new proteins and experimentally test each system for oxidative resistance to loss of structure and function. From our extensive assessment of secondary structure, protein hydrodynamics, and enzyme activity upon hypochlorous acid or hypobromous acid challenge, we have identified two key strategies for conferring structural and functional resistance, namely, the design of proteins (adenylate kinase enzymes) that are resistant to oxidation requires complementary consideration of protein stability and the modification (elimination) of certain oxidizable residues proximal to catalytic sites. PMID:26266833

  19. Pyrolysis Mechanisms of Aromatic Carboxylic Acids

    SciTech Connect

    Britt, P.F.; Eskay, T.P.; Buchanan, A.C. III

    1997-12-31

    Although decarboxylation of carboxylic acids is widely used in organic synthesis, there is limited mechanistic information on the uncatalyzed reaction pathways of aromatic carboxylic acids at 300-400 {degrees} C. The pyrolysis mechanisms of 1,2-(3,3-dicarboxyphenyl)ethane, 1,2-(4,4-dicarboxylphenyl)ethane, 1-(3-carboxyphenyl)-2-(4- biphenyl)ethane, and substituted benzoic acids have been investigated at 325-425 {degrees} C neat and diluted in an inert solvent. Decarboxylation is the dominant pyrolysis path. Arrhenius parameters, substituent effects, and deuterium isotope effects are consistent with decarboxylation by an electrophilic aromatic substitution reaction. Pyrolysis of benzoic acid in naphthalene, as a solvent, produces significant amounts of 1- and 2-phenylnaphthalenes. The mechanistic pathways for decarboxylation and arylation with be presented.

  20. Exploring the diversity of arsenic resistance genes from acid mine drainage microorganisms.

    PubMed

    Morgante, Verónica; Mirete, Salvador; de Figueras, Carolina G; Postigo Cacho, Marina; González-Pastor, José E

    2015-06-01

    The microbial communities from the Tinto River, a natural acid mine drainage environment, were explored to search for novel genes involved in arsenic resistance using a functional metagenomic approach. Seven pentavalent arsenate resistance clones were selected and analysed to find the genes responsible for this phenotype. Insights about their possible mechanisms of resistance were obtained from sequence similarities and cellular arsenic concentration. A total of 19 individual open reading frames were analysed, and each one was individually cloned and assayed for its ability to confer arsenic resistance in Escherichia coli cells. A total of 13 functionally active genes involved in arsenic resistance were identified, and they could be classified into different global processes: transport, stress response, DNA damage repair, phospholipids biosynthesis, amino acid biosynthesis and RNA-modifying enzymes. Most genes (11) encode proteins not previously related to heavy metal resistance or hypothetical or unknown proteins. On the other hand, two genes were previously related to heavy metal resistance in microorganisms. In addition, the ClpB chaperone and the RNA-modifying enzymes retrieved in this work were shown to increase the cell survival under different stress conditions (heat shock, acid pH and UV radiation). Thus, these results reveal novel insights about unidentified mechanisms of arsenic resistance. PMID:24801164

  1. Mechanisms of Resistance to Grapevine Powdery Mildew

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Although all high quality Vitis vinifera cultivars are highly susceptible to powdery mildew, current efforts show promise for the identification or modulation of resistance within the species and for continued introgression of resistance from resistant accessions of wild Vitis spp. Examination of t...

  2. Mechanisms of lichen resistance to metallic pollution

    SciTech Connect

    Sarret, C.; Manceau, A.; Eybert-Berard, L.; Cuny, D.; Haluwyn, C. van; Deruelle, S.; Hazemann, J.L.; Menthonnex, J.J. |; Soldo, Y.

    1998-11-01

    Some lichens have a unique ability to grow in heavily contaminated areas due to the development of adaptative mechanisms allowing a high tolerance to metals. Here the authors report on the chemical forms of Pb and Zn in the metal hyperaccumulator Diploschistes muscorum and of Pb in the metal tolerant lichen Xanthoria parietina. The speciation of Zn and Pb has been investigated by powder X-ray diffraction (XRD) and extended X-ray absorption fine structure (EXAFS) spectroscopy using the advanced third-generation synchrotron radiation source of the European synchrotron radiation facility (ESRF in Grenoble). This study reveals that in both lichens cells are protected from toxicity by complexation of heavy metals, but the strategies differ: in D. muscorum, Pb and Zn are accumulated through an enhanced synthesis of oxalate, which precipitates toxic elements as insoluble salts, whereas in X. parietina, Pb is complexed to carboxylic groups of the fungal cell walls. The authors conclude that hyperaccumulation of metals results from a reactive mechanism of organic acid production, whereas metallo-tolerance is achieved by a passive complexation to existing functional groups.

  3. Associations of erythrocyte fatty acid patterns with insulin resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Synergistic and/or additive effects on cardiometabolic risk may be missed by examining individual fatty acids (FA). A pattern analysis may be a more useful approach. As well, it remains unclear whether erythrocyte fatty acid composition relates to insulin resistance among Hispanic/Latino...

  4. Fluoroquinolone Resistance Mechanisms of Shigella flexneri Isolated in Bangladesh

    PubMed Central

    Azmi, Ishrat J.; Khajanchi, Bijay K.; Akter, Fatema; Hasan, Trisheeta N.; Shahnaij, Mohammad; Akter, Mahmuda; Banik, Atanu; Sultana, Halima; Hossain, Mohammad A.; Ahmed, Mohammad K.; Faruque, Shah M.; Talukder, Kaisar A.

    2014-01-01

    Objective To investigate the prevalence and mechanisms of fluoroquinolone resistance in Shigella species isolated in Bangladesh and to compare with similar strains isolated in China. Methods A total of 3789 Shigella isolates collected from Clinical Microbiology Laboratory of icddr,b, during 2004–2010 were analyzed for antibiotic susceptibility. Analysis of plasmids, plasmid-mediated quinolone-resistance genes, PFGE, and sequencing of genes of the quinolone-resistance-determining regions (QRDR) were conducted in representative strains isolated in Bangladesh and compared with strains isolated in Zhengding, China. In addition, the role of efflux-pump was studied by using the efflux-pump inhibitor carbonyl cyanide-m-chlorophenylhydrazone (CCCP). Results Resistance to ciprofloxacin in Shigella species increased from 0% in 2004 to 44% in 2010 and S. flexneri was the predominant species. Of Shigella spp, ciprofloxacin resistant (CipR) strains were mostly found among S. flexneri (8.3%), followed by S. sonnei (1.5%). Within S. flexneri (n = 2181), 14.5% were resistance to ciprofloxacin of which serotype 2a was predominant (96%). MIC of ciprofloxacin, norfloxacin, and ofloxacin were 6–32 mg/L, 8–32 mg/L, and 8–24 mg/L, respectively in S. flexneri 2a isolates. Sequencing of QRDR genes of resistant isolates showed double mutations in gyrA gene (Ser83Leu, Asp87Asn/Gly) and single mutation in parC gene (Ser80Ile). A difference in amino acid substitution at position 87 was found between strains isolated in Bangladesh (Asp87Asn) and China (Asp87Gly) except for one. A novel mutation at position 211 (His→Tyr) in gyrA gene was detected only in the Bangladeshi strains. Susceptibility to ciprofloxacin was increased by the presence of CCCP indicating the involvement of energy dependent active efflux pumps. A single PFGE type was found in isolates from Bangladesh and China suggesting their genetic relatedness. Conclusions Emergence of fluoroquinolone resistance in Shigella

  5. New nalidixic acid resistance mutations related to deoxyribonucleic acid gyrase activity.

    PubMed Central

    Yamagishi, J; Furutani, Y; Inoue, S; Ohue, T; Nakamura, S; Shimizu, M

    1981-01-01

    In Escherichia coli K-12 mutants which had a new nalidixic acid resistance mutation at about 82 min on the chromosome map, cell growth was resistant to or hypersusceptible to nalidixic acid, oxolinic acid, piromidic acid, pipemidic acid, and novobiocin. Deoxyribonucleic acid gyrase activity as tested by supercoiling of lambda phage deoxyribonucleic acid inside the mutants was similarly resistant or hypersusceptible to the compounds. The drug concentrations required for gyrase inhibition were much higher than those for cell growth inhibition but similar to those for inhibition of lambda phage multiplication. Transduction analysis with lambda phages carrying the chromosomal fragment of the tnaA-gyrB region suggested that one of the mutations, nal-31, was located on the gyrB gene. PMID:6271730

  6. Resistant mechanism study of benzalkonium chloride selected Salmonella Typhimurium mutants.

    PubMed

    Guo, Wei; Cui, Shenghui; Xu, Xiao; Wang, Haoyan

    2014-02-01

    Benzalkonium chloride is one of the invaluable biocides that is extensively used in healthcare settings as well as in the food processing industry. After exposing wild-type Salmonella Typhimurium 14028s or its AcrAB inactivation mutant to gradually increasing levels of benzalkonium chloride, resistance mutants S-41, S-150, S-AB-23, S-AB-38, and S-AB-73 were selected and these mutants also showed a 2-64-fold stable minimum inhibitory concentration (MIC) increase to chloramphenicol, ciprofloxacin, nalidixic acid, and tetracycline. In S-41 and S-150, the expression of acrB was increased 2.7- and 7.6-fold, and ΔtolC or ΔacrAB mutants of S-41 and S-150 showed the same MICs to all tested antimicrobials as the equivalent Salmonella Typhimurium 14028s mutants. However, in S-AB-23, S-AB-38, and S-AB-73, the expression of acrF was increased 96-, 230-, and 267-fold, respectively, and ΔtolC or ΔacrEF mutants of S-AB-23, S-AB-38, and S-AB-73 showed the similar MICs to all tested antimicrobials as the ΔtolC mutant of Salmonella Typhimurium 14028s. Our data showed that constitutively over-expressed AcrAB working through TolC was the main resistance mechanism in ST14028s benzalkonium chloride resistance mutants. However, after AcrAB had been inactivated, benzalkonium chloride-resistant mutants could still be selected and constitutively over-expressed, AcrEF became the dominant efflux pump working through TolC and being responsible for the increasing antimicrobial resistance. These data indicated that different mechanisms existed for acrB and acrF constitutive over-expression. Since exposure to benzalkonium chloride may lead to Salmonella mutants with a decreased susceptibility to quinolones, which is currently one of the drugs of choice for the treatment of life-threatening salmonelosis, research into the pathogenesis and epidemiology of the benzalkonium chloride resistance mutants will be of increasing importance. PMID:23987991

  7. Shigella Antimicrobial Drug Resistance Mechanisms, 2004-2014.

    PubMed

    Nüesch-Inderbinen, Magdalena; Heini, Nicole; Zurfluh, Katrin; Althaus, Denise; Hächler, Herbert; Stephan, Roger

    2016-06-01

    To determine antimicrobial drug resistance mechanisms of Shigella spp., we analyzed 344 isolates collected in Switzerland during 2004-2014. Overall, 78.5% of isolates were multidrug resistant; 10.5% were ciprofloxacin resistant; and 2% harbored mph(A), a plasmid-mediated gene that confers reduced susceptibility to azithromycin, a last-resort antimicrobial agent for shigellosis. PMID:27191035

  8. Shigella Antimicrobial Drug Resistance Mechanisms, 2004–2014

    PubMed Central

    Nüesch-Inderbinen, Magdalena; Heini, Nicole; Zurfluh, Katrin; Althaus, Denise; Hächler, Herbert

    2016-01-01

    To determine antimicrobial drug resistance mechanisms of Shigella spp., we analyzed 344 isolates collected in Switzerland during 2004–2014. Overall, 78.5% of isolates were multidrug resistant; 10.5% were ciprofloxacin resistant; and 2% harbored mph(A), a plasmid-mediated gene that confers reduced susceptibility to azithromycin, a last-resort antimicrobial agent for shigellosis. PMID:27191035

  9. Induction of Multidrug Resistance Mechanism in Escherichia coli Biofilms by Interplay between Tetracycline and Ampicillin Resistance Genes▿ †

    PubMed Central

    May, Thithiwat; Ito, Akinobu; Okabe, Satoshi

    2009-01-01

    Biofilms gain resistance to various antimicrobial agents, and the presence of antibiotic resistance genes is thought to contribute to a biofilm-mediated antibiotic resistance. Here we showed the interplay between the tetracycline resistance efflux pump TetA(C) and the ampicillin resistance gene (blaTEM-1) in biofilms of Escherichia coli harboring pBR322 in the presence of the mixture of ampicillin and tetracycline. E. coli in the biofilms could obtain the high-level resistance to ampicillin, tetracycline, penicillin, erythromycin, and chloramphenicol during biofilm development and maturation as a result of the interplay between the marker genes on the plasmids, the increase of plasmid copy number, and consequently the induction of the efflux systems on the bacterial chromosome, especially the EmrY/K and EvgA/S pumps. In addition, we characterized the overexpression of the TetA(C) pump that contributed to osmotic stress response and was involved in the induction of capsular colanic acid production, promoting formation of mature biofilms. However, this investigated phenomenon was highly dependent on the addition of the subinhibitory concentrations of antibiotic mixture, and the biofilm resistance behavior was limited to aminoglycoside antibiotics. Thus, marker genes on plasmids played an important role in both resistance of biofilm cells to antibiotics and in formation of mature biofilms, as they could trigger specific chromosomal resistance mechanisms to confer a high-level resistance during biofilm formation. PMID:19721076

  10. Mechanisms of Resistance to Aminoglycoside Antibiotics: Overview and Perspectives

    PubMed Central

    Garneau-Tsodikova, Sylvie

    2015-01-01

    Aminoglycoside (AG) antibiotics are used to treat many Gram-negative and some Gram-positive infections and, importantly, multidrug-resistant tuberculosis. Among various bacterial species, resistance to AGs arises through a variety of intrinsic and acquired mechanisms. The bacterial cell wall serves as a natural barrier for small molecules such as AGs and may be further fortified via acquired mutations. Efflux pumps work to expel AGs from bacterial cells, and modifications here too may cause further resistance to AGs. Mutations in the ribosomal target of AGs, while rare, also contribute to resistance. Of growing clinical prominence is resistance caused by ribosome methyltransferases. By far the most widespread mechanism of resistance to AGs is the inactivation of these antibiotics by AG-modifying enzymes. We provide here an overview of these mechanisms by which bacteria become resistant to AGs and discuss their prevalence and potential for clinical relevance. PMID:26877861

  11. Improved Acetic Acid Resistance in Saccharomyces cerevisiae by Overexpression of the WHI2 Gene Identified through Inverse Metabolic Engineering.

    PubMed

    Chen, Yingying; Stabryla, Lisa; Wei, Na

    2016-01-01

    Development of acetic acid-resistant Saccharomyces cerevisiae is important for economically viable production of biofuels from lignocellulosic biomass, but the goal remains a critical challenge due to limited information on effective genetic perturbation targets for improving acetic acid resistance in the yeast. This study employed a genomic-library-based inverse metabolic engineering approach to successfully identify a novel gene target, WHI2 (encoding a cytoplasmatic globular scaffold protein), which elicited improved acetic acid resistance in S. cerevisiae. Overexpression of WHI2 significantly improved glucose and/or xylose fermentation under acetic acid stress in engineered yeast. The WHI2-overexpressing strain had 5-times-higher specific ethanol productivity than the control in glucose fermentation with acetic acid. Analysis of the expression of WHI2 gene products (including protein and transcript) determined that acetic acid induced endogenous expression of Whi2 in S. cerevisiae. Meanwhile, the whi2Δ mutant strain had substantially higher susceptibility to acetic acid than the wild type, suggesting the important role of Whi2 in the acetic acid response in S. cerevisiae. Additionally, overexpression of WHI2 and of a cognate phosphatase gene, PSR1, had a synergistic effect in improving acetic acid resistance, suggesting that Whi2 might function in combination with Psr1 to elicit the acetic acid resistance mechanism. These results improve our understanding of the yeast response to acetic acid stress and provide a new strategy to breed acetic acid-resistant yeast strains for renewable biofuel production. PMID:26826231

  12. Structural stability and prebiotic properties of resistant starch type 3 increase bile acid turnover and lower secondary bile acid formation.

    PubMed

    Dongowski, Gerhard; Jacobasch, Gisela; Schmiedl, Detlef

    2005-11-16

    Microbial metabolism is essential in maintaining a healthy mucosa in the large bowel, preferentially through butyrate specific mechanisms. This system depends on starch supply. Two structurally different resistant starches type 3 (RS3) have been investigated with respect to their resistance to digestion, fermentability, and their effects on the composition and turnover of bile acids in rats. RSA (a mixture of retrograded maltodextrins and branched high molecular weight polymers), which is more resistant than RSB (a retrograded potato starch), increased the rate of fermentation accompanied by a decrease of pH in cecum, colon, and feces. Because they were bound to RS3, less bile acids were reabsorbed, resulting in a higher turnover through the large bowel. Because of the rise of volume, the bile acid level was unchanged and the formation of secondary bile acids was partly suppressed. The results proved a strong relation between RS3, short chain fatty acid production, and microflora. However, butyrate specific benefits are only achieved by an intake of RS3 that result in good fermentation properties, which depend on the kind of the resistant starch structures. PMID:16277431

  13. Investigation of carbon storage regulation network (csr genes) and phenotypic differences between acid sensitive and resistant Escherichia coli O157:H7 strains

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Escherichia coli O157:H7 and related serotype strains have previously been shown to vary in acid resistance, however, little is known about strain specific mechanisms of acid resistance. We examined sensitive and resistant E. coli strains to determine the effects of growth in minimal and...

  14. Inducible Expression of a Resistance-Nodulation-Division-Type Efflux Pump in Staphylococcus aureus Provides Resistance to Linoleic and Arachidonic Acids

    PubMed Central

    Alnaseri, Heba; Arsic, Benjamin; Schneider, James E. T.; Kaiser, Julienne C.; Scinocca, Zachariah C.; Heinrichs, David E.

    2015-01-01

    ABSTRACT Although Staphylococcus aureus is exposed to antimicrobial fatty acids on the skin, in nasal secretions, and in abscesses, a specific mechanism of inducible resistance to this important facet of innate immunity has not been identified. Here, we have sequenced the genome of S. aureus USA300 variants selected for their ability to grow at an elevated concentration of linoleic acid. The fatty acid-resistant clone FAR7 had a single nucleotide polymorphism resulting in an H121Y substitution in an uncharacterized transcriptional regulator belonging to the AcrR family, which was divergently transcribed from a gene encoding a member of the resistance-nodulation-division superfamily of multidrug efflux pumps. We named these genes farR and farE, for regulator and effector of fatty acid resistance, respectively. Several lines of evidence indicated that FarE promotes efflux of antimicrobial fatty acids and is regulated by FarR. First, expression of farE was strongly induced by arachidonic and linoleic acids in an farR-dependent manner. Second, an H121Y substitution in FarR resulted in increased expression of farE and was alone sufficient to promote increased resistance of S. aureus to linoleic acid. Third, inactivation of farE resulted in a significant reduction in the inducible resistance of S. aureus to the bactericidal activity of 100 μM linoleic acid, increased accumulation of [14C]linoleic acid by growing cells, and severely impaired growth in the presence of nonbactericidal concentrations of linoleic acid. Cumulatively, these findings represent the first description of a specific mechanism of inducible resistance to antimicrobial fatty acids in a Gram-positive pathogen. IMPORTANCE Staphylococcus aureus colonizes approximately 25% of humans and is a leading cause of human infectious morbidity and mortality. To persist on human hosts, S. aureus must have intrinsic defense mechanisms to cope with antimicrobial fatty acids, which comprise an important component of

  15. Resistance of geopolymer materials to acid attack

    SciTech Connect

    Bakharev, T

    2005-04-01

    This article presents an investigation into durability of geopolymer materials manufactured using a class F fly ash (FA) and alkaline activators when exposed to 5% solutions of acetic and sulfuric acids. The main parameters studied were the evolution of weight, compressive strength, products of degradation and microstructural changes. The degradation was studied using X-ray diffraction (XRD), Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM). The performance of geopolymer materials when exposed to acid solutions was superior to ordinary Portland cement (OPC) paste. However, significant degradation of strength was observed in some geopolymer materials prepared with sodium silicate and with a mixture of sodium hydroxide and potassium hydroxide as activators. The deterioration observed was connected to depolymerisation of the aluminosilicate polymers in acidic media and formation of zeolites, which in some cases lead to a significant loss of strength. The best performance was observed in the geopolymer material prepared with sodium hydroxide and cured at elevated temperature, which was attributed to a more stable cross-linked aluminosilicate polymer structure formed in this material.

  16. Does high serum uric acid level cause aspirin resistance?

    PubMed

    Yildiz, Bekir S; Ozkan, Emel; Esin, Fatma; Alihanoglu, Yusuf I; Ozkan, Hayrettin; Bilgin, Murat; Kilic, Ismail D; Ergin, Ahmet; Kaftan, Havane A; Evrengul, Harun

    2016-06-01

    In patients with coronary artery disease (CAD), though aspirin inhibits platelet activation and reduces atherothrombotic complications, it does not always sufficiently inhibit platelet function, thereby causing a clinical situation known as aspirin resistance. As hyperuricemia activates platelet turnover, aspirin resistance may be specifically induced by increased serum uric acid (SUA) levels. In this study, we thus investigated the association between SUA level and aspirin resistance in patients with CAD. We analyzed 245 consecutive patients with stable angina pectoris (SAP) who in coronary angiography showed more than 50% occlusion in a major coronary artery. According to aspirin resistance, two groups were formed: the aspirin resistance group (Group 1) and the aspirin-sensitive group (Group 2). Compared with those of Group 2, patients with aspirin resistance exhibited significantly higher white blood cell counts, neutrophil counts, neutrophil-to-lymphocyte ratios, SUA levels, high-sensitivity C-reactive protein levels, and fasting blood glucose levels. After multivariate analysis, a high level of SUA emerged as an independent predictor of aspirin resistance. The receiver-operating characteristic analysis provided a cutoff value of 6.45 mg/dl for SUA to predict aspirin resistance with 79% sensitivity and 65% specificity. Hyperuricemia may cause aspirin resistance in patients with CAD and high SUA levels may indicate aspirin-resistant patients. Such levels should thus recommend avoiding heart attack and stroke by adjusting aspirin dosage. PMID:26656902

  17. Chemical resistance/thermal and mechanical properties of unsaturated polyester-based nanocomposites

    NASA Astrophysics Data System (ADS)

    Jaya Vinse Ruban, Y.; Ginil Mon, S.; Vetha Roy, D.

    2013-01-01

    Nanocomposites were synthesized using unsaturated polyester as the matrix and organically modified montmorillonite (CA-MMT) as the reinforcing agent. XRD pattern of the modified montmorillonite showed that the interlayer spacing expanded from 1.21 to 1.9 nm, indicating intercalation. TGA and DTA show loss of organic surfactant from interlayer galleries. Glass transition temperature (T g) of these composites increased from 71 °C in the unfilled unsaturated polyester to 79 °C in the composites with 5 % organically modified montmorillonite. Chemical resistance and mechanical properties of the UP/organo-clay nanocomposites were studied. Chemical resistance was studied under aqueous conditions in acetic acid, nitric acid, hydrochloric acid, sodium hydroxide, aqueous ammonia and sodium carbonate. Chemical resistance studies reveal maximum weight gain/loss with increasing clay content. Mechanical studies show maximum characteristics for the composites-clay filled 5 % (w/w).

  18. Comparison of methods for acid quantification: impact of resist components on acid-generating efficiency

    NASA Astrophysics Data System (ADS)

    Cameron, James F.; Fradkin, Leslie; Moore, Kathryn; Pohlers, Gerd

    2000-06-01

    Chemically amplified deep UV (CA-DUV) positive resists are the enabling materials for manufacture of devices at and below 0.18 micrometer design rules in the semiconductor industry. CA-DUV resists are typically based on a combination of an acid labile polymer and a photoacid generator (PAG). Upon UV exposure, a catalytic amount of a strong Bronsted acid is released and is subsequently used in a post-exposure bake step to deprotect the acid labile polymer. Deprotection transforms the acid labile polymer into a base soluble polymer and ultimately enables positive tone image development in dilute aqueous base. As CA-DUV resist systems continue to mature and are used in increasingly demanding situations, it is critical to develop a fundamental understanding of how robust these materials are. One of the most important factors to quantify is how much acid is photogenerated in these systems at key exposure doses. For the purpose of quantifying photoacid generation several methods have been devised. These include spectrophotometric methods, ion conductivity methods and most recently an acid-base type titration similar to the standard addition method. This paper compares many of these techniques. First, comparisons between the most commonly used acid sensitive dye, tetrabromophenol blue sodium salt (TBPB) and a less common acid sensitive dye, Rhodamine B base (RB) are made in several resist systems. Second, the novel acid-base type titration based on the standard addition method is compared to the spectrophotometric titration method. During these studies, the make up of the resist system is probed as follows: the photoacid generator and resist additives are varied to understand the impact of each of these resist components on the acid generation process.

  19. Sphingolipids contribute to acetic acid resistance in Zygosaccharomyces bailii.

    PubMed

    Lindahl, Lina; Genheden, Samuel; Eriksson, Leif A; Olsson, Lisbeth; Bettiga, Maurizio

    2016-04-01

    Lignocellulosic raw material plays a crucial role in the development of sustainable processes for the production of fuels and chemicals. Weak acids such as acetic acid and formic acid are troublesome inhibitors restricting efficient microbial conversion of the biomass to desired products. To improve our understanding of weak acid inhibition and to identify engineering strategies to reduce acetic acid toxicity, the highly acetic-acid-tolerant yeast Zygosaccharomyces bailii was studied. The impact of acetic acid membrane permeability on acetic acid tolerance in Z. bailii was investigated with particular focus on how the previously demonstrated high sphingolipid content in the plasma membrane influences acetic acid tolerance and membrane permeability. Through molecular dynamics simulations, we concluded that membranes with a high content of sphingolipids are thicker and more dense, increasing the free energy barrier for the permeation of acetic acid through the membrane. Z. bailii cultured with the drug myriocin, known to decrease cellular sphingo-lipid levels, exhibited significant growth inhibition in the presence of acetic acid, while growth in medium without acetic acid was unaffected by the myriocin addition. Furthermore, following an acetic acid pulse, the intracellular pH decreased more in myriocin-treated cells than in control cells. This indicates a higher inflow rate of acetic acid and confirms that the reduction in growth of cells cultured with myriocin in the medium with acetic acid was due to an increase in membrane permeability, thereby demonstrating the importance of a high fraction of sphingolipids in the membrane of Z. bailii to facilitate acetic acid resistance; a property potentially transferable to desired production organisms suffering from weak acid stress. PMID:26416641

  20. Understanding the mechanisms and drivers of antimicrobial resistance.

    PubMed

    Holmes, Alison H; Moore, Luke S P; Sundsfjord, Arnfinn; Steinbakk, Martin; Regmi, Sadie; Karkey, Abhilasha; Guerin, Philippe J; Piddock, Laura J V

    2016-01-01

    To combat the threat to human health and biosecurity from antimicrobial resistance, an understanding of its mechanisms and drivers is needed. Emergence of antimicrobial resistance in microorganisms is a natural phenomenon, yet antimicrobial resistance selection has been driven by antimicrobial exposure in health care, agriculture, and the environment. Onward transmission is affected by standards of infection control, sanitation, access to clean water, access to assured quality antimicrobials and diagnostics, travel, and migration. Strategies to reduce antimicrobial resistance by removing antimicrobial selective pressure alone rely upon resistance imparting a fitness cost, an effect not always apparent. Minimising resistance should therefore be considered comprehensively, by resistance mechanism, microorganism, antimicrobial drug, host, and context; parallel to new drug discovery, broad ranging, multidisciplinary research is needed across these five levels, interlinked across the health-care, agriculture, and environment sectors. Intelligent, integrated approaches, mindful of potential unintended results, are needed to ensure sustained, worldwide access to effective antimicrobials. PMID:26603922

  1. Mechanisms of azole resistance among clinical isolates of Candida glabrata in Poland.

    PubMed

    Szweda, Piotr; Gucwa, Katarzyna; Romanowska, Ewa; Dzierzanowska-Fangrat, Katarzyna; Naumiuk, Łukasz; Brillowska-Dabrowska, Anna; Wojciechowska-Koszko, Iwona; Milewski, Sławomir

    2015-06-01

    Candida glabrata is currently ranked as the second most frequently isolated aetiological agent of human fungal infections, next only to Candida albicans. In comparison with C. albicans, C. glabrata shows lower susceptibility to azoles, the most common agents used in treatment of fungal infections. Interestingly, the mechanisms of resistance to azole agents in C. albicans have been much better investigated than those in C. glabrata. The aim of the presented study was to determine the mechanisms of resistance to azoles in 81 C. glabrata clinical isolates from three different hospitals in Poland. The investigation was carried out with a Sensititre Yeast One test and revealed that 18 strains were resistant to fluconazole, and 15 were cross-resistant to all other azoles tested (voriconazole, posaconazole and itraconazole). One isolate resistant to fluconazole was cross-resistant to voriconazole, and resistance to voriconazole only was observed in six other isolates. All strains were found to be susceptible to echinocandins and amphotericin B, and five were classified as resistant to 5-fluorocytosine. The sequence of the ERG11 gene encoding lanosterol 14-α demethylase (the molecular target of azoles) of 41 isolates, including all strains resistant to fluconazole and three resistant only to voriconazole, was determined, and no amino acid substitutions were found. Real-time PCR studies revealed that 13 of 15 azole-resistant strains showed upregulation of the CDR1 gene encoding the efflux pump. No upregulation of expression of the CDR2 or ERG11 gene was observed. PMID:25818698

  2. Mechanisms of drug resistance in Mycobacterium tuberculosis: update 2015.

    PubMed

    Zhang, Y; Yew, W-W

    2015-11-01

    Drug-resistant tuberculosis (DR-TB), including multi- and extensively drug-resistant TB, is posing a significant challenge to effective treatment and TB control worldwide. New progress has been made in our understanding of the mechanisms of resistance to anti-tuberculosis drugs. This review provides an update on the major advances in drug resistance mechanisms since the previous publication in 2009, as well as added information on mechanisms of resistance to new drugs and repurposed agents. The recent application of whole genome sequencing technologies has provided new insight into the mechanisms and complexity of drug resistance. However, further research is needed to address the significance of newly discovered gene mutations in causing drug resistance. Improved knowledge of drug resistance mechanisms will help understand the mechanisms of action of the drugs, devise better molecular diagnostic tests for more effective DR-TB management (and for personalised treatment), and facilitate the development of new drugs to improve the treatment of this disease. PMID:26467578

  3. Mechanisms Linking Inflammation to Insulin Resistance

    PubMed Central

    Chen, Li; Wang, Hua

    2015-01-01

    Obesity is now widespread around the world. Obesity-associated chronic low-grade inflammation is responsible for the decrease of insulin sensitivity, which makes obesity a major risk factor for insulin resistance and related diseases such as type 2 diabetes mellitus and metabolic syndromes. The state of low-grade inflammation is caused by overnutrition which leads to lipid accumulation in adipocytes. Obesity might increase the expression of some inflammatory cytokines and activate several signaling pathways, both of which are involved in the pathogenesis of insulin resistance by interfering with insulin signaling and action. It has been suggested that specific factors and signaling pathways are often correlated with each other; therefore, both of the fluctuation of cytokines and the status of relevant signaling pathways should be considered during studies analyzing inflammation-related insulin resistance. In this paper, we discuss how these factors and signaling pathways contribute to insulin resistance and the therapeutic promise targeting inflammation in insulin resistance based on the latest experimental studies. PMID:26136779

  4. Mechanisms Linking Inflammation to Insulin Resistance.

    PubMed

    Chen, Li; Chen, Rui; Wang, Hua; Liang, Fengxia

    2015-01-01

    Obesity is now widespread around the world. Obesity-associated chronic low-grade inflammation is responsible for the decrease of insulin sensitivity, which makes obesity a major risk factor for insulin resistance and related diseases such as type 2 diabetes mellitus and metabolic syndromes. The state of low-grade inflammation is caused by overnutrition which leads to lipid accumulation in adipocytes. Obesity might increase the expression of some inflammatory cytokines and activate several signaling pathways, both of which are involved in the pathogenesis of insulin resistance by interfering with insulin signaling and action. It has been suggested that specific factors and signaling pathways are often correlated with each other; therefore, both of the fluctuation of cytokines and the status of relevant signaling pathways should be considered during studies analyzing inflammation-related insulin resistance. In this paper, we discuss how these factors and signaling pathways contribute to insulin resistance and the therapeutic promise targeting inflammation in insulin resistance based on the latest experimental studies. PMID:26136779

  5. Acid phosphatase deactivation by a series mechanism.

    PubMed

    Gianfreda, L; Marrucci, G; Grizzuti, N; Greco, G

    1984-05-01

    Acid phosphatase (E.C.3.1.3.2.) thermal deactivation at pH 3.77 has been investigated by monitoring the enzyme activity as a function of time in the hydrolysis of p-nitrophenyl phosphate. The experimental curves obtained show a two-slope behavior in a log (activity)versus-time plot, which indicates that deactivation occurs via a complex mechanism. From the dependence of the kinetic parameters on both deactivation and hydrolysis temperatures, it is inferred that the deactivation mechanism involves intermediate, temperature-dependent, less-active forms of the enzyme. This interpretation is confirmed by the results of additional tests in which the temperature was suddenly changed during the deactivation process. PMID:18553349

  6. Novel nickel resistance genes from the rhizosphere metagenome of plants adapted to acid mine drainage.

    PubMed

    Mirete, Salvador; de Figueras, Carolina G; González-Pastor, Jose E

    2007-10-01

    Metal resistance determinants have traditionally been found in cultivated bacteria. To search for genes involved in nickel resistance, we analyzed the bacterial community of the rhizosphere of Erica andevalensis, an endemic heather which grows at the banks of the Tinto River, a naturally metal-enriched and extremely acidic environment in southwestern Spain. 16S rRNA gene sequence analysis of rhizosphere DNA revealed the presence of members of five phylogenetic groups of Bacteria and the two main groups of Archaea mostly associated with sites impacted by acid mine drainage (AMD). The diversity observed and the presence of heavy metals in the rhizosphere led us to construct and screen five different metagenomic libraries hosted in Escherichia coli for searching novel nickel resistance determinants. A total of 13 positive clones were detected and analyzed. Insights about their possible mechanisms of resistance were obtained from cellular nickel content and sequence similarities. Two clones encoded putative ABC transporter components, and a novel mechanism of metal efflux is suggested. In addition, a nickel hyperaccumulation mechanism is proposed for a clone encoding a serine O-acetyltransferase. Five clones encoded proteins similar to well-characterized proteins but not previously reported to be related to nickel resistance, and the remaining six clones encoded hypothetical or conserved hypothetical proteins of uncertain functions. This is the first report documenting nickel resistance genes recovered from the metagenome of an AMD environment. PMID:17675438

  7. Update on antifungal drug resistance mechanisms of Aspergillus fumigatus.

    PubMed

    Chamilos, G; Kontoyiannis, D P

    2005-12-01

    Although the arsenal of agents with anti-Aspergillus activity has expanded over the last decade, mortality due to invasive aspergillosis (IA) remains unacceptably high. Aspergillus fumigatus still accounts for the majority of cases of IA; however less susceptible to antifungals non-fumigatus aspergilli began to emerge. Antifungal drug resistance of Aspergillus might partially account for treatment failures. Recent advances in our understanding of mechanisms of antifungal drug action in Aspergillus, along with the standardization of in vitro susceptibility testing methods, has brought resistance testing to the forefront of clinical mycology. In addition, molecular biology has started to shed light on the mechanisms of resistance of A. fumigatus to azoles and the echinocandins, while genome-based assays show promise for high-throughput screening for genotypic antifungal resistance. Several problems remain, however, in the study of this complex area. Large multicenter clinical studies--point prevalence or longitudinal--to capture the incidence and prevalence of antifungal resistance in A. fumigatus isolates are lacking. Correlation of in vitro susceptibility with clinical outcome and susceptibility breakpoints has not been established. In addition, the issue of cross-resistance between the newer triazoles is of concern. Furthermore, in vitro resistance testing for polyenes and echinocandins is difficult, and their mechanisms of resistance are largely unknown. This review examines challenges in the diagnosis, epidemiology, and mechanisms of antifungal drug resistance in A. fumigatus. PMID:16488654

  8. Mechanism of action of 5-arninosalicylic acid

    PubMed Central

    Greenfield, S. M.; Thompson, R. P. H.

    1992-01-01

    5-Aminosalicylic Acid (5-ASA) has been used for over 50 years in the treatment of inflammatory bowel disease in the pro-drug form sulphasalazine (SASP). SASP is also used to treat rheumatoid arthritis. However whether the therapeutic properties of SASP are due to the intact molecule, the 5-ASA or sulphapyridine components is unknown. Several mechanisms of action have been proposed for 5-ASA and SASP including interference in the metabolism of arachidonic acid to prostaglandins and leukotrienes, scavenging,of reactive oxygen species, effects on leucocyte function and production of cytokines. However, it is unlikely that the anti-inflammatory properties of SASP and 5-ASA are due to several different properties but more likely that a single property of 5-ASA explains the theraapeutic effects of 5-ASA and SASP. Reactive oxygen species (ROS) are involved in the metabolism of prostaglandins and leukotrienes and can act as second messengers, and so the scavenging of ROS may be the single mechanism of action of 5-ASA that gives rise to its antiinflammatory effects in both inflammatory bowel disease and rheumatoid arthritis. PMID:18475455

  9. Antibiotic Resistances of Starter and Probiotic Strains of Lactic Acid Bacteria▿

    PubMed Central

    Hummel, Anja S.; Hertel, Christian; Holzapfel, Wilhelm H.; Franz, Charles M. A. P.

    2007-01-01

    The antibiotic resistances of 45 lactic acid bacteria strains belonging to the genera Lactobacillus, Streptococcus, Lactococcus, Pediococcus, and Leuconostoc were investigated. The objective was to determine antibiotic resistances and to verify these at the genetic level, as is currently suggested by the European “qualified presumption of safety” safety evaluation system for industrial starter strains. In addition, we sought to pinpoint possible problems in resistance determinations. Primers were used to PCR amplify genes involved in β-lactam antibiotic, chloramphenicol, tetracycline, and erythromycin resistance. The presence of ribosomal protection protein genes and the ermB gene was also determined by using a gene probe. Generally, the incidences of erythromycin, chloramphenicol, tetracycline, or β-lactam resistances in this study were low (<7%). In contrast, aminoglycoside (gentamicin and streptomycin) and ciprofloxacin resistances were higher than 70%, indicating that these may constitute intrinsic resistances. The genetic basis for ciprofloxacin resistance could not be verified, since no mutations typical of quinolone resistances were detected in the quinolone determining regions of the parC and gyrA genes. Some starter strains showed low-level ampicillin, penicillin, chloramphenicol, and tetracycline resistances, but no known resistance genes could be detected. Although some strains possessed the cat gene, none of these were phenotypically resistant to chloramphenicol. Using reverse transcription-PCR, these cat genes were shown to be silent under both inducing and noninducing conditions. Only Lactobacillus salivarius BFE 7441 possessed an ermB gene, which was encoded on the chromosome and which could not be transferred in filter-mating experiments. This study clearly demonstrates problems encountered with resistance testing, in that the breakpoint values are often inadequately identified, resistance genes may be present but silent, and the genetic basis

  10. 30 CFR 7.48 - Acid resistance test.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... MINING PRODUCTS TESTING BY APPLICANT OR THIRD PARTY Battery Assemblies § 7.48 Acid resistance test. (a) Test procedures. (1) Prepare one sample each of the insulated surfaces of the battery box and of the... insulation plus the battery cover or box material. The insulation thickness shall be representative of...

  11. 30 CFR 7.48 - Acid resistance test.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... MINING PRODUCTS TESTING BY APPLICANT OR THIRD PARTY Battery Assemblies § 7.48 Acid resistance test. (a) Test procedures. (1) Prepare one sample each of the insulated surfaces of the battery box and of the... insulation plus the battery cover or box material. The insulation thickness shall be representative of...

  12. Microbial resistance to disinfectants: mechanisms and significance

    SciTech Connect

    Hoff, J.C.; Akin, E.W.

    1986-11-01

    Drinking water disinfection provides the final barrier to transmission of a wide variety of potentially waterborne infectious agents including pathogenic bacteria, viruses, and protozoa. These agents differ greatly in their innate resistance to inactivation by disinfectants, ranging from extremely sensitive bacteria to highly resistant protozoan cysts. The close similarity between microorganism inactivation rates and the kinetics of chemical reactions has long been recognized. Ideally, under carefully controlled conditions, microorganism inactivation rates simulate first-order chemical reaction rates, making it possible to predict the effectiveness of disinfection under specific conditions. In practice, changes in relative resistance and deviations from first-order kinetics are caused by a number of factors, including microbial growth conditions, aggregation, and association with particulate materials. The net effect of all these factors is a reduction in the effectiveness and predictability of disinfection processes. To ensure effective pathogen control, disinfectant concentrations and contact times greater than experimentally determined values may be required. Of the factors causing enhanced disinfection resistance, protection by association with particulate matter is the most significant. Therefore, removal of particulate matter is an important step in increasing the effectiveness of disinfection processes.

  13. Microbial resistance to disinfectants: mechanisms and significance.

    PubMed Central

    Hoff, J C; Akin, E W

    1986-01-01

    Drinking water disinfection provides the final barrier to transmission of a wide variety of potentially waterborne infectious agents including pathogenic bacteria, viruses, and protozoa. These agents differ greatly in their innate resistance to inactivation by disinfectants, ranging from extremely sensitive bacteria to highly resistant protozoan cysts. The close similarity between microorganism inactivation rates and the kinetics of chemical reactions has long been recognized. Ideally, under carefully controlled conditions, microorganism inactivation rates simulate first-order chemical reaction rates, making it possible to predict the effectiveness of disinfection under specific conditions. In practice, changes in relative resistance and deviations from first-order kinetics are caused by a number of factors, including microbial growth conditions, aggregation, and association with particulate materials. The net effect of all these factors is a reduction in the effectiveness and predictability of disinfection processes. To ensure effective pathogen control, disinfectant concentrations and contact times greater than experimentally determined values may be required. Of the factors causing enhanced disinfection resistance, protection by association with particulate matter is the most significant. Therefore, removal of particulate matter is an important step in increasing the effectiveness of disinfection processes. Images FIGURE 6. PMID:3816738

  14. Roles of the Major, Small, Acid-Soluble Spore Proteins and Spore-Specific and Universal DNA Repair Mechanisms in Resistance of Bacillus subtilis Spores to Ionizing Radiation from X Rays and High-Energy Charged-Particle Bombardment▿

    PubMed Central

    Moeller, Ralf; Setlow, Peter; Horneck, Gerda; Berger, Thomas; Reitz, Günther; Rettberg, Petra; Doherty, Aidan J.; Okayasu, Ryuichi; Nicholson, Wayne L.

    2008-01-01

    The role of DNA repair by nonhomologous end joining (NHEJ), homologous recombination, spore photoproduct lyase, and DNA polymerase I and genome protection via α/β-type small, acid-soluble spore proteins (SASP) in Bacillus subtilis spore resistance to accelerated heavy ions (high-energy charged [HZE] particles) and X rays has been studied. Spores deficient in NHEJ and α/β-type SASP were significantly more sensitive to HZE particle bombardment and X-ray irradiation than were the recA, polA, and splB mutant and wild-type spores, indicating that NHEJ provides an efficient DNA double-strand break repair pathway during spore germination and that the loss of the α/β-type SASP leads to a significant radiosensitivity to ionizing radiation, suggesting the essential function of these spore proteins as protectants of spore DNA against ionizing radiation. PMID:18055591

  15. Antibiotic resistance in food lactic acid bacteria--a review.

    PubMed

    Mathur, Shalini; Singh, Rameshwar

    2005-12-15

    Antibiotics are a major tool utilized by the health care industry to fight bacterial infections; however, bacteria are highly adaptable creatures and are capable of developing resistance to antibiotics. Consequently, decades of antibiotic use, or rather misuse, have resulted in bacterial resistance to many modern antibiotics. This antibiotic resistance can cause significant danger and suffering for many people with common bacterial infections, those once easily treated with antibiotics. For several decades studies on selection and dissemination of antibiotic resistance have focused mainly on clinically relevant species. However, recently many investigators have speculated that commensal bacteria including lactic acid bacteria (LAB) may act as reservoirs of antibiotic resistance genes similar to those found in human pathogens. The main threat associated with these bacteria is that they can transfer resistance genes to pathogenic bacteria. Genes conferring resistance to tetracycline, erythromycin and vancomycin have been detected and characterized in Lactococcus lactis, Enterococci and, recently, in Lactobacillus species isolated from fermented meat and milk products. A number of initiatives have been recently launched by various organizations across the globe to address the biosafety concerns of starter cultures and probiotic microorganisms. The studies can lead to better understanding of the role played by the dairy starter microorganisms in horizontal transfer of antibiotic resistance genes to intestinal microorganisms and food-associated pathogenic bacteria. PMID:16289406

  16. Fatty acid composition and freeze-thaw resistance in lactobacilli.

    PubMed

    Gomez Zavaglia, A; Disalvo, E A; De Antoni, G L

    2000-05-01

    The fatty acid composition and freeze-thaw resistance of eight strains of thermophilic lactobacilli were studied. Seven of these contained the same polar and neutral lipids, the five major components making up 90% of the cellular fatty acid pool being 14:0, 16:0, 16:1, 18:1 and C19 cyclopropane (cyc19:0). Strain comparison by means of cluster analysis based on the fatty acid ratios using the overlap coefficient revealed two well defined clusters. One was formed by three strains of species Lactobacillus delbrueckii subsp. lactis and Lb. delbrueckii subsp. delbrueckii, the other included five strains of the species Lb. delbrueckii subsp. bulgaricus, Lb. acidophilus and Lb. helveticus. Resistance of strains with a high content of unsaturated fatty acids (66-70%) decreased with increasing cyc19:0 concentrations. In contrast, in strains with a low concentration of unsaturated fatty acids (42-49%), increasing cyc19:0 levels were associated with increased freeze-thaw resistance. PMID:10840678

  17. Mechanism of Insect Resistance to the Microbial Insecticide Bacillus thuringiensis

    NASA Astrophysics Data System (ADS)

    van Rie, J.; McGaughey, W. H.; Johnson, D. E.; Barnett, B. D.; van Mellaert, H.

    1990-01-01

    Receptor binding studies show that resistance of a laboratory-selected Plodia interpunctella strain to a Bacillus thuringiensis insecticidal crystal protein (ICP) is correlated with a 50-fold reduction in affinity of the membrane receptor for this protein. The strain is sensitive to a second type of ICP that apparently recognizes a different receptor. Understanding the mechanism of resistance will provide strategies to prevent or delay resistance and hence prolong the usefulness of B. thuringiensis ICPs as environmentally safe insecticides.

  18. Resistance mechanisms against arthropod herbivores in cotton

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cotton plants from the genus Gossypium are grown on more than 30 million hectares worldwide and are a major source of fiber. The plants possess a wide-range of indirect and direct-defense mechanisms against arthropod pests. Direct defense mechanisms include morphological traits such as trichomes and...

  19. Mechanisms of naturally evolved ethanol resistance in Drosophila melanogaster.

    PubMed

    Fry, James D

    2014-11-15

    The decaying fruit in which Drosophila melanogaster feed and breed can contain ethanol in concentrations as high as 6-7%. In this cosmopolitan species, populations from temperate regions are consistently more resistant to ethanol poisoning than populations from the tropics, but little is known about the physiological basis of this difference. I show that when exposed to low levels of ethanol vapor, flies from a tropical African population accumulated 2-3 times more internal ethanol than flies from a European population, giving evidence that faster ethanol catabolism by European flies contributes to the resistance difference. Using lines differing only in the origin of their third chromosome, however, I show that faster ethanol elimination cannot fully explain the resistance difference, because relative to African third chromosomes, European third chromosomes confer substantially higher ethanol resistance, while having little effect on internal ethanol concentrations. European third chromosomes also confer higher resistance to acetic acid, a metabolic product of ethanol, than African third chromosomes, suggesting that the higher ethanol resistance conferred by the former might be due to increased resistance to deleterious effects of ethanol-derived acetic acid. In support of this hypothesis, when ethanol catabolism was blocked with an Alcohol dehydrogenase mutant, there was no difference in ethanol resistance between flies with European and African third chromosomes. PMID:25392459

  20. What have the mechanisms of resistance to glyphosate taught us?

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The intensive use of glyphosate alone to manage weeds has selected populations that are glyphosate resistant. The three mechanisms of glyphosate resistance that have been elucidated are 1) target site mutations; 2) gene amplification; and 3) altered translocation due to sequestration. What have we...

  1. Anthelmintic Resistance in Haemonchus contortus: History, Mechanisms and Diagnosis.

    PubMed

    Kotze, A C; Prichard, R K

    2016-01-01

    Haemonchus contortus has shown a great ability to develop resistance to anthelmintic drugs. In many instances, resistance has appeared less than 10years after the introduction of a new drug class. Field populations of this species now show resistance to all major anthelmintic drug classes, including benzimidazoles (BZs), imidazothiazoles and macrocyclic lactones. In addition, resistance to the recently introduced amino-acetonitrile derivative class (monepantel) has already been reported. The existence of field populations showing resistance to all three major drug classes, and the early appearance of resistance to monepantel, threatens the sustainability of sheep and goat production systems worldwide. This chapter reviews the history of the development of resistance to the various anthelmintics in H. contortus and examines the mechanisms utilized by this species to resist the effects of these drugs. Some of these mechanisms are well understood, particularly for BZ drugs, while our knowledge and understanding of others are increasing. Finally, we summarize methods available for the diagnosis of resistance. While such diagnosis currently relies largely on the faecal egg count reduction test, which suffers from issues of expense and sensitivity, we describe past and current efforts to utilize cheaper and less laborious phenotypic assays with free-living life stages, and then describe progress on the development of molecular assays to provide sensitive resistance-detection tests. PMID:27238009

  2. Electrical resistance response of polyaniline films to water, ethanol, and nitric acid solution

    NASA Astrophysics Data System (ADS)

    Yin, Hong-Xing; Li, Meng-Meng; Yang, H.; Long, Yun-Ze; Sun, Xin

    2010-08-01

    This paper reports on electrical resistance vs. aging time for the response of polyaniline films under exposure to water, ethanol and nitric acid (HNO3) solution. Camphor sulfonic acid-doped polyaniline films were prepared by a “doping-dedoping-redoping" method, the morphology and microstructures of the films were characterized by a scanning electron microscope and an x-ray diffractometer, the electrical resistance was measured by a four-probe method. It was found that a lower amount of water molecules infiltrating the film can decrease the film's resistance possibly due to an enhancement of charge carrier transfer between polyaniline chains, whereas excessive water molecules can swell inter-chain distances and result in a quick increase of resistance. The resistance of the film under exposure to ethanol increases and becomes much larger than the original value. However, HNO3 solution can decrease the film's resistance sharply possibly owing to doping effect of protonic acid. These results can help to understand the conduction mechanism in polyaniline films, and also indicate that the films have potential application in chemical sensors.

  3. Glutamine, glutamate, and arginine-based acid resistance in Lactobacillus reuteri.

    PubMed

    Teixeira, Januana S; Seeras, Arisha; Sanchez-Maldonado, Alma Fernanda; Zhang, Chonggang; Su, Marcia Shu-Wei; Gänzle, Michael G

    2014-09-01

    This study aimed to determine whether glutamine deamidation improves acid resistance of Lactobacillus reuteri, and to assess whether arginine, glutamine, and glutamate-mediated acid resistance are redundant or complementary mechanisms of acid resistance. Three putative glutaminase genes, gls1, gls2, and gls3, were identified in L. reuteri 100-23. All three genes were expressed during growth in mMRS and wheat sourdough. L. reuteri consistently over-expressed gls3 and the glutamate decarboxylase gadB. L. reuteri 100-23ΔgadB over-expressed gls3 and the arginine deiminase gene adi. Analysis of the survival of L. reuteri in acidic conditions revealed that arginine conversion is effective at pH of 3.5 while glutamine or glutamate conversion were effective at pH of 2.5. Arginine conversion increased the pHin but not ΔΨ; glutamate decarboxylation had only a minor effect on the pHin but increased the ΔΨ. This study demonstrates that glutamine deamidation increases the acid resistance of L. reuteri independent of glutamate decarboxylase activity. Arginine and glutamine/glutamate conversions confer resistance to lactate at pH of 3.5 and phosphate at pH of 2.5, respectively. Knowledge of L. reuteri's acid resistance improves the understanding of the adaptation of L. reuteri to intestinal ecosystems, and facilitates the selection of probiotic and starter cultures. PMID:24929734

  4. Mechanisms of lactone hydrolysis in acidic conditions.

    PubMed

    Gómez-Bombarelli, Rafael; Calle, Emilio; Casado, Julio

    2013-07-19

    The acid-catalyzed hydrolysis of linear esters and lactones was studied using a hybrid supermolecule-polarizable continuum model (PCM) approach including up to six water molecules. The compounds studied included two linear esters, four β-lactones, two γ-lactones, and one δ-lactone: ethyl acetate, methyl formate, β-propiolactone, β-butyrolactone, β-isovalerolactone, diketene (4-methyleneoxetan-2-one), γ-butyrolactone, 2(5H)-furanone, and δ-valerolactone. The theoretical results are in good quantitative agreement with the experimental measurements reported in the literature and also in excellent qualitative agreement with long-held views regarding the nature of the hydrolysis mechanisms at molecular level. The present results help to understand the balance between the unimolecular (A(AC)1) and bimolecular (A(AC)2) reaction pathways. In contrast to the experimental setting, where one of the two branches is often occluded by the requirement of rather extreme experimental conditions, we have been able to estimate both contributions for all the compounds studied and found that a transition from A(AC)2 to A(AC)1 hydrolysis takes place as acidity increases. A parallel work addresses the neutral and base-catalyzed hydrolysis of lactones. PMID:23731203

  5. Rapid vacuolar sequestration: the horseweed glyphosate resistance mechanism

    PubMed Central

    Ge, Xia; Avignon, D André d’; Ackerman, Joseph JH; Sammons, R Douglas

    2010-01-01

    BACKGROUND Glyphosate-resistant (GR) weed species are now found with increasing frequency and threaten the critically importantGR weed management system. RESULTS The reported 31P NMR experiments on glyphosate-sensitive (S) and glyphosate-resistant (R) horseweed, Conyza canadensis (L.) Cronq., show significantly more accumulation of glyphosate within the R biotype vacuole. CONCLUSIONS Selective sequestration of glyphosate into the vacuole confers the observed horseweed resistance to glyphosate. This observation represents the first clear evidence for the glyphosate resistance mechanism in C. canadensis. PMID:20063320

  6. Integrating Mechanisms for Insulin Resistance: Common Threads and Missing Links

    PubMed Central

    Samuel, Varman T.; Shulman, Gerald I.

    2012-01-01

    Insulin resistance is a complex metabolic disorder that defies a single etiological pathway. Accumulation of ectopic lipid metabolites, activation of the unfolded protein response (UPR) pathway and innate immune pathways have all been implicated in the pathogenesis of insulin resistance. However, these pathways are also closely linked to changes in fatty acid uptake, lipogenesis, and energy expenditure that can impact ectopic lipid deposition. Ultimately, accumulation of specific lipid metabolites (diacylglycerols and/or ceramides) in liver and skeletal muscle, may be a common pathway leading to impaired insulin signaling and insulin resistance. PMID:22385956

  7. Mechanisms of tumor resistance to EGFR-targeted therapies

    PubMed Central

    Hopper-Borge, Elizabeth A; Nasto, Rochelle E; Ratushny, Vladimir; Weiner, Louis M; Golemis, Erica A

    2009-01-01

    Background Much effort has been devoted to development of cancer therapies targeting EGFR, based on its role in regulating cell growth. Small-molecule and antibody EGFR inhibitors have clinical roles based on their efficacy in a subset of cancers, generally as components of combination therapies. Many cancers are either initially resistant to EGFR inhibitors or become resistant during treatment, limiting the efficacy of these reagents. Objective/Methods To review cellular resistance mechanisms to EGFR-targeted therapies. Results/Conclusions The best validated of these mechanisms include activation of classic ATP-binding casette (ABC) multidrug transporters; activation or mutation of EGFR; and overexpression or activation of signaling proteins operating in relation to EGFR. We discuss current efforts and potential strategies to override these sources of resistance. We describe emerging systems-biology-based concepts of alternative resistance to EGFR-targeted therapies, and discuss their implications for use of EGFR-targeted and other targeted therapies. PMID:19236156

  8. Molecular Mechanisms of Chromium in Alleviating Insulin Resistance

    PubMed Central

    Hua, Yinan; Clark, Suzanne; Ren, Jun; Sreejayan, Nair

    2011-01-01

    Type 2 diabetes is often associated with obesity, dyslipidemia, and cardiovascular anomalies and is a major health problem approaching global epidemic proportions. Insulin resistance, a prediabetic condition, precedes the onset of frank type 2 diabetes and offers potential avenues for early intervention to treat the disease. Although lifestyle modifications and exercise can reduce the incidence of diabetes, compliance has proved to be difficult, warranting pharmacological interventions. However, most of the currently available drugs that improve insulin sensitivity have adverse effects. Therefore, attractive strategies to alleviate insulin resistance include dietary supplements. One such supplement is chromium, which has been shown reduce insulin resistance in some, but not all, studies. Furthermore, the molecular mechanisms of chromium in alleviating insulin resistance remain elusive. This review examines emerging reports on the effect of chromium, as well as molecular and cellular mechanisms by which chromium may provide beneficial effects in alleviating insulin resistance. PMID:22423897

  9. Production of siderophores increases resistance to fusaric acid in Pseudomonas protegens Pf-5.

    PubMed

    Ruiz, Jimena A; Bernar, Evangelina M; Jung, Kirsten

    2015-01-01

    Fusaric acid is produced by pathogenic fungi of the genus Fusarium, and is toxic to plants and rhizobacteria. Many fluorescent pseudomonads can prevent wilt diseases caused by these fungi. This study was undertaken to evaluate the effect of fusaric acid on P. protegens Pf-5 and elucidate the mechanisms that enable the bacterium to survive in the presence of the mycotoxin. The results confirm that fusaric acid negatively affects growth and motility of P. protegens. Moreover, a notable increase in secretion of the siderophore pyoverdine was observed when P. protegens was grown in the presence of fusaric acid. Concomitantly, levels of enzymes involved in the biosynthesis of pyoverdine and enantio-pyochelin, the second siderophore encoded by P. protegens, increased markedly. Moreover, while similar levels of resistance to fusaric acid were observed for P. protegens mutants unable to synthesize either pyoverdine or enanto-pyochelin and the wild type strain, a double mutant unable to synthesize both kinds of siderophores showed a dramatically reduced resistance to this compound. This reduced resistance was not observed when this mutant was grown under conditions of iron excess. Spectrophotometric titrations revealed that fusaric acid binds not only Fe2+ and Fe3+, but also Zn2+, Mn2+ and Cu2+, with high affinity. Our results demonstrate that iron sequestration accounts at least in part for the deleterious effect of the mycotoxin on P. protegens. PMID:25569682

  10. Production of Siderophores Increases Resistance to Fusaric Acid in Pseudomonas protegens Pf-5

    PubMed Central

    Ruiz, Jimena A.; Bernar, Evangelina M.; Jung, Kirsten

    2015-01-01

    Fusaric acid is produced by pathogenic fungi of the genus Fusarium, and is toxic to plants and rhizobacteria. Many fluorescent pseudomonads can prevent wilt diseases caused by these fungi. This study was undertaken to evaluate the effect of fusaric acid on P. protegens Pf-5 and elucidate the mechanisms that enable the bacterium to survive in the presence of the mycotoxin. The results confirm that fusaric acid negatively affects growth and motility of P. protegens. Moreover, a notable increase in secretion of the siderophore pyoverdine was observed when P. protegens was grown in the presence of fusaric acid. Concomitantly, levels of enzymes involved in the biosynthesis of pyoverdine and enantio-pyochelin, the second siderophore encoded by P. protegens, increased markedly. Moreover, while similar levels of resistance to fusaric acid were observed for P. protegens mutants unable to synthesize either pyoverdine or enanto-pyochelin and the wild type strain, a double mutant unable to synthesize both kinds of siderophores showed a dramatically reduced resistance to this compound. This reduced resistance was not observed when this mutant was grown under conditions of iron excess. Spectrophotometric titrations revealed that fusaric acid binds not only Fe2+ and Fe3+, but also Zn2+, Mn2+ and Cu2+, with high affinity. Our results demonstrate that iron sequestration accounts at least in part for the deleterious effect of the mycotoxin on P. protegens. PMID:25569682

  11. Antibiotic resistance mechanisms in M. tuberculosis: an update.

    PubMed

    Nguyen, Liem

    2016-07-01

    Treatment of tuberculosis (TB) has been a therapeutic challenge because of not only the naturally high resistance level of Mycobacterium tuberculosis to antibiotics but also the newly acquired mutations that confer further resistance. Currently standardized regimens require patients to daily ingest up to four drugs under direct observation of a healthcare worker for a period of 6-9 months. Although they are quite effective in treating drug susceptible TB, these lengthy treatments often lead to patient non-adherence, which catalyzes for the emergence of M. tuberculosis strains that are increasingly resistant to the few available anti-TB drugs. The rapid evolution of M. tuberculosis, from mono-drug-resistant to multiple drug-resistant, extensively drug-resistant and most recently totally drug-resistant strains, is threatening to make TB once again an untreatable disease if new therapeutic options do not soon become available. Here, I discuss the molecular mechanisms by which M. tuberculosis confers its profound resistance to antibiotics. This knowledge may help in developing novel strategies for weakening drug resistance, thus enhancing the potency of available antibiotics against both drug susceptible and resistant M. tuberculosis strains. PMID:27161440

  12. Pseudomonas aeruginosa: arsenal of resistance mechanisms, decades of changing resistance profiles, and future antimicrobial therapies.

    PubMed

    El Zowalaty, Mohamed E; Al Thani, Asmaa A; Webster, Thomas J; El Zowalaty, Ahmed E; Schweizer, Herbert P; Nasrallah, Gheyath K; Marei, Hany E; Ashour, Hossam M

    2015-01-01

    Antimicrobial resistance is one of the most serious public health issues facing humans since the discovery of antimicrobial agents. The frequent, prolonged, and uncontrolled use of antimicrobial agents are major factors in the emergence of antimicrobial-resistant bacterial strains, including multidrug-resistant variants. Pseudomonas aeruginosa is a leading cause of nosocomial infections. The abundant data on the increased resistance to antipseudomonal agents support the need for global action. There is a paucity of new classes of antibiotics active against P. aeruginosa. Here, we discuss recent antibacterial resistance profiles and mechanisms of resistance by P. aeruginosa. We also review future potential methods for controlling antibiotic-resistant bacteria, such as phage therapy, nanotechnology and antipseudomonal vaccines. PMID:26439366

  13. [Molecular characterization of resistance mechanisms: methicillin resistance Staphylococcus aureus, extended spectrum β-lactamases and carbapenemases].

    PubMed

    Oteo, Jesús; Belén Aracil, María

    2015-07-01

    Multi-drug resistance in bacterial pathogens increases morbidity and mortality in infected patients and it is a threat to public health concern by their high capacity to spread. For both reasons, the rapid detection of multi-drug resistant bacteria is critical. Standard microbiological procedures require 48-72 h to provide the antimicrobial susceptibility results, thus there is emerging interest in the development of rapid detection techniques. In recent years, the use of selective and differential culture-based methods has widely spread. However, the capacity for detecting antibiotic resistance genes and their low turnaround times has made molecular methods a reference for diagnosis of multidrug resistance. This review focusses on the molecular methods for detecting some mechanisms of antibiotic resistance with a high clinical and epidemiological impact: a) Enzymatic resistance to broad spectrum β-lactam antibiotics in Enterobacteriaceae, mainly extended spectrum β-lactamases (ESBL) and carbapenemases; and b) methicillin resistance in Staphylococcus aureus. PMID:26320993

  14. Hypoglycemic effects and mechanisms of electroacupuncture on insulin resistance

    PubMed Central

    Yin, Jieyun; Kuang, Jian; Chandalia, Manisha; Tuvdendorj, Demidmaa; Tumurbaatar, Batbayar; Abate, Nicola

    2014-01-01

    The aim of this study was to investigate effects and mechanisms of electroacupuncture (EA) on blood glucose and insulin sensitivity in mice fed a high-fat diet. Both wild-type (WT) and adipose ectonucleotide pyrophosphate phosphodiesterase (ENPP1) transgenic (TG) mice were fed a high-fat diet for 12 wk; for each mouse, an intraperitoneal glucose tolerance test (IPGTT) and insulin tolerance test (ITT) were performed with or without EA at abdomen or auricular areas. A high-fat diet-induced insulin resistance in both WT and TG mice. In the WT mice, EA at 3 Hz and 15 Hz, but not at 1 Hz or 100 Hz, via CV4+CV12 significantly reduced postprandial glucose levels; EA at 3 Hz was most potent. The glucose level was reduced by 61.7% at 60 min and 74.5% at 120 min with EA at 3 Hz (all P < 0.001 vs. control). Similar hypoglycemic effect was noted in the TG mice. On the contrary, EA at auricular points increased postprandial glucose level (P < 0.03). 4). EA at 3 Hz via CV4+CV12 significantly enhanced the decrease of blood glucose after insulin injection, suggesting improvement of insulin sensitivity. Plasma free fatty acid was significantly suppressed by 42.5% at 15 min and 50.8% at 30 min with EA (P < 0.01) in both WT and TG mice. EA improves glucose tolerance in both WT and TG mice fed a high-fat diet, and the effect is associated with stimulation parameters and acupoints and is probably attributed to the reduction of free fatty acid. PMID:24848362

  15. Hypoglycemic effects and mechanisms of electroacupuncture on insulin resistance.

    PubMed

    Yin, Jieyun; Kuang, Jian; Chandalia, Manisha; Tuvdendorj, Demidmaa; Tumurbaatar, Batbayar; Abate, Nicola; Chen, Jiande D Z

    2014-08-01

    The aim of this study was to investigate effects and mechanisms of electroacupuncture (EA) on blood glucose and insulin sensitivity in mice fed a high-fat diet. Both wild-type (WT) and adipose ectonucleotide pyrophosphate phosphodiesterase (ENPP1) transgenic (TG) mice were fed a high-fat diet for 12 wk; for each mouse, an intraperitoneal glucose tolerance test (IPGTT) and insulin tolerance test (ITT) were performed with or without EA at abdomen or auricular areas. A high-fat diet-induced insulin resistance in both WT and TG mice. In the WT mice, EA at 3 Hz and 15 Hz, but not at 1 Hz or 100 Hz, via CV4+CV12 significantly reduced postprandial glucose levels; EA at 3 Hz was most potent. The glucose level was reduced by 61.7% at 60 min and 74.5% at 120 min with EA at 3 Hz (all P < 0.001 vs. control). Similar hypoglycemic effect was noted in the TG mice. On the contrary, EA at auricular points increased postprandial glucose level (P < 0.03). 4). EA at 3 Hz via CV4+CV12 significantly enhanced the decrease of blood glucose after insulin injection, suggesting improvement of insulin sensitivity. Plasma free fatty acid was significantly suppressed by 42.5% at 15 min and 50.8% at 30 min with EA (P < 0.01) in both WT and TG mice. EA improves glucose tolerance in both WT and TG mice fed a high-fat diet, and the effect is associated with stimulation parameters and acupoints and is probably attributed to the reduction of free fatty acid. PMID:24848362

  16. Studies on Resistance Transfer Factor Deoxyribonucleic Acid in Escherichia coli

    PubMed Central

    Silver, Richard P.; Falkow, Stanley

    1970-01-01

    A variant of the derepressed R factor, R1, which does not contain any of the drug resistance markers, and represents, in large part, the resistance transfer factor (RTF) was studied in Escherichia coli. RTF deoxyribonucleic acid (DNA) was specifically labeled in a female cell after conjugation. Physical characterization of the molecule showed that RTF possessed an average molecular weight of 50 × 106 daltons and a buoyant density of 1.709 g/cm3. By comparison to R1, we calculate that the region of DNA carrying the drug resistance genes is therefore about 20% of the R1 molecule and has a buoyant density of approximately 1.716 g/cm3. These results support the hypothesis that the single species of R-factor DNA observed in E. coli represents a composite of the 1.709 and 1.716 g/cm3 replicons seen in Proteus. PMID:4919749

  17. Fungal Resistance to Plant Antibiotics as a Mechanism of Pathogenesis

    PubMed Central

    Morrissey, John P.; Osbourn, Anne E.

    1999-01-01

    Many plants produce low-molecular-weight compounds which inhibit the growth of phytopathogenic fungi in vitro. These compounds may be preformed inhibitors that are present constitutively in healthy plants (also known as phytoanticipins), or they may be synthesized in response to pathogen attack (phytoalexins). Successful pathogens must be able to circumvent or overcome these antifungal defenses, and this review focuses on the significance of fungal resistance to plant antibiotics as a mechanism of pathogenesis. There is increasing evidence that resistance of fungal pathogens to plant antibiotics can be important for pathogenicity, at least for some fungus-plant interactions. This evidence has emerged largely from studies of fungal degradative enzymes and also from experiments in which plants with altered levels of antifungal secondary metabolites were generated. Whereas the emphasis to date has been on degradative mechanisms of resistance of phytopathogenic fungi to antifungal secondary metabolites, in the future we are likely to see a rapid expansion in our knowledge of alternative mechanisms of resistance. These may include membrane efflux systems of the kind associated with multidrug resistance and innate resistance due to insensitivity of the target site. The manipulation of plant biosynthetic pathways to give altered antibiotic profiles will also be valuable in telling us more about the significance of antifungal secondary metabolites for plant defense and clearly has great potential for enhancing disease resistance for commercial purposes. PMID:10477313

  18. Bacterial resistance to tetracycline: mechanisms, transfer, and clinical significance.

    PubMed Central

    Speer, B S; Shoemaker, N B; Salyers, A A

    1992-01-01

    Tetracycline has been a widely used antibiotic because of its low toxicity and broad spectrum of activity. However, its clinical usefulness has been declining because of the appearance of an increasing number of tetracycline-resistant isolates of clinically important bacteria. Two types of resistance mechanisms predominate: tetracycline efflux and ribosomal protection. A third mechanism of resistance, tetracycline modification, has been identified, but its clinical relevance is still unclear. For some tetracycline resistance genes, expression is regulated. In efflux genes found in gram-negative enteric bacteria, regulation is via a repressor that interacts with tetracycline. Gram-positive efflux genes appear to be regulated by an attenuation mechanism. Recently it was reported that at least one of the ribosome protection genes is regulated by attenuation. Tetracycline resistance genes are often found on transmissible elements. Efflux resistance genes are generally found on plasmids, whereas genes involved in ribosome protection have been found on both plasmids and self-transmissible chromosomal elements (conjugative transposons). One class of conjugative transposon, originally found in streptococci, can transfer itself from streptococci to a variety of recipients, including other gram-positive bacteria, gram-negative bacteria, and mycoplasmas. Another class of conjugative transposons has been found in the Bacteroides group. An unusual feature of the Bacteroides elements is that their transfer is enhanced by preexposure to tetracycline. Thus, tetracycline has the double effect of selecting for recipients that acquire a resistance gene and stimulating transfer of the gene. PMID:1423217

  19. Insecticide resistance in vector Chagas disease: evolution, mechanisms and management.

    PubMed

    Mougabure-Cueto, Gastón; Picollo, María Inés

    2015-09-01

    Chagas disease is a chronic parasitic infection restricted to America. The disease is caused by the protozoa Trypanosoma cruzi, which is transmitted to human through the feces of infected triatomine insects. Because no treatment is available for the chronic forms of the disease, vector chemical control represents the best way to reduce the incidence of the disease. Chemical control has been based principally on spraying dwellings with insecticide formulations and led to the reduction of triatomine distribution and consequent interruption of disease transmission in several areas from endemic region. However, in the last decade it has been repeatedly reported the presence triatomnes, mainly Triatoma infestans, after spraying with pyrethroid insecticides, which was associated to evolution to insecticide resistance. In this paper the evolution of insecticide resistance in triatomines is reviewed. The insecticide resistance was detected in 1970s in Rhodnius prolixus and 1990s in R. prolixus and T. infestans, but not until the 2000s resistance to pyrthroids in T. infestans associated to control failures was described in Argentina and Bolivia. The main resistance mechanisms (i.e. enhanced metabolism, altered site of action and reduced penetration) were described in the T. infestans resistant to pyrethrods. Different resistant profiles were demonstrated suggesting independent origin of the different resistant foci of Argentina and Bolivia. The deltamethrin resistance in T. infestans was showed to be controlled by semi-dominant, autosomally inherited factors. Reproductive and developmental costs were also demonstrated for the resistant T. infestans. A discussion about resistance and tolerance concepts and the persistence of T. infestans in Gran Chaco region are presented. In addition, theoretical concepts related to toxicological, evolutionary and ecological aspects of insecticide resistance are discussed in order to understand the particular scenario of pyrethroid

  20. Different mechanisms of resistance modulate sulfite tolerance in wine yeasts.

    PubMed

    Nadai, Chiara; Treu, Laura; Campanaro, Stefano; Giacomini, Alessio; Corich, Viviana

    2016-01-01

    From a technological point of view, yeast resistance to sulfite is of great interest and represents an important technological character for winemaking. Several mechanisms are involved, and strain-dependent strategies to obtain SO2 resistance can deeply influence wine quality, although this choice is less relevant in determining the technological performance of the strain during fermentation. In this study, to better understand the strain-specific mechanisms of resistance, 11 Saccharomyces cerevisiae strains, whose genomes have been previously sequenced, were selected. Their attitude towards sulfites, in terms of resistance and production, was evaluated, and RNA-sequencing of four selected strains was performed during fermentation process in synthetic grape must in the presence of SO2. Results demonstrated that at molecular level, the physical effect of SO2 triggered multiple stress responses in the cell and high tolerance to general enological stressing condition increased SO2 resistance. Adaptation mechanism due to high basal gene expression level rather than specific gene induction in the presence of sulfite seemed to be responsible in modulating strain resistance. This mechanism involved higher basal gene expression level of specific cell wall proteins, enzymes for lipid biosynthesis, and enzymes directly involved in SO2 assimilation pathway and efflux. PMID:26615396

  1. Insulin resistance and the metabolism of branched-chain amino acids in humans.

    PubMed

    Adeva, María M; Calviño, Jesús; Souto, Gema; Donapetry, Cristóbal

    2012-07-01

    Peripheral resistance to insulin action is the major mechanism causing the metabolic syndrome and eventually type 2 diabetes mellitus. The metabolic derangement associated with insulin resistance is extensive and not restricted to carbohydrates. The branched-chain amino acids (BCAAs) are particularly responsive to the inhibitory insulin action on amino acid release by skeletal muscle and their metabolism is profoundly altered in conditions featuring insulin resistance, insulin deficiency, or both. Obesity, the metabolic syndrome and diabetes mellitus display a gradual increase in the plasma concentration of BCAAs, from the obesity-related low-grade insulin-resistant state to the severe deficiency of insulin action in diabetes ketoacidosis. Obesity-associated hyperinsulinemia succeeds in maintaining near-normal or slightly elevated plasma concentration of BCAAs, despite the insulin-resistant state. The low circulating levels of insulin and/or the deeper insulin resistance occurring in diabetes mellitus are associated with more marked elevation in the plasma concentration of BCAAs. In diabetes ketoacidosis, the increase in plasma BCAAs is striking, returning to normal when adequate metabolic control is achieved. The metabolism of BCAAs is also disturbed in other situations typically featuring insulin resistance, including kidney and liver dysfunction. However, notwithstanding the insulin-resistant state, the plasma level of BCAAs in these conditions is lower than in healthy subjects, suggesting that these organs are involved in maintaining BCAAs blood concentration. The pathogenesis of the decreased BCAAs plasma level in kidney and liver dysfunction is unclear, but a decreased afflux of these amino acids into the blood stream has been observed. PMID:21984377

  2. Study on corrosion resistance of high - entropy alloy in medium acid liquid and chemical properties

    NASA Astrophysics Data System (ADS)

    Florea, I.; Buluc, G.; Florea, R. M.; Soare, V.; Carcea, I.

    2015-11-01

    High-entropy alloy is a new alloy which is different from traditional alloys. The high entropy alloys were started in Tsing Hua University of Taiwan since 1995 by Yeh et al. Consisting of a variety of elements, each element occupying a similar compared with other alloy elements to form a high entropy. We could define high entropy alloys as having approximately equal concentrations, made up of a group of 5 to 11 major elements. In general, the content of each element is not more than 35% by weight of the alloy. During the investigation it turned out that this alloy has a high hardness and is also corrosion proof and also strength and good thermal stability. In the experimental area, scientists used different tools, including traditional casting, mechanical alloying, sputtering, splat-quenching to obtain the high entropy alloys with different alloying elements and then to investigate the corresponding microstructures and mechanical, chemical, thermal, and electronic performances. The present study is aimed to investigate the corrosion resistance in a different medium acid and try to put in evidence the mechanical properties. Forasmuch of the wide composition range and the enormous number of alloy systems in high entropy alloys, the mechanical properties of high entropy alloys can vary significantly. In terms of hardness, the most critical factors are: hardness/strength of each composing phase in the alloy, distribution of the composing phases. The corrosion resistance of an high entropy alloy was made in acid liquid such as 10%HNO3-3%HF, 10%H2SO4, 5%HCl and then was investigated, respectively with weight loss experiment. Weight loss test was carried out by put the samples into the acid solution for corrosion. The solution was maintained at a constant room temperature. The liquid formulations used for tests were 3% hydrofluoric acid with 10% nitric acid, 10% sulphuric acid, 5% hydrochloric acid. Weight loss of the samples was measured by electronic scale.

  3. Molecular mechanisms associated with Fluconazole resistance in clinical Candida albicans isolates from India.

    PubMed

    Mane, Arati; Vidhate, Pallavi; Kusro, Chanchal; Waman, Vaishali; Saxena, Vandana; Kulkarni-Kale, Urmila; Risbud, Arun

    2016-02-01

    Resistance to azole antifungals is a significant problem in Candida albicans. An understanding of resistance at molecular level is essential for the development of strategies to tackle resistance and rationale design of newer antifungals and target-based molecular approaches. This study presents the first evaluation of molecular mechanisms associated with fluconazole resistance in clinical C.albicans isolates from India. Target site (ERG11) alterations were determined by DNA sequencing, whereas real-time PCRs were performed to quantify target and efflux pump genes (CDR1, CDR2, MDR1) in 87 [Fluconazole susceptible (n = 30), susceptible-dose dependent (n = 30) and resistant (n = 27)] C.albicans isolates. Cross-resistance to fluconazole, ketoconazole and itraconazole was observed in 74.1% isolates. Six amino acid substitutions were identified, including 4 (E116D, F145L, E226D, I437V) previously reported ones and 2 (P406L, Q474H) new ones. CDR1 over-expression was seen in 77.7% resistant isolates. CDR2 was exclusively expressed with CDR1 and their concomitant over-expression was associated with azole cross-resistance. MDR1 and ERG11 over-expression did not seem to be associated with resistance. Our results show that drug efflux mediated by Adenosine-5'-triphosphate (ATP)-binding cassette transporters, especially CDR1 is the predominant mechanism of fluconazole resistance and azole cross-resistance in C. albicans and indicate the need for research directed towards developing strategies to tackle efflux mediated resistance to salvage azoles. PMID:26648048

  4. Metabolic mechanism of phenyllactic acid naturally occurring in Chinese pickles.

    PubMed

    Li, Xingfeng; Ning, Yawei; Liu, Dou; Yan, Aihong; Wang, Zhixin; Wang, Shijie; Miao, Ming; Zhu, Hong; Jia, Yingmin

    2015-11-01

    Phenyllactic acid, a phenolic acid phytochemical with the antimicrobial activity, was rarely reported in food besides honey and sourdough. This study evidenced a new food source of phenyllactic acid and elucidated its metabolic mechanism. Phenyllactic acid naturally occurred in Chinese pickles with concentrations ranged from 0.02 to 0.30 mM in 23 pickle samples including homemade and commercial ones. Then, lactic acid bacteria capable of metabolizing phenyllactic acid were screened from each homemade pickle and a promising strain was characterized as Lactobacillus plantarum. Moreover, the investigation of the metabolic mechanism of phenyllactic acid in pickles suggested that the yield of phenyllactic acid was positively related to the content of phenylalanine in food, and the addition of phenylalanine as precursor substance could significantly promote the production of phenyllactic acid. This investigation could provide some insights into the accumulation of phenyllactic acid in pickle for long storage life. PMID:25976820

  5. Aging mechanisms and service life of lead-acid batteries

    NASA Astrophysics Data System (ADS)

    Ruetschi, Paul

    In lead-acid batteries, major aging processes, leading to gradual loss of performance, and eventually to the end of service life, are: Anodic corrosion (of grids, plate-lugs, straps or posts). Positive active mass degradation and loss of adherence to the grid (shedding, sludging). Irreversible formation of lead sulfate in the active mass (crystallization, sulfation). Short-circuits. Loss of water. Aging mechanisms are often inter-dependent. For example, corrosion of the grids will lead to increased resistance to current flow, which will in turn impede proper charge of certain parts of the active mass, resulting in sulfation. Active mass degradation may lead to short-circuits. Sulfation may be the result of a loss of water, and so forth. The rates of the different aging processes strongly depend on the type of use (or misuse) of the battery. Over-charge will lead to accelerated corrosion and also to accelerated loss of water. With increasing depth-of-discharge during cycling, positive active mass degradation is accelerated. Some aging mechanisms are occurring only upon misuse. Short-circuits across the separators, due to the formation of metallic lead dendrites, for example, are usually formed only after (excessively) deep discharge. Stationary batteries, operated under float-charge conditions, will age typically by corrosion of the positive grids. On the other hand, service life of batteries subject to cycling regimes, will typically age by degradation of the structure of the positive active mass. Starter batteries are usually aging by grid corrosion, for instance in normal passenger car use. However, starter batteries of city buses, making frequent stops, may age (prematurely) by positive active mass degradation, because the batteries are subject to numerous shallow discharge cycles. Valve-regulated batteries often fail as a result of negative active mass sulfation, or water loss. For each battery design, and type of use, there is usually a characteristic

  6. Protecting cell walls from binding aluminum by organic acids contributes to aluminum resistance.

    PubMed

    Li, Ya-Ying; Zhang, Yue-Jiao; Zhou, Yuan; Yang, Jian-Li; Zheng, Shao-Jian

    2009-06-01

    Aluminum-induced secretion of organic acids from the root apex has been demonstrated to be one major Al resistance mechanism in plants. However, whether the organic acid concentration is high enough to detoxify Al in the growth medium is frequently questioned. The genotypes of Al-resistant wheat, Cassia tora L. and buckwheat secrete malate, citrate and oxalate, respectively. In the present study we found that at a 35% inhibition of root elongation, the Al activities in the solution were 10, 20, and 50 muM with the corresponding malate, citrate, and oxalate exudation at the rates of 15, 20 and 21 nmol/cm(2) per 12 h, respectively, for the above three plant species. When exogenous organic acids were added to ameliorate Al toxicity, twofold and eightfold higher oxalate and malate concentrations were required to produce the equal effect by citrate. After the root apical cell walls were isolated and preincubated in 1 mM malate, oxalate or citrate solution overnight, the total amount of Al adsorbed to the cell walls all decreased significantly to a similar level, implying that these organic acids own an equal ability to protect the cell walls from binding Al. These findings suggest that protection of cell walls from binding Al by organic acids may contribute significantly to Al resistance. PMID:19522816

  7. New approaches for understanding mechanisms of drug resistance in schistosomes

    PubMed Central

    GREENBERG, ROBERT M.

    2013-01-01

    SUMMARY Schistosomes are parasitic flatworms that cause schistosomiasis, a neglected tropical disease that affects hundreds of millions worldwide. Treatment and control of schistosomiasis relies almost entirely on the single drug praziquantel (PZQ), making the prospect of emerging drug resistance particularly worrisome. This review will survey reports of PZQ (and other drug) resistance in schistosomes and other platyhelminths, and explore mechanisms by which drug resistance might develop. Newer genomic and post-genomic strategies that offer the promise of better understanding of how drug resistance might arise in these organisms will be discussed. These approaches could also lead to insights into the mode of action of these drugs and potentially provide markers for monitoring the emergence of resistance. PMID:23552512

  8. Mechanisms involved in quinolone resistance in Mycoplasma mycoides subsp. capri.

    PubMed

    Antunes, Nuno T; Assunção, Patrícia; Poveda, José B; Tavío, María M

    2015-06-01

    Mycoplasma mycoides subsp. capri is a causative agent of contagious agalactia in goats. In this study, M. mycoides subsp. capri mutants were selected for resistance to fluoroquinolones (norfloxacin, enrofloxacin and ciprofloxacin) by serial passes in broth with increasing concentrations of antibiotic. Mutations conferring cross-resistance to the three fluoroquinolones were found in the quinolone resistance determining regions of the four genes encoding DNA gyrase and topoisomerase IV. Different mutations in the DNA gyrase GyrA subunit suggest a different mechanism of inhibition between norfloxacin and the other tested fluoroquinolones. The presence of an adenosine triphosphate-dependent efflux system was suggested through the use of the inhibitor orthovanadate. PMID:25951987

  9. Drug resistance. Population transcriptomics of human malaria parasites reveals the mechanism of artemisinin resistance.

    PubMed

    Mok, Sachel; Ashley, Elizabeth A; Ferreira, Pedro E; Zhu, Lei; Lin, Zhaoting; Yeo, Tomas; Chotivanich, Kesinee; Imwong, Mallika; Pukrittayakamee, Sasithon; Dhorda, Mehul; Nguon, Chea; Lim, Pharath; Amaratunga, Chanaki; Suon, Seila; Hien, Tran Tinh; Htut, Ye; Faiz, M Abul; Onyamboko, Marie A; Mayxay, Mayfong; Newton, Paul N; Tripura, Rupam; Woodrow, Charles J; Miotto, Olivo; Kwiatkowski, Dominic P; Nosten, François; Day, Nicholas P J; Preiser, Peter R; White, Nicholas J; Dondorp, Arjen M; Fairhurst, Rick M; Bozdech, Zbynek

    2015-01-23

    Artemisinin resistance in Plasmodium falciparum threatens global efforts to control and eliminate malaria. Polymorphisms in the kelch domain-carrying protein K13 are associated with artemisinin resistance, but the underlying molecular mechanisms are unknown. We analyzed the in vivo transcriptomes of 1043 P. falciparum isolates from patients with acute malaria and found that artemisinin resistance is associated with increased expression of unfolded protein response (UPR) pathways involving the major PROSC and TRiC chaperone complexes. Artemisinin-resistant parasites also exhibit decelerated progression through the first part of the asexual intraerythrocytic development cycle. These findings suggest that artemisinin-resistant parasites remain in a state of decelerated development at the young ring stage, whereas their up-regulated UPR pathways mitigate protein damage caused by artemisinin. The expression profiles of UPR-related genes also associate with the geographical origin of parasite isolates, further suggesting their role in emerging artemisinin resistance in the Greater Mekong Subregion. PMID:25502316

  10. Drug Targets and Mechanisms of Resistance in the Anaerobic Protozoa

    PubMed Central

    Upcroft, Peter; Upcroft, Jacqueline A.

    2001-01-01

    The anaerobic protozoa Giardia duodenalis, Trichomonas vaginalis, and Entamoeba histolytica infect up to a billion people each year. G. duodenalis and E. histolytica are primarily pathogens of the intestinal tract, although E. histolytica can form abscesses and invade other organs, where it can be fatal if left untreated. T. vaginalis infection is a sexually transmitted infection causing vaginitis and acute inflammatory disease of the genital mucosa. T. vaginalis has also been reported in the urinary tract, fallopian tubes, and pelvis and can cause pneumonia, bronchitis, and oral lesions. Respiratory infections can be acquired perinatally. T. vaginalis infections have been associated with preterm delivery, low birth weight, and increased mortality as well as predisposing to human immunodeficiency virus infection, AIDS, and cervical cancer. All three organisms lack mitochondria and are susceptible to the nitroimidazole metronidazole because of similar low-redox-potential anaerobic metabolic pathways. Resistance to metronidazole and other drugs has been observed clinically and in the laboratory. Laboratory studies have identified the enzyme that activates metronidazole, pyruvate:ferredoxin oxidoreductase, to its nitroso form and distinct mechanisms of decreasing drug susceptibility that are induced in each organism. Although the nitroimidazoles have been the drug family of choice for treating the anaerobic protozoa, G. duodenalis is less susceptible to other antiparasitic drugs, such as furazolidone, albendazole, and quinacrine. Resistance has been demonstrated for each agent, and the mechanism of resistance has been investigated. Metronidazole resistance in T. vaginalis is well documented, and the principal mechanisms have been defined. Bypass metabolism, such as alternative oxidoreductases, have been discovered in both organisms. Aerobic versus anaerobic resistance in T. vaginalis is discussed. Mechanisms of metronidazole resistance in E. histolytica have recently

  11. Pathophysiological mechanisms of death resistance in colorectal carcinoma

    PubMed Central

    Huang, Ching-Ying; Yu, Linda Chia-Hui

    2015-01-01

    Colon cancers develop adaptive mechanisms to survive under extreme conditions and display hallmarks of unlimited proliferation and resistance to cell death. The deregulation of cell death is a key factor that contributes to chemoresistance in tumors. In a physiological context, balance between cell proliferation and death, and protection against cell damage are fundamental processes for maintaining gut epithelial homeostasis. The mechanisms underlying anti-death cytoprotection and tumor resistance often bear common pathways, and although distinguishing them would be a challenge, it would also provide an opportunity to develop advanced anti-cancer therapeutics. This review will outline cell death pathways (i.e., apoptosis, necrosis, and necroptosis), and discuss cytoprotective strategies in normal intestinal epithelium and death resistance mechanisms of colon tumor. In colorectal cancers, the intracellular mechanisms of death resistance include the direct alteration of apoptotic and necroptotic machinery and the upstream events modulating death effectors such as tumor suppressor gene inactivation and pro-survival signaling pathways. The autocrine, paracrine and exogenous factors within a tumor microenvironment can also instigate resistance against apoptotic and necroptotic cell death in colon cancers through changes in receptor signaling or transporter uptake. The roles of cyclooxygenase-2/prostaglandin E2, growth factors, glucose, and bacterial lipopolysaccharides in colorectal cancer will be highlighted. Targeting anti-death pathways in the colon cancer tissue might be a promising approach outside of anti-proliferation and anti-angiogenesis strategies for developing novel drugs to treat refractory tumors. PMID:26557002

  12. Use of Ekibastuzsk coal ash as a filler for acid resistant plaster

    SciTech Connect

    Korsakov, F.F.; Isichenko, I.I.; Kabanov, G.A.

    1981-01-01

    Acid resistant plasters are used extensively at thermal power plants for protection of gas conduits, ash traps with spouts and hydraulic valves, and the internal surfaces of smoke pump housings. The surface being protected is preliminarily cleaned and a No. 16-20 steel grid attached to the surface by electrial welding. In producing the acid resistant plaster, 14-17 parts by weight of sodium silicofluoride are added to 100 parts by weight of sodium water glass; the remainder consists of andesite or diabase meal to the required consistency. The water glass fulfills the role of a binder; the sodium silicofluoride accelerates solidification of the water glass and the andesite and diabase meal serve as fillers. We found, tested in the laboratory and used successfully (under experimental-industrial conditions) a substitute for andesite and diabase meal. This substitute was ash of Ekibastuzsk coal, which was not only comparable to the meal in regard to quality of the acid resistant plaster, but even exceeded andesite and diabase meal in regard to several qualitative indicators. At the present time, a formula is being developed for an acid resistant plaster produced on the basis of water glass, sodium silicofluoride and ash of Ekibastuzsk coal. In order to verify the possibility of using other ashes instead of andesite and diabase meal, we also tested, under laboratory conditions, acid resistant plasters using ash from thermal power plants (TPP's) also burning Karagandinsk, Kuuchekinsk, Kuznetsk and Kansko-Achinsk coals. In compositions produced with polymer binders, Kansko-Achinsk coal ash was one of the best fillers, providing the most favorable physico-mechanical properties of the composition.

  13. Production of amino acids by analog-resistant mutants of the cyanobacterium Spirulina platensis.

    PubMed Central

    Riccardi, G; Sora, S; Ciferri, O

    1981-01-01

    Mutants of Spirulina platensis resistant to 5-fluorotryptophan, beta-3-thienyl-alanine, ethionine, p-fluorophenylalanine, or azetidine-2-carboxylic acid were isolated. Some of these mutants appeared to be resistant to more than one analog and to overproduce the corresponding amino acids. A second group was composed of mutants that were resistant to one analog only. Of the latter mutants, one resistant to azetidine-2-carboxylic acid was found to overproduce proline only, whereas one resistant to fluorotryptophan and one resistant to ethionine did not overproduce any of the tested amino acids. PMID:6792182

  14. Synthesis, Antitubercular Activity and Mechanism of Resistance of Highly Effective Thiacetazone Analogues

    PubMed Central

    Coxon, Geoffrey D.; Craig, Derek; Corrales, Rosa Milagros; Vialla, Emilie; Gannoun-Zaki, Laila; Kremer, Laurent

    2013-01-01

    Defining the pharmacological target(s) of currently used drugs and developing new analogues with greater potency are both important aspects of the search for agents that are effective against drug-sensitive and drug-resistant Mycobacterium tuberculosis. Thiacetazone (TAC) is an anti-tubercular drug that was formerly used in conjunction with isoniazid, but removed from the antitubercular chemotherapeutic arsenal due to toxic side effects. However, several recent studies have linked the mechanisms of action of TAC to mycolic acid metabolism and TAC-derived analogues have shown increased potency against M. tuberculosis. To obtain new insights into the molecular mechanisms of TAC resistance, we isolated and analyzed 10 mutants of M. tuberculosis that were highly resistant to TAC. One strain was found to be mutated in the methyltransferase MmaA4 at Gly101, consistent with its lack of oxygenated mycolic acids. All remaining strains harbored missense mutations in either HadA (at Cys61) or HadC (at Val85, Lys157 or Thr123), which are components of the β-hydroxyacyl-ACP dehydratase complex that participates in the mycolic acid elongation step. Separately, a library of 31 new TAC analogues was synthesized and evaluated against M. tuberculosis. Two of these compounds, 15 and 16, exhibited minimal inhibitory concentrations 10-fold lower than the parental molecule, and inhibited mycolic acid biosynthesis in a dose-dependent manner. Moreover, overexpression of HadAB HadBC or HadABC in M. tuberculosis led to high level resistance to these compounds, demonstrating that their mode of action is similar to that of TAC. In summary, this study uncovered new mutations associated with TAC resistance and also demonstrated that simple structural optimization of the TAC scaffold was possible and may lead to a new generation of TAC-derived drug candidates for the potential treatment of tuberculosis as mycolic acid inhibitors. PMID:23301038

  15. Overcoming ABC transporter-mediated multidrug resistance: Molecular mechanisms and novel therapeutic drug strategies.

    PubMed

    Li, Wen; Zhang, Han; Assaraf, Yehuda G; Zhao, Kun; Xu, Xiaojun; Xie, Jinbing; Yang, Dong-Hua; Chen, Zhe-Sheng

    2016-07-01

    Multidrug resistance is a key determinant of cancer chemotherapy failure. One of the major causes of multidrug resistance is the enhanced efflux of drugs by membrane ABC transporters. Targeting ABC transporters projects a promising approach to eliminating or suppressing drug resistance in cancer treatment. To reveal the functional mechanisms of ABC transporters in drug resistance, extensive studies have been conducted from identifying drug binding sites to elucidating structural dynamics. In this review article, we examined the recent crystal structures of ABC proteins to depict the functionally important structural elements, such as domains, conserved motifs, and critical amino acids that are involved in ATP-binding and drug efflux. We inspected the drug-binding sites on ABC proteins and the molecular mechanisms of various substrate interactions with the drug binding pocket. While our continuous battle against drug resistance is far from over, new approaches and technologies have emerged to push forward our frontier. Most recent developments in anti-MDR strategies include P-gp inhibitors, RNA-interference, nano-medicines, and delivering combination strategies. With the advent of the 'Omics' era - genomics, epigenomics, transcriptomics, proteomics, and metabolomics - these disciplines play an important role in fighting the battle against chemoresistance by further unraveling the molecular mechanisms of drug resistance and shed light on medical therapies that specifically target MDR. PMID:27449595

  16. Effect of mechanical surface and heat treatments on erosion resistance

    NASA Technical Reports Server (NTRS)

    Salik, J.; Buckley, D. H.

    1980-01-01

    The effects of mechanical surface treatments as well as heat treatments on the erosion resistance of 6061 aluminum alloy and 1045 steel were studied. Mechanical surface treatments were found to have little or no effect on the erosion resistance. This is due to the formation by particle impact of a work hardened surface layer regardless of the initial surface condition. The erosion resistance of Al single crystals is found to be independent of orientation. This is due to destruction of the surface microstructure and formation of a polycrystalline surface layer by the impact of erodant particles as observed by X-ray diffraction. While upon solution treatment of annealed 6061 aluminum the increase in hardness is accompanied by an increase in erosion resistance, precipitation treatment which causes a further increase in hardness results in slightly lower erosion resistance. Using two types of erodant particles, glass beads and crushed glass, the erosion rate is found to be strongly dependent on erodant particle shape, being an order of magnitude higher for erosion with crushed glass as compared to glass beads. While for erosion with glass beads heat treatment of 1045 steel had a profound effect on its erosion resistance, little or no such effect was observed for erosion with crushed glass.

  17. Resistive switching characteristics and mechanisms in silicon oxide memory devices

    NASA Astrophysics Data System (ADS)

    Chang, Yao-Feng; Fowler, Burt; Chen, Ying-Chen; Zhou, Fei; Wu, Xiaohan; Chen, Yen-Ting; Wang, Yanzhen; Xue, Fei; Lee, Jack C.

    2016-05-01

    Intrinsic unipolar SiOx-based resistance random access memories (ReRAM) characterization, switching mechanisms, and applications have been investigated. Device structures, material compositions, and electrical characteristics are identified that enable ReRAM cells with high ON/OFF ratio, low static power consumption, low switching power, and high readout-margin using complementary metal-oxide semiconductor transistor (CMOS)-compatible SiOx-based materials. These ideas are combined with the use of horizontal and vertical device structure designs, composition optimization, electrical control, and external factors to help understand resistive switching (RS) mechanisms. Measured temperature effects, pulse response, and carrier transport behaviors lead to compact models of RS mechanisms and energy band diagrams in order to aid the development of computer-aided design for ultralarge-v scale integration. This chapter presents a comprehensive investigation of SiOx-based RS characteristics and mechanisms for the post-CMOS device era.

  18. Precision microbiome restoration of bile acid-mediated resistance to Clostridium difficile

    PubMed Central

    Buffie, Charlie G.; Bucci, Vanni; Stein, Richard R.; McKenney, Peter T.; Ling, Lilan; Gobourne, Asia; No, Daniel; Liu, Hui; Kinnebrew, Melissa; Viale, Agnes; Littmann, Eric; van den Brink, Marcel R. M.; Jenq, Robert R.; Taur, Ying; Sander, Chris; Cross, Justin; Toussaint, Nora C.; Xavier, Joao B.; Pamer, Eric G.

    2015-01-01

    The gastrointestinal tracts of mammals are colonized by hundreds of microbial species that contribute to health, including colonization resistance against intestinal pathogens1. Many antibiotics destroy intestinal microbial communities and increase susceptibility to intestinal pathogens2. Among these, Clostridium difficile, a major cause of antibiotic-induced diarrhea, greatly increases morbidity and mortality in hospitalized patients3. Which intestinal bacteria provide resistance to C. difficile infection and their in vivo inhibitory mechanisms remain unclear. By treating mice with different antibiotics that result in distinct microbiota changes and lead to varied susceptibility to C. difficile, we correlated loss of specific bacterial taxa with development of infection. Mathematical modeling augmented by microbiota analyses of hospitalized patients identified resistance-associated bacteria common to mice and humans. Using these platforms, we determined that Clostridium scindens, a bile acid 7-dehydroxylating intestinal bacterium, is associated with resistance to C. difficile infection and, upon administration, enhances resistance to infection in a secondary bile acid-dependent fashion. Using a workflow involving mouse models, clinical studies, metagenomic analyses and mathematical modeling, we identified a probiotic candidate that corrects a clinically relevant microbiome deficiency. These findings have implications for rational design of targeted antimicrobials as well as microbiome-based diagnostics and therapeutics for individuals at risk for C. difficile infection. PMID:25337874

  19. Precision microbiome reconstitution restores bile acid mediated resistance to Clostridium difficile

    NASA Astrophysics Data System (ADS)

    Buffie, Charlie G.; Bucci, Vanni; Stein, Richard R.; McKenney, Peter T.; Ling, Lilan; Gobourne, Asia; No, Daniel; Liu, Hui; Kinnebrew, Melissa; Viale, Agnes; Littmann, Eric; van den Brink, Marcel R. M.; Jenq, Robert R.; Taur, Ying; Sander, Chris; Cross, Justin R.; Toussaint, Nora C.; Xavier, Joao B.; Pamer, Eric G.

    2015-01-01

    The gastrointestinal tracts of mammals are colonized by hundreds of microbial species that contribute to health, including colonization resistance against intestinal pathogens. Many antibiotics destroy intestinal microbial communities and increase susceptibility to intestinal pathogens. Among these, Clostridium difficile, a major cause of antibiotic-induced diarrhoea, greatly increases morbidity and mortality in hospitalized patients. Which intestinal bacteria provide resistance to C. difficile infection and their in vivo inhibitory mechanisms remain unclear. Here we correlate loss of specific bacterial taxa with development of infection, by treating mice with different antibiotics that result in distinct microbiota changes and lead to varied susceptibility to C. difficile. Mathematical modelling augmented by analyses of the microbiota of hospitalized patients identifies resistance-associated bacteria common to mice and humans. Using these platforms, we determine that Clostridium scindens, a bile acid 7α-dehydroxylating intestinal bacterium, is associated with resistance to C. difficile infection and, upon administration, enhances resistance to infection in a secondary bile acid dependent fashion. Using a workflow involving mouse models, clinical studies, metagenomic analyses, and mathematical modelling, we identify a probiotic candidate that corrects a clinically relevant microbiome deficiency. These findings have implications for the rational design of targeted antimicrobials as well as microbiome-based diagnostics and therapeutics for individuals at risk of C. difficile infection.

  20. Role of antioxidant enzymes in bacterial resistance to organic acids.

    PubMed

    Bruno-Bárcena, Jose M; Azcárate-Peril, M Andrea; Hassan, Hosni M

    2010-05-01

    Growth in aerobic environments has been shown to generate reactive oxygen species (ROS) and to cause oxidative stress in most organisms. Antioxidant enzymes (i.e., superoxide dismutases and hydroperoxidases) and DNA repair mechanisms provide protection against ROS. Acid stress has been shown to be associated with the induction of Mn superoxide dismutase (MnSOD) in Lactococcus lactis and Staphylococcus aureus. However, the relationship between acid stress and oxidative stress is not well understood. In the present study, we showed that mutations in the gene coding for MnSOD (sodA) increased the toxicity of lactic acid at pH 3.5 in Streptococcus thermophilus. The inclusion of the iron chelators 2,2'-dipyridyl (DIP), diethienetriamine-pentaacetic acid (DTPA), and O-phenanthroline (O-Phe) provided partial protection against 330 mM lactic acid at pH 3.5. The results suggested that acid stress triggers an iron-mediated oxidative stress that can be ameliorated by MnSOD and iron chelators. These findings were further validated in Escherichia coli strains lacking both MnSOD and iron SOD (FeSOD) but expressing a heterologous MnSOD from S. thermophilus. We also found that, in E. coli, FeSOD did not provide the same protection afforded by MnSOD and that hydroperoxidases are equally important in protecting the cells against acid stress. These findings may explain the ability of some microorganisms to survive better in acidified environments, as in acid foods, during fermentation and accumulation of lactic acid or during passage through the low pH of the stomach. PMID:20305033

  1. Tumor resistance to vascular disrupting agents: mechanisms, imaging, and solutions

    PubMed Central

    Liang, Wenjie; Ni, Yicheng; Chen, Feng

    2016-01-01

    The emergence of vascular disrupting agents (VDAs) is a significant advance in the treatment of solid tumors. VDAs induce rapid and selective shutdown of tumor blood flow resulting in massive necrosis. However, a viable marginal tumor rim always remains after VDA treatment and is a major cause of recurrence. In this review, we discuss the mechanisms involved in the resistance of solid tumors to VDAs. Hypoxia, tumor-associated macrophages, and bone marrow-derived circulating endothelial progenitor cells all may contribute to resistance. Resistance can be monitored using magnetic resonance imaging markers. The various solutions proposed to manage tumor resistance to VDAs emphasize combining these agents with other approaches including antiangiogenic agents, chemotherapy, radiotherapy, radioimmunotherapy, and sequential dual-targeting internal radiotherapy. PMID:26812886

  2. Effect of mechanical surface and heat treatments on erosion resistance

    NASA Technical Reports Server (NTRS)

    Salik, J.; Buckley, D. H.

    1981-01-01

    The effect of erosion by glass beads and crushed glass and by heat treatments on the erosional resistance of 6061 aluminum alloy and 1045 steel were studied. The aluminum alloy's erosion resistance was found to be insensitive to mechanical surface treatment applied before testing, and was determined to depend on the properties of the work-hardened surface layer; this was also demonstrated for aluminum alloy single crystals. The aluminum alloy heat treatments included annealing, solution, and precipitation. Solution was found to increase erosion resistance but precipitation had the opposite effect. Hardness showed no correlation with erosion resistance for either aluminum alloy steel. The steel tests showed that crushed glass provides an order of magnitude more erosion than glass beads.

  3. Jasmonic acid involves in grape fruit ripening and resistant against Botrytis cinerea.

    PubMed

    Jia, Haifeng; Zhang, Cheng; Pervaiz, Tariq; Zhao, Pengcheng; Liu, Zhongjie; Wang, Baoju; Wang, Chen; Zhang, Lin; Fang, Jinggui; Qian, Jianpu

    2016-01-01

    Fruit ripening is a complex process that is regulated by a signal network. Whereas the regulatory mechanism of abscisic acid has been studied extensively in non-climacteric fruit, little is know about other signaling pathways involved in this process. In this study, we performed that plant hormone jasmonic acid plays an important role in grape fruit coloring and softening by increasing the transcription levels of several ripening-related genes, such as the color-related genes PAL1, DFR, CHI, F3H, GST, CHS, and UFGT; softening-related genes PG, PL, PE, Cell, EG1, and XTH1; and aroma-related genes Ecar, QR, and EGS. Lastly, the fruit anthocyanin, phenol, aroma, and cell wall materials were changed. Jasmonic acid positively regulated its biosynthesis pathway genes LOS, AOS, and 12-oxophytodienoate reductase (OPR) and signal pathway genes COI1 and JMT. RNA interference of grape jasmonic acid pathway gene VvAOS in strawberry fruit appeared fruit un-coloring phenotypes; exogenous jasmonic acid rescued this phenotypes. On the contrary, overexpression of grape jasmonic acid receptor VvCOI1 in the strawberry fruit accelerated the fruit-ripening process and induced some plant defense-related gene expression level. Furthermore, jasmonic acid treatment or strong jasmonic acid signal pathway in strawberry fruit make the fruit resistance against Botrytis cinerea. PMID:26498957

  4. Sphingolipids in neuroblastoma: their role in drug resistance mechanisms.

    PubMed

    Sietsma, Hannie; Dijkhuis, Anne Jan; Kamps, Willem; Kok, Jan Willem

    2002-08-01

    Disseminated neuroblastoma usually calls for chemotherapy as the primary approach for treatment. Treatment failure is often attributable to drug resistance. This involves a variety of cellular mechanisms, including increased drug efflux through expression of ATP-binding cassette transporters (e.g., P-glycoprotein) and the inability of tumor cells to activate or propagate the apoptotic response. In recent years it has become apparent that sphingolipid metabolism and the generation of sphingolipid species, such as ceramide, also play a role in drug resistance. This may involve an autonomous mechanism, related to direct effects of sphingolipids on the apoptotic response, but also a subtle interplay between sphingolipids and ATP-binding cassette transporters. Here, we present an overview of the current understanding of the multiple levels at which sphingolipids function in drug resistance, with an emphasis on sphingolipid function in neuroblastoma and how modulation of sphingolipid metabolism may be used as a novel treatment paradigm. PMID:12374201

  5. Mechanisms of resistance to EGFR tyrosine kinase inhibitors

    PubMed Central

    Huang, Lihua; Fu, Liwu

    2015-01-01

    Since the discovery that non-small cell lung cancer (NSCLC) is driven by epidermal growth factor receptor (EGFR) mutations, the EGFR tyrosine kinase inhibitors (EGFR-TKIs, e.g., gefitinib and elrotinib) have been effectively used for clinical treatment. However, patients eventually develop drug resistance. Resistance to EGFR-TKIs is inevitable due to various mechanisms, such as the secondary mutation (T790M), activation of alternative pathways (c-Met, HGF, AXL), aberrance of the downstream pathways (K-RAS mutations, loss of PTEN), impairment of the EGFR-TKIs-mediated apoptosis pathway (BCL2-like 11/BIM deletion polymorphism), histologic transformation, ATP binding cassette (ABC) transporter effusion, etc. Here we review and summarize the known resistant mechanisms to EGFR-TKIs and provide potential targets for development of new therapeutic strategies. PMID:26579470

  6. Mechanisms of Drug Resistance in Relapse and Refractory Multiple Myeloma

    PubMed Central

    Yang, Wen-Chi; Lin, Sheng-Fung

    2015-01-01

    Multiple myeloma (MM) is a hematological malignancy that remains incurable because most patients eventually relapse or become refractory to current treatments. Although the treatments have improved, the major problem in MM is resistance to therapy. Clonal evolution of MM cells and bone marrow microenvironment changes contribute to drug resistance. Some mechanisms affect both MM cells and microenvironment, including the up- and downregulation of microRNAs and programmed death factor 1 (PD-1)/PD-L1 interaction. Here, we review the pathogenesis of MM cells and bone marrow microenvironment and highlight possible drug resistance mechanisms. We also review a potential molecular targeting treatment and immunotherapy for patients with refractory or relapse MM. PMID:26649299

  7. Emergent and evolving antimicrobial resistance cassettes in community-associated fusidic acid and meticillin-resistant Staphylococcus aureus.

    PubMed

    Ellington, Matthew J; Reuter, Sandra; Harris, Simon R; Holden, Matthew T G; Cartwright, Edward J; Greaves, Daniel; Gerver, Sarah M; Hope, Russell; Brown, Nicholas M; Török, M Estee; Parkhill, Julian; Köser, Claudio U; Peacock, Sharon J

    2015-05-01

    Fusidic acid is a topical and systemic antimicrobial used for the treatment of staphylococcal infections in hospitals and the community. Sales of fusidic acid and resistance rates among meticillin-resistant Staphylococcus aureus (MRSA) doubled between 1990 and 2001. For the following decade, fusidic acid resistance rates among isolates from Addenbrooke's Hospital (Cambridge, UK) were compared with national resistance rates from MRSA bacteraemia surveillance data and with antimicrobial sales data. Sales of fusidic acid remained relatively constant between 2002 and 2012, whilst fusidic acid resistance increased two- and four-fold in MRSA bacteraemias nationally and in MRSA isolates from Cambridge, respectively. A subgroup of MRSA resistant only to fusidic acid increased after 2006 by 5-fold amongst bacteraemias nationally and 17-fold (to 7.7% in 2012) amongst Cambridge MRSA isolates. All of the available local isolates from 2011 to 2012 (n=23) were acquired in the community, were not related epidemiologically and belonged to multilocus sequence typing (MLST) groups ST1, 5, 8, 45 or 149 as revealed from analysis of whole-genome sequence data. All harboured the fusC gene on one of six distinct staphylococcal cassette chromosome (SCC) elements, four of which were dual-resistance chimeras that encoded β-lactam and fusidic acid resistance. In summary, fusidic acid-resistant MRSA increased in prevalence during the 2000s with notable rises after 2006. The development of chimeric cassettes that confer dual resistance to β-lactams and fusidic acid demonstrates that the genetics underpinning resistance in community-associated MRSA are evolving. PMID:25769787

  8. Emergent and evolving antimicrobial resistance cassettes in community-associated fusidic acid and meticillin-resistant Staphylococcus aureus

    PubMed Central

    Ellington, Matthew J.; Reuter, Sandra; Harris, Simon R.; Holden, Matthew T.G.; Cartwright, Edward J.; Greaves, Daniel; Gerver, Sarah M.; Hope, Russell; Brown, Nicholas M.; Török, M. Estee; Parkhill, Julian; Köser, Claudio U.; Peacock, Sharon J.

    2015-01-01

    Fusidic acid is a topical and systemic antimicrobial used for the treatment of staphylococcal infections in hospitals and the community. Sales of fusidic acid and resistance rates among meticillin-resistant Staphylococcus aureus (MRSA) doubled between 1990 and 2001. For the following decade, fusidic acid resistance rates among isolates from Addenbrooke's Hospital (Cambridge, UK) were compared with national resistance rates from MRSA bacteraemia surveillance data and with antimicrobial sales data. Sales of fusidic acid remained relatively constant between 2002 and 2012, whilst fusidic acid resistance increased two- and four-fold in MRSA bacteraemias nationally and in MRSA isolates from Cambridge, respectively. A subgroup of MRSA resistant only to fusidic acid increased after 2006 by 5-fold amongst bacteraemias nationally and 17-fold (to 7.7% in 2012) amongst Cambridge MRSA isolates. All of the available local isolates from 2011 to 2012 (n = 23) were acquired in the community, were not related epidemiologically and belonged to multilocus sequence typing (MLST) groups ST1, 5, 8, 45 or 149 as revealed from analysis of whole-genome sequence data. All harboured the fusC gene on one of six distinct staphylococcal cassette chromosome (SCC) elements, four of which were dual-resistance chimeras that encoded β-lactam and fusidic acid resistance. In summary, fusidic acid-resistant MRSA increased in prevalence during the 2000s with notable rises after 2006. The development of chimeric cassettes that confer dual resistance to β-lactams and fusidic acid demonstrates that the genetics underpinning resistance in community-associated MRSA are evolving. PMID:25769787

  9. Worldwide Variability of Insecticide Resistance Mechanisms in the Codling Moth

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Known resistance mechanisms including the action of detoxifying enzymes and insensitive variants of target proteins were examined in individual male and female moths from 29 populations of codling moth, Cydia pomonella L collected in 11 countries in Africa, Europe, North America and the Australian c...

  10. Upconversion nanoparticles with a strong acid-resistant capping

    NASA Astrophysics Data System (ADS)

    Recalde, Ileana; Estebanez, Nestor; Francés-Soriano, Laura; Liras, Marta; González-Béjar, María; Pérez-Prieto, Julia

    2016-03-01

    Water-dispersible upconversion nanoparticles (β-NaYF4:Yb3+,Er3+, UCNP) coated with a thin shell of a biocompatible copolymer comprising 2-hydroxyethylmethacrylate (HEMA) and 2-acrylamido-2-methyl-1-propanesulphonsulphonic acid (AMPS), which we will term COP, have been prepared by multidentate grafting. This capping is remarkably resistant to strong acidic conditions as low as pH 2. The additional functionality of the smart UCNP@COP nanosystem has been proved by its association to a well-known photosensitizer (namely, methylene blue, MB). The green-to-red emission ratio of the UC@COP@MB nanohybrid exhibits excellent linear dependence in the 7 to 2 pH range as a consequence of the release of the dye as the pH decreases.Water-dispersible upconversion nanoparticles (β-NaYF4:Yb3+,Er3+, UCNP) coated with a thin shell of a biocompatible copolymer comprising 2-hydroxyethylmethacrylate (HEMA) and 2-acrylamido-2-methyl-1-propanesulphonsulphonic acid (AMPS), which we will term COP, have been prepared by multidentate grafting. This capping is remarkably resistant to strong acidic conditions as low as pH 2. The additional functionality of the smart UCNP@COP nanosystem has been proved by its association to a well-known photosensitizer (namely, methylene blue, MB). The green-to-red emission ratio of the UC@COP@MB nanohybrid exhibits excellent linear dependence in the 7 to 2 pH range as a consequence of the release of the dye as the pH decreases. Electronic supplementary information (ESI) available: Additional spectra and data of HEMA, AMPS, COP, UCNP@oleate, UCNP@COP, and UCNP@COP@MB. See DOI: 10.1039/c5nr06653k

  11. MIG1 Regulates Resistance of Candida albicans against the Fungistatic Effect of Weak Organic Acids

    PubMed Central

    Cottier, Fabien; Tan, Alrina Shin Min; Xu, Xiaoli; Wang, Yue

    2015-01-01

    Candida albicans is the leading cause of fungal infections; but it is also a member of the human microbiome, an ecosystem of thousands of microbial species potentially influencing the outcome of host-fungal interactions. Accordingly, antibacterial therapy raises the risk of candidiasis, yet the underlying mechanism is currently not fully understood. We hypothesize the existence of bacterial metabolites that normally control C. albicans growth and of fungal resistance mechanisms against these metabolites. Among the most abundant microbiota-derived metabolites found on human mucosal surfaces are weak organic acids (WOAs), such as acetic, propionic, butyric, and lactic acid. Here, we used quantitative growth assays to investigate the dose-dependent fungistatic properties of WOAs on C. albicans growth and found inhibition of growth to occur at physiologically relevant concentrations and pH values. This effect was conserved across distantly related fungal species both inside and outside the CTG clade. We next screened a library of transcription factor mutants and identified several genes required for the resistance of C. albicans to one or more WOAs. A single gene, MIG1, previously known for its role in glucose repression, conferred resistance against all four acids tested. Consistent with glucose being an upstream activator of Mig1p, the presence of this carbon source was required for WOA resistance in wild-type C. albicans. Conversely, a MIG1-complemented strain completely restored the glucose-dependent resistance against WOAs. We conclude that Mig1p plays a central role in orchestrating a transcriptional program to fight against the fungistatic effect of this class of highly abundant metabolites produced by the gastrointestinal tract microbiota. PMID:26297702

  12. Abscisic acid perception and signaling: structural mechanisms and applications

    PubMed Central

    Ng, Ley Moy; Melcher, Karsten; Teh, Bin Tean; Xu, H Eric

    2014-01-01

    Adverse environmental conditions are a threat to agricultural yield and therefore exert a global effect on livelihood, health and the economy. Abscisic acid (ABA) is a vital plant hormone that regulates abiotic stress tolerance, thereby allowing plants to cope with environmental stresses. Previously, attempts to develop a complete understanding of the mechanisms underlying ABA signaling have been hindered by difficulties in the identification of bona fide ABA receptors. The discovery of the PYR/PYL/RCAR family of ABA receptors therefore represented a major milestone in the effort to overcome these roadblocks; since then, many structural and functional studies have provided detailed insights into processes ranging from ABA perception to the activation of ABA-responsive gene transcription. This understanding of the mechanisms of ABA perception and signaling has served as the basis for recent, preliminary developments in the genetic engineering of stress-resistant crops as well as in the design of new synthetic ABA agonists, which hold great promise for the agricultural enhancement of stress tolerance. PMID:24786231

  13. Microstructure and corrosion resistance of phytic acid conversion coatings for magnesium alloy

    NASA Astrophysics Data System (ADS)

    Cui, Xiufang; Li, Qingfen; Li, Ying; Wang, Fuhui; Jin, Guo; Ding, Minghui

    2008-12-01

    In this paper, a new innoxious and pollution-free chemical protective coating for magnesium alloys, phytic acid conversion coating, was prepared. The conversion coatings are found to have high cover ratio and no cracks are found by atomic force microscopes (AFM) and scanning electron microscopy (SEM). The main elements of the conversion coatings are Mg, Al, O, P and C by X-ray photoelectron spectroscopy (XPS) and Auger electron spectroscopy (AES). The chemical state of the elements in the coatings was also investigated by Fourier transform infrared spectroscopy (FTIR). AES depth profile analysis suggests that the thickness of the conversion coating is about 340 nm. The corrosion resistance of the coatings was evaluated by polarization curves. The results indicate that the corrosion resistance for the conversion coated AZ91D magnesium alloys in 3.5% NaCl solution increases markedly. The mechanisms of corrosion resistance and coatings formation are also discussed.

  14. Ammonium Metabolism Enzymes Aid Helicobacter pylori Acid Resistance

    PubMed Central

    Miller, Erica F.

    2014-01-01

    The gastric pathogen Helicobacter pylori possesses a highly active urease to support acid tolerance. Urea hydrolysis occurs inside the cytoplasm, resulting in the production of NH3 that is immediately protonated to form NH4+. This ammonium must be metabolized or effluxed because its presence within the cell is counterproductive to the goal of raising pH while maintaining a viable proton motive force (PMF). Two compatible hypotheses for mitigating intracellular ammonium toxicity include (i) the exit of protonated ammonium outward via the UreI permease, which was shown to facilitate diffusion of both urea and ammonium, and/or (ii) the assimilation of this ammonium, which is supported by evidence that H. pylori assimilates urea nitrogen into its amino acid pools. We investigated the second hypothesis by constructing strains with altered expression of the ammonium-assimilating enzymes glutamine synthetase (GS) and glutamate dehydrogenase (GDH) and the ammonium-evolving periplasmic enzymes glutaminase (Ggt) and asparaginase (AsnB). H. pylori strains expressing elevated levels of either GS or GDH are more acid tolerant than the wild type, exhibit enhanced ammonium production, and are able to alkalize the medium faster than the wild type. Strains lacking the genes for either Ggt or AsnB are acid sensitive, have 8-fold-lower urea-dependent ammonium production, and are more acid sensitive than the parent. Additionally, we found that purified H. pylori GS produces glutamine in the presence of Mg2+ at a rate similar to that of unadenylated Escherichia coli GS. These data reveal that all four enzymes contribute to whole-cell acid resistance in H. pylori and are likely important for assimilation and/or efflux of urea-derived ammonium. PMID:24936052

  15. Emergence of Azole Resistance in Aspergillus fumigatus and Spread of a Single Resistance Mechanism

    PubMed Central

    Snelders, Eveline; van der Lee, Henrich A. L; Kuijpers, Judith; Rijs, Anthonius J. M. M; Varga, János; Samson, Robert A; Mellado, Emilia; Donders, A. Rogier T; Melchers, Willem J. G; Verweij, Paul E

    2008-01-01

    Background Resistance to triazoles was recently reported in Aspergillus fumigatus isolates cultured from patients with invasive aspergillosis. The prevalence of azole resistance in A. fumigatus is unknown. We investigated the prevalence and spread of azole resistance using our culture collection that contained A. fumigatus isolates collected between 1994 and 2007. Methods and Findings We investigated the prevalence of itraconazole (ITZ) resistance in 1,912 clinical A. fumigatus isolates collected from 1,219 patients in our University Medical Centre over a 14-y period. The spread of resistance was investigated by analyzing 147 A. fumigatus isolates from 101 patients, from 28 other medical centres in The Netherlands and 317 isolates from six other countries. The isolates were characterized using phenotypic and molecular methods. The electronic patient files were used to determine the underlying conditions of the patients and the presence of invasive aspergillosis. ITZ-resistant isolates were found in 32 of 1,219 patients. All cases were observed after 1999 with an annual prevalence of 1.7% to 6%. The ITZ-resistant isolates also showed elevated minimum inhibitory concentrations of voriconazole, ravuconazole, and posaconazole. A substitution of leucine 98 for histidine in the cyp51A gene, together with two copies of a 34-bp sequence in tandem in the gene promoter (TR/L98H), was found to be the dominant resistance mechanism. Microsatellite analysis indicated that the ITZ-resistant isolates were genetically distinct but clustered. The ITZ-sensitive isolates were not more likely to be responsible for invasive aspergillosis than the ITZ-resistant isolates. ITZ resistance was found in isolates from 13 patients (12.8%) from nine other medical centres in The Netherlands, of which 69% harboured the TR/L98H substitution, and in six isolates originating from four other countries. Conclusions Azole resistance has emerged in A. fumigatus and might be more prevalent than currently

  16. Mechanisms and consequences of bacterial resistance to antimicrobial peptides.

    PubMed

    Andersson, D I; Hughes, D; Kubicek-Sutherland, J Z

    2016-05-01

    Cationic antimicrobial peptides (AMPs) are an intrinsic part of the human innate immune system. Over 100 different human AMPs are known to exhibit broad-spectrum antibacterial activity. Because of the increased frequency of resistance to conventional antibiotics there is an interest in developing AMPs as an alternative antibacterial therapy. Several cationic peptides that are derivatives of AMPs from the human innate immune system are currently in clinical development. There are also ongoing clinical studies aimed at modulating the expression of AMPs to boost the human innate immune response. In this review we discuss the potential problems associated with these therapeutic approaches. There is considerable experimental data describing mechanisms by which bacteria can develop resistance to AMPs. As for any type of drug resistance, the rate by which AMP resistance would emerge and spread in a population of bacteria in a natural setting will be determined by a complex interplay of several different factors, including the mutation supply rate, the fitness of the resistant mutant at different AMP concentrations, and the strength of the selective pressure. Several studies have already shown that AMP-resistant bacterial mutants display broad cross-resistance to a variety of AMPs with different structures and modes of action. Therefore, routine clinical administration of AMPs to treat bacterial infections may select for resistant bacterial pathogens capable of better evading the innate immune system. The ramifications of therapeutic levels of exposure on the development of AMP resistance and bacterial pathogenesis are not yet understood. This is something that needs to be carefully studied and monitored if AMPs are used in clinical settings. PMID:27180309

  17. Antibacterial-Resistant Pseudomonas aeruginosa: Clinical Impact and Complex Regulation of Chromosomally Encoded Resistance Mechanisms

    PubMed Central

    Lister, Philip D.; Wolter, Daniel J.; Hanson, Nancy D.

    2009-01-01

    Summary: Treatment of infectious diseases becomes more challenging with each passing year. This is especially true for infections caused by the opportunistic pathogen Pseudomonas aeruginosa, with its ability to rapidly develop resistance to multiple classes of antibiotics. Although the import of resistance mechanisms on mobile genetic elements is always a concern, the most difficult challenge we face with P. aeruginosa is its ability to rapidly develop resistance during the course of treating an infection. The chromosomally encoded AmpC cephalosporinase, the outer membrane porin OprD, and the multidrug efflux pumps are particularly relevant to this therapeutic challenge. The discussion presented in this review highlights the clinical significance of these chromosomally encoded resistance mechanisms, as well as the complex mechanisms/pathways by which P. aeruginosa regulates their expression. Although a great deal of knowledge has been gained toward understanding the regulation of AmpC, OprD, and efflux pumps in P. aeruginosa, it is clear that we have much to learn about how this resourceful pathogen coregulates different resistance mechanisms to overcome the antibacterial challenges it faces. PMID:19822890

  18. ERECTA, salicylic acid, abscisic acid, and jasmonic acid modulate quantitative disease resistance of Arabidopsis thaliana to Verticillium longisporum

    PubMed Central

    2014-01-01

    Background Verticillium longisporum is a soil-borne vascular pathogen infecting cruciferous hosts such as oilseed rape. Quantitative disease resistance (QDR) is the major control means, but its molecular basis is poorly understood so far. Quantitative trait locus (QTL) mapping was performed using a new (Bur×Ler) recombinant inbred line (RIL) population of Arabidopsis thaliana. Phytohormone measurements and analyses in defined mutants and near-isogenic lines (NILs) were used to identify genes and signalling pathways that underlie different resistance QTL. Results QTL for resistance to V. longisporum-induced stunting, systemic colonization by the fungus and for V. longisporum-induced chlorosis were identified. Stunting resistance QTL were contributed by both parents. The strongest stunting resistance QTL was shown to be identical with Erecta. A functional Erecta pathway, which was present in Bur, conferred partial resistance to V. longisporum-induced stunting. Bur showed severe stunting susceptibility in winter. Three stunting resistance QTL of Ler origin, two co-localising with wall-associated kinase-like (Wakl)-genes, were detected in winter. Furthermore, Bur showed a much stronger induction of salicylic acid (SA) by V. longisporum than Ler. Systemic colonization was controlled independently of stunting. The vec1 QTL on chromosome 2 had the strongest effect on systemic colonization. The same chromosomal region controlled the level of abscisic acid (ABA) and jasmonic acid (JA) in response to V. longisporum: The level of ABA was higher in colonization-susceptible Ler than in colonization-resistant Bur after V. longisporum infection. JA was down-regulated in Bur after infection, but not in Ler. These differences were also demonstrated in NILs, varying only in the region containing vec1. All phytohormone responses were shown to be independent of Erecta. Conclusions Signalling systems with a hitherto unknown role in the QDR of A. thaliana against V. longisporum were

  19. Acid ceramidase upregulation in prostate cancer cells confers resistance to radiation: AC inhibition, a potential radiosensitizer.

    PubMed

    Mahdy, Ayman E M; Cheng, Joseph C; Li, Jun; Elojeimy, Saeed; Meacham, William D; Turner, Lorianne S; Bai, Aiping; Gault, Christopher R; McPherson, Alex S; Garcia, Nicole; Beckham, Thomas H; Saad, Antonio; Bielawska, Alicja; Bielawski, Jacek; Hannun, Yusuf A; Keane, Thomas E; Taha, Mohhammed I; Hammouda, Hisham M; Norris, James S; Liu, Xiang

    2009-03-01

    Radiation resistance in a subset of prostate tumors remains a challenge to prostate cancer radiotherapy. The current study on the effects of radiation on prostate cancer cells reveals that radiation programs an unpredicted resistance mechanism by upregulating acid ceramidase (AC). Irradiated cells demonstrated limited changes of ceramide levels while elevating levels of sphingosine and sphingosine-1-phosphate. By genetically downregulating AC with small interfering RNA (siRNA), we observed radiosensitization of cells using clonogenic and cytotoxicity assays. Conversely, AC overexpression further decreased sensitivity to radiation. We also observed that radiation-induced AC upregulation was sufficient to create cross-resistance to chemotherapy as demonstrated by decreased sensitivity to Taxol and C(6) ceramide compared to controls. Lower levels of caspase 3/7 activity were detected in cells pretreated with radiation, also indicating increased resistance. Finally, utilization of the small molecule AC inhibitor, LCL385, sensitized PPC-1 cells to radiation and significantly decreased tumor xenograft growth. These data suggest a new mechanism of cancer cell resistance to radiation, through upregulation of AC that is, in part, mediated by application of the therapy itself. An improved understanding of radiotherapy and the application of combination therapy achieved in this study offer new opportunities for the modulation of radiation effects in the treatment of cancer. PMID:19107118

  20. 16S ribosomal RNA methylation: emerging resistance mechanism against aminoglycosides.

    PubMed

    Doi, Yohei; Arakawa, Yoshichika

    2007-07-01

    Methylation of 16S ribosomal RNA (rRNA) has recently emerged as a new mechanism of resistance against aminoglycosides among gram-negative pathogens belonging to the family Enterobacteriaceae and glucose-nonfermentative microbes, including Pseudomonas aeruginosa and Acinetobacter species. This event is mediated by a newly recognized group of 16S rRNA methylases, which share modest similarity to those produced by aminoglycoside-producing actinomycetes. Their presence confers a high level of resistance to all parenterally administered aminoglycosides that are currently in clinical use. The responsible genes are mostly located on transposons within transferable plasmids, which provides them with the potential to spread horizontally and may in part explain the already worldwide distribution of this novel resistance mechanism. Some of these organisms have been found to coproduce extended-spectrum beta-lactamases or metallo-beta-lactamases, contributing to their multidrug-resistant phenotypes. A 2-tiered approach, consisting of disk diffusion tests followed by confirmation with polymerase chain reaction, is recommended for detection of 16S rRNA methylase-mediated resistance. PMID:17554708

  1. Eco-friendly Rot and Crease Resistance Finishing of Jute Fabric using Citric Acid and Chitosan

    NASA Astrophysics Data System (ADS)

    Samanta, A. K.; Bagchi, A.

    2013-03-01

    Citric acid (CA) along with chitosan was used on bleached jute fabrics to impart anti crease and rot resistance properties in one step. The treatment was carried out by pad-dry-cure method in presence of sodium hypophosphite monohydrate catalyst. Curing at 150° Centigrade for 5 min delivered good crease resistant property (dry crease recovery angle is 244°) and high rot resistance simultaneously by a single treatment, which are durable for five washings with distilled water. Strength retention of jute fabric after 21 days soil burial was found to be 81 % and the loss (%) in strength due to this treatment was 15-18 %. The results showed that chitosan and CA treated-fabric exhibited higher rot resistance (as indicated by soil burial test) when compared to either CA or chitosan by individual treatment. The effect of CA and chitosan combination on the resistance to rotting of jute fabric was found to be synergistic which is higher than the sum of the effects of individual chemicals. CA possibly reacts with hydroxyl groups in cellulose or chitosan to form ester. The CA and chitosan finished fabric has adverse effect on stiffness. Thermal studies showed that final residue left at 500° C was much higher for CA and chitosan treated fabric than untreated jute fabric. FTIR spectroscopy suggested the formation of ester cross-linkage between the jute fibre, CA and chitosan and hence it is understood that this rot resistant finish on jute fabric become durable by this mechanism.

  2. Increased thymidylate synthase in L1210 cells possessing acquired resistance to N10-propargyl-5,8-dideazafolic acid (CB3717): development, characterization, and cross-resistance studies

    SciTech Connect

    Jackman, A.L.; Alison, D.L.; Calvert, A.H.; Harrap, K.R.

    1986-06-01

    The properties are described of a mutant L1210 cell line (L1210:C15) with acquired resistance (greater than 200-fold) to the thymidylate synthase (TS) inhibitor N10-propargyl-5,8-dideazafolic acid. TS was overproduced 45-fold and was accompanied by a small increase in the activity of dihydrofolate reductase (2.6-fold). Both the level of resistance and enzyme activities were maintained in drug-free medium (greater than 300 generations). Failure of N10-propargyl-5,8-dideazafolic acid to suppress the (/sup 3/H)-2'-deoxyuridine incorporation into the acid-precipitable material of the resistant line supported the evidence that TS overproduction was the mechanism of resistance; consequently the L1210:C15 cells were largely cross-resistant to another (but weaker) TS inhibitor, 5,8-dideazafolic acid. Minimal cross-resistance was observed to the dihydrofolate reductase inhibitors methotrexate and 5-methyl-5,8-dideazaaminopterin (5- and 2-fold, respectively). L1210 and L1210:C15 cells were, however, equally sensitive to 5-fluorodeoxyuridine (FdUrd), an unexpected finding since a metabolite, 5-fluorodeoxyuridine monophosphate, is a potent TS inhibitor; however, this cytotoxicity against the L1210:C15 cells was antagonized by coincubation with 5 microM folinic acid although folinic acid potentiated the cytotoxicity of FdUrd to the N10-propargyl-5,8-dideazafolic acid-sensitive L1210 line. Thymidine was much less effective as a FdUrd protecting agent in the L1210:C15 when compared with the L1210 cells; however, a combination of thymidine plus hypoxanthine was without any additional effect (compared with thymidine alone) against the sensitive line but effectively protected L1210:C15 cells.

  3. The Landscape of Pancreatic Cancer Therapeutic Resistance Mechanisms.

    PubMed

    Chand, Saswati; O'Hayer, Kevin; Blanco, Fernando F; Winter, Jordan M; Brody, Jonathan R

    2016-01-01

    Pancreatic cancer (pancreatic ductal adenocarcinoma, PDA) is infamously moving to the top of the list as one of the most lethal cancers with an overall 5 year survival rate of 7%. Multiple genomic-based and molecular characterization studies of PDA specimens and established animal models have provided the field with multiple targets and a progression model of this disease. Still, to date, the best therapeutic options are surgery and combination cytotoxic therapies. In general, even in the best case scenario (i.e., an early stage diagnosis and a response to a specific therapy), most of these fortunate patients' PDA cells acquire or exert resistance mechanisms and eventually kill the patient. Herein, we touch on a growing field of investigation that focuses on PDA cell therapeutic resistance mechanisms. We examine extrinsic elements (i.e., the tumor microenvironment, hypoxia) to the intrinsic processes within the cell (i.e., post-transcriptional gene regulation and somatic mutations) that are important for therapeutic efficacy and resistance. Even as better targeted and personalized approaches move through the clinical trial pipeline the discussed resistance mechanisms will most likely play a role in the management of this deadly disease. PMID:26929734

  4. The Landscape of Pancreatic Cancer Therapeutic Resistance Mechanisms

    PubMed Central

    Chand, Saswati; O'Hayer, Kevin; Blanco, Fernando F.; Winter, Jordan M.; Brody, Jonathan R.

    2016-01-01

    Pancreatic cancer (pancreatic ductal adenocarcinoma, PDA) is infamously moving to the top of the list as one of the most lethal cancers with an overall 5 year survival rate of 7%. Multiple genomic-based and molecular characterization studies of PDA specimens and established animal models have provided the field with multiple targets and a progression model of this disease. Still, to date, the best therapeutic options are surgery and combination cytotoxic therapies. In general, even in the best case scenario (i.e., an early stage diagnosis and a response to a specific therapy), most of these fortunate patients' PDA cells acquire or exert resistance mechanisms and eventually kill the patient. Herein, we touch on a growing field of investigation that focuses on PDA cell therapeutic resistance mechanisms. We examine extrinsic elements (i.e., the tumor microenvironment, hypoxia) to the intrinsic processes within the cell (i.e., post-transcriptional gene regulation and somatic mutations) that are important for therapeutic efficacy and resistance. Even as better targeted and personalized approaches move through the clinical trial pipeline the discussed resistance mechanisms will most likely play a role in the management of this deadly disease. PMID:26929734

  5. Molecular mechanisms of cisplatin resistance in cervical cancer

    PubMed Central

    Zhu, Haiyan; Luo, Hui; Zhang, Wenwen; Shen, Zhaojun; Hu, Xiaoli; Zhu, Xueqiong

    2016-01-01

    Patients with advanced or recurrent cervical cancer have poor prognosis, and their 1-year survival is only 10%–20%. Chemotherapy is considered as the standard treatment for patients with advanced or recurrent cervical cancer, and cisplatin appears to treat the disease effectively. However, resistance to cisplatin may develop, thus substantially compromising the efficacy of cisplatin to treat advanced or recurrent cervical cancer. In this article, we systematically review the recent literature and summarize the recent advances in our understanding of the molecular mechanisms underlying cisplatin resistance in cervical cancer. PMID:27354763

  6. A molecular mechanism of artemisinin resistance in Plasmodium falciparum malaria

    PubMed Central

    Mbengue, Alassane; Bhattacharjee, Souvik; Pandharkar, Trupti; Liu, Haining; Estiu, Guillermina; Stahelin, Robert V.; Rizk, Shahir; Njimoh, Dieudonne L.; Ryan, Yana; Chotivanich, Kesinee; Nguon, Chea; Ghorbal, Mehdi; Lopez-Rubio, Jose-Juan; Pfrender, Michael; Emrich, Scott; Mohandas, Narla; Dondorp, Arjen M.; Wiest, Olaf; Haldar, Kasturi

    2015-01-01

    Artemisinins are the corner stone of anti-malarial drugs1. Emergence and spread of resistance to them2–4 raises risk of wiping out recent gains achieved in reducing world-wide malaria burden and threatens future malaria control and elimination on a global level. Genome wide association studies (GWAS) have revealed parasite genetic loci associated with artemisinin resistance5–10. However, there is no consensus on biochemical targets of artemisinin. Whether and how these targets interact with genes identified by GWAS, remains unknown. Here we provide biochemical and cellular evidence that artemisinins are potent inhibitors of Plasmodium falciparum phosphatidylinositol-3-kinase (PfPI3K), revealing an unexpected mechanism of action. In resistant clinical strains, increased PfPI3K was associated with the C580Y mutation in P. falciparum Kelch13 (PfKelch13), a primary marker of artemisinin resistance. Polyubiquitination of PfPI3K and its binding to PfKelch13 were reduced by PfKelch13 mutation, which limited proteolysis of PfPI3K and thus increased levels of the kinase as well as its lipid product phosphatidylinositol 3-phosphate (PI3P). We find PI3P levels to be predictive of artemisinin resistance in both clinical and engineered laboratory parasites as well as across non-isogenic strains. Elevated PI3P induced artemisinin resistance in absence of PfKelch13 mutations, but remained responsive to regulation by PfKelch13. Evidence is presented for PI3P-dependent signaling, where transgenic expression of an additional kinase confers resistance. Together these data present PI3P as the key mediator of artemisinin resistance and the sole PfPI3K as an important target for malaria elimination. PMID:25874676

  7. Hexanoic acid is a resistance inducer that protects tomato plants against Pseudomonas syringae by priming the jasmonic acid and salicylic acid pathways.

    PubMed

    Scalschi, Loredana; Vicedo, Begonya; Camañes, Gemma; Fernandez-Crespo, Emma; Lapeña, Leonor; González-Bosch, Carmen; García-Agustín, Pilar

    2013-05-01

    Hexanoic acid-induced resistance (Hx-IR) is effective against several pathogens in tomato plants. Our study of the mechanisms implicated in Hx-IR against Pseudomonas syringae pv. tomato DC3000 suggests that hexanoic acid (Hx) treatment counteracts the negative effect of coronatine (COR) and jasmonyl-isoleucine (JA-Ile) on the salicylic acid (SA) pathway. In Hx-treated plants, an increase in the expression of jasmonic acid carboxyl methyltransferase (JMT) and the SA marker genes PR1 and PR5 indicates a boost in this signalling pathway at the expense of a decrease in JA-Ile. Moreover, Hx treatment potentiates 12-oxo-phytodienoic acid accumulation, which suggests that this molecule might play a role per se in Hx-IR. These results support a positive relationship between the SA and JA pathways in Hx-primed plants. Furthermore, one of the mechanisms of virulence mediated by COR is stomatal re-opening on infection with P. syringae. In this work, we observed that Hx seems to inhibit stomatal opening in planta in the presence of COR, which suggests that, on infection in tomato, this treatment suppresses effector action to prevent bacterial entry into the mesophyll. PMID:23279078

  8. Skeletal muscle fatty acid handling in insulin resistant men.

    PubMed

    van Hees, Anneke M J; Jans, Anneke; Hul, Gabby B; Roche, Helen M; Saris, Wim H M; Blaak, Ellen E

    2011-07-01

    Disturbances in skeletal muscle lipid metabolism may precede or contribute to the development of whole body insulin resistance. In this study, we examined fasting and postprandial skeletal muscle fatty acid (FA) handling in insulin resistant (IR) men. Thirty men with the metabolic syndrome (MetS) (National Cholesterol Education Program-Adult Treatment Panel III) were included in this sub-study to the LIPGENE study, and divided in two groups (IR and control) based on the median of insulin sensitivity (S(I) = 2.06 (mU/l(-1))·min(-1)·10(-4)). Fasting and postprandial skeletal muscle FA handling were examined by combining the forearm balance technique with stable isotopes of palmitate. [(2)H(2)]-palmitate was infused intravenously to label endogenous triacylglycerol (TAG) and free FAs (FFAs) in the circulation and [U-(13)C]-palmitate was incorporated in a high-fat mixed meal (2.6 MJ, 61 E% fat) to label chylomicron-TAG. Muscle biopsies were taken to determine muscle TAG, diacylglycerol (DAG), FFA, and phospholipid (PL) content, their fractional synthetic rates (FSRs) and degree of saturation, as well as messenger RNA (mRNA) expression of genes involved in lipid metabolism. In the first 2 h after meal consumption, forearm muscle [(2)H(2)]-labeled TAG extraction was higher in IR vs. control (P = 0.05). Fasting percentage saturation of muscle DAG was higher in IR vs. control (P = 0.016). No differences were observed for intramuscular TAG, DAG, FFA, and PL content, FSR, and muscle mRNA expression. In conclusion, increased muscle (hepatically derived) TAG extraction during postprandial conditions and increased saturation of intramuscular DAG are associated with insulin resistance, suggesting that disturbances in skeletal muscle FA handling could play a role in the development of whole body insulin resistance and type 2 diabetes. PMID:21331063

  9. Eicosapentaenoic acid reduces high-fat diet-induced insulin resistance by altering adipose tissue glycolytic and inflammatory function

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We previously reported Eicosapentaenoic Acid (EPA)'s ability to prevent high-fat (HF) diet-induced obesity, insulin resistance, and inflammation. In this study, we dissected mechanisms mediating anti-inflammatory and anti-lipogenic actions of EPA, using histology/ immunohistochemistry, transcriptomi...

  10. Towards the Understanding of Resistance Mechanisms in Clinically Isolated Trimethoprim-resistant, Methicillin-resistant Staphylococcus aureus Dihydrofolate Reductase

    SciTech Connect

    Frey, K.; Lombardo, M; Wright, D; Anderson, A

    2010-01-01

    Resistance to therapeutics such as trimethoprim-sulfamethoxazole has become an increasing problem in strains of methicillin-resistant Staphylococcus aureus (MRSA). Clinically isolated trimethoprim-resistant strains reveal a double mutation, H30N/F98Y, in dihydrofolate reductase (DHFR). In order to develop novel and effective therapeutics against these resistant strains, we evaluated a series of propargyl-linked antifolate lead compounds for inhibition of the mutant enzyme. For the propargyl-linked antifolates, the F98Y mutation generates minimal (between 1.2- and 6-fold) losses of affinity and the H30N mutation generates greater losses (between 2.4- and 48-fold). Conversely, trimethoprim affinity is largely diminished by the F98Y mutation (36-fold) and is not affected by the H30N mutation. In order to elucidate a mechanism of resistance, we determined a crystal structure of a complex of this double mutant with a lead propargyl-linked antifolate. This structure suggests a resistance mechanism consistent both for the propargyl-linked class of antifolates and for trimethoprim that is based on the loss of a conserved water-mediated hydrogen bond.

  11. Mechanisms and evolution of plant resistance to aphids.

    PubMed

    Züst, Tobias; Agrawal, Anurag A

    2016-01-01

    Aphids are important herbivores of both wild and cultivated plants. Plants rely on unique mechanisms of recognition, signalling and defence to cope with the specialized mode of phloem feeding by aphids. Aspects of the molecular mechanisms underlying aphid-plant interactions are beginning to be understood. Recent advances include the identification of aphid salivary proteins involved in host plant manipulation, and plant receptors involved in aphid recognition. However, a complete picture of aphid-plant interactions requires consideration of the ecological outcome of these mechanisms in nature, and the evolutionary processes that shaped them. Here we identify general patterns of resistance, with a special focus on recognition, phytohormonal signalling, secondary metabolites and induction of plant resistance. We discuss how host specialization can enable aphids to co-opt both the phytohormonal responses and defensive compounds of plants for their own benefit at a local scale. In response, systemically induced resistance in plants is common and often involves targeted responses to specific aphid species or even genotypes. As co-evolutionary adaptation between plants and aphids is ongoing, the stealthy nature of aphid feeding makes both the mechanisms and outcomes of these interactions highly distinct from those of other herbivore-plant interactions. PMID:27250753

  12. Investigating the Molecular Mechanisms of Organophosphate and Pyrethroid Resistance in the Fall Armyworm Spodoptera frugiperda

    PubMed Central

    Carvalho, Renato A.; Omoto, Celso; Field, Linda M.; Williamson, Martin S.; Bass, Chris

    2013-01-01

    The fall armyworm Spodoptera frugiperda is an economically important pest of small grain crops that occurs in all maize growing regions of the Americas. The intensive use of chemical pesticides for its control has led to the selection of resistant populations, however, to date, the molecular mechanisms underlying resistance have not been characterised. In this study the mechanisms involved in the resistance of two S. frugiperda strains collected in Brazil to chlorpyrifos (OP strain) or lambda-cyhalothrin (PYR strain) were investigated using molecular and genomic approaches. To examine the possible role of target-site insensitivity the genes encoding the organophosphate (acetylcholinesterase, AChE) and pyrethroid (voltage-gated sodium channel, VGSC) target-site proteins were PCR amplified. Sequencing of the S. frugiperda ace-1 gene identified several nucleotide changes in the OP strain when compared to a susceptible reference strain (SUS). These result in three amino acid substitutions, A201S, G227A and F290V, that have all been shown previously to confer organophosphate resistance in several other insect species. Sequencing of the gene encoding the VGSC in the PYR strain, identified mutations that result in three amino acid substitutions, T929I, L932F and L1014F, all of which have been shown previously to confer knockdown/super knockdown-type resistance in several arthropod species. To investigate the possible role of metabolic detoxification in the resistant phenotype of the OP and PYR stains all EST sequences available for S. frugiperda were used to design a gene-expression microarray. This was then used to compare gene expression in the resistant strains with the susceptible reference strain. Members of several gene families, previously implicated in metabolic resistance in other insects were found to be overexpressed in the resistant strains including glutathione S-transferases, cytochrome P450s and carboxylesterases. Taken together these results provide

  13. Mechanisms of sensitivity and resistance of murine tumors to 5-fluorouracil.

    PubMed

    Ardalan, B; Cooney, D A; Jayaram, H N; Carrico, C K; Glazer, R I; Macdonald, J; Schein, P S

    1980-05-01

    The biochemical basis for the resistance of murine leukemia P388 to 5-fluorouracil (FUra) was systematically investigated by examining the transport and metabolism of FUra, or its anabolites, as well as the inhibition of enzymes and processes known to be affected by the drug. Of these parameters, only three were found to be altered significantly in the resistant line: (a) the enzyme required for the phosphorylation of uridine 5'-monophosphate to uridine 5'-diphosphate was present at a significantly lower specific activity in the resistant line than in its sensitive counterpart; (b) the rates of generation and persistance of 5-fluoro-2'-deoxyuridine 5'-monophosphate were significantly lower and shorter in the variant; and (c) there was a 1.6- and 3-fold decrease in the incorporation of FUra into polyadenylic acid-containing RNA and polyadenylic acid-lacking RNA, respectively, in resistant versus sensitive cells. Taken together, these findings suggest a dual mechanism for resistance to FUra in these leukemic cells, namely, a depressed capacity to generate di- and triphosphates of the riboside and deoxyriboside of the drug leading to lower pools of the proximate antimetabolite, fluorouridine 5'-triphosphate, and accelerated excretion of 5-fluoro-2'-deoxyuridine 5'-monophosphate, so that thymidylate synthetase is perturbed in a less than lethal way. PMID:6245793

  14. The Emerging Role of Branched-Chain Amino Acids in Insulin Resistance and Metabolism

    PubMed Central

    Yoon, Mee-Sup

    2016-01-01

    Insulin is required for maintenance of glucose homeostasis. Despite the importance of insulin sensitivity to metabolic health, the mechanisms that induce insulin resistance remain unclear. Branched-chain amino acids (BCAAs) belong to the essential amino acids, which are both direct and indirect nutrient signals. Even though BCAAs have been reported to improve metabolic health, an increased BCAA plasma level is associated with a high risk of metabolic disorder and future insulin resistance, or type 2 diabetes mellitus (T2DM). The activation of mammalian target of rapamycin complex 1 (mTORC1) by BCAAs has been suggested to cause insulin resistance. In addition, defective BCAA oxidative metabolism might occur in obesity, leading to a further accumulation of BCAAs and toxic intermediates. This review provides the current understanding of the mechanism of BCAA-induced mTORC1 activation, as well as the effect of mTOR activation on metabolic health in terms of insulin sensitivity. Furthermore, the effects of impaired BCAA metabolism will be discussed in detail. PMID:27376324

  15. The Emerging Role of Branched-Chain Amino Acids in Insulin Resistance and Metabolism.

    PubMed

    Yoon, Mee-Sup

    2016-01-01

    Insulin is required for maintenance of glucose homeostasis. Despite the importance of insulin sensitivity to metabolic health, the mechanisms that induce insulin resistance remain unclear. Branched-chain amino acids (BCAAs) belong to the essential amino acids, which are both direct and indirect nutrient signals. Even though BCAAs have been reported to improve metabolic health, an increased BCAA plasma level is associated with a high risk of metabolic disorder and future insulin resistance, or type 2 diabetes mellitus (T2DM). The activation of mammalian target of rapamycin complex 1 (mTORC1) by BCAAs has been suggested to cause insulin resistance. In addition, defective BCAA oxidative metabolism might occur in obesity, leading to a further accumulation of BCAAs and toxic intermediates. This review provides the current understanding of the mechanism of BCAA-induced mTORC1 activation, as well as the effect of mTOR activation on metabolic health in terms of insulin sensitivity. Furthermore, the effects of impaired BCAA metabolism will be discussed in detail. PMID:27376324

  16. Genome Sequence Analysis of the Naphthenic Acid Degrading and Metal Resistant Bacterium Cupriavidus gilardii CR3.

    PubMed

    Wang, Xiaoyu; Chen, Meili; Xiao, Jingfa; Hao, Lirui; Crowley, David E; Zhang, Zhewen; Yu, Jun; Huang, Ning; Huo, Mingxin; Wu, Jiayan

    2015-01-01

    Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals. PMID:26301592

  17. Genome Sequence Analysis of the Naphthenic Acid Degrading and Metal Resistant Bacterium Cupriavidus gilardii CR3

    PubMed Central

    Xiao, Jingfa; Hao, Lirui; Crowley, David E.; Zhang, Zhewen; Yu, Jun; Huang, Ning; Huo, Mingxin; Wu, Jiayan

    2015-01-01

    Cupriavidus sp. are generally heavy metal tolerant bacteria with the ability to degrade a variety of aromatic hydrocarbon compounds, although the degradation pathways and substrate versatilities remain largely unknown. Here we studied the bacterium Cupriavidus gilardii strain CR3, which was isolated from a natural asphalt deposit, and which was shown to utilize naphthenic acids as a sole carbon source. Genome sequencing of C. gilardii CR3 was carried out to elucidate possible mechanisms for the naphthenic acid biodegradation. The genome of C. gilardii CR3 was composed of two circular chromosomes chr1 and chr2 of respectively 3,539,530 bp and 2,039,213 bp in size. The genome for strain CR3 encoded 4,502 putative protein-coding genes, 59 tRNA genes, and many other non-coding genes. Many genes were associated with xenobiotic biodegradation and metal resistance functions. Pathway prediction for degradation of cyclohexanecarboxylic acid, a representative naphthenic acid, suggested that naphthenic acid undergoes initial ring-cleavage, after which the ring fission products can be degraded via several plausible degradation pathways including a mechanism similar to that used for fatty acid oxidation. The final metabolic products of these pathways are unstable or volatile compounds that were not toxic to CR3. Strain CR3 was also shown to have tolerance to at least 10 heavy metals, which was mainly achieved by self-detoxification through ion efflux, metal-complexation and metal-reduction, and a powerful DNA self-repair mechanism. Our genomic analysis suggests that CR3 is well adapted to survive the harsh environment in natural asphalts containing naphthenic acids and high concentrations of heavy metals. PMID:26301592

  18. Nucleic Acid-Targeting Pathways Promote Inflammation in Obesity-Related Insulin Resistance.

    PubMed

    Revelo, Xavier S; Ghazarian, Magar; Chng, Melissa Hui Yen; Luck, Helen; Kim, Justin H; Zeng, Kejing; Shi, Sally Y; Tsai, Sue; Lei, Helena; Kenkel, Justin; Liu, Chih Long; Tangsombatvisit, Stephanie; Tsui, Hubert; Sima, Corneliu; Xiao, Changting; Shen, Lei; Li, Xiaoying; Jin, Tianru; Lewis, Gary F; Woo, Minna; Utz, Paul J; Glogauer, Michael; Engleman, Edgar; Winer, Shawn; Winer, Daniel A

    2016-07-19

    Obesity-related inflammation of metabolic tissues, including visceral adipose tissue (VAT) and liver, are key factors in the development of insulin resistance (IR), though many of the contributing mechanisms remain unclear. We show that nucleic-acid-targeting pathways downstream of extracellular trap (ET) formation, unmethylated CpG DNA, or ribonucleic acids drive inflammation in IR. High-fat diet (HFD)-fed mice show increased release of ETs in VAT, decreased systemic clearance of ETs, and increased autoantibodies against conserved nuclear antigens. In HFD-fed mice, this excess of nucleic acids and related protein antigens worsens metabolic parameters through a number of mechanisms, including activation of VAT macrophages and expansion of plasmacytoid dendritic cells (pDCs) in the liver. Consistently, HFD-fed mice lacking critical responders of nucleic acid pathways, Toll-like receptors (TLR)7 and TLR9, show reduced metabolic inflammation and improved glucose homeostasis. Treatment of HFD-fed mice with inhibitors of ET formation or a TLR7/9 antagonist improves metabolic disease. These findings reveal a pathogenic role for nucleic acid targeting as a driver of metabolic inflammation in IR. PMID:27373163

  19. Mechanisms of resistance to HER family targeting antibodies

    SciTech Connect

    Kruser, Tim J.; Wheeler, Deric L.

    2010-04-15

    The epidermal growth factor (EGF) family of receptor tyrosine kinases consists of four members: EGFR (HER1/ErbB1), HER2/neu (ErbB2), HER3 (ErbB3) and HER4 (ErbB4). Receptor activation via ligand binding leads to downstream signaling that influence cell proliferation, angiogenesis, invasion and metastasis. Aberrant expression or activity of EGFR and HER2 have been strongly linked to the etiology of several human epithelial cancers including but not limited to head and neck squamous cell carcinoma (HNSCC), non-small cell lung cancer (NSCLC), colorectal cancer (CRC), and breast cancer. With this, intense efforts have been made to inhibit the activity of the EGFR and HER2 by designing antibodies against the ligand binding domains (cetuximab, panitumumab and trastuzumab) or small molecules against the tyrosine kinase domains (erlotinib, gefitinib, and lapatinib). Both approaches have shown considerable clinical promise. However, increasing evidence suggests that the majority of patients do not respond to these therapies, and those who show initial response ultimately become refractory to treatment. While mechanisms of resistance to tyrosine kinase inhibitors have been extensively studied, resistance to monoclonal antibodies is less well understood, both in the laboratory and in the clinical setting. In this review, we discuss resistance to antibody-based therapies against the EGFR and HER2, similarities between these resistance profiles, and strategies to overcome resistance to HER family targeting monoclonal antibody therapy.

  20. [MOLECULAR MECHANISMS OF DRUG RESISTANCE NEISSERIA GONORRHOEAE HISTORY AND PROSPECTS].

    PubMed

    Bodoev, I N; Il'ina, E N

    2015-01-01

    Neisseria gonorrhoeae (gonococcus) is a strict human pathogen, which causes gonorrhea--an infectious disease, whose origin dates back to more than two thousand years. Due to the unique plasticity of the genetic material, these bacteria have acquired the capacity to adapt to the host immune system, cause repeated infections, as well as withstand antimicrobials. Since the introduction of antibiotics in 1930s, gonococcus has displayed its propensity to develop resistance to all clinically useful antibiotics. It is important to note that the known resistance determinants of N. gonorrhoeae were acquired through horizontal gene transfer, recombination and spontaneous mutagenesis, and may be located both in the chromosome and on the plasmid. After introduction of a new antimicrobial drug, gonococcus becomes resistant within two decades and replaces sensitive bacterial population. Currently Ceftriaxone is the last remaining antibiotic for first-line treatment of gonorrhea. However, the first gonococcus displaying high-level resistance to Ceftriaxone was isolated in Japan a few years ago. Therefore, in the near future, gonorrhea may become untreatable. In the present review, we discuss the chronology of the anti-gonorrhea drugs (antibiotics) replacement, the evolution of resistance mechanisms emergence and future perspectives of N. gonorrhoeae treatment. PMID:26665738

  1. Mechanisms of Resistance in Bacteria: An Evolutionary Approach

    PubMed Central

    Martins, Ana; Hunyadi, Attila; Amaral, Leonard

    2013-01-01

    Acquisition of resistance is one of the major causes of failure in therapy of bacterial infections. According to the World Health Organization (WHO), thousands of deaths caused by Salmonella sp., Escherichia coli, Staphylococcus aureus or Mycobacteria tuberculosis are due to failure in therapy caused by resistance to the chemotherapeutic agents. Understanding the mechanisms of resistance acquisition by the bacterial strains is therefore essential to prevent and overcome resistance. However, it is very difficult to extrapolate from in vitro studies, where the variables are far less and under constant control, as compared to what happens in vivo where the chosen chemotherapeutic, its effective dose, and the patient’s immune system are variables that differ substantially case-by-case. The aim of this review is to provide a new perspective on the possible ways by which resistance is acquired by the bacterial strains within the patient, with a special emphasis on the adaptive response of the infecting bacteria to the administered antibiotic. PMID:23560029

  2. Salvianolic acids: small compounds with multiple mechanisms for cardiovascular protection

    PubMed Central

    2011-01-01

    Salvianolic acids are the most abundant water-soluble compounds extracted from Radix Salvia miltiorrhiza (Danshen). In China, Danshen has been wildly used to treat cardiovascular diseases for hundreds of years. Salvianolic acids, especially salvianolic acid A (Sal A) and salvianolic acid B (Sal B), have been found to have potent anti-oxidative capabilities due to their polyphenolic structure. Recently, intracellular signaling pathways regulated by salvianolic acids in vascular endothelial cells, aortic smooth muscle cells, as well as cardiomyocytes, have been investigated both in vitro and in vivo upon various cardiovascular insults. It is discovered that the cardiovascular protection of salvianolic acids is not only because salvianolic acids act as reactive oxygen species scavengers, but also due to the reduction of leukocyte-endothelial adherence, inhibition of inflammation and metalloproteinases expression from aortic smooth muscle cells, and indirect regulation of immune function. Competitive binding of salvianolic acids to target proteins to interrupt protein-protein interactions has also been found to be a mechanism of cardiovascular protection by salvianolic acids. In this article, we review a variety of studies focusing on the above mentioned mechanisms. Besides, the target proteins of salvianolic acids are also described. These results of recent advances have shed new light to the development of novel therapeutic strategies for salvianolic acids to treat cardiovascular diseases. PMID:21569331

  3. Identification and Characterization of Mutations Conferring Resistance to d-Amino Acids in Bacillus subtilis

    PubMed Central

    Leiman, Sara A.; Richardson, Charles; Foulston, Lucy; Elsholz, Alexander K. W.; First, Eric A.

    2015-01-01

    ABSTRACT Bacteria produce d-amino acids for incorporation into the peptidoglycan and certain nonribosomally produced peptides. However, d-amino acids are toxic if mischarged on tRNAs or misincorporated into protein. Common strains of the Gram-positive bacterium Bacillus subtilis are particularly sensitive to the growth-inhibitory effects of d-tyrosine due to the absence of d-aminoacyl-tRNA deacylase, an enzyme that prevents misincorporation of d-tyrosine and other d-amino acids into nascent proteins. We isolated spontaneous mutants of B. subtilis that survive in the presence of a mixture of d-leucine, d-methionine, d-tryptophan, and d-tyrosine. Whole-genome sequencing revealed that these strains harbored mutations affecting tRNATyr charging. Three of the most potent mutations enhanced the expression of the gene (tyrS) for tyrosyl-tRNA synthetase. In particular, resistance was conferred by mutations that destabilized the terminator hairpin of the tyrS riboswitch, as well as by a mutation that transformed a tRNAPhe into a tyrS riboswitch ligand. The most potent mutation, a substitution near the tyrosine recognition site of tyrosyl-tRNA synthetase, improved enzyme stereoselectivity. We conclude that these mutations promote the proper charging of tRNATyr, thus facilitating the exclusion of d-tyrosine from protein biosynthesis in cells that lack d-aminoacyl-tRNA deacylase. IMPORTANCE Proteins are composed of l-amino acids. Mischarging of tRNAs with d-amino acids or the misincorporation of d-amino acids into proteins causes toxicity. This work reports on mutations that confer resistance to d-amino acids and their mechanisms of action. PMID:25733611

  4. Mechanisms of methotrexate resistance in osteosarcoma cell lines and strategies for overcoming this resistance

    PubMed Central

    WANG, JIANJUN; LI, GUOJUN

    2015-01-01

    The aim of the present study was to investigate the underlying mechanisms of methotrexate (MTX) resistance in the human osteosarcoma cell line, Saos-2/MTX4.4, and to evaluate various methods of overcoming the resistance to this chemotherapeutic agent. MMT assays were performed to determine the resistance of the primary (Saos-2) and resistant (Saos-2/MTX4.4) cell lines to MTX, cisplatin [cis-diamminedichloroplatinum II (DDP)], ifosfamide (IFO), Adriamycin (ADM), epirubicin (EPI) and theprubicin (THP). The Saos-2/MTX4.4 cells exhibited a low resistance to IFO, ADM, EPI and THP; however, no resistance to DDP was identified. Overall, the Saos-2/MTX4.4 cells exhibited a greater resistance to all the chemotherapeutic agents investigated compared with the Saos-2 cells. Rhodamine 123 (R123) fluorescence was measured in the Saos-2/MTX4.4 and Saos-2 cells 30 and 60 min after the addition of R123, and R123 plus verapamil (VER). VER administration increased the intracellular accumulation of R123. In addition, reverse transcription-quantitative polymerase chain reaction was performed to determine the mRNA expression levels of multidrug resistance gene 1 (MDR1) in the two cell lines. Although the Saos-2/MTX4.4 cells were more resistant to the chemotherapeutic agents than the Saos-2 cells, no significant difference was identified between the relative mRNA expression levels of MDR1 in the Saos-2/MTX4.4 and Saos-2 cells (0.4350±0.0354 vs. 0.3886±0.0456; P>0.05). PMID:25621072

  5. Current perspectives on tigecycline resistance in Enterobacteriaceae: susceptibility testing issues and mechanisms of resistance.

    PubMed

    Pournaras, Spyros; Koumaki, Vasiliki; Spanakis, Nicholas; Gennimata, Vasiliki; Tsakris, Athanassios

    2016-07-01

    During the past decades, rates of multidrug-resistant (MDR) and carbapenem-resistant (CR) Enterobacteriaceae clinical isolates, mainly Klebsiella spp., Escherichia coli, Enterobacter spp., Proteus spp. and Serratia marcescens, have increased, considerably restricting effective antimicrobial treatments. Tigecycline, the first member of the glycylcyclines, has been approved by the US Food and Drug Administration (FDA) for the treatment of complicated skin and soft-tissue, complicated intra-abdominal and community-acquired bacterial respiratory infections and is increasingly administered against MDR Enterobacteriaceae. Although resistance has gradually appeared, tigecycline still remains relatively active among Enterobacteriaceae, with resistance rates largely <10% in most wide-scale surveillance studies. Tigecycline resistance has been reported in some studies to be elevated among extended-spectrum β-lactamase (ESBL)-producing, MDR, extensively drug-resistant and CR isolates. Broth microdilution (BMD) is the reference method for tigecycline susceptibility testing, but disagreements have been reported between the methods applied for routine tigecycline susceptibility testing. Therefore, confirmation of daily tigecycline susceptibility testing with BMD appears important in order to avoid misclassification of isolates. Various mechanisms have been reported to confer tigecycline resistance, with RND-type transporters, mainly the AcrAB efflux pump, playing an important role. Other pumps and various control pathways are also implicated in tigecycline resistance. Overall, tigecycline is a potent therapeutic option for enterobacterial infections. Accurate detection of tigecycline susceptibility status and surveillance of resistant organisms in the hospital environment is necessary in order to optimise its use and to preserve tigecycline in our therapeutic arsenal. PMID:27256586

  6. An insight into the drug resistance profile & mechanism of drug resistance in Neisseria gonorrhoeae.

    PubMed

    Patel, Achchhe Lal; Chaudhry, Uma; Sachdev, Divya; Sachdeva, Poonam Nagpal; Bala, Manju; Saluja, Daman

    2011-10-01

    Among the aetiological agents of treatable sexually transmitted diseases (STDs), Neissseria gonorrhoeae is considered to be most important because of emerging antibiotic resistant strains that compromise the effectiveness of treatment of the disease - gonorrhoea. In most of the developing countries, treatment of gonorrhoea relies mainly on syndromic management rather than the aetiological based therapy. Gonococcal infections are usually treated with single-dose therapy with an agent found to cure > 95 per cent of cases. Unfortunately during the last few decades, N. gonorrhoeae has developed resistance not only to less expensive antimicrobials such as sulphonamides, penicillin and tetracyclines but also to fluoroquinolones. The resistance trend of N. gonorrhoeae towards these antimicrobials can be categorised into pre-quinolone, quinolone and post-quinolone era. Among the antimicrobials available so far, only the third-generation cephalosporins could be safely recommended as first-line therapy for gonorrhoea globally. However, resistance to oral third-generation cephalosporins has also started emerging in some countries. Therefore, it has become imperative to initiate sustained national and international efforts to reduce infection and misuse of antibiotics so as to prevent further emergence and spread of antimicrobial resistance. It is necessary not only to monitor drug resistance and optimise treatment regimens, but also to gain insight into how gonococcus develops drug resistance. Knowledge of mechanism of resistance would help us to devise methods to prevent the occurrence of drug resistance against existing and new drugs. Such studies could also help in finding out new drug targets in N. gonorrhoeae and also a possibility of identification of new drugs for treating gonorrhoea. PMID:22089602

  7. Drug Resistance Characteristics and Macrolide-Resistant Mechanisms of Streptococcus pneumoniae in Wenzhou City, China.

    PubMed

    Hu, Dakang; Sun, Zheng; Luo, Xinhua; Liu, Shuangchun; Yu, Lianhua; Qu, Ying; Yang, Jinhong; Yu, Jian; Li, Xiangyang; Zhang, Jin

    2016-01-01

    BACKGROUND Streptococcus pneumoniae (SP) is a Gram-positive, alpha-hemolytic, facultative anaerobic member of the genus Streptococcus. The erythromycin-resistant methylase (erm) gene and macrolide efflux (mef) gene are the 2 main genes that can mediate SP. Transposon (Tn) also plays an important role in the collection and metastasis of the gene. In the present study we investigated the drug resistance characteristics and the macrolide-resistant mechanisms of SP in Wenzhou City, China. MATERIAL AND METHODS Sixty-eight strains of SP were isolated from sputum samples of hospitalized children in the Second Affiliated Hospital of Wenzhou Medical University. These strains were analyzed using antimicrobial susceptibility tests to determine their drug resistance to 10 kinds of antibacterials. Macrolide-resistant phenotypes were identified using K-B method. PCR method was used to analyze the erm B gene, mef A gene, and int Tn gene. RESULTS Drug resistance rates of 68 strains of SP were 98.5%, 100.0%, 63.2%, 52.9%, 94.1%, 89.7%, 0.0%, 0.0%, 16.2%, and 14.7% for clindamycin, erythromycin, penicillin G, cefotaxime, tetracycline, sulfamethoxazole/trimethoprim, levofloxacin, vancomycin, chloramphenicol, and amoxicillin, respectively. Total detection rates of the erm B gene, mef A gene, and int Tn gene were 98.5%, 91.2%, and 100.0%, respectively. CONCLUSIONS SP shows significant multi-drug resistance in Wenzhou City, whereas there is no clinical value of macrolides antibiotics for SP. cMLSB mediated by erm B gene is the most predominant phenotype among macrolide-resistant SP. The int Tn gene may play an important role in horizontal transfer and clonal dissemination of SP drug resistance genes in Wenzhou City. PMID:27483416

  8. An insight into the drug resistance profile & mechanism of drug resistance in Neisseria gonorrhoeae

    PubMed Central

    Patel, Achchhe Lal; Chaudhry, Uma; Sachdev, Divya; Sachdeva, Poonam Nagpal; Bala, Manju; Saluja, Daman

    2011-01-01

    Among the aetiological agents of treatable sexually transmitted diseases (STDs), Neissseria gonorrhoeae is considered to be most important because of emerging antibiotic resistant strains that compromise the effectiveness of treatment of the disease - gonorrhoea. In most of the developing countries, treatment of gonorrhoea relies mainly on syndromic management rather than the aetiological based therapy. Gonococcal infections are usually treated with single-dose therapy with an agent found to cure > 95 per cent of cases. Unfortunately during the last few decades, N. gonorrhoeae has developed resistance not only to less expensive antimicrobials such as sulphonamides, penicillin and tetracyclines but also to fluoroquinolones. The resistance trend of N. gonorrhoeae towards these antimicrobials can be categorised into pre-quinolone, quinolone and post-quinolone era. Among the antimicrobials available so far, only the third-generation cephalosporins could be safely recommended as first-line therapy for gonorrhoea globally. However, resistance to oral third-generation cephalosporins has also started emerging in some countries. Therefore, it has become imperative to initiate sustained national and international efforts to reduce infection and misuse of antibiotics so as to prevent further emergence and spread of antimicrobial resistance. It is necessary not only to monitor drug resistance and optimise treatment regimens, but also to gain insight into how gonococcus develops drug resistance. Knowledge of mechanism of resistance would help us to devise methods to prevent the occurrence of drug resistance against existing and new drugs. Such studies could also help in finding out new drug targets in N. gonorrhoeae and also a possibility of identification of new drugs for treating gonorrhoea. PMID:22089602

  9. Drug Resistance Characteristics and Macrolide-Resistant Mechanisms of Streptococcus pneumoniae in Wenzhou City, China

    PubMed Central

    Hu, Dakang; Sun, Zheng; Luo, Xinhua; Liu, Shuangchun; Yu, Lianhua; Qu, Ying; Yang, Jinhong; Yu, Jian; Li, Xiangyang; Zhang, Jin

    2016-01-01

    Background Streptococcus pneumoniae (SP) is a Gram-positive, alpha-hemolytic, facultative anaerobic member of the genus Streptococcus. The erythromycin-resistant methylase (erm) gene and macrolide efflux (mef) gene are the 2 main genes that can mediate SP. Transposon (Tn) also plays an important role in the collection and metastasis of the gene. In the present study we investigated the drug resistance characteristics and the macrolide-resistant mechanisms of SP in Wenzhou City, China. Material/Methods Sixty-eight strains of SP were isolated from sputum samples of hospitalized children in the Second Affiliated Hospital of Wenzhou Medical University. These strains were analyzed using antimicrobial susceptibility tests to determine their drug resistance to 10 kinds of antibacterials. Macrolide-resistant phenotypes were identified using K-B method. PCR method was used to analyze the erm B gene, mef A gene, and int Tn gene. Results Drug resistance rates of 68 strains of SP were 98.5%, 100.0%, 63.2%, 52.9%, 94.1%, 89.7%, 0.0%, 0.0%, 16.2%, and 14.7% for clindamycin, erythromycin, penicillin G, cefotaxime, tetracycline, sulfamethoxazole/trimethoprim, levofloxacin, vancomycin, chloramphenicol, and amoxicillin, respectively. Total detection rates of the erm B gene, mef A gene, and int Tn gene were 98.5%, 91.2%, and 100.0%, respectively. Conclusions SP shows significant multi-drug resistance in Wenzhou City, whereas there is no clinical value of macrolides antibiotics for SP. cMLSB mediated by erm B gene is the most predominant phenotype among macrolide-resistant SP. The int Tn gene may play an important role in horizontal transfer and clonal dissemination of SP drug resistance genes in Wenzhou City. PMID:27483416

  10. β-Lactam Resistance Mechanisms: Gram-Positive Bacteria and Mycobacterium tuberculosis.

    PubMed

    Fisher, Jed F; Mobashery, Shahriar

    2016-01-01

    The value of the β-lactam antibiotics for the control of bacterial infection has eroded with time. Three Gram-positive human pathogens that were once routinely susceptible to β-lactam chemotherapy-Streptococcus pneumoniae, Enterococcus faecium, and Staphylococcus aureus-now are not. Although a fourth bacterium, the acid-fast (but not Gram-positive-staining) Mycobacterium tuberculosis, has intrinsic resistance to earlier β-lactams, the emergence of strains of this bacterium resistant to virtually all other antibiotics has compelled the evaluation of newer β-lactam combinations as possible contributors to the multidrug chemotherapy required to control tubercular infection. The emerging molecular-level understanding of these resistance mechanisms used by these four bacteria provides the conceptual framework for bringing forward new β-lactams, and new β-lactam strategies, for the future control of their infections. PMID:27091943

  11. Azole fungicides - understanding resistance mechanisms in agricultural fungal pathogens.

    PubMed

    Price, Claire L; Parker, Josie E; Warrilow, Andrew G S; Kelly, Diane E; Kelly, Steven L

    2015-08-01

    Plant fungal pathogens can have devastating effects on a wide range of crops, including cereals and fruit (such as wheat and grapes), causing losses in crop yield, which are costly to the agricultural economy and threaten food security. Azole antifungals are the treatment of choice; however, resistance has arisen against these compounds, which could lead to devastating consequences. Therefore, it is important to understand how these fungicides are used and how the resistance arises in order to tackle the problem fully. Here, we give an overview of the problem and discuss the mechanisms that mediate azole resistance in agriculture (point mutations in the CYP51 amino acid sequence, overexpression of the CYP51 enzyme and overexpression of genes encoding efflux pump proteins). © 2015 Society of Chemical Industry. PMID:25914201

  12. Studies on the Mechanism of Action of Nalidixic Acid

    PubMed Central

    Bourguignon, Gerard J.; Levitt, Martin; Sternglanz, Rolf

    1973-01-01

    With three independent techniques (absorption spectrophotometry, measurement of the deoxyribonucleic acid [DNA] melting temperature, and equilibrium dialysis), no evidence has been found for the binding of nalidixic acid to purified DNA. Also, no evidence has been found to support the hypothesis that nalidixic acid is permanently modified to a new, active compound by the bacterial cell. By using an in vitro DNA replication system developed by Bonhoeffer and colleagues, soluble extracts from nalidixic acid-sensitive cells have been shown to confer nalidixic acid sensitivity on the DNA synthesis of lysates from nalidixic acid-resistant cells. The activity in the extracts is only present in sensitive cells and is nondialyzable and heat sensitive. Finally, two known nalidixic acid-resistant mutants of Escherichia coli, mapping at nal A and nal B, respectively, have been tested to determine whether either of them is a transport mutant. It has been shown that nal Br is a transport mutant whereas nal Ar is not. PMID:4208771

  13. Resistant mechanisms and molecular epidemiology of imipenem-resistant Acinetobacter baumannii.

    PubMed

    Xiao, Shu-Zhen; Chu, Hai-Qing; Han, Li-Zhong; Zhang, Zhe-Min; Li, Bing; Zhao, Lan; Xu, Liyun

    2016-09-01

    The aim of the study was to investigate the resistant mechanisms and homology of imipenem-resistant Acinetobacter baumannii (A. baumannii). A total of 46 non-duplicate imipenem‑resistant A. baumannii clinical isolates were collected from three tertiary hospitals between July, 2011 and June, 2012. The minimal inhibitory concentrations (MICs) of antimicrobial agents were determined using the agar dilution method. Phenylalanine‑arginine β-naphthylamide was used to detect the presence of the efflux pump-mediated resistant mechanism. Polymerase chain reaction was employed to amplify genes associated with drug resistance, including β‑lactamase genes, efflux pump genes and outer membrane protein gene CarO. A few amplicons were randomly selected and sequenced. Multilocus sequence analysis (MLST) was employed in typing A. baumanni. A. baumannii was resistant to imipenem, simultaneously showing resistance to several other antimicrobials. In addtition, 13 A. baumannii were found to mediate drug resistance through operation of the efflux pump. Of the various drug resistance genes tested, blaOXA‑51 was present in 46 isolates, blaOXA‑23 gene was present in 44 isolates and blaNDM gene was found in only one strain. Other drug resistant‑associated genes, including blaKPC, blaIMP, blaOXA-24, blaOXA‑58, blaSHV, blaGIM and blaVIM were not detected. Mutation of adeS and outer membrane protein gene CarO were found in a few of the imipenem‑resistant isolates. The MLST analysis revealed that all 46 clinical isolates were clustered into 11 genotypes and the most frequent genotype was ST208. In conclusion, β‑lactamase genes, genes involved in efflux pump and mutation of outer membrane protein encoding gene may be important in mediating imipenem resistance in A. baumannii. Of the 11 different genotypes, ST11 was shared by the majority of A. baumannii, which may be due to horizontal transfer of patients from hospitals. PMID:27485638

  14. Corrosion-resistant catalyst supports for phosphoric acid fuel cells

    SciTech Connect

    Kosek, J.A.; Cropley, C.C.; LaConti, A.B.

    1990-01-01

    High-surface-area carbon blacks such as Vulcan XC-72 (Cabot Corp.) and graphitized carbon blacks such as 2700{degree}C heat-treated Black Pearls 2000 (HTBP) (Cabot Corp.) have found widespread applications as catalyst supports in phosphoric acid fuel cells (PAFCs). However, due to the operating temperatures and pressures being utilized in PAFCs currently under development, the carbon-based cathode catalyst supports suffer from corrosion, which decreases the performance and life span of a PAFC stack. The feasibility of using alternative, low-cost, corrosion-resistant catalyst support (CRCS) materials as replacements for the cathode carbon support materials was investigated. The objectives of the program were to prepare high-surface-area alternative supports and to evaluate the physical characteristics and the electrochemical stability of these materials. The O{sub 2} reduction activity of the platinized CRCS materials was also evaluated. 2 refs., 3 figs.

  15. Arabidopsis YAK1 regulates abscisic acid response and drought resistance.

    PubMed

    Kim, Dongjin; Ntui, Valentine Otang; Xiong, Liming

    2016-07-01

    Abscisic acid (ABA) is an important phytohormone that controls several plant processes such as seed germination, seedling growth, and abiotic stress response. Here, we report that AtYak1 plays an important role in ABA signaling and postgermination growth in Arabidopsis. AtYak1 knockout mutant plants were hyposensitive to ABA inhibition of seed germination, cotyledon greening, seedling growth, and stomatal movement. atyak1-1 mutant plants display reduced drought stress resistance, as evidenced by water loss rate and survival rate. Molecular genetic analysis revealed that AtYak1 deficiency led to elevated expression of stomatal-related gene, MYB60, and down-regulation of several stress-responsive genes. Altogether, these results indicate that AtYak1 plays a role as a positive regulator in ABA-mediated drought response in Arabidopsis. PMID:27264339

  16. Mechanism of the reaction of isocyanic acid with ethanol

    SciTech Connect

    Sheludyakov, Y.L.; Shubareva, F.Z.; Golodov, V.A.; Korolev, A.V.

    1995-03-01

    The kinetics of the interaction of isocyanic acid with ethanol is investigated. The reaction products include ethyl carbamate and ethyl allophanate, the yields of which depend on both the concentration ratio of HNCO:ROH and the presence of a catalyst. The influence of water, acid, and base additives is also examined. A reaction mechanism is proposed.

  17. Implementation of In Vitro Drug Resistance Assays: Maximizing the Potential for Uncovering Clinically Relevant Resistance Mechanisms.

    PubMed

    Korpal, Manav; Feala, Jacob; Puyang, Xiaoling; Zou, Jian; Ramos, Alex H; Wu, Jeremy; Baumeister, Timm; Yu, Lihua; Warmuth, Markus; Zhu, Ping

    2015-01-01

    Although targeted therapies are initially effective, resistance inevitably emerges. Several methods, such as genetic analysis of resistant clinical specimens, have been applied to uncover these resistance mechanisms to facilitate follow-up care. Although these approaches have led to clinically relevant discoveries, difficulties in attaining the relevant patient material or in deconvoluting the genomic data collected from these specimens have severely hampered the path towards a cure. To this end, we here describe a tool for expeditious discovery that may guide improvement in first-line therapies and alternative clinical management strategies. By coupling preclinical in vitro or in vivo drug selection with next-generation sequencing, it is possible to identify genomic structural variations and/or gene expression alterations that may serve as functional drivers of resistance. This approach facilitates the spontaneous emergence of alterations, enhancing the probability that these mechanisms may be observed in the patients. In this protocol we provide guidelines to maximize the potential for uncovering single nucleotide variants that drive resistance using adherent lines. PMID:26710000

  18. Implementation of In Vitro Drug Resistance Assays: Maximizing the Potential for Uncovering Clinically Relevant Resistance Mechanisms

    PubMed Central

    Korpal, Manav; Feala, Jacob; Puyang, Xiaoling; Zou, Jian; Ramos, Alex H.; Wu, Jeremy; Baumeister, Timm; Yu, Lihua; Warmuth, Markus; Zhu, Ping

    2015-01-01

    Although targeted therapies are initially effective, resistance inevitably emerges. Several methods, such as genetic analysis of resistant clinical specimens, have been applied to uncover these resistance mechanisms to facilitate follow-up care. Although these approaches have led to clinically relevant discoveries, difficulties in attaining the relevant patient material or in deconvoluting the genomic data collected from these specimens have severely hampered the path towards a cure. To this end, we here describe a tool for expeditious discovery that may guide improvement in first-line therapies and alternative clinical management strategies. By coupling preclinical in vitro or in vivo drug selection with next-generation sequencing, it is possible to identify genomic structural variations and/or gene expression alterations that may serve as functional drivers of resistance. This approach facilitates the spontaneous emergence of alterations, enhancing the probability that these mechanisms may be observed in the patients. In this protocol we provide guidelines to maximize the potential for uncovering single nucleotide variants that drive resistance using adherent lines. PMID:26710000

  19. Engineering Porous Organic Cage Crystals with Increased Acid Gas Resistance.

    PubMed

    Zhu, Guanghui; Hoffman, Christopher D; Liu, Yang; Bhattacharyya, Souryadeep; Tumuluri, Uma; Jue, Melinda L; Wu, Zili; Sholl, David S; Nair, Sankar; Jones, Christopher W; Lively, Ryan P

    2016-07-25

    Both known and new CC3-based porous organic cages are prepared and exposed to acidic SO2 in vapor and liquid conditions. Distinct differences in the stability of the CC3 cages exist depending on the chirality of the diamine linkers used. The acid catalyzed CC3 degradation mechanism is probed via in situ IR and a degradation pathway is proposed and supported with computational results. CC3 crystals synthesized with racemic mixtures of diaminocyclohexane exhibited enhanced stability compared to CC3-R and CC3-S. Confocal fluorescent microscope images reveal that the stability difference in CC3 species originates from an abundance of mesoporous grain boundaries in CC3-R and CC3-S, allowing facile access of aqueous SO2 throughout the crystal, promoting decomposition. These grain boundaries are absent from CC3 crystals made with racemic linkers. PMID:27253350

  20. Arabidopsis abscisic acid receptors play an important role in disease resistance.

    PubMed

    Lim, Chae Woo; Lee, Sung Chul

    2015-06-01

    Stomata are natural pores of plants and constitute the entry points for water during transpiration. However, they also facilitate the ingress of potentially harmful bacterial pathogens. The phytohormone abscisic acid (ABA) plays a pivotal role in protecting plants against biotic stress, by regulating stomatal closure. In the present study, we investigated the mechanism whereby ABA influences plant defense responses to Pseudomonas syringae pv. tomato (Pst) DC3000, which is a virulent bacterial pathogen of Arabidopsis, at the pre-invasive stage. We found that overexpression of two ABA receptors, namely, RCAR4/PYL10-OX and RCAR5/PYL11-OX (hereafter referred to as RCARs), resulted in ABA-hypersensitive phenotypes being exhibited during the seed germination and seedling growth stages. Sensitivity to ABA enhanced the resistance of RCAR4-OX and RCAR5-OX plants to Pst DC3000, through promoting stomatal closure leading to the development of resistance to this bacterial pathogen. Protein phosphatase HAB1 is an important component that is responsible for ABA signaling and which interacts with ABA receptors. We found that hab1 mutants exhibited enhanced resistance to Pst DC3000; moreover, similar to RCAR4-OX and RCAR5-OX plants, this enhanced resistance was correlated with stomatal closure. Taken together, our findings demonstrate that alteration of RCAR4- or RCAR5-HAB1 mediated ABA signaling influences resistance to bacterial pathogens via stomatal regulation. PMID:25969135

  1. An Amino Acid Substitution (L925V) Associated with Resistance to Pyrethroids in Varroa destructor

    PubMed Central

    González-Cabrera, Joel; Davies, T. G. Emyr; Field, Linda M.; Kennedy, Peter J.; Williamson, Martin S.

    2013-01-01

    The Varroa mite, Varroa destructor, is an important pest of honeybees and has played a prominent role in the decline in bee colony numbers over recent years. Although pyrethroids such as tau-fluvalinate and flumethrin can be highly effective in removing the mites from hives, their intensive use has led to many reports of resistance. To investigate the mechanism of resistance in UK Varroa samples, the transmembrane domain regions of the V. destructor voltage-gated sodium channel (the main target site for pyrethroids) were PCR amplified and sequenced from pyrethroid treated/untreated mites collected at several locations in Central/Southern England. A novel amino acid substitution, L925V, was identified that maps to a known hot spot for resistance within the domain IIS5 helix of the channel protein; a region that has also been proposed to form part of the pyrethroid binding site. Using a high throughput diagnostic assay capable of detecting the mutation in individual mites, the L925V substitution was found to correlate well with resistance, being present in all mites that had survived tau-fluvalinate treatment but in only 8 % of control, untreated samples. The potential for using this assay to detect and manage resistance in Varroa-infected hives is discussed. PMID:24367572

  2. The prebiotic synthesis of amino acids - interstellar vs. atmospheric mechanisms

    NASA Astrophysics Data System (ADS)

    Meierhenrich, U. J.; Muñoz Caro, G. M.; Schutte, W. A.; Barbier, B.; Arcones Segovia, A.; Rosenbauer, H.; Thiemann, W. H.-P.; Brack, A.

    2002-11-01

    Until very recently, prebiotic amino acids were believed to have been generated in the atmosphere of the early Earth, as successfully simulated by the Urey-Miller experiments. Two independent studies now identified ice photochemistry in the interstellar medium as a possible source of prebiotic amino acids. Ultraviolet irradiation of ice mixtures containing identified interstellar molecules (such as H2O, CO2, CO, CH3OH, and NH3) in the conditions of vacuum and low temperature found in the interstellar medium generated amino acid structures including glycine, alanine, serine, valine, proline, and aspartic acid. After warmup, hydrolysis and derivatization, our team was able to identify 16 amino acids as well as furans and pyrroles. Enantioselective analyses of the amino acids showed racemic mixtures. A prebiotic interstellar origin of amino acid structures is now discussed to be a plausible alternative to the Urey-Miller mechanism.

  3. Mechanical properties and corrosion resistance of Ti-6Al-7Nb alloy dental castings.

    PubMed

    Kobayashi, E; Wang, T J; Doi, H; Yoneyama, T; Hamanaka, H

    1998-10-01

    With the aim of applying a novel titanium alloy, Ti-6Al-7Nb, to a dental casting material, a comprehensive research work was carried out on its characteristics, such as castability, mechanical properties and corrosion resistance in the present study. As a result, Ti-6Al-7Nb alloy exhibited sufficient castability by a dental casting method for titanium alloys and enough mechanical properties for dental application. It is also showed excellent corrosion resistance through an immersion test in 1.0% lactic acid and an anodic polarization test in 0.9% NaCl solution. From these results, it is concluded that this Ti-6Al-7Nb alloy is applicable as a dental material in place of Ti-6Al-4V alloy, which includes cytotoxic vanadium. PMID:15348689

  4. Eubacterium rangiferina, a novel usnic acid-resistant bacterium from the reindeer rumen

    NASA Astrophysics Data System (ADS)

    Sundset, Monica A.; Kohn, Alexandra; Mathiesen, Svein D.; Præsteng, Kirsti E.

    2008-08-01

    Reindeer are able to eat and utilize lichens as an important source of energy and nutrients. In the current study, the activities of antibiotic secondary metabolites including usnic, antranoric, fumarprotocetraric, and lobaric acid commonly found in lichens were tested against a collection of 26 anaerobic rumen bacterial isolates from reindeer ( Rangifer tarandus tarandus) using the agar diffusion method. The isolates were identified based on their 16S ribosomal ribonucleic acid (rRNA) gene sequences. Usnic acid had a potent antimicrobial effect against 25 of the isolates, belonging to Clostridiales, Enterococci, and Streptococci. Isolates of Clostridia and Streptococci were also susceptible to atranoric and lobaric acid. However, one isolate (R3_91_1) was found to be resistant to usnic, antranoric, fumarprotocetraric, and lobaric acid. R3_91_1 was also seen invading and adhering to lichen particles when grown in a liquid anaerobic culture as demonstrated by transmission electron microscopy. This was a Gram-negative, nonmotile rod (0.2-0.7 × 2.0-3.5 μm) with a deoxyribonucleic acid G + C content of 47.0 mol% and main cellular fatty acids including 15:0 anteiso-dimethyl acetal (DMA), 16:0 iso-fatty acid methyl ester (FAME), 13:0 iso-3OH FAME, and 17:0 anteiso-FAME, not matching any of the presently known profiles in the MIDI database. Combined, the phenotypic and genotypic traits including the 16S rRNA gene sequence show that R3_91_1 is a novel species inside the order Clostridiales within the family Lachnospiraceae, for which we propose the name Eubacterium rangiferina. This is the first record of a rumen bacterium able to tolerate and grow in the presence of usnic acid, indicating that the rumen microorganisms in these animals have adapted mechanisms to deal with lichen secondary metabolites, well known for their antimicrobial and toxic effects.

  5. Insecticide Resistance Status of United States Populations of Aedes albopictus and Mechanisms Involved

    PubMed Central

    Marcombe, Sébastien; Farajollahi, Ary; Healy, Sean P.; Clark, Gary G.; Fonseca, Dina M.

    2014-01-01

    Aedes albopictus (Skuse) is an invasive mosquito that has become an important vector of chikungunya and dengue viruses. Immature Ae. albopictus thrive in backyard household containers that require treatment with larvicides and when adult populations reach pest levels or disease transmission is ongoing, adulticiding is often required. To assess the feasibility of control of USA populations, we tested the susceptibility of Ae. albopictus to chemicals representing the main insecticide classes with different modes of action: organochlorines, organophosphates, carbamates, pyrethroids, insect growth regulators (IGR), naturalytes, and biolarvicides. We characterized a susceptible reference strain of Ae. albopictus, ATM95, and tested the susceptibility of eight USA populations to five adulticides and six larvicides. We found that USA populations are broadly susceptible to currently available larvicides and adulticides. Unexpectedly, however, we found significant resistance to dichlorodiphenyltrichloroethane (DDT) in two Florida populations and in a New Jersey population. We also found resistance to malathion, an organophosphate, in Florida and New Jersey and reduced susceptibility to the IGRs pyriproxyfen and methoprene. All populations tested were fully susceptible to pyrethroids. Biochemical assays revealed a significant up-regulation of GSTs in DDT-resistant populations in both larval and adult stages. Also, β-esterases were up-regulated in the populations with suspected resistance to malathion. Of note, we identified a previously unknown amino acid polymorphism (Phe → Leu) in domain III of the VGSC, in a location known to be associated with pyrethroid resistance in another container-inhabiting mosquito, Aedes aegypti L. The observed DDT resistance in populations from Florida may indicate multiple introductions of this species into the USA, possibly from tropical populations. In addition, the mechanisms underlying DDT resistance often result in pyrethroid resistance

  6. Molecular and cellular mechanisms of cadmium resistance in cultured cells

    SciTech Connect

    Grady, D.L.; Moyzis, R.K.; Hildebrand, C.E.

    1985-01-01

    Heavy metal induction of the synthesis of metallothioneins (MTs) provides an ideal model system for basic mechanistic studies of gene expression. Cell lines varying in their resistance to heavy metals have been isolated through a regime of exposure to serially increasing levels of Cd followed by clonal isolation. These cell lines have been used to examine the role of methylation and amplification in the Cd-resistant (Cd/sup r/) phenotype. It is suggested that regulation of expression of the MT genes in Cd/sup r/ Chinese hamster cells is modulated at both the transcriptional and translational levels. An analysis of the MT2 gene sequence has uncovered a potential alternative splice site in the first intron. Usage of this site would insert 3 or 12 additional amino acids between amino acids 9 and 10. Analysis of the splicing pattern of the MT2 gene transcript in cultured cells has indicated that the second intron is preferentially removed prior to first intron excision. 34 refs., 2 figs., 1 tab.

  7. Modifications in membrane fatty acid composition of Salmonella typhimurium in response to growth conditions and their effect on heat resistance.

    PubMed

    Alvarez-Ordóñez, Avelino; Fernández, Ana; López, Mercedes; Arenas, Ricardo; Bernardo, Ana

    2008-04-30

    , changes observed in membrane fatty acid composition are not enough to explain the great thermotolerance of cells grown at 45 degrees C. Thus, other mechanisms, such as the synthesis of Heat Shock Proteins, could be responsible for this increase in the bacterial heat resistance. PMID:18313782

  8. Mechanisms of Nuclear Export in Cancer and Resistance to Chemotherapy

    PubMed Central

    El-Tanani, Mohamed; Dakir, El-Habib; Raynor, Bethany; Morgan, Richard

    2016-01-01

    Tumour suppressor proteins, such as p53, BRCA1, and ABC, play key roles in preventing the development of a malignant phenotype, but those that function as transcriptional regulators need to enter the nucleus in order to function. The export of proteins between the nucleus and cytoplasm is complex. It occurs through nuclear pores and exported proteins need a nuclear export signal (NES) to bind to nuclear exportin proteins, including CRM1 (Chromosomal Region Maintenance protein 1), and the energy for this process is provided by the RanGTP/RanGDP gradient. Due to the loss of DNA repair and cell cycle checkpoints, drug resistance is a major problem in cancer treatment, and often an initially successful treatment will fail due to the development of resistance. An important mechanism underlying resistance is nuclear export, and a number of strategies that can prevent nuclear export may reverse resistance. Examples include inhibitors of CRM1, antibodies to the nuclear export signal, and alteration of nuclear pore structure. Each of these are considered in this review. PMID:26985906

  9. Mechanisms of Hepatitis C Viral Resistance to Direct Acting Antivirals

    PubMed Central

    Ahmed, Asma; Felmlee, Daniel J.

    2015-01-01

    There has been a remarkable transformation in the treatment of chronic hepatitis C in recent years with the development of direct acting antiviral agents targeting virus encoded proteins important for viral replication including NS3/4A, NS5A and NS5B. These agents have shown high sustained viral response (SVR) rates of more than 90% in phase 2 and phase 3 clinical trials; however, this is slightly lower in real-life cohorts. Hepatitis C virus resistant variants are seen in most patients who do not achieve SVR due to selection and outgrowth of resistant hepatitis C virus variants within a given host. These resistance associated mutations depend on the class of direct-acting antiviral drugs used and also vary between hepatitis C virus genotypes and subtypes. The understanding of these mutations has a clear clinical implication in terms of choice and combination of drugs used. In this review, we describe mechanism of action of currently available drugs and summarize clinically relevant resistance data. PMID:26694454

  10. Infection control implications of heterogeneous resistance mechanisms in carbapenem-resistant Enterobacteriaceae (CRE).

    PubMed

    Goodman, K E; Simner, P J; Tamma, P D; Milstone, A M

    2016-01-01

    The Centers for Disease Control and Prevention (CDC) defines carbapenem-resistant Enterobacteriaceae (CRE) based upon a phenotypic demonstration of carbapenem resistance. However, considerable heterogeneity exists within this definitional umbrella. CRE may mechanistically differ by whether they do or do not produce carbapenemases. Moreover, patients can acquire CRE through multiple pathways: endogenously through antibiotic selective pressure on intestinal microbiota, exogenously through horizontal transmission or through a combination of these factors. Some evidence suggests that non-carbapenemase-producing CRE may be more frequently acquired by antibiotic exposure and carbapenemase-producing CRE via horizontal transmission, but definitive data are lacking. This review examines types of CRE resistance mechanisms, antibiotic exposure and horizontal transmission pathways of CRE acquisition, and the implications of these heterogeneities to the development of evidence-based CRE healthcare epidemiology policies. In our Expert Commentary & Five-Year View, we outline specific nosocomial CRE knowledge gaps and potential methodological approaches for their resolution. PMID:26535959

  11. Antibiotic resistance and resistance mechanisms in Campylobacter jejuni and Campylobacter coli.

    PubMed

    Alfredson, David A; Korolik, Victoria

    2007-12-01

    Campylobacter jejuni and Campylobacter coli are recognized as the most common causative agents of bacterial gastroenteritis in the world and infections with these organisms occur more frequently than do infections due to Salmonella species, Shigella species, or Escherichia coli 0157:H7. The incidence of human Campylobacter infections has increased markedly in both developed and developing countries worldwide and, more significantly, so has the rapid emergence of antibiotic-resistant Campylobacter strains, with evidence suggesting that the use of antibiotics, in particular the fluoroquinolones, as growth promoters in food animals and the veterinary industry is accelerating this trend. In this minireview, the patterns of emerging resistance to the antimicrobial agents useful in treatment of the disease are presented and the mechanisms of resistance to these drugs in Campylobacter spp are discussed. PMID:18031331

  12. EGFR-TKI resistance in NSCLC patients: mechanisms and strategies

    PubMed Central

    Lin, Yuxin; Wang, Xian; Jin, Hongchuan

    2014-01-01

    The epidermal growth factor receptor (EGFR) is a kind of receptor tyrosine kinase (RTK) that plays a critical role in the initiation and development of malignant tumors via modulating downstream signaling pathways. In non-small cell lung cancer (NSCLC), the activating mutations located in the tyrosine kinase domains of EGFR have been demonstrated in multiple researches as the “Achilles’ heel” of this deadly disease since they could be well-targeted by epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs). However, it’s still too early to celebrate since the first-generation EGFR-TKIs such as gefitinib and erlotinib have only achieved limited clinical benefits and acquired resistance to this kind of drugs occurred inevitably in almost all the NSCLC patients. In order to make the most of EGFR-TKIs and develop more effective regimens for the NSCLC patients, researchers majoring in different aspects start a battle against EGFR-TKI resistance. Challenging as it is, we still progress stably and step firmly toward the final victory. This review will summarize the major mechanisms of acquired resistance to EGFR-TKIs, and then discuss the development of rationally designed molecular target drugs in accordance with each mechanism, in the hope of shedding light on the great achievements we have obtained and tough obstacles we have to overcome in the battle against this deadly disease. PMID:25232485

  13. Neurobiological Mechanisms Supporting Experience-Dependent Resistance to Social Stress

    PubMed Central

    Cooper, Matthew A.; Clinard, Catherine T.; Morrison, Kathleen E.

    2015-01-01

    Humans and other animals show a remarkable capacity for resilience following traumatic, stressful events. Resilience is thought to be an active process related to coping with stress, although the cellular and molecular mechanisms that support active coping and stress resistance remain poorly understood. In this review, we focus on the neurobiological mechanisms by which environmental and social experiences promote stress resistance. In male Syrian hamsters, exposure to a brief social defeat stressor leads to increased avoidance of novel opponents, which we call conditioned defeat. Also, hamsters that have achieved dominant social status show reduced conditioned defeat as well as cellular and molecular changes in the neural circuits controlling the conditioned defeat response. We propose that experience-dependent neural plasticity occurs in the prelimbic (PL) cortex, infralimbic (IL) cortex, and ventral medial amygdala (vMeA) during the maintenance of dominance relationships, and that adaptions in these neural circuits support stress resistance in dominant individuals. Overall, behavioral treatments that promote success in competitive interactions may represent valuable interventions for instilling resilience. PMID:25677096

  14. Mechanisms underlying the antidepressant response and treatment resistance

    PubMed Central

    Levinstein, Marjorie R.; Samuels, Benjamin A.

    2014-01-01

    Depression is a complex and heterogeneous disorder affecting millions of Americans. There are several different medications and other treatments that are available and effective for many patients with depression. However, a substantial percentage of patients fail to achieve remission with these currently available interventions, and relapse rates are high. Therefore, it is necessary to determine both the mechanisms underlying the antidepressant response and the differences between responders and non-responders to treatment. Delineation of these mechanisms largely relies on experiments that utilize animal models. Therefore, this review provides an overview of the various mouse models that are currently used to assess the antidepressant response, such as chronic mild stress, social defeat, and chronic corticosterone. We discuss how these mouse models can be used to advance our understanding of the differences between responders and non-responders to antidepressant treatment. We also provide an overview of experimental treatment modalities that are used for treatment-resistant depression, such as deep brain stimulation and ketamine administration. We will then review the various genetic polymorphisms and transgenic mice that display resistance to antidepressant treatment. Finally, we synthesize the published data to describe a potential neural circuit underlying the antidepressant response and treatment resistance. PMID:25018708

  15. Antimicrobial Combinations against Pan-Resistant Acinetobacter baumannii Isolates with Different Resistance Mechanisms

    PubMed Central

    Leite, Gleice Cristina; Oliveira, Maura Salaroli; Perdigão-Neto, Lauro Vieira; Rocha, Cristiana Kamia Dias; Guimarães, Thais; Rizek, Camila; Levin, Anna Sara; Costa, Silvia Figueiredo

    2016-01-01

    The study investigated the effect of antibiotic combinations against 20 clinical isolates of A. baumannii (seven colistin-resistant and 13 colistin-susceptible) with different resistance mechanisms. Clinical data, treatment, and patient mortality were evaluated. The following methods were used: MIC, PCRs, and outer membrane protein (OMP) analysis. Synergy was investigated using the checkerboard and time-kill methods. Clonality was evaluated by PFGE. Based on clonality, the whole genome sequence of six A. baumannii isolates was analyzed. All isolates were resistant to meropenem, rifampicin, and fosfomycin. OXA-23 and OXA-143 were the most frequent carbapenemases found. Four isolates showed loss of a 43kDa OMP. The colistin-susceptible isolates belonged to different clones and showed the highest synergistic effect with fosfomycin-amikacin. Among colistin-resistant isolates, the highest synergistic effect was observed with the combinations of colistin-rifampicin followed by colistin-vancomycin. All colistin-resistant isolates harbored blaOXA-23-like and belonged to CC113. Clinical and demographic data were available for 18 of 20 patients. Fourteen received treatment and eight patients died during treatment. The most frequent site of infection was the blood in 13 of 14 patients. Seven patients received vancomycin plus an active drug against A. baumannii; however, mortality did not differ in this group. The synergistic effect was similar for colistin-susceptible isolates of distinct clonal origin presenting with the same resistance mechanism. Overall mortality and death during treatment was high, and despite the high synergism in vitro with vancomycin, death did not differ comparing the use or not of vancomycin plus an active drug against A. baumannii. PMID:26998609

  16. Mechanism of single-layer 193-nm dissolution inhibition resist

    NASA Astrophysics Data System (ADS)

    Yan, Zhenglin; Houlihan, Francis M.; Reichmanis, Elsa; Nalamasu, Omkaram; Reiser, Arnost; Dabbagh, Gary; Hutton, Richard S.; Osei, Dan; Sousa, Jose; Bolan, Kevin J.

    2000-06-01

    We have found that the progress of developer base into films of terpolymers of norbornene (NB)-maleic anhydride (MA) and acrylic acid (AA) is a percolation process with a critical site concentration of x(c) equals 0.084 which suggests that every acrylic acid site in the terpolymer of norbornene-maleic anhydride-acrylic acid can make 12 monomer units of the polymer water compatible. In practice these systems are being used with various tert-butyl esters of cholic acid as dissolution inhibitors. The cholates differ very much in their dissolution inhibition factors (lowest t-butyl cholate (1.3) to highest t-butyl lithocholate glutarate dimer (7.4). The change in these factors corrected for molarity follow the hydrophobic character of the dissolution as measured by log(p). A quick screening method has also been established to evaluate dissolution inhibitors based on our observation that the cloud point (the volume % acetone in a water/acetone which gives persistent cloudiness) parallels the dissolution inhibiting power as measured by the dissolution inhibition factor. For dissolution promotion, optimal results are obtained with t-butyl 1,3,5-cyclohexanetricarboxylate (f equals -6.3) and poorest results with t-butyl lithocholate (f equals -2.8); this appears to track with the number of carboxyl groups and the hydrophobicity of the carboxylic acids. The Rmax found for resist formulations tracks well with these findings. Another factor in determining the ultimate achievable contrast is the degree of acidolytic deprotection achieved by the material. It appears that acidolyticaly cleaveable carboxylate esters with a higher concentration of electron withdrawing groups such as t-butyl 1,3,5-cyclohexanetricarboxylate are more effective.

  17. Structural Insights into the Fluoroquinolone Resistance Mechanism of Shigella flexneri DNA Gyrase and Topoisomerase IV.

    PubMed

    Tamanna; Ramana, Jayashree

    2016-07-01

    Traveler's diarrhea (TD) is an important public health concern that can result from a variety of intestinal pathogens, including bacteria, parasites, and virus. A number of antibiotics are being used to cure TD, but due to widespread use of these antibiotics, the pathogens are becoming resistant to them. In this work, we performed docking studies of DNA gyraseA (GyrA) and topoisomerase IV (ParC) of Shigella flexneri and their mutants with two different fluoroquinolones, ciprofloxacin and norfloxacin, to understand their resistance mechanism at the structural level. S. flexneri strains with mutations at serine 83 to leucine and aspartic acid 87 to glutamate or asparagine of GyrA and that of serine 80 to isoleucine in ParC have decreased susceptibility to fluoroquinolones. This analysis revealed that interaction of ciprofloxacin/norfloxacin with all the mutants was weaker than the interaction of ciprofloxacin/norfloxacin with the wild type. This study highlights the importance of aspartic acid and serine in GyrA and that of serine in ParC, forming bonds with ciprofloxacin/norfloxacin, which may play a crucial role in antibiotic resistance. This work corelates very well with the experimental outcomes and gives a good explanation for fluoroquinolone resistance in S. flexneri. PMID:26859259

  18. Mutagenesis Mapping of the Protein-Protein Interaction Underlying FusB-Type Fusidic Acid Resistance

    PubMed Central

    Cox, Georgina; Edwards, Thomas A.

    2013-01-01

    FusB-type proteins represent the predominant mechanism of resistance to fusidic acid in staphylococci and act by binding to and modulating the function of the drug target (elongation factor G [EF-G]). To gain further insight into this antibiotic resistance mechanism, we sought to identify residues important for the interaction of FusB with EF-G and thereby delineate the binding interface within the FusB–EF-G complex. Replacement with alanine of any one of four conserved residues within the C-terminal domain of FusB (F156, K184, Y187, and F208) abrogated the ability of the protein to confer resistance to fusidic acid; the purified mutant proteins also lost the ability to bind S. aureus EF-G in vitro. E. coli EF-G, which is not ordinarily able to bind FusB-type proteins, was rendered competent for binding to FusB following deletion of a 3-residue tract (529SNP531) from domain IV of the protein. This study has identified key regions of both FusB and EF-G that are important for the interaction between the proteins, findings which corroborate our previous in silico prediction for the architecture of the complex formed between the resistance protein and the drug target (G. Cox, G. S. Thompson, H. T. Jenkins, F. Peske, A. Savelsbergh, M. V. Rodnina, W. Wintermeyer, S. W. Homans, T. A. Edwards, and A. J. O'Neill, Proc. Natl. Acad. Sci. U. S. A. 109:2102-2107, 2012). PMID:23836182

  19. Mutagenesis mapping of the protein-protein interaction underlying FusB-type fusidic acid resistance.

    PubMed

    Cox, Georgina; Edwards, Thomas A; O'Neill, Alex J

    2013-10-01

    FusB-type proteins represent the predominant mechanism of resistance to fusidic acid in staphylococci and act by binding to and modulating the function of the drug target (elongation factor G [EF-G]). To gain further insight into this antibiotic resistance mechanism, we sought to identify residues important for the interaction of FusB with EF-G and thereby delineate the binding interface within the FusB-EF-G complex. Replacement with alanine of any one of four conserved residues within the C-terminal domain of FusB (F156, K184, Y187, and F208) abrogated the ability of the protein to confer resistance to fusidic acid; the purified mutant proteins also lost the ability to bind S. aureus EF-G in vitro. E. coli EF-G, which is not ordinarily able to bind FusB-type proteins, was rendered competent for binding to FusB following deletion of a 3-residue tract (529SNP531) from domain IV of the protein. This study has identified key regions of both FusB and EF-G that are important for the interaction between the proteins, findings which corroborate our previous in silico prediction for the architecture of the complex formed between the resistance protein and the drug target (G. Cox, G. S. Thompson, H. T. Jenkins, F. Peske, A. Savelsbergh, M. V. Rodnina, W. Wintermeyer, S. W. Homans, T. A. Edwards, and A. J. O'Neill, Proc. Natl. Acad. Sci. U. S. A. 109:2102-2107, 2012). PMID:23836182

  20. Resistance mechanism of Acinetobacter spp. strains resistant to DW-116, a new quinolone.

    PubMed

    Choi, K H; Baek, M C; Kim, B K; Choi, E C

    1998-06-01

    DW-116 is a new fluoroquinolone antimicrobial agent with a broad spectrum. In order to elucidate the resistance mechanism to DW-116 in Acinetobacter spp. bacteria, total chromosomal DNA was isolated from 10 strains of Acinetobacter spp. resistant to DW-116. Quinolone resistance determinant region (QRDR) of DNA gyrase gene was amplified by PCR. The 345 bp nucleotide fragment yielded was inserted into pKF 3 which was used as the vector. Comparisons of the DNA sequences of 8 strains with that of the wild type strain revealed a Ser-83 to Leu mutation in mutants and all ten strains contained one silent mutation(T-->G) in QRDR. From Acinetobacter MB4-8 strain, DNA gyrase was isolated and purified, through no-vobiocin-sepharose, heparin-sepharose affinity column chromatography. The enzyme was composed of two subunits and the molecular mass of subunits A and B were 75.6 and 51.9 kDa, respectively. The supercoiling activity of the reconstituted DNA gyrase composed of subunit A from Acinetobacter MB4-8 and subunit B from E. coli was not inhibited by 128 micrograms/ml of ciprofloxacin. It might be said that one of the resistance mechanisms to DW-116 in A-cinetobacter MB4-8 was subunit A alteration of DNA gyrase. PMID:9875449

  1. Alkali-Resistant Mechanism of a Hollandite DeNOx Catalyst.

    PubMed

    Hu, Pingping; Huang, Zhiwei; Gu, Xiao; Xu, Fei; Gao, Jiayi; Wang, Yue; Chen, Yaxin; Tang, Xingfu

    2015-06-01

    A thorough understanding of the deactivation mechanism by alkalis is of great importance for rationally designing improved alkali-resistant deNOx catalysts, but a traditional ion-exchange mechanism cannot often accurately describe the nature of the deactivation, thus hampering the development of superior catalysts. Here, we establish a new exchange-coordination mechanism on the basis of the exhaustive study on the strong alkali resistance of a hollandite manganese oxide (HMO) catalyst. A combination of isothermal adsorption measurements of ammonia with X-ray absorption near-edge structure spectra and X-ray photoelectron spectra reveals that alkali metal ions first react with protons from Brønsted acid sites of HMO via the ion exchange. Synchrotron X-ray diffraction patterns and extended X-ray absorption fine structure spectra coupled with theoretical calculations demonstrate that the exchanged alkali metal ions are subsequently stabilized at size-suitable cavities in the HMO pores via a coordination model with an energy savings. This exchange-coordination mechanism not only gives a wholly convincing explanation for the intrinsic nature of the deactivation of the reported catalysts by alkalis but also provides a strategy for rationally designing improved alkali-resistant deNOx catalysts in general. PMID:25941972

  2. Cell biological mechanisms of multidrug resistance in tumors.

    PubMed Central

    Simon, S M; Schindler, M

    1994-01-01

    Multidrug resistance (MDR) is a generic term for the variety of strategies tumor cells use to evade the cytotoxic effects of anticancer drugs. MDR is characterized by a decreased sensitivity of tumor cells not only to the drug employed for chemotherapy but also to a broad spectrum of drugs with neither obvious structural homology nor common targets. This pleiotropic resistance is one of the major obstacles to the successful treatment of tumors. MDR may result from structural or functional changes at the plasma membrane or within the cytoplasm, cellular compartments, or nucleus. Molecular mechanisms of MDR are discussed in terms of modifications in detoxification and DNA repair pathways, changes in cellular sites of drug sequestration, decreases in drug-target affinity, synthesis of specific drug inhibitors within cells, altered or inappropriate targeting of proteins, and accelerated removal or secretion of drugs. PMID:7909602

  3. Mycoplasma bovis: Mechanisms of Resistance and Trends in Antimicrobial Susceptibility.

    PubMed

    Lysnyansky, Inna; Ayling, Roger D

    2016-01-01

    Mycoplasma bovis is a cell-wall-less bacterium and belongs to the class Mollicutes. It is the most important etiological agent of bovine mycoplasmoses in North America and Europe, causing respiratory disease, mastitis, otitis media, arthritis, and reproductive disease. Clinical disease associated with M. bovis is often chronic, debilitating, and poorly responsive to antimicrobial therapy, resulting in significant economic loss, the full extent of which is difficult to estimate. Until M. bovis vaccines are universally available, sanitary control measures and antimicrobial treatment are the only approaches that can be used in attempts to control M. bovis infections. However, in vitro studies show that many of the current M. bovis isolates circulating in Europe have high minimum inhibitory concentrations (MIC) for many of the commercially available antimicrobials. In this review we summarize the current MIC trends indicating the development of antimicrobial resistance in M. bovis as well as the known molecular mechanisms by which resistance is acquired. PMID:27199926

  4. Cell Biological Mechanisms of Multidrug Resistance in Tumors

    NASA Astrophysics Data System (ADS)

    Simon, Sanford M.; Schindler, Melvin

    1994-04-01

    Multidrug resistance (MDR) is a generic term for the variety of strategies tumor cells use to evade the cytotoxic effects of anticancer drugs. MDR is characterized by a decreased sensitivity of tumor cells not only to the drug employed for chemotherapy but also to a broad spectrum of drugs with neither obvious structural homology nor common targets. This pleotropic resistance is one of the major obstacles to the successful treatment of tumors. MDR may result from structural or functional changes at the plasma membrane or within the cytoplasm, cellular compartments, or nucleus. Molecular mechanisms of MDR are discussed in terms of modifications in detoxification and DNA repair pathways, changes in cellular sites of drug sequestration, decreases in drug-target affinity, synthesis of specific drug inhibitors within cells, altered or inappropriate targeting of proteins, and accelerated removal or secretion of drugs.

  5. Mycoplasma bovis: Mechanisms of Resistance and Trends in Antimicrobial Susceptibility

    PubMed Central

    Lysnyansky, Inna; Ayling, Roger D.

    2016-01-01

    Mycoplasma bovis is a cell-wall-less bacterium and belongs to the class Mollicutes. It is the most important etiological agent of bovine mycoplasmoses in North America and Europe, causing respiratory disease, mastitis, otitis media, arthritis, and reproductive disease. Clinical disease associated with M. bovis is often chronic, debilitating, and poorly responsive to antimicrobial therapy, resulting in significant economic loss, the full extent of which is difficult to estimate. Until M. bovis vaccines are universally available, sanitary control measures and antimicrobial treatment are the only approaches that can be used in attempts to control M. bovis infections. However, in vitro studies show that many of the current M. bovis isolates circulating in Europe have high minimum inhibitory concentrations (MIC) for many of the commercially available antimicrobials. In this review we summarize the current MIC trends indicating the development of antimicrobial resistance in M. bovis as well as the known molecular mechanisms by which resistance is acquired. PMID:27199926

  6. Mechanism of cytotoxic action of perfluorinated acids

    SciTech Connect

    Kleszczynski, Konrad Skladanowski, Andrzej C.

    2009-02-01

    Perfluorinated (aliphatic) acids (PFAs) and congeners have many applications in various industrial fields and household for decades. Years later they have been detected in wildlife and this has spurred interest in environmental occurrence as well as influencing living organisms. PFAs were established as peroxisome proliferators and hepatocarcinogens. Amphipatic structure suggests that they may alter cell membrane potential (mb{delta}{psi}) and/or induce changes in cytosolic pH (pHi). The aim of this study was to examine the correlation between changes of above parameters and PFAs structure (CF{sub 6}-CF{sub 12}) in human colon carcinoma HCT116 cells. mb{delta}{psi} and pHi were measured by flow cytometry using fluorescence polarization of the plasma membrane probe 3,3'-dipentyloxacarbocyanine (DiOC{sub 5}(3)) and fluorescein diacetate (FDA), respectively. Dose- and time-dependent manner analysis revealed relatively fast depolarization of plasma membrane and acidification of cytosol both positively correlated with fluorocarbon chain length. mb{delta}{psi} depletion after 4 h of incubation reached 8.01% and 30.08% for 50 {mu}M PFOA and 50 {mu}M PFDoDA, respectively. Prolonged treatment (72 h) led to dramatic dissipation of membrane potential up to 21.65% and 51.29% and strong acidification to pHi level at 6.92 and 6.03 at the presence of above compounds, respectively. The data demonstrate that PFAs can alter plasma membrane protonotrophy with the mode dependent on the compound hydrophobicity.

  7. Role of volatile fatty acids in colonization resistance to Clostridium difficile in gnotobiotic mice.

    PubMed Central

    Su, W J; Waechter, M J; Bourlioux, P; Dolegeal, M; Fourniat, J; Mahuzier, G

    1987-01-01

    Clostridium difficile is an agent involved in the development of antibiotic-associated pseudomembranous colitis. The purpose of this work was to investigate the role of volatile fatty acids (VFAs) in resistance to colonization by C. difficile by using a gnotobiotic animal model. Accordingly, germfree mice were associated with different hamster flora, and the VFAs in their cecal contents were measured by gas chromatography. The results showed that VFAs were produced mainly by the intestinal flora, especially by the strictly anaerobic bacteria. In these associated mice, the concentrations of acetic, propionic, and butyric acids were higher than those of other acids, but at pH 6.8 the MICs of these three acids in vitro for C. difficile were more than 200 mu eq/ml. In gnotobiotic mice monoassociated with C. difficile and in the isolated ceca of these mice, VFAs did not inhibit the growth of C. difficile. In gnotobiotic mice which were diassociated with C. difficile and C. butyricum and given drinking water with a lactose concentration of 20%, the cecal contents included about the same amount of butyric acid as did those of the monoassociated mice, although the population of C. difficile remained the same. Therefore, it is suggested that VFAs alone cannot inhibit intestinal colonization by C. difficile and that, consequently, other inhibitory mechanisms are also present. PMID:3596806

  8. Alternate mechanism for amino acid entry into Neurospora crassa: extracellular deamination and subsequent keto acid transport.

    PubMed Central

    DeBusk, R M; Brown, D T; DeBusk, A G; Penderghast, R D

    1981-01-01

    The growth of the pm nbg mutant strain of Neurospora crassa was inhibited by the amino acid analog para-fluorophenylalanine despite the fact that none of the three constitutive amino acid permeases is functional in this strain. This observation led to the detection of both a deaminase which was released into the growth medium in response to para-fluorophenylalanine and a keto acid transport system which allowed entry of the resulting keto acid into the cell. The transported keto acid was recovered in cellular protein, suggesting its regeneration as the amino acid. The cooperative activity of these two systems represents an additional mechanism for the intracellular accumulation of amino acids, which is distinct from the known amino acid permeases. Images PMID:6452443

  9. Nanoparticle mechanics: deformation detection via nanopore resistive pulse sensing

    NASA Astrophysics Data System (ADS)

    Darvish, Armin; Goyal, Gaurav; Aneja, Rachna; Sundaram, Ramalingam V. K.; Lee, Kidan; Ahn, Chi Won; Kim, Ki-Bum; Vlahovska, Petia M.; Kim, Min Jun

    2016-07-01

    Solid-state nanopores have been widely used in the past for single-particle analysis of nanoparticles, liposomes, exosomes and viruses. The shape of soft particles, particularly liposomes with a bilayer membrane, can greatly differ inside the nanopore compared to bulk solution as the electric field inside the nanopores can cause liposome electrodeformation. Such deformations can compromise size measurement and characterization of particles, but are often neglected in nanopore resistive pulse sensing. In this paper, we investigated the deformation of various liposomes inside nanopores. We observed a significant difference in resistive pulse characteristics between soft liposomes and rigid polystyrene nanoparticles especially at higher applied voltages. We used theoretical simulations to demonstrate that the difference can be explained by shape deformation of liposomes as they translocate through the nanopores. Comparing our results with the findings from electrodeformation experiments, we demonstrated that the rigidity of liposomes can be qualitatively compared using resistive pulse characteristics. This application of nanopores can provide new opportunities to study the mechanics at the nanoscale, to investigate properties of great value in fundamental biophysics and cellular mechanobiology, such as virus deformability and fusogenicity, and in applied sciences for designing novel drug/gene delivery systems.Solid-state nanopores have been widely used in the past for single-particle analysis of nanoparticles, liposomes, exosomes and viruses. The shape of soft particles, particularly liposomes with a bilayer membrane, can greatly differ inside the nanopore compared to bulk solution as the electric field inside the nanopores can cause liposome electrodeformation. Such deformations can compromise size measurement and characterization of particles, but are often neglected in nanopore resistive pulse sensing. In this paper, we investigated the deformation of various

  10. [Evolution as resistance to entropy. I. Mechanisms of species homeostasis].

    PubMed

    Shcherbakov, V P

    2005-01-01

    The idea is discussed that the common output of any evolution is creation of the entities that are increasingly resistant to further evolution. The moving force of evolution is entropy, the tendency to disorder. This general aspiration for chaos is a cause of the mortality of organisms and species, however, being prerequisite for any movement, it creates (by chance) novelties, which may occur (by chance) more resistant to further decay and thus survive. The surviving of those who survive is the most general principle of evolution discovered by Darwin for particular case of biological evolution. The second law of thermodynamics states that our Universe is perishing but its ontology is such that it creates resistance to destruction. The evolution is a history of this resistance. Not only those who die do not survive but also those who evolve. The entities that change (evolve) rapidly disappear rapidly and by this reason they are not observed among both the fossils and now-living organisms. We know only about long-living species. All the existing organisms are endowed with an ability to resist other changing. The following main achievements of the species homeostasis are discussed: high fidelity of DNA replication and effective mechanisms of DNA repair; diploidy; normalizing selection; truncated selection; heterozygote superiority; ability to change phenotype adaptively without changing genotype; parental care and the K-strategy of reproduction; behavior that provides independence of the environment. The global resistance of the living systems to entropy is provided the state that all the essential in biology is determined not by physical-chemical interactions but could semantic rules. A conception of "potential zygotic information" that determines the rules of ontogenesis is proposed. A zygote does not contain this information in explicit form. It is created de novo step by step during ontogenesis and it could not be decoded beforehand. The experimental data on the

  11. Development, stability, and molecular mechanisms of macrolide resistance in Campylobacter jejuni.

    PubMed

    Caldwell, Dave Bryson; Wang, Ying; Lin, Jun

    2008-11-01

    Previous studies of macrolide resistance in Campylobacter were primarily focused on strains from various origins or used in vitro systems. In this study, we conducted both in vitro and in vivo experiments to examine the development, stability, and genetic basis of macrolide resistance in Campylobacter jejuni using erythromycin-resistant (Ery(r)) mutants derived from the same parent strain. Chickens inoculated with low-level Ery(r) mutants (MIC = 32 or 64 microg/ml) at 15 days old did not shed highly Ery(r) mutants (MIC > 512 microg/ml) after prolonged exposure to a low dose of tylosin. The low-level Ery resistance was not stable in vitro or in vivo in the absence of macrolide selection pressure. However, high-level Ery resistance displayed remarkable stability in vitro and in vivo. Ribosomal sequence analysis of 69 selected Ery(r) mutants showed that specific point mutations (A2074G or A2074C) occurred in all highly Ery(r) mutants. No mutations in ribosomal protein L4 were observed in any of the in vitro-selected Ery(r) mutants. However, three specific mutations in L4, G74D, G57D, and G57V, were widely found among in vivo-selected Ery(r) mutants. Insertion of three amino acids, TSH, at position 98 in ribosomal protein L22 was observed only in mutants selected in vitro. Inactivation of the CmeABC efflux pump dramatically reduced Ery MICs in Ery(r) mutants. Together, these findings suggest that multiple factors contribute to the emergence of highly Ery(r) Campylobacter in chicken, reveal resistance level-dependent stability of macrolide resistance in C. jejuni, and indicate that C. jejuni utilizes complex and different mechanisms to develop Ery resistance in vitro and in vivo. PMID:18779354

  12. Molecular level understanding of resistance to nalidixic acid in Salmonella enteric serovar typhimurium associates with the S83F sequence type.

    PubMed

    Preethi, B; Ramanathan, K

    2016-01-01

    Nalidixic acid is an antibiotic drug used for treatment of Salmonellosis, a gastrointestinal infection. DNA gyrase subunit A (GyrA) of Salmonella typhimurium is the drug target for nalidixic acid. Resistance of GyrA to nalidixic acid, because of a point mutation in S. typhimurium, was recently reported. Substitution of Phe in place of Ser at locus 83 in GyrA of S. typhimurium has been experimentally associated with nalidixic acid resistance. Despite recent efforts, the mechanism of this resistance is not well understood. In this investigation we used computational techniques to address this shortcoming. Our results showed that contact with residue Arg 91 is certainly important for efficient binding of nalidixic acid to the target protein, and that mutation of this residue results in 180° rotation of the antibiotic in its binding pocket, around its own long axis. It is hoped these findings may enable development of new antibiotics against resistant forms of Salmonella. PMID:26329667

  13. Survival mechanism of Escherichia coli O157:H7 against combined treatment with acetic acid and sodium chloride.

    PubMed

    Lee, Sun-Young; Kang, Dong-Hyun

    2016-05-01

    The combination of salt and acid is commonly used in the production of many foods, including pickles and fermented foods. However, in our previous studies, the addition of salt significantly reduced the inhibitory effect of acetic acid on Escherichia coli O157:H7 in laboratory media and pickled cucumbers. Therefore, this study was conducted to determine the mechanism by which salt confers resistance against acetic acid in E. coli O157:H7. The addition of high concentrations (up to 9% or 15% [w/v]) of salt increased the resistance of E. coli O157:H7 to acetic acid treatment. Combined treatment with acetic acid and salt showed varying results among different bacterial strains (an antagonistic effect for E. coli O157:H7 and Shigella and a synergistic effect for Listeria monocytogenes and Staphylococcus aureus). The addition of salt increased the cytoplasmic pH of E. coli O157:H7, but decreased the cytoplasmic pH of L. monocytogenes and S. aureus on treatment with acetic acid. Therefore, the addition of salt increases the acid resistance of E. coli O157:H7 possibly by increasing its acid resistance response and consequently preventing the acidification of its cytoplasm by organic acids. PMID:26742620

  14. Mycobacterium tuberculosis Folate Metabolism and the Mechanistic Basis for para-Aminosalicylic Acid Susceptibility and Resistance

    PubMed Central

    Minato, Yusuke; Thiede, Joshua M.; Kordus, Shannon Lynn; McKlveen, Edward J.; Turman, Breanna J.

    2015-01-01

    para-Aminosalicylic acid (PAS) entered clinical use in 1946 as the second exclusive drug for the treatment of tuberculosis (TB). While PAS was initially a first-line TB drug, the introduction of more potent antitubercular agents relegated PAS to the second-line tier of agents used for the treatment of drug-resistant Mycobacterium tuberculosis infections. Despite the long history of PAS usage, an understanding of the molecular and biochemical mechanisms governing the susceptibility and resistance of M. tuberculosis to this drug has lagged behind that of most other TB drugs. Herein, we discuss previous studies that demonstrate PAS-mediated disruption of iron acquisition, as well as recent genetic, biochemical, and metabolomic studies that have revealed that PAS is a prodrug that ultimately corrupts one-carbon metabolism through inhibition of the formation of reduced folate species. We also discuss findings from laboratory and clinical isolates that link alterations in folate metabolism to PAS resistance. These advancements in our understanding of the basis of the susceptibility and resistance of M. tuberculosis to PAS will enable the development of novel strategies to revitalize this and other antimicrobial agents for use in the global effort to eradicate TB. PMID:26033719

  15. Increased amoxicillin-clavulanic acid resistance in Escherichia coli blood isolates, Spain.

    PubMed

    Oteo, Jesús; Campos, José; Lázaro, Edurne; Cuevas, Oscar; García-Cobos, Silvia; Pérez-Vázquez, María; de Abajo, F J

    2008-08-01

    To determine the evolution and trends of amoxicillin-clavulanic acid resistance among Escherichia coli isolates in Spain, we tested 9,090 blood isolates from 42 Spanish hospitals and compared resistance with trends in outpatient consumption. These isolates were collected by Spanish hospitals that participated in the European Antimicrobial Resistance Surveillance System network from April 2003 through December 2006. PMID:18680650

  16. Molecular Mechanisms for Sweet-suppressing Effect of Gymnemic Acids*

    PubMed Central

    Sanematsu, Keisuke; Kusakabe, Yuko; Shigemura, Noriatsu; Hirokawa, Takatsugu; Nakamura, Seiji; Imoto, Toshiaki; Ninomiya, Yuzo

    2014-01-01

    Gymnemic acids are triterpene glycosides that selectively suppress taste responses to various sweet substances in humans but not in mice. This sweet-suppressing effect of gymnemic acids is diminished by rinsing the tongue with γ-cyclodextrin (γ-CD). However, little is known about the molecular mechanisms underlying the sweet-suppressing effect of gymnemic acids and the interaction between gymnemic acids versus sweet taste receptor and/or γ-CD. To investigate whether gymnemic acids directly interact with human (h) sweet receptor hT1R2 + hT1R3, we used the sweet receptor T1R2 + T1R3 assay in transiently transfected HEK293 cells. Similar to previous studies in humans and mice, gymnemic acids (100 μg/ml) inhibited the [Ca2+]i responses to sweet compounds in HEK293 cells heterologously expressing hT1R2 + hT1R3 but not in those expressing the mouse (m) sweet receptor mT1R2 + mT1R3. The effect of gymnemic acids rapidly disappeared after rinsing the HEK293 cells with γ-CD. Using mixed species pairings of human and mouse sweet receptor subunits and chimeras, we determined that the transmembrane domain of hT1R3 was mainly required for the sweet-suppressing effect of gymnemic acids. Directed mutagenesis in the transmembrane domain of hT1R3 revealed that the interaction site for gymnemic acids shared the amino acid residues that determined the sensitivity to another sweet antagonist, lactisole. Glucuronic acid, which is the common structure of gymnemic acids, also reduced sensitivity to sweet compounds. In our models, gymnemic acids were predicted to dock to a binding pocket within the transmembrane domain of hT1R3. PMID:25056955

  17. Renal clearance of uric acid is linked to insulin resistance and lower excretion of sodium in gout patients.

    PubMed

    Perez-Ruiz, Fernando; Aniel-Quiroga, Maria Angeles; Herrero-Beites, Ana María; Chinchilla, Sandra Pamela; Erauskin, Gorka Garcia; Merriman, Toni

    2015-09-01

    Inefficient renal excretion of uric acid is the main pathophysiological mechanism for hyperuricemia in gout patients. Polymorphisms of renal tubular transporters linked with sodium and monosaccharide transport have yet to be demonstrated. We intended to evaluate the impact of insulin resistance, evaluated with the homeostasis model assessment (HOMA), through a transversal study of non-diabetic patients with gout, with normal renal function, not treated with any medication but colchicine as prophylaxis. One hundred and thirty-three patients were evaluated. Clearance of uric acid was inversely correlated with insulin resistance and directly correlated with fractional excretion of sodium. In multivariate analysis, hypertension and hyperlipidemia, in addition to insulin resistance and fractional excretion of sodium, were associated with renal clearance of uric acid. HOMA cutoff for efficient versus inefficient renal handling of uric acid was 2.72, close to that observed in studies of reference population. The impact of insulin resistance and renal handling of sodium on renal clearance of uric acid may help to explain why hyperuricemia is more commonly associated with diabetes and hypertension. PMID:25763991

  18. Strengthening mechanisms and mechanical properties of high interstitial stainless steel for drill collar and its corrosion resistance

    NASA Astrophysics Data System (ADS)

    Lee, Eunkyung

    Two types (CN66, CN71) of high interstitial stainless steels (HISSs) were investigated for down-hole application in sour gas well environments. Experiments were designed to identify factors that have a significant effect on mechanical properties. The three factors examined in the study were carbon + nitrogen content (0.66 or 0.71 mass %), cooling rate in quenching (air or water), and heat treatment time (2 or 4 hours). The results showed that the cooling rate, C+N content, and the two-factor interaction of these variables have a significant effect on the mechanical properties of HISSs. Based on the statistical analysis results on mechanical properties, extensive analyses were undertaken to understand the strengthening mechanisms of HISSs. Microstructure analysis revealed that a pearlite phase with a high carbide and/or nitride content is dissolved in the matrix by heat treatment at 1,200 ºC which is considered the dissolution to increase the concentration of interstitial elements in steels. The distribution of elements in HISSs was investigated by quantitative mapping using EPMA, which showed that the high carbon concentration (carbide/cementite) area was decreased by increases in both the cooling rate and C+N content. The ferrite volume fraction of each specimen is increased by an increase in cooling rate, because there is insufficient time to form austenite from retained ferrite. The lattice expansion of HISS was investigated by the calculation of lattice parameters under various conditions, and these investigations confirm the solid solution strengthening effect on HISSs. CN66 with heat treatment at fast cooling has the highest wear resistance; a finding that was consistent with hardening mechanisms that occur due to an increased ferrite volume fraction. In addition, precipitates on the surface and the chemical bonding of chromium were investigated. As the amount of CrN bonding increased, the wear resistance also increased. This study also assessed the

  19. The tokamak density limit: A thermo-resistive disruption mechanism

    SciTech Connect

    Gates, D. A.; Brennan, D. P.; Delgado-Aparicio, L.; White, R. B.

    2015-06-15

    The behavior of magnetic islands with 3D electron temperature and the corresponding 3D resistivity effects on growth are examined for islands with near-zero net heating in the island interior. We refer to the resulting class of non-linearities as thermo-resistive effects. In particular, the effects of varying impurity mix on the previously proposed local island onset threshold [Gates and Delgado-Aparicio, Phys. Rev. Lett. 108, 165004 (2012)] are examined and shown to be consistent with the well established experimental scalings for tokamaks at the density limit. A surprisingly simple semi-analytic theory is developed which imposes the effects of heating/cooling in the island interior as well as the effects of island geometry. For the class of current profiles considered, it is found that a new term that accounts for the thermal effects of island asymmetry is required in the modified Rutherford equation. The resultant model is shown to exhibit a robust onset of a rapidly growing tearing mode—consistent with the disruption mechanism observed at the density limit in tokamaks. A fully non-linear 3D cylindrical calculation is performed that simulates the effect of net island heating/cooling by raising/suppressing the temperature in the core of the island. In both the analytic theory and the numerical simulation, the sudden threshold for rapid growth is found to be due to an interaction between three distinct thermal non-linearities which affect the island resistivity, thereby modifying the growth dynamics.

  20. Resistance mechanisms and drug susceptibility testing of nontuberculous mycobacteria.

    PubMed

    van Ingen, Jakko; Boeree, Martin J; van Soolingen, Dick; Mouton, Johan W

    2012-06-01

    Nontuberculous mycobacteria (NTM) are increasingly recognized as causative agents of opportunistic infections in humans. For most NTM infections the therapy of choice is drug treatment, but treatment regimens differ by species, in particular between slow (e.g. Mycobacterium avium complex, Mycobacterium kansasii) and rapid growers (e.g. Mycobacterium abscessus, Mycobacterium fortuitum). In general, drug treatment is long, costly, and often associated with drug-related toxicities; outcome of drug treatment is poor and is likely related to the high levels of natural antibiotic resistance in NTM. The role of drug susceptibility testing (DST) in the choice of agents for antimicrobial treatment of NTM disease, mainly that by slow growers, remains subject of debate. There are important discrepancies between drug susceptibility measured in vitro and the activity of the drug observed in vivo. In part, these discrepancies derive from laboratory technical issues. There is still no consensus on a standardized method. With the increasing clinical importance of NTM disease, DST of NTM is again in the spotlight. This review provides a comprehensive overview of the mechanisms of drug resistance in NTM, phenotypic methods for testing susceptibility in past and current use for DST of NTM, as well as molecular approaches to assess drug resistance. PMID:22525524

  1. The tokamak density limit: A thermo-resistive disruption mechanism

    NASA Astrophysics Data System (ADS)

    Gates, D. A.; Brennan, D. P.; Delgado-Aparicio, L.; White, R. B.

    2015-06-01

    The behavior of magnetic islands with 3D electron temperature and the corresponding 3D resistivity effects on growth are examined for islands with near-zero net heating in the island interior. We refer to the resulting class of non-linearities as thermo-resistive effects. In particular, the effects of varying impurity mix on the previously proposed local island onset threshold [Gates and Delgado-Aparicio, Phys. Rev. Lett. 108, 165004 (2012)] are examined and shown to be consistent with the well established experimental scalings for tokamaks at the density limit. A surprisingly simple semi-analytic theory is developed which imposes the effects of heating/cooling in the island interior as well as the effects of island geometry. For the class of current profiles considered, it is found that a new term that accounts for the thermal effects of island asymmetry is required in the modified Rutherford equation. The resultant model is shown to exhibit a robust onset of a rapidly growing tearing mode—consistent with the disruption mechanism observed at the density limit in tokamaks. A fully non-linear 3D cylindrical calculation is performed that simulates the effect of net island heating/cooling by raising/suppressing the temperature in the core of the island. In both the analytic theory and the numerical simulation, the sudden threshold for rapid growth is found to be due to an interaction between three distinct thermal non-linearities which affect the island resistivity, thereby modifying the growth dynamics.

  2. Nanoparticle mechanics: deformation detection via nanopore resistive pulse sensing.

    PubMed

    Darvish, Armin; Goyal, Gaurav; Aneja, Rachna; Sundaram, Ramalingam V K; Lee, Kidan; Ahn, Chi Won; Kim, Ki-Bum; Vlahovska, Petia M; Kim, Min Jun

    2016-08-14

    Solid-state nanopores have been widely used in the past for single-particle analysis of nanoparticles, liposomes, exosomes and viruses. The shape of soft particles, particularly liposomes with a bilayer membrane, can greatly differ inside the nanopore compared to bulk solution as the electric field inside the nanopores can cause liposome electrodeformation. Such deformations can compromise size measurement and characterization of particles, but are often neglected in nanopore resistive pulse sensing. In this paper, we investigated the deformation of various liposomes inside nanopores. We observed a significant difference in resistive pulse characteristics between soft liposomes and rigid polystyrene nanoparticles especially at higher applied voltages. We used theoretical simulations to demonstrate that the difference can be explained by shape deformation of liposomes as they translocate through the nanopores. Comparing our results with the findings from electrodeformation experiments, we demonstrated that the rigidity of liposomes can be qualitatively compared using resistive pulse characteristics. This application of nanopores can provide new opportunities to study the mechanics at the nanoscale, to investigate properties of great value in fundamental biophysics and cellular mechanobiology, such as virus deformability and fusogenicity, and in applied sciences for designing novel drug/gene delivery systems. PMID:27321911

  3. Intestinal regeneration as an insect resistance mechanism to entomopathogenic bacteria.

    PubMed

    Castagnola, Anaïs; Jurat-Fuentes, Juan Luis

    2016-06-01

    The intestinal epithelium of insects is exposed to xenobiotics and entomopathogens during the feeding developmental stages. In these conditions, an effective enterocyte turnover mechanism is highly desirable to maintain integrity of the gut epithelial wall. As in other insects, the gut of lepidopteran larvae have stem cells that are capable of proliferation, which occurs during molting and pathogenic episodes. While much is known on the regulation of gut stem cell division during molting, there is a current knowledge gap on the molecular regulation of gut healing processes after entomopathogen exposure. Relevant information on this subject is emerging from studies of the response to exposure to insecticidal proteins from the bacterium Bacillus thuringiensis (Bt) as model intoxicants. In this work we discuss currently available data on the molecular cues involved in gut stem cell proliferation, insect gut healing, and the implications of enhanced healing as a potential mechanism of resistance against Bt toxins. PMID:27436739

  4. Effects of inhaled acids on respiratory tract defense mechanisms.

    PubMed Central

    Schlesinger, R B

    1985-01-01

    The respiratory tract is endowed with an interlocking array of nonspecific and specific defense mechanisms which protect it from the effects of inhaled microbes and toxicants, and reduce the risk of absorption of materials into the bloodstream, with subsequent systemic translocation. Ambient acids may compromise these defenses, perhaps providing a link between exposure and development of chronic and acute pulmonary disease. This paper reviews the effects of inhaled acids upon the nonspecific clearance system of the lungs. PMID:3908089

  5. Interaction of sulfuric acid corrosion and mechanical wear of iron

    NASA Technical Reports Server (NTRS)

    Rengstorff, G. W. P.; Miyoshi, K.; Buckley, D. H.

    1984-01-01

    Friction and wear experiments were conducted with elemental iron sliding on aluminum oxide in aerated sulfuric acid at concentrations ranging from very dilute (0.00007 N; i.e., 4 ppm) to very concentrated (96 percent acid). Load and reciprocating sliding speed were kept constant. With the most dilute acid concentration of 0.00007 to 0.0002 N, a complex corrosion product formed that was friable and often increased friction and wear. At slightly higher concentrations of 0.001 N, metal losses were essentially by wear alone. Because no buildup of corrosion products occurred, this acid concentration became the standard from which to separate metal loss from direct corrosion and mechanical wear losses. When the acid concentration was increased to 5 percent (1 N), the well-established high corrosion rate of iron in sulfuric acid strongly dominated the total wear loss. This strong corrosion increased to 30 percent acid and decreased somewhat to 50 percent acid in accordance with expectations. However, the low corrosion of iron expected at acid concentrations of 65 to 96 percent was not observed in the wear area. It was apparent that the normal passivating film was being worn away and a galvanic cell established that rapidly attacked the wear area. Under the conditions where direct corrosion losses were highest, the coefficient of friction was the lowest.

  6. Interaction of sulfuric acid corrosion and mechanical wear of iron

    NASA Technical Reports Server (NTRS)

    Rengstorff, G. W. P.; Miyoshi, K.; Buckley, D. H.

    1986-01-01

    Friction and wear experiment were conducted with elemental iron sliding on aluminum oxide in aerated sulfuric acid at concentrations ranging from very dilute (0.00007 N; i.e., 4 ppm) to very concentrated (96 percent acid). Load and reciprocating sliding speed were kept constant. With the most dilute acid concentration of 0.00007 to 0.0002 N, a complex corrosion product formed that was friable and often increased friction and wear. At slightly higher concentrations of 0.001 N, metal losses were essentially by wear alone. Because no buildup of corrosion products occurred, this acid concentration became the standard from which to separate metal loss from direct corrosion and mechanical wear losses. When the acid concentration was increased to 5 percent (1 N), the well-established high corrosion rate of iron in sulfuric acid strongly dominated the total wear loss. This strong corrosion increased to 30 percent acid and decreased somewhat to 50 percent acid in accordance with expectations. However, the low corrosion of iron expected at acid concentrations of 65 to 96 percent was not observed in the wear area. It was apparent that the normal passivating film was being worn away and a galvanic cell established that rapidly attacked the wear area. Under the conditions where direct corrosion losses were highest, the coefficient of friction was the lowest.

  7. Docosahexaenoic Acid (DHA) But Not Eicosapentaenoic Acid (EPA) Reverses Trans-10, Cis-12 Conjugated Linoleic Acid Induced Insulin Resistance in Mice1

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Objective: t10, c12-Conjugated linoleic acid (CLA) induces insulin resistance and fatty liver in mice which can be reversed by fish oils. We determined if it is eicospentaenoic acid (20:5n-3, EPA) or docoshexaenoic acid (22:6n-3, DHA) that reverses these adverse effects of CLA. Research Design and M...

  8. Effect of Resistance Mechanisms on the Inoculum Effect of Carbapenem in Klebsiella pneumoniae Isolates with Borderline Carbapenem Resistance

    PubMed Central

    Ben-Dalak, Ma'ayan; Chmelnitsky, Ina; Carmeli, Yehuda

    2015-01-01

    We aimed to examine the effects of resistance mechanisms on several resistance phenotypes among carbapenem-resistant Klebsiella pneumoniae isolates with borderline carbapenem MICs. We compared carbapenemase-negative K. pneumoniae with carbapenemase-producing K. pneumoniae (CPKP) isolates with similar MICs. CPKP isolates exhibited a marked inoculum effect and were more resistant to the bactericidal effect of meropenem. This suggests that MIC measurements alone may not be sufficient in predicting the therapeutic efficacy of carbapenems against CPKP. PMID:25987630

  9. Effect of Resistance Mechanisms on the Inoculum Effect of Carbapenem in Klebsiella pneumoniae Isolates with Borderline Carbapenem Resistance.

    PubMed

    Adler, Amos; Ben-Dalak, Ma'ayan; Chmelnitsky, Ina; Carmeli, Yehuda

    2015-08-01

    We aimed to examine the effects of resistance mechanisms on several resistance phenotypes among carbapenem-resistant Klebsiella pneumoniae isolates with borderline carbapenem MICs. We compared carbapenemase-negative K. pneumoniae with carbapenemase-producing K. pneumoniae (CPKP) isolates with similar MICs. CPKP isolates exhibited a marked inoculum effect and were more resistant to the bactericidal effect of meropenem. This suggests that MIC measurements alone may not be sufficient in predicting the therapeutic efficacy of carbapenems against CPKP. PMID:25987630

  10. Candida parapsilosis Resistance to Fluconazole: Molecular Mechanisms and In Vivo Impact in Infected Galleria mellonella Larvae.

    PubMed

    Souza, Ana Carolina R; Fuchs, Beth Burgwyn; Pinhati, Henrique M S; Siqueira, Ricardo A; Hagen, Ferry; Meis, Jacques F; Mylonakis, Eleftherios; Colombo, Arnaldo L

    2015-10-01

    Candida parapsilosis is the main non-albicans Candida species isolated from patients in Latin America. Mutations in the ERG11 gene and overexpression of membrane transporter proteins have been linked to fluconazole resistance. The aim of this study was to evaluate the molecular mechanisms in fluconazole-resistant strains of C. parapsilosis isolated from critically ill patients. The identities of the nine collected C. parapsilosis isolates at the species level were confirmed through molecular identification with a TaqMan qPCR assay. The clonal origin of the strains was checked by microsatellite typing. The Galleria mellonella infection model was used to confirm in vitro resistance. We assessed the presence of ERG11 mutations, as well as the expression of ERG11 and two additional genes that contribute to antifungal resistance (CDR1 and MDR1), by using real-time quantitative PCR. All of the C. parapsilosis (sensu stricto) isolates tested exhibited fluconazole MICs between 8 and 16 μg/ml. The in vitro data were confirmed by the failure of fluconazole in the treatment of G. mellonella infected with fluconazole-resistant strains of C. parapsilosis. Sequencing of the ERG11 gene revealed a common mutation leading to a Y132F amino acid substitution in all of the isolates, a finding consistent with their clonal origin. After fluconazole exposure, overexpression was noted for ERG11, CDR1, and MDR1 in 9/9, 9/9, and 2/9 strains, respectively. We demonstrated that a combination of molecular mechanisms, including the presence of point mutations in the ERG11 gene, overexpression of ERG11, and genes encoding efflux pumps, are involved in fluconazole resistance in C. parapsilosis. PMID:26259795

  11. Molecular Mechanisms of Fluconazole Resistance in Candida parapsilosis Isolates from a U.S. Surveillance System

    PubMed Central

    Grossman, Nina T.; Pham, Cau D.; Cleveland, Angela A.

    2014-01-01

    Candida parapsilosis is the second or third most common cause of candidemia in many countries. The Infectious Diseases Society of America recommends fluconazole as the primary therapy for C. parapsilosis candidemia. Although the rate of fluconazole resistance among C. parapsilosis isolates is low in most U.S. institutions, the resistance rate can be as high as 7.5%. This study was designed to assess the mechanisms of fluconazole resistance in 706 incident bloodstream isolates from U.S. hospitals. We sequenced the ERG11 and MRR1 genes of 122 C. parapsilosis isolates with resistant (30 isolates; 4.2%), susceptible dose-dependent (37 isolates; 5.2%), and susceptible (55 isolates) fluconazole MIC values and used real-time PCR of RNA from 17 isolates to investigate the regulation of MDR1. By comparing these isolates to fully fluconazole-susceptible isolates, we detected at least two mechanisms of fluconazole resistance: an amino acid substitution in the 14-α-demethylase gene ERG11 and overexpression of the efflux pump MDR1, possibly due to point mutations in the MRR1 transcription factor that regulates MDR1. The ERG11 single nucleotide polymorphism (SNP) was found in 57% of the fluconazole-resistant isolates and in no susceptible isolates. The MRR1 SNPs were more difficult to characterize, as not all resulted in overexpression of MDR1 and not all MDR1 overexpression was associated with an SNP in MRR1. Further work to characterize the MRR1 SNPs and search for overexpression of other efflux pumps is needed. PMID:25451046

  12. Candida parapsilosis Resistance to Fluconazole: Molecular Mechanisms and In Vivo Impact in Infected Galleria mellonella Larvae

    PubMed Central

    Souza, Ana Carolina R.; Fuchs, Beth Burgwyn; Pinhati, Henrique M. S.; Siqueira, Ricardo A.; Hagen, Ferry; Meis, Jacques F.; Mylonakis, Eleftherios

    2015-01-01

    Candida parapsilosis is the main non-albicans Candida species isolated from patients in Latin America. Mutations in the ERG11 gene and overexpression of membrane transporter proteins have been linked to fluconazole resistance. The aim of this study was to evaluate the molecular mechanisms in fluconazole-resistant strains of C. parapsilosis isolated from critically ill patients. The identities of the nine collected C. parapsilosis isolates at the species level were confirmed through molecular identification with a TaqMan qPCR assay. The clonal origin of the strains was checked by microsatellite typing. The Galleria mellonella infection model was used to confirm in vitro resistance. We assessed the presence of ERG11 mutations, as well as the expression of ERG11 and two additional genes that contribute to antifungal resistance (CDR1 and MDR1), by using real-time quantitative PCR. All of the C. parapsilosis (sensu stricto) isolates tested exhibited fluconazole MICs between 8 and 16 μg/ml. The in vitro data were confirmed by the failure of fluconazole in the treatment of G. mellonella infected with fluconazole-resistant strains of C. parapsilosis. Sequencing of the ERG11 gene revealed a common mutation leading to a Y132F amino acid substitution in all of the isolates, a finding consistent with their clonal origin. After fluconazole exposure, overexpression was noted for ERG11, CDR1, and MDR1 in 9/9, 9/9, and 2/9 strains, respectively. We demonstrated that a combination of molecular mechanisms, including the presence of point mutations in the ERG11 gene, overexpression of ERG11, and genes encoding efflux pumps, are involved in fluconazole resistance in C. parapsilosis. PMID:26259795

  13. Non-Invasive Methods to Monitor Mechanisms of Resistance to Tyrosine Kinase Inhibitors in Non-Small-Cell Lung Cancer: Where Do We Stand?

    PubMed Central

    Ulivi, Paola

    2016-01-01

    The induction of resistance mechanisms represents an important problem for the targeted therapy of patients with non-small-cell lung cancer (NSCLC). The best-known resistance mechanism induced during treatment with epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitors (TKIs) is EGFR T790M mutation for which specific drugs are have been developed. However, other molecular alterations have also been reported as induced resistance mechanisms to EGFR-TKIs. Similarly, there is growing evidence of acquired resistance mechanisms to anaplastic lymphoma kinase (ALK)-TKI treatment. A better understanding of these acquired resistance mechanisms is essential in clinical practice as patients could be treated with specific drugs that are active against the induced alterations. The use of free circulating tumor nucleic acids or circulating tumor cells (CTCs) enables resistance mechanisms to be characterized in a non-invasive manner and reduces the need for tumor re-biopsy. This review discusses the main resistance mechanisms to TKIs and provides a comprehensive overview of innovative strategies to evaluate known resistance mechanisms in free circulating nucleic acids or CTCs and potential future orientations for these non-invasive approaches. PMID:27455248

  14. Resistance to antiplatelet drugs: molecular mechanisms and laboratory detection.

    PubMed

    Cattaneo, M

    2007-07-01

    The definition 'resistance to antiplatelet drugs' should be limited to situations in which failure of the drug to hit its pharmacological target has been documented by specific laboratory tests. Aspirin resistance, as determined by specific tests (e.g. serum thromboxane B(2)), appears to be rare (1-2%) and, in most instances, is caused by poor compliance. In contrast to aspirin, studies that used specific tests to measure the pharmacological effect of thienopyridines [e.g. vasodilator-stimulated phosphoprotein (VASP)] showed a wide variability of responses to these drugs, with significant proportions of subjects (15-30%) who are very poor responders. Inter-individual differences in the extent of metabolism of thienopyridines to their active metabolites is the most plausible mechanism for the observed inter-individual variability in platelet inhibition. The demonstration that some patients may be 'resistant' or 'poor responders' to the pharmacological effect of antiplatelet drugs, has prompted the need of laboratory monitoring of antiplatelet therapy. However, many published studies have been performed using unspecific tests of platelet function, which identify patients on antiplatelet treatment with high residual platelet reactivity, which is not necessarily because of resistance to antiplatelet drugs. Despite this drawback, identification of patients with high residual platelet reactivity may be useful to predict their risk of atherothrombotic events. However, many studies still need to be carried out to identify the ideal laboratory test and to answer basic questions on its clinical utility and cost-effectiveness, before monitoring antiplatelet therapy can be recommended in the clinical practise. Until then, monitoring of antiplatelet therapy should be considered for investigational purposes only. PMID:17635731

  15. Hydrofluoric acid-resistant composite window and method for its fabrication

    DOEpatents

    Ostenak, C.A.; Mackay, H.A.

    1985-07-18

    A hydrofluoric acid-resistant composite window and method for its fabrication are disclosed. The composite window comprises a window having first and second sides. The first side is oriented towards an environment containing hydrofluoric acid. An adhesive is applied to the first side. A layer of transparent hydrofluoric acid-resistant material, such as Mylar, is applied to the adhesive and completely covers the first side. The adhesive is then cured.

  16. Hydrofluoric acid-resistant composite window and method for its fabrication

    DOEpatents

    Ostenak, Carl A.; Mackay, Harold A.

    1987-01-01

    A hydrofluoric acid-resistant composite window and method for its fabrication are disclosed. The composite window comprises a window having first and second sides. The first side is oriented towards an environment containing hydrofluoric acid. An adhesive is applied to the first side. A layer of transparent hydrofluoric acid-resistant material, such as Mylar, is applied to the adhesive and completely covers the first side. The adhesive is then cured.

  17. Expression of Efflux Pumps and Fatty Acid Activator One Genes in Azole Resistant Candida Glabrata Isolated From Immunocompromised Patients.

    PubMed

    Farahyar, Shirin; Zaini, Farideh; Kordbacheh, Parivash; Rezaie, Sassan; Falahati, Mehraban; Safara, Mahin; Raoofian, Reza; Hatami, Kamran; Mohebbi, Masoumeh; Heidari, Mansour

    2016-07-01

    Acquired azole resistance in opportunistic fungi causes severe clinical problems in immunosuppressed individuals. This study investigated the molecular mechanisms of azole resistance in clinical isolates of Candida glabrata. Six unmatched strains were obtained from an epidemiological survey of candidiasis in immunocompromised hosts that included azole and amphotericin B susceptible and azole resistant clinical isolates. Candida glabrata CBS 138 was used as reference strain. Antifungal susceptibility testing of clinical isolates was evaluated using Clinical and Laboratory Standards Institute (CLSI) methods. Complementary DNA-amplified fragment length polymorphism (cDNA-AFLP) technology, semi-quantitative RT-PCR, and sequencing were employed for identification of potential genes involved in azole resistance. Candida glabrata Candida drug resistance 1 (CgCDR1) and Candida glabrata Candida drug resistance 2 (CgCDR2) genes, which encode for multidrug transporters, were found to be upregulated in azole-resistant isolates (≥2-fold). Fatty acid activator 1 (FAA1) gene, belonging to Acyl-CoA synthetases, showed expression in resistant isolates ≥2-fold that of the susceptible isolates and the reference strain. This study revealed overexpression of the CgCDR1, CgCDR2, and FAA1 genes affecting biological pathways, small hydrophobic compounds transport, and lipid metabolism in the resistant clinical C.glabrata isolates. PMID:27424018

  18. Acid resistance and response to pH-induced stress in two Lactobacillus plantarum strains with probiotic potential.

    PubMed

    Šeme, H; Gjuračić, K; Kos, B; Fujs, Š; Štempelj, M; Petković, H; Šušković, J; Bogovič Matijašić, B; Kosec, G

    2015-01-01

    Two new Lactobacillus plantarum strains, KR6-DSM 28780 and M5 isolated from sour turnip and traditional dried fresh cheese, respectively, were evaluated for species identity, antibiotic susceptibility, resistance to gastrointestinal conditions and adaptive response to low pH. Resistance mechanisms involved in the adaptation to acid-induced stress in these two strains were investigated by quantitative PCR of the atpA, cfa1, mleS and hisD genes. In addition to absence of antibiotic resistance, the two L. plantarum strains showed excellent survival rates at pH values as low as 2.4. Adaptive response to low pH was clearly observed in both strains; strain KR6 was superior to M5, as demonstrated by its ability to survive during 3 h incubation at pH 2.0 upon adaptation to moderately acidic conditions. In contrast, acid adaptation did not significantly affect the survival rate during simulated passage through the gastrointestinal tract. In both strains, induction of histidine biosynthesis (hisD) was upregulated during the acid adaptation response. In addition, significant upregulation of the cfa1 gene, involved in modulation of membrane fatty acid composition, was observed during the adaptation phase in strain KR6 but not in strain M5. Cells adapted to moderately acidic conditions also showed a significantly increased viability after the lyophilisation procedure, a cross-protection phenomenon providing additional advantage in probiotic application. PMID:25380802

  19. Characterization of the abomasal transcriptome for mechanisms of resistance to gastrointestinal nematodes in cattle

    PubMed Central

    2011-01-01

    The response of the abomasal transcriptome to gastrointestinal parasites was evaluated in parasite-susceptible and parasite-resistant Angus cattle using RNA-seq at a depth of 23.7 million sequences per sample. These cattle displayed distinctly separate resistance phenotypes as assessed by fecal egg counts. Approximately 65.3% of the 23 632 bovine genes were expressed in the fundic abomasum. Of these, 13 758 genes were expressed in all samples tested and likely represent core components of the bovine abomasal transcriptome. The gene (BT14427) with the most abundant transcript, accounting for 10.4% of sequences in the transcriptome, is located on chromosome 29 and has unknown functions. Additionally, PIGR (1.6%), Complement C3 (0.7%), and Immunoglobulin J chain (0.5%) were among the most abundant transcripts in the transcriptome. Among the 203 genes impacted, 64 were significantly over-expressed in resistant animals at a stringent cutoff (FDR < 5%). Among the 94 224 splice junctions identified, 133 were uniquely present: 90 were observed only in resistant animals, and 43 were present only in susceptible animals. Gene Ontology (GO) enrichment of the genes under study uncovered an association with lipid metabolism, which was confirmed by an independent pathway analysis. Several pathways, such as FXR/RXR activation, LXR/RXR activation, LPS/IL-1 mediated inhibition of RXR function, and arachidonic acid metabolism, were impacted in resistant animals, which are potentially involved in the development of parasite resistance in cattle. Our results provide insights into the development of host immunity to gastrointestinal nematode infection and will facilitate understanding of mechanism underlying host resistance. PMID:22129081

  20. Virulence factors and mechanisms of antimicrobial resistance in Shigella strains from periurban areas of Lima (Peru)

    PubMed Central

    Lluque, Angela; Mosquito, Susan; Gomes, Cláudia; Riveros, Maribel; Durand, David; Tilley, Drake H.; Bernal, María; Prada, Ana; Ochoa, Theresa J.; Ruiz, Joaquim

    2015-01-01

    The study was aimed to describe the serotype, mechanisms of antimicrobial resistance, and virulence determinants in Shigella spp. isolated from Peruvian children. Eighty three Shigella spp. were serogrouped and serotyped being established the antibiotic susceptibility. The presence of 12 virulence factors (VF) and integrase 1 and 2, along with commonly found antibiotic resistance genes was established by PCR. S. flexneri was the most relevant serogroup (55 isolates, 66%), with serotype 2a most frequently detected (27 of 55, 49%), followed by S. boydii and S. sonnei at 12 isolates each (14%) and S. dysenteriae (4 isolates, 5%). Fifty isolates (60%) were multi-drug resistant (MDR) including 100% of S. sonnei and 64% of S. flexneri. Resistance levels were high to trimethoprim-sulfamethoxazole (86%), tetracycline (74%), ampicillin (67%), and chloramphenicol (65%). Six isolates showed decreased azithromycin susceptibility. No isolate was resistant to nalidixic acid, ciprofloxacin, nitrofurantoin, or ceftriaxone. The most frequent resistance genes were sul2 (95%), tet(B) (92%), cat (80%), dfrA1 (47%), blaOXA-1 like (40%), with intl1 and intl2 detected in 51 and 52% of the isolates, respectively. Thirty-one different VF profiles were observed, being the ipaH (100%), sen (77%), virA and icsA (75%) genes the most frequently found. Differences in the prevalence of VF were observed between species with S. flexneri isolates, particularly serotype 2a, possessing high numbers of VF. In conclusion, this study highlights the high heterogeneity of Shigella VF and resistance genes, and prevalence of MDR organisms within this geographic region. PMID:25998616

  1. Metabolic and Target-Site Mechanisms Combine to Confer Strong DDT Resistance in Anopheles gambiae

    PubMed Central

    Mitchell, Sara N.; Rigden, Daniel J.; Dowd, Andrew J.; Lu, Fang; Wilding, Craig S.; Weetman, David; Dadzie, Samuel; Jenkins, Adam M.; Regna, Kimberly; Boko, Pelagie; Djogbenou, Luc; Muskavitch, Marc A. T.; Ranson, Hilary; Paine, Mark J. I.; Mayans, Olga; Donnelly, Martin J.

    2014-01-01

    The development of resistance to insecticides has become a classic exemplar of evolution occurring within human time scales. In this study we demonstrate how resistance to DDT in the major African malaria vector Anopheles gambiae is a result of both target-site resistance mechanisms that have introgressed between incipient species (the M- and S-molecular forms) and allelic variants in a DDT-detoxifying enzyme. Sequencing of the detoxification enzyme, Gste2, from DDT resistant and susceptible strains of An. gambiae, revealed a non-synonymous polymorphism (I114T), proximal to the DDT binding domain, which segregated with strain phenotype. Recombinant protein expression and DDT metabolism analysis revealed that the proteins from the susceptible strain lost activity at higher DDT concentrations, characteristic of substrate inhibition. The effect of I114T on GSTE2 protein structure was explored through X-ray crystallography. The amino acid exchange in the DDT-resistant strain introduced a hydroxyl group nearby the hydrophobic DDT-binding region. The exchange does not result in structural alterations but is predicted to facilitate local dynamics and enzyme activity. Expression of both wild-type and 114T alleles the allele in Drosophila conferred an increase in DDT tolerance. The 114T mutation was significantly associated with DDT resistance in wild caught M-form populations and acts in concert with target-site mutations in the voltage gated sodium channel (Vgsc-1575Y and Vgsc-1014F) to confer extreme levels of DDT resistance in wild caught An. gambiae. PMID:24675797

  2. Virulence factors and mechanisms of antimicrobial resistance in Shigella strains from periurban areas of Lima (Peru).

    PubMed

    Lluque, Angela; Mosquito, Susan; Gomes, Cláudia; Riveros, Maribel; Durand, David; Tilley, Drake H; Bernal, María; Prada, Ana; Ochoa, Theresa J; Ruiz, Joaquim

    2015-01-01

    The study was aimed to describe the serotype, mechanisms of antimicrobial resistance, and virulence determinants in Shigella spp. isolated from Peruvian children. Eighty three Shigella spp. were serogrouped and serotyped being established the antibiotic susceptibility. The presence of 12 virulence factors (VF) and integrase 1 and 2, along with commonly found antibiotic resistance genes was established by PCR. S. flexneri was the most relevant serogroup (55 isolates, 66%), with serotype 2a most frequently detected (27 of 55, 49%), followed by S. boydii and S. sonnei at 12 isolates each (14%) and S. dysenteriae (four isolates, 5%). Fifty isolates (60%) were multi-drug resistant (MDR) including 100% of S. sonnei and 64% of S. flexneri. Resistance levels were high to trimethoprim-sulfamethoxazole (86%), tetracycline (74%), ampicillin (67%), and chloramphenicol (65%). Six isolates showed decreased azithromycin susceptibility. No isolate was resistant to nalidixic acid, ciprofloxacin, nitrofurantoin, or ceftriaxone. The most frequent resistance genes were sul2 (95%), tet(B) (92%), cat (80%), dfrA1 (47%), blaOXA-1like (40%), with intl1 and intl2 detected in 51 and 52% of the isolates, respectively. Thirty-one different VF profiles were observed, being the ipaH (100%), sen (77%), virA and icsA (75%) genes the most frequently found. Differences in the prevalence of VF were observed between species with S. flexneri isolates, particularly serotype 2a, possessing high numbers of VF. In conclusion, this study highlights the high heterogeneity of Shigella VF and resistance genes, and prevalence of MDR organisms within this geographic region. PMID:25998616

  3. L-Ascorbic acid can abrogate SVCT-2-dependent cetuximab resistance mediated by mutant KRAS in human colon cancer cells.

    PubMed

    Jung, Soo-A; Lee, Dae-Hee; Moon, Jai-Hee; Hong, Seung-Woo; Shin, Jae-Sik; Hwang, Ih Yeon; Shin, Yu Jin; Kim, Jeong Hee; Gong, Eun-Yeung; Kim, Seung-Mi; Lee, Eun Young; Lee, Seul; Kim, Jeong Eun; Kim, Kyu-Pyo; Hong, Yong Sang; Lee, Jung Shin; Jin, Dong-Hoon; Kim, TaeWon; Lee, Wang Jae

    2016-06-01

    Colon cancer patients with mutant KRAS are resistant to cetuximab, an antibody directed against the epidermal growth factor receptor, which is an effective clinical therapy for patients with wild-type KRAS. Numerous combinatorial therapies have been tested to overcome the resistance to cetuximab. However, no combinations have been found that can be used as effective therapeutic strategies. In this study, we demonstrate that L-ascorbic acid partners with cetuximab to induce killing effects, which are influenced by sodium-dependent vitamin C transporter 2 (SVCT-2) in human colon cancer cells with a mutant KRAS. L-Ascorbic acid treatment of human colon cancer cells that express a mutant KRAS differentially and synergistically induced cell death with cetuximab in a SVCT-2-dependent manner. The ectopic expression of SVCT-2 induced sensitivity to L-ascorbic acid treatment in human colon cancer cells that do not express SVCT-2, whereas the knockdown of endogenous SVCT-2 induced resistance to L-ascorbic acid treatment in SVCT-2-positive cells. Moreover, tumor regression via the administration of L-ascorbic acid and cetuximab in mice bearing tumor cell xenografts corresponded to SVCT-2 protein levels. Interestingly, cell death induced by the combination of L-ascorbic acid and cetuximab resulted in both apoptotic and necrotic cell death. These cell death mechanisms were related to a disruption of the ERK pathway and were represented by the impaired activation of RAFs and the activation of the ASK-1-p38 pathway. Taken together, these results suggest that resistance to cetuximab in human colon cancer patients with a mutant KRAS can be bypassed by L-ascorbic acid in an SVCT-2-dependent manner. Furthermore, SVCT-2 in mutant KRAS colon cancer may act as a potent marker for potentiating L-ascorbic acid co-treatment with cetuximab. PMID:27012422

  4. Avidity Mechanism of Dendrimer–Folic Acid Conjugates

    PubMed Central

    2015-01-01

    Multivalent conjugation of folic acid has been employed to target cells overexpressing folate receptors. Such polymer conjugates have been previously demonstrated to have high avidity to folate binding protein. However, the lack of a monovalent folic acid–polymer material has prevented a full binding analysis of these conjugates, as multivalent binding mechanisms and polymer-mass mechanisms are convoluted in samples with broad distributions of folic acid-to-dendrimer ratios. In this work, the synthesis of a monovalent folic acid–dendrimer conjugate allowed the elucidation of the mechanism for increased binding between the folic acid–polymer conjugate and a folate binding protein surface. The increased avidity is due to a folate-keyed interaction between the dendrimer and protein surfaces that fits into the general framework of slow-onset, tight-binding mechanisms of ligand/protein interactions. PMID:24725205

  5. Abscisic Acid Determines Basal Susceptibility of Tomato to Botrytis cinerea and Suppresses Salicylic Acid-Dependent Signaling Mechanisms1

    PubMed Central

    Audenaert, Kris; De Meyer, Geert B.; Höfte, Monica M.

    2002-01-01

    Abscisic acid (ABA) is one of the plant hormones involved in the interaction between plants and pathogens. In this work, we show that tomato (Lycopersicon esculentum Mill. cv Moneymaker) mutants with reduced ABA levels (sitiens plants) are much more resistant to the necrotrophic fungus Botrytis cinerea than wild-type (WT) plants. Exogenous application of ABA restored susceptibility to B. cinerea in sitiens plants and increased susceptibility in WT plants. These results indicate that ABA plays a major role in the susceptibility of tomato to B. cinerea. ABA appeared to interact with a functional plant defense response against B. cinerea. Experiments with transgenic NahG tomato plants and benzo(1,2,3)thiadiazole-7-carbothioic acid demonstrated the importance of salicylic acid in the tomato-B. cinerea interaction. In addition, upon infection with B. cinerea, sitiens plants showed a clear increase in phenylalanine ammonia lyase activity, which was not observed in infected WT plants, indicating that the ABA levels in healthy WT tomato plants partly repress phenylalanine ammonia lyase activity. In addition, sitiens plants became more sensitive to benzo(1,2,3)thiadiazole-7-carbothioic acid root treatment. The threshold values for PR1a gene expression declined with a factor 10 to 100 in sitiens compared with WT plants. Thus, ABA appears to negatively modulate the salicylic acid-dependent defense pathway in tomato, which may be one of the mechanisms by which ABA levels determine susceptibility to B. cinerea. PMID:11842153

  6. Mechanisms of Resistance to an Azole Fungicide in the Grapevine Powdery Mildew Fungus, Erysiphe necator.

    PubMed

    Frenkel, Omer; Cadle-Davidson, Lance; Wilcox, Wayne F; Milgroom, Michael G

    2015-03-01

    We studied the mechanisms of azole resistance in Erysiphe necator by quantifying the sensitivity to myclobutanil (EC50) in 65 isolates from the eastern United States and 12 from Chile. From each isolate, we sequenced the gene for sterol 14α-demethylase (CYP51), and measured the expression of CYP51 and homologs of four putative efflux transporter genes, which we identified in the E. necator transcriptome. Sequence variation in CYP51 was relatively low, with sequences of 40 U.S. isolates identical to the reference sequence. Nine U.S. isolates and five from Chile carried a previously identified A to T nucleotide substitution in position 495 (A495T), which results in an amino acid substitution in codon 136 (Y136F) and correlates with high levels of azole resistance. We also found a nucleotide substitution in position 1119 (A1119C) in 15 U.S. isolates, whose mean EC50 value was equivalent to that for the Y136F isolates. Isolates carrying mutation A1119C had significantly greater CYP51 expression, even though A1119C does not affect the CYP51 amino acid sequence. Regression analysis showed no significant effects of the expression of efflux transporter genes on EC50. Both the Y136F mutation in CYP51 and increased CYP51 expression appear responsible for azole resistance in eastern U.S. populations of E. necator. PMID:25271353

  7. Low Prevalence of Carbapenem-Resistant Bacteria in River Water: Resistance Is Mostly Related to Intrinsic Mechanisms.

    PubMed

    Tacão, Marta; Correia, António; Henriques, Isabel S

    2015-10-01

    Carbapenems are last-resort antibiotics to handle serious infections caused by multiresistant bacteria. The incidence of resistance to these antibiotics has been increasing and new resistance mechanisms have emerged. The dissemination of carbapenem resistance in the environment has been overlooked. The main goal of this research was to assess the prevalence and diversity of carbapenem-resistant bacteria in riverine ecosystems. The presence of frequently reported carbapenemase-encoding genes was inspected. The proportion of imipenem-resistant bacteria was on average 2.24 CFU/ml. Imipenem-resistant strains (n=110) were identified as Pseudomonas spp., Stenotrophomonas maltophilia, Aeromonas spp., Chromobacterium haemolyticum, Shewanella xiamenensis, and members of Enterobacteriaceae. Carbapenem-resistant bacteria were highly resistant to other beta-lactams such as quinolones, aminoglycosides, chloramphenicol, tetracyclines, and sulfamethoxazole/trimethoprim. Carbapenem resistance was mostly associated with intrinsically resistant bacteria. As intrinsic resistance mechanisms, we have identified the blaCphA gene in 77.3% of Aeromonas spp., blaL1 in all S. maltophilia, and blaOXA-48-like in all S. xiamenensis. As acquired resistance mechanisms, we have detected the blaVIM-2 gene in six Pseudomonas spp. (5.45%). Integrons with gene cassettes encoding resistance to aminoglycosides (aacA and aacC genes), trimethoprim (dfrB1b), and carbapenems (blaVIM-2) were found in Pseudomonas spp. Results suggest that carbapenem resistance dissemination in riverine ecosystems is still at an early stage. Nevertheless, monitoring these aquatic compartments for the presence of resistance genes and its host organisms is essential to outline strategies to minimize resistance dissemination. PMID:26430939

  8. Analysis of acid-generating action of PAG in an EUV resist using acid-sensitive dyes

    NASA Astrophysics Data System (ADS)

    Sekiguchi, Atsushi; Matsumoto, Yoko; Biafore, John J.

    2013-03-01

    Researchers are currently examining various methods for determining the quantity of acid generated by a photoacid generator (PAG) and for analyzing acid-generating reactions using acid-sensitive dyes that react with acid and generate a color. Adding an acid-sensitive dye to the resist gives a clear grasp of the acid-generating action. The process involves applying a resist containing an acid-sensitive dye to a quartz substrate; exposing the substrate; and measuring and evaluating the absorbance of a chromogenic substance near 530 nm using a spectroscope. The method determines the rate constant for acid generation (Dill C parameter) during exposure based on the relationship between transmissivity at 530 nm and exposure dose. Using this method, we obtained and compared rate constants for acid generation (C parameters) as part of our study of dependence on the quantity of quencher in the EUV resist. Our results indicate a new model that accounts for the quencher concentration parameter would be useful in analyzing dependence on the quantity of quencher. This paper presents these findings, together with the results of studies of profile simulations using the quencher concentration parameter obtained in the experiments.

  9. Decrypting the H-NS-dependent regulatory cascade of acid stress resistance in Escherichia coli

    PubMed Central

    2010-01-01

    Background H-NS regulates the acid stress resistance. The present study aimed to characterize the H-NS-dependent cascade governing the acid stress resistance pathways and to define the interplay between the different regulators. Results We combined mutational, phenotypic and gene expression analyses, to unravel the regulatory hierarchy in acid resistance involving H-NS, RcsB-P/GadE complex, HdfR, CadC, AdiY regulators, and DNA-binding assays to separate direct effects from indirect ones. RcsB-P/GadE regulatory complex, the general direct regulator of glutamate-, arginine- and lysine-dependent acid resistance pathways plays a central role in the regulatory cascade. However, H-NS also directly controls specific regulators of these pathways (e.g. cadC) and genes involved in general stress resistance (hdeAB, hdeD, dps, adiY). Finally, we found that in addition to H-NS and RcsB, a third regulator, HdfR, inversely controls glutamate-dependent acid resistance pathway and motility. Conclusions H-NS lies near the top of the hierarchy orchestrating acid response centred on RcsB-P/GadE regulatory complex, the general direct regulator of glutamate-, arginine- and lysine-dependent acid resistance pathways. PMID:21034467

  10. Mechanisms of β-lactam antimicrobial resistance and epidemiology of major community- and healthcare-associated multidrug-resistant bacteria.

    PubMed

    Tang, Sarah S; Apisarnthanarak, Anucha; Hsu, Li Yang

    2014-11-30

    Alexander Fleming's discovery of penicillin heralded an age of antibiotic development and healthcare advances that are premised on the ability to prevent and treat bacterial infections both safely and effectively. The resultant evolution of antimicrobial resistant mechanisms and spread of bacteria bearing these genetic determinants of resistance are acknowledged to be one of the major public health challenges globally, and threatens to unravel the gains of the past decades. We describe the major mechanisms of resistance to β-lactam antibiotics - the most widely used and effective antibiotics currently - in both Gram-positive and Gram-negative bacteria, and also briefly detail the existing and emergent pharmacological strategies to overcome such resistance. The global epidemiology of the four major types of bacteria that are responsible for the bulk of antimicrobial-resistant infections in the healthcare setting - methicillin-resistant Staphylococcus aureus, vancomycin-resistant enterococci, Enterobactericeae, and Acinetobacter baumannii - are also briefly described. PMID:25134490

  11. Applications of hydroxy acids: classification, mechanisms, and photoactivity

    PubMed Central

    Kornhauser, Andrija; Coelho, Sergio G; Hearing, Vincent J

    2010-01-01

    Hydroxy acids (HAs) represent a class of compounds which have been widely used in a number of cosmetic and therapeutic formulations in order to achieve a variety of beneficial effects for the skin. We review and discuss the most frequently used classes of these compounds, such as α-hydroxy acids, β-hydroxy acids, polyhydroxy acids, and bionic acids, and describe their applications as cosmetic and therapeutic agents. Special emphasis is devoted to the safety evaluation of these formulations, in particular on the effects of their prolonged use on sun-exposed skin. Furthermore, we summarize the very limited number of studies dealing with the modifications evoked by topical application of products containing HAs on photocarcinogenesis. In spite of the large number of reports on the cosmetic and clinical effects of HAs, their biological mechanism(s) of action still require more clarification. Some of these mechanisms are discussed in this article along with important findings on the effect of HAs on melanogenesis and on tanning. We also emphasize the important contribution of cosmetic vehicles in these types of studies. Thus, HAs play an important role in cosmetic formulations, as well as in many dermatologic applications, such as in treating photoaging, acne, ichthyosis, rosacea, pigmentation disorders, and psoriasis. PMID:21437068

  12. Applications of hydroxy acids: classification, mechanisms, and photoactivity.

    PubMed

    Kornhauser, Andrija; Coelho, Sergio G; Hearing, Vincent J

    2010-01-01

    Hydroxy acids (HAs) represent a class of compounds which have been widely used in a number of cosmetic and therapeutic formulations in order to achieve a variety of beneficial effects for the skin. We review and discuss the most frequently used classes of these compounds, such as α-hydroxy acids, β-hydroxy acids, polyhydroxy acids, and bionic acids, and describe their applications as cosmetic and therapeutic agents. Special emphasis is devoted to the safety evaluation of these formulations, in particular on the effects of their prolonged use on sun-exposed skin. Furthermore, we summarize the very limited number of studies dealing with the modifications evoked by topical application of products containing HAs on photocarcinogenesis. In spite of the large number of reports on the cosmetic and clinical effects of HAs, their biological mechanism(s) of action still require more clarification. Some of these mechanisms are discussed in this article along with important findings on the effect of HAs on melanogenesis and on tanning. We also emphasize the important contribution of cosmetic vehicles in these types of studies. Thus, HAs play an important role in cosmetic formulations, as well as in many dermatologic applications, such as in treating photoaging, acne, ichthyosis, rosacea, pigmentation disorders, and psoriasis. PMID:21437068

  13. Mechanisms of hexavalent chromium resistance and removal by microorganisms.

    PubMed

    Joutey, Nezha Tahri; Sayel, Hanane; Bahafid, Wifak; El Ghachtouli, Naïma

    2015-01-01

    Chromium has been and is extensively used worldwide in multiple industrial processes and is routinely discharged to the environment from such processes. Therefore, this heavy metal is a potential threat to the environment and to public health, primarily because it is non-biodegradable and environmentally persistent. Chromium exists in several oxidation states, the most stable of which are trivalent Cr(Ill) and hexavalent Cr(VI) species. Each species possesses its own individual chemical characteristics and produces its own biological effects. For example, Cr (Ill) is an essential oligoelement for humans, whereas Cr(VI) is carcinogenic and mutagenic. Several chemical methods are used to remove Cr(VI) from contaminated sites. Each of these methods has advantages and disadvantages. Currently, bioremediation is often the preferred method to deal with Cr contaminated sites, because it is eco-friendly, cost-effective and is a "natural" technology. Many yeast, bacterial and fungal species have been assessed for their suitability to reduce or remove Cr(VI) contamination. The mechanisms by which these microorganisms resist and reduce Cr(VI) are variable and are species dependent. There are several Cr-resistance mechanisms that are displayed by microorganisms. These include active efflux of Cr compounds, metabolic reduction of Cr(VI) to Cr (ill), and either intercellular or extracellular prec1p1tation. Microbial Cr (VI) removal typically involves three stages: binding of chromium to the cell surface, translocation of chromium into the cell, and reduction of Cr(VI) to Cr (ill). Cr(VI) reduction by microorganisms may proceed on the cell surface, outside the cell, or intracellularly, either directly via chromate reductase enzymes, or indirectly via metabolite reduction of Cr(VI). The uptake of chromium ions is a biphasic process. The primary step is known as biosorption, a metabolic energyindependent process. Thereafter, bioaccumulation occurs, but is much slower, and is

  14. Ferulic acid reverses ABCB1-mediated paclitaxel resistance in MDR cell lines.

    PubMed

    Muthusamy, Ganesan; Balupillai, Agilan; Ramasamy, Karthikeyan; Shanmugam, Mohana; Gunaseelan, Srithar; Mary, Beaulah; Prasad, N Rajendra

    2016-09-01

    Multidrug resistance (MDR) remains a major obstacle in cancer chemotherapy. The use of the dietary phytochemicals as chemosensitizing agents to enhance the efficacy of conventional cytostatic drugs has recently gained the attention as a plausible approach for overcoming the drug resistance. The aim of this study was to investigate whether a naturally occurring diet-based phenolic acid, ferulic acid, could sensitize paclitaxel efficacy in ABCB1 overexpressing (P-glycoprotein) colchicine selected KB Ch(R)8-5 cell line. In vitro drug efflux assays demonstrated that ferulic acid inhibits P-glycoprotein transport function in drug resistant KB Ch(R)8-5 cell lines. However, ferulic acid significantly downregulates ABCB1 expression in a concentration dependent manner. Cytotoxicity assay reveals that ferulic acid decreased paclitaxel resistance in KBCh(R)8-5 and HEK293/ABCB1 cells, which indicates its chemosensitizing potential. Clonogenic cell survival assay and apoptotic morphological staining further confirm the chemosensitizing potential of ferulic acid in drug resistant KB Ch(R)8-5 cell lines. Ferulic acid treatment enhances paclitaxel mediated cell cycle arrest and upregulates paclitaxel-induced apoptotic signaling in KB resistant cells. Hence, it has been concluded that downregulation of ABCB1 and subsequent induction of paclitaxel-mediated cell cycle arrest and apoptotic signaling may be the cause for the chemosensitizing potential of ferulic acid in P-gp overexpressing cell lines. PMID:27262378

  15. Mechanisms of suberoylanilide hydroxamic acid inhibition of mammary cell growth

    PubMed Central

    Said, Thenaa K; Moraes, Ricardo CB; Sinha, Raghu; Medina, Daniel

    2001-01-01

    The mechanism of suberoylanilide hydroxamic acid in cell growth inhibition involved induction of pRb-2/p130 interaction and nuclear translocation with E2F-4, followed by significant repression in E2F-1 and PCNA nuclear levels, which led to inhibition in DNA synthesis in mammary epithelial cell lines. PMID:11250759

  16. ACID RAIN AND SOIL MICROBIAL ACTIVITY: EFFECTS AND THEIR MECHANISMS

    EPA Science Inventory

    In the investigation, our aim was to determine if acid rain affects soil microbial activity and to identify possible mechanisms of observed effects. A Sierran forest soil (pH 6.4) planted with Ponderosa pine seedlings was exposed to simulated rain (pH 2.0, 3.0, 4.0 and 5.6) with ...

  17. Mechanisms of Metal Resistance and Homeostasis in Haloarchaea

    PubMed Central

    Srivastava, Pallavee; Kowshik, Meenal

    2013-01-01

    Haloarchaea are the predominant microflora of hypersaline econiches such as solar salterns, soda lakes, and estuaries where the salinity ranges from 35 to 400 ppt. Econiches like estuaries and solar crystallizer ponds may contain high concentrations of metals since they serve as ecological sinks for metal pollution and also as effective traps for river borne metals. The availability of metals in these econiches is determined by the type of metal complexes formed and the solubility of the metal species at such high salinity. Haloarchaea have developed specialized mechanisms for the uptake of metals required for various key physiological processes and are not readily available at high salinity, beside evolving resistance mechanisms for metals with high solubility. The present paper seeks to give an overview of the main molecular mechanisms involved in metal tolerance in haloarchaea and focuses on factors such as salinity and metal speciation that affect the bioavailability of metals to haloarchaea. Global transcriptomic analysis during metal stress in these organisms will help in determining the various factors differentially regulated and essential for metal physiology. PMID:23533331

  18. Mechanisms of metal resistance and homeostasis in haloarchaea.

    PubMed

    Srivastava, Pallavee; Kowshik, Meenal

    2013-01-01

    Haloarchaea are the predominant microflora of hypersaline econiches such as solar salterns, soda lakes, and estuaries where the salinity ranges from 35 to 400 ppt. Econiches like estuaries and solar crystallizer ponds may contain high concentrations of metals since they serve as ecological sinks for metal pollution and also as effective traps for river borne metals. The availability of metals in these econiches is determined by the type of metal complexes formed and the solubility of the metal species at such high salinity. Haloarchaea have developed specialized mechanisms for the uptake of metals required for various key physiological processes and are not readily available at high salinity, beside evolving resistance mechanisms for metals with high solubility. The present paper seeks to give an overview of the main molecular mechanisms involved in metal tolerance in haloarchaea and focuses on factors such as salinity and metal speciation that affect the bioavailability of metals to haloarchaea. Global transcriptomic analysis during metal stress in these organisms will help in determining the various factors differentially regulated and essential for metal physiology. PMID:23533331

  19. Nutrient enrichment affects the mechanical resistance of aquatic plants.

    PubMed

    Lamberti-Raverot, Barbara; Puijalon, Sara

    2012-10-01

    For many plant species, nutrient availability induces important anatomical responses, particularly the production of low-density tissues to the detriment of supporting tissues. Due to the contrasting biomechanical properties of plant tissues, these anatomical responses may induce important modifications in the biomechanical properties of plant organs. The aim of this study was to determine the effects of nutrient enrichment on the anatomical traits of two freshwater plant species and its consequences on plant biomechanical performance. Two plant species were grown under controlled conditions in low versus high nutrient levels. The anatomical and biomechanical traits of the plant stems were measured. Both species produced tissues with lower densities under nutrient-rich conditions, accompanied by modifications in the structure of the aerenchyma for one species. As expected, nutrient enrichment also led to important modifications in the biomechanical properties of the stem for both species. In particular, mechanical resistance (breaking force and strength) and stiffness of stems were significantly reduced under nutrient rich conditions. The production of weaker stem tissues as a result of nutrient enrichment may increase the risk of plants to mechanical failure, thus challenging plant maintenance in mechanically stressful or disturbed habitats. PMID:23028018

  20. Salicylic acid confers enhanced resistance to Glomerella leaf spot in apple.

    PubMed

    Zhang, Ying; Shi, Xiangpeng; Li, Baohua; Zhang, Qingming; Liang, Wenxing; Wang, Caixia

    2016-09-01

    Glomerella leaf spot (GLS) caused by Glomerella cingulata is a newly emergent disease that results in severe defoliation and fruit spots in apple. Currently, there are no effective means to control this disease except for the traditional fungicide sprays. Induced resistance by elicitors against pathogens infection is a widely accepted eco-friendly strategy. In the present study, we investigated whether exogenous application of salicylic acid (SA) could improve resistance to GLS in a highly susceptible apple cultivar (Malus domestica Borkh. cv. 'Gala') and the underlying mechanisms. The results showed that pretreatment with SA, at 0.1-1.0 mM, induced strong resistance against GLS in 'Gala' apple leaves, with SA treated leaves showing significant reduction in lesion numbers and disease index. Concurrent with the enhanced disease resistance, SA treatment markedly increased the total antioxidant capacity (T-AOC) and defence-related enzyme activities, including catalase (CAT), superoxide dismutase (SOD), peroxidase (POD), phenylalanine ammonia-lyase (PAL) and polyphenol oxidase (PPO). As expected, SA treatment also induced the expression levels of five pathogenesis-related (PR) genes including PR1, PR5, PR8, Chitinase and β-1,3-glucanase. Furthermore, the most pronounced and/or rapid increase was observed in leaves treated with SA and subsequently inoculated with G. cingulata compared to the treatment with SA or inoculation with the pathogen. Together, these results suggest that exogenous SA triggered increase in reactive oxygen species levels and the antioxidant system might be responsible for enhanced resistance against G. cingulata in 'Gala' apple leaves. PMID:27139585

  1. Mycobacterium tuberculosis gene Rv2136c is dispensable for acid resistance and virulence in mice

    PubMed Central

    Darby, Crystal M.; Venugopal, Aditya; Ehrt, Sabine; Nathan, Carl F.

    2011-01-01

    Summary The gene Rv2136c is annotated to encode the Mycobacterium tuberculosis (Mtb) homologue of Escherichia coli’s undecaprenyl pyrophosphate phosphatase. In previous work, a genetic screen of 10,100 Mtb transposon mutants identified Rv2136c as being involved in acid resistance in Mtb. The Rv2136c:Tn strain was also sensitive to sodium dodecyl sulfate, lipophilic antibiotics, elevated temperature and reactive oxygen and nitrogen intermediates and was attenuated for growth and persistence in mice. However, none of these phenotypes could be genetically complemented, leading us to generate an Rv2136c knockout strain to test its role in Mtb pathogenicity. Genetic deletion revealed that Rv2136c is not responsible for any of the phenotypes observed in the transposon mutant strain. An independent genomic mutation is likely to have accounted for the extreme attenuation of this strain. Identification of the mutated gene will further our understanding of acid resistance mechanisms in Mtb and may offer a target for anti-tuberculosis chemotherapy. PMID:21778115

  2. Mechanism of Trypanosoma brucei gambiense resistance to human serum.

    PubMed

    Uzureau, Pierrick; Uzureau, Sophie; Lecordier, Laurence; Fontaine, Frédéric; Tebabi, Patricia; Homblé, Fabrice; Grélard, Axelle; Zhendre, Vanessa; Nolan, Derek P; Lins, Laurence; Crowet, Jean-Marc; Pays, Annette; Felu, Cécile; Poelvoorde, Philippe; Vanhollebeke, Benoit; Moestrup, Soren K; Lyngsø, Jeppe; Pedersen, Jan Skov; Mottram, Jeremy C; Dufourc, Erick J; Pérez-Morga, David; Pays, Etienne

    2013-09-19

    The African parasite Trypanosoma brucei gambiense accounts for 97% of human sleeping sickness cases. T. b. gambiense resists the specific human innate immunity acting against several other tsetse-fly-transmitted trypanosome species such as T. b. brucei, the causative agent of nagana disease in cattle. Human immunity to some African trypanosomes is due to two serum complexes designated trypanolytic factors (TLF-1 and -2), which both contain haptoglobin-related protein (HPR) and apolipoprotein LI (APOL1). Whereas HPR association with haemoglobin (Hb) allows TLF-1 binding and uptake via the trypanosome receptor TbHpHbR (ref. 5), TLF-2 enters trypanosomes independently of TbHpHbR (refs 4, 5). APOL1 kills trypanosomes after insertion into endosomal/lysosomal membranes. Here we report that T. b. gambiense resists TLFs via a hydrophobic β-sheet of the T. b. gambiense-specific glycoprotein (TgsGP), which prevents APOL1 toxicity and induces stiffening of membranes upon interaction with lipids. Two additional features contribute to resistance to TLFs: reduction of sensitivity to APOL1 requiring cysteine protease activity, and TbHpHbR inactivation due to a L210S substitution. According to such a multifactorial defence mechanism, transgenic expression of T. b. brucei TbHpHbR in T. b. gambiense did not cause parasite lysis in normal human serum. However, these transgenic parasites were killed in hypohaptoglobinaemic serum, after high TLF-1 uptake in the absence of haptoglobin (Hp) that competes for Hb and receptor binding. TbHpHbR inactivation preventing high APOL1 loading in hypohaptoglobinaemic serum may have evolved because of the overlapping endemic area of T. b. gambiense infection and malaria, the main cause of haemolysis-induced hypohaptoglobinaemia in western and central Africa. PMID:23965626

  3. Resistance Mechanisms and Molecular Docking Studies of Four Novel QoI Fungicides in Peronophythora litchii.

    PubMed

    Zhou, Yuxin; Chen, Lei; Hu, Jian; Duan, Hongxia; Lin, Dong; Liu, Pengfei; Meng, Qingxiao; Li, Bin; Si, Naiguo; Liu, Changling; Liu, Xili

    2015-01-01

    Peronophythora litchii is the causal agent of litchi downy blight. Enestroburin, SYP-1620, SYP-2815 and ZJ0712 are four novel QoI fungicides developed by China. Eight mutants of P. litchii resistant to these QoI fungicides and azoxystrobin (as a known QoI fungicide) were obtained in our preliminary work. In this study, the full length of the cytochrome b gene in P. litchii, which has a full length of 382 amino acids, was cloned from both sensitive isolates and resistant mutants, and single-site mutations G142A, G142S, Y131C, or F128S were found in resistant mutants. Molecular docking was used to predict how the mutations alter the binding of the five QoI fungicides to the Qo-binding pockets. The results have increased our understanding of QoI fungicide-resistance mechanisms and may help in the development of more potent inhibitors against plant diseases in the fields. PMID:26657349

  4. Resistance Mechanisms and Molecular Docking Studies of Four Novel QoI Fungicides in Peronophythora litchii

    PubMed Central

    Zhou, Yuxin; Chen, Lei; Hu, Jian; Duan, Hongxia; Lin, Dong; Liu, Pengfei; Meng, Qingxiao; Li, Bin; Si, Naiguo; Liu, Changling; Liu, Xili

    2015-01-01

    Peronophythora litchii is the causal agent of litchi downy blight. Enestroburin, SYP-1620, SYP-2815 and ZJ0712 are four novel QoI fungicides developed by China. Eight mutants of P. litchii resistant to these QoI fungicides and azoxystrobin (as a known QoI fungicide) were obtained in our preliminary work. In this study, the full length of the cytochrome b gene in P. litchii, which has a full length of 382 amino acids, was cloned from both sensitive isolates and resistant mutants, and single-site mutations G142A, G142S, Y131C, or F128S were found in resistant mutants. Molecular docking was used to predict how the mutations alter the binding of the five QoI fungicides to the Qo-binding pockets. The results have increased our understanding of QoI fungicide-resistance mechanisms and may help in the development of more potent inhibitors against plant diseases in the fields. PMID:26657349

  5. Mutational and acquired carbapenem resistance mechanisms in multidrug resistant Pseudomonas aeruginosa clinical isolates from Recife, Brazil

    PubMed Central

    Cavalcanti, Felipe Lira de Sá; Mirones, Cristina Rodríguez; Paucar, Elena Román; Montes, Laura Álvarez; Leal-Balbino, Tereza Cristina; de Morais, Marcia Maria Camargo; Martínez-Martínez, Luis; Ocampo-Sosa, Alain Antonio

    2015-01-01

    An investigation was carried out into the genetic mechanisms responsible for multidrug resistance in nine carbapenem-resistant Pseudomonas aeruginosaisolates from different hospitals in Recife, Brazil. Susceptibility to antimicrobial agents was determined by broth microdilution. Polymerase chain reaction (PCR) was employed to detect the presence of genes encoding β-lactamases, aminoglycoside-modifying enzymes (AMEs), 16S rRNA methylases, integron-related genes and OprD. Expression of genes coding for efflux pumps and AmpC cephalosporinase were assessed by quantitative PCR. The outer membrane proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The blaSPM-1, blaKPC-2 and blaGES-1 genes were detected in P. aeruginosaisolates in addition to different AME genes. The loss of OprD in nine isolates was mainly due to frameshift mutations, premature stop codons and point mutations. An association of loss of OprD with the overexpression of MexAB-OprM and MexXY-OprM was observed in most isolates. Hyper-production of AmpC was also observed in three isolates. Clonal relationship of the isolates was determined by repetitive element palindromic-PCR and multilocus sequence typing. Our results show that the loss of OprD along with overexpression of efflux pumps and β-lactamase production were responsible for the multidrug resistance in the isolates analysed. PMID:26676375

  6. Study of the mechanisms of acid rain formation

    SciTech Connect

    Parungo, F.; Nagamoto, C.; Madel, R.

    1987-11-01

    Samples of rain, snow, cloud water, aerosols and soil were collected in Colorado to study the mechanisms of acid rain formation. Chemical compositions of various types of samples were analyzed to investigate the stepwise incorporation of inpurities into precipitation. Local soil was generally alkaline; atmospheric aerosols, which are mixtures of stirred-up soil particles and anthropogenic pollution, were slightly acidic; cloud condensation nuclei, which initiate clouds at condensation level, had an average pH of approx.6. However, local clouds were very acidic (pH approx.4), indicating that further acidification takes place in clouds by adsorption of acidic gases, e.g., CO/sub 2/, SO/sub 2/, and NO/sub x/. We found that summer showers formed by coalescence of cloud droplets are likely to be as acidic as cloud water. The chemistry of snow may differ from that of clouds, depending on the mechanisms of snow formation. If snow crystals are initiated by deposition nucleation and grown by diffusion of water vapor from surrounding evaporating cloud droplets as in the Bergeron--Findeisen process, the snow crystals are purified and should not be acidic. If the snow crystals are initiated by freezing of cloud droplets and grow by vapor diffusion, then the constituents of cloud water are diluted and the snow is less acidic than cloud water. If snow grains (graupel) are formed by accretion of frozen cloud drops or by riming, the snow can be as acidic as cloud water. Raindrops formed by melting snow inherit the chemistry of the parent snow, but differentiate in scavenging coefficiencies of gases and aerosols below the clouds. Both atmospheric chemical reactions and cloud microphysical processes are responsible for chemical variations in precipitation.

  7. Mechanisms of azole resistance in Candida albicans clinical isolates from Shanghai, China.

    PubMed

    Liu, Jin-Yan; Shi, Ce; Wang, Ying; Li, Wen-Jing; Zhao, Yue; Xiang, Ming-Jie

    2015-04-01

    This study was undertaken to characterize the mechanism(s) of azole resistance in clinical isolates of Candida albicans collected in Shanghai, China, focusing on the role of efflux pumps, target enzymes of fluconazole (Erg11), respiratory status and the ergosterol biosynthetic pathway. Clinical isolates of C. albicans (n = 30) were collected from 30 different non-HIV-infected patients in four hospitals in Shanghai. All 30 C. albicans isolates were susceptible to amphotericin B and 5-fluorocytosine. Twelve C. albicans isolates showed resistance to at least one type of triazole antifungal. Flow cytometry analysis of rhodamine 6G efflux showed that azole-resistant isolates had greater efflux pump activity, which was consistent with elevated levels of CDR1 and CDR2 genes that code for ABC efflux pumps. However, we did not observe increased expression of ERG11 and MDR1 or respiratory deficiency. Several mutations of ERG11 and TAC1 genes were detected. The F964Y mutation in the TAC1 gene was identified for the first time. Two main sterols, ergosterol and lanosterol, were identified by GC-MS chromatogram, and no missense mutations were found in ERG3. Furthermore, seven amino acid substitutions in ERG11, A114S, Y132H, Y132F, K143Q, K143R, Y257H and G448E were found, by Type II spectral quantitative analysis, to contribute to low affinity binding between Erg11 and fluconazole. PMID:25748216

  8. Insulin resistance is associated with altered amino acid metabolism and adipose tissue dysfunction in normoglycemic women

    PubMed Central

    Wiklund, Petri; Zhang, Xiaobo; Pekkala, Satu; Autio, Reija; Kong, Lingjia; Yang, Yifan; Keinänen-Kiukaanniemi, Sirkka; Alen, Markku; Cheng, Sulin

    2016-01-01

    Insulin resistance is associated adiposity, but the mechanisms are not fully understood. In this study, we aimed to identify early metabolic alterations associated with insulin resistance in normoglycemic women with varying degree of adiposity. One-hundred and ten young and middle-aged women were divided into low and high IR groups based on their median HOMA-IR (0.9 ± 0.4 vs. 2.8 ± 1.2). Body composition was assessed using DXA, skeletal muscle and liver fat by proton magnetic resonance spectroscopy, serum metabolites by nuclear magnetic resonance spectroscopy and adipose tissue and skeletal muscle gene expression by microarrays. High HOMA-IR subjects had higher serum branched-chain amino acid concentrations (BCAA) (p < 0.05 for both). Gene expression analysis of subcutaneous adipose tissue revealed significant down-regulation of genes related to BCAA catabolism and mitochondrial energy metabolism and up-regulation of several inflammation-related pathways in high HOMA-IR subjects (p < 0.05 for all), but no differentially expressed genes in skeletal muscle were found. In conclusion, in normoglycemic women insulin resistance was associated with increased serum BCAA concentrations, down-regulation of mitochondrial energy metabolism and increased expression of inflammation-related genes in the adipose tissue. PMID:27080554

  9. The Necrotic Signal Induced by Mycophenolic Acid Overcomes Apoptosis-Resistance in Tumor Cells

    PubMed Central

    Dilhuydy, Marie-Sarah; Pinson, Benoît; Mahfouf, Walid; Pasquet, Jean-Max; Mahon, François-Xavier; Pourquier, Philippe; Moreau, Jean-François; Legembre, Patrick

    2009-01-01

    Background The amount of inosine monophosphate dehydrogenase (IMPDH), a pivotal enzyme for the biosynthesis of the guanosine tri-phosphate (GTP), is frequently increased in tumor cells. The anti-viral agent ribavirin and the immunosuppressant mycophenolic acid (MPA) are potent inhibitors of IMPDH. We recently showed that IMPDH inhibition led to a necrotic signal requiring the activation of Cdc42. Methodology/Principal Findings Herein, we strengthened the essential role played by this small GTPase in the necrotic signal by silencing Cdc42 and by the ectopic expression of a constitutive active mutant of Cdc42. Since resistance to apoptosis is an essential step for the tumorigenesis process, we next examined the effect of the MPA–mediated necrotic signal on different tumor cells demonstrating various mechanisms of resistance to apoptosis (Bcl2-, HSP70-, Lyn-, BCR-ABL–overexpressing cells). All tested cells remained sensitive to MPA–mediated necrotic signal. Furthermore, inhibition of IMPDH activity in Chronic Lymphocytic Leukemia cells was significantly more efficient at eliminating malignant cells than apoptotic inducers. Conclusions/Significance These findings indicate that necrosis and apoptosis are split signals that share few if any common hub of signaling. In addition, the necrotic signaling pathway induced by depletion of the cellular amount of GTP/GDP would be of great interest to eliminate apoptotic-resistant tumor cells. PMID:19430526

  10. Significant effect of Ca2+ on improving the heat resistance of lactic acid bacteria.

    PubMed

    Huang, Song; Chen, Xiao Dong

    2013-07-01

    The heat resistance of lactic acid bacteria (LAB) has been extensively investigated due to its highly practical significance. Reconstituted skim milk (RSM) has been found to be one of the most effective protectant wall materials for microencapsulating microorganisms during convective drying, such as spray drying. In addition to proteins and carbohydrate, RSM is rich in calcium. It is not clear which component is critical in the RSM protection mechanism. This study investigated the independent effect of calcium. Ca(2+) was added to lactose solution to examine its influence on the heat resistance of Lactobacillus rhamnosus ZY, Lactobacillus casei Zhang, Lactobacillus plantarum P8 and Streptococcus thermophilus ND03. The results showed that certain Ca(2+) concentrations enhanced the heat resistance of the LAB strains to different extents, that is produced higher survival and shorter regrowth lag times of the bacterial cells. In some cases, the improvements were dramatic. More scientifically insightful and more intensive instrumental study of the Ca(2+) behavior around and in the cells should be carried out in the near future. In the meantime, this work may lead to the development of more cost-effective wall materials with Ca(2+) added as a prime factor. PMID:23617813

  11. Colistin and Fusidic Acid, a Novel Potent Synergistic Combination for Treatment of Multidrug-Resistant Acinetobacter baumannii Infections

    PubMed Central

    Betts, Jonathan W.; Bharathan, Binutha

    2015-01-01

    The spread of multidrug-resistant Acinetobacter baumannii (MDRAB) has led to the renaissance of colistin (COL), often the only agent to which MDRAB remains susceptible. Effective therapy with COL is beset with problems due to unpredictable pharmacokinetics, toxicity, and the rapid selection of resistance. Here, we describe a potent synergistic interaction when COL was combined with fusidic acid (FD) against A. baumannii. Synergy in vitro was assessed against 11 MDRAB isolates using disc diffusion, checkerboard methodology (fractional inhibitory concentration index [FICI] of ≤ 0.5, susceptibility breakpoint index [SBPI] of >2), and time-kill methodology (≥2 log10 CFU/ml reduction). The ability of FD to limit the emergence of COL resistance was assessed in the presence and absence of each drug alone and in combination. Synergy was demonstrated against all strains, with an average FICI and SBPI of 0.064 and 78.85, respectively. In time-kill assays, COL-FD was synergistic and rapidly bactericidal, including against COL-resistant strains. Fusidic acid prevented the emergence of COL resistance, which was readily selected with COL alone. This is the first description of a novel COL-FD regimen for the treatment of MDRAB. The combination was effective at low concentrations, which should be therapeutically achievable while limiting toxicity. Further studies are warranted to determine the mechanism underlying the interaction and the suitability of COL-FD as an unorthodox therapy for the treatment of multidrug-resistant Gram-negative infections. PMID:25987639

  12. Colistin and Fusidic Acid, a Novel Potent Synergistic Combination for Treatment of Multidrug-Resistant Acinetobacter baumannii Infections.

    PubMed

    Phee, Lynette M; Betts, Jonathan W; Bharathan, Binutha; Wareham, David W

    2015-08-01

    The spread of multidrug-resistant Acinetobacter baumannii (MDRAB) has led to the renaissance of colistin (COL), often the only agent to which MDRAB remains susceptible. Effective therapy with COL is beset with problems due to unpredictable pharmacokinetics, toxicity, and the rapid selection of resistance. Here, we describe a potent synergistic interaction when COL was combined with fusidic acid (FD) against A. baumannii. Synergy in vitro was assessed against 11 MDRAB isolates using disc diffusion, checkerboard methodology (fractional inhibitory concentration index [FICI] of ≤ 0.5, susceptibility breakpoint index [SBPI] of >2), and time-kill methodology (≥2 log10 CFU/ml reduction). The ability of FD to limit the emergence of COL resistance was assessed in the presence and absence of each drug alone and in combination. Synergy was demonstrated against all strains, with an average FICI and SBPI of 0.064 and 78.85, respectively. In time-kill assays, COL-FD was synergistic and rapidly bactericidal, including against COL-resistant strains. Fusidic acid prevented the emergence of COL resistance, which was readily selected with COL alone. This is the first description of a novel COL-FD regimen for the treatment of MDRAB. The combination was effective at low concentrations, which should be therapeutically achievable while limiting toxicity. Further studies are warranted to determine the mechanism underlying the interaction and the suitability of COL-FD as an unorthodox therapy for the treatment of multidrug-resistant Gram-negative infections. PMID:25987639

  13. Mechanisms of insulin resistance in the amygdala: influences on food intake.

    PubMed

    Areias, Maria Fernanda Condes; Prada, Patricia Oliveira

    2015-04-01

    Obesity is increasing worldwide and is triggered, at least in part, by enhanced caloric intake. Food intake is regulated by a complex mechanism involving the hypothalamus and hindbrain circuitries. However, evidences have showing that reward systems are also important in regulating feeding behavior. In this context, amygdala is considered a key extra-hypothalamic area regulating feeding behavior in human beings and rodents. This review focuses on the regulation of food intake by amygdala and the mechanisms of insulin resistance in this brain area. Similar to the hypothalamus the anorexigenic effect of insulin is mediated via PI3K (phosphoinositide 3-kinase)/Akt (protein kinase B) pathway in the amygdala. Insulin decreases NPY (neuropeptide Y) and increases oxytocin mRNA levels in the amygdala. High fat diet and saturated fatty acids induce inflammation, ER (endoplasmic reticulum) stress and the activation of serine kinases such as PKCθ (protein kinase C theta), JNK (c-Jun N-terminal kinase) and IKKβ (inhibitor of nuclear factor kappa-B kinase beta) in the amygdala, which have an important role in insulin resistance in this brain region. Overexpressed PKCθ in the CeA (central nucleus of amygdala) of rats increases weight gain, food intake, insulin resistance and hepatic triglycerides content. The inhibition of ER stress ameliorates insulin action/signaling, increases oxytocin and decreases NPY gene expression in the amygdala of high fat feeding rodents. Those data suggest that PKCθ and ER stress are main mechanisms of insulin resistance in the amygdala of obese rats and play an important role regulating feeding behavior. PMID:25601576

  14. Acid ceramidase in prostate cancer radiation therapy resistance and relapse

    NASA Astrophysics Data System (ADS)

    Cheng, Joseph C.

    Prostate tumor cell escape from ionizing radiation (IR)-induced killing can lead to disease progression and relapse. Sphingolipids such as ceramide and sphingosine 1-phosphate influence signal transduction pathways that regulate stress response in cancer cells. In particular, metabolism of apoptotic ceramide constitutes an important survival adaptation. Assessments of enzyme activity, mRNA, and protein demonstrated preferential upregulation of the ceramide deacylating enzyme acid ceramidase (AC) in irradiated cancer cells. Promoter-reporter and ChIP-qPCR assays revealed AC transcription by activator protein 1 (AP-1) is sensitive to pharmacological inhibition of de novo ceramide biosynthesis, identifying a protective feedback mechanism that mitigates the effects of IR-induced ceramide. Deregulation of c-Jun, in particular, induced marked radiosensitization in vitro and in vivo, which was rescued by ectopic AC over-expression. AC over-expression in prostate cancer clonogens surviving 80 Gray fractionated irradiation was associated with increased radioresistance and proliferation, suggesting a role in radiotherapy failure and relapse. Indeed, immunohistochemical analysis of human prostate cancer tissues revealed higher levels of AC after radiotherapy failure than therapy-naive adenocarcinoma, PIN, or benign tissues. By genetically downregulating AC with small interfering RNA (siRNA), we observed radiosensitization of cells using clonogenic and cytotoxicity assays. Finally, treatment with lysosomotropic small molecule inhibitors of AC, LCL385 or LCL521, induced prostate cancer xenograft radiosensitization and long-term suppression, suggesting AC is a tractable target for adjuvant radiotherapy.

  15. Diversity of acid stress resistant variants of Listeria monocytogenes and the potential role of ribosomal protein S21 encoded by rpsU

    PubMed Central

    Metselaar, Karin I.; den Besten, Heidy M. W.; Boekhorst, Jos; van Hijum, Sacha A. F. T.; Zwietering, Marcel H.; Abee, Tjakko

    2015-01-01

    The dynamic response of microorganisms to environmental conditions depends on the behavior of individual cells within the population. Adverse environments can select for stable stress resistant subpopulations. In this study, we aimed to get more insight in the diversity within Listeria monocytogenes LO28 populations, and the genetic basis for the increased resistance of stable resistant fractions isolated after acid exposure. Phenotypic cluster analysis of 23 variants resulted in three clusters and four individual variants and revealed multiple-stress resistance, with both unique and overlapping features related to stress resistance, growth, motility, biofilm formation, and virulence indicators. A higher glutamate decarboxylase activity correlated with increased acid resistance. Whole genome sequencing revealed mutations in rpsU, encoding ribosomal protein S21 in the largest phenotypic cluster, while mutations in ctsR, which were previously shown to be responsible for increased resistance of heat and high hydrostatic pressure resistant variants, were not found in the acid resistant variants. This underlined that large population diversity exists within one L. monocytogenes strain and that different adverse conditions drive selection for different variants. The finding that acid stress selects for rpsU variants provides potential insights in the mechanisms underlying population diversity of L. monocytogenes. PMID:26005439

  16. Ribosome clearance by FusB-type proteins mediates resistance to the antibiotic fusidic acid

    PubMed Central

    Cox, Georgina; Thompson, Gary S.; Jenkins, Huw T.; Peske, Frank; Savelsbergh, Andreas; Rodnina, Marina V.; Wintermeyer, Wolfgang; Homans, Steve W.; Edwards, Thomas A.; O'Neill, Alexander J.

    2012-01-01

    Resistance to the antibiotic fusidic acid (FA) in the human pathogen Staphylococcus aureus usually results from expression of FusB-type proteins (FusB or FusC). These proteins bind to elongation factor G (EF-G), the target of FA, and rescue translation from FA-mediated inhibition by an unknown mechanism. Here we show that the FusB family are two-domain metalloproteins, the C-terminal domain of which contains a four-cysteine zinc finger with a unique structural fold. This domain mediates a high-affinity interaction with the C-terminal domains of EF-G. By binding to EF-G on the ribosome, FusB-type proteins promote the dissociation of stalled ribosome⋅EF-G⋅GDP complexes that form in the presence of FA, thereby allowing the ribosomes to resume translation. Ribosome clearance by these proteins represents a highly unusual antibiotic resistance mechanism, which appears to be fine-tuned by the relative abundance of FusB-type protein, ribosomes, and EF-G. PMID:22308410

  17. Ribosome clearance by FusB-type proteins mediates resistance to the antibiotic fusidic acid.

    PubMed

    Cox, Georgina; Thompson, Gary S; Jenkins, Huw T; Peske, Frank; Savelsbergh, Andreas; Rodnina, Marina V; Wintermeyer, Wolfgang; Homans, Steve W; Edwards, Thomas A; O'Neill, Alexander J

    2012-02-01

    Resistance to the antibiotic fusidic acid (FA) in the human pathogen Staphylococcus aureus usually results from expression of FusB-type proteins (FusB or FusC). These proteins bind to elongation factor G (EF-G), the target of FA, and rescue translation from FA-mediated inhibition by an unknown mechanism. Here we show that the FusB family are two-domain metalloproteins, the C-terminal domain of which contains a four-cysteine zinc finger with a unique structural fold. This domain mediates a high-affinity interaction with the C-terminal domains of EF-G. By binding to EF-G on the ribosome, FusB-type proteins promote the dissociation of stalled ribosome⋅EF-G⋅GDP complexes that form in the presence of FA, thereby allowing the ribosomes to resume translation. Ribosome clearance by these proteins represents a highly unusual antibiotic resistance mechanism, which appears to be fine-tuned by the relative abundance of FusB-type protein, ribosomes, and EF-G. PMID:22308410

  18. Mechanism of resistance to macrolide-lincosamide-streptogramin antibiotics in Streptococcus thermophilus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance to macrolide-lincosamide-streptogramin (MLS) group antibiotics in the dairy bacterium Streptococcus thermophilus (ST) is documented but the mechanism of resistance has not been elucidated. MIC values for erythromycin (Erm), azithromycin (Azm), tylosin (Tyl), spiramycin (Spm), pristinamyci...

  19. Determination, mechanism and monitoring of knockdown resistance in permethrin-resistant human head lice, Pediculus humanus capitis.

    PubMed

    Clark, J Marshall

    2009-03-01

    Permethrin resistance has been reported worldwide and clinical failures to commercial pediculicides containing permethrin have likewise occurred. Permethrin resistance in head lice populations from the U.S. is widespread but is not yet uniform and the level of resistance is relatively low (~4-8 fold). Permethrin-resistant lice are cross-resistant to pyrethrins, PBO-synergized pyrethrins and to DDT. Nix((R)), when applied to human hair tufts following manufacture's instructions, did not provide 100% control when assessed by the hair tuft bioassay in conjunction with the in vitro rearing system. Resistance to permethrin is due to knockdown resistance (kdr), which is the result of three point mutations within the alpha-subunit gene of the voltage-gated sodium channel that causes amino acid substitutions, leading to nerve insensitivity.A three-tiered resistance monitoring system has been established based on molecular resistance detection techniques. Quantitative sequencing (QS) has been developed to predict the kdr allele frequency in head lice at a population level. The speed, simplicity and accuracy of QS made it an ideal candidate for a routine primary resistance monitoring tool to screen a large number of louse populations as an alternative to conventional bioassay. As a secondary monitoring method, real-time PASA (rtPASA) has been devised for a more precise determination of low resistance allele frequencies. To obtain more detailed information on resistance allele zygosity, as well as allele frequency, serial invasive signal amplification reaction (SISAR) has been developed as an individual genotyping method. Our approach of using three tiers of molecular resistance detection should facilitate large-scale routine resistance monitoring of permethrin resistance in head lice using field-collected samples. PMID:20161186

  20. Effect of polyunsaturated fatty acids on drug-sensitive and resistant tumor cells in vitro

    PubMed Central

    2011-01-01

    Previous studies showed that γ-linolenic acid (GLA, 18: 3 ω-6), arachidonic acid (AA, 20:4 ω -6), eicosapentaenoic acid (EPA, 20: 5 ω -3) and docosahexaenoic acid (DHA, 22:6 ω -3) have selective tumoricidal action. In the present study, it was observed that dihomo-gamma-linolenic acid (DGLA) and AA, EPA and DHA have cytotoxic action on both vincristine-sensitive (KB-3-1) and resistant (KB-ChR-8-5) cancer cells in vitro that appeared to be a free-radical dependent process but not due to the formation of prostaglandins, leukotrienes and thromboxanes. Uptake of vincristine and fatty acids was higher while their efflux was lower in KB-3-1 cells compared with KB-ChR-8-5 cells, suggesting that drug resistant cells have an effective efflux pump. GLA, DGLA, AA, EPA and DHA enhanced the uptake and decreased efflux in both drug-sensitive and drug-resistant cells and augmented the susceptibility of tumor cells especially, of drug-resistant cells to the cytotoxic action of vincristine. These results suggest that certain polyunsaturated fatty acids have tumoricidal action and are capable of enhancing the cytotoxic action of anti-cancer drugs specifically, on drug-resistant cells by enhancing drug uptake and reducing its efflux. Thus, polyunsaturated fatty acids either by themselves or in combination with chemotherapeutic drugs have the potential as anti-cancer molecules. PMID:21917129

  1. The tokamak density limit: A thermo-resistive disruption mechanism

    NASA Astrophysics Data System (ADS)

    Gates, David

    2015-11-01

    A magnetic island growth mechanism based on radiative cooling of the internal island flux surfaces is shown to produce the correct physical scaling to explain one of the long standing mysteries of tokamak physics - the empirical Greenwald density limit. In this presentation we will review the phenomenology of the density limit and the correlation between the Greenwald limit and the onset threshold for radiation-driven tearing modes. The behavior of magnetic islands with a 3D electron temperature distribution which is consistent with a large ratio of radial to parallel heat conductivity - and a corresponding 3D resistivity profile - is examined for islands with near-zero net heating in the island interior. The effect of varying impurity mix on the local island onset threshold is consistent with the established experimental scalings for tokamaks at the density limit. A simple analytic theory is developed which reveals the effect of heating and cooling in the island interior as well as the effect of island asymmetry. It is shown that a new term accounting for the thermal effects of island asymmetry is a crucial addition to the Modified Rutherford Equation. The resultant model exhibits a robust onset of a rapidly growing tearing mode - consistent with the disruption mechanism observed at the density limit in tokamaks. Additionally, a fully non-linear 3D cylindrical calculation is performed that simulates the effect of net island heating / cooling by raising / suppressing the temperature in the core of the island. In both the analytic theory and the numerical simulation a sudden threshold for explosive growth is found to be due to the interaction between three distinct thermal non-linearities, which affect the island resistivity, thereby modifying the growth dynamics. Expanding on the model presented, we speculate that the mechanism described may be applicable to a much wider range of tokamak disruptions than just those near the Greenwald limit. This work is supported

  2. Gas Cluster Ion Beam Etching under Acetic Acid Vapor for Etch-Resistant Material

    NASA Astrophysics Data System (ADS)

    Yamaguchi, Akira; Hinoura, Ryo; Toyoda, Noriaki; Hara, Ken-ichi; Yamada, Isao

    2013-05-01

    Gas cluster ion beam (GCIB) etching of etch-resistant materials under acetic acid vapor was studied for development of new manufacturing process of future nonvolatile memory. Etching depths of various etch-resistant materials (Pt, Ru, Ta, CoFe) with acetic acid vapor during O2-GCIB irradiations were 1.8-10.7 times higher than those without acetic acid. Also, etching depths of Ru, Ta, CoFe by Ar-GCIB with acetic acid vapor were 2.2-16.1 times higher than those without acetic acid. Even after etching of Pt, smoothing of Pt was realized using O2-GCIB under acetic acid. From XPS and angular distribution of sputtered Pt, it was shown that PtOx layer was formed on Pt after O2-GCIB irradiation. PtOx reacted with acetic acid by GCIB bombardments; as a result, increase of etching depth was observed.

  3. Mechanisms underlying obesity resistance associated with high spontaneous physical activity

    PubMed Central

    Teske, Jennifer A.; Billington, Charles J.; Kotz, Catherine M.

    2013-01-01

    Obesity resistance due to elevated orexin signaling is accompanied by high levels of spontaneous physical activity (SPA). The behavioral and neural mechanisms underlying this observation have not been fully worked out. We determined the contribution of hypothalamic orexin receptors (OXR) to SPA stimulated by orexin A (OXA), whether OXA-stimulated SPA was secondary to arousal and whether voluntary wheel running led to compensations in 24-h SPA. We further tested whether orexin action on dopamine one receptors (DA1R) in the substantia nigra (SN) plays an important role in generation of SPA. To test this, SPA response was determined in lean and obese rats with cannulae targeted towards the rostral lateral hypothalamus (rLH) or SN. Sleep/wake states were also measured in rats with rLH cannula and EEG/EMG radiotelemetry transmitters. SPA in lean rats was more sensitive to antagonism of the orexin 1 receptor (OX1R) and in the early response to the orexin 2 agonist. OXA increased arousal equally in lean and obese rodents, which is discordant from the greater SPA response in lean rats. Obesity resistant rats ran more and wheel running was directly related to 24-h SPA levels. The OX1R antagonist, SB-334867-A, and the DA1R antagonist, SCH3390, in SN more effectively reduced SPA stimulated by OXA in OR rats. These data suggest OXA-stimulated SPA is not secondary to enhanced arousal, propensity for SPA parallels inclination to run and that orexin action on dopaminergic neurons in SN may participate in mediation of SPA and running wheel activity. PMID:24161277

  4. Response to oxalic acid as a resistance assay for Sclerotinia minor in peanut

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Response to oxalic acid was evaluated as a potential assay for screening peanut breeding lines for resistance to Sclerotinia blight caused by Sclerotinia minor. Detached stems of seven Spanish- and six runner-type peanut cultivars and advanced breeding lines, varying in resistance to Sclerotinia bl...

  5. ENHANCED DISEASE SUSCEPTIBILITY 1 and SALICYLIC ACID act redundantly to regulate resistance gene-mediated signaling

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Resistance (R) protein–associated pathways are well known to participate in defense against a variety of microbial pathogens. Salicylic acid (SA) and its associated proteinaceous signaling components, including enhanced disease susceptibility 1 (EDS1), non–race-specific disease resistance 1 (NDR1), ...

  6. SALICYLIC ACID- AND NITRIC OXIDE-MEDIATED SIGNAL TRANSDUCTION IN DISEASE RESISTANCE

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Current advances in plant defense signaling is discussed, with emphasis on the role of nitric oxide and salicylic acid in the development of disease resistance. Nitric Oxide has recently been shown to have an important role in plant disease resistance. We show an increase in NOS-like activity in TMV...

  7. Photodegradation and inhibition of drug-resistant influenza virus neuraminidase using anthraquinone-sialic acid hybrids.

    PubMed

    Aoki, Yusuke; Tanimoto, Shuho; Takahashi, Daisuke; Toshima, Kazunobu

    2013-02-11

    The anthraquinone-sialic acid hybrids designed effectively degraded not only non-drug-resistant neuraminidase but also drug-resistant neuraminidase, which is an important target of anti-influenza therapy. Degradation was achieved using long-wavelength UV radiation in the absence of any additives and under neutral conditions. Moreover, the hybrids efficiently inhibited neuraminidase activities upon photo-irradiation. PMID:23282898

  8. Clinical epidemiology and resistance mechanisms of carbapenem-resistant Acinetobacter baumannii, French Guiana, 2008-2014.

    PubMed

    Mahamat, Aba; Bertrand, Xavier; Moreau, Brigitte; Hommel, Didier; Couppie, Pierre; Simonnet, Christine; Kallel, Hatem; Demar, Magalie; Djossou, Felix; Nacher, Mathieu

    2016-07-01

    This study investigated the clinical epidemiology and resistance mechanisms of Acinetobacter baumannii and characterised the clonal diversity of carbapenem-resistant A. baumannii (CRAB) during an ICU-associated outbreak at Cayenne Hospital, French Guiana. All non-duplicate A. baumannii isolates from 2008 to 2014 were tested for antibiotic susceptibility by disk diffusion. Multilocus sequence typing, pulsed-field gel electrophoresis (PFGE) and characterisation of carbapenemase-encoding genes were performed on CRAB. Of the 441 A. baumannii isolates, most were from males (54.0%) and were detected mainly from the ICU (30.8%) and medicine wards (21.8%). In the ICU, strains were mainly isolated from the respiratory tract (44.1%) and bloodstream (14.0%), whereas in medicine wards they mainly were from wound/drainage (36.5%) and bloodstream (25.0%). A. baumannii showed the greatest susceptibility to piperacillin/tazobactam (92.7%), imipenem (92.5%), colistin (95.6%) and amikacin (97.2%), being lower in the ICU and medicine wards compared with other wards. An outbreak of OXA-23-producing CRAB occurred in the 13-bed ICU in 2010. CRAB strains were more co-resistant to other antimicrobials compared with non-CRAB. Molecular genetics analysis revealed five sequence types [ST78, ST107 and ST642 and two new STs (ST830 and ST831)]. Analysis of PFGE profiles indicated cross-transmissions of CRAB within the ICU, between the ICU and one medicine ward during transfer of patients, and within that medicine ward. This study provides the first clinical and molecular data of A. baumannii from French Guiana and the Amazon basin. The ICU was the highest risk unit of this nosocomial outbreak of OXA-23-producing CRAB, which could subsequently disseminate within the hospital. PMID:27236843

  9. Mechanism of Plasmid-Mediated Resistance to Cadmium in Staphylococcus aureus

    PubMed Central

    Chopra, I.

    1975-01-01

    The mechanism of plasmid-mediated resistance to cadmium in Staphylococcus aureus was investigated. Protein synthesis in cell-free extracts from resistant or susceptible bacteria was equally susceptible to inhibition by Cd2+, but spheroplasts from resistant bacteria retained their resistance. Resistant bacteria did not have a decreased affinity for cations in general, nor was active metabolism required for exclusion of Cd2+. The kinetics of Cd2+ uptake into susceptible and resistant bacteria suggested that the conformation of membrane proteins in resistant bacteria may be important in the exclusion of Cd2+. PMID:1137361

  10. Arginine-dependent acid-resistance pathway in Shigella boydii

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ability to survive the low pH of the human stomach is considered be an important virulent determinant. Acid tolerance of Shigella boydii 18 CDPH, the strain implicated in an outbreak may have played an important role in surviving the acidic food (bean salad). The strain was capable of inducing arg...

  11. Selected mechanisms of molecular resistance of Candida albicans to azole drugs.

    PubMed

    Gołąbek, Karolina; Strzelczyk, Joanna Katarzyna; Owczarek, Aleksander; Cuber, Piotr; Ślemp-Migiel, Anna; Wiczkowski, Andrzej

    2015-01-01

    A phenomenon of increasing resistance of Candida spp. to azoles has been observed for several years now. One of the mechanisms of lack of sensitivity to azoles is associated with CDR1, CDR2, MRD1 genes (their products are active transport pumps conditioning drug efflux from pathogen's cell), and ERG11 gene (encoding lanosterol 14α-demethylase). Test material was 120 strains of Candida albicans (60 resistant and 60 susceptible to azole drugs) obtained from clinical samples. The first stage of experiment assessed the expression of CDR1, CDR2, MDR1 and ERG11 genes by Q-PCR. The impact of ERG11 gene's mutations on the expression of this gene was analysed. The final stage of the experiment assessed the level of genome methylation of Candida albicans strains. An increase in the expression of CDR2, MDR1 and ERG11 was observed in azole-resistant strains of Candida albicans in comparison to strains sensitive to this class of drugs. Furthermore, 19 changes in the sequence of ERG11 were detected in tested strains. Four of the discovered mutations: T495A, A530C, G622A and A945C led to the following amino acid substitutions: D116E, K128T, V159I and E266D, respectively. It has also been found that statistically five mutations: T462C, G1309A, C216T, C1257T and A945C affected the expression of ERG11. The applied method of assessing the level of methylation of Candida albicans genome did not confirm its role in the development of resistance to azoles. The results indicate however, that resistance of Candida albicans strains to azole drugs is multifactorial. PMID:25901298

  12. Diets Containing α-Linolenic (ω3) or Oleic (ω9) Fatty Acids Rescues Obese Mice From Insulin Resistance.

    PubMed

    Oliveira, V; Marinho, R; Vitorino, D; Santos, G A; Moraes, J C; Dragano, N; Sartori-Cintra, A; Pereira, L; Catharino, R R; da Silva, A S R; Ropelle, E R; Pauli, J R; De Souza, C T; Velloso, L A; Cintra, D E

    2015-11-01

    Subclinical systemic inflammation is a hallmark of obesity and insulin resistance. The results obtained from a number of experimental studies suggest that targeting different components of the inflammatory machinery may result in the improvement of the metabolic phenotype. Unsaturated fatty acids exert antiinflammatory activity through several distinct mechanisms. Here, we tested the capacity of ω3 and ω9 fatty acids, directly from their food matrix, to exert antiinflammatory activity through the G protein-coupled receptor (GPR)120 and GPR40 pathways. GPR120 was activated in liver, skeletal muscle, and adipose tissues, reverting inflammation and insulin resistance in obese mice. Part of this action was also mediated by GPR40 on muscle, as a novel mechanism described. Pair-feeding and immunoneutralization experiments reinforced the pivotal role of GPR120 as a mediator in the response to the nutrients. The improvement in insulin sensitivity in the high-fat substituted diets was associated with a marked reduction in tissue inflammation, decreased macrophage infiltration, and increased IL-10 levels. Furthermore, improved glucose homeostasis was accompanied by the reduced expression of hepatic gluconeogenic enzymes and reduced body mass. Thus, our data indicate that GPR120 and GPR40 play a critical role as mediators of the beneficial effects of dietary unsaturated fatty acids in the context of obesity-induced insulin resistance. PMID:26280128

  13. Antibiotic resistance and multidrug-resistant efflux pumps expression in lactic acid bacteria isolated from pozol, a nonalcoholic Mayan maize fermented beverage.

    PubMed

    Wacher-Rodarte, Maria Del Carmen; Trejo-Muñúzuri, Tanya Paulina; Montiel-Aguirre, Jesús Fernando; Drago-Serrano, Maria Elisa; Gutiérrez-Lucas, Raúl L; Castañeda-Sánchez, Jorge Ismael; Sainz-Espuñes, Teresita

    2016-05-01

    Pozol is a handcrafted nonalcoholic Mayan beverage produced by the spontaneous fermentation of maize dough by lactic acid bacteria. Lactic acid bacteria (LAB) are carriers of chromosomal encoded multidrug-resistant efflux pumps genes that can be transferred to pathogens and/or confer resistance to compounds released during the fermentation process causing food spoiling. The aim of this study was to evaluate the antibiotic sensibility and the transcriptional expression of ABC-type efflux pumps in LAB isolated from pozol that contributes to multidrug resistance. Analysis of LAB and Staphylococcus (S.) aureus ATCC 29213 and ATCC 6538 control strains to antibiotic susceptibility, minimal inhibitory concentration (MIC), and minimal bactericidal concentration (MBC) to ethidium bromide were based in "standard methods" whereas the ethidium bromide efflux assay was done by fluorometric assay. Transcriptional expression of efflux pumps was analyzed by RT-PCR. LAB showed antibiotic multiresistance profiles, moreover, Lactococcus (L.) lactis and Lactobacillus (L.) plantarum displayed higher ethidium bromide efflux phenotype than S. aureus control strains. Ethidium bromide resistance and ethidium bromide efflux phenotypes were unrelated with the overexpression of lmrD in L. lactics, or the underexpression of lmrA in L. plantarum and norA in S. aureus. These findings suggest that, moreover, the analyzed efflux pumps genes, other unknown redundant mechanisms may underlie the antibiotic resistance and the ethidium bromide efflux phenotype in L. lactis and L. plantarum. Phenotypic and molecular drug multiresistance assessment in LAB may improve a better selection of the fermentation starter cultures used in pozol, and to control the antibiotic resistance widespread and food spoiling for health safety. PMID:27247772

  14. Mechanisms of acid reflux associated with cigarette smoking.

    PubMed Central

    Kahrilas, P J; Gupta, R R

    1990-01-01

    Studies were done to evaluate the lower oesophageal sphincter function of chronic smokers compared with non-smokers and to ascertain the acute effects of smoking on the sphincter and the occurrence of acid reflux. All subjects (non-smokers, asymptomatic cigarette smokers, and smokers with oesophagitis) were studied postprandially with a lower oesophageal sphincter sleeve assembly, distal oesophageal pH electrode, and submental electromyographic electrodes. The two groups of cigarette smokers then smoked three cigarettes in succession before being recorded for an additional hour. As a group, the cigarette smokers had significantly lower lower oesophageal sphincter pressure compared with non-smokers but the sphincter was not further compromised by acutely smoking cigarettes. Cigarette smoking did, however, acutely increase the rate at which acid reflux events occurred. The mechanisms of acid reflux during cigarette smoking were mainly dependent upon the coexistence of diminished lower oesophageal sphincter pressure. Fewer than half of reflux events occurred by transient lower oesophageal sphincter relaxations. The majority of acid reflux occurred with coughing or deep inspiration during which abrupt increases in intra-abdominal pressure overpowered a feeble sphincter. We conclude that cigarette smoking probably exacerbates reflux disease by directly provoking acid reflux and perhaps by a long lasting reduction of lower oesophageal sphincter pressure. PMID:2318431

  15. Mechanism of antiinflammatory actions of curcumine and boswellic acids.

    PubMed

    Ammon, H P; Safayhi, H; Mack, T; Sabieraj, J

    1993-03-01

    Curcumine from Curcuma longa and the gum resin of Boswellia serrata, which were demonstrated to act as anti-inflammatories in in vivo animal models, were studied in a set of in vitro experiments in order to elucidate the mechanism of their beneficial effects. Curcumine inhibited the 5-lipoxygenase activity in rat peritoneal neutrophils as well as the 12-lipoxygenase and the cyclooxygenase activities in human platelets. In a cell free peroxidation system curcumine exerted strong antioxidative activity. Thus, its effects on the dioxygenases are probably due to its reducing capacity. Boswellic acids were isolated from the gum resin of Boswellia serrata and identified as the active principles. Boswellic acids inhibited the leukotriene synthesis via 5-lipoxygenase, but did not affect the 12-lipoxygenase and the cyclooxygenase activities. Additionally, boswellic acids did not impair the peroxidation of arachidonic acid by iron and ascorbate. The data suggest that boswellic acids are specific, non-redox inhibitors of leukotriene synthesis either interacting directly with 5-lipoxygenase or blocking its translocation. PMID:8510458

  16. The rib1 Mutant Is Resistant to Indole-3-Butyric Acid, an Endogenous Auxin in Arabidopsis1

    PubMed Central

    Poupart, Julie; Waddell, Candace S.

    2000-01-01

    The presence of indole-3-butyric acid (IBA) as an endogenous auxin in Arabidopsis has been recently demonstrated. However, the in vivo role of IBA remains to be elucidated. We present the characterization of a semi-dominant mutant that is affected in its response to IBA, but shows a wild-type response to indole-3-acetic acid (IAA), the predominant and most studied form of auxin. We have named this mutant rib1 for resistant to IBA. Root elongation assays show that rib1 is specifically resistant to IBA, to the synthetic auxin 2,4-dichlorophenoxyacetic acid, and to auxin transport inhibitors. rib1 does not display increased resistance to IAA, to the synthetic auxin naphthalene acetic acid, or to other classes of plant hormones. rib1 individuals also have other root specific phenotypes including a shortened primary root, an increased number of lateral roots, and a more variable response than wild type to a change in gravitational vector. Adult rib1 plants are morphologically indistinguishable from wild-type plants. These phenotypes suggest that rib1 alters IBA activity in the root, thereby affecting root development and response to environmental stimuli. We propose models in which RIB1 has a function in either IBA transport or response. Our experiments also suggest that IBA does not use the same mechanism to exit cells as does IAA and we propose a model for IBA transport. PMID:11115890

  17. The Epoxyeicosatrienoic Acid Pathway Enhances Hepatic Insulin Signaling and is Repressed in Insulin-Resistant Mouse Liver.

    PubMed

    Schäfer, Alexander; Neschen, Susanne; Kahle, Melanie; Sarioglu, Hakan; Gaisbauer, Tobias; Imhof, Axel; Adamski, Jerzy; Hauck, Stefanie M; Ueffing, Marius

    2015-10-01

    Although it is widely accepted that ectopic lipid accumulation in the liver is associated with hepatic insulin resistance, the underlying molecular mechanisms have not been well characterized.Here we employed time resolved quantitative proteomic profiling of mice fed a high fat diet to determine which pathways were affected during the transition of the liver to an insulin-resistant state. We identified several metabolic pathways underlying altered protein expression. In order to test the functional impact of a critical subset of these alterations, we focused on the epoxyeicosatrienoic acid (EET) eicosanoid pathway, whose deregulation coincided with the onset of hepatic insulin resistance. These results suggested that EETs may be positive modulators of hepatic insulin signaling. Analyzing EET activity in primary hepatocytes, we found that EETs enhance insulin signaling on the level of Akt. In contrast, EETs did not influence insulin receptor or insulin receptor substrate-1 phosphorylation. This effect was mediated through the eicosanoids, as overexpression of the deregulated enzymes in absence of arachidonic acid had no impact on insulin signaling. The stimulation of insulin signaling by EETs and depression of the pathway in insulin resistant liver suggest a likely role in hepatic insulin resistance. Our findings support therapeutic potential for inhibiting EET degradation. PMID:26070664

  18. Emerging broad-spectrum resistance in Pseudomonas aeruginosa and Acinetobacter baumannii: Mechanisms and epidemiology.

    PubMed

    Potron, Anaïs; Poirel, Laurent; Nordmann, Patrice

    2015-06-01

    Multidrug resistance is quite common among non-fermenting Gram-negative rods, in particular among clinically relevant species including Pseudomonas aeruginosa and Acinetobacter baumannii. These bacterial species, which are mainly nosocomial pathogens, possess a diversity of resistance mechanisms that may lead to multidrug or even pandrug resistance. Extended-spectrum β-lactamases (ESBLs) conferring resistance to broad-spectrum cephalosporins, carbapenemases conferring resistance to carbapenems, and 16S rRNA methylases conferring resistance to all clinically relevant aminoglycosides are the most important causes of concern. Concomitant resistance to fluoroquinolones, polymyxins (colistin) and tigecycline may lead to pandrug resistance. The most important mechanisms of resistance in P. aeruginosa and A. baumannii and their most recent dissemination worldwide are detailed here. PMID:25857949

  19. Role of sialic acid in insulin action and the insulin resistance of diabetes mellitus

    SciTech Connect

    Salhanick, A.I.; Amatruda, J.M. )

    1988-08-01

    Adipocytes treated with neuraminidase show markedly reduced responsiveness to insulin without any alteration in insulin binding. In addition, several studies have separately demonstrated both insulin resistance and decreases in membrane sialic acid content and associated biosynthetic enzymes in diabetes mellitus. In the present study, the authors investigated the role that sialic acid residues may play in insulin action and in the hepatic insulin resistance associated with nonketotic diabetes. Primary cultures of hepatocytes from normal rats treated with neuraminidase demonstrated a dose-dependent decrease in insulin-stimulated lipogenesis. At a concentration of neuraminidase that decreases insulin action by 50%, 23% of total cellular sialic acid content was released. Neuraminidase-releasable sialic acid was significantly decreased in hepatocytes from diabetic rats and this was associated with significant insulin resistance. Treatment of hepatocytes from diabetic rats with cytidine 5{prime}-monophospho-N-acetylneuraminic acid (CMP-NANA) enhanced insulin responsiveness 39%. The enhanced insulin responsiveness induced by CMP-NANA was blocked by cytidine 5{prime}-monophosphate (CMP) suggesting that the CMP-NANA effect was catalyzed by a cell surface sialyl-transferase. CMP reduced neuraminidase-releasable ({sup 14}C)sialic acid incorporation into hepatocytes by 43%. The data demonstrate a role for cell surface sialic acid residues in hepatic insulin action and support a role for decreased cell surface sialic acid residues in the insulin resistance of diabetes mellitus.

  20. PROTEOMIC ANALYSIS OF B-AMINOBUTYRIC ACID-PRIMED DROUGHT RESISTANCE IN CRABAPPLE SEEDLINGS

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In a variety of annual crops and some model plant species, the non-protein, amino acid, DL-B-aminobutyric acid (BABA), has been shown to enhance disease resistance and increase salt and drought tolerance, through sensitization, and not direct induction of defense genes. This process is referred to a...

  1. Characterization of a mitomycin-binding drug resistance mechanism from the producing organism, Streptomyces lavendulae.

    PubMed Central

    Sheldon, P J; Johnson, D A; August, P R; Liu, H W; Sherman, D H

    1997-01-01

    In an effort to characterize the diversity of mechanisms involved in cellular self-protection against the antitumor antibiotic mitomycin C (MC), DNA fragments from the producing organism (Streptomyces lavendulae) were introduced into Streptomyces lividans and transformants were selected for resistance to the drug. Subcloning of a 4.0-kb BclI fragment revealed the presence of an MC resistance determinant, mrd. Nucleotide sequence analysis identified an open reading frame consisting of 130 amino acids with a predicted molecular weight of 14,364. Transcriptional analysis revealed that mrd is expressed constitutively, with increased transcription in the presence of MC. Expression of mrd in Escherichia coli resulted in the synthesis of a soluble protein with an Mr of 14,400 that conferred high-level cellular resistance to MC and a series of structurally related natural products. Purified MRD was shown to function as a drug-binding protein that provides protection against cross-linking of DNA by preventing reductive activation of MC. PMID:9045843

  2. Mechanisms of daptomycin resistance in Staphylococcus aureus: role of the cell membrane and cell wall

    PubMed Central

    Bayer, Arnold S.; Schneider, Tanja; Sahl, Hans-Georg

    2012-01-01

    The bactericidal, cell membrane-targeting lipopeptide antibiotic daptomycin (DAP) is an important agent in treating invasive Staphylococcus aureus infections. However, there have been numerous recent reports of development of daptomycin-resistance (DAP-R) during therapy with this agent. The mechanisms of DAP-R in S. aureus appear to be quite diverse. DAP-R strains often exhibit progressive accumulation of single nucleotide polymorphisms in the multipeptide resistance factor gene (mprF) and the yycFG components of the yycFGHI operon. Both loci are involved in key cell membrane (CM) events, with mprF being responsible for the synthesis and outer CM translocation of the positively-charged phospholipid, lysyl-phosphotidylglycerol (L-PG), while the yyc operon is involved in the generalized response to stressors such as antimicrobials. In addition, other perturbations of the CM have been identified in DAP-R strains including: extremes in CM order; resistance to CM depolarization and permeabilization; and reduced surface binding of DAP. Moreover, modifications of the cell wall (CW) appear to also contribute to DAP-R, including enhanced expression of the dlt operon (involved in D-alanylation of CW teichoic acids) and progressive CW thickening. PMID:23215859

  3. A single amino acid substitution in isozyme GST mu in Triclabendazole resistant Fasciola hepatica (Sligo strain) can substantially influence the manifestation of anthelmintic resistance.

    PubMed

    Fernández, V; Estein, S; Ortiz, P; Luchessi, P; Solana, V; Solana, H

    2015-12-01

    The helminth parasite Fasciola hepatica causes fascioliasis in human and domestic ruminants. Economic losses due to this infection are estimated in U$S 2000-3000 million yearly. The most common method of control is the use of anthelmintic drugs. However, there is an increased concern about the growing appearance of F. hepatica resistance to Triclabendazole (TCBZ), an anthelmintic with activity over adult and young flukes. F. hepatica has eight Glutathione S-Transferase (GST) isozymes, which are enzymes involved in the detoxification of a wide range of substrates through chemical conjugation with glutathione. In the present work we identified and characterized the GST mu gene isolated from the TCBZ-susceptible and TCBZ-resistant F. hepatica strains. Total RNA was transcribed into cDNA by reverse transcription and a 657 bp amplicon corresponding to the GST mu gene was obtained. The comparative genetic analysis of the GST mu gene of the TCBZ susceptible strain (Cullompton) and TCBZ resistant strain (Sligo) showed three nucleotide changes and one amino acid change at position 143 in the GST mu isozyme of the TCBZ-resistant strain. These results have potential relevance as they contribute better understand the mechanisms that generate resistance to anthelmintics. PMID:26542261

  4. Obesity, insulin resistance and comorbidities – Mechanisms of association

    PubMed Central

    Castro, Ana Valeria B.; Kolka, Cathryn M.; Kim, Stella P.; Bergman, Richard N.

    2015-01-01

    Overall excess of fat, usually defined by the body mass index, is associated with metabolic (e.g. glucose intolerance, type 2 diabetes mellitus (T2DM), dyslipidemia) and non-metabolic disorders (e.g. neoplasias, polycystic ovary syndrome, non-alcoholic fat liver disease, glomerulopathy, bone fragility etc.). However, more than its total amount, the distribution of adipose tissue throughout the body is a better predictor of the risk to the development of those disorders. Fat accumulation in the abdominal area and in non-adipose tissue (ectopic fat), for example, is associated with increased risk to develop metabolic and non-metabolic derangements. On the other hand, observations suggest that individuals who present peripheral adiposity, characterized by large hip and thigh circumferences, have better glucose tolerance, reduced incidence of T2DM and of metabolic syndrome. Insulin resistance (IR) is one of the main culprits in the association between obesity, particularly visceral, and metabolic as well as non-metabolic diseases. In this review we will highlight the current pathophysiological and molecular mechanisms possibly involved in the link between increased VAT, ectopic fat, IR and comorbidities. We will also provide some insights in the identification of these abnormalities. PMID:25211442

  5. The role of uric acid in the insulin resistance in children and adolescents with obesity

    PubMed Central

    de Miranda, Josiane Aparecida; Almeida, Guilherme Gomide; Martins, Raissa Isabelle Leão; Cunha, Mariana Botrel; Belo, Vanessa Almeida; dos Santos, José Eduardo Tanus; Mourão-Júnior, Carlos Alberto; Lanna, Carla Márcia Moreira

    2015-01-01

    Objective: To investigate the association between serum uric acid levels and insulin resistance in children and adolescents with obesity. Methods: Cross-sectional study with 245 children and adolescents (134 obese and 111 controls), aged 8-18 years. The anthropometric variables (weight, height and waist circumference), blood pressure and biochemical parameters were collected. The clinical characteristics of the groups were analyzed by t-test or chi-square test. To evaluate the association between uric acid levels and insulin resistance the Pearson's test and logistic regression were applied. Results: The prevalence of insulin resistance was 26.9%. The anthropometric variables, systolic and diastolic blood pressure and biochemical variables were significantly higher in the obese group (p<0.001), except for the high-density-lipoprotein cholesterol. There was a positive and significant correlation between anthropometric variables and uric acid with HOMA-IR in the obese and in the control groups, which was higher in the obese group and in the total sample. The logistic regression model that included age, gender and obesity, showed an odds ratio of uric acid as a variable associated with insulin resistance of 1.91 (95%CI 1.40-2.62; p<−0.001). Conclusions: The increase in serum uric acid showed a positive statistical correlation with insulin resistance and it is associated with and increased risk of insulin resistance in obese children and adolescents. PMID:26300523

  6. Effects of Peracetic Acid on the Corrosion Resistance of Commercially Pure Titanium (grade 4).

    PubMed

    Raimundo, Lariça B; Orsi, Iara A; Kuri, Sebastião E; Rovere, Carlos Alberto D; Busquim, Thaís P; Borie, Eduardo

    2015-01-01

    The aim of this study was to evaluate the corrosion resistance of pure titanium grade 4 (cp-Ti-4), subjected to disinfection with 0.2% and 2% peracetic acid during different immersion periods using anodic potentiodynamic polarization test in acid and neutral artificial saliva. Cylindrical samples of cp-Ti-4 (5 mm x 5 mm) were used to fabricate 24 working electrodes, which were mechanically polished and divided into eight groups (n=3) for disinfection in 2% and 0.2% peracetic acid for 30 and 120 min. After disinfection, anodic polarization was performed in artificial saliva with pH 4.8 and 6.8 to assess the electrochemical behavior of the electrodes. A conventional electrochemical cell, constituting a reference electrode, a platinum counter electrode, and the working electrode (cp-Ti specimens) were used with a scanning rate of 1 mV/s. Three curves were obtained for each working electrode, and corrosion was characterized by using scanning electron microscopy (SEM) and energy dispersive x-ray spectrometry (EDS). Data of corrosion potential (Ecorr) and passive current (Ipass) obtained by the polarization curves were analyzed statistically by Student's t-test (a=0.05). The statistical analysis showed no significant differences (p>0.05) between artificial saliva types at different concentrations and periods of disinfection, as well as between control and experimental groups. No surface changes were observed in all groups evaluated. In conclusion, disinfection with 0.2% and 2% peracetic acid concentrations did not cause corrosion in samples manufactured with cp-Ti-4. PMID:26963213

  7. Theoretical study of the reaction mechanism of phenolic acid decarboxylase.

    PubMed

    Sheng, Xiang; Lind, Maria E S; Himo, Fahmi

    2015-12-01

    The cofactor-free phenolic acid decarboxylases (PADs) catalyze the non-oxidative decarboxylation of phenolic acids to their corresponding p-vinyl derivatives. Phenolic acids are toxic to some organisms, and a number of them have evolved the ability to transform these compounds, including PAD-catalyzed reactions. Since the vinyl derivative products can be used as polymer precursors and are also of interest in the food-processing industry, PADs might have potential applications as biocatalysts. We have investigated the detailed reaction mechanism of PAD from Bacillus subtilis using quantum chemical methodology. A number of different mechanistic scenarios have been considered and evaluated on the basis of their energy profiles. The calculations support a mechanism in which a quinone methide intermediate is formed by protonation of the substrate double bond, followed by C-C bond cleavage. A different substrate orientation in the active site is suggested compared to the literature proposal. This suggestion is analogous to other enzymes with p-hydroxylated aromatic compounds as substrates, such as hydroxycinnamoyl-CoA hydratase-lyase and vanillyl alcohol oxidase. Furthermore, on the basis of the calculations, a different active site residue compared to previous proposals is suggested to act as the general acid in the reaction. The mechanism put forward here is consistent with the available mutagenesis experiments and the calculated energy barrier is in agreement with measured rate constants. The detailed mechanistic understanding developed here might be extended to other members of the family of PAD-type enzymes. It could also be useful to rationalize the recently developed alternative promiscuous reactivities of these enzymes. PMID:26408050

  8. Genetic resistance in experimental autoimmune encephalomyelitis. I. Analysis of the mechanism of LeR resistance using radiation chimeras

    SciTech Connect

    Pelfrey, C.M.; Waxman, F.J.; Whitacre, C.C. )

    1989-09-01

    Experimental autoimmune encephalomyelitis (EAE) is a cell-mediated autoimmune disease of the central nervous system that has been extensively studied in the rat. The Lewis rat is highly susceptible to the induction of EAE, while the Lewis resistant (LeR) rat is known to be resistant. In this paper, we demonstrate that the LeR rat, which was derived from the Lewis strain by inbreeding of fully resistant animals, is histocompatible with the Lewis strain. Radiation chimeras, a tool for distinguishing between immunologic and nonimmunologic resistance mechanisms, were utilized to analyze the cellular mechanisms involved in genetic resistance to EAE. By transplanting bone marrow cells from LeR rats into irradiated Lewis recipients, Lewis rats were rendered resistant to EAE induction. Likewise, transplanting Lewis bone marrow cells into irradiated LeR recipients rendered LeR rats susceptible. Mixed lymphoid cell chimeras using bone marrow, spleen, and thymus cells in Lewis recipient rats revealed individual lymphoid cell types and cell interactions that significantly affected the incidence and severity of EAE. Our results suggest that LeR resistance is mediated by hematopoietic/immune cells, and that cells located in the spleen appear to play a critical role in the resistance/susceptibility to EAE induction. Depletion of splenic adherent cells did not change the patterns of EAE resistance. In vivo cell mixing studies suggested the presence of a suppressor cell population in the LeR spleen preparations which exerted an inhibitory effect on Lewis autoimmune responses. Thus, the mechanism of LeR resistance appears to be different from that in other EAE-resistant animals.

  9. Characterization of Pseudomonas aeruginosa isolates from dogs and cats in Japan: current status of antimicrobial resistance and prevailing resistance mechanisms.

    PubMed

    Harada, Kazuki; Arima, Sayuri; Niina, Ayaka; Kataoka, Yasushi; Takahashi, Toshio

    2012-02-01

    Seventy-three Pseudomonas aeruginosa isolates were collected from dogs and cats in Japan to investigate antimicrobial susceptibility and resistance mechanisms to anti-pseudomonal agents. Resistance rates against orbifloxacin, enrofloxacin, ciprofloxacin, cefotaxime, aztreonam and gentamicin were 34.2, 31.5, 20.5, 17.8, 12.3 and 4.1%, respectively. The degree of resistance to cefotaxime, orbifloxacin, and enrofloxacin was greatly affected by efflux pump inhibitors, indicating overexpression of efflux pump contributes to these resistances. Notably, orbifloxacin and enrofloxacin resistance was observed even in isolates without mutations in the target sites. This is the first report on cephalosporin- and fluoroquinolone-resistant isolates of P. aeruginosa from Japanese companion animals. PMID:22188523

  10. [Mycobacterium tuberculosis mutants with multidrug resistance: history of origin, genetic and molecular mechanisms of resistance, and emerging challenges].

    PubMed

    Prozorov, A A; Zaĭchikova, M V; Danilenko, V N

    2012-01-01

    The review summarizes the data on the Mycobacterium tuberculosis mutations that lead to multidrug resistance (MDR) to various antibiotics. MDR strains arose over the past 30 years as a variety of antituberculosis drugs were introduced in medicine, and they largely discount the results of chemotherapy for tuberculosis. The most dangerous of them are strains with extensive drug resistance (XDR), which are resistant to four or five different drugs on average. The molecular mechanisms that make a strain resistant are considered. XDR and MDR strains result from successive and usually independent resistance mutations, which arise in various regions of the mycobacterial genome. In addition, the formation of resistant strains is affected by the phenomenon of tolerance and mycobacterial latency in infected tissues. PMID:22567849

  11. Antimicrobial Drug Resistance of Salmonella enterica Serovar Typhi in Asia and Molecular Mechanism of Reduced Susceptibility to the Fluoroquinolones▿

    PubMed Central

    Chau, Tran Thuy; Campbell, James Ian; Galindo, Claudia M.; Van Minh Hoang, Nguyen; Diep, To Song; Nga, Tran Thu Thi; Van Vinh Chau, Nguyen; Tuan, Phung Quoc; Page, Anne Laure; Ochiai, R. Leon; Schultsz, Constance; Wain, John; Bhutta, Zulfiqar A.; Parry, Christopher M.; Bhattacharya, Sujit K.; Dutta, Shanta; Agtini, Magdarina; Dong, Baiqing; Honghui, Yang; Anh, Dang Duc; Canh, Do Gia; Naheed, Aliya; Albert, M. John; Phetsouvanh, Rattanaphone; Newton, Paul N.; Basnyat, Buddha; Arjyal, Amit; La, Tran Thi Phi; Rang, Nguyen Ngoc; Phuong, Le Thi; Van Be Bay, Phan; von Seidlein, Lorenz; Dougan, Gordon; Clemens, John D.; Vinh, Ha; Hien, Tran Tinh; Chinh, Nguyen Tran; Acosta, Camilo J.; Farrar, Jeremy; Dolecek, Christiane

    2007-01-01

    This study describes the pattern and extent of drug resistance in 1,774 strains of Salmonella enterica serovar Typhi isolated across Asia between 1993 and 2005 and characterizes the molecular mechanisms underlying the reduced susceptibilities to fluoroquinolones of these strains. For 1,393 serovar Typhi strains collected in southern Vietnam, the proportion of multidrug resistance has remained high since 1993 (50% in 2004) and there was a dramatic increase in nalidixic acid resistance between 1993 (4%) and 2005 (97%). In a cross-sectional sample of 381 serovar Typhi strains from 8 Asian countries, Bangladesh, China, India, Indonesia, Laos, Nepal, Pakistan, and central Vietnam, collected in 2002 to 2004, various rates of multidrug resistance (16 to 37%) and nalidixic acid resistance (5 to 51%) were found. The eight Asian countries involved in this study are home to approximately 80% of the world's typhoid fever cases. These results document the scale of drug resistance across Asia. The Ser83→Phe substitution in GyrA was the predominant alteration in serovar Typhi strains from Vietnam (117/127 isolates; 92.1%). No mutations in gyrB, parC, or parE were detected in 55 of these strains. In vitro time-kill experiments showed a reduction in the efficacy of ofloxacin against strains harboring a single-amino-acid substitution at codon 83 or 87 of GyrA; this effect was more marked against a strain with a double substitution. The 8-methoxy fluoroquinolone gatifloxacin showed rapid killing of serovar Typhi harboring both the single- and double-amino-acid substitutions. PMID:17908946

  12. Understanding the molecular mechanisms of the instability of rice blast resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Race-specific blast resistance is not durable and the molecular mechanisms of the instability of race-specific resistance are unclear. The pathogenicity factor AVR-Pita in Magnaporthe oryzae that determines the efficacy of the resistance gene Pi-ta encodes a predicted metalloprotease. Here we repo...

  13. Negative resists for electron-beam lithography utilizing acid-catalyzed intramolecular dehydration of phenylcarbinol

    NASA Astrophysics Data System (ADS)

    Migitaka, Sonoko; Uchino, Shou-ichi; Ueno, Takumi; Yamamoto, Jiro; Kojima, Kyoko; Hashimoto, Michiaki; Shiraishi, Hiroshi

    1996-06-01

    Acid-catalyzed intramolecular dehydration of phenylcarbinol is used to design highly sensitive negative resists for electron beam lithography. Of the phenylcarbinol resists evaluated in this study, the resist composed of 1,3-bis(alpha-hydroxyisopropyl)benzene (Diol-1), m/p-cresol novolak resin, and diphenyliodonium triflate (DIT) shows the best lithographic performance in terms of sensitivity and resolution. Fine 0.25-micrometer line-and-space patterns were formed by using the resist containing Diol-1 with a dose of 3.6 (mu) C/cm2 in conjunction with a 50 kV electron beam exposure system.

  14. Possible contribution of cell-wall-bound ferulic acid in drought resistance and recovery in triticale seedlings.

    PubMed

    Hura, T; Hura, K; Grzesiak, S

    2009-11-01

    Studies were undertaken to estimate whether the presence of free and cell-wall-bound ferulic acid in leaf tissues can support drought resistance and its recovery under rehydration. An experiment was carried out on two genotypes of winter triticale: Lamberto and Ticino, at the propagation phase. Lamberto exhibited high content of ferulic acid bound with carbohydrates of the cell-wall under drought and rehydration. The markedly better parameters of chlorophyll fluorescence for this variety under both treatments correlated strongly and positively with the high contents of cell-wall-bound ferulic acid. The photosynthetic apparatus of Lamberto, in relation to Ticino, proved to be the more efficient after 4 weeks of drought treatment. The after-effects of soil drought better elicited the function disturbances of the photosynthetic apparatus in Ticino, which did not fully recover in comparison to Lamberto. Ferulic acid covalently bound to carbohydrates of the cell wall may act as a light filter limiting mesophyll penetration under drought conditions and can also support drought adaptation by down-regulation of leaf growth. The observed increase in the content of cell-wall-bound ferulic acid, as a response to water deficit in the leaf, could be one of the protective mechanisms induced by drought conditions. The ability to accumulate phenolic compounds in dehydrated leaves might be an additional and reliable biochemical parameter indicating the resistance of plants to drought stress. PMID:19464752

  15. Mechanisms of group A Streptococcus resistance to reactive oxygen species.

    PubMed

    Henningham, Anna; Döhrmann, Simon; Nizet, Victor; Cole, Jason N

    2015-07-01

    Streptococcus pyogenes, also known as group A Streptococcus (GAS), is an exclusively human Gram-positive bacterial pathogen ranked among the 'top 10' causes of infection-related deaths worldwide. GAS commonly causes benign and self-limiting epithelial infections (pharyngitis and impetigo), and less frequent severe invasive diseases (bacteremia, toxic shock syndrome and necrotizing fasciitis). Annually, GAS causes 700 million infections, including 1.8 million invasive infections with a mortality rate of 25%. In order to establish an infection, GAS must counteract the oxidative stress conditions generated by the release of reactive oxygen species (ROS) at the infection site by host immune cells such as neutrophils and monocytes. ROS are the highly reactive and toxic byproducts of oxygen metabolism, including hydrogen peroxide (H2O2), superoxide anion (O2•(-)), hydroxyl radicals (OH•) and singlet oxygen (O2*), which can damage bacterial nucleic acids, proteins and cell membranes. This review summarizes the enzymatic and regulatory mechanisms utilized by GAS to thwart ROS and survive under conditions of oxidative stress. PMID:25670736

  16. Oxidation-Resistant Coating For Bipolar Lead/Acid Battery

    NASA Technical Reports Server (NTRS)

    Bolstad, James J.

    1993-01-01

    Cathode side of bipolar substrate coated with nonoxidizable conductive layer. Coating prepared as water slurry of aqueous dispersion of polyethylene copolymer plus such conductive fillers as tin oxide, titanium, tantalum, or tungsten oxide. Applied easily to substrate of polyethylene carbon plastic. As slurry dries, conductive, oxidation-resistant coating forms on positive side of substrate.

  17. Effect of folic acid on homocysteine and insulin resistance of overweight and obese children and adolescents

    PubMed Central

    Dehkordi, Elham Hashemi; Sedehi, Morteza; Shahraki, Zohre Gholipour; Najafi, Reza

    2016-01-01

    Background: Considering the increasing trend of childhood obesity and subsequent burden of the disease in Iran and other countries and importance of early life intervention for achieving sustained effect on health of children and adolescents, this study aimed to investigate the effect of two different dose of folic acid on homocysteine (Hcy) level and insulin resistance of obese children. Materials and Methods: In this randomized, double-blind controlled clinical trial study, 60 obese and overweight children aged 5–12 years were enrolled. Selected obese children randomly allocated in two interventional (1 mg/day folic acid and 5 mg/day folic acid, for 8 weeks) and one control groups. Biochemical measurements including folic acid, Hcy, insulin and insulin resistance were measured between and within groups before and after trial. Results: In each group, 20 obese children were studied. The three groups were age and sex matched. After folic acid administration, mean of Hcy, insulin resistance and insulin decreased significantly in two groups which folic acid administrated with two different doses (P < 0.05). The reduction in studied biochemical variables was similar in two interventional groups (1 and 5 mg folic acid daily) (P > 0.05). Mean differences for Hcy, insulin resistance and insulin, in two intervention groups were significantly higher than the control group (P < 0.0001). Mean differences of Hcy, insulin resistance and insulin, in two intervention groups were not different significantly (P > 0.05). Conclusion: The findings of current trial showed that folic acid in two studied doses could be a safe and effective supplement for obese children to reduce Hcy level and insulin resistance, which consequently could prevent obesity-related complications including cardiovascular and metabolic disorders. PMID:27274503

  18. [Investigation on mechanism of pyrite oxidation in acidic solutions].

    PubMed

    Wang, Nan; Yi, Xiao-Yun; Dang, Zhi; Liu, Yun

    2012-11-01

    The mechanism of pyrite oxidation in acidic solutions was investigated by electrochemical analysis methods, such as open-circuit potential, cyclic voltammetry, Tafel polarization curve and anodic polarization curve, using a pyrite-carbon paste electrode as working electrode. The results showed that the oxidation process of pyrite in acidic solutions was via a two-step reaction: the first step was the dissolution of iron moiety and formation of a passivation film composed of elemental sulphur, metal-deficient sulfide and polysulfide; the second step was the further oxidation of these intermediate products to SO4(2-). The final reaction products of pyrite oxidation were Fe3+ and SO4(2-) in acidic solutions. In addition, the open-circuit potential and corrosion potential were positively shifted, the peak current and the corrosion current were increased with the increase in concentration of H2SO4 solutions. This indicated that increased acidity of the system was advantageous to the oxidation of pyrite. PMID:23323425

  19. Resistance training suppresses intra-abdominal fatty acid synthesis in ovariectomized rats.

    PubMed

    Stotzer, U S; Rodrigues, M F C; Domingos, M M; Silva, G H G; Duarte, F O; Gatto, C V G; Duarte, A C G O; Shiguemoto, G E; Perez, S E A; Selistre-de-Araujo, H S

    2015-03-01

    Ovarian hormone loss is associated with a shift in fat distribution to intra-abdomin al adipose tissue (intra-AAT) depots and with lipid metabolism disorders, which predisposes individuals to developing insulin resistance. Resistance training (RT) prevents increases in intra-AAT after ovarian hormone loss. However, the molecular mechanisms underlying these changes remain unclear. We investigated the effects of ovariectomy and RT on gene expression related to lipogenesis and fat oxidation in the intra-AAT of ovariectomized rats. Sprague-Dawley rats (n=6/group) were divided into the groups: sham-sedentary, ovariectomized-sedentary, sham-RT and ovariectomized-RT. RT groups performed a 10-week climbing program on a ladder with progressive overload. Intra-AAT was subjected to morphometric and mRNA analysis. Ovariectomized-sedentary group had larger adipocytes and higher expression of peroxisome proliferator-activated receptor-γ (PPAR-γ), sterol regulatory element-binding protein-1c (SREBP-1c), stearoyl-CoA desaturase-1 (SCD-1), acetyl-CoA carboxylase (ACC), hormone-sensitive lipase (HSL) and lower expression of the oxidative carnitinepalmitoyltransferase-I (CPT-1). RT counteracted OVX-induced increases in PPAR-γ and SCD-1 and decreased SREBP-1c. ACC and HSL were downregulated in ovariectomized-RT compared with the ovariectomized-sedentary group. Ovariectomized-RT group had the highest CPT-1 gene expression. Adipocyte size decreased in ovariectomized-RT group. Results suggest that RT reduces intra-AAT adipocyte size in ovariectomized rats by suppressing intra-AAT fatty acid synthesis and enhancing fatty acid β-oxidation. PMID:25415388

  20. Growth and Survival of Acid-Resistant and Non-Acid-Resistant Shiga-Toxin-Producing Escherichia coli Strains during the Manufacture and Ripening of Camembert Cheese

    PubMed Central

    Montet, M. P.; Jamet, E.; Ganet, S.; Dizin, M.; Miszczycha, S.; Dunière, L.; Thevenot, D.; Vernozy-Rozand, C.

    2009-01-01

    Growth and survival of acid-resistant (AR) and non-acid-resistant (NAR) Shiga-toxin-producing Escherichia coli (STEC) strains were investigated during the manufacture and ripening of microfiltered milk Camembert cheeses. The induction of acid resistance of the STEC strains in cheeses was also studied. Six different mixtures of AR and/or NAR STEC strains were inoculated separately into microfiltered milk at a level of 103 CFU mL−1. The STEC counts (AR and NAR) initially increased by 1 to 2 log10 CFU g−1 during cheese-making. Thereafter, the populations stabilized during salting/drying and then decreased during the early stages of ripening. Exposing the STEC strains in artificially inoculated cheeses to simulated gastric fluid (SGF - pH: 2.0) reduced the number of NAR strains to undetectable levels within 40 minutes, versus 120 minutes for the AR STEC strains. AR and NAR STEC were able to survive during the manufacture and ripening of Camembert cheese prepared from microfiltered milk with no evidence of induced acid tolerance in NAR STEC strains. PMID:20016668

  1. Growth and Survival of Acid-Resistant and Non-Acid-Resistant Shiga-Toxin-Producing Escherichia coli Strains during the Manufacture and Ripening of Camembert Cheese.

    PubMed

    Montet, M P; Jamet, E; Ganet, S; Dizin, M; Miszczycha, S; Dunière, L; Thevenot, D; Vernozy-Rozand, C

    2009-01-01

    Growth and survival of acid-resistant (AR) and non-acid-resistant (NAR) Shiga-toxin-producing Escherichia coli (STEC) strains were investigated during the manufacture and ripening of microfiltered milk Camembert cheeses. The induction of acid resistance of the STEC strains in cheeses was also studied. Six different mixtures of AR and/or NAR STEC strains were inoculated separately into microfiltered milk at a level of 10(3) CFU mL(-1). The STEC counts (AR and NAR) initially increased by 1 to 2 log(10) CFU g(-1) during cheese-making. Thereafter, the populations stabilized during salting/drying and then decreased during the early stages of ripening. Exposing the STEC strains in artificially inoculated cheeses to simulated gastric fluid (SGF - pH: 2.0) reduced the number of NAR strains to undetectable levels within 40 minutes, versus 120 minutes for the AR STEC strains. AR and NAR STEC were able to survive during the manufacture and ripening of Camembert cheese prepared from microfiltered milk with no evidence of induced acid tolerance in NAR STEC strains. PMID:20016668

  2. Retinoid resistance and multifaceted impairment of retinoic acid synthesis in glioblastoma.

    PubMed

    Campos, Benito; Weisang, Sarah; Osswald, Florian; Ali, Ramadan; Sedlmeier, Georg; Bageritz, Josephine; Mallm, Jan-Philipp; Hartmann, Christian; von Deimling, Andreas; Popanda, Odillia; Goidts, Violaine; Plass, Christoph; Unterberg, Andreas; Schmezer, Peter; Burhenne, Jürgen; Herold-Mende, Christel

    2015-10-01

    Measuring concentrations of the differentiation-promoting hormone retinoic acid (RA) in glioblastoma tissues would help to understand the reason why RA treatment has been inefficient in clinical trials involving brain tumor patients. Here, we apply a recently established extraction and measurement protocol to screen glioblastoma tissues for the levels of the RA precursor retinol and biologically active RA. Combining this approach with mRNA analyses of 26 tumors and 8 normal brains, we identify a multifaceted disturbance of RA synthesis in glioblastoma, involving multiple aldehyde dehydrogenase 1 family and retinol dehydrogenase enzymes. Through database studies and methylation analyses, we narrow down chromosomal deletions and aberrant promoter hypermethylation as potential mechanisms accounting for these alterations. Employing chromatin immunoprecipitation analyses and cell-culture studies, we further show that chromatin at RA target genes is poised to RA substitution, but most glioblastoma cell cultures are completely resistant to RA treatment. This paradoxical RA response is unrelated to alternative RA signaling through the fatty acid-binding protein 5/peroxisome proliferator-activated receptor delta axis. Our data suggest a multifaceted disturbance of RA synthesis in glioblastoma and contribute to reconsider current RA treatment strategies. PMID:25944104

  3. Binding Pocket Alterations in Dihydrofolate Synthase Confer Resistance to para-Aminosalicylic Acid in Clinical Isolates of Mycobacterium tuberculosis

    PubMed Central

    Zhao, Fei; Wang, Xu-De; Erber, Luke N.; Luo, Ming; Guo, Ai-zhen; Yang, Shan-shan; Gu, Jing; Turman, Breanna J.; Gao, Yun-rong; Li, Dong-fang; Cui, Zong-qiang; Zhang, Zhi-ping; Bi, Li-jun; Baughn, Anthony D.

    2014-01-01

    The mechanistic basis for the resistance of Mycobacterium tuberculosis to para-aminosalicylic acid (PAS), an important agent in the treatment of multidrug-resistant tuberculosis, has yet to be fully defined. As a substrate analog of the folate precursor para-aminobenzoic acid, PAS is ultimately bioactivated to hydroxy dihydrofolate, which inhibits dihydrofolate reductase and disrupts the operation of folate-dependent metabolic pathways. As a result, the mutation of dihydrofolate synthase, an enzyme needed for the bioactivation of PAS, causes PAS resistance in M. tuberculosis strain H37Rv. Here, we demonstrate that various missense mutations within the coding sequence of the dihydropteroate (H2Pte) binding pocket of dihydrofolate synthase (FolC) confer PAS resistance in laboratory isolates of M. tuberculosis and Mycobacterium bovis. From a panel of 85 multidrug-resistant M. tuberculosis clinical isolates, 5 were found to harbor mutations in the folC gene within the H2Pte binding pocket, resulting in PAS resistance. While these alterations in the H2Pte binding pocket resulted in reduced dihydrofolate synthase activity, they also abolished the bioactivation of hydroxy dihydropteroate to hydroxy dihydrofolate. Consistent with this model for abolished bioactivation, the introduction of a wild-type copy of folC fully restored PAS susceptibility in folC mutant strains. Confirmation of this novel PAS resistance mechanism will be beneficial for the development of molecular method-based diagnostics for M. tuberculosis clinical isolates and for further defining the mode of action of this important tuberculosis drug. PMID:24366731

  4. Characterization of Triclosan-Resistant Mutants Reveals Multiple Antimicrobial Resistance Mechanisms in Rhodospirillum rubrum S1H▿ †

    PubMed Central

    Pycke, Benny F. G.; Crabbé, Aurélie; Verstraete, Willy; Leys, Natalie

    2010-01-01

    Antimicrobial resistance mechanisms were identified in 11 spontaneous high- and low-level triclosan resistance (Tcsr) mutants of Rhodospirillum rubrum S1H by genotyping complemented with transcriptional analyses, antibiotic resistance screening, and membrane permeability analyses. High-end Tcsr (MIC = 8 mg/liter) was the result of a FabI1(G98V) mutation. This point mutation led to an even higher level of Tcsr (MIC ≥ 16 mg/liter) in combination with constitutive upregulation of mexB and mexF efflux pump homologs. Hence, a mechanistic synergy of constitutive efflux pump expression and a FabI1 point mutation could prevent TCS-induced cell permeabilization, which was shown to occur between 4 and 8 mg/liter TCS in the R. rubrum S1H parent strain. Low-level Tcsr mutants constitutively upregulated the emrAB, mexAB, and/or mexF homolog. The mutants that overexpressed emrAB also derepressed the micropollutant-upregulated factors mufA1 and mufM. In some cases, low-level Tcsr decreased innate resistance to ampicillin and tetracycline, while in others, a triclosan-induced antibiotic cross-resistance was shown for chloramphenicol and carbenicillin. This study showed that the TCS resistance degree is dependent of the initial exposure concentration in Rhodospirillum rubrum S1H and that similar resistance degrees can be the result of different defense mechanisms, which all have distinct antibiotic cross-resistance profiles. PMID:20305019

  5. Creatine Loading, Resistance Exercise Performance, and Muscle Mechanics.

    ERIC Educational Resources Information Center

    Stevenson, Scott W.; Dudley, Gary A.

    2001-01-01

    Examined whether creatine (CR) monohydrate loading would alter resistance exercise performance, isometric strength, or in vivo contractile properties of the quadriceps femoris muscle compared with placebo loading in resistance-trained athletes. Overall, CR loading did not provide an ergogenic benefit for the unilateral dynamic knee extension…

  6. Defense mechanisms involved in disease resistance of grafted vegetables

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Vegetable grafting with resistant rootstocks is an effective strategy to control a variety of soil-borne diseases and root-knot nematodes in the Cucurbitaceae and Solanaceae. In addition, improved resistance to some foliar diseases and viruses has also been reported in grafted plants. Hence, graft...

  7. Biochemical and molecular study on insecticide resistance mechanisms

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The following topics will be covered: ' Investigation of Bt resistance in the Indianmeal moth. ' Study on malathion resistance in a parasitic wasp of the rice weevil. ' Cloning and characterization of chitin synthase, laccase, and JH suppressible protein cDNAs. ' Development of PCR technique for det...

  8. Genetic mechanisms of Maize dwarf mosaic virus resistance in maize

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Maize resistance to viruses has been well-characterized at the genetic level, and loci responsible for resistance to potyviruses including Maize dwarf mosaic virus (MDMV), Sugarcane mosaic virus (SCMV), Sorghum mosaic virus (SrMV), and Johnsongrass mosaic virus (JGMV), have been mapped in several ge...

  9. Mechanism Of Resistance Of Evolved Glyphosate-Resistant Palmer Amaranth (Amaranthus Palmeri L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Evolved glyphosate resistance in weedy species represents a challenge for the continued success and utility of glyphosate-resistant crops. The first case of evolved glyphosate resistance in Palmer amaranth was a population from the U.S. state of Georgia, which was previously reported to have amplif...

  10. DFT investigation on the decarboxylation mechanism of ortho hydroxy benzoic acids with acid catalysis.

    PubMed

    Hu, Yanying; Gao, Lu; Dai, Zhoutong; Sun, Guojuan; Zhang, Tongcun; Jia, Shiru; Dai, Yujie; Zhang, Xiuli

    2016-03-01

    A density functional theory (DFT) study was performed to explore the mechanisms of the acid-catalyzed decarboxylation reaction of salicylic acids using the B3LYP method with 6-31++G(d,p) basis set in both gas phase and aqueous environment. The α-protonated cation of carboxylate acid was formed during the decarboxylation process in acidic conditions, and the presence of hydrogen ions promotes decarboxylation greatly by significantly decreasing the overall reaction energy barriers to 20.98 kcal mol(-1) in gas phase and 20.93 kcal mol(-1) in water, respectively. The hydrogen in the α-carbon came directly from the acid rather than from the carboxyl group in neutral state. Compared with the reaction in gas phase, water in aqueous state causes the reaction to occur more easily. Substituents of methyl group, chlorine and fluorine at the ortho-position to the carboxyl of salicylic acid could further lower the decarboxylation energy barriers and facilitate the reaction. PMID:26874949

  11. A brief review on the mechanisms of aspirin resistance.

    PubMed

    Du, Gang; Lin, Qiang; Wang, Jinhua

    2016-10-01

    Aspirin is the most widely prescribed drug for the primary and secondary prevention of cardiovascular and cerebrovascular diseases. However, a large number of patients continue to experience thromboembolic events despite aspirin therapy, a phenomenon referred to as aspirin resistance or treatment failure. Aspirin resistance is often observed along with a high incidence of unstable plaque, cardiovascular events and cerebrovascular accident. Studies have shown that aspirin reduces the production of TXA2, but not totally inhibits the activation of platelets. In this review, we analyze current and past research on aspirin resistance, presenting important summaries of results regarding the potential contributive roles of single nucleotide polymorphisms, inflammation, metabolic syndrome and miRNAs. The aim of this article is to provide a brief review on aspirin resistance and platelet function, which will provide important insights into the research of aspirin resistance. PMID:27372038

  12. Impact of beta-cyclodextrin and resistant starch on bile acid metabolism and fecal steroid excretion in regard to their hypolipidemic action in hamsters.

    PubMed

    Trautwein, E A; Forgbert, K; Rieckhoff, D; Erbersdobler, H F

    1999-01-29

    To examine the impact on bile acid metabolism and fecal steroid excretion as a mechanism involved in the lipid-lowering action of beta-cyclodextrin and resistant starch in comparison to cholestyramine, male golden Syrian hamsters were fed 0% (control), 8% or 12% of beta-cyclodextrin or resistant starch or 1% cholestyramine. Resistant starch, beta-cyclodextrin and cholestyramine significantly lowered plasma total cholesterol and triacylglycerol concentrations compared to control. Distinct changes in the bile acid profile of gallbladder bile were caused by resistant starch, beta-cyclodextrin and cholestyramine. While cholestyramine significantly reduced chenodeoxycholate independently of its taurine-glycine conjugation, beta-cyclodextrin and resistant starch decreased especially the percentage of taurochenodeoxycholate by -75% and -44%, respectively. As a result, the cholate:chenodeoxycholate ratio was significantly increased by 100% with beta-cyclodextrin and by 550% with cholestyramine while resistant starch revealed no effect on this ratio. beta-Cyclodextrin and resistant starch, not cholestyramine, significantly increased the glycine:taurine conjugation ratio demonstrating the predominance of glycine conjugated bile acids. Daily fecal excretion of bile acids was 4-times higher with 8% beta-cyclodextrin and 19-times with 1% cholestyramine compared to control. beta-Cyclodextrin and cholestyramine also induced a 2-fold increase in fecal neutral sterol excretion, demonstrating the sterol binding capacity of these two compounds. Resistant starch had only a modest effect on fecal bile acid excretion (80% increase) and no effect on excretion of neutral sterols, suggesting a weak interaction with intestinal steroid absorption. These data demonstrate the lipid-lowering potential of beta-cyclodextrin and resistant starch. An impaired reabsorption of circulating bile acids and intestinal cholesterol absorption leading to an increase in fecal bile acid and neutral sterol

  13. Acetolactate Synthase-Inhibiting Herbicide-Resistant Rice Flatsedge (Cyperus iria): Cross Resistance and Molecular Mechanism of Resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Overuse of acetolactate synthase (ALS) –inhibiting herbicides in rice has led to evolution of halosulfuron-resistant rice flatsedge (Cyperus iria L.) in Arkansas (AR) and Mississippi (MS), USA. Resistant accessions were cross-resistant to labeled field rates of ALS-inhibiting herbicides from four d...

  14. Oxidation resistance of selected mechanical carbons at 650 deg C in dry flowing air

    NASA Technical Reports Server (NTRS)

    Allen, G. P.; Wisander, D. W.

    1973-01-01

    Oxidation experiments were conducted with several experimental mechanical carbons at 650 C in air flowing at 28 cu cm/sec (STP). Experiments indicate that boron carbide addition and zinc phosphate treatment definitely improved oxidation resistance. Impregnation with coal tar pitch before final graphitization had some beneficial effect on oxidation resistance and it markedly improved flexure strength and hardness. Graphitization temperature alone did not affect oxidation resistance, but with enough added boron carbide the oxidation resistance was increased although the hardness greatly decreased.

  15. Mycolic Acid Cyclopropanation is Essential for Viability, Drug Resistance, and Cell Wall Integrity of Mycobacterium tuberculosis

    SciTech Connect

    Barkan, Daniel; Liu, Zhen; Sacchettini, James C.; Glickman, Michael S.

    2009-12-01

    Mycobacterium tuberculosis infection remains a major global health problem complicated by escalating rates of antibiotic resistance. Despite the established role of mycolic acid cyclopropane modification in pathogenesis, the feasibility of targeting this enzyme family for antibiotic development is unknown. We show through genetics and chemical biology that mycolic acid methyltransferases are essential for M. tuberculosis viability, cell wall structure, and intrinsic resistance to antibiotics. The tool compound dioctylamine, which we show acts as a substrate mimic, directly inhibits the function of multiple mycolic acid methyltransferases, resulting in loss of cyclopropanation, cell death, loss of acid fastness, and synergistic killing with isoniazid and ciprofloxacin. These results demonstrate that mycolic acid methyltransferases are a promising antibiotic target and that a family of virulence factors can be chemically inhibited with effects not anticipated from studies of each individual enzyme.

  16. Surface and line-edge roughness in acid-breakable resin-based positive resist

    NASA Astrophysics Data System (ADS)

    Sakamizu, Toshio; Shiraishi, Hiroshi

    2003-06-01

    A positive chemical amplification resist based on acid-catalyzed fragmentation of acetal groups in its main-chain has been developed as a means for reducing line-edge roughness. The resist consists of an acid-generator, an acid-diffusion controller and an acid-breakable (AB) resin that is synthesized through a co-condensation reaction between polyphenol and aromatic multi-functional vinylether compound. The effects of the fractionation of AB resins on resin properties and line-edge roughness (LER) are evaluated. Although AB resins have wide molecular-weight distributions, the density of acetal groups in this AB resin is found to be almost constant except in the lower molecular-weight components. The resist with a fractionated resin from which such components removed provides the high resolution of 60-nm line-and-space (L/S) patterns with fairly low LER. AFM analysis shows the surface roughness (SR) for the resist with the fractionated resin is smaller than that for a resist using non-fractionated AB resin, and that the SR value is not altered throughout the range of exposure doses up to just below the beginning of dissolution. By using the fractionated AB resin, the AB resin-based resist (ABR) is capable of forming sub-100 nm L/S patterns with less than 5 nm of LER (3σ).

  17. L-Glutamine inhibits beta-aminobutyric acid-induced stress resistance and priming in Arabidopsis

    PubMed Central

    Wu, Chen-Chi; Singh, Prashant; Chen, Mao-Chuain; Zimmerli, Laurent

    2010-01-01

    The non-protein amino acid beta-aminobutyric acid (BABA) enhances Arabidopsis resistance to microbial pathogens and abiotic stresses through potentiation of the Arabidopsis defence responses. In this study, it is shown that BABA induces the stress-induced morphogenic response (SIMR). SIMR is observed in plants exposed to sub-lethal stress conditions. Anthocyanin, a known modulator of stress signalling, was also found to accumulate in BABA-treated Arabidopsis. These data and a previous microarray study indicate that BABA induces a stress response in Arabidopsis. High concentrations of amino acids, except for L-glutamine, cause a general amino acid stress inhibition. General amino acid inhibition is prevented by the addition of L-glutamine. L-Glutamine was found to inhibit the BABA-mediated SIMR and anthocyanin accumulation, suggesting that the non-protein amino acid BABA causes a general amino acid stress inhibition in Arabidopsis. L-Glutamine also blocked BABA-induced resistance to heat stress and to the virulent bacterial pathogen Pseudomonas syringae pv. tomato DC3000. During bacterial infection, priming of the salicylic acid-dependent defence marker PR1 was abolished by L-glutamine treatment. These results indicate that L-glutamine removal of the BABA-mediated stress response is concomitant with L-glutamine inhibition of BABA priming and BABA-induced resistance. PMID:20007686

  18. Mechanism of Action and Limited Cross-Resistance of New Lipopeptide MX-2401▿

    PubMed Central

    Rubinchik, E.; Schneider, T.; Elliott, M.; Scott, W. R. P.; Pan, J.; Anklin, C.; Yang, H.; Dugourd, D.; Müller, A.; Gries, K.; Straus, S. K.; Sahl, H. G.; Hancock, R. E. W.

    2011-01-01

    MX-2401 is a semisynthetic calcium-dependent lipopeptide antibiotic (analogue of amphomycin) in preclinical development for the treatment of serious Gram-positive infections. In vitro and in vivo, MX-2401 demonstrates broad-spectrum bactericidal activity against Gram-positive organisms, including antibiotic-resistant strains. The objective of this study was to investigate the mechanism of action of MX-2401 and compare it with that of the lipopeptide daptomycin. The results indicated that although both daptomycin and MX-2401 are in the structural class of Ca2+-dependent lipopeptide antibiotics, the latter has a different mechanism of action. Specifically, MX-2401 inhibits peptidoglycan synthesis by binding to the substrate undecaprenylphosphate (C55-P), the universal carbohydrate carrier involved in several biosynthetic pathways. This interaction resulted in inhibition, in a dose-dependent manner, of the biosynthesis of the cell wall precursors lipids I and II and the wall teichoic acid precursor lipid III, while daptomycin had no significant effect on these processes. MX-2401 induced very slow membrane depolarization that was observed only at high concentrations. Unlike daptomycin, membrane depolarization by MX-2401 did not correlate with its bactericidal activity and did not affect general membrane permeability. In contrast to daptomycin, MX-2401 had no effect on lipid flip-flop, calcein release, or membrane fusion with 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC)/1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-(1′-rac-glycerol) (sodium salt) (POPG) liposomes. MX-2401 adopts a more defined structure than daptomycin, presumably to facilitate interaction with C55-P. Mutants resistant to MX-2401 demonstrated low cross-resistance to other antibiotics. Overall, these results provided strong evidence that the mode of action of MX-2401 is unique and different from that of any of the approved antibiotics, including daptomycin. PMID:21464247

  19. Potential mechanisms for low uric acid in Parkinson disease.

    PubMed

    Sampat, Radhika; Young, Sarah; Rosen, Ami; Bernhard, Douglas; Millington, David; Factor, Stewart; Jinnah, H A

    2016-04-01

    Several epidemiologic studies have described an association between low serum uric acid (UA) and Parkinson disease (PD). Uric acid is a known antioxidant, and one proposed mechanism of neurodegeneration in PD is oxidative damage of dopamine neurons. However, other complex metabolic pathways may contribute. The purpose of this study is to elucidate potential mechanisms of low serum UA in PD. Subjects who met diagnostic criteria for definite or probable PD (n = 20) and controls (n = 20) aged 55-80 years were recruited. Twenty-four hour urine samples were collected from all participants, and both uric acid and allantoin were measured and corrected for body mass index (BMI). Urinary metabolites were compared using a twoway ANOVA with diagnosis and sex as the explanatory variables. There were no significant differences between PD and controls for total UA (p = 0.60), UA corrected for BMI (p = 0.37), or in the interaction of diagnosis and sex on UA (p = 0.24). Similarly, there were no significant differences between PD and controls for allantoin (p = 0.47), allantoin corrected for BMI (p = 0.57), or in the interaction of diagnosis and sex on allantoin (p = 0.78). Allantoin/UA ratios also did not significantly differ by diagnosis (p = 0.99). Our results imply that low serum UA in PD may be due to an intrinsic mechanism that alters the homeostatic set point for serum UA in PD, and may contribute to relatively lower protection against oxidative damage. These findings provide indirect support for neuroprotection trials aimed at raising serum UA. PMID:26747026

  20. Salicylic acid and jasmonic acid are essential for systemic resistance against tobacco mosaic virus in Nicotiana benthamiana.

    PubMed

    Zhu, Feng; Xi, De-Hui; Yuan, Shu; Xu, Fei; Zhang, Da-Wei; Lin, Hong-Hui

    2014-06-01

    Systemic resistance is induced by pathogens and confers protection against a broad range of pathogens. Recent studies have indicated that salicylic acid (SA) derivative methyl salicylate (MeSA) serves as a long-distance phloem-mobile systemic resistance signal in tobacco, Arabidopsis, and potato. However, other experiments indicate that jasmonic acid (JA) is a critical mobile signal. Here, we present evidence suggesting both MeSA and methyl jasmonate (MeJA) are essential for systemic resistance against Tobacco mosaic virus (TMV), possibly acting as the initiating signals for systemic resistance. Foliar application of JA followed by SA triggered the strongest systemic resistance against TMV. Furthermore, we use a virus-induced gene-silencing-based genetics approach to investigate the function of JA and SA biosynthesis or signaling genes in systemic response against TMV infection. Silencing of SA or JA biosynthetic and signaling genes in Nicotiana benthamiana plants increased susceptibility to TMV. Genetic experiments also proved the irreplaceable roles of MeSA and MeJA in systemic resistance response. Systemic resistance was compromised when SA methyl transferase or JA carboxyl methyltransferase, which are required for MeSA and MeJA formation, respectively, were silenced. Moreover, high-performance liquid chromatography-mass spectrometry analysis indicated that JA and MeJA accumulated in phloem exudates of leaves at early stages and SA and MeSA accumulated at later stages, after TMV infection. Our data also indicated that JA and MeJA could regulate MeSA and SA production. Taken together, our results demonstrate that (Me)JA and (Me)SA are required for systemic resistance response against TMV. PMID:24450774

  1. Deep Sequencing of Pyrethroid-Resistant Bed Bugs Reveals Multiple Mechanisms of Resistance within a Single Population

    PubMed Central

    Adelman, Zach N.; Kilcullen, Kathleen A.; Koganemaru, Reina; Anderson, Michelle A. E.; Anderson, Troy D.; Miller, Dini M.

    2011-01-01

    A frightening resurgence of bed bug infestations has occurred over the last 10 years in the U.S. and current chemical methods have been inadequate for controlling this pest due to widespread insecticide resistance. Little is known about the mechanisms of resistance present in U.S. bed bug populations, making it extremely difficult to develop intelligent strategies for their control. We have identified bed bugs collected in Richmond, VA which exhibit both kdr-type (L925I) and metabolic resistance to pyrethroid insecticides. Using LD50 bioassays, we determined that resistance ratios for Richmond strain bed bugs were ∼5200-fold to the insecticide deltamethrin. To identify metabolic genes potentially involved in the detoxification of pyrethroids, we performed deep-sequencing of the adult bed bug transcriptome, obtaining more than 2.5 million reads on the 454 titanium platform. Following assembly, analysis of newly identified gene transcripts in both Harlan (susceptible) and Richmond (resistant) bed bugs revealed several candidate cytochrome P450 and carboxylesterase genes which were significantly over-expressed in the resistant strain, consistent with the idea of increased metabolic resistance. These data will accelerate efforts to understand the biochemical basis for insecticide resistance in bed bugs, and provide molecular markers to assist in the surveillance of metabolic resistance. PMID:22039447

  2. Mechanisms of corrosion inhibitors used in acidizing wells

    SciTech Connect

    Frenier, W.W.; Growcock, F.B.; Lopp, V.R. )

    1988-11-01

    Two model compounds, n-dodecylpyridinium bromide (n-DDPB) and 1-octyn-3-ol, were tested in HCL acid as inhibitors for J55 oilfield steel. This paper describes the kinetic and chemical analyses conducted to arrive at inhibition mechanisms for these model compounds. These studies show that the pyridinium forms a weak bond with the chloride-covered surface and is sensitive to temperature and (HCl). Octynol, however, chemisorbs and produces a film that contains a reaction product of the acetylenic alcohol. This film is quite insensitive to changes in temperature and (HCl).

  3. Mechanisms of abscisic acid-mediated control of stomatal aperture.

    PubMed

    Munemasa, Shintaro; Hauser, Felix; Park, Jiyoung; Waadt, Rainer; Brandt, Benjamin; Schroeder, Julian I

    2015-12-01

    Drought stress triggers an increase in the level of the plant hormone abscisic acid (ABA), which initiates a signaling cascade to close stomata and reduce water loss. Recent studies have revealed that guard cells control cytosolic ABA concentration through the concerted actions of biosynthesis, catabolism as well as transport across membranes. Substantial progress has been made at understanding the molecular mechanisms of how the ABA signaling core module controls the activity of anion channels and thereby stomatal aperture. In this review, we focus on our current mechanistic understanding of ABA signaling in guard cells including the role of the second messenger Ca(2+) as well as crosstalk with biotic stress responses. PMID:26599955

  4. Whole-Genome Sequencing of Methicillin-Resistant Staphylococcus aureus Resistant to Fifth-Generation Cephalosporins Reveals Potential Non-mecA Mechanisms of Resistance.

    PubMed

    Greninger, Alexander L; Chatterjee, Som S; Chan, Liana C; Hamilton, Stephanie M; Chambers, Henry F; Chiu, Charles Y

    2016-01-01

    Fifth-generation cephalosporins, ceftobiprole and ceftaroline, are promising drugs for treatment of bacterial infections from methicillin-resistant Staphylococcus aureus (MRSA). These antibiotics are able to bind native PBP2a, the penicillin-binding protein encoded by the mecA resistance determinant that mediates broad class resistance to nearly all other beta-lactam antibiotics, at clinically achievable concentrations. Mechanisms of resistance to ceftaroline based on mecA mutations have been previously described. Here we compare the genomes of 11 total parent-daughter strains of Staphylococcus aureus for which specific selection by serial passaging with ceftaroline or ceftobiprole was used to identify novel non-mecA mechanisms of resistance. All 5 ceftaroline-resistant strains, derived from 5 different parental strains, contained mutations directly upstream of the pbp4 gene (coding for the PBP4 protein), including four with the same thymidine insertion located 377 nucleotides upstream of the promoter site. In 4 of 5 independent ceftaroline-driven selections, we also isolated mutations to the same residue (Asn138) in PBP4. In addition, mutations in additional candidate genes such as ClpX endopeptidase, PP2C protein phosphatase and transcription terminator Rho, previously undescribed in the context of resistance to ceftaroline or ceftobiprole, were detected in multiple selections. These genomic findings suggest that non-mecA mechanisms, while yet to be encountered in the clinical setting, may also be important in mediating resistance to 5th-generation cephalosporins. PMID:26890675

  5. Whole-Genome Sequencing of Methicillin-Resistant Staphylococcus aureus Resistant to Fifth-Generation Cephalosporins Reveals Potential Non-mecA Mechanisms of Resistance

    PubMed Central

    Chan, Liana C.; Hamilton, Stephanie M.; Chambers, Henry F.; Chiu, Charles Y.

    2016-01-01

    Fifth-generation cephalosporins, ceftobiprole and ceftaroline, are promising drugs for treatment of bacterial infections from methicillin-resistant Staphylococcus aureus (MRSA). These antibiotics are able to bind native PBP2a, the penicillin-binding protein encoded by the mecA resistance determinant that mediates broad class resistance to nearly all other beta-lactam antibiotics, at clinically achievable concentrations. Mechanisms of resistance to ceftaroline based on mecA mutations have been previously described. Here we compare the genomes of 11 total parent-daughter strains of Staphylococcus aureus for which specific selection by serial passaging with ceftaroline or ceftobiprole was used to identify novel non-mecA mechanisms of resistance. All 5 ceftaroline-resistant strains, derived from 5 different parental strains, contained mutations directly upstream of the pbp4 gene (coding for the PBP4 protein), including four with the same thymidine insertion located 377 nucleotides upstream of the promoter site. In 4 of 5 independent ceftaroline-driven selections, we also isolated mutations to the same residue (Asn138) in PBP4. In addition, mutations in additional candidate genes such as ClpX endopeptidase, PP2C protein phosphatase and transcription terminator Rho, previously undescribed in the context of resistance to ceftaroline or ceftobiprole, were detected in multiple selections. These genomic findings suggest that non-mecA mechanisms, while yet to be encountered in the clinical setting, may also be important in mediating resistance to 5th-generation cephalosporins. PMID:26890675

  6. A novel mechanism of insect resistance engineered into tobacco

    NASA Astrophysics Data System (ADS)

    Hilder, Vaughan A.; Gatehouse, Angharad M. R.; Sheerman, Suzanne E.; Barker, Richard F.; Boulter, Donald

    1987-11-01

    A major goal of plant genetic engineering is the introduction of agronomically desirable phenotypic traits into crop plants in situations where conventional breeding methods have been unsuccessful. One such target is enhanced resistance to insect pests which, in view of the estimated production losses world-wide and the heavy costs of protective treatments, is very important. We report here that a gene encoding a cowpea trypsin inhibitor, which has been shown to give some measure of field resistance to insect pests1, confers, when transferred to tobacco, enhanced resistance to this species' own herbivorous insect pests.

  7. Intrinsic antibiotic resistance: mechanisms, origins, challenges and solutions.

    PubMed

    Cox, Georgina; Wright, Gerard D

    2013-08-01

    The intrinsic antibiotic resistome is a naturally occurring phenomenon that predates antibiotic chemotherapy and is present in all bacterial species. In addition to the intrinsic resistance mediated by the bacterial outer membrane and active efflux, studies have shown that a surprising number of additional genes and genetic loci also contribute to this phenotype. Antibiotic resistance is rife in both the clinic and the environment; novel therapeutic strategies need to be developed in order to prevent a major global clinical threat. The possibility of inhibiting elements comprising the intrinsic resistome in bacterial pathogens offers the promise for repurposing existing antibiotics against intrinsically resistant bacteria. PMID:23499305

  8. Withaferin A protects against palmitic acid-induced endothelial insulin resistance and dysfunction through suppression of oxidative stress and inflammation

    PubMed Central

    Batumalaie, Kalaivani; Amin, Muhammad Arif; Murugan, Dharmani Devi; Sattar, Munavvar Zubaid Abdul; Abdullah, Nor Azizan

    2016-01-01

    Activation of inflammatory pathways via reactive oxygen species (ROS) by free fatty acids (FFA) in obesity gives rise to insulin resistance and endothelial dysfunction. Withaferin A (WA), possesses both antioxidant and anti-inflammatory properties and therefore would be a good strategy to suppress palmitic acid (PA)-induced oxidative stress and inflammation and hence, insulin resistance and dysfunction in the endothelium. Effect of WA on PA-induced insulin resistance in human umbilical vein endothelial cells (HUVECs) was determined by evaluating insulin signaling mechanisms whilst effect of this drug on PA-induced endothelial dysfunction was determined in acetylcholine-mediated relaxation in isolated rat aortic preparations. WA significantly inhibited ROS production and inflammation induced by PA. Furthermore, WA significantly decreased TNF-α and IL-6 production in endothelial cells by specifically suppressing IKKβ/NF-κβ phosphorylation. WA inhibited inflammation-stimulated IRS-1 serine phosphorylation and improved the impaired insulin PI3-K signaling, and restored the decreased nitric oxide (NO) production triggered by PA. WA also decreased endothelin-1 and plasminogen activator inhibitor type-1 levels, and restored the impaired endothelium-mediated vasodilation in isolated aortic preparations. These findings suggest that WA inhibited both ROS production and inflammation to restore impaired insulin resistance in cultured endothelial cells and improve endothelial dysfunction in rat aortic rings. PMID:27250532

  9. Withaferin A protects against palmitic acid-induced endothelial insulin resistance and dysfunction through suppression of oxidative stress and inflammation.

    PubMed

    Batumalaie, Kalaivani; Amin, Muhammad Arif; Murugan, Dharmani Devi; Sattar, Munavvar Zubaid Abdul; Abdullah, Nor Azizan

    2016-01-01

    Activation of inflammatory pathways via reactive oxygen species (ROS) by free fatty acids (FFA) in obesity gives rise to insulin resistance and endothelial dysfunction. Withaferin A (WA), possesses both antioxidant and anti-inflammatory properties and therefore would be a good strategy to suppress palmitic acid (PA)-induced oxidative stress and inflammation and hence, insulin resistance and dysfunction in the endothelium. Effect of WA on PA-induced insulin resistance in human umbilical vein endothelial cells (HUVECs) was determined by evaluating insulin signaling mechanisms whilst effect of this drug on PA-induced endothelial dysfunction was determined in acetylcholine-mediated relaxation in isolated rat aortic preparations. WA significantly inhibited ROS production and inflammation induced by PA. Furthermore, WA significantly decreased TNF-α and IL-6 production in endothelial cells by specifically suppressing IKKβ/NF-κβ phosphorylation. WA inhibited inflammation-stimulated IRS-1 serine phosphorylation and improved the impaired insulin PI3-K signaling, and restored the decreased nitric oxide (NO) production triggered by PA. WA also decreased endothelin-1 and plasminogen activator inhibitor type-1 levels, and restored the impaired endothelium-mediated vasodilation in isolated aortic preparations. These findings suggest that WA inhibited both ROS production and inflammation to restore impaired insulin resistance in cultured endothelial cells and improve endothelial dysfunction in rat aortic rings. PMID:27250532

  10. Radio-resistant mesenchymal stem cells: mechanisms of resistance and potential implications for the clinic

    PubMed Central

    Nicolay, Nils H.; Perez, Ramon Lopez; Saffrich, Rainer; Huber, Peter E.

    2015-01-01

    Mesenchymal stem cells (MSCs) comprise a heterogeneous population of multipotent stromal cells and can be isolated from various tissues and organs. Due to their regenerative potential, they have been subject to intense research efforts, and they may provide an efficient means for treating radiation-induced tissue damage. MSCs are relatively resistant to ionizing radiation and retain their stem cell characteristics even after high radiation doses. The underlying mechanisms for the observed MSC radioresistance have been extensively studied and may involve efficient DNA damage recognition, double strand break repair and evasion of apoptosis. Here, we present a concise review of the published scientific data on the radiobiological features of MSCs. The involvement of different DNA damage recognition and repair pathways in the creation of a radioresistant MSC phenotype is outlined, and the roles of apoptosis, senescence and autophagy regarding the reported radioresistance are summarized. Finally, potential influences of the radioresistant MSCs for the clinic are discussed with respect to the repair and radioprotection of irradiated tissues. PMID:26203772

  11. Association between insulin resistance and plasma amino acid profile in non-diabetic Japanese subjects

    PubMed Central

    Yamada, Chizumi; Kondo, Masumi; Kishimoto, Noriaki; Shibata, Takeo; Nagai, Yoko; Imanishi, Tadashi; Oroguchi, Takashige; Ishii, Naoaki; Nishizaki, Yasuhiro

    2015-01-01

    Aims/Introduction Elevation of the branched-chain amino acids (BCAAs), valine, leucine and isoleucine; and the aromatic amino acids, tyrosine and phenylalanine, has been observed in obesity-related insulin resistance. However, there have been few studies on Asians, who are generally less obese and less insulin-resistant than Caucasian or African-Americans. In the present study, we investigated the relationship between homeostasis model assessment of insulin resistance (HOMA-IR) and plasma amino acid concentration in non-diabetic Japanese participants. Materials and Methods A total of 94 healthy men and women were enrolled, and plasma amino acid concentration was measured by liquid chromatography/mass spectrometry after overnight fasting. The associations between HOMA-IR and 20 amino acid concentrations, and anthropometric and clinical parameters of lifestyle-related diseases were evaluated. Results The mean age and body mass index were 40.1 ± 9.6 years and 22.7 ± 3.9, respectively. Significantly positive correlations were observed between HOMA-IR and valine, isoleucine, leucine, tyrosine, phenylalanine and total BCAA concentration. Compared with the HOMA-IR ≤ 1.6 group, the HOMA-IR > 1.6 group showed significantly exacerbated anthropometric and clinical parameters, and significantly elevated levels of valine, isoleucine, leucine, tyrosine, phenylalanine and BCAA. Conclusions The present study shows that the insulin resistance-related change in amino acid profile is also observed in non-diabetic Japanese subjects. These amino acids include BCAAs (valine, isoleucine and leucine) and aromatic amino acids (tyrosine and phenylalanine), in agreement with previous studies carried out using different ethnic groups with different degrees of obesity and insulin resistance. PMID:26221519

  12. Protection of 2024-T3 aluminium alloy by corrosion resistant phytic acid conversion coating

    NASA Astrophysics Data System (ADS)

    Shi, Hongwei; Han, En-Hou; Liu, Fuchun; Kallip, Silvar

    2013-09-01

    The corrosion protection properties of environmentally friendly phytic acid conversion coatings were studied on 2024-T3 aluminium alloy. The films were prepared under acidic conditions with various pH values and characterised by SEM, EDS, ATR-FTIR and electrochemical techniques. The results indicate that the conversion coatings obtained by immersing the alloy in phytic acid solutions at pH from 3 to 5.5 provide excellent corrosion resistance. ATR-FTIR confirms that the film is formed by deposition of reaction products between Al3+ and phosphate groups in phytic acid molecules. The conformation models of the deposition film are proposed.

  13. Micro-electro-mechanical systems phosphoric acid fuel cell

    DOEpatents

    Sopchak, David A.; Morse, Jeffrey D.; Upadhye, Ravindra S.; Kotovsky, Jack; Graff, Robert T.

    2010-08-17

    A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

  14. Micro-electro-mechanical systems phosphoric acid fuel cell

    DOEpatents

    Sopchak, David A.; Morse, Jeffrey D.; Upadhye, Ravindra S.; Kotovsky, Jack; Graff, Robert T.

    2010-12-21

    A phosphoric acid fuel cell system comprising a porous electrolyte support, a phosphoric acid electrolyte in the porous electrolyte support, a cathode electrode contacting the phosphoric acid electrolyte, and an anode electrode contacting the phosphoric acid electrolyte.

  15. Mechanisms of antimicrobial resistance in Gram-negative bacilli.

    PubMed

    Ruppé, Étienne; Woerther, Paul-Louis; Barbier, François

    2015-12-01

    The burden of multidrug resistance in Gram-negative bacilli (GNB) now represents a daily issue for the management of antimicrobial therapy in intensive care unit (ICU) patients. In Enterobacteriaceae, the dramatic increase in the rates of resistance to third-generation cephalosporins mainly results from the spread of plasmid-borne extended-spectrum beta-lactamase (ESBL), especially those belonging to the CTX-M family. The efficacy of beta-lactam/beta-lactamase inhibitor associations for severe infections due to ESBL-producing Enterobacteriaceae has not been adequately evaluated in critically ill patients, and carbapenems still stands as the first-line choice in this situation. However, carbapenemase-producing strains have emerged worldwide over the past decade. VIM- and NDM-type metallo-beta-lactamases, OXA-48 and KPC appear as the most successful enzymes and may threaten the efficacy of carbapenems in the near future. ESBL- and carbapenemase-encoding plasmids frequently bear resistance determinants for other antimicrobial classes, including aminoglycosides (aminoglycoside-modifying enzymes or 16S rRNA methylases) and fluoroquinolones (Qnr, AAC(6')-Ib-cr or efflux pumps), a key feature that fosters the spread of multidrug resistance in Enterobacteriaceae. In non-fermenting GNB such as Pseudomonas aeruginosa, Acinetobacter baumannii and Stenotrophomonas maltophilia, multidrug resistance may emerge following the sole occurrence of sequential chromosomal mutations, which may lead to the overproduction of intrinsic beta-lactamases, hyper-expression of efflux pumps, target modifications and permeability alterations. P. aeruginosa and A. baumannii also have the ability to acquire mobile genetic elements encoding resistance determinants, including carbapenemases. Available options for the treatment of ICU-acquired infections due to carbapenem-resistant GNB are currently scarce, and recent reports emphasizing the spread of colistin resistance in environments with high

  16. Abscisic acid and water stress as mediators of root herbivore-induced leaf resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Systemically induced resistance is a common and important phenomenon in plant-pathogen and plant-insect interactions. The mechanisms triggered by microorganisms and leaf-herbivores that lead to systemic resistance are largely understood, but, as yet, it remains unknown how root herbivory may increas...

  17. Colistin and tigecycline resistance in carbapenemase-producing Gram-negative bacteria: emerging resistance mechanisms and detection methods.

    PubMed

    Osei Sekyere, J; Govinden, U; Bester, L A; Essack, S Y

    2016-09-01

    A literature review was undertaken to ascertain the molecular basis for tigecycline and colistin resistance mechanisms and the experimental basis for the detection and delineation of this resistance particularly in carbapenemase-producing Gram-negative bacteria. Pubmed, Google Scholar and Science Direct were searched with the keywords colistin, tigecycline, resistance mechanisms and detection methods. Trans-complementation and comparative MIC studies, mass spectrometry, chromatography, spectrofluorometry, PCR, qRT-PCR and whole genome sequencing (WGS) were commonly used to determine tigecycline and colistin resistance mechanisms, specifically modifications in the structural and regulatory efflux (acrAB, OqxAB, kpgABC adeABC-FGH-IJK, mexAB-XY-oprJM and soxS, rarA robA, ramRAB marRABC, adeLRS, mexRZ and nfxb) and lipid A (pmrHFIJFKLM, lpxA, lpxC lpxD and mgrB, pmrAB, phoPQ,) genes respectively. Mutations in the ribosomal 16S rRNA operon rrnBC, also yielded resistance to tigecycline through target site modifications. The mcr-1 gene conferring resistance to colistin was identified via WGS, trans-complementation and a murine thigh infection model studies. Common detection methods are mainly antibiotic sensitivity testing with broth microdilution while molecular identification tools are mostly PCR and WGS. Spectrofluorometry, MALDI-TOF MS, micro-array and real-time multiplex PCR hold much promise for the future as new detection tools. PMID:27153928

  18. Boric acid inhibits embryonic histone deacetylases: A suggested mechanism to explain boric acid-related teratogenicity

    SciTech Connect

    Di Renzo, Francesca; Cappelletti, Graziella; Broccia, Maria L.; Giavini, Erminio; Menegola, Elena . E-mail: elena.menegola@unimi.it

    2007-04-15

    Histone deacetylases (HDAC) control gene expression by changing histonic as well as non histonic protein conformation. HDAC inhibitors (HDACi) are considered to be among the most promising drugs for epigenetic treatment for cancer. Recently a strict relationship between histone hyperacetylation in specific tissues of mouse embryos exposed to two HDACi (valproic acid and trichostatin A) and specific axial skeleton malformations has been demonstrated. The aim of this study is to verify if boric acid (BA), that induces in rodents malformations similar to those valproic acid and trichostatin A-related, acts through similar mechanisms: HDAC inhibition and histone hyperacetylation. Pregnant mice were treated intraperitoneally with a teratogenic dose of BA (1000 mg/kg, day 8 of gestation). Western blot analysis and immunostaining were performed with anti hyperacetylated histone 4 (H4) antibody on embryos explanted 1, 3 or 4 h after treatment and revealed H4 hyperacetylation at the level of somites. HDAC enzyme assay was performed on embryonic nuclear extracts. A significant HDAC inhibition activity (compatible with a mixed type partial inhibition mechanism) was evident with BA. Kinetic analyses indicate that BA modifies substrate affinity by a factor {alpha} = 0.51 and maximum velocity by a factor {beta} = 0.70. This work provides the first evidence for HDAC inhibition by BA and suggests such a molecular mechanism for the induction of BA-related malformations.

  19. Determining the resistance of carbapenem-resistant Klebsiella pneumoniae to common disinfectants and elucidating the underlying resistance mechanisms

    PubMed Central

    Guo, Wei; Shan, Kai; Xu, Bin; Li, Jianguo

    2015-01-01

    Introduction: Carbapenem-resistant Klebsiella pneumoniae (CRKP) infection is a serious problem in hospitals worldwide, posing a particular risk to immunocompromised patients. Elimination strategies may prevent these drug-resistant bacteria from spreading within hospital environments. Here, the susceptibility of patient-derived CRKP strains to common chemical disinfectants and possible correlations between the presence of drug-resistance genes and increased resistance to disinfectants were investigated. Methods: The minimum inhibitory (MIC) and the minimum bactericidal concentrations (MBC) of common chemical disinfectants against each CRKP strain were determined using agar dilution; K. pneumoniae ATCC700603 served as a standard. The presence of the drug-resistance genes qacΔE, qacA, acrA and qacE was determined using PCR. Results: A total of 27 clinically isolated CRKP strains collected in our hospital from 2011 to 2013 exhibited sensitivity to the following common chemical disinfectants in decreasing order of sensitivity: 75% ethyl alcohol > 2% glutaraldehyde > “84” disinfectant > 0.2% benzalkonium bromide > 2% iodine tincture > 1% iodophor > 0.1% chlorhexidine acetate. Of the 27 strains, 59, 41, 19 and 15% contained qacΔE, qacA, acrA and qacE resistance genes; 15% carried acrA, qacΔE and qacA, and 26% carried both qacA and qacΔE. Comparative analysis indicated that drug-resistance genes were correlated with higher MIC values. Conclusion: These pan-resistant pathogenic CRKP strains contained various drug-resistance genes and exhibited relatively high resistance to ethyl alcohol, chlorhexidine acetate and iodophor. Monitoring the drug-resistance rates of CRKP strains displaying disinfectant resistance may facilitate appropriate and effective sterilisation and thus preventing the spread of these pan-resistant strains PMID:26184804

  20. Functional Genome Screening to Elucidate the Colistin Resistance Mechanism

    PubMed Central

    Kumar, Mohit; Gupta, Ashutosh; Sahoo, Rajesh Kumar; Jena, Jayanti; Debata, Nagen Kumar; Subudhi, Enketeswara

    2016-01-01

    Antibiogram profile of 1590 clinical bacterial isolates based on thirteen different antimicrobial compounds showed that 1.6% of the bacterial isolates are multidrug resistant. Distribution pattern based on 16S rRNA sequence analysis showed that Pseudomonas aeruginosa constituted the largest group (83.6%) followed by Burkholderia pseudomallei sp. A191 (5.17%), Staphylococcus sp. A261 (3.45%). Among the various antibiotics used, colistin appeared to be the most effective against the Gram negative bacteria. Burkholderia pseudomallei sp. A191 and Pseudomonas aeruginosa sp. A111 showed resistance to 1500 μg/ml and 750 μg/ml of colistin respectively which constitutes 7.7% of the bacterial population. A functional genomics strategy was employed to discover the molecular support for colistin resistance in Burkholderia pseudomallei sp. A191. A pUC plasmid-based genomic expression library was constructed with an estimated library size of 2.1 × 107bp. Five colistin resistant clones were obtained after functional screening of the library. Analysis of DNA sequence of five colistin resistant clones showed homology to two component regularity systems (TCRS) encoding for a histidine kinase (mrgS) and its regulatory component (mrgR). Cross complementation assay showed that mutations in mrgS were sufficient enough to confer colistin resistant phenotype in a sensitive strain. PMID:26988670

  1. Drug Resistance Mechanisms of Mycoplasma pneumoniae to Macrolide Antibiotics

    PubMed Central

    Liu, Xijie; Jiang, Yue; Chen, Xiaogeng; Li, Jing; Shi, Dawei; Xin, Deli

    2014-01-01

    Throat swabs from children with suspected Mycoplasma pneumoniae (M. pneumoniae) infection were cultured for the presence of M. pneumoniae and its species specificity using the 16S rRNA gene. Seventy-six M. pneumoniae strains isolated from 580 swabs showed that 70 were erythromycin resistant with minimum inhibitory concentrations (MIC) around 32–512 mg/L. Fifty M. pneumoniae strains (46 resistant, 4 sensitive) were tested for sensitivity to tetracycline, ciprofloxacin, and gentamicin. Tetracycline and ciprofloxacin had some effect, and gentamicin had an effect on the majority of M. pneumoniae strains. Domains II and V of the 23S rRNA gene and the ribosomal protein L4 and L22 genes, both of which are considered to be associated with macrolide resistance, were sequenced and the sequences were compared with the corresponding sequences in M129 registered with NCBI and the FH strain. The 70 resistant strains all showed a 2063 or 2064 site mutation in domain V of the 23S rRNA but no mutations in domain II. Site mutations of L4 or L22 can be observed in either resistant or sensitive strains, although it is not known whether this is associated with drug resistance. PMID:24592385

  2. Mechanisms of triglyceride metabolism in patients with bile acid diarrhea.

    PubMed

    Sagar, Nidhi Midhu; McFarlane, Michael; Nwokolo, Chuka; Bardhan, Karna Dev; Arasaradnam, Ramesh Pulendran

    2016-08-14

    Bile acids (BAs) are essential for the absorption of lipids. BA synthesis is inhibited through intestinal farnesoid X receptor (FXR) activity. BA sequestration is known to influence BA metabolism and control serum lipid concentrations. Animal data has demonstrated a regulatory role for the FXR in triglyceride metabolism. FXR inhibits hepatic lipogenesis by inhibiting the expression of sterol regulatory element binding protein 1c via small heterodimer primer activity. Conversely, FXR promotes free fatty acids oxidation by inducing the expression of peroxisome proliferator-activated receptor α. FXR can reduce the expression of microsomal triglyceride transfer protein, which regulates the assembly of very low-density lipoproteins (VLDL). FXR activation in turn promotes the clearance of circulating triglycerides by inducing apolipoprotein C-II, very low-density lipoproteins receptor (VLDL-R) and the expression of Syndecan-1 together with the repression of apolipoprotein C-III, which increases lipoprotein lipase activity. There is currently minimal clinical data on triglyceride metabolism in patients with bile acid diarrhoea (BAD). Emerging data suggests that a third of patients with BAD have hypertriglyceridemia. Further research is required to establish the risk of hypertriglyceridaemia in patients with BAD and elicit the mechanisms behind this, allowing for targeted treatment. PMID:27570415

  3. Mechanisms of triglyceride metabolism in patients with bile acid diarrhea

    PubMed Central

    Sagar, Nidhi Midhu; McFarlane, Michael; Nwokolo, Chuka; Bardhan, Karna Dev; Arasaradnam, Ramesh Pulendran

    2016-01-01

    Bile acids (BAs) are essential for the absorption of lipids. BA synthesis is inhibited through intestinal farnesoid X receptor (FXR) activity. BA sequestration is known to influence BA metabolism and control serum lipid concentrations. Animal data has demonstrated a regulatory role for the FXR in triglyceride metabolism. FXR inhibits hepatic lipogenesis by inhibiting the expression of sterol regulatory element binding protein 1c via small heterodimer primer activity. Conversely, FXR promotes free fatty acids oxidation by inducing the expression of peroxisome proliferator-activated receptor α. FXR can reduce the expression of microsomal triglyceride transfer protein, which regulates the assembly of very low-density lipoproteins (VLDL). FXR activation in turn promotes the clearance of circulating triglycerides by inducing apolipoprotein C-II, very low-density lipoproteins receptor (VLDL-R) and the expression of Syndecan-1 together with the repression of apolipoprotein C-III, which increases lipoprotein lipase activity. There is currently minimal clinical data on triglyceride metabolism in patients with bile acid diarrhoea (BAD). Emerging data suggests that a third of patients with BAD have hypertriglyceridemia. Further research is required to establish the risk of hypertriglyceridaemia in patients with BAD and elicit the mechanisms behind this, allowing for targeted treatment. PMID:27570415

  4. Antioxidant enzymes and fatty acid composition as related to disease resistance in postharvest loquat fruit.

    PubMed

    Cao, Shifeng; Yang, Zhenfeng; Cai, Yuting; Zheng, Yonghua

    2014-11-15

    Two cultivars of loquat fruit were stored at 20°C for 10days to investigate the relationship between disease resistance, and fatty acid composition and activities of endogenous antioxidant enzymes. The results showed that decay incidence increased with storage time in both cultivars. A significantly lower disease incidence was observed in 'Qingzhong' fruit than in 'Fuyang', suggesting 'Qingzhong' had increased disease resistance. Meanwhile, 'Qingzhong' fruit also had lower levels of superoxide radical and hydrogen peroxide, and lower lipoxygenase activity, but higher levels of linolenic and linoleic acids and higher activities of catalase (CAT) and ascorbate peroxidase (APX) compared with 'Fuyang'. These results suggest that the higher levels of linolenic and linoleic acids and the higher activity of CAT and APX have a role in disease resistance of postharvest loquat fruit. PMID:24912701

  5. Effect of basic additives on sensitivity and diffusion of acid in chemical amplification resists

    NASA Astrophysics Data System (ADS)

    Asakawa, Koji; Ushirogouchi, Tohru; Nakase, Makoto

    1995-06-01

    The effect of amine additives in chemical amplification resists is discussed. Phenolic amines such as 4-aminophenol and 2-(4-aminophenyl)-2-(4-hydroxyphenyl) propane were investigated as model compounds from the viewpoint of sensitivity, diffusion and resolution. Equal molar amounts of acid and amine deactivated at the very beginning of post-exposure bake, and could not participate in decomposing the inhibitor as a catalyst. Only the acid which survived from the deactivation diffuses in the resist, decomposing the inhibitors from the middle to late stage of PEB. The basic additives reduce the diffusion range of the acid, especially for long-range diffusion, resulting in higher contrast at the interfaces between the exposed and unexposed areas. In addition, the amine concentration required is found to be less than the concentration which causes the resist sensitivity to start decreasing.

  6. Prebiotically plausible mechanisms increase compositional diversity of nucleic acid sequences

    PubMed Central

    Derr, Julien; Manapat, Michael L.; Rajamani, Sudha; Leu, Kevin; Xulvi-Brunet, Ramon; Joseph, Isaac; Nowak, Martin A.; Chen, Irene A.

    2012-01-01

    During the origin of life, the biological information of nucleic acid polymers must have increased to encode functional molecules (the RNA world). Ribozymes tend to be compositionally unbiased, as is the vast majority of possible sequence space. However, ribonucleotides vary greatly in synthetic yield, reactivity and degradation rate, and their non-enzymatic polymerization results in compositionally biased sequences. While natural selection could lead to complex sequences, molecules with some activity are required to begin this process. Was the emergence of compositionally diverse sequences a matter of chance, or could prebiotically plausible reactions counter chemical biases to increase the probability of finding a ribozyme? Our in silico simulations using a two-letter alphabet show that template-directed ligation and high concatenation rates counter compositional bias and shift the pool toward longer sequences, permitting greater exploration of sequence space and stable folding. We verified experimentally that unbiased DNA sequences are more efficient templates for ligation, thus increasing the compositional diversity of the pool. Our work suggests that prebiotically plausible chemical mechanisms of nucleic acid polymerization and ligation could predispose toward a diverse pool of longer, potentially structured molecules. Such mechanisms could have set the stage for the appearance of functional activity very early in the emergence of life. PMID:22319215

  7. Resistance of Stenotrophomonas maltophilia to Fluoroquinolones: Prevalence in a University Hospital and Possible Mechanisms

    PubMed Central

    Jia, Wei; Wang, Jiayuan; Xu, Haotong; Li, Gang

    2015-01-01

    Objective: The purpose of this study was to investigate the clinical distribution and genotyping of Stenotrophomonas maltophilia, its resistance to antimicrobial agents, and the possible mechanisms of this drug resistance. Methods: S. maltophilia isolates were collected from clinical specimens in a university hospital in Northwestern China during the period between 2010 and 2012, and were identified to the species level with a fully automated microbiological system. Antimicrobial susceptibility testing was performed for S. maltophilia with the Kirby-Bauer disc diffusion method. The minimal inhibitory concentrations (MICs) of norfloxacin, ofloxacin, chloramphenicol, minocycline, ceftazidime, levofloxacin and ciprofloxacin against S. maltophilia were assessed using the agar dilution method, and changes in the MIC of norfloxacin, ciprofloxacin and ofloxacin were observed after the addition of reserpine, an efflux pump inhibitor. Fluoroquinolone resistance genes were detected in S. maltophilia using a polymerase chain reaction (PCR) assay, and the expression of efflux pump smeD and smeF genes was determined using a quantitative fluorescent (QF)-PCR assay. Pulsed-field gel electrophoresis (PFGE) was employed to genotype identified S. maltophilia isolates. Results: A total of 426 S. maltophilia strains were isolated from the university hospital from 2010 to 2012, consisting of 10.1% of total non-fermentative bacteria. The prevalence of norfloxacin, ciprofloxacin and ofloxacin resistance was 32.4%, 21.9% and 13.2% in the 114 S. maltophilia isolates collected from 2012, respectively. Following reserpine treatment, 19 S. maltophilia isolates positive for efflux pump were identified, and high expression of smeD and smeF genes was detected in two resistant isolates. gyrA, parC, smeD, smeE and smeF genes were detected in all 114 S. maltophilia isolates, while smqnr gene was found in 25.4% of total isolates. Glu-Lys mutation (GAA-AAA) was detected at the 151th amino acid of the

  8. Evolutionary Distance of Amino Acid Sequence Orthologs across Macaque Subspecies: Identifying Candidate Genes for SIV Resistance in Chinese Rhesus Macaques

    PubMed Central

    Ross, Cody T.; Roodgar, Morteza; Smith, David Glenn

    2015-01-01

    We use the Reciprocal Smallest Distance (RSD) algorithm to identify amino acid sequence orthologs in the Chinese and Indian rhesus macaque draft sequences and estimate the evolutionary distance between such orthologs. We then use GOanna to map gene function annotations and human gene identifiers to the rhesus macaque amino acid sequences. We conclude methodologically by cross-tabulating a list of amino acid orthologs with large divergence scores with a list of genes known to be involved in SIV or HIV pathogenesis. We find that many of the amino acid sequences with large evolutionary divergence scores, as calculated by the RSD algorithm, have been shown to be related to HIV pathogenesis in previous laboratory studies. Four of the strongest candidate genes for SIVmac resistance in Chinese rhesus macaques identified in this study are CDK9, CXCL12, TRIM21, and TRIM32. Additionally, ANKRD30A, CTSZ, GORASP2, GTF2H1, IL13RA1, MUC16, NMDAR1, Notch1, NT5M, PDCD5, RAD50, and TM9SF2 were identified as possible candidates, among others. We failed to find many laboratory experiments contrasting the effects of Indian and Chinese orthologs at these sites on SIVmac pathogenesis, but future comparative studies might hold fertile ground for research into the biological mechanisms underlying innate resistance to SIVmac in Chinese rhesus macaques. PMID:25884674

  9. Evolutionary distance of amino acid sequence orthologs across macaque subspecies: identifying candidate genes for SIV resistance in Chinese rhesus macaques.

    PubMed

    Ross, Cody T; Roodgar, Morteza; Smith, David Glenn

    2015-01-01

    We use the Reciprocal Smallest Distance (RSD) algorithm to identify amino acid sequence orthologs in the Chinese and Indian rhesus macaque draft sequences and estimate the evolutionary distance between such orthologs. We then use GOanna to map gene function annotations and human gene identifiers to the rhesus macaque amino acid sequences. We conclude methodologically by cross-tabulating a list of amino acid orthologs with large divergence scores with a list of genes known to be involved in SIV or HIV pathogenesis. We find that many of the amino acid sequences with large evolutionary divergence scores, as calculated by the RSD algorithm, have been shown to be related to HIV pathogenesis in previous laboratory studies. Four of the strongest candidate genes for SIVmac resistance in Chinese rhesus macaques identified in this study are CDK9, CXCL12, TRIM21, and TRIM32. Additionally, ANKRD30A, CTSZ, GORASP2, GTF2H1, IL13RA1, MUC16, NMDAR1, Notch1, NT5M, PDCD5, RAD50, and TM9SF2 were identified as possible candidates, among others. We failed to find many laboratory experiments contrasting the effects of Indian and Chinese orthologs at these sites on SIVmac pathogenesis, but future comparative studies might hold fertile ground for research into the biological mechanisms underlying innate resistance to SIVmac in Chinese rhesus macaques. PMID:25884674

  10. Origin and Evolution of Antibiotic Resistance: The Common Mechanisms of Emergence and Spread in Water Bodies

    PubMed Central

    Lupo, Agnese; Coyne, Sébastien; Berendonk, Thomas Ulrich

    2011-01-01

    The environment, and especially freshwater, constitutes a reactor where the evolution and the rise of new resistances occur. In water bodies such as waste water effluents, lakes, and rivers or streams, bacteria from different sources, e.g., urban, industrial, and agricultural waste, probably selected by intensive antibiotic usage, are collected and mixed with environmental species. This may cause two effects on the development of antibiotic resistances: first, the contamination of water by antibiotics or other pollutants lead to the rise of resistances due to selection processes, for instance, of strains over-expressing broad range defensive mechanisms, such as efflux pumps. Second, since environmental species are provided with intrinsic antibiotic resistance mechanisms, the mixture with allochthonous species is likely to cause genetic exchange. In this context, the role of phages and integrons for the spread of resistance mechanisms appears significant. Allochthonous species could acquire new resistances from environmental donors and introduce the newly acquired resistance mechanisms into the clinics. This is illustrated by clinically relevant resistance mechanisms, such as the fluoroquinolones resistance genes qnr. Freshwater appears to play an important role in the emergence and in the spread of antibiotic resistances, highlighting the necessity for strategies of water quality improvement. We assume that further knowledge is needed to better understand the role of the environment as reservoir of antibiotic resistances and to elucidate the link between environmental pollution by anthropogenic pressures and emergence of antibiotic resistances. Only an integrated vision of these two aspects can provide elements to assess the risk of spread of antibiotic resistances via water bodies and suggest, in this context, solutions for this urgent health issue. PMID:22303296

  11. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  12. Insecticide Resistance Mechanisms in the Green Peach Aphid Myzus persicae (Hemiptera: Aphididae) I: A Transcriptomic Survey

    PubMed Central

    Silva, Andrea X.; Jander, Georg; Samaniego, Horacio; Ramsey, John S; Figueroa, Christian C.

    2012-01-01

    Background Insecticide resistance is one of the best examples of rapid micro-evolution found in nature. Since the development of the first synthetic insecticide in 1939, humans have invested considerable effort to stay ahead of resistance phenotypes that repeatedly develop in insects. Aphids are a group of insects that have become global pests in agriculture and frequently exhibit insecticide resistance. The green peach aphid, Myzus persicae, has developed resistance to at least seventy different synthetic compounds, and different insecticide resistance mechanisms have been reported worldwide. Methodology/Principal Findings To further characterize this resistance, we analyzed genome-wide transcriptional responses in three genotypes of M. persicae, each exhibiting different resistance mechanisms, in response to an anti-cholinesterase insecticide. The sensitive genotype (exhibiting no resistance mechanism) responded to the insecticide by up-regulating 183 genes primarily ones related to energy metabolism, detoxifying enzymes, proteins of extracellular transport, peptidases and cuticular proteins. The second genotype (resistant through a kdr sodium channel mutation), up-regulated 17 genes coding for detoxifying enzymes, peptidase and cuticular proteins. Finally, a multiply resistant genotype (carrying kdr and a modified acetylcholinesterase), up-regulated only 7 genes, appears not to require induced insecticide detoxification, and instead down-regulated many genes. Conclusions/Significance This study suggests strongly that insecticide resistance in M. persicae is more complex that has been described, with the participation of a broad array of resistance mechanisms. The sensitive genotype exhibited the highest transcriptional plasticity, accounting for the wide range of potential adaptations to insecticides that this species can evolve. In contrast, the multiply resistant genotype exhibited a low transcriptional plasticity, even for the expression of genes encoding

  13. Mechanisms of resistance to RAF inhibition in melanomas harboring a BRAF mutation.

    PubMed

    Chapman, Paul B

    2013-01-01

    Treatment of V600E/K BRAF-mutated melanomas with RAF inhibitors (either vemurafenib or dabrafenib) results in rapid and dramatic responses in most patients-results that are associated with improved progression-free survival (PFS) and in the case of vemurafenib, overall survival (OS). However, resistance develops at a median time of approximately 6 months. Understanding the mechanisms of resistance is critical to develop strategies to prolong PFS and OS. Negative feedback mechanisms inherent in the MAPK pathway serve to modulate responses to these drugs. However, genetic changes develop within the tumor, which lead to reactivation of the MAPK and resistance to these drugs. The mechanisms that have been demonstrated in many patients by multiple investigators are (1) development of an activating mutation in NRAS, and (2) appearance of a BRAFV600E splice variant that encourages RAF dimerization. Several other mechanisms of resistance have also been described in individual patients or in preclinical models of resistance. In addition, there is evidence that activation of parallel pathways, such as the PI3K/AKT pathway, may represent another mechanism of resistance. Understanding the various mechanisms of resistance will inform our attempts to prevent resistance to RAF inhibitors. PMID:23714462

  14. Bypassing Mechanisms of Mitochondria-Mediated Cancer Stem Cells Resistance to Chemo- and Radiotherapy

    PubMed Central

    Lyakhovich, Alex; Lleonart, Matilde E.

    2016-01-01

    Cancer stem cells (CSCs) are highly resistant to conventional chemo- and radiotherapeutic regimes. Therefore, the multiple drug resistance (MDR) of cancer is most likely due to the resistance of CSCs. Such resistance can be attributed to some bypassing pathways including detoxification mechanisms of reactive oxygen and nitrogen species (RO/NS) formation or enhanced autophagy. Unlike in normal cells, where RO/NS concentration is maintained at certain threshold required for signal transduction or immune response mechanisms, CSCs may develop alternative pathways to diminish RO/NS levels leading to cancer survival. In this minireview, we will focus on elaborated mechanisms developed by CSCs to attenuate high RO/NS levels. Gaining a better insight into the mechanisms of stem cell resistance to chemo- or radiotherapy may lead to new therapeutic targets thus serving for better anticancer strategies. PMID:26697128

  15. Acid-Responsive Therapeutic Polymer for Prolonging Nanoparticle Circulation Lifetime and Destroying Drug-Resistant Tumors.

    PubMed

    Piao, Ji-Gang; Gao, Feng; Yang, Lihua

    2016-01-13

    How to destroy drug-resistant tumor cells remains an ongoing challenge for cancer treatment. We herein report on a therapeutic nanoparticle, aHLP-PDA, which has an acid-activated hemolytic polymer (aHLP) grafted onto photothermal polydopamine (PDA) nanosphere via boronate ester bond, in efforts to ablate drug-resistant tumors. Upon exposure to oxidative stress and/or near-infrared laser irradiation, aHLP-PDA nanoparticle responsively releases aHLP, likely via responsive cleavage of boronate ester bond, and thus responsively exhibits acid-facilitated mammalian-membrane-disruptive activity. In vitro cell studies with drug-resistant and/or thermo-tolerant cancer cells show that the aHLP-PDA nanoparticle demonstrates preferential cytotoxicity at acidic pH over physiological pH. When administered intravenously, the aHLP-PDA nanoparticle exhibits significantly prolonged blood circulation lifetime and enhanced tumor uptake compared to bare PDA nanosphere, likely owing to aHLP's stealth effects conferred by its zwitterionic nature at blood pH. As a result, the aHLP-PDA nanoparticle effectively ablates drug-resistant tumors, leading to 100% mouse survival even on the 32nd day after suspension of photothermal treatment, as demonstrated with the mouse model. This work suggests that a combination of nanotechnology with lessons learned in bacterial antibiotic resistance may offer a feasible and effective strategy for treating drug-resistant cancers often found in relapsing patients. PMID:26654626

  16. Fatty acid composition analyses of the DCMU resistant mutants of Nannochloropsis oculata (eustigmatophyceae)

    NASA Astrophysics Data System (ADS)

    Jimin, Zhang; Shuang, Liu; Xue, Sun; Guanpin, Yang; Xuecheng, Zhang; Zhenhui, Gao

    2003-04-01

    Ultraviolet mutagenesis was applied to Nannochloropsis oculata and three mutants resistant to 3-(3, 4-dichlorophenyl)-1,1-dimethylurea (DCMU) were isolated. The cellular chlorophyll a and total lipid content of the wild are higher in the medium supplemented with DCMU than in the control without DCMU. Without DCMU, the growth rates and chlorophyll a contents of the mutants are similar to those of the wild. Significant changes of fatty acid content and composition have occurred in DCMU-resistant mutants growing in the medium supplemented with DCMU. The total lipid, palmitic acid (16:0), palmitoleic acid (16:1ω9) and oleic (18:1ω9) contents decrease significantly, while the vaccenic acid (18:1ω11) increases significantly and the EPA content of dried powder increases slightly in the mutants. The study may provide a basis to improve EPA content in Nannochloropsis oculata in the future.

  17. A new detection method for a newly revealed mechanism of pyrethroid resistance development in Varroa destructor.

    PubMed

    Strachecka, Aneta; Borsuk, Grzegorz; Olszewski, Krzysztof; Paleolog, Jerzy

    2015-11-01

    The Varroa destructor mite has recently displayed an ever increasing resistance to new drugs, contributing to CCD proliferation. This work was aimed at determining new viable methods for identifying the pyrethroid resistance of V. destructor and DNA methylation in resistant and sensitive mites. DNA was extracted from Varroa mites. Nucleotide changes in the DNA of pyrethroid-resistant, pyrethroid-sensitive, and control mites were identified with polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) in the case of five mitochondrial gene fragments. More bands were observed in the drug-resistant mites than in the other two groups. Sequencing confirmed these observations. Decreased global DNA methylation levels were observed in the pyrethroid-resistant mites. There exists a previously undescribed mechanism of pyrethroid resistance development in Varroa mites. The PCR-SSCP methods can be considered and further developed as useful tools for detecting V. destructor resistance. PMID:26210302

  18. Hydrogen induced redox mechanism in amorphous carbon resistive random access memory

    PubMed Central

    2014-01-01

    We investigated the bipolar resistive switching characteristics of the resistive random access memory (RRAM) device with amorphous carbon layer. Applying a forming voltage, the amorphous carbon layer was carbonized to form a conjugation double bond conductive filament. We proposed a hydrogen redox model to clarify the resistive switch mechanism of high/low resistance states (HRS/LRS) in carbon RRAM. The electrical conduction mechanism of LRS is attributed to conductive sp2 carbon filament with conjugation double bonds by dehydrogenation, while the electrical conduction of HRS resulted from the formation of insulating sp3-type carbon filament through hydrogenation process. PMID:24475979

  19. Phosphonoacetic Acid-Resistant Herpes Simplex Virus Infection in Hairless Mice1

    PubMed Central

    Klein, Richard J.; Friedman-Kien, Alvin E.

    1975-01-01

    Phosphonoacetic acid (PAA)-resistant type 1 herpes simplex virus population was isolated by repeated passage of the virus in the presence of this inhibitor. Hairless mice infected percutaneously with the inhibitor-resistant or the parental inhibitor-susceptible virus were treated intraperitoneally with PAA and 9-β-d-arabinofuranosyl-adenine by using several different dosage schedules. Whereas 9-β-d-arabinofuranosyl-adenine was effective both in the PAA-susceptible and PAA-resistant herpes simplex virus-induced skin infection, PAA suppressed only the infection induced by the parental PAA-susceptible virus. PMID:166611

  20. Electrochemical and Mechanical Behavior of Lead-Silver and Lead-Bismuth Casting Alloys for Lead-Acid Battery Components

    NASA Astrophysics Data System (ADS)

    Osório, Wislei R.; Peixoto, Leandro C.; Garcia, Amauri

    2015-09-01

    The present study focuses on the interrelation of microstructure, mechanical properties, and corrosion resistance of Pb-Ag and Pb-Bi casting alloys, which can be used in the manufacture of lead-acid battery components, as potential alternatives to alloys currently used. A water-cooled solidification system is used, in which vertical upward directional solidification is promoted permitting a wide range of microstructures to be investigated. Correlations between microstructural arrays, tensile strengths, and corrosion resistances of Pb-1 wt pct Ag, Pb-2.5 wt pct Ag, Pb-1 wt pct Bi, and Pb-2.5 wt pct Bi alloys are envisaged. It is shown that a compromise between corrosion resistance (represented by the corrosion current density) and mechanical properties (represented by the ultimate tensile strength) can be obtained. Comparisons between specific strengths and mechanical/corrosion ratios are also made. It is also shown that, for microstructures solidified under cooling rates higher than 10 K/s, the Pb-Ag alloys exhibit higher specific strength and mechanical/corrosion ratio. In contrast, for casting processes in which the cooling rates are lower than 5 K/s, the dilute Pb-Bi alloy ( i.e., 1 wt pct Bi) is shown to have more appropriate requirements for lead-acid battery components. Comparisons between specific strengths, mechanical/corrosion ratio, and relative weight and cost with Pb-Sn and Pb-Sb alloys are also made.

  1. Mechanisms of antimicrobial resistance and genetic relatedness among enterococci isolated from dogs and cats in the United States

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Aims: In this study, mechanisms of antimicrobial resistance and genetic relatedness among resistant enterococci from dogs and cats in the United States were determined. Methods and Results: Enterococci resistant to chloramphenicol, ciprofloxacin, erythromycin, gentamicin, kanamycin, streptomycin,...

  2. Membrane fouling in a membrane bioreactor: High filtration resistance of gel layer and its underlying mechanism.

    PubMed

    Chen, Jianrong; Zhang, Meijia; Li, Fengquan; Qian, Lei; Lin, Hongjun; Yang, Lining; Wu, Xilin; Zhou, Xiaoling; He, Yiming; Liao, Bao-Qiang

    2016-10-01

    A membrane bioreactor (MBR) was continuously operated to investigate mechanisms of fouling caused by the gel layer in this study. Agar was used as a model foulant for gel layer formation, and filtration resistance of gel layers was systematically assessed. The results showed that gel layer possessed unusually high specific filtration resistance (SFR) and high measured porosity as compared with cake layer. Current knowledge cannot explain the contradiction between high filtration resistance and high porosity of gel layer. A new fouling mechanism based on Flory-Huggins theory was then proposed. Filtration resistance of agar gel layer was found to be independent of pH and ionic strength, but linearly increase with gel thickness. The results are accordant with the mechanism deductions. Simulation of the mechanism model showed that the filtration resistance induced by mixing chemical potential variation was comparable to the experimental data of filtration resistance of agar gel layer, indicating that the proposed mechanism is the predominant mechanism responsible for the high filtration resistance of gel layer. The proposed mechanism was further verified from the bound water viewpoint. PMID:27328364

  3. Anti-Plasmodial Polyvalent Interactions in Artemisia annua L. Aqueous Extract – Possible Synergistic and Resistance Mechanisms

    PubMed Central

    Suberu, John O.; Gorka, Alexander P.; Jacobs, Lauren; Roepe, Paul D.; Sullivan, Neil

    2013-01-01

    Artemisia annua hot water infusion (tea) has been used in in vitro experiments against P. falciparum malaria parasites to test potency relative to equivalent pure artemisinin. High performance liquid chromatography (HPLC) and mass spectrometric analyses were employed to determine the metabolite profile of tea including the concentrations of artemisinin (47.5±0.8 mg L-1), dihydroartemisinic acid (70.0±0.3 mg L-1), arteannuin B (1.3±0.0 mg L-1), isovitexin (105.0±7.2 mg L-1) and a range of polyphenolic acids. The tea extract, purified compounds from the extract, and the combination of artemisinin with the purified compounds were tested against chloroquine sensitive and chloroquine resistant strains of P. falciparum using the DNA-intercalative SYBR Green I assay. The results of these in vitro tests and of isobologram analyses of combination effects showed mild to strong antagonistic interactions between artemisinin and the compounds (9-epi-artemisinin and artemisitene) extracted from A. annua with significant (IC50 <1 μM) anti-plasmodial activities for the combination range evaluated. Mono-caffeoylquinic acids, tri-caffeoylquinic acid, artemisinic acid and arteannuin B showed additive interaction while rosmarinic acid showed synergistic interaction with artemisinin in the chloroquine sensitive strain at a combination ratio of 1:3 (artemisinin to purified compound). In the chloroquine resistant parasite, using the same ratio, these compounds strongly antagonised artemisinin anti-plasmodial activity with the exception of arteannuin B, which was synergistic. This result would suggest a mechanism targeting parasite resistance defenses for arteannuin B’s potentiation of artemisinin. PMID:24244716

  4. Etoxazole resistance in predatory mite Phytoseiulus persimilis A.-H. (Acari: Phytoseiidae): Cross-resistance, inheritance and biochemical resistance mechanisms.

    PubMed

    Yorulmaz Salman, Sibel; Aydınlı, Fatma; Ay, Recep

    2015-07-01

    Phytoseiulus persimilis of the family Phytoseiidae is an effective predatory mite species that is used to control pest mites. The LC50 and LC60 values of etoxazole were determined on P. persimilis using a leaf-disc method and spraying tower. A laboratory selection population designated ETO6 was found to have a 111.63-fold resistance to etoxazole following 6 selection cycles. This population developed low cross-resistance to spinosad, spiromesifen, acetamiprid, indoxacarb, chlorantraniliprole, milbemectin and moderate cross-resistance to deltamethrin. PBO, IBP and DEM synergised resistance 3.17-, 2.85- and 3.60-fold respectively. Crossing experiments revealed that etoxazole resistance in the ETO6 population was an intermediately dominant and polygenic. In addition, detoxifying enzyme activities were increased 2.71-fold for esterase, 3.09-fold for glutathione S-transferase (GST) and 2.76-fold for cytochrome P450 monooxygenase (P450) in the ETO6 population. Selection for etoxazole under laboratory conditions resulted in the development of etoxazole resistance in the predatory mite P. persimilis that are resistant to pesticides are considered valuable for use in resistance management programmes within integrated pest control strategies. PMID:26071813

  5. New antivirals - mechanism of action and resistance development.

    PubMed

    Balzarini, J; Naesens, L; De Clercq, E

    1998-10-01

    In recent years, several novel treatment modalities emerged for a number of virus infections, including lamivudine for hepatitis B virus, abacavir, adefovir dipivoxyl and apropovir disprometil for human immunodeficiency virus, cidofovir for cytomegalovirus, and famciclovir (the oral prodrug of penciclovir) and cidofovir for other herpesviruses (i.e. herpes simplex virus and varicella-zoster virus). For all drugs, resistance eventually develops upon prolonged administration to the infected individuals, albeit at a varying extent. In addition, new mutations related to multidrug resistance have recently been identified. PMID:10066527

  6. Predictive performance of microarray gene signatures: impact of tumor heterogeneity and multiple mechanisms of drug resistance

    PubMed Central

    A’Hern, Roger; Bidard, Francois-Clement; Lemetre, Christophe; Swanton, Charles; Shen, Ronglai; Reis-Filho, Jorge S.

    2014-01-01

    Gene signatures have failed to predict responses to breast cancer therapy in patients to date. In this study, we used bioinformatic methods to explore the hypothesis that the existence of multiple drug resistance mechanisms in different patients may limit the power of gene signatures to predict responses to therapy. Additionally, we explored whether sub-stratification of resistant cases could improve performance. Gene expression profiles from 1,550 breast cancers analyzed with the same microarray platform were retrieved from publicly available sources. Gene expression changes were introduced in cases defined as sensitive or resistant to a hypothetical therapy. In the resistant group, up to five different mechanisms of drug resistance causing distinct or overlapping gene expression changes were generated bioinformatically, and their impact on sensitivity, specificity and predictive values of the signatures was investigated. We found that increasing the number of resistance mechanisms corresponding to different gene expression changes weakened the performance of the predictive signatures generated, even if the resistance-induced changes in gene expression were sufficiently strong and informative. Performance was also affected by cohort composition and the proportion of sensitive versus resistant cases or resistant cases that were mechanistically distinct. It was possible to improve response prediction by sub-stratifying chemotherapy-resistant cases from actual datasets (non-bioinformatically-perturbed datasets), and by using outliers to model multiple resistance mechanisms. Our work supports the hypothesis that the presence of multiple resistance mechanisms to a given therapy in patients limits the ability of gene signatures to make clinically-useful predictions. PMID:24706696

  7. Multiple Mechanisms Increase Levels of Resistance in Rapistrum rugosum to ALS Herbicides

    PubMed Central

    Hatami, Zahra M.; Gherekhloo, Javid; Rojano-Delgado, Antonia M.; Osuna, Maria D.; Alcántara, Ricardo; Fernández, Pablo; Sadeghipour, Hamid R.; De Prado, Rafael

    2016-01-01

    Rapistrum rugosum (turnip weed) is a common weed of wheat fields in Iran, which is most often controlled by tribenuron-methyl (TM), a sulfonylurea (SU) belonging to the acetolactate synthase (ALS) inhibiting herbicides group. Several cases of unexplained control failure of R. rugosum by TM have been seen, especially in Golestan province-Iran. Hence, there is lack of research in evaluation of the level of resistance of the R. rugosum populations to TM, using whole plant dose-response and enzyme assays, then investigating some potential resistance mechanisms Results revealed that the resistance factor (RF) for resistant (R) populations was 2.5–6.6 fold higher than susceptible (S) plant. Neither foliar retention, nor 14C-TM absorption and translocation were the mechanisms responsible for resistance in turnip weed. Metabolism of TM was the second resistant mechanism in two populations (Ag-R5 and G-1), in which three metabolites were found. The concentration of TM for 50% inhibition of ALS enzyme activity in vitro showed a high level of resistance to the herbicide (RFs were from 28 to 38) and cross-resistance to sulfonyl-aminocarbonyl-triazolinone (SCT), pyrimidinyl-thiobenzoate (PTB) and triazolopyrimidine (TP), with no cross-resistance to imidazolinone (IMI). Substitution Pro 197 to Ser 197 provided resistance to four of five ALS-inhibiting herbicides including SU, TP, PTB, and SCT with no resistance to IMI. These results documented the first case of R. rugosum resistant population worldwide and demonstrated that both RST and NRST mechanisms are involved to the resistance level to TM. PMID:26941749

  8. Multiple Mechanisms Increase Levels of Resistance in Rapistrum rugosum to ALS Herbicides.

    PubMed

    Hatami, Zahra M; Gherekhloo, Javid; Rojano-Delgado, Antonia M; Osuna, Maria D; Alcántara, Ricardo; Fernández, Pablo; Sadeghipour, Hamid R; De Prado, Rafael

    2016-01-01

    Rapistrum rugosum (turnip weed) is a common weed of wheat fields in Iran, which is most often controlled by tribenuron-methyl (TM), a sulfonylurea (SU) belonging to the acetolactate synthase (ALS) inhibiting herbicides group. Several cases of unexplained control failure of R. rugosum by TM have been seen, especially in Golestan province-Iran. Hence, there is lack of research in evaluation of the level of resistance of the R. rugosum populations to TM, using whole plant dose-response and enzyme assays, then investigating some potential resistance mechanisms Results revealed that the resistance factor (RF) for resistant (R) populations was 2.5-6.6 fold higher than susceptible (S) plant. Neither foliar retention, nor (14)C-TM absorption and translocation were the mechanisms responsible for resistance in turnip weed. Metabolism of TM was the second resistant mechanism in two populations (Ag-R5 and G-1), in which three metabolites were found. The concentration of TM for 50% inhibition of ALS enzyme activity in vitro showed a high level of resistance to the herbicide (RFs were from 28 to 38) and cross-resistance to sulfonyl-aminocarbonyl-triazolinone (SCT), pyrimidinyl-thiobenzoate (PTB) and triazolopyrimidine (TP), with no cross-resistance to imidazolinone (IMI). Substitution Pro 197 to Ser 197 provided resistance to four of five ALS-inhibiting herbicides including SU, TP, PTB, and SCT with no resistance to IMI. These results documented the first case of R. rugosum resistant population worldwide and demonstrated that both RST and NRST mechanisms are involved to the resistance level to TM. PMID:26941749

  9. Chemical Changes Associated with Increased Acid Resistance of Er:YAG Laser Irradiated Enamel

    PubMed Central

    Olea-Mejía, Oscar Fernando; García-Fabila, María Magdalena; Rodríguez-Vilchis, Laura Emma; Sánchez-Flores, Ignacio; Centeno-Pedraza, Claudia

    2014-01-01

    Background. An increase in the acid resistance of dental enamel, as well as morphological and structural changes produced by Er:YAG laser irradiation, has been reported. Purpose. To evaluate the chemical changes associated with acid resistance of enamel treated with Er:YAG laser. Methods. Forty-eight enamel samples were divided into 4 groups (n = 12). Group I (control); Groups II, III, and IV were irradiated with Er:YAG at 100 mJ (12.7 J/cm2), 200 mJ (25.5 J/cm2), and 300 mJ (38.2 J/cm2), respectively. Results. There were significant differences in composition of irradiated groups (with the exception of chlorine) and in the amount of calcium released. Conclusions. Chemical changes associated with an increase in acid resistance of enamel treated with Er:YAG laser showed a clear postirradiation pattern characterized by a decrease in C at.% and an increase in O, P, and Ca at.% and no changes in Cl at.%. An increased Ca/P ratio after Er:YAG laser irradiation was associated with the use of higher laser energy densities. Chemical changes produced by acid dissolution showed a similar trend among experimental groups. Stable or increased Ca/P ratio after acid dissolution was observed in the irradiated groups, with reduction of Ca released into the acid solution. PMID:24600327

  10. Disruption of abscisic acid signaling constitutively activates Arabidopsis resistance to the necrotrophic fungus Plectosphaerella cucumerina.

    PubMed

    Sánchez-Vallet, Andrea; López, Gemma; Ramos, Brisa; Delgado-Cerezo, Magdalena; Riviere, Marie-Pierre; Llorente, Francisco; Fernández, Paula Virginia; Miedes, Eva; Estevez, José Manuel; Grant, Murray; Molina, Antonio

    2012-12-01

    Plant resistance to necrotrophic fungi is regulated by a complex set of signaling pathways that includes those mediated by the hormones salicylic acid (SA), ethylene (ET), jasmonic acid (JA), and abscisic acid (ABA). The role of ABA in plant resistance remains controversial, as positive and negative regulatory functions have been described depending on the plant-pathogen interaction analyzed. Here, we show that ABA signaling negatively regulates Arabidopsis (Arabidopsis thaliana) resistance to the necrotrophic fungus Plectosphaerella cucumerina. Arabidopsis plants impaired in ABA biosynthesis, such as the aba1-6 mutant, or in ABA signaling, like the quadruple pyr/pyl mutant (pyr1pyl1pyl2pyl4), were more resistant to P. cucumerina than wild-type plants. In contrast, the hab1-1abi1-2abi2-2 mutant impaired in three phosphatases that negatively regulate ABA signaling displayed an enhanced susceptibility phenotype to this fungus. Comparative transcriptomic analyses of aba1-6 and wild-type plants revealed that the ABA pathway negatively regulates defense genes, many of which are controlled by the SA, JA, or ET pathway. In line with these data, we found that aba1-6 resistance to P. cucumerina was partially compromised when the SA, JA, or ET pathway was disrupted in this mutant. Additionally, in the aba1-6 plants, some genes encoding cell wall-related proteins were misregulated. Fourier transform infrared spectroscopy and biochemical analyses of cell walls from aba1-6 and wild-type plants revealed significant differences in their Fourier transform infrared spectratypes and uronic acid and cellulose contents. All these data suggest that ABA signaling has a complex function in Arabidopsis basal resistance, negatively regulating SA/JA/ET-mediated resistance to necrotrophic fungi. PMID:23037505

  11. The High Level of Aluminum Resistance in Signalgrass Is Not Associated with Known Mechanisms of External Aluminum Detoxification in Root Apices1

    PubMed Central

    Wenzl, Peter; Patiño, Gloria M.; Chaves, Alba L.; Mayer, Jorge E.; Rao, Idupulapati M.

    2001-01-01

    Al resistance of signalgrass (Brachiaria decumbens Stapf cv Basilisk), a widely sown tropical forage grass, is outstanding compared with the closely related ruzigrass (Brachiaria ruziziensis Germain and Evrard cv Common) and Al-resistant genotypes of graminaceous crops such as wheat, triticale, and maize. Secretion of organic acids and phosphate by root apices and alkalinization of the apical rhizosphere are commonly believed to be important mechanisms of Al resistance. However, root apices of signalgrass secreted only moderately larger quantities of organic acids than did those of ruzigrass, and efflux from signalgrass apices was three to 30 times smaller than from apices of Al-resistant genotypes of buckwheat, maize, and wheat (all much more sensitive to Al than signalgrass). In the presence, but not absence, of Al, root apices of signalgrass alkalinized the rhizosphere more than did those of ruzigrass. The latter was associated with a shortening of the alkalinizing zone in Al-intoxicated apices of ruzigrass, indicating that differences in alkalinizing power were a consequence, not a cause of, differential Al resistance. These data indicate that the main mechanism of Al resistance in signalgrass does not involve external detoxification of Al. Therefore, highly effective resistance mechanisms based on different physiological strategies appear to operate in this species. PMID:11244126

  12. Arabidopsis ENHANCED DISEASE SUSCEPTIBILITY1 promotes systemic acquired resistance via azelaic acid and its precursor 9-oxo nonanoic acid.

    PubMed

    Wittek, Finni; Hoffmann, Thomas; Kanawati, Basem; Bichlmeier, Marlies; Knappe, Claudia; Wenig, Marion; Schmitt-Kopplin, Philippe; Parker, Jane E; Schwab, Wilfried; Vlot, A Corina

    2014-11-01

    Systemic acquired resistance (SAR) is a form of inducible disease resistance that depends on salicylic acid and its upstream regulator ENHANCED DISEASE SUSCEPTIBILITY1 (EDS1). Although local Arabidopsis thaliana defence responses activated by the Pseudomonas syringae effector protein AvrRpm1 are intact in eds1 mutant plants, SAR signal generation is abolished. Here, the SAR-specific phenotype of the eds1 mutant is utilized to identify metabolites that contribute to SAR. To this end, SAR bioassay-assisted fractionation of extracts from the wild type compared with eds1 mutant plants that conditionally express AvrRpm1 was performed. Using high-performance liquid chromatography followed by mass spectrometry, systemic immunity was associated with the accumulation of 60 metabolites, including the putative SAR signal azelaic acid (AzA) and its precursors 9-hydroperoxy octadecadienoic acid (9-HPOD) and 9-oxo nonanoic acid (ONA). Exogenous ONA induced SAR in systemic untreated leaves when applied at a 4-fold lower concentration than AzA. The data suggest that in planta oxidation of ONA to AzA might be partially responsible for this response and provide further evidence that AzA mobilizes Arabidopsis immunity in a concentration-dependent manner. The AzA fragmentation product pimelic acid did not induce SAR. The results link the C9 lipid peroxidation products ONA and AzA with systemic rather than local resistance and suggest that EDS1 directly or indirectly promotes the accumulation of ONA, AzA, or one or more of their common precursors possibly by activating one or more pathways that either result in the release of these compounds from galactolipids or promote lipid peroxidation. PMID:25114016

  13. Arabidopsis ENHANCED DISEASE SUSCEPTIBILITY1 promotes systemic acquired resistance via azelaic acid and its precursor 9-oxo nonanoic acid

    PubMed Central

    Wittek, Finni; Hoffmann, Thomas; Kanawati, Basem; Bichlmeier, Marlies; Knappe, Claudia; Wenig, Marion; Schmitt-Kopplin, Philippe; Parker, Jane E.; Schwab, Wilfried; Vlot, A. Corina

    2014-01-01

    Systemic acquired resistance (SAR) is a form of inducible disease resistance that depends on salicylic acid and its upstream regulator ENHANCED DISEASE SUSCEPTIBILITY1 (EDS1). Although local Arabidopsis thaliana defence responses activated by the Pseudomonas syringae effector protein AvrRpm1 are intact in eds1 mutant plants, SAR signal generation is abolished. Here, the SAR-specific phenotype of the eds1 mutant is utilized to identify metabolites that contribute to SAR. To this end, SAR bioassay-assisted fractionation of extracts from the wild type compared with eds1 mutant plants that conditionally express AvrRpm1 was performed. Using high-performance liquid chromatography followed by mass spectrometry, systemic immunity was associated with the accumulation of 60 metabolites, including the putative SAR signal azelaic acid (AzA) and its precursors 9-hydroperoxy octadecadienoic acid (9-HPOD) and 9-oxo nonanoic acid (ONA). Exogenous ONA induced SAR in systemic untreated leaves when applied at a 4-fold lower concentration than AzA. The data suggest that in planta oxidation of ONA to AzA might be partially responsible for this response and provide further evidence that AzA mobilizes Arabidopsis immunity in a concentration-dependent manner. The AzA fragmentation product pimelic acid did not induce SAR. The results link the C9 lipid peroxidation products ONA and AzA with systemic rather than local resistance and suggest that EDS1 directly or indirectly promotes the accumulation of ONA, AzA, or one or more of their common precursors possibly by activating one or more pathways that either result in the release of these compounds from galactolipids or promote lipid peroxidation. PMID:25114016

  14. Insulin resistance is a cellular antioxidant defense mechanism.

    PubMed

    Hoehn, Kyle L; Salmon, Adam B; Hohnen-Behrens, Cordula; Turner, Nigel; Hoy, Andrew J; Maghzal, Ghassan J; Stocker, Roland; Van Remmen, Holly; Kraegen, Edward W; Cooney, Greg J; Richardson, Arlan R; James, David E

    2009-10-20

    We know a great deal about the cellular response to starvation via AMPK, but less is known about the reaction to nutrient excess. Insulin resistance may be an appropriate response to nutrient excess, but the cellular sensors that link these parameters remain poorly defined. In the present study we provide evidence that mitochondrial superoxide production is a common feature of many different models of insulin resistance in adipocytes, myotubes, and mice. In particular, insulin resistance was rapidly reversible upon exposure to agents that act as mitochondrial uncouplers, ETC inhibitors, or mitochondrial superoxide dismutase (MnSOD) mimetics. Similar effects were observed with overexpression of mitochondrial MnSOD. Furthermore, acute induction of mitochondrial superoxide production using the complex III antagonist antimycin A caused rapid attenuation of insulin action independently of changes in the canonical PI3K/Akt pathway. These results were validated in vivo in that MnSOD transgenic mice were partially protected against HFD induced insulin resistance and MnSOD+/- mice were glucose intolerant on a standard chow diet. These data place mitochondrial superoxide at the nexus between intracellular metabolism and the control of insulin action potentially defining this as a metabolic sensor of energy excess. PMID:19805130

  15. Mechanism of DMI resistance in field isolates of Cercospora beticola

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Leaf spot, caused by the fungus Cercospora beticola, is an endemic disease of sugarbeets in the North Dakota and Minnesota growing regions. Control measures against the fungus include resistant sugarbeet varieties and crop rotation, but the disease is managed effectively only when combined with tim...

  16. Insights into molecular mechanism of blast resistance in weedy rice

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Weedy rice is a serious pest in direct-seeded rice fields in the U.S. and worldwide. Under suitable conditions, weedy rice can reduce crop yields up to 70%. However, weedy rice may carry novel disease resistance genes. Rice blast disease caused by the fungus Magnaporthe oryzae is a major disease wo...

  17. Insulin resistance is a cellular antioxidant defense mechanism

    PubMed Central

    Hoehn, Kyle L.; Salmon, Adam B.; Hohnen-Behrens, Cordula; Turner, Nigel; Hoy, Andrew J.; Maghzal, Ghassan J.; Stocker, Roland; Van Remmen, Holly; Kraegen, Edward W.; Cooney, Greg J.; Richardson, Arlan R.; James, David E.

    2009-01-01

    We know a great deal about the cellular response to starvation via AMPK, but less is known about the reaction to nutrient excess. Insulin resistance may be an appropriate response to nutrient excess, but the cellular sensors that link these parameters remain poorly defined. In the present study we provide evidence that mitochondrial superoxide production is a common feature of many different models of insulin resistance in adipocytes, myotubes, and mice. In particular, insulin resistance was rapidly reversible upon exposure to agents that act as mitochondrial uncouplers, ETC inhibitors, or mitochondrial superoxide dismutase (MnSOD) mimetics. Similar effects were observed with overexpression of mitochondrial MnSOD. Furthermore, acute induction of mitochondrial superoxide production using the complex III antagonist antimycin A caused rapid attenuation of insulin action independently of changes in the canonical PI3K/Akt pathway. These results were validated in vivo in that MnSOD transgenic mice were partially protected against HFD induced insulin resistance and MnSOD+/− mice were glucose intolerant on a standard chow diet. These data place mitochondrial superoxide at the nexus between intracellular metabolism and the control of insulin action potentially defining this as a metabolic sensor of energy excess. PMID:19805130

  18. Emerging memories: resistive switching mechanisms and current status

    NASA Astrophysics Data System (ADS)

    Jeong, Doo Seok; Thomas, Reji; Katiyar, R. S.; Scott, J. F.; Kohlstedt, H.; Petraru, A.; Hwang, Cheol Seong

    2012-07-01

    The resistance switching behaviour of several materials has recently attracted considerable attention for its application in non-volatile memory (NVM) devices, popularly described as resistive random access memories (RRAMs). RRAM is a type of NVM that uses a material(s) that changes the resistance when a voltage is applied. Resistive switching phenomena have been observed in many oxides: (i) binary transition metal oxides (TMOs), e.g. TiO2, Cr2O3, FeOx and NiO; (ii) perovskite-type complex TMOs that are variously functional, paraelectric, ferroelectric, multiferroic and magnetic, e.g. (Ba,Sr)TiO3, Pb(Zrx Ti1-x)O3, BiFeO3 and PrxCa1-xMnO3 (iii) large band gap high-k dielectrics, e.g. Al2O3 and Gd2O3; (iv) graphene oxides. In the non-oxide category, higher chalcogenides are front runners, e.g. In2Se3 and In2Te3. Hence, the number of materials showing this technologically interesting behaviour for information storage is enormous. Resistive switching in these materials can form the basis for the next generation of NVM, i.e. RRAM, when current semiconductor memory technology reaches its limit in terms of density. RRAMs may be the high-density and low-cost NVMs of the future. A review on this topic is of importance to focus concentration on the most promising materials to accelerate application into the semiconductor industry. This review is a small effort to realize the ambitious goal of RRAMs. Its basic focus is on resistive switching in various materials with particular emphasis on binary TMOs. It also addresses the current understanding of resistive switching behaviour. Moreover, a brief comparison between RRAMs and memristors is included. The review ends with the current status of RRAMs in terms of stability, scalability and switching speed, which are three important aspects of integration onto semiconductors.

  19. Emerging memories: resistive switching mechanisms and current status.

    PubMed

    Jeong, Doo Seok; Thomas, Reji; Katiyar, R S; Scott, J F; Kohlstedt, H; Petraru, A; Hwang, Cheol Seong

    2012-07-01

    The resistance switching behaviour of several materials has recently attracted considerable attention for its application in non-volatile memory (NVM) devices, popularly described as resistive random access memories (RRAMs). RRAM is a type of NVM that uses a material(s) that changes the resistance when a voltage is applied. Resistive switching phenomena have been observed in many oxides: (i) binary transition metal oxides (TMOs), e.g. TiO(2), Cr(2)O(3), FeO(x) and NiO; (ii) perovskite-type complex TMOs that are variously functional, paraelectric, ferroelectric, multiferroic and magnetic, e.g. (Ba,Sr)TiO(3), Pb(Zr(x) Ti(1-x))O(3), BiFeO(3) and Pr(x)Ca(1-x)MnO(3); (iii) large band gap high-k dielectrics, e.g. Al(2)O(3) and Gd(2)O(3); (iv) graphene oxides. In the non-oxide category, higher chalcogenides are front runners, e.g. In(2)Se(3) and In(2)Te(3). Hence, the number of materials showing this technologically interesting behaviour for information storage is enormous. Resistive switching in these materials can form the basis for the next generation of NVM, i.e. RRAM, when current semiconductor memory technology reaches its limit in terms of density. RRAMs may be the high-density and low-cost NVMs of the future. A review on this topic is of importance to focus concentration on the most promising materials to accelerate application into the semiconductor industry. This review is a small effort to realize the ambitious goal of RRAMs. Its basic focus is on resistive switching in various materials with particular emphasis on binary TMOs. It also addresses the current understanding of resistive switching behaviour. Moreover, a brief comparison between RRAMs and memristors is included. The review ends with the current status of RRAMs in terms of stability, scalability and switching speed, which are three important aspects of integration onto semiconductors. PMID:22790779

  20. Cisplatin Resistant Spheroids Model Clinically Relevant Survival Mechanisms in Ovarian Tumors.

    PubMed

    Chowanadisai, Winyoo; Messerli, Shanta M; Miller, Daniel H; Medina, Jamie E; Hamilton, Joshua W; Messerli, Mark A; Brodsky, Alexander S

    2016-01-01

    The majority of ovarian tumors eventually recur in a drug resistant form. Using cisplatin sensitive and resistant cell lines assembled into 3D spheroids we profiled gene expression and identified candidate mechanisms and biological pathways associated with cisplatin resistance. OVCAR-8 human ovarian carcinoma cells were exposed to sub-lethal concentrations of cisplatin to create a matched cisplatin-resistant cell line, OVCAR-8R. Genome-wide gene expression profiling of sensitive and resistant ovarian cancer spheroids identified 3,331 significantly differentially expressed probesets coding for 3,139 distinct protein-coding genes (Fc >2, FDR < 0.05) (S2 Table). Despite significant expression changes in some transporters including MDR1, cisplatin resistance was not associated with differences in intracellular cisplatin concentration. Cisplatin resistant cells were significantly enriched for a mesenchymal gene expression signature. OVCAR-8R resistance derived gene sets were significantly more biased to patients with shorter survival. From the most differentially expressed genes, we derived a 17-gene expression signature that identifies ovarian cancer patients with shorter overall survival in three independent datasets. We propose that the use of cisplatin resistant cell lines in 3D spheroid models is a viable approach to gain insight into resistance mechanisms relevant to ovarian tumors in patients. Our data support the emerging concept that ovarian cancers can acquire drug resistance through an epithelial-to-mesenchymal transition. PMID:26986722

  1. Evidence of multiple pyrethroid resistance mechanisms in the malaria vector Anopheles gambiae sensu stricto from Nigeria.

    PubMed

    Awolola, T S; Oduola, O A; Strode, C; Koekemoer, L L; Brooke, B; Ranson, H

    2009-11-01

    Pyrethroid insecticide resistance in Anopheles gambiae sensu stricto is a major concern to malaria vector control programmes. Resistance is mainly due to target-site insensitivity arising from a single point mutation, often referred to as knockdown resistance (kdr). Metabolic-based resistance mechanisms have also been implicated in pyrethroid resistance in East Africa and are currently being investigated in West Africa. Here we report the co-occurrence of both resistance mechanisms in a population of An. gambiae s.s. from Nigeria. Bioassay, synergist and biochemical analysis carried out on resistant and susceptible strains of An. gambiae s.s. from the same geographical area revealed >50% of the West African kdr mutation in the resistant mosquitoes but <3% in the susceptible mosquitoes. Resistant mosquitoes synergized using pyperonyl butoxide before permethrin exposure showed a significant increase in mortality compared with the non-synergized. Biochemical assays showed an increased level of monooxygenase but not glutathione-S-transferase or esterase activities in the resistant mosquitoes. Microarray analysis using the An. gambiae detox-chip for expression of detoxifying genes showed five over-expressed genes in the resistant strain when compared with the susceptible one. Two of these, CPLC8 and CPLC#, are cuticular genes not implicated in pyrethroid metabolism in An. gambiae s.s, and could constitute a novel set of candidate genes that warrant further investigation. PMID:18829056

  2. Cisplatin Resistant Spheroids Model Clinically Relevant Survival Mechanisms in Ovarian Tumors

    PubMed Central

    Miller, Daniel H.; Medina, Jamie E.; Hamilton, Joshua W.; Messerli, Mark A.; Brodsky, Alexander S.

    2016-01-01

    The majority of ovarian tumors eventually recur in a drug resistant form. Using cisplatin sensitive and resistant cell lines assembled into 3D spheroids we profiled gene expression and identified candidate mechanisms and biological pathways associated with cisplatin resistance. OVCAR-8 human ovarian carcinoma cells were exposed to sub-lethal concentrations of cisplatin to create a matched cisplatin-resistant cell line, OVCAR-8R. Genome-wide gene expression profiling of sensitive and resistant ovarian cancer spheroids identified 3,331 significantly differentially expressed probesets coding for 3,139 distinct protein-coding genes (Fc >2, FDR < 0.05) (S2 Table). Despite significant expression changes in some transporters including MDR1, cisplatin resistance was not associated with differences in intracellular cisplatin concentration. Cisplatin resistant cells were significantly enriched for a mesenchymal gene expression signature. OVCAR-8R resistance derived gene sets were significantly more biased to patients with shorter survival. From the most differentially expressed genes, we derived a 17-gene expression signature that identifies ovarian cancer patients with shorter overall survival in three independent datasets. We propose that the use of cisplatin resistant cell lines in 3D spheroid models is a viable approach to gain insight into resistance mechanisms relevant to ovarian tumors in patients. Our data support the emerging concept that ovarian cancers can acquire drug resistance through an epithelial-to-mesenchymal transition. PMID:26986722

  3. Antibiotic susceptibility and molecular mechanisms of macrolide resistance in streptococci isolated from adult cystic fibrosis patients.

    PubMed

    Thornton, Christina S; Grinwis, Margot E; Sibley, Christopher D; Parkins, Michael D; Rabin, Harvey R; Surette, Michael G

    2015-11-01

    The cystic fibrosis (CF) airways are colonized by polymicrobial communities with high bacterial load and are influenced by frequent antibiotic exposures. This community includes diverse streptococci, some of which have been directly or indirectly associated with pulmonary exacerbations. As many streptococci are naturally competent, horizontal transfer of antibiotic-resistant determinants coupled with frequent and/or chronic antibiotic exposure may contribute to high resistance rates. In this study, we assessed antibiotic resistance in 413 streptococcal isolates from adult CF patients against nine antibiotics relevant in CF treatment. We observed very low rates of cephalosporin resistance [cefepime and ceftriaxone ( < 2%)], and higher rates of resistance to tetracycline (∼34%) and sulfamethoxazole/trimethoprim (∼45%). The highest rate of antibiotic resistance was to the macrolides [azithromycin (56.4%) and erythromycin (51.6%)]. We also investigated the molecular mechanisms of macrolide resistance and found that only half of our macrolide-resistant streptococci isolates contained the mef (efflux pump) or erm (methylation of 23S ribosomal target site) genes. The majority of isolates were, however, found to have point mutations at position 2058 or 2059 of the 23S ribosomal subunit - a molecular mechanism of resistance not commonly reported in the non-pyogenic and non-pneumococcal streptococci, and unique in comparison with previous studies. The high rates of resistance observed here may result in poor outcomes where specific streptococci are contributing to CF airway disease and serve as a reservoir of resistance genes within the CF airway microbiome. PMID:26408040

  4. Amino Acid Substitutions of CrrB Responsible for Resistance to Colistin through CrrC in Klebsiella pneumoniae.

    PubMed

    Cheng, Yi-Hsiang; Lin, Tzu-Lung; Lin, Yi-Tsung; Wang, Jin-Town

    2016-06-01

    Colistin is a last-resort antibiotic for treatment of carbapenem-resistant Klebsiella pneumoniae A recent study indicated that missense mutations in the CrrB protein contribute to colistin resistance. In our previous study, mechanisms of colistin resistance were defined in 17 of 26 colistin-resistant K. pneumoniae clinical isolates. Of the remaining nine strains, eight were highly resistant to colistin. In the present study, crrAB sequences were determined for these eight strains. Six separate amino acid substitutions in CrrB (Q10L, Y31H, W140R, N141I, P151S, and S195N) were detected. Site-directed mutagenesis was used to generate crrB loci harboring individual missense mutations; introduction of the mutated genes into a susceptible strain, A4528, resulted in 64- to 1,024-fold increases in colistin MICs. These crrB mutants showed increased accumulation of H239_3062, H239_3059, pmrA, pmrC, and pmrH transcripts by quantitative reverse transcription (qRT)-PCR. Deletion of H239_3062 (but not that of H239_3059) in the A4528 crrB(N141I) strain attenuated resistance to colistin, and H239_3062 was accordingly named crrC Similarly, accumulation of pmrA, pmrC, and pmrH transcripts induced by crrB(N141I) was significantly attenuated upon deletion of crrC Complementation of crrC restored resistance to colistin and accumulation of pmrA, pmrC, and pmrH transcripts in a crrB(N141I) ΔcrrC strain. In conclusion, novel individual CrrB amino acid substitutions (Y31H, W140R, N141I, P151S, and S195N) were shown to be responsible for colistin resistance. We hypothesize that CrrB mutations induce CrrC expression, thereby inducing elevated expression of the pmrHFIJKLM operon and pmrC (an effect mediated via the PmrAB two-component system) and yielding increased colistin resistance. PMID:27067316

  5. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  6. The unification of filament and interfacial resistive switching mechanisms for titanium dioxide based memory devices

    NASA Astrophysics Data System (ADS)

    Zhang, F.; Li, X. M.; Gao, X. D.; Wu, L.; Cao, X.; Liu, X. J.; Yang, R.

    2011-05-01

    Reversible and controllable conversion between unipolar and bipolar resistive switching (URS and BRS) was observed in Pt/TiO2/Pt memory devices. The URS and BRS of this device exhibited different low resistance states but shared the same high resistance state. The conduction mechanisms of low resistance states in URS and BRS are Ohmic conduction and electrons tunneling, respectively, while the high resistance state is controlled by Schottky barrier formed at the top interface of Pt/TiO2. The temperature dependence of resistance states indicates Magnéli phase filaments formed in URS. A unified model was then proposed to demonstrate the unification of filament and interfacial switching mechanisms.

  7. Co-administration of glycyrrhizic acid with the antileishmanial drug sodium antimony gluconate (SAG) cures SAG-resistant visceral leishmaniasis.

    PubMed

    Bhattacharjee, Amrita; Majumder, Saikat; Majumdar, Suchandra Bhattacharyya; Choudhuri, Soumitra Kumar; Roy, Syamal; Majumdar, Subrata

    2015-03-01

    Since there are very few affordable antileishmanial drugs available, antimonial resistance has crippled antileishmanial therapy, thereby emphasising the need for development of novel therapeutic strategies. This study aimed to evaluate the antileishmanial role of combined therapy with sodium antimony gluconate (SAG) and the triterpenoid glycyrrhizic acid (GA) against infection with SAG-resistant Leishmania (GE1F8R). Combination therapy with GA and SAG successfully limited infection with SAG-resistant Leishmania in a synergistic manner (fractional inhibitory concentration index <1.0). At the same time, mice infected with SAG-resistant Leishmania and co-treated with GA and SAG exhibited a significant reduction in hepatic and splenic parasite burden. In probing the mechanism, it was observed that GA treatment suppressed the expression and efflux activity of P-glycoprotein (P-gp) and multidrug resistance-associated protein 1 (MRP1), two host ABC transporters responsible for antimony efflux from host cells infected with SAG-resistant parasites. This suppression correlated with greater intracellular antimony retention during SAG therapy both in vitro and in vivo, which was reflected in the reduced parasite load. Furthermore, co-administration of GA and SAG induced a shift in the cytokine balance towards a Th1 phenotype by augmenting pro-inflammatory cytokines (such as IL-12, IFNγ and TNFα) and inducing nitric oxide generation in GE1F8R-infected macrophages as well as GE1F8R-infected mice. This study aims to provide an affordable leishmanicidal alternative to expensive antileishmanial drugs such as miltefosine and amphotericin B. Furthermore, this report explores the role of GA as a resistance modulator in MRP1- and P-gp-overexpressing conditions. PMID:25600891

  8. Investigation of mechanics of mine acid formation. Volume 1

    SciTech Connect

    Paciorek, K.L.; Kimble, P.F.; Vatasescu, A.L.; Toben, W.A.; Kratzer, R.H.

    1980-03-01

    The objective of the contract was to determine, by the combination of laboratory experiments and mine samplings, the kinetics and mechanisms of the various reactions that produce mine acid drainage. To achieve this goal, primary investigations were performed utilizing pure iron disulfide in the form of pyrite and marcasite, free from coal. The effects of temperature, concentration, surface area, media nature, oxygen, presence of additional ions and bacterial action with respect to dissolution rates were measured. Thiobacillus ferrooxidans and T. thiooxidans were included in this study, both as purchased cultures and freshly isolated from mine samples. Mine samplings were performed to determine the type and quantity of bacteria present, the effect of weathering upon coals' propensity to produce acid and other drainage, the effect of other minerals and the nature of the mine water upon ion liberation, and the effect of the different kinds of bacteria upon the above process. It was established that both pyrite and marcasite, provided sufficient surface area is exposed, will produce hydrogen, sulfate, and iron ions. This process is accelerated in the case of pyrite and marcasite by the presence of T. ferrooxidans and ferric ions. T. thiooxidans accelerates marcasite solubilization and the dissolution of iron disulfide present in coal, but had no effect on museum grade pyrite.

  9. Analysis of antimicrobial resistance mechanisms in multi-drug resistant (MDR) Salmonella enterica by high-throughput DNA sequencing

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Multi drug resistant (MDR) Salmonella enterica is found in food animals and may consequently pose a risk to humans through food bor