Science.gov

Sample records for acid ribonucleic acid

  1. Ribonucleic acid purification.

    PubMed

    Martins, R; Queiroz, J A; Sousa, F

    2014-08-15

    Research on RNA has led to many important biological discoveries and improvement of therapeutic technologies. From basic to applied research, many procedures employ pure and intact RNA molecules; however their isolation and purification are critical steps because of the easy degradability of RNA, which can impair chemical stability and biological functionality. The current techniques to isolate and purify RNA molecules still have several limitations and the requirement for new methods able to improve RNA quality to meet regulatory demands is growing. In fact, as basic research improves the understanding of biological roles of RNAs, the biopharmaceutical industry starts to focus on them as a biotherapeutic tools. Chromatographic bioseparation is a high selective unit operation and is the major option in the purification of biological compounds, requiring high purity degree. In addition, its application in biopharmaceutical manufacturing is well established. This paper discusses the importance and the progress of RNA isolation and purification, considering RNA applicability both in research and clinical fields. In particular and in view of the high specificity, affinity chromatography has been recently applied to RNA purification processes. Accordingly, recent chromatographic investigations based on biorecognition phenomena occurring between RNA and amino acids are focused. Histidine and arginine have been used as amino acid ligands, and their ability to isolate different RNA species demonstrated a multipurpose applicability in molecular biology analysis and RNA therapeutics preparation, highlighting the potential contribution of these methods to overcome the challenges of RNA purification. PMID:24951289

  2. Ribonucleic Acid Polymerase in Allomyces arbuscula

    PubMed Central

    Cain, Alice K.; Nester, Eugene W.

    1973-01-01

    Three distinct species of ribonucleic acid (RNA) polymerase were resolved from Allomyces arbuscula by diethylaminoethyl-cellulose chromatography and characterized as to ionic strength and divalent cation preference. α-Amanitin specifically inhibited enzyme II; neither rifampin nor cycloheximide had any effect on the three enzymes. RNA polymerase was isolated from three stages of the diploid life cycle: the hyphal growth stage, mycelia in the process of forming sporangia, and the mitospores. The same three enzyme species could be resolved from each stage. Thus, there is no evidence from this work that RNA polymerase plays a major role in the control of development. PMID:4728272

  3. Ribonucleic acid interference induced gene knockdown

    PubMed Central

    Gottumukkala, Sruthima N. V. S.; Dwarakanath, C. D.; Sudarsan, Sabitha

    2013-01-01

    Despite major advances in periodontal regeneration over the past three decades, complete regeneration of the lost periodontium on a regular and predictable basis in humans has still remained elusive. The identification of stem cells in the periodontal ligament together with the growing concept of tissue engineering has opened new vistas in periodontal regenerative medicine. In this regard, ribonucleic acid interference (RNAi) opens a new gate way for a novel RNA based approach in periodontal management. This paper aims to summarize the current opinion on the mechanisms underlying RNAi, in vitro and in vivo existing applications in the dental research, which could lead to their future use in periodontal regeneration. PMID:24174717

  4. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  5. Ribonucleic acid (RNA) biosynthesis in human cancer.

    PubMed

    Hajjawi, Omar S

    2015-01-01

    In many respects, the most remarkable chemical substances within the genome of eukaryotic cells are remarkable proteins which are the critical structural and functional units of living cells. The specifications for everything that goes in the cell are natural digital-to-digital decoding process in an archive sequence by deoxyribonucleic acid (DNA) and an articulate construction by ribonucleic acid (RNA). The products of DNA transcription are long polymers of ribonucleotides rather than deoxyribonucleotides and are termed ribonucleic acids. Certain deoxyribonucleotide sequences, or genes, give rise to transfer RNA (tRNA) and other ribosomal RNA (rRNA) when transcribed. The ribonucleotide sequences fold extensively and rRNA is associated with specific proteins to yield the essential cell components, ribosomes. Transcription of other special sequences yields messenger RNAs (mRNAs) that contain ribonucleotide sequences that will be ultimately translated into new types of amino acid sequences of functional cellular protein molecules. This switch to a different variety of cellular molecular sequences is complex, but each sequence of the three ribonucleotides specifies the insertion of one particular amino acid into the polypeptide chain under production. Whilst mRNA is considered the vehicle by which genetic information is transmitted from the genome and allocated in the appropriate cytoplasmic sites for translation into protein via cap-dependent mechanism, the actual translation depends also on the presence of other so-called household and luxury protein molecules. Recent evidence suggests RNA species are required at initiation, because treatment of cells with antibiotics or drugs that inhibit RNA synthesis cause a decrease in protein synthesis. The rRNA is necessary as a structural constituent of the ribosomes upon which translation takes place, whereas tRNA is necessary as an adaptor in amino acid activation and elongation protein chains to ribosomes. In this article

  6. Control of dihydrofolate reductase messenger ribonucleic acid production

    SciTech Connect

    Leys, E.J.; Kellems, R.E.

    1981-11-01

    The authors used methotrexate-resistant mouse cells in which dihydrofolate reductase levels are approximately 500 times normal to study the effect of growth stimulation on dihydrofolate reductase gene expression. As a result of growth stimulation, the relative rate of dihydrofolate reductase protein synthesis increased threefold, reaching a maximum between 25 and 30 h after stimulation. The relative rate of dihydrofolate reductase messenger ribonucleic acid production (i.e., the appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm) increased threefold after growth stimulation and was accompanied by a corresponding increase in the relative steady-state level of dihydrofolate reductase ribonucleic acid in the nucleus. However, the increase in the nuclear level of dihydrofolate reductase ribonucleic acid was not accompanied by a significant increase in the relative rate of transcription of the dihydrofolate reductase genes. These data indicated that the relative rate of appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm depends on the relative stability of the dihydrofolate reductase ribonucleic acid sequences in the nucleus and is not dependent on the relative rate of transcription of the dihydrofolate reductase genes.

  7. Inhibition of Influenza Virus Ribonucleic Acid Polymerase by Ribavirin Triphosphate

    PubMed Central

    Eriksson, Bertil; Helgstrand, Erik; Johansson, Nils Gunnar; Larsson, Alf; Misiorny, Alfons; Noren, Jan Olof; Philipson, Lennart; Stenberg, Kjell; Stening, Goran; Stridh, Stig; Öberg, Bo

    1977-01-01

    Ribavirin 5′-triphosphate (RTP), derived from the broad-spectrum antiviral compound ribavirin (Virazole), can selectively inhibit influenza virus ribonucleic acid polymerase in a cell-free assay. Ribavirin and its 5′-monophosphate have no effect on the polymerase. The inhibition is competitive with respect to adenosine 5′-triphosphate and guanosine 5′-triphosphate. RTP also inhibits ApG- and GpC-stimulated influenza virus ribonucleic acid polymerase. Since ribavirin is phosphorylated in the cell, the inhibition of influenza multiplication in the cell may also be caused by RTP. PMID:879760

  8. Saliva of Lygus lineolaris digests double stranded ribonucleic acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The prospects for development of highly specific pesticides based on double stranded ribonucleic acid have been a recent focus of scientific research. Creative applications have been proposed and demonstrated. However, not all insects are sensitive to double stranded RNA (dsRNA) gene knockdown effec...

  9. Towards the elements of successful insect Ribonucleic acid interference (RNAi)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference (RNAi), the sequence-specific suppression of gene expression, offers great opportunities for insect science, especially to analyze gene function, manage pest populations, and reduce disease pathogens. The accumulating body of literature on insect RNAi has revealed that ...

  10. Isolation and Characterization of Simian Virus 40 Ribonucleic Acid

    PubMed Central

    Weinberg, R. A.; Warnaar, S. O.; Winocour, E.

    1972-01-01

    Deoxyribonucleic acid-ribonucleic acid (RNA) hybridization in formamide was used to isolate simian virus 40-specific RNA. Early in the lytic cycle, a 19S viral RNA species was observed. Late in the lytic cycle, 16S and 19S viral species were found. The 16S and 19S species of viral RNA were localized in the cytoplasm. High-molecular-weight heterogeneous RNA, containing viral sequences, was isolated from the nuclear fraction of infected cells late in the lytic cycle. This RNA may contain non-viral sequences linked to viral sequences. The formamide hybridization technique can be used to isolate intact late lytic viral RNA which is at least 99% pure. PMID:4342237

  11. Structure of the Ribonucleic Acid Bacteriophage R17

    PubMed Central

    Vasquez, Cesar; Granboulan, Nicole; Franklin, Richard M.

    1966-01-01

    Vasquez, Cesar (Institut de Recherches sur le Cancer, Villejuif, Seine, France), Nicole Granboulan, and Richard M. Franklin. Structure of the ribonucleic acid bacteriophage R17. J. Bacteriol. 92:1779–1786. 1966.—The morphology of bacteriophage R17 was studied by electron microscopy of negatively stained virions. The hexagonal shape, the presence of a maximum of 10 units at the periphery, and especially the observation of central fivefold points of symmetry with neighboring five and six coordinated units indicated icosahedral symmetry with 32 morphological units. Although the exact shape of the polyhedron could not be specified, the number of morphological units agreed with the chemically estimated number of structural units. Images PMID:5958109

  12. Interaction of neomycin with ribosomes and ribosomal ribonucleic acid.

    PubMed

    Dahlberg, A E; Horodyski, F; Keller, P

    1978-02-01

    Neomycin binds ribosomes and ribosomal ribonucleic acid (rRNA) in vivo and in vitro producing changes detectable by increases in gel electrophoretic mobility. These changes were observed in gels that contain ethylenediaminetetraacetic acid or no added magnesium ion. The progressive increase in gel electrophoretic mobility with increasing antibiotic concentrations suggests that neomycin is binding at multiple sites on RNA. The binding was reversible but sufficiently stable to survive dialysis and electrophoresis. It is proposed that bound neomycin stabilizes the ribosome and RNA structures, restricting the unfolding of the particles during electrophoresis and thus allowing for a more rapid migration in the gel. Gentamicin produced an effect similar to that of neomycin. Paromomycin, differing from neomycin by only one amino group, had considerably less effect on ribosome and rRNA mobilities. The binding of neomycin to rRNA improved the linearity of the plot of log molecular weight versus mobility and thus may be of benefit in providing a more accurate estimation of molecular weights of large RNAs.

  13. Ribonucleic Acid Polymerases of the Yeast Phase of Histoplasma capsulatum

    PubMed Central

    Boguslawski, George; Schlessinger, David; Medoff, Gerald; Kobayashi, George

    1974-01-01

    Ribonucleic acid (RNA) polymerases of Histoplasma capsulatum (yeast phase) were fractionated by phosphocellulose chromatography and partially characterized. Three distinct, active fractions were seen. The major RNA polymerase species was inhibited strongly by α-amanitin, whereas the other two were resistant. When either slightly purified (HSE) extract or the major active component was assayed at 37 C, the incorporation of tritiated uridine monophosphate into RNA stopped after 10 to 15 min. In contrast, the synthesis continued for at least 1 h at 23 C. The other two RNA polymerase species exhibited higher rates of incorporation when tested at 37 C, and continued to synthesize RNA even after 60 min. However, by that time the levels of incorporation at 23 C were higher than at 37 C for all three enzymes. The temperature sensitivity was not affected by changing substrate concentration or employing either native or denatured calf thymus deoxyribonucleic acid as a template. These results are compared with the data obtained with RNA polymerases from different fungi and other organisms. A possible involvement of RNA polymerase(s) in morphological differentiation of H. capsulatum is discussed. PMID:4828308

  14. Ribonucleic acid synthesis during fruiting body formation in Myxococcus xanthus.

    PubMed

    Smith, B A; Dworkin, M

    1981-04-01

    A method has been devised that allowed us, for the first time, to pulse-label M. xanthus cells with precursors for ribonucleic acid biosynthesis while they were undergoing fruiting body formation. Using this method, we examined patterns of ribonucleic acid (RNA) accumulation throughout the process of fruiting body formation. As development proceeded, the rate of RNA accumulation increased at two periods of the developmental cycle: once just before aggregation and once late in the cycle, when sporulation was essentially completed. In contrast to vegetatively growing cells, in which only stable RNA species are labeled during a 30-min pulse, the majority of radioactivity found in RNA from 30-min pulse-labeled developing cells was found in an unstable heterodisperse fraction that migrated to the 5S to 16S region of sucrose density gradients and sodium dodecyl sulfate-polyacrylamide gels. This pattern of incorporation could not be induced (i) by a shift down of vegetatively growing cells to a nutritionally poor medium, in which the generation time was increased to that of developing cells during the growth phase, or (ii) by plating of vegetative cells onto the same solid-surface environment as that of developing cells, but which surface supported vegetative growth rather than fruiting body formation. Thus, the RNA synthesis pattern observed appeared to be related to development per se rather than to nutritional depletion or growth on a solid surface alone. The radioactivity incorporated into the unstable 5S to 16S RNA fraction accumulated as the pulse length was increased from 10 to 30 min; in contrast, an analogous unstable fraction from vegetative cells decreased as pulse length was increased. This suggested that developmental 5S to 16S RNA was more stable than vegetative cell 5S to 16S RNA (presumptive messenger RNA). However, during a 45-min chase period, radioactivity in 30-min-pulse-labeled developmental 5S to 16S RNA decayed to an extent twice that of

  15. Ribonucleic acid interference (RNAi) Technology for control of Asian citrus psyllid - You Tube

    Technology Transfer Automated Retrieval System (TEKTRAN)

    RNAi, Ribonucleic acid interference, function and application are described to bring a better understanding of how this emerging technology is providing environmentally friendly, non-transgenic, insect pest control to the citrus industry....

  16. Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.

    PubMed

    PRESCOTT, D M

    1959-10-01

    The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.

  17. Inactivation of Encephalomyocarditis Virus in Aerosols: Fate of Virus Protein and Ribonucleic Acid

    PubMed Central

    De Jong, J. C.; Harmsen, M.; Trouwborst, T.; Winkler, K. C.

    1974-01-01

    After aerosolization at relative humidities of 50% or lower, encephalomyocarditis virus is rapidly inactivated. In this process the protein coat of the virion is damaged. This appears as a loss of hemagglutination activity and loss of affinity for hemagglutination inhibiting antibodies. The ribonucleic acid of the virus retains its infectivity but it becomes susceptible to ribonuclease. It sediments in sucrose gradients when centrifuged at high speed with the same velocity as free infectious ribonucleic acid extracted with phenol from intact encephalomyocarditis virus. PMID:4358862

  18. Characterization of the Subunit Structure of the Ribonucleic Acid Genome of Influenza Virus

    PubMed Central

    Lewandowski, L. J.; Content, J.; Leppla, S. H.

    1971-01-01

    Ribonucleic acid extracted from influenza virus was labeled at the 3′ termini with 3H and analyzed by polyacrylamide gel electrophoresis. Influenza virus was found to contain a minimum of seven and possibly as many as 10 polynucleotide chains, most of which appear to terminate at the 3′ end in uridine. PMID:4332140

  19. Control of larval and egg development in Aedes aegypti with Ribonucleic acid interference (RNAi) against juvenile hormone acid methyl transferase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Ribonucleic acid interference (RNAi) is a powerful approach for elucidating gene functions in a variety of organisms, including mosquitoes and many other insects. Little has been done, however, to harness this approach in order to control adult and larval mosquitoes. Juvenile hormone (JH) plays a pi...

  20. Optical and electronic properties of polyaniline sulfonic acid-ribonucleic acid-gold nanobiocomposites.

    PubMed

    Routh, Parimal; Garai, Ashesh; Nandi, Arun K

    2011-08-14

    Finely fibrillar polyaniline sulfonic acid (PSA)/ribonucleic acid (RNA) hybrids are developed by wrapping PSA with RNA from a mixture of aqueous PSA (P) and RNA (R) solutions of different compositions. FTIR spectra suggest H-bonding and π-π interactions in the hybrids and dedoping of self doped PSA during hybrid formation. UV-vis spectra exhibit a blue shift of the π-band to polaron band transition of PSA from 870 to 581 nm due to dedoping. The PR hybrids show enhanced PL-properties when excited at 540 nm relative to PSA which also exhibits rectification behavior in current (I)-voltage (V) curves. Gold nanoparticles (Au NPs) grown on these PR hybrids by the reduction of Au(3+) by PSA show different morphologies with varying composition. FTIR spectra of the nanobiocomposites indicate that Au NPs are stabilized by the co-ordination of the nitrogen atoms of -N=Q=N- bonds of PSA (Q = quinonoid ring). The intensity of the Au plasmon band gradually decreases with time but the PL-intensities of the PAu/PRAu nanocomposites increase with time. The PL-intensity of the nanocomposites is higher than that of PSA and PR hybrids. The DC-conductivity of the PR hybrids increases by an order of magnitude on addition of Au NPs. I-V curves of the nanobiocomposites show negative differential resistance (NDR) in PSA rich systems with a stable NDR ratio of 7 in the PRAu21 and PRAu11 hybrids. Possible reasons from the accumulation of charges on the Au NPs and its stabilization through the π-clouds of RNA bases are discussed. The PRAu11 system also exhibits rectification properties with a rectification ratio of 14.

  1. Optical and electronic properties of polyaniline sulfonic acid-ribonucleic acid-gold nanobiocomposites.

    PubMed

    Routh, Parimal; Garai, Ashesh; Nandi, Arun K

    2011-08-14

    Finely fibrillar polyaniline sulfonic acid (PSA)/ribonucleic acid (RNA) hybrids are developed by wrapping PSA with RNA from a mixture of aqueous PSA (P) and RNA (R) solutions of different compositions. FTIR spectra suggest H-bonding and π-π interactions in the hybrids and dedoping of self doped PSA during hybrid formation. UV-vis spectra exhibit a blue shift of the π-band to polaron band transition of PSA from 870 to 581 nm due to dedoping. The PR hybrids show enhanced PL-properties when excited at 540 nm relative to PSA which also exhibits rectification behavior in current (I)-voltage (V) curves. Gold nanoparticles (Au NPs) grown on these PR hybrids by the reduction of Au(3+) by PSA show different morphologies with varying composition. FTIR spectra of the nanobiocomposites indicate that Au NPs are stabilized by the co-ordination of the nitrogen atoms of -N=Q=N- bonds of PSA (Q = quinonoid ring). The intensity of the Au plasmon band gradually decreases with time but the PL-intensities of the PAu/PRAu nanocomposites increase with time. The PL-intensity of the nanocomposites is higher than that of PSA and PR hybrids. The DC-conductivity of the PR hybrids increases by an order of magnitude on addition of Au NPs. I-V curves of the nanobiocomposites show negative differential resistance (NDR) in PSA rich systems with a stable NDR ratio of 7 in the PRAu21 and PRAu11 hybrids. Possible reasons from the accumulation of charges on the Au NPs and its stabilization through the π-clouds of RNA bases are discussed. The PRAu11 system also exhibits rectification properties with a rectification ratio of 14. PMID:21698302

  2. Striking similarities are exhibited by two small Epstein-Barr virus-encoded ribonucleic acids and the adenovirus-associated ribonucleic acids VAI and VAII

    SciTech Connect

    Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.

    1981-09-01

    The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.

  3. In Vitro Synthesis of Poliovirus Ribonucleic Acid: Role of the Replicative Intermediate

    PubMed Central

    Girard, Marc

    1969-01-01

    Poliovirus ribonucleic acid (RNA) polymerase crude extracts could be stored frozen in liquid nitrogen without loss of activity or specificity. The major in vitro product of these extracts was viral single-stranded RNA. However, after short periods of incubation with radioactive nucleoside triphosphates, most of the incorporated label was found in replicative intermediate. When excess unlabeled nucleoside triphosphate was added, the label was displaced from the replicative intermediate and accumulated as viral RNA. It is concluded from this experiment that the replicative intermediate is the precursor to viral RNA. In addition, some of the label was chased into double-stranded RNA. The implications of this finding are discussed. PMID:4306193

  4. Inhibition of Interjacent Ribonucleic Acid (26S) Synthesis in Cells Infected by Sindbis Virus

    PubMed Central

    Scheele, Christina M.; Pfefferkorn, E. R.

    1969-01-01

    The interrelationship of viral ribonucleic acid (RNA) and protein synthesis in cells infected by Sindbis virus was investigated. When cultures were treated with puromycin early in the course of infection, the synthesis of interjacent RNA (26S) was preferentially inhibited. A similar result was obtained by shifting cells infected by one temperature-sensitive mutant defective in RNA synthesis from the permissive (29 C) to the nonpermissive (41.5 C) temperature. Under both conditions, the viral RNA produced appeared to be fully active biologically. Once underway, the synthesis of viral RNA in wild-type Sindbis infections did not require concomitant protein synthesis. PMID:5817400

  5. The role of micro-ribonucleic acids in normal hematopoiesis and leukemic T-lymphogenesis.

    PubMed

    Slavov, S N; Gimenes Teixeira, H L; Rego, E M

    2010-07-01

    Micro-ribonucleic acids (microRNAs) are small molecules containing 20-23 nucleotides. Despite their small size, it is likely that almost every cellular process is regulated by them. Moreover, aberrant microRNA expression has been involved in the development of various diseases, including cancer. Although many data are available about the role of microRNAs in various lymphoproliferative disorders, their impact on the development of acute lymphoblastic leukemia of T-cell progenitors is largely unknown. In this review, we present recent information about how specific microRNAs are expressed and regulated during malignant T-lymphopoiesis and about their role during normal hematopoiesis.

  6. Factors Affecting Immunogenic Activity of Mycobacterial Ribosomal and Ribonucleic Acid Preparations

    PubMed Central

    Youmans, Anne S.; Youmans, Guy P.

    1969-01-01

    By following careful procedures, mycobacterial ribosomal fractions and ribonucleic acid (RNA) prepared by ethyl alcohol precipitation were obtained which have immunogenic activities similar to the viable attenuated H37Ra cells of Mycobacterium tuberculosis from which they were obtained. This comparison was based on the amount of ribonucleic acid (RNA) present. These preparations consisted of approximately 63% RNA and 37% protein; no deoxyribonucleic acid or polysaccharide was detected by chemical tests. A high correlation was found between the immunogenic activity of a preparation and the per cent increase in hyperchromicity at 260 nm of a ribonuclease-hydrolyzed portion. Final concentrations of sodium dodecyl sulfate higher than 0.25% when used for the preparation of the ribosomal fractions and RNA resulted in significantly lower immune responses and greater variation between experiments. This was not related to the amount of protein present. The stability of the ribosomal and RNA preparations was tested under a variety of conditions. The need for a good protective adjuvant again was shown since mouse serum readily hydrolyzed the RNA. Equal immunity was obtained after immunization by the intraperitoneal and subcutaneous routes; however, no immune response was obtained when the intravenous route was used. Preliminary results with RNA prepared with phenol showed that it was more easily degraded during preparation. This resulted in a lower immune response than was obtained with the RNA prepared with ethyl alcohol. PMID:4979447

  7. Comparison of Two Serologically Distinct Ribonucleic Acid Bacteriophages II. Properties of the Nucleic Acids and Coat Proteins

    PubMed Central

    Overby, L. R.; Barlow, G. H.; Doi, R. H.; Jacob, Monique; Spiegelman, S.

    1966-01-01

    Overby, L. R. (University of Illinois, Urbana), G. H. Barlow, R. H. Doi, Monique Jacob, and S. Spiegelman. Comparison of two serologically distinct ribonucleic acid bacteriophages. II. Properties of the nucleic acids and coat proteins. J. Bacteriol. 92:739–745. 1966.—The ribonucleic acid (RNA) molecules and coat proteins of two RNA coliphages, MS-2 and Qβ, have been characterized. MS-2 RNA shows an S20,w of 25.8 and a molecular weight by light scattering of 106. The corresponding parameters for Qβ-RNA were 28.9 and 0.9 × 106. A difference in base composition was reflected in the adenine-uracil ratio, which was 0.95 for MS-2 and 0.75 for Qβ. The two RNA preparations are readily separated by chromatography on columns of methylated albumin. Both gave identical bouyant densities in cesium sulfate of 1.64 g/ml. The coat protein subunits were of similar molecular weights: 15,500 (Qβ) and 14,000 (MS-2). They differed, however, in that the Qβ-protein lacked tryptophan and histidine, whereas the MS-2 protein lacked only histidine. Images PMID:5922545

  8. Simian Virus 40 Deoxyribonucleic Acid Transcription In Vitro: Binding and Transcription Patterns with a Mammalian Ribonucleic Acid Polymerase 1

    PubMed Central

    Herzberg, Max; Winocour, Ernest

    1970-01-01

    The in vitro transcription pattern of simian virus 40 (SV40) deoxyribonucleic acid (DNA) by a mammalian ribonucleic acid (RNA) polymerase, was studied by electron microscopy and velocity sedimentation techniques. It was found that (i) the majority of supercoiled SV40 DNA molecules displayed a single binding site for the enzyme, (ii) the supercoiled structure of SV40 DNA was frequently retained during transcription, and (iii) the majority of RNA molecules synthesized from the supercoiled SV40 DNA template showed no self-complementarity and sedimented relatively homogeneously in the 15S to 16S region of a sucrose gradient (in contrast, the RNA product synthesized from the nicked-circular SV40 DNA template showed self-complementarity and sedimented heterogeneously). RNA polymerase preparations isolated from SV40-infected monkey cells were more active than those isolated from uninfected monkey cells. Images PMID:4320700

  9. In vitro translation of cardiovirus ribonucleic acid by mammalian cell-free extracts.

    PubMed

    Eggen, K L; Shatkin, A J

    1972-04-01

    Cell-free extracts prepared from Ehrlich ascites and mouse L cells synthesize viral proteins in response to encephalomyocarditis virus, mouse Elberfeld virus, and mengovirus ribonucleic acid. Although HeLa cell extracts are inactive, their ribosomes are functional in the presence of heterologous supernatant fractions. Synthesis depends upon the addition of adenosine triphosphate, guanosine triphosphate, an energy-generating system, and 4 mm Mg(2+). Initiation is completed during the first 10 to 20 min of incubation, but chain elongation continues for 1 hr or more. The products are of higher molecular weight than virion structural proteins and resemble polypeptides formed in virus-infected cells during a short pulse. Tryptic peptides of virion proteins and in vitro products are similar for all three cardioviruses.

  10. Transcription In Vitro by Reovirus-Associated Ribonucleic Acid-Dependent Polymerase 1

    PubMed Central

    Banerjee, A. K.; Shatkin, A. J.

    1970-01-01

    Digestion of purified reovirus type 3 with chymotrypsin degrades 70% of the viral protein and converts the virions to subviral particles (SVP). The SVP contain 3 of the 6 viral structural proteins and all 10 double-stranded ribonucleic acid (RNA) genome segments but not adenine-rich, single-stranded RNA. An RNA polymerase which is structurally associated with SVP transcribes one strand of each genome segment by a conservative mechanism in vitro. The single-stranded products include large (1.2 × 106 daltons), medium (0.7 × 106 daltons), and small (0.4 × 106 daltons) molecules which hybridize exclusively with the corresponding genome segments. The enzyme obtained by heating virions at 60 C synthesizes similar products. Kinetic and pulse-chase studies indicate that the different-sized products are synthesized simultaneously but at rates which are in the order: small > medium > large. Images PMID:5529847

  11. Small interfering ribonucleic acid induces liquid-to-ripple phase transformation in a phospholipid membrane

    SciTech Connect

    Choubey, Amit; Nomura, Ken-ichi; Kalia, Rajiv K.; Nakano, Aiichiro; Vashishta, Priya

    2014-09-15

    Small interfering ribonucleic acid (siRNA) molecules play a pivotal role in silencing gene expression via the RNA interference mechanism. A key limitation to the widespread implementation of siRNA therapeutics is the difficulty of delivering siRNA-based drugs to cells. Here, we examine changes in the structure and dynamics of a dipalmitoylphosphatidylcholine bilayer in the presence of a siRNA molecule and mechanical barriers to siRNA transfection in the bilayer. Our all-atom molecular dynamics simulation shows that siRNA induces a liquid crystalline-to-ripple phase transformation in the bilayer. The ripple phase consists of a major region of non-interdigitated and a minor region of interdigitated lipid molecules with an intervening kink. In the ripple phase, hydrocarbon chains of lipid molecules have large compressive stresses, which present a considerable barrier to siRNA transfection.

  12. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

    PubMed

    MacKay, R M; Gray, M W; Doolittle, W F

    1980-11-11

    The complete nucleotide sequence of the cytosol 5S ribosomal ribonucleic acid of the trypanosomatid protozoan Crithidia fasciculata has been determined by a combination of T1-oligonucleotide catalog and gel sequencing techniques. The sequence is: GAGUACGACCAUACUUGAGUGAAAACACCAUAUCCCGUCCGAUUUGUGAAGUUAAGCACC CACAGGCUUAGUUAGUACUGAGGUCAGUGAUGACUCGGGAACCCUGAGUGCCGUACUCCCOH. This 5S ribosomal RNA is unique in having GAUU in place of the GAAC or GAUC found in all other prokaryotic and eukaryotic 5S RNAs, and thought to be involved in interactions with tRNAs. Comparisons to other eukaryotic cytosol 5S ribosomal RNA sequences indicate that the four major eukaryotic kingdoms (animals, plants, fungi, and protists) are about equally remote from each other, and that the latter kingdom may be the most internally diverse.

  13. In vitro evaluation of endothelial exosomes as carriers for small interfering ribonucleic acid delivery.

    PubMed

    Banizs, Anna B; Huang, Tao; Dryden, Kelly; Berr, Stuart S; Stone, James R; Nakamoto, Robert K; Shi, Weibin; He, Jiang

    2014-01-01

    Exosomes, one subpopulation of nanosize extracellular vesicles derived from multivesicular bodies, ranging from 30 to 150 nm in size, emerged as promising carriers for small interfering ribonucleic acid (siRNA) delivery, as they are capable of transmitting molecular messages between cells through carried small noncoding RNAs, messenger RNAs, deoxyribonucleic acids, and proteins. Endothelial cells are involved in a number of important biological processes, and are a major source of circulating exosomes. In this study, we prepared exosomes from endothelial cells and evaluated their capacity to deliver siRNA into primary endothelial cells. Exosomes were isolated and purified by sequential centrifugation and ultracentrifugation from cultured mouse aortic endothelial cells. Similar to exosome particles from other cell sources, endothelial exosomes are nanometer-size vesicles, examined by both the NanoSight instrument and transmission electron microscopy. Enzyme-linked immunosorbent assay analysis confirmed the expression of two exosome markers: CD9 and CD63. Flow cytometry and fluorescence microscopy studies demonstrated that endothelial exosomes were heterogeneously distributed within cells. In a gene-silencing study with luciferase-expressing endothelial cells, exosomes loaded with siRNA inhibited luciferase expression by more than 40%. In contrast, siRNA alone and control siRNA only suppressed luciferase expression by less than 15%. In conclusion, we demonstrated that endothelial exosomes have the capability to accommodate and deliver short foreign nucleic acids into endothelial cells.

  14. In vitro evaluation of endothelial exosomes as carriers for small interfering ribonucleic acid delivery

    PubMed Central

    Banizs, Anna B; Huang, Tao; Dryden, Kelly; Berr, Stuart S; Stone, James R; Nakamoto, Robert K; Shi, Weibin; He, Jiang

    2014-01-01

    Exosomes, one subpopulation of nanosize extracellular vesicles derived from multivesicular bodies, ranging from 30 to 150 nm in size, emerged as promising carriers for small interfering ribonucleic acid (siRNA) delivery, as they are capable of transmitting molecular messages between cells through carried small noncoding RNAs, messenger RNAs, deoxyribonucleic acids, and proteins. Endothelial cells are involved in a number of important biological processes, and are a major source of circulating exosomes. In this study, we prepared exosomes from endothelial cells and evaluated their capacity to deliver siRNA into primary endothelial cells. Exosomes were isolated and purified by sequential centrifugation and ultracentrifugation from cultured mouse aortic endothelial cells. Similar to exosome particles from other cell sources, endothelial exosomes are nanometer-size vesicles, examined by both the NanoSight instrument and transmission electron microscopy. Enzyme-linked immunosorbent assay analysis confirmed the expression of two exosome markers: CD9 and CD63. Flow cytometry and fluorescence microscopy studies demonstrated that endothelial exosomes were heterogeneously distributed within cells. In a gene-silencing study with luciferase-expressing endothelial cells, exosomes loaded with siRNA inhibited luciferase expression by more than 40%. In contrast, siRNA alone and control siRNA only suppressed luciferase expression by less than 15%. In conclusion, we demonstrated that endothelial exosomes have the capability to accommodate and deliver short foreign nucleic acids into endothelial cells. PMID:25214786

  15. Characterization of hybrid plasmids carrying individual ribosomal ribonucleic acid transcription units of Escherichia coli.

    PubMed Central

    Kenerley, M E; Morgan, E A; Post, L; Lindahl, L; Nomura, M

    1977-01-01

    We have screened the strains with ColE1 hybrid plasmids constructed by Clarke and Carbon (Cell 9:91-99, 1976) for the presence of ribosomal ribonucleic acid (rRNA) genes on the plasmids and identified 16 strains whose plasmids carry rRNA genes. The structures of these 16 plasmids were compared by heteroduplex analysis, and the plasmids were classified into six groups on the basis of their chromosomal origins. Homology with known transducing-phage deoxyribonucleic acids and genetic mapping have assigned locations on the Escherichia coli chromosome to three of the six groups. These are rrnB near rif at 88 min, rrnC near ilvE at 83 min, and rrnD near aroE at 71 min. A fourth group is probably rrnA at 85 min (T. Ikemura and M. Nomura, Cell, 11:779-793, 1977). We conclude that the minimum number of rRNA transcription units per haploid chromosomes is seven, that is, the six groups identified in this work plus a known operon (rrnE near metA at 89 min) that we failed to find among the hybrid plasmids. This heteroduplex analysis also suggests that there are only two kinds of rRNA operons with respect to their spacer region; three of the six rRNA operon groups studied here have one kind, whereas the remaining three have the other kind. Images PMID:336613

  16. Incorporation of Mevalonic Acid into Ribosylzeatin in Tobacco Callus Ribonucleic Acid Preparations 1

    PubMed Central

    Murai, Norimoto; Armstrong, Donald J.; Skoog, Folke

    1975-01-01

    The incorporation of 14C-2-mevalonic acid into transfer RNA and ribosomal RNA (high molecular weight RNA) in rapidly growing, cytokinin-dependent tobacco (Nicotiana tabacum var. Wisconsin No. 38) callus cultures has been investigated. Approximately 40% of the label incorporated into transfer RNA was present in a ribonucleoside with chromatographic properties identical to those of cis-ribosylzeatin. The remainder of the label in the transfer RNA appears to be nonspecific incorporation resulting from degradation and metabolism of 14C-2-mevalonic acid by the tobacco callus tissue. Although the total radioactivity incorporated into ribosomal RNA was roughly the same as in transfer RNA, the specific radioactivity of the transfer RNA was about four times higher than that of the ribosomal RNA, and the ribosomal RNA labeling could be distinguished from the cytokinin labeling observed in transfer RNA. The distributions of the 14C-2-mevalonic acid label and cytokinin activity in tobacco callus transfer RNA fractionated by benzoylated diethylaminoethylcellulose chromatography indicate that at least two cytokinin-containing transfer RNA species are present in this tissue. PMID:16659180

  17. Ribonucleic Acid, Deoxyribonucleic Acid, and Protein Content of Cells of Different Ages of Mycobacterium tuberculosis and the Relationship to Immunogenicity

    PubMed Central

    Youmans, Anne S.; Youmans, Guy P.

    1968-01-01

    The amount of ribonucleic acid (RNA), protein, and deoxyribonucleic acid (DNA) was determined in pellicle cultures of different ages of the H37Ra strain of Mycobacterium tuberculosis, grown on a synthetic medium. We found that the highest content of RNA and protein was present in 2-week-old cultures, indicating that these cells were in the logarithmic phase of growth. DNA content was highest at 1 and 2 weeks. The amount of all three compounds then decreased about 50% during the following 6 weeks. Two-week-old cells should therefore be used for preparation of the immunogenic ribosomal fraction. The optimal concentration of zinc chloride increased RNA and protein synthesis, and also improved the appearance of the pellicle growth. Two-week-old cells, which contained the largest amount of RNA and protein, immunized mice significantly better than older cells. Since protein and DNA are not involved in the production of immunity, a correlation could be made between amount of RNA and the capacity of viable H37Ra cells to immunize mice. The immunizing capacity of these cells was not affected by ribonuclease, probably because the ribonuclease did not penetrate into the whole cells. PMID:4966539

  18. Effect of growth rate on the amounts of ribosomal and transfer ribonucleic acids in yeast.

    PubMed Central

    Waldron, C; Lacroute, F

    1975-01-01

    The steady-state growth rate of Saccharomyces cerevisiae was varied by growing the cells in different media. The total amount of ribonucleic acid (RNA) per cell was found to decrease as a nonlinear function of decreasing growh rate. The RNA from cells growing in different media was analyzed by polyacrylamide gel electrophoresis. Although the amounts of both ribosomal RNA and transfer RNA decreased with decreasing growth rate, the ratio of ribosomal to transfer RNA was not constant. As the growth rate was reduced the ribosomal RNA fraction decreased slightly, whereas the transfer RNA fraction increased slightly. Thus the levels of ribosomal and transfer RNA were regulated to similar yet different extents. The levels of the different ribosomal RNA species were more closely coordinated. At all growth rates the ribosomal RNAs (including 5S RNA) were present in equimolar amounts. The rate of protein synthesis in yeast cells also decreased with decreasing growth rate. The low rates of protein synthesis did not appear to be due to limiting numbers of ribosomes or transfer RNA molecules. PMID:1097403

  19. Rate of ribonucleic acid chain growth in Mycobacterium tuberculosis H37Rv.

    PubMed Central

    Harshey, R M; Ramakrishnan, T

    1977-01-01

    Two methods were employed to measure the rate of ribonucleic acid (RNA) chain growth in vivo in Mycobacterium tuberculosis H37Rv cultures growing in Sauton medium at 37 degrees C, with a generation time of 10 h. In the first, the bacteria were allowed to assimilate [3H]uracil or [3H]guanine into their RNA for short time periods. The RNA was then extracted and hydrolyzed with alkali, and the radioactivity in the resulting nucleotides and nucleosides was measured. The data obtained by this method allowed the calculation of the individual nucleotide step times during the growth of RNA chains, from which the average rate of RNA chain elongation was estimated to be about 4 nucleotides per s. The second method employed the antibiotic rifampin, which specifically inhibits the initiation of RNA synthesis without interfering with the elongation and completion of nascent RNA chains. Usint this method, the transcription time of the 16S, 23S, and 5S ribosomal RNA genes was estimated to be 7.6 min, which corresponds to a ribosomal RNA chain growth rate of 10 nucleotides per s. PMID:402354

  20. Measurement of Microbial Activity and Growth in the Ocean by Rates of Stable Ribonucleic Acid Synthesis

    PubMed Central

    Karl, David M.

    1979-01-01

    A relatively simple and extremely sensitive technique for measuring rates of stable ribonucleic acid (RNA) synthesis was devised and applied to bacterial cultures and seawater samples. The procedure is based upon the uptake and incorporation of exogenous radiolabeled adenine into cellular RNA. To calculate absolute rates of synthesis, measurements of the specific radioactivity of the intracellular adenosine 5′-triphosphate pools (precursor to RNA) and of the total amount of radioactivity incorporated into stable cellular RNA per unit time are required. Since the rate of RNA synthesis is positively correlated with growth rate, measurements of RNA synthesis should be extremely useful for estimating and comparing the productivities of microbial assemblages in nature. Adenosine 5′-triphosphate, adenylate energy charge, and rates of stable RNA synthesis have been measured at a station located in the Columbian Basin of the Caribbean Sea. A subsurface peak in RNA synthesis (and therefore growth) was located within the dissolved oxygen minimum zone (450 m), suggesting in situ microbiological utilization of dissolved molecular oxygen. Calculations of the specific rates of RNA synthesis (i.e., RNA synthesis per unit of biomass) revealed that the middepth maximum corresponded to the highest specific rate of growth (420 pmol of adenine incorporated into RNA·day−1) of all depths sampled, including the euphotic zone. The existence of an intermediate depth zone of active microbial growth may be an important site for nutrient regeneration and may serve as a source of reduced carbon for mesopelagic and deep sea environments. PMID:16345461

  1. Aggregates of Small Nuclear Ribonucleic Acids (snRNAs) in Alzheimer’s Disease’

    PubMed Central

    Hales, Chadwick M.; Dammer, Eric B.; Diner, Ian; Yi, Hong; Seyfried, Nicholas T.; Gearing, Marla; Glass, Jonathan D.; Montine, Thomas J.; Levey, Allan I.; Lah, James J.

    2014-01-01

    We recently discovered that protein components of the ribonucleic acid (RNA) spliceosome form cytoplasmic aggregates in Alzheimer’s disease (AD) brain, resulting in widespread changes in RNA splicing. However, the involvement of small nuclear RNAs (snRNAs), also key components of the spliceosome complex, in the pathology of AD remains unknown. Using immunohistochemical staining of post-mortem human brain and spinal cord, we identified cytoplasmic tangle-shaped aggregates of snRNA in both sporadic and familial AD cases but not in aged controls or other neurodegenerative disorders. Immunofluorescence using antibodies reactive with the 2,2,7-trimethylguanosine cap of snRNAs and transmission electron microscopy demonstrated snRNA localization with tau and paired helical filaments, the main component of neurofibrillary tangles. Quantitative real-time polymerase chain reaction (PCR) showed U1 snRNA accumulation in the insoluble fraction of AD brains whereas other U snRNAs were not enriched. In combination with our previous results, these findings demonstrate that aggregates of U1 snRNA and U1 small nuclear ribonucleoproteins represent a new pathological hallmark of AD. PMID:24571648

  2. Human immunodeficiency virus trans-activator of transcription peptide detection via ribonucleic acid aptamer on aminated diamond biosensor

    NASA Astrophysics Data System (ADS)

    Rahim Ruslinda, A.; Wang, Xianfen; Ishii, Yoko; Ishiyama, Yuichiro; Tanabe, Kyosuke; Kawarada, Hiroshi

    2011-09-01

    The potential of ribonucleic acid (RNA) as both informational and ligand binding molecule have opened a scenario in the development of biosensors. An aminated diamond-based RNA aptasensor is presented for human immunodeficiency virus (HIV) trans-activator of transcription (Tat) peptide protein detection that not only gives a labeled or label-free detection method but also provides a reusable platform for a simple, sensitive, and selective detection of proteins. The immobilized procedure was based on the binding interaction between positively charged amine terminated diamond and the RNA aptamer probe molecules with the negatively charged surface carboxylic compound linker molecule such as terephthalic acid.

  3. Acoustic cavitation-mediated delivery of small interfering ribonucleic acids with phase-shift nanoemulsions

    PubMed Central

    Burgess, Mark T.; Porter, Tyrone M.

    2015-01-01

    Localized, targeted delivery of small interfering ribonucleic acid (siRNA) has been the foremost hurdle in the use of siRNA for the treatment of various diseases. Major advances have been achieved in the synthesis of siRNA, which has led to greater target messenger RNA (mRNA) silencing and stability in physiological conditions. Although numerous delivery strategies have shown promise, there are still limited options for targeted delivery and release of siRNA administered systemically. In this in vitro study, phase-shift nanoemulsions (PSNE) were explored as cavitation nuclei to facilitate free siRNA delivery to cancer cells via sonoporation. A cell suspension containing varying amounts of PSNE and siRNA was exposed to 5 MHz pulsed ultrasound at fixed settings (6.2 MPa peak negative pressure, 5 cycle pulses, 250 Hz pulse repetition frequency, and total exposure duration of 100 seconds). Inertial cavitation emissions were detected throughout the exposure using a passive cavitation detector. Successful siRNA delivery was achieved (i.e. > 50% cell uptake) with high viability (> 80% viability). The percentage of cells with siRNA uptake was correlated with the amount of inertial cavitation activity generated from vaporized PSNE. The siRNA remained functional after delivery, significantly reducing expression of green fluorescent protein (GFP) in a stably transfected cell line. These results show that vaporized PSNE can facilitate siRNA entry into the cytosol of a majority of sonicated cells and may provide a non-endosomal route for siRNA delivery. PMID:25979417

  4. Ribonucleic acid synthesis by Escherichia coli C3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of the coliphage-induced double-stranded ribonucleic acid

    PubMed Central

    Bishop, D. H. L.

    1966-01-01

    1. The efficiency of extracting nucleic acids from Escherichia coli after five methods of obtaining cell lysis was determined. 2. The recovery of various nucleic acid species isolated after chromatography on methylated albumin-coated kieselguhr was also examined. 3. Double-stranded coliphage-induced RNA was isolated from infected bacteria and its resistance to ribonuclease digestion under various conditions determined. 4. The involvement of double-stranded RNA during the infection process was demonstrated. 5. The time-course of the syntheses in infected cells of double-stranded RNA, DNA, single-stranded coliphage and 16s ribosomal RNA, transfer RNA and ribosomal 23s RNA was examined. 6. It was demonstrated that the syntheses of DNA, transfer RNA and ribosomal RNA decreased 10–15min. after infection. 7. Synthesis of coliphage RNA commenced 10–15min. after infection and double-stranded RNA was also synthesized from about 10min. after coliphage adsorption. PMID:5338876

  5. Ribonucleic acid synthesis by Escherichia coli C 3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of the coliphage-induced double-stranged ribonucleic acid.

    PubMed

    Bishop, D H

    1966-09-01

    1. The efficiency of extracting nucleic acids from Escherichia coli after five methods of obtaining cell lysis was determined. 2. The recovery of various nucleic acid species isolated after chromatography on methylated albumin-coated kieselguhr was also examined. 3. Double-stranded coliphage-induced RNA was isolated from infected bacteria and its resistance to ribonuclease digestion under various conditions determined. 4. The involvement of double-stranded RNA during the infection process was demonstrated. 5. The time-course of the syntheses in infected cells of double-stranded RNA, DNA, single-stranded coliphage and 16s ribosomal RNA, transfer RNA and ribosomal 23s RNA was examined. 6. It was demonstrated that the syntheses of DNA, transfer RNA and ribosomal RNA decreased 10-15min. after infection. 7. Synthesis of coliphage RNA commenced 10-15min. after infection and double-stranded RNA was also synthesized from about 10min. after coliphage adsorption.

  6. Antibacterial Action of Primaquine: Effects In Vitro on Polypeptide Synthesis and In Vivo on Ribosomes and Ribosomal Ribonucleic Acid

    PubMed Central

    Olenick, John G.

    1975-01-01

    Primaquine inhibited polyphenylalanine formation directed by poly(U) in a cell-free system obtained from Bacillus megaterium only when the drug was preincubated with transfer ribonucleic acid (tRNA), poly(U), or ribosomes. Considerably less inhibition was produced when the ionic strength of the preincubation mixture of tRNA or poly(U) plus primaquine was increased; with ribosomes, the extent of inhibition was only slightly reduced. In cultures of B. megaterium, primaquine induced the breakdown of ribosomes and their RNA. PMID:813574

  7. Oligonucleotide-conjugated thiazole orange probes as "light-up" probes for messenger ribonucleic acid molecules in living cells.

    PubMed

    Privat, E; Melvin, T; Asseline, U; Vigny, P

    2001-10-01

    "Light-up" probes, icosa-alpha-thymidylate-thiazole orange conjugates, for the in situ time-resolved detection of messenger ribonucleic acid (mRNA) in living cells are evaluated. Upon annealing with polyA in aqueous solutions, the icosa-alpha-thymidylate-thiazole orange conjugates were shown to be up to 15 times more fluorescent. Microinjection of these probes into adherent fibroblasts resulted in high yields of hybridization and fluorescent signals. Incubation of cells in the presence of these probes resulted in facile internalization of the probe and similar painting of the messenger RNA in the nuclear and cytosolic regions.

  8. Identification by affinity chromatography of the eukaryotic ribosomal proteins that bind to 5.8 S ribosomal ribonucleic acid.

    PubMed

    Ulbrich, N; Lin, A; Wool, I G

    1979-09-10

    The proteins that bind to rat liver 5.8 S ribosomal ribonucleic acid were identified by affinity chromatography. The nucleic acid was oxidized with periodate and coupled by its 3'-terminus to Sepharose 4B through and adipic acid dihydrazide spacer. The ribosomal proteins that associate with the immobilized 5.8 S rRNA were identified by polyacrylamide gel electrophoresiss: they were L19, L8, and L6 from the 60 S subunit; and S13 and S9 from the small subparticle. Small amounts of L14, L17', L18, L27/L27', and L35', and of S11, S15, S23/S24, and S26 also were bound to the affinity column, but whether they associate directly and specifically with 5.8 S rRNA is not known. Escherichia coli ribosomal proteins did not bind to the rat liver 5.8 S rRNA affinity column. PMID:468846

  9. Tn9 and IS1 inserts in a ribosomal ribonucleic acid operon of Escherichia coli are incompletely polar.

    PubMed Central

    Brewster, J M; Morgan, E A

    1981-01-01

    Transcription is known to be coupled to translation in many or all bacterial operons which code for proteins. In these operons, nonsense codons which prevent normal translation often result in premature termination of transcription (polarity). However, efficient transcription of ribosomal ribonucleic acid operons (rrn operons) occurs, although rrn transcripts are not translated. It therefore seemed possible that insertion sequences and transposable elements which are polar in protein-coding operons might not be polar in rrn operons. Previously, it has been shown (E. A. Morgan, Cell 21:257-265, 1980) that Tn10 is incompletely polar in the rrnX operon. Here we show that the transposon Tn9 and the insertion sequence IS1 also incompletely polar in rrnX. In normal cells expression of sequences distal to the insertions can be detected by genetic methods. In ultraviolet-irradiated cells expression of distal sequences is about 80% of that observed in uninterrupted rrnX operons. These observations provide evidence that ribonucleic acid polymerase molecules beginning at rrnX promoters can read through Tn9 and IS1 and that, at least in ultraviolet-irradiated cells, read-through is very efficient. Images PMID:6171559

  10. Evidence for messenger ribonucleic acid of an ammonium-inducible glutamate dehydrogenase and synthesis, covalent modification, and degradation of enzyme subunits in uninduced Chlorella sorokiniana cells.

    PubMed Central

    Turner, K J; Bascomb, N F; Lynch, J J; Molin, W T; Thurston, C F; Schmidt, R R

    1981-01-01

    The cells of Chlorella sorokiniana cultured in nitrate medium contain no detectable catalytic activity of an ammonium-inducible nicotinamide adenine dinucleotide phosphate-specific glutamate dehydrogenase (NADP-GDH). However, several lines of experimental evidence indicated that the NADP-GDH messenger ribonucleic acid was present at high levels and was being translated in uninduced cells. First, binding studies with 125I-labeled anti-NADP-GDH immunoglobulin G and total polysomes isolated from uninduced and induced cells showed that NADP-GDH subunits were being synthesized on polysomes from both types of cells. Second, when polyadenylic acid-containing ribonucleic acid was extracted from polysomes from uninduced and induced cells and placed into a messenger ribonucleic acid-dependent in vitro translation system, NADP-GDH subunits were synthesized from the ribonucleic acid from both sources. Third, when ammonia was added to uninduced cells, NADP-GDH antigen accumulated without an apparent induction lag. Fourth, by use of a specific immunoprecipitation procedure coupled to pulse-chase studies with [35S]sulfate, it was shown that the NADP-GDH subunits are rapidly synthesized, covalently modified, and then degraded in uninduced cells. PMID:7217012

  11. Effect of Infection with Ribonucleic Acid Bacteriophage R23 on the Inducible Synthesis of β-Galactosidase in Escherichia coli

    PubMed Central

    Watanabe, Hiroko; Watanabe, Mamoru

    1968-01-01

    Infection by ribonucleic acid (RNA) bacteriophage R23 inhibited the synthesis of β-galactosidase in Escherichia coli. The inhibition, although not complete, was apparent shortly after infection and was maximal after the first 20 min of infection. R23 diminished the β-galactosidase-synthesizing capacity when inducer was added after phage infection, but not when infection followed inducer removal. These findings suggested that the primary effect of R23 on enzyme-forming capacity was limitation of synthesis of enzyme-specific messenger RNA. Studies with ultraviolet irradiated phage and amber mutants of R23 indicated that the inhibitory process could be separated into two phases. Early inhibition did not require the expression of the viral genome, whereas late inhibition required the expression of the viral RNA synthetase cistron. PMID:4910818

  12. 5S ribosomal ribonucleic acid sequences in Bacteroides and Fusobacterium: evolutionary relationships within these genera and among eubacteria in general

    NASA Technical Reports Server (NTRS)

    Van den Eynde, H.; De Baere, R.; Shah, H. N.; Gharbia, S. E.; Fox, G. E.; Michalik, J.; Van de Peer, Y.; De Wachter, R.

    1989-01-01

    The 5S ribosomal ribonucleic acid (rRNA) sequences were determined for Bacteroides fragilis, Bacteroides thetaiotaomicron, Bacteroides capillosus, Bacteroides veroralis, Porphyromonas gingivalis, Anaerorhabdus furcosus, Fusobacterium nucleatum, Fusobacterium mortiferum, and Fusobacterium varium. A dendrogram constructed by a clustering algorithm from these sequences, which were aligned with all other hitherto known eubacterial 5S rRNA sequences, showed differences as well as similarities with respect to results derived from 16S rRNA analyses. In the 5S rRNA dendrogram, Bacteroides clustered together with Cytophaga and Fusobacterium, as in 16S rRNA analyses. Intraphylum relationships deduced from 5S rRNAs suggested that Bacteroides is specifically related to Cytophaga rather than to Fusobacterium, as was suggested by 16S rRNA analyses. Previous taxonomic considerations concerning the genus Bacteroides, based on biochemical and physiological data, were confirmed by the 5S rRNA sequence analysis.

  13. Regulation of Synthesis of the Branched-Chain Amino Acids and Cognate Aminoacyl-Transfer Ribonucleic Acid Synthetases of Escherichia coli: a Common Regulatory Element

    PubMed Central

    Jackson, Julius; Williams, L. S.; Umbarger, H. E.

    1974-01-01

    Regulation of isoleucine, valine, and leucine biosynthesis and isoleucyl-, valyl-, and leucyl-transfer ribonucleic acid (tRNA) synthetase formation was examined in two mutant strains of Escherichia coli. One mutant was selected for growth resistance to the isoleucine analogue, ketomycin, and the other was selected for growth resistance to both trifluoroleucine and valine. Control of the synthesis of the branched-chain amino acids by repression was altered in both of these mutants. They also exhibited altered control of formation of isoleucyl-tRNA synthetase (EC 6.1.15, isoleucine:sRNA ligase, AMP), valyl-tRNA synthetase (EC 6.1.1.9, valine:sRNA ligase, AMP), and leucyl-tRNA synthetase (EC 6.1.1.4, leucine:sRNA ligase, AMP). These results suggest the existence of a common element for the control of these two classes of enzymes in Escherichia coli. PMID:4612020

  14. Determination of /sup 35/S-aminoacyl-transfer ribonucleic acid specific radioactivity in small tissue samples

    SciTech Connect

    Samarel, A.M.; Ogunro, E.A.; Ferguson, A.G.; Lesch, M.

    1981-11-15

    Rate determination of protein synthesis utilizing tracer amino acid incorporation requires accurate assessment of the specific radioactivity of the labeled precursor aminoacyl-tRNA pool. Previously published methods presumably useful for the measurement of any aminoacyl-tRNA were unsuccessful when applied to (/sup 35/S)methionine, due to the unique chemical properties of this amino acid. Herein we describe modifications of these methods necessary for the measurement of /sup 35/S-aminoacyl-tRNA specific radioactivity from small tissue samples incubated in the presence of (/sup 35/S)methionine. The use of (/sup 35/S)methionine of high specific radioactivity enables analysis of the methionyl-tRNA from less than 100 mg of tissue. Conditions for optimal recovery of /sup 35/S-labeled dansyl-amino acid derivatives are presented and possible applications of this method are discussed.

  15. A versatile method for the removal of melanin from ribonucleic acids in melanocytic cells.

    PubMed

    Satyamoorthy, K; Li, G; Van Belle, P A; Elder, D E; Herlyn, M

    2002-10-01

    Melanin pigments often co-purify during preparation of nucleic acids from cells or tissues of melanocytic origin. Contaminating melanin can severely impede subsequent analyses of RNA. We attempted to eliminate melanin in RNA preparations using selected gel matrices. We show here that co-purified melanin pigments can be largely eliminated from RNA samples after passing through polyacrylamide-based beads (Bio-Gel P-60). After isolation from the pigment-containing cells or tissues, RNA was subsequently processed through batch or column purification under acidic pH conditions. The resulting RNA was devoid of contaminating melanin pigments and amenable to molecular reactions such as polymerase chain reaction and cDNA synthesis by reverse transcriptase. Although the process results in some loss of input RNA, this purification procedure is simple, robust and can easily be adopted in any laboratory for the molecular analysis of RNA that requires removal of melanin contamination.

  16. Polyacrylamide gel analysis of high molecular weight ribonucleic Acid from etiolated and green cucumber cotyledons.

    PubMed

    Vedel, F; D'Aoust, M J

    1970-07-01

    Cucumis sativus L. seeds and 5-day-old dark-grown cotyledons contain 25 and 18 S cytoplasmic ribosomal RNAs as main components. The major increase in nucleic acid content in both green and etiolated cotyledons occurs between days 5 and 7 of germination. This increase is characterized by an important synthesis of 23 and 16 S plastid (chloroplast and proplastid) ribosomal RNAs. Proplastid RNA synthesis appears to continue for a longer period in the dark-grown cotyledons, despite a total RNA content considerably less than in the light-grown cotyledons.The nonribosomal distribution of the chloroplast and proplastid ribosomal RNAs observed in all cases (after extraction and fractionation) results from the lability of the 23 S component. This degradation increases if the chloroplasts and proplastids are isolated prior to extraction of their nucleic acid.

  17. Affinity chromatography of aminoacyl-transfer ribonucleic acid synthetases. Small organic ligands.

    PubMed Central

    Clarke, C M; Knowles, J R

    1977-01-01

    The usefulness of affinity chromatography for the purification of aminoacyl-tRNA synthetases was explored by using column ligands derived from the corresponding amino acid and aminoalkyladenylate, a non-labile analogue of the aminoacyladenylate reaction intermediate. Four modes of attachment of the aminoalkyladenylate to Sepharose were studied. The interaction between amino acid derivatives and the corresponding aminoacyl-tRNA synthetases is too weak to allow their use as ligands for affinity chromatography. Attachment of the aminoalkyladenylate via the alpha-nitrogen atom of the amino acid or via C-8 of the nucleotide abolishes synthetase binding, and immobilization via the oxidized ribose ring is only marginally useful. However, attachment of the aminoalkyladenylate to the matrix via N-6 of the nucleotide allows strong and specific synthetase binding, and the use of such columns permits the isolation of homogeneous synthetase from crude mixtures. The effect of non-specific adsorption and the utility of pre-columns and of specific substrate elution are investigated and discussed. Images Fig. 4. Fig. 7. PMID:597251

  18. Label-free serum ribonucleic acid analysis for colorectal cancer detection by surface-enhanced Raman spectroscopy and multivariate analysis

    NASA Astrophysics Data System (ADS)

    Chen, Yanping; Chen, Gang; Feng, Shangyuan; Pan, Jianji; Zheng, Xiongwei; Su, Ying; Chen, Yan; Huang, Zufang; Lin, Xiaoqian; Lan, Fenghua; Chen, Rong; Zeng, Haishan

    2012-06-01

    Studies with circulating ribonucleic acid (RNA) not only provide new targets for cancer detection, but also open up the possibility of noninvasive gene expression profiling for cancer. In this paper, we developed a surface-enhanced Raman scattering (SERS), platform for detection and differentiation of serum RNAs of colorectal cancer. A novel three-dimensional (3-D), Ag nanofilm formed by dry MgSO4 aggregated silver nanoparticles, Ag NP, as the SERS-active substrate was presented to effectively enhance the RNA Raman signals. SERS measurements were performed on two groups of serum RNA samples. One group from patients, n=55 with pathologically diagnosed colorectal cancer and the other group from healthy controls, n=45. Tentative assignments of the Raman bands in the normalized SERS spectra demonstrated that there are differential expressions of cancer-related RNAs between the two groups. Linear discriminate analysis, based on principal component analysis, generated features can differentiate the colorectal cancer SERS spectra from normal SERS spectra with sensitivity of 89.1 percent and specificity of 95.6 percent. This exploratory study demonstrated great potential for developing serum RNA SERS analysis into a useful clinical tool for label-free, noninvasive screening and detection of colorectal cancers.

  19. Gradient enhanced-fluidity liquid hydrophilic interaction chromatography of ribonucleic acid nucleosides and nucleotides: A "green" technique.

    PubMed

    Beilke, Michael C; Beres, Martin J; Olesik, Susan V

    2016-03-01

    A "green" hydrophilic interaction liquid chromatography (HILIC) technique for separating the components of mixtures with a broad range of polarities is illustrated using enhanced-fluidity liquid mobile phases. Enhanced-fluidity liquid chromatography (EFLC) involves the addition of liquid CO2 to conventional liquid mobile phases. Decreased mobile phase viscosity and increased analyte diffusivity results when a liquefied gas is dissolved in common liquid mobile phases. The impact of CO2 addition to a methanol:water (MeOH:H2O) mobile phase was studied to optimize HILIC gradient conditions. For the first time a fast separation of 16 ribonucleic acid (RNA) nucleosides/nucleotides was achieved (16min) with greater than 1.3 resolution for all analyte pairs. By using a gradient, the analysis time was reduced by over 100% compared to similar separations conducted under isocratic conditions. The optimal separation using MeOH:H2O:CO2 mobile phases was compared to MeOH:H2O and acetonitrile:water (ACN:H2O) mobile phases. Based on chromatographic performance parameters (efficiency, resolution and speed of analysis) and an assessment of the environmental impact of the mobile phase mixtures, MeOH:H2O:CO2 mixtures are preferred over ACN:H2O or MeOH:H2O mobile phases for the separation of mixtures of RNA nucleosides and nucleotides.

  20. Reagentless measurement of aminoglycoside antibiotics in blood serum via an electrochemical, ribonucleic acid aptamer-based biosensor.

    PubMed

    Rowe, Aaron A; Miller, Erin A; Plaxco, Kevin W

    2010-09-01

    Biosensors built using ribonucleic acid (RNA) aptamers show promise as tools for point-of-care medical diagnostics, but they remain vulnerable to nuclease degradation when deployed in clinical samples. To explore methods for protecting RNA-based biosensors from such degradation we have constructed and characterized an electrochemical, aptamer-based sensor for the detection of aminoglycosidic antibiotics. We find that while this sensor achieves low micromolar detection limits and subminute equilibration times when challenged in buffer, it deteriorates rapidly when immersed directly in blood serum. In order to circumvent this problem, we have developed and tested sensors employing modified versions of the same aptamer. Our first effort to this end entailed the methylation of all of the 2'-hydroxyl groups outside of the aptamer's antibiotic binding pocket. However, while devices employing this modified aptamer are as sensitive as those employing an unmodified parent, the modification fails to confer greater stability when the sensor is challenged directly in blood serum. As a second potentially naive alternative, we replaced the RNA bases in the aptamer with their more degradation-resistant deoxyribonucleic acid (DNA) equivalents. Surprisingly and unlike control DNA-stem loops employing other sequences, this DNA aptamer retains the ability to bind aminoglycosides, albeit with poorer affinity than the parent RNA aptamer. Unfortunately, however, while sensors fabricated using this DNA aptamer are stable in blood serum, its lower affinity pushes their detection limits above the therapeutically relevant range. Finally, we find that ultrafiltration through a low-molecular-weight-cutoff spin column rapidly and efficiently removes the relevant nucleases from serum samples spiked with gentamicin, allowing the convenient detection of this aminoglycoside at clinically relevant concentrations using the original RNA-based sensor.

  1. Sub-unit structure and specificity of methionyl-transfer-ribonucleic acid synthetase from Escherichia coli

    PubMed Central

    Bruton, C. J.; Hartley, B. S.

    1968-01-01

    1. The purification of methionyl-transfer-RNA synthetase from Escherichia coli by a modified technique gives a 16% yield of a protein that appears homogeneous by the criteria of disc gel electrophoresis, ultracentrifugation and end-group analysis. 2. The molecular weight is 96000 and the protein consists of two sub-units of 48000, which appear to be identical. The amino acid composition and thiol content are reported. 3. Kinetic data are reported for analogues of methionine and for pure t-RNAF and t-RNAM, which are respectively the methionine transfer RNA that can exist in the formylmethionyl form and the one that can exist only in the methionyl form. The enzyme binds and acylates both species of transfer RNA identically. PMID:4874971

  2. Polymeric Cryogel-Based Boronate Affinity Chromatography for Separation of Ribonucleic Acid from Bacterial Extracts.

    PubMed

    Shakya, Akhilesh Kumar; Srivastava, Akshay; Kumar, Ashok

    2015-01-01

    Three-dimensional monolithic columns are preferred stationary phase in column chromatography. Conventional columns based on silica or particles are efficient in bioseparation though associated with limitations of nonspecific interaction and uneven porosity that causes high mass transfer resistance for the movement of big molecules. Cryogels as a monolith column have shown promising application in bioseparation. Cryogels column can be synthesized in the form of a monolith at sub-zero temperature through gelation of pre-synthesized polymers or polymerization of monomers. Cryogels are macroporous and mechanically stable materials. They have open interconnected micron-sized pores with a wide range of porosity (10-200 μm). Current protocol demonstrated the ability of poly(hydroxymethyl methacrylate)-co-vinylphenyl boronic acid p(HEMA-co-VPBA) cryogel matrix for selective separation of RNA from the bacterial crude extract. PMID:26623972

  3. Stability of polyadenylic and polyadenylated ribonucleic acids in radish (Raphanus sativus) seedlings.

    PubMed

    Aspart, L; Cooke, R; Delseny, M

    1979-08-29

    The stability of polyadenylic acid and polyadenylated RNA was investigated in young radish (Raphanus sativus) seedlings. We first studied the decay of poly(A) content, using a [3H]poly(U) assay, following a complete block of transcription by cordycepin (200 microgram/ml). Two lifetime classes of polyadenylic acid have been determined in these seedlings: a short-lived component with a half-life of 30 min which represents 60% of poly(A) and a more stable component with varying half-lives of which the majority range from 4-10 h and a few are considerably longer. During this period rRNA was shown to decay linearly, taking about 41 h for half of this RNA to disappear. The life-time of the other moiety of polyadenylated-RNA was analysed by continuous labelling with [3H]uridine. We have been able to demonstrate that a significant part of the mRNA molecules turns over with a half-life similar to that of the more slowly turning-over poly(A). No evidence could be obtained for rapidly turning-over messenger RNA. Thus the rapidly turning over poly(A) could correspond to a poly(A) turn-over independent of the remainder of the sequence. When labelling was very long, an apparent steady-state was reached and we determined the polyadenylated RNA content of seedlings to be 2.2% of whole cell RNA. Finally, these results were compared with those previously obtained in studying early germination of radish embryo axes. In contrast with stored mRNA which is rapidly degraded following imbibition, part of the mRNA present in 22 h old seedlings is stable for several hours.

  4. Studies on independent synthesis of cytoplasmic ribonucleic acids in Acetabularia mediterranea.

    PubMed

    NAORA, H; BRACHET, J

    1960-07-01

    1. The RNA content of anucleate and nucleate fragments of Acetabularia has been measured. It was found that there is a net synthesis of RNA in nucleate fragments. On the other hand, the RNA content of anucleate fragments did not change significantly after enucleation. 2. Anucleate fragments, however, can readily incorporate (14)C-labeled adenine, orotic acid, and carbon dioxide into their cytoplasmic RNA. 3. The results of experiments on (14)CO(2) incorporation into the RNA of anucleate and nucleate fragments suggest that there is a mechanism for de novo synthesis of RNA in anucleate cytoplasm. 4. In Acetabularia, 81 per cent of the cytoplasmic RNA is bound to a large granule fraction, consisting mainly of chloroplasts. Even after removal of the nucleus, RNA is synthesized in this "chloroplast" fraction. The chloroplasts are thus a major site of RNA synthesis in the cytoplasm of these algae. Synthesis of "chloroplastic" RNA, in anucleate fragments, possibly occurs at the expense of the RNA present in other fractions (microsomes and supernatant). 5. 8-Azaguanine stimulates regeneration and cap formation in anucleate fragments and does not inhibit RNA synthesis in these fragments.

  5. Accumulation of methyl-deficient rat liver messenger ribonucleic acid on ethionine administration

    SciTech Connect

    Goswami, B.B.; Sharma, O.K.

    1980-01-01

    Highly purified poly(adenylic acid)-containing RNA isolated from livers of rats fed 0.25% DL-etionine in the diet for 7 days accepted methyl groups from S-adenosyl(methyl-/sup 3/H)methionine, when incubated in vitro with mRNA methyltransferases from vaccinia virus or Ehrlich ascites cells, whereas RNA from control rats had no such activity. Nuclease digestion followed by chromatographic analyses of mRNA methylated in vitro revealed that the methyl groups were incorporated at the 5' end into cap 1 structures (m/sup 7/GpppNmp...) by the viral enzyme, whereas both cap 0 (m/sup 7/GpppNp...) and cap 1 (m/sup 7/Gpppm/sup 6/Am...) structures were formed by the Ehrlich ascites cell enzymes. the methyl-deficient mRNA isolated from the liver of ethionine-fed rats differed in its translational properties from mRNA isolated from control animals in an in vitro protein synthesizing system from wheat germ.

  6. Prolactin messenger ribonucleic acid levels, prolactin synthesis, and radioimmunoassayable prolactin during the estrous cycle in the Golden Syrian hamster

    SciTech Connect

    Massa, J.S. ); Blask, D.E. )

    1990-01-01

    The purpose of this study was to observe the molecular dynamics of pituitary prolactin (PRL) gene expression during the estrous cycle of the Golden Syrian hamster. PRL messenger ribonucleic acid (mRNA) levels, PRL synthesis were measured in the morning on each day of the cycle. We observed that all of these PRL indices declined or did not change from Day 2 to Day 3 of the cycle. From Day 3 to Day 4 however, PRL mRNA levels increased 33-38% and media {sup 3}H-PRL increased 32-42%, while there were no significant changes in pituitary {sup 3}H-PRL, or RIA-PRL in the media or pituitary. From Day 4 to Day 1 (estrus) there was reciprocal change in the levels of {sup 3}H-PRL in the pituitary vs. the media, with the former increasing 37-50% and the latter decreasing 25-32%. Pituitary RIA-PRL did also increased 45-64% from Day 4 to Day 1 while media RIA-PRL did not change. These data are consistent with the following hypothesis: On the morning of proestrus(Day 4) in the hamster, PRL mRNA levels are elevated compared to those on Day 3, signaling an increase in PRL synthesis. This newly synthesized PRL is shunted into a readily releasable pool on the morning of Day 4 (contributing to the afternoon surge of serum PRL), and into a preferentially stored pool by the morning of Day 1.

  7. Short hairpin ribonucleic acid constructs targeting insulin-like growth factor binding protein-3 rehabilitated dyslipidaemia in diabetic rats.

    PubMed

    Zhou, Z-Y; Cheng, S-P; Huang, H; Wang, J; Pan, H; Liu, C-M; Xing, C; Sun, Y-L; Liu, R-H; Zhong, G-J

    2016-02-01

    It was investigated whether short hairpin ribonucleic acid constructs targeting insulin-like growth factor binding protein-3 (IGFBP-3 shRNA) can rehabilitate dyslipidaemia in streptozotocin-induced diabetic rats. After 12 weeks of intracavernous administration of IGFBP-3 shRNA, intracavernous pressure responses to electrical stimulation of cavernous nerves were evaluated. The concentrations of serum low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, triglyceride and cavernous cyclic guanosine monophosphate were all detected by enzyme-linked immunosorbent assay. The per cent of smooth muscle in corpus cavernous tissue was also evaluated. It was found that the cavernosal pressure was significantly increased in the IGFBP-3 shRNA treatment group compared to the diabetic control group after 12 weeks of intracavernous administration of IGFBP-3 shRNA (P < 0.01). The concentrations of serum low-density lipoprotein cholesterol and triglyceride were significantly decreased in the IGFBP-3 shRNA treatment group compared to the diabetic control group, while no significant changes of serum high-density lipoprotein cholesterol concentration were found (P < 0.01). At the same time, cavernous cyclic guanosine monophosphate concentrations and the percentage of cavernosal smooth muscle were both significantly increased in the IGFBP-3 shRNA treatment group compared to the diabetic control group (P < 0.01). This study indicated that IGFBP-3 shRNA might rehabilitate erectile function via a decrease in concentrations of serum low-density lipoprotein and triglyceride, an increase in the percentage of cavernosal smooth muscle and an improvement in the nitric oxide-cyclic guanosine monophosphate signalling activities in streptozotocin-induced diabetic rats.

  8. Transfer ribonucleic acid synthesis during sporulation and spore outgrowth in Bacillus subtilis studied by two-dimensional polyacrylamide gel electrophoresis.

    PubMed Central

    Henner, D J; Steinberg, W

    1979-01-01

    The synthesis of transfer ribonucleic acid (tRNA) was examined during spore formation and spore outgrowth in Bacillus subtilis by two-dimensional polyacrylamide gel electrophoresis of in vivo 32P-labeled RNA. The two-dimensional gel system separated the B. subtilis tRNA's into 32 well-resolved spots, with the relative abundances ranging from 0.9 to 17% of the total. There were several spots (five to six) resolved which were not quantitated due to their low abundance. All of the tRNA species resolved by this gel system were synthesized at every stage examined, including vegetative growth, different stages of sporulation, and different stages of outgrowth. Quantitation of the separated tRNA's showed that in general the tRNA species were present in approximately the same relative abundances at the different developmental periods. tRNA turnover and compartmentation occurring during sporulation were examined by labeling during vegetative growth followed by the addition of excess phosphate to block further 32P incorporation. The two-dimensional gels of these samples showed the same tRNA's seen during vegetative growth, and they were in approximately the same relative abundances, indicating minimal differences in the rates of turnover of individual tRNA's. Vegetatively labeled samples, chased with excess phosphate into mature spores, also showed all of the tRNA species seen during vegetative growth, but an additional five to six minor spots were also observed. These are hypothesized to arise from the loss of 3'-terminal residues from preexisting tRNA's. Images PMID:115846

  9. Growth hormone and drug metabolism. Acute effects on nuclear ribonucleic acid polymerase activity and chromatin.

    PubMed Central

    Spelsberg, T C; Wilson, J T

    1976-01-01

    Adult male rats, subjected either to sham operation or to hypophysectomy and adrenalectomy were maintained for 10 days before treatment with growth hormone. Results of the acute effects of growth hormone on the rat liver nuclear RNA polymerase I (nucleolar) and II (nucleoplasmic) activities as well as the chromatin template capacity were then studied and compared with the growth-hormone effects on the drug metabolism described in the preceding paper (Wilson & Spelsberg, 1976). 2. Conditions for isolation and storage of nuclei for maintenance of optimal polymerase activities are described. It is verified that the assays for polymerase activities require a DNA template, all four nucleoside triphosphates, and a bivalent cation, and that the acid-insoluble radioactive product represents RNA. Proof is presented that under high-salt conditions DNA-like RNA (polymerase II) is synthesized, and that under low-salt conditions in the presence of alpha-amanitin, rRNA (polymerase I) is synthesized. 3. In the livers of hypophysectomized/adrenalectomized rats, growth hormone increases the activity of both RNA polymerase enzymes and the chromatin template capacity within 1h after treatment. The effects last for 12h in the case of polymerase II but for only 6h in the case of polymerase I. Sham-operated rats respond to growth hormone in a manner somewhat similar to that shown by hypophysectomized/adrenalectomized rats. These results, which demonstrate an enhancement of RNA polymerase I activity in response to growth hormone, support those from other laboratories. 4. Growth-hormone enhancement of the chromatin template capacity in the liver of hypophysectomized/adrenalectomized rats contrasts with previous reports. The growth-hormone-induced de-repression of the chromatin DNA could represent the basis of the growth-hormone-induced enhancement of RNA polymerase II activity in the hypophysectomized/adrenalectomized rats, although some effect of growth-hormone on the polymerase enzymes

  10. Evidence for defective transfer ribonucleic acid in polymyopathic hamsters and its inhibitory effect on protein synthesis

    PubMed Central

    Bester, André J.; Gevers, Wieland

    1973-01-01

    1. Different reaction steps involved in protein synthesis were studied in skeletal muscles from control and myopathic hamsters. 2. There was no difference between partially purified aminoacyl-tRNA synthetases from myopathic and control animals in yield or catalytic activity, as tested with exogenous deacylated tRNA. 3. However, isolated deacylated tRNA from myopathic muscle was aminoacylated by these synthetases to a lesser extent than that derived from control muscle. 4. Addition of deacylated tRNA isolated from control muscle improved the performance of pH5 enzymes from myopathic muscle in polypeptide synthesis on homologous polyribosomes; tRNA isolated from myopathic animals did not. 5. Preparation of extracts from both types of animals in the presence of the ribonuclease-absorbent bentonite led to an increased capacity of endogenous tRNA to accept amino acids in pH5 enzymes prepared from normal and abnormal tissue, but the difference between the two systems remained the same. 6. Total tRNA nucleotidyltransferase activity, tested with twice-pyrophosphorolysed rat liver tRNA, was identical in both extracts. 7. Added tRNA nucleotidyltransferase incorporated more AMP and CMP into endogenous tRNA with the pH5 enzyme from myopathic muscle than with that from control muscle. 8. Preincubation of deacylated tRNA from myopathic muscle with ATP, CTP and tRNA nucleotidyltransferase more than doubled its subsequent aminoacyl-acceptor activity, and halved the extent of the defect relative to aminoacylation of control tRNA similarly treated. Endogenous tRNA in pH5 enzyme preparations behaved likewise. 9. It is suggested that a 3′-exonuclease in myopathic muscles attacks tRNA molecules in such a way that some of them remain substrates for tRNA nucleotidyltransferase, which may incorporate into RNA not only AMP and CMP, but also GMP. 10. Cell-free protein synthesis in preparations from myopathic hamster muscles is limited by the supply of intact tRNA molecules. PMID:4725037

  11. THE RELATION BETWEEN THE INTRACELLULAR RIBONUCLEIC ACID DISTRIBUTION AND AMINO ACID INCORPORATION IN THE LIVER OF THE DEVELOPING CHICK EMBRYO

    PubMed Central

    Duck-Chong, Coral; Pollak, J. K.; North, R. J.

    1964-01-01

    The RNA-P and DNA-P content of the nucleus and the RNA-P content of the whole cell of the livers of 8- to 20-day chick embryos and of adult fowls have been determined. The DNA-P content of the liver nuclei was slightly higher in the 8- and 10-day embryo than in all the other stages examined. A significant decrease in the RNA content of the cell occurred during embryonic development. The RNA content of the adult cell was the same as that of the 14- to 16-day embryo. The proportion of the cellular RNA contributed by the nucleus also decreased during development. In respect to both nuclear RNA content and distribution of RNA between nucleus and cytoplasm, the adult resembled the 8- to 12-day embryo. Examination of the fine structure of the cell showed that, as development progressed, free ribosomes decreased in number and the rough membranes increased. Slices of 8-, 14-, and 20-day embryonic livers and of adult livers were incubated with 14C-leucine, and the amount of labeled amino acid incorporated into whole tissue protein and into the proteins of the subcellular fractions was measured. Embryonic liver incorporated 14C-leucine 15 to 30 times more rapidly than adult liver. The microsomal protein was always more highly labelled than the protein in any other subcellular fraction; however, in the 8-day embryonic and the adult liver the proportion of total counts found in the nuclear fraction was considerably higher than in the 14- or 20-day embryonic liver. The significance of an apparent correlation between the proportion of the cell's RNA contributed by the nucleus and the proportion of total counts in the nuclear fraction is discussed. PMID:14105214

  12. Bone marrow mononuclear cells from patients with Paget's disease contain measles virus nucleocapsid messenger ribonucleic acid that has mutations in a specific region of the sequence.

    PubMed

    Reddy, S V; Singer, F R; Roodman, G D

    1995-07-01

    Ultrastructural, immunocytochemical, and in situ hybridization studies have suggested that paramyxoviruses, such as measles virus (MV), are present in Pagetic osteoclasts and may contribute to the abnormality in osteoclast function. However, little additional information is known about potential viruses present in Pagetic osteoclasts. As there are increased numbers of osteoclast precursors among the marrow mononuclear cells of Paget's patients, we used the reverse transcriptase-polymerase chain reaction to amplify the nucleocapsid sequence of MV from freshly isolated bone marrow-derived mononuclear cells to examine the potential role of these viruses in cells in the osteoclast lineage. We detected MV nucleocapsid transcripts in 5 of 6 individual Paget's patients' marrow samples. MV transcripts were not detected in marrow samples from 10 normal subjects. Sequence analysis of the PCR products revealed that 1 patient had the same sequence as the Edmonston strain of MV. The remaining 4 patients had point mutations clustered between position 1360-1371 base pairs. Two of the patients exhibited identical mutations at this region. In total, 3 different point mutations were identified that resulted in amino acid substitutions. These data show that 1) unlike those from normal subjects, marrow mononuclear cells from Paget's patients express MV nucleocapsid messenger ribonucleic acid; and 2) mutations of a specific region of the MV nucleocapsid gene were present in 4 of 5 patients and suggest a persistent MV infection in Pagetic osteoclast precursors. These data further suggest that osteoclasts are infected by fusion with infected precursors.

  13. Encapsulation of ribonucleic acid in human red blood cells for use as a reticulocyte quality control material for flow cytometric analysis.

    PubMed

    Ebrahim, A; Ryan, W L

    1996-10-01

    The osmotic lysis procedure was employed to encapsulate ribonucleic acid (RNA) in human red blood cells in order to prepare a reticulocyte reference control. The procedure required the hypotonic dialysis of erythrocytes in the presence of RNA and cytosolic components of red blood cells followed by a short hypertonic dialysis to restore isotonicity and reseal the pores formed on the cell membrane during the hypotonic swelling. The procedure was monitored by a dedicated flow cytometer for reticulocyte counting and required 120 min. Approximately 20% of the erythrocytes undergoing the reversible osmotic lysis were encapsulated with various amounts of RNA. The morphology of the RNA-loaded erythrocytes were similar to those of normal erythrocytes and reticulocytes, however, their mean cell volume (MCV) was slightly smaller than normal cells. RNA-loaded erythrocytes prepared by this method were stable for several months as a reference control for identification and enumeration of reticulocytes using flow cytometric as well as manual analysis methods and resulted in a high correlation coefficient between these counting techniques. PMID:8891445

  14. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA)

    PubMed Central

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S.; Harlow, Mark L.

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5′ ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission. PMID:26446566

  15. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).

    PubMed

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission.

  16. Synaptic vesicles contain small ribonucleic acids (sRNAs) including transfer RNA fragments (trfRNA) and microRNAs (miRNA).

    PubMed

    Li, Huinan; Wu, Cheng; Aramayo, Rodolfo; Sachs, Matthew S; Harlow, Mark L

    2015-01-01

    Synaptic vesicles (SVs) are neuronal presynaptic organelles that load and release neurotransmitter at chemical synapses. In addition to classic neurotransmitters, we have found that synaptic vesicles isolated from the electric organ of Torpedo californica, a model cholinergic synapse, contain small ribonucleic acids (sRNAs), primarily the 5' ends of transfer RNAs (tRNAs) termed tRNA fragments (trfRNAs). To test the evolutionary conservation of SV sRNAs we examined isolated SVs from the mouse central nervous system (CNS). We found abundant levels of sRNAs in mouse SVs, including trfRNAs and micro RNAs (miRNAs) known to be involved in transcriptional and translational regulation. This discovery suggests that, in addition to inducing changes in local dendritic excitability through the release of neurotransmitters, SVs may, through the release of specific trfRNAs and miRNAs, directly regulate local protein synthesis. We believe these findings have broad implications for the study of chemical synaptic transmission. PMID:26446566

  17. The identification by affinity chromatography of the rat liver ribosomal proteins that bind to elongator and initiator transfer ribonucleic acids.

    PubMed

    Ulbrich, N; Wool, I G; Ackerman, E; Sigler, P B

    1980-07-25

    Mixed yeast elongator-tRNAs (bulk tRNA lacking fRNAm,fMet), pure isoaccepting species of elongator-tRNAs (tRNAmMet and tRNAPhe), and purified initiator-tRNA (tRNAfMet) were each oxidized with periodate and the 3' terminus was coupled to Sepharose 4B through an adipic acid dihydrazide spacer. The rat liver ribosomal proteins that associated with the tRNAs were isolated by affinity chromatography and identified by electrophoresis in polyacrylamide gels. The rat liver ribosomal proteins that were bound to the elongator-tRNA preparations were L6, L35a, and S15; small amounts of a number of other proteins also associated with the nucleic acid. When initiator-tRNA (tRNAfMet) was immobilized on Sepharose, only L6 and L35a were bound; no 40 S subunit proteins associated with initiator-tRNA. No Escherichia coli proteins formed a complex with either eukaryotic initiator- or elongator-tRNAs. PMID:7391064

  18. Field-deployable real-time polymerase chain reaction detection of bluetongue and epizootic haemorrhagic disease viral ribonucleic acid.

    PubMed

    Wilson, W C; Stallknecht, D E; Mecham, J O

    2004-01-01

    Nucleic acid sequence information from molecular evolution studies of bluetongue virus (BTV) and related epizootic haemorrhagic disease virus (EHDV) strains has resulted in a large database of genomic information. Published sequence data and sequence data from our laboratory were used to design real-time field-deployable reverse transcriptase-polymerase chain reaction assays for the detection of BTV or EHDV viral RNA. The assays used standard RNA extraction and TaqMan chemistries and the entire process was completed in

  19. Effects of gamma-irradiation on biosynthesis of different types of ribonucleic acids in normal and regenerating rat liver.

    PubMed Central

    Markov, G G; Dessev, G N; Russev, G C; Tsanev, R G

    1975-01-01

    1. The effect of gamma-irradiation (4000rd) on the synthesis of ribosomal (pre-rRNA) and heterogeneous nuclear RNA (pre-mRNA) in normal and in regenerating rat liver was studied by using 40 min labelling with [6(-14)C]orotic acid. 2. Partial hepatectomy caused a sharp transient increase in the specific radioactivity of the endogenous low-molecular-weight RNA precursors in the livers of both normal and irradiated rats. Irradiation of intact animals did not affect the pool. 3. Irradiation enhanced the synthesis of pre-rRNA for at least 12h. The synthesis of pre-mRNA was also enhanced, but only in the first 3h after irradiation. 4. Partial hepatectomy strongly stimulated the synthesis of both pre-rRNA and pre-mRNA. 5. The synthesis of pre-rRNA was enhanced also in regenerating liver of animals irradiated before or after the operation. The conclusion can be drawn that the early increase in the synthesis of ribosomal RNA is a non-specific cellular response to different injuring factors. 6. The only case where irradiation caused an early inhibition of RNA synthesis was that of pre-mRNA in regenerating liver. This supports the hypothesis that ionizing radiation does not suppress the transcription per se but affects the mechanisms of activation of new genes (cellular programming). PMID:1147904

  20. Mengovirus Replication in Novikoff Rat Hepatoma and Mouse L Cells: Effects on Synthesis of Host-Cell Macromolecules and Virus-specific Synthesis of Ribonucleic Acid

    PubMed Central

    Plagemann, Peter G. W.

    1968-01-01

    Novikoff cells (strain N1S1-67) and L-67 cells, a nutritional mutant of the common strain of mouse L cells which grows in the same medium as N1S1-67 cells, were infected with mengovirus under identical experimental conditions. The synthesis of host-cell ribonucleic acid (RNA) by either type of cell was not affected quantitatively or qualitatively until about 2 hr after infection, when viral RNA synthesis rapidly displaced the synthesis of cellular RNA. The rate of synthesis of protein by both types of cells continued at the same rate as in uninfected cells until about 3 hr after infection, and a disintegration of polyribosomes occurred only towards the end of the replicative cycle, between 5 and 6 hr. The time courses and extent of synthesis of single-stranded and double-stranded viral RNA and of the production of virus were very similar in both types of cells, in spite of the fact that the normal rate of RNA synthesis and the growth rate of uninfected N1S1-67 cells are about three times greater than those of L-67 cells. In both cells, the commencement of viral RNA synthesis coincided with the induction of viral RNA polymerase, as measured in cell-free extracts. Viral RNA polymerase activity disappeared from infected L-67 cells during the period of production of mature virus, but there was a secondary increase in activity in both types of cells coincidental with virus-induced disintegration of the host cells. Infected L-67 cells, however, disintegrated and released progeny virus much more slowly than N1S1-67 cells. The two strains of cells also differed in that replication of the same strain of mengovirus was markedly inhibited by treating N1S1-67 cells with actinomycin D prior to infection; the same treatment did not affect replication in L-67 cells. PMID:4176992

  1. Molecular cloning of otoconin-22 complementary deoxyribonucleic acid in the bullfrog endolymphatic sac: effect of calcitonin on otoconin-22 messenger ribonucleic acid levels.

    PubMed

    Yaoi, Yuichi; Suzuki, Masakazu; Tomura, Hideaki; Sasayama, Yuichi; Kikuyama, Sakae; Tanaka, Shigeyasu

    2003-08-01

    Anuran amphibians have a special organ called the endolymphatic sac (ELS), containing many calcium carbonate crystals, which is believed to have a calcium storage function. The major protein of aragonitic otoconia, otoconin-22, which is considered to be involved in the formation of calcium carbonate crystals, has been purified from the saccule of the Xenopus inner ear. In this study, we cloned a cDNA encoding otoconin-22 from the cDNA library constructed for the paravertebral lime sac (PVLS) of the bullfrog, Rana catesbeiana, and sequenced it. The bullfrog otoconin-22 encoded a protein consisting of 147 amino acids, including a signal peptide of 20 amino acids. The protein had cysteine residues identical in a number and position to those conserved among the secretory phospholipase A(2) family. The mRNA of bullfrog otoconin-22 was expressed in the ELS, including the PVLS and inner ear. This study also revealed the presence of calcitonin receptor-like protein in the ELS, with the putative seven-transmembrane domains of the G protein-coupled receptors. The ultimobranchialectomy induced a prominent decrease in the otoconin-22 mRNA levels of the bullfrog PVLS. Supplementation of the ultimobranchialectomized bullfrogs with synthetic salmon calcitonin elicited a significant increase in the mRNA levels of the sac. These findings suggest that calcitonin secreted from the ultimobranchial gland, regulates expression of bullfrog otoconin-22 mRNA via calcitonin receptor-like protein on the ELS, thereby stimulating the formation of calcium carbonate crystals in the lumen of the ELS. PMID:12865304

  2. Studies of Nondefective Adenovirus 2-Simian Virus 40 Hybrid Viruses IV. Characterization of the Simian Virus 40 Ribonucleic Acid Species Induced by Wild-Type Simian Virus 40 and by the Nondefective Hybrid Virus, Ad2+ND1

    PubMed Central

    Oxman, Michael N.; Levine, Arthur S.; Crumpacker, Clyde S.; Levin, Myron J.; Henry, Patrick H.; Lewis, Andrew M.

    1971-01-01

    Ad2+ND1, a nondefective adenovirus 2 (Ad2)-simian virus 40 (SV40) hybrid virus, has been previously shown to contain a small segment of the SV40 genome covalently linked to Ad2 deoxyribonucleic acid (DNA). The SV40 portion of this hybrid virus has been characterized by relating the SV40-specific ribonucleic acid (RNA) sequences transcribed from the Ad2+ND1 DNA to those transcribed from the DNA of SV40 itself. RNA-DNA hybridization-competition studies indicate that the SV40 component of Ad2+ND1 consists of some, but not all, of that part of the SV40 genome which is transcribed early, i.e., prior to viral DNA replication, in SV40 lytic infection. PMID:4329969

  3. Qualitative and quantitative aspects of the biosynthesis of ribonucleic acid and of protein in the liver and the lung of the Syrian golden hamster

    PubMed Central

    Witschi, Hanspeter

    1973-01-01

    1. The incorporation of orotic acid and of uridine into total RNA was measured in vivo in liver and lung of the Syrian golden hamster. Specific activities of total acid-soluble UMP were measured in both organs. An estimation of the rate of RNA biosynthesis showed that hamster lung synthesizes RNA at about one-half of the rate of that of hamster liver. 2. The apparent Km and Vmax. values of a few enzymes involved in pyrimidine biosynthesis were measured in the 100000g supernatants of liver and lung. The apparent Km values were very similar in both organs. From the estimated Vmax., it was concluded that hamster lung cells have less capacity to metabolize orotic acid than have liver cells. 3. A time–response and a dose–response study showed that actinomycin D inhibits pulmonary RNA synthesis as efficiently as hepatic RNA synthesis. 4. Protein synthesis, measured as the incorporation of leucine, was inhibited in both organs 30min after a dose of 2mg of cycloheximide/kg. The dose–response patterns were similar in both liver and lung 3h after cycloheximide. 5. It is concluded that RNA and protein synthesis in vivo in hamster lung are very similar to the corresponding reactions in liver. Alterations of RNA and protein synthesis by toxic agents can therefore be evaluated in lung with a similar approach to that used to study the pathological biochemistry of liver. PMID:4780700

  4. Properties of the ribonucleic acid bacteriophage ZIK-1 coat protein and its synthesis in an Escherichia coli cell-free system.

    PubMed

    Robinson, J W

    1972-07-01

    The coat protein subunit of the RNA bacteriophage ZIK/1 has a molecular weight of 12100 and does not contain histidine, methionine and cysteine. The amino acid composition of the coat protein is different from that of other RNA bacteriophage coat proteins. Bacteriophage ZIK/1 belongs to a class of RNA bacteriophages distinct from the f2 type, which lack histidine in their coat proteins, and the Qbeta type, which lack histidine and methionine. Bacteriophage ZIK/1 RNA is an efficient template in the Escherichia coli cell-free system producing coat protein as the major product and a number of non-coat proteins. This result is similar to that obtained with RNA from f2-type bacteriophages. It is probable that the genomes of RNA bacteriophages are structurally similar and that differences between the types of RNA bacteriophage arise from minor differences in RNA sequence.

  5. Properties of the ribonucleic acid bacteriophage ZIK/1 coat protein and its synthesis in an Escherichia coli cell-free system

    PubMed Central

    Robinson, J. W.

    1972-01-01

    The coat protein subunit of the RNA bacteriophage ZIK/1 has a molecular weight of 12100 and does not contain histidine, methionine and cysteine. The amino acid composition of the coat protein is different from that of other RNA bacteriophage coat proteins. Bacteriophage ZIK/1 belongs to a class of RNA bacteriophages distinct from the f2 type, which lack histidine in their coat proteins, and the Qβ type, which lack histidine and methionine. Bacteriophage ZIK/1 RNA is an efficient template in the Escherichia coli cell-free system producing coat protein as the major product and a number of non-coat proteins. This result is similar to that obtained with RNA from f2-type bacteriophages. It is probable that the genomes of RNA bacteriophages are structurally similar and that differences between the types of RNA bacteriophage arise from minor differences in RNA sequence. PMID:4564257

  6. Assessing delivery and quantifying efficacy of small interfering ribonucleic acid therapeutics in the skin using a dual-axis confocal microscope

    NASA Astrophysics Data System (ADS)

    Ra, Hyejun; Gonzalez-Gonzalez, Emilio; Smith, Bryan R.; Gambhir, Sanjiv S.; Kino, Gordon S.; Solgaard, Olav; Kaspar, Roger L.; Contag, Christopher H.

    2010-05-01

    Transgenic reporter mice and advances in imaging instrumentation are enabling real-time visualization of cellular mechanisms in living subjects and accelerating the development of novel therapies. Innovative confocal microscope designs are improving their utility for microscopic imaging of fluorescent reporters in living animals. We develop dual-axis confocal (DAC) microscopes for such in vivo studies and create mouse models where fluorescent proteins are expressed in the skin for the purpose of advancing skin therapeutics and transdermal delivery tools. Three-dimensional image volumes, through the different skin compartments of the epidermis and dermis, can be acquired in several seconds with the DAC microscope in living mice, and are comparable to histologic analyses of reporter protein expression patterns in skin sections. Intravital imaging with the DAC microscope further enables visualization of green fluorescent protein (GFP) reporter gene expression in the skin over time, and quantification of transdermal delivery of small interfering RNA (siRNA) and therapeutic efficacy. Visualization of transdermal delivery of nucleic acids will play an important role in the development of innovative strategies for treating skin pathologies.

  7. Technical Report: Triple-Colour Staining Flow Cytometry for Co-Distribution of Thrombospondin Receptor (CD36), Ribonucleic Acid (RNA) and Fetal Haemoglobin (HbF) in Sickle Red Blood Cells.

    PubMed

    Mundee, Y; Bigelow, N C; Davis, B H; Porter, J B

    2001-01-01

    Red blood cells (RBCs) from sickle cell patients (SS) express thrombospondin receptor (CD36), contain ribonucleic acid (RNA, recognised as reticulocytes) and fetal haemoglobin (HbF, defined as F cells) in a higher proportion than RBCs from healthy individuals. The co-distribution of CD36, RNA and HbF on the same RBCs has not been demonstrated due to a lack of detection methods. A triple-colour staining flow cytometry for the co-distribution of CD36, RNA and HbF was developed. The method can simultaneously determine CD36-expressing RBCs (CD36 cells), RNA-bearing RBCs (reticulocytes), HbF-bearing RBCs (F cells), CD36-expressing reticulocytes (CD36 reticulocytes), CD36-expressing-F cells (CD36-F cells), HbF-bearing reticulocytes (F reticulocytes) and CD36-expressing-F reticulocjrtes (CD36-F reticulocytes). Mouse monoclonal antibody against CD36 (MoAb-CD36), antibodagainst mouse-immunoglobulin conjugated to biotin (Ab-Molg-Bi), streptavidin conjugated to rhodamine phycoerythrin (StA-RFE), MoAb against HbF conjugated to Tri-Colour® (MoAb-HbF-TC), Thiazole orange (TO), Glutaraldehyde and Triton X-100 were used. The procedure takes approximately 7 hours. The numbers of CD36 cells, reticulocytes and F cells obtaining from single and triple staining were well correlated and not significantly different. Intra- and inter-assay coefficient of variation percents (%CVs) of the triple-colour staining were less than 10 and 15% respectively. EDTA blood samples stored at 4°C for less than 3 days are suitable. The method trial was then employed on blood samples from SS and healthy individuals. The method is reproducible, objective and applicable for determination of co-distribution of other membrane and intracellular markers in RBCs.

  8. Luteinizing hormone releasing hormone (LHRH) neurons maintained in nasal explants decrease LHRH messenger ribonucleic acid levels after activation of GABA(A) receptors.

    PubMed

    Fueshko, S M; Key, S; Wray, S

    1998-06-01

    Inhibition of the LHRH system appears to play an important role in preventing precocious activation of the hypothalamic-pituitary-gonadal axis. Evidence points to gamma-aminobutyric acid (GABA) as the major negative regulator of postnatal LHRH neuronal activity. Changes in LHRH messenger RNA (mRNA) levels after alterations of GABAergic activity have been reported in vivo. However, the extent to which GABA acts directly on LHRH neurons to effect LHRH mRNA levels has been difficult to ascertain. The present work evaluates the effect of GABAergic activity, via GABA(A) receptors, on LHRH neuropeptide gene expression in LHRH neurons maintained in olfactory explants generated from E11.5 mouse embryos. These explants maintain large numbers of primary LHRH neurons that migrate from bilateral olfactory pits in a directed manner. Using in situ hybridization histochemistry and single cell analysis, we report dramatic alterations in LHRH mRNA levels. Inhibition of spontaneous synaptic activity by GABA(A) antagonists, bicuculline (10(-5) M) or picrotoxin (10(-4) M), or of electrical activity by tetrodotoxin (TTX, 10(-6) M) significantly increased LHRH mRNA levels. In contrast, LHRH mRNA levels decreased in explants cultured with the GABA(A) receptor agonist, muscimol (10(-4) M), or KCl (50 mM). The observed responses suggest that LHRH neurons possess functional pathways linking GABA(A) receptors to repression of neuropeptide gene expression and indicate that gene expression in embryonic LHRH neurons, outside the CNS, is highly responsive to alterations in neuronal activity.

  9. Polyuridylic Acid-directed Phenylalanine Incorporation in Minicell Extracts

    PubMed Central

    Fralick, J. A.; Fisher, W. D.; Adler, H. I.

    1969-01-01

    Cell-free extracts of miniature Escherichia coli cells deficient in deoxyribonucleic acid (DNA) and DNA-dependent ribonucleic acid polymerase have been shown to be capable of polyuridylic acid-directed [14C]phenylalanine incorporation. PMID:4897117

  10. Down-regulation of messenger ribonucleic acid encoding an importer of sulfoconjugated steroids during human chorionic gonadotropin-induced follicular luteinization in vivo.

    PubMed

    Brown, Kristy A; Bouchard, Nadine; Lussier, Jacques G; Sirois, Jean

    2007-01-01

    Members of the organic anion transporting polypeptide (SLCO/OATP) superfamily are capable of importing anionic compounds across the lipid bilayer in a sodium-independent manner. Member 2B1 has been shown to transport few substrates, two of which are dihydroepiandrosterone-3-sulfate (DHEA-S) and estrone-3-sulfate. Steroid sulfatase (STS) catalyses the hydrolysis of these steroids into their unconjugated counterparts. The objective of this study was to investigate the regulation of SLCO2B1 and STS mRNAs during human chorionic gonadotropin (hCG)-induced ovulation/luteinization. The equine SLCO2B1 cDNA was cloned and shown to encode a 709-amino acid protein (OATP2B1) that is highly conserved when compared to mammalian orthologs. RT-PCR/Southern blot analyses were performed to study the regulation of SLCO2B1 and STS transcripts in equine preovulatory follicles isolated between 0 and 39h after hCG treatment. Results showed high levels of SLCO2B1 mRNA expression before hCG, with a marked decrease observed in follicles obtained 24-39h post-hCG (P<0.05). Analyses of isolated granulosa and theca interna cells identified high mRNA expression in both cell types prior to hCG treatment, with granulosa cells showing a more rapid SLCO2B1 mRNA down-regulation. No significant change in STS mRNA was observed in intact follicle walls. However, when both cell types were isolated, a significant decrease in STS mRNA was observed in granulosa cells 24-39h post-hCG. Collectively, these results demonstrate that the hCG-dependent induction of follicular luteinization is accompanied by the down-regulation of SLCO2B1 and STS transcripts. Considering that OATP2B1 can import sulfoconjugated DHEA and estrogens, and that STS can remove the sulfonate moiety from these steroids, their down-regulation in luteinizing preovulatory follicles may provide an additional biochemical basis for the decrease in ovarian 17beta-estradiol biosynthesis after the LH surge.

  11. Comparing the effects of tetrabromobisphenol-A, bisphenol A, and their potential replacement alternatives, TBBPA-bis(2,3-dibromopropyl ether) and bisphenol S, on cell viability and messenger ribonucleic acid expression in chicken embryonic hepatocytes.

    PubMed

    Ma, Melissa; Crump, Doug; Farmahin, Reza; Kennedy, Sean W

    2015-02-01

    A market for alternative brominated flame retardants (BFRs) has emerged recently due to the phase out of persistent and inherently toxic BFRs. Several of these replacement compounds have been detected in environmental matrices, including wild birds. A chicken embryonic hepatocyte (CEH) assay was utilized to assess the effects of the BFR, tetrabromobisphenol-A (TBBPA), and its replacement alternative, tetrabromobisphenol A bis(2,3-dibromopropyl ether [TBBPA-DBPE]) on cell viability and messenger ribonucleic acid (mRNA) expression. Bisphenol A (BPA) and 1 of its replacement alternatives, bisphenol S (BPS), were also screened for effects. Both TBBPA and BPA decreased CEH viability with calculated median lethal concentration (LC50) values of 40.6 μM and 61.7 μM, respectively. However, the replacement alternatives, TBBPA-DBPE and BPS, did not affect cell viability (up to 300 μM). Effects on mRNA expression were determined using an Avian ToxChip polymerse chain reaction (PCR) array and a real-time (RT)-PCR assay for the estrogen-responsive genes, apolipoproteinII (ApoII) and vitellogenin (Vtg). A luciferase reporter gene assay was used to assess dioxin-like effects. Tetrabromobisphenol-A altered mRNA levels of 4 genes from multiple toxicity pathways and increased luciferase activity in the luciferase reporter gene assay, whereas its alternative, TBBPA-DBPE, only altered 1 gene on the array, Cyp1a4, and increased luciferase activity. At 300 μM, a concentration that decreased cell viability for TBBPA and BPA, the BPA replacement, BPS, altered the greatest number of transcripts, including both ApoII and Vtg. Bisphenol A exposure did not alter any genes on the array but did up-regulate Vtg at 10 μM. Characterization of the potential toxicological and molecular-level effects of these compounds will ideally be useful to chemical regulators tasked with assessing the risk of new and existing chemicals. PMID:25470364

  12. Enhanced downregulation of transforming growth factor‑β2 in rat retinal pigment epithelium cells by adeno‑associated virus‑mediated ribonucleic acid interference combined with ultrasound or microbubbles.

    PubMed

    Li, Hongli; Wan, Caifeng; Du, Lianfang; Li, Fenghua

    2015-02-01

    The present study was designed to determine the efficiency and safety of ultrasound (US) and/or US contrast agent microbubbles (MBs) in the delivery of type 2 recombinant adeno-associated virus‑delivered transforming growth factor‑β2 short hairpin ribonucleic acid encoding the enhanced green fluorescent protein gene (rAAV2‑TGFβ2 shRNA‑EGFP) and the downregulation of TGFβ2 in rat retinal pigment epithelium (RPE‑J) cells. The effects of US and/or MBs on the delivery of rAAV2‑EGFP and rAAV2‑TGFβ2 shRNA‑EGFP were evaluated by fluorescence microscopy and flow cytometry. The potential toxicity of cell viability under various US or MB conditions was assessed by CellTiter 96® AQueous One solution cell proliferation assay. The level of TGFβ2 mRNA in RPE‑J cells under various conditions was estimated by reverse transcription‑quantitative polymerase chain reaction analysis. The results obtained demonstrated that low-intensity US (0.5 W/cm2 and 30 sec) or SonoVue (MB:cell ratio, 40:1) increased the delivery efficiency of rAAV2‑EGFP and rAAV2‑TGFβ2 shRNA‑EGFP to RPE‑J cells, whereas the combination of US with MBs did not further increase but instead decreased rAAV transfection. Under the optimal conditions of rAAV delivery, enhanced TGFβ2 gene silencing with a combination of US or SonoVue with rAAV2‑TGFβ2 shRNA resulted in a significant decrease in mRNA levels compared with rAAV2‑TGFβ2 shRNA alone. US or SonoVue was used safely to enhance the delivery of rAAV2‑TGFβ2 shRNA to RPE‑J cells. A combination of the biological (rAAV2‑TGFβ2 shRNA) and physical (US or SonoVue) approaches downregulated the mRNA level of TGFβ2 more effectively.

  13. Comparing the effects of tetrabromobisphenol-A, bisphenol A, and their potential replacement alternatives, TBBPA-bis(2,3-dibromopropyl ether) and bisphenol S, on cell viability and messenger ribonucleic acid expression in chicken embryonic hepatocytes.

    PubMed

    Ma, Melissa; Crump, Doug; Farmahin, Reza; Kennedy, Sean W

    2015-02-01

    A market for alternative brominated flame retardants (BFRs) has emerged recently due to the phase out of persistent and inherently toxic BFRs. Several of these replacement compounds have been detected in environmental matrices, including wild birds. A chicken embryonic hepatocyte (CEH) assay was utilized to assess the effects of the BFR, tetrabromobisphenol-A (TBBPA), and its replacement alternative, tetrabromobisphenol A bis(2,3-dibromopropyl ether [TBBPA-DBPE]) on cell viability and messenger ribonucleic acid (mRNA) expression. Bisphenol A (BPA) and 1 of its replacement alternatives, bisphenol S (BPS), were also screened for effects. Both TBBPA and BPA decreased CEH viability with calculated median lethal concentration (LC50) values of 40.6 μM and 61.7 μM, respectively. However, the replacement alternatives, TBBPA-DBPE and BPS, did not affect cell viability (up to 300 μM). Effects on mRNA expression were determined using an Avian ToxChip polymerse chain reaction (PCR) array and a real-time (RT)-PCR assay for the estrogen-responsive genes, apolipoproteinII (ApoII) and vitellogenin (Vtg). A luciferase reporter gene assay was used to assess dioxin-like effects. Tetrabromobisphenol-A altered mRNA levels of 4 genes from multiple toxicity pathways and increased luciferase activity in the luciferase reporter gene assay, whereas its alternative, TBBPA-DBPE, only altered 1 gene on the array, Cyp1a4, and increased luciferase activity. At 300 μM, a concentration that decreased cell viability for TBBPA and BPA, the BPA replacement, BPS, altered the greatest number of transcripts, including both ApoII and Vtg. Bisphenol A exposure did not alter any genes on the array but did up-regulate Vtg at 10 μM. Characterization of the potential toxicological and molecular-level effects of these compounds will ideally be useful to chemical regulators tasked with assessing the risk of new and existing chemicals.

  14. Ribonucleic acids of Machupo and Lassa viruses.

    PubMed

    Lukashevich, I S; Stelmakh, T A; Golubev, V P; Stchesljenok, E P; Lemeshko, N N

    1984-01-01

    Sucrose gradient velocity centrifugation, polyacrylamide gel electrophoresis and RNA-RNA hybridization were used to characterize Lassa and Machupo virion RNAs as well as virus-specific RNAs from cells infected with Pichinde and Machupo viruses. Five RNA species: 30-31S, 28S, 22-24S, 18S and 4-6S have been detected in Lassa, Machupo, and Pichinde virion RNAs. Among them 28S, 18S and 4-6S RNAs cosediment and comigrate with respectively cell RNAs. RNase resistance analyses suggest the presence of extensive secondary structures and complementary RNAs in Lassa, Machupo, and Pichinde virion RNAs. Annealing with poly(A)-containing RNA from infected cells has revealed that the bulk of "minus" strands of Machupo virion RNA is located in 22-24S and 28-31S fractions of sucrose gradient. Thus Machupo and Lassa viruses as well as Pichinde virus contain two genomic RNA fragments: "large" (molecular weight of about 2.2 X 10(6] and "small" (molecular weight of about 1.3 X 10(6]. In the cells infected with Pichinde virus and treated with actinomycin D (1.0 microgram/ml) synthesis of 18S, 22-24S and 30-31S RNAs has been registered. At least 22-24S and 30-31S classes comprise "plus" and "minus" strands. In cells infected with Machupo virus in the presence of actinomycin D the synthesis of similar sedimentation classes of RNAs and certain amounts of 28S RNA have been detected.

  15. Affinity chromatography of aminoacyl-transfer ribonucleic acid synthetases. Cognate transfer ribonucleic acid as a ligand.

    PubMed Central

    Clarke, C M; Knowles, J R

    1977-01-01

    The use of tRNA affinity columns for the purification of aminoacyl-tRNA synthetases was investigated. A purification method for valyl-tRNA synthetase from Bacillus stearothermophilus is described that uses two affinity columns, one containing the pure cognate tRNA, and the other containing all tRNA species except the cognate tRNA. A method for the rapid preparation of the two columns was developed, which does not require prior isolation of cognate tRNA but makes use of the ability of the target synthetase to select its cognate tRNA. The usefulness of tRNA columns is compared with that of affinity columns derived from the aminoalkyladenylate reported in the preceding paper [Clarke & Knowles (1977) Biochem J. 167, 405-417]. PMID:23108

  16. Ribosomal ribonucleic acid and ribosomal precursor ribonucleic acid in Anacystis nidulans.

    PubMed

    Szalay, A; Munsche, D; Wolligiehn, R; Parthier, B

    1972-08-01

    The RNA of the blue-green alga Anacystis nidulans contains three ribosomal RNA species with molecular weights of 0.56x10(6), 0.9x10(6), and 1.1x10(6) if the RNA is extracted in the absence of Mg(2+). The 0.9x10(6)mol.wt. rRNA is extremely slowly labelled in (32)P-incorporation experiments. This rRNA may be a cleavage product of the 1.1x10(6)mol.wt. rRNA from the ribosomes of cells in certain physiological states (e.g. light-deficiency during growth). The cleavage of the 1.1x10(6)mol.wt. rRNA during the extraction procedure can be prevented by the addition of 10mm-MgCl(2). (32)P-pulse-labelling studies demonstrate the rapid synthesis of two ribosomal precursor RNA species. One precursor RNA migrating slightly slower than the 1.1x10(6)mol.wt. rRNA appears much less stable than the other precursor RNA, which shows the electrophoretic behaviour of the 0.7x10(6)mol.wt. rRNA. Our observations support the close relationship between bacteria and blue-green algae also with respect to rRNA maturation. The conversion of the ribosomal precursor RNA species into 0.56x10(6)- and 1.1x10(6)-mol.wt. rRNA species requires Mg(2+) in the incubation medium.

  17. Folic Acid

    MedlinePlus

    Folic acid is a B vitamin. It helps the body make healthy new cells. Everyone needs folic acid. For women who may get pregnant, it is really important. Getting enough folic acid before and during pregnancy can prevent major birth ...

  18. Folic Acid

    MedlinePlus

    Folic acid is used to treat or prevent folic acid deficiency. It is a B-complex vitamin needed by ... Folic acid comes in tablets. It usually is taken once a day. Follow the directions on your prescription label ...

  19. Ribonucleic acid-protein cross-linking within the intact Escherichia coli ribosome, utilizing ethylene glycol bis[3-(2-ketobutyraldehyde) ether], a reversible, bifunctional reagent: identification of 30S proteins.

    PubMed

    Brewer, L A; Noller, H F

    1983-08-30

    To obtain detailed topographical information concerning the spatial arrangement of the multitude of ribosomal proteins with respect to specific sequences in the three RNA chains of intact ribosomes, a reagent capable of covalently and reversibly joining RNA to protein has been synthesized [Brewer, L.A., Goelz, S., & Noller, H. F. (1983) Biochemistry (preceding paper in this issue)]. This compound, ethylene glycol bis[3-(2-ketobutyraldehyde) ether] which we term "bikethoxal", possesses two reactive ends similar to kethoxal. Accordingly, it reacts selectively with guanine in single-stranded regions of nucleic acid and with arginine in protein. The cross-linking is reversible in that the arginine- and guanine-bikethoxal linkage can be disrupted by treatment with mild base, allowing identification of the linked RNA and protein components by standard techniques. Further, since the sites of kethoxal modification within the RNA sequences of intact subunits are known, the task of identifying the components of individual ribonucleoprotein complexes should be considerably simplified. About 15% of the ribosomal protein was covalently cross-linked to 16S RNA by bikethoxal under our standard reaction conditions, as monitored by comigration of 35S-labeled protein with RNA on Sepharose 4B in urea. Cross-linked 30S proteins were subsequently removed from 16S RNA by treatment with T1 ribonuclease and/or mild base cleavage of the reagent and were identified by two-dimensional polyacrylamide gel electrophoresis. The major 30S proteins found in cross-linked complexes are S4, S5, S6, S7, S8, S9 (S11), S16, and S18. The minor ones are S2, S3, S12, S13, S14, S15, and S17.

  20. Amino acids

    MedlinePlus

    ... amino acids are: histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan , and valine. Nonessential amino acids "Nonessential" means that our bodies produce an amino ...

  1. Ribonucleic acid synthesis by Escherichia coli C3000/L after infection by the ribonucleic acid coliphage ZIK/1, and properties of coliphage-ZIK/1 ribonucleic acid.

    PubMed

    Bishop, D H

    1965-10-01

    1. A method is described for the preparation and purification of the RNA from the RNA coliphage ZIK/1. 2. Some of the physical characteristics and infective properties of coliphage-ZIK/1 RNA were examined. 3. A method is also described for examining the type and quantity of RNA synthesized after bacteriophage infection. 4. Ribosome synthesis was decreased 15min. after bacteriophage adsorption, bacteriophage RNA was synthesized from 15min. to 120min. after adsorption and intracellular bacteriophages appeared 40min. after adsorption. Cell lysis commenced 60min. after adsorption, and was half complete 20min. later and 90-95% complete 120min. after adsorption. 5. Cell division continued until 40min. after bacteriophage adsorption. 6. Bacterial ribosomes were conserved during the infective process. 7. Intracellular bacteriophage RNA has sedimentation coefficient 28s but after cell lysis it has sedimentation coefficient 10-5s.

  2. Acid Rain.

    ERIC Educational Resources Information Center

    Openshaw, Peter

    1987-01-01

    Provides some background information on acid deposition. Includes a historical perspective, describes some effects of acid precipitation, and discusses acid rain in the United Kingdom. Contains several experiments that deal with the effects of acid rain on water quality and soil. (TW)

  3. Acid rain

    SciTech Connect

    Not Available

    1985-01-01

    This report has four parts: they discuss acid rain in relation to acid soils, agriculture, forests, and aquatic ecosystems. Among findings: modern sources of acid deposition from the atmosphere for all the acid soils in the world, nor even chiefly responsible for those of northern U.S. Agriculture has its problems, but acid precipitation is probably not one of them. More research is needed to determine to what extent acid precipitation is responsible for forest declines and for smaller detrimental effects on forest growth where no damage to the foliage is evident. Many lakes and streams are extremely sensitive to added acids.

  4. Aminocaproic Acid

    MedlinePlus

    Aminocaproic acid is used to control bleeding that occurs when blood clots are broken down too quickly. This type ... the baby is ready to be born). Aminocaproic acid is also used to control bleeding in the ...

  5. Ethacrynic Acid

    MedlinePlus

    Ethacrynic acid, a 'water pill,' is used to treat swelling and fluid retention caused by various medical problems. It ... Ethacrynic acid comes as a tablet to take by mouth. It is usually taken once or twice a day ...

  6. Aristolochic Acids

    MedlinePlus

    ... Sciences NIH-HHS www.niehs.nih.gov Aristolochic Acids Key Points Report on Carcinogens Status Known to be human carcinogens Aristolochia Clematitis Aristolochic Acids n Known human carcinogens n Found in certain ...

  7. Obeticholic Acid

    MedlinePlus

    Obeticholic acid is used alone or in combination with ursodiol (Actigall, Urso) to treat primary biliary cholangitis (PBC; a ... were not treated successfully with ursodiol alone. Obeticholic acid is in a class of medications called farnesoid ...

  8. Acid mucopolysaccharides

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003368.htm Acid mucopolysaccharides To use the sharing features on this page, please enable JavaScript. Acid mucopolysaccharides is a test that measures the amount ...

  9. Effect of Bacteriophage R17 Infection on Hostdirected Synthesis of Ribosomal Ribonucleates

    PubMed Central

    Hudson, James B.; Paranchych, William

    1967-01-01

    Studies were performed on the synthesis of ribosomal ribonucleates in cells of Escherichia coli K-12 infected by the ribonucleic acid (RNA) bacteriophage R17. Host-specific RNA was measured in the presence of phage RNA by in vitro hybridization of the purified ribonucleates with E. coli deoxyribonucleic acid. The results showed that, although the overall rate of RNA synthesis was only slightly affected by phage infection, the level of host RNA synthesis was decreased by 70 to 80%. Fractionation of the purified ribonucleates by sucrose gradient sedimentation, followed by hybridization of fractions sedimenting in the 23S and 16S regions, revealed that the level of ribosomal RNA synthesis was also decreased by 70 to 80%, and that this inhibition occurred during the first 15 to 20 min after infection. These findings are discussed in light of what is known about the inhibition of host RNA synthesis by other virus systems. PMID:4918239

  10. Cytoplasmic incorporation of a ribonucleic acid precursor in Amoeba proteus.

    PubMed

    PLAUT, W; RUSTAD, R C

    1957-07-25

    The question of RNA synthesis in enucleate cytoplasm of Amoeba has been approached experimentally by incubating enucleate amoebae in a labelled RNA precursor and determining the incorporation into RNA autoradiographically. The results indicate that there is a cytoplasmic incorporation mechanism which can operate in the absence of the nucleus. A comparison is made between Acetabularia and Amoeba with respect to the origins of cytoplasmic RNA. It is concluded that the existing data are consistent with the assumption that some cytoplasmic RNA is of nuclear origin in both organisms.

  11. Fatty acids - trans fatty acids

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The data supporting a negative effect of dietary trans fatty acids on cardiovascular disease risk is consistent. The primary dietary sources of trans fatty acids include partially hydrogenated fat and rudiment fat. The adverse effect of trans fatty acids on plasma lipoprotein profiles is consisten...

  12. Aspartic acid

    MedlinePlus

    ... Hormone production and release Normal nervous system function Plant sources of aspartic acid include: Legumes such as soybeans, garbanzo beans, and lentils Peanuts, almonds, walnuts, and flaxseeds Animal ...

  13. Usnic acid.

    PubMed

    Ingólfsdóttir, K

    2002-12-01

    Since its first isolation in 1844, usnic acid [2,6-diacetyl-7,9-dihydroxy-8,9b-dimethyl-1,3(2H,9bH)-dibenzo-furandione] has become the most extensively studied lichen metabolite and one of the few that is commercially available. Usnic acid is uniquely found in lichens, and is especially abundant in genera such as Alectoria, Cladonia, Usnea, Lecanora, Ramalina and Evernia. Many lichens and extracts containing usnic acid have been utilized for medicinal, perfumery, cosmetic as well as ecological applications. Usnic acid as a pure substance has been formulated in creams, toothpaste, mouthwash, deodorants and sunscreen products, in some cases as an active principle, in others as a preservative. In addition to antimicrobial activity against human and plant pathogens, usnic acid has been shown to exhibit antiviral, antiprotozoal, antiproliferative, anti-inflammatory and analgesic activity. Ecological effects, such as antigrowth, antiherbivore and anti-insect properties, have also been demonstrated. A difference in biological activity has in some cases been observed between the two enantiomeric forms of usnic acid. Recently health food supplements containing usnic acid have been promoted for use in weight reduction, with little scientific support. The emphasis of the current review is on the chemistry and biological activity of usnic acid and its derivatives in addition to rational and ecologically acceptable methods for provision of this natural compound on a large scale.

  14. Acid rain

    SciTech Connect

    Elsworth, S.

    1985-01-01

    This book was written in a concise and readable style for the lay public. It's purpose was to make the public aware of the damage caused by acid rain and to mobilize public opinion to favor the elimination of the causes of acid rain.

  15. Acid rain

    SciTech Connect

    White, J.C. )

    1988-01-01

    This book presents the proceedings of the third annual conference sponsored by the Acid Rain Information Clearinghouse (ARIC). Topics covered include: Legal aspects of the source-receptor relationship: an energy perspective; Scientific uncertainty, agency inaction, and the courts; and Acid rain: the emerging legal framework.

  16. How Acidic Is Carbonic Acid?

    PubMed

    Pines, Dina; Ditkovich, Julia; Mukra, Tzach; Miller, Yifat; Kiefer, Philip M; Daschakraborty, Snehasis; Hynes, James T; Pines, Ehud

    2016-03-10

    Carbonic, lactic, and pyruvic acids have been generated in aqueous solution by the transient protonation of their corresponding conjugate bases by a tailor-made photoacid, the 6-hydroxy-1-sulfonate pyrene sodium salt molecule. A particular goal is to establish the pK(a) of carbonic acid H2CO3. The on-contact proton transfer (PT) reaction rate from the optically excited photoacid to the carboxylic bases was derived, with unprecedented precision, from time-correlated single-photon-counting measurements of the fluorescence lifetime of the photoacid in the presence of the proton acceptors. The time-dependent diffusion-assisted PT rate was analyzed using the Szabo-Collins-Kimball equation with a radiation boundary condition. The on-contact PT rates were found to follow the acidity order of the carboxylic acids: the stronger was the acid, the slower was the PT reaction to its conjugate base. The pK(a) of carbonic acid was found to be 3.49 ± 0.05 using both the Marcus and Kiefer-Hynes free energy correlations. This establishes H2CO3 as being 0.37 pK(a) units stronger and about 1 pK(a) unit weaker, respectively, than the physiologically important lactic and pyruvic acids. The considerable acid strength of intact carbonic acid indicates that it is an important protonation agent under physiological conditions. PMID:26862781

  17. Acid rain

    SciTech Connect

    Sweet, W.

    1980-06-20

    Acid precipitation includes not only rain but also acidified snow, hail and frost, as well as sulfur and nitrogen dust. The principal source of acid precipitation is pollution emitted by power plants and smelters. Sulfur and nitrogen compounds contained in the emissions combine with moisture to form droplets with a high acid content - sometimes as acidic as vinegar. When sufficiently concentrated, these acids can kill fish and damage material structures. Under certain circumstances they may reduce crop and forest yields and cause or aggravate respiratory diseases in humans. During the summer, especially, pollutants tend to collect over the Great Lakes in high pressure systems. Since winds typically are westerly and rotate clockwise around high pressure systems, the pollutants gradually are dispersed throughout the eastern part of the continent.

  18. Asparagusic acid.

    PubMed

    Mitchell, Stephen C; Waring, Rosemary H

    2014-01-01

    Asparagusic acid (1,2-dithiolane-4-carboxylic acid) is a simple sulphur-containing 5-membered heterocyclic compound that appears unique to asparagus, though other dithiolane derivatives have been identified in non-food species. This molecule, apparently innocuous toxicologically to man, is the most probable culprit responsible for the curious excretion of odorous urine following asparagus ingestion. The presence of the two adjacent sulphur atoms leads to an enhanced chemical reactivity, endowing it with biological properties including the ability to substitute potentially for α-lipoic acid in α-keto-acid oxidation systems. This brief review collects the scattered data available in the literature concerning asparagusic acid and highlights its properties, intermediary metabolism and exploratory applications.

  19. Acid rain

    SciTech Connect

    Bess, F.D.

    1980-01-01

    The acid rain problem in the northeastern U.S. has been growing in severity and geographical areas affected. Acid rain has damaged, or will result in damage to visibility, physical structures and materials, aquatic life, timber, crops, and soils. The principal causes of acid rain in the northeastern U.S. are sulfur oxide and nitrogen oxide emissions from large power plants and smelters in the Ohio River Valley. Immediate corrective action and appropriate research are needed to reduce acid precipitation. Short-term programs that will define the rate of environmental deterioration, remaining environmental capacity to resist sudden deterioration, mechanisms of acid rain formation, and costs of various control options must be developed. (3 maps, 13 references, 1 table)

  20. Asparagusic acid.

    PubMed

    Mitchell, Stephen C; Waring, Rosemary H

    2014-01-01

    Asparagusic acid (1,2-dithiolane-4-carboxylic acid) is a simple sulphur-containing 5-membered heterocyclic compound that appears unique to asparagus, though other dithiolane derivatives have been identified in non-food species. This molecule, apparently innocuous toxicologically to man, is the most probable culprit responsible for the curious excretion of odorous urine following asparagus ingestion. The presence of the two adjacent sulphur atoms leads to an enhanced chemical reactivity, endowing it with biological properties including the ability to substitute potentially for α-lipoic acid in α-keto-acid oxidation systems. This brief review collects the scattered data available in the literature concerning asparagusic acid and highlights its properties, intermediary metabolism and exploratory applications. PMID:24099657

  1. Acid fog

    SciTech Connect

    Hileman, B.

    1983-03-01

    Fog in areas of southern California previously thought to be pollution-free has been shown to have a pH as low as 1.69. It has been found to be most acidic after smoggy days, suggesting that it forms on the aerosol associated with the previously exiting smog. Studies on Whiteface Mountain in the Adirondacks show that fog water is often 10 times as acidic as rainwater. As a result of their studies, California plans to spend $4 million on acid deposition research in the coming year. (JMT)

  2. Tranexamic Acid

    MedlinePlus

    ... is used to treat heavy bleeding during the menstrual cycle (monthly periods) in women. Tranexamic acid is in ... tablets for more than 5 days in a menstrual cycle or take more than 6 tablets in a ...

  3. Mefenamic Acid

    MedlinePlus

    ... as mefenamic acid may cause ulcers, bleeding, or holes in the stomach or intestine. These problems may ... like coffee grounds, blood in the stool, or black and tarry stools.Keep all appointments with your ...

  4. Acid Precipitation

    ERIC Educational Resources Information Center

    Likens, Gene E.

    1976-01-01

    Discusses the fact that the acidity of rain and snow falling on parts of the U.S. and Europe has been rising. The reasons are still not entirely clear and the consequences have yet to be well evaluated. (MLH)

  5. Acidic precipitation

    SciTech Connect

    Martin, H.C.

    1987-01-01

    At the International Symposium on Acidic Precipitation, over 400 papers were presented, and nearly 200 of them are included here. They provide an overview of the present state of the art of acid rain research. The Conference focused on atmospheric science (monitoring, source-receptor relationships), aquatic effects (marine eutrophication, lake acidification, impacts on plant and fish populations), and terrestrial effects (forest decline, soil acidification, etc.).

  6. Salicylic acids

    PubMed Central

    Hayat, Shamsul; Irfan, Mohd; Wani, Arif; Nasser, Alyemeni; Ahmad, Aqil

    2012-01-01

    Salicylic acid is well known phytohormone, emerging recently as a new paradigm of an array of manifestations of growth regulators. The area unleashed yet encompassed the applied agriculture sector to find the roles to strengthen the crops against plethora of abiotic and biotic stresses. The skipped part of integrated picture, however, was the evolutionary insight of salicylic acid to either allow or discard the microbial invasion depending upon various internal factors of two interactants under the prevailing external conditions. The metabolic status that allows the host invasion either as pathogenesis or symbiosis with possible intermediary stages in close systems has been tried to underpin here. PMID:22301975

  7. Stearic Acid

    ERIC Educational Resources Information Center

    Young, Jay A.

    2004-01-01

    A chemical laboratory information profile (CLIP) is presented for the chemical, stearic acid. The profile lists the chemical's physical and harmful characteristics, exposure limits, and symptoms of major exposure, for the benefit of teachers and students, who use the chemical in the laboratory.

  8. Trichloroacetic acid

    Integrated Risk Information System (IRIS)

    Trichloroacetic acid ( TCA ) ; CASRN 76 - 03 - 9 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Nonca

  9. Acrylic acid

    Integrated Risk Information System (IRIS)

    Acrylic acid ( CASRN 79 - 10 - 7 ) Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Eff

  10. Selenious acid

    Integrated Risk Information System (IRIS)

    Selenious acid ; CASRN 7783 - 00 - 8 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic E

  11. Dichloroacetic acid

    Integrated Risk Information System (IRIS)

    Dichloroacetic acid ; CASRN 79 - 43 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogeni

  12. Cacodylic acid

    Integrated Risk Information System (IRIS)

    Cacodylic acid ; CASRN 75 - 60 - 5 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Eff

  13. Phosphoric acid

    Integrated Risk Information System (IRIS)

    Phosphoric acid ; CASRN 7664 - 38 - 2 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic

  14. Benzoic acid

    Integrated Risk Information System (IRIS)

    Benzoic acid ; CASRN 65 - 85 - 0 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Effec

  15. Formic acid

    Integrated Risk Information System (IRIS)

    Formic acid ; CASRN 64 - 18 - 6 Human health assessment information on a chemical substance is included in the IRIS database only after a comprehensive review of toxicity data , as outlined in the IRIS assessment development process . Sections I ( Health Hazard Assessments for Noncarcinogenic Effect

  16. [Hyaluronic acid].

    PubMed

    Pomarede, N

    2008-01-01

    Hyaluronic Acid (HA) is now a leader product in esthetic procedures for the treatment of wrinkles and volumes. The structure of HA, its metabolism, its physiological function are foremost breaking down then its use in aesthetic dermatology: steps of injection, possible side effects, benefits and downsides of the use of HA in aesthetic dermatology.

  17. Hydroxycarboxylic acids and salts

    DOEpatents

    Kiely, Donald E; Hash, Kirk R; Kramer-Presta, Kylie; Smith, Tyler N

    2015-02-24

    Compositions which inhibit corrosion and alter the physical properties of concrete (admixtures) are prepared from salt mixtures of hydroxycarboxylic acids, carboxylic acids, and nitric acid. The salt mixtures are prepared by neutralizing acid product mixtures from the oxidation of polyols using nitric acid and oxygen as the oxidizing agents. Nitric acid is removed from the hydroxycarboxylic acids by evaporation and diffusion dialysis.

  18. [Gene therapy: nucleic acids as drugs. Action mechanisms and delivery into the cell].

    PubMed

    Cavagnari, Brian M

    2011-06-01

    Gene therapy involves the transference of new genetic material to the cell in order to obtain a therapeutic benefit, offering a new option for the treatment of various diseases. In this article, some of these nucleic acid-based drugs, such as plasmids, aptamers, oligonucleotides, ribozymes and small interfering ribonucleic acid, are presented. Their mechanism and level of action is commented and several delivery systems, such as liposomes, cationic polymers, direct nucleic acid transfer and viral vectors, are also discussed.

  19. Methylmalonic acid blood test

    MedlinePlus

    ... acid is a substance produced when proteins, called amino acids, in the body break down. The health care ... Cederbaum S, Berry GT. Inborn errors of carbohydrate, ammonia, amino acid, and organic acid metabolism. In: Gleason CA, Devaskar ...

  20. Folic Acid and Pregnancy

    MedlinePlus

    ... 5 Things to Know About Zika & Pregnancy Folic Acid and Pregnancy KidsHealth > For Parents > Folic Acid and ... before conception and during early pregnancy . About Folic Acid Folic acid, sometimes called folate, is a B ...

  1. Deoxyribonucleic acid-dependent ribonucleic acid polymerase activity in rat liver after protein restriction.

    PubMed Central

    Andersson, G M; von der Decken, A

    1975-01-01

    Rats were fed for 6 days on a diet containing either 3 or 20% high-quality protein. Nuclei were isolated from liver and DNA-dependent RNA polymerases (EC 2.7.7.6) extracted with 1 M-(NH4)2SO4. The proteins were then precipitated with 3.5 M-(NH4)2SO4 and after dialysis applied to a DEAE-Sephadex column. The column was developed with a gradient of (NH4)2SO4. Polymerase I separated well from alpha-amanitin-sensitive polymerase II. The enzyme activities were compared between the two dietary groups. Rats that had received 3% protein showed a lower polymerase I activity per g wet wt. of liver, per mg of DNA and per mg of protein. Polymerase II was lower in activity per g wet wt. of liver and per mg of DNA, but was higher per mg of protein. Polyacrylamide-gel electrophoretograms showed a higher proportion of contaminating proteins in polymerase II fractions isolated from 20%-protein-fed rats. The data explain the lower activity obtained per mg of protein in these rats. It is concluded that a decrease in dietary protein content from 20 to 3% induces a fall in content and specific activity of RNA polymerase I and II in liver. PMID:1156400

  2. Understanding Acid Rain

    ERIC Educational Resources Information Center

    Damonte, Kathleen

    2004-01-01

    The term acid rain describes rain, snow, or fog that is more acidic than normal precipitation. To understand what acid rain is, it is first necessary to know what an acid is. Acids can be defined as substances that produce hydrogen ions (H+), when dissolved in water. Scientists indicate how acidic a substance is by a set of numbers called the pH…

  3. Precipitation: its acidic nature.

    PubMed

    Frohliger, J O; Kane, R

    1975-08-01

    A comparison of the free hydrogen ion concentration and the total hydrogen ion concentration of rain samples shows that rain is a weak acid. The weak acid nature of rain casts doubt on the concepts that the acidity of rain is increasing and that these increases are due to strong acids such as sulfuric acid.

  4. Amino Acid Metabolism Disorders

    MedlinePlus

    ... defects & other health conditions > Amino acid metabolism disorders Amino acid metabolism disorders E-mail to a friend Please ... baby’s newborn screening may include testing for certain amino acid metabolism disorders. These are rare health conditions that ...

  5. Carbolic acid poisoning

    MedlinePlus

    Phenol poisoning; Phenylic acid poisoning; Hydroxybenzene poisoning; Phenic acid poisoning; Benzenol poisoning ... Below are symptoms of carbolic acid poisoning in different parts of the ... urine Decreased urine output No urine output EYES, EARS, ...

  6. Azelaic Acid Topical

    MedlinePlus

    Azelaic acid gel is used to clear the bumps, lesions, and swelling caused by rosacea (a skin disease that ... redness, flushing, and pimples on the face). Azelaic acid cream is used to treat acne. Azelaic acid ...

  7. Uric acid test (image)

    MedlinePlus

    Uric acid urine test is performed to check for the amount of uric acid in urine. Urine is collected over a 24 ... testing. The most common reason for measuring uric acid levels is in the diagnosis or treatment of ...

  8. Facts about Folic Acid

    MedlinePlus

    ... Information For... Media Policy Makers Facts About Folic Acid Language: English Español (Spanish) Recommend on Facebook Tweet ... of the baby's brain and spine. About folic acid Folic acid is a B vitamin. Our bodies ...

  9. Acid Lipase Disease

    MedlinePlus

    ... Awards Enhancing Diversity Find People About NINDS NINDS Acid Lipase Disease Information Page Synonym(s): Cholesterol Ester Storage ... Trials Related NINDS Publications and Information What is Acid Lipase Disease ? Acid lipase disease or deficiency occurs ...

  10. Acid distribution in phosphoric acid fuel cells

    SciTech Connect

    Okae, I.; Seya, A.; Umemoto, M.

    1996-12-31

    Electrolyte acid distribution among each component of a cell is determined by capillary force when the cell is not in operation, but the distribution under the current load conditions had not been clear so far. Since the loss of electrolyte acid during operation is inevitable, it is necessary to store enough amount of acid in every cell. But it must be under the level of which the acid disturbs the diffusion of reactive gases. Accordingly to know the actual acid distribution during operation in a cell is very important. In this report, we carried out experiments to clarify the distribution using small single cells.

  11. Acid tolerance in amphibians

    SciTech Connect

    Pierce, B.A.

    1985-04-01

    Studies of amphibian acid tolerance provide information about the potential effects of acid deposition on amphibian communities. Amphibians as a group appear to be relatively acid tolerant, with many species suffering increased mortality only below pH 4. However, amphibians exhibit much intraspecific variation in acid tolerance, and some species are sensitive to even low levels of acidity. Furthermore, nonlethal effects, including depression of growth rates and increases in developmental abnormalities, can occur at higher pH.

  12. Bioconversions of ferulic acid, an hydroxycinnamic acid.

    PubMed

    Mathew, Sindhu; Abraham, T Emilia

    2006-01-01

    Ferulic acid is the most abundant hydroxycinnamic acid in the plant world and is ester linked to arabinose, in various plant polysaccharides such as arabinoxylans and pectins. It is a precursor to vanillin, one of the most important aromatic flavor compound used in foods, beverages, pharmaceuticals, and perfumes. This article presents an overview of the various biocatalytic routes, focusing on the relevant biotransformations of ferulic acid using plant sources, microorganisms, and enzymes.

  13. Acid Thunder: Acid Rain and Ancient Mesoamerica

    ERIC Educational Resources Information Center

    Kahl, Jonathan D. W.; Berg, Craig A.

    2006-01-01

    Much of Mesoamerica's rich cultural heritage is slowly eroding because of acid rain. Just as water dissolves an Alka-Seltzer tablet, acid rain erodes the limestone surfaces of Mexican archaeological sites at a rate of about one-half millimeter per century (Bravo et al. 2003). A half-millimeter may not seem like much, but at this pace, a few…

  14. Quantity of acid in acid fog

    SciTech Connect

    Deal, W.J.

    1983-07-01

    This communication notes the actual magnitude of the acidity in acidic fog particles and suggests a possible line of inquiry into the health effects of such fog so that it can be determined whether a typical fog is detrimental or beneficial relative to dry air.

  15. Lactic acid test

    MedlinePlus

    ... this page: //medlineplus.gov/ency/article/003507.htm Lactic acid test To use the sharing features on this page, please enable JavaScript. Lactic acid is mainly produced in muscle cells and red ...

  16. Omega-6 Fatty Acids

    MedlinePlus

    ... types of fats. Some types are found in vegetable oils, including corn, evening primrose seed, safflower, and soybean ... from studying specific omega-6 fatty acids or plant oils containing omega-6 fatty acids. See the separate ...

  17. Fatty acid analogs

    DOEpatents

    Elmaleh, David R.; Livni, Eli

    1985-01-01

    In one aspect, a radioactively labeled analog of a fatty acid which is capable of being taken up by mammalian tissue and which exhibits an in vivo beta-oxidation rate below that with a corresponding radioactively labeled fatty acid.

  18. Deoxycholic Acid Injection

    MedlinePlus

    Deoxycholic acid injection is used to improve the appearance and profile of moderate to severe submental fat ('double chin'; fatty tissue located under the chin). Deoxycholic acid injection is in a class of medications called ...

  19. Aminocaproic Acid Injection

    MedlinePlus

    Aminocaproic acid injection is used to control bleeding that occurs when blood clots are broken down too quickly. This ... the baby is ready to be born). Aminocaproic acid injection is also used to control bleeding in ...

  20. Zoledronic Acid Injection

    MedlinePlus

    ... acid (Reclast) is used to prevent or treat osteoporosis (condition in which the bones become thin and ... Zoledronic acid (Reclast) is also used to treat osteoporosis in men, and to prevent or treat osteoporosis ...

  1. Uric Acid Test

    MedlinePlus

    ... limited. Home Visit Global Sites Search Help? Uric Acid Share this page: Was this page helpful? Also known as: Serum Urate; UA Formal name: Uric Acid Related tests: Synovial Fluid Analysis , Kidney Stone Analysis , ...

  2. Methylmalonic Acid Test

    MedlinePlus

    ... limited. Home Visit Global Sites Search Help? Methylmalonic Acid Share this page: Was this page helpful? Also known as: MMA Formal name: Methylmalonic Acid Related tests: Vitamin B12 and Folate , Homocysteine , Intrinsic ...

  3. Hydrochloric acid poisoning

    MedlinePlus

    Hydrochloric acid is a clear, poisonous liquid. It is highly corrosive, which means it immediately causes severe ... discusses poisoning due to swallowing or breathing in hydrochloric acid. This article is for information only. Do ...

  4. Mixed Acid Oxidation

    SciTech Connect

    Pierce, R.A.

    1999-10-26

    Several non-thermal processes have been developed to destroy organic waste compounds using chemicals with high oxidation potentials. These efforts have focused on developing technologies that work at low temperatures, relative to incineration, to overcome many of the regulatory issues associated with obtaining permits for waste incinerators. One such technique with great flexibility is mixed acid oxidation. Mixed acid oxidation, developed at the Savannah River Site, uses a mixture of an oxidant (nitric acid) and a carrier acid (phosphoric acid). The carrier acid acts as a non-volatile holding medium for the somewhat volatile oxidant. The combination of acids allows appreciable amounts of the concentrated oxidant to remain in the carrier acid well above the oxidant''s normal boiling point.

  5. Plant fatty acid hydroxylases

    DOEpatents

    Somerville, Chris; Broun, Pierre; van de Loo, Frank

    2001-01-01

    This invention relates to plant fatty acyl hydroxylases. Methods to use conserved amino acid or nucleotide sequences to obtain plant fatty acyl hydroxylases are described. Also described is the use of cDNA clones encoding a plant hydroxylase to produce a family of hydroxylated fatty acids in transgenic plants. In addition, the use of genes encoding fatty acid hydroxylases or desaturases to alter the level of lipid fatty acid unsaturation in transgenic plants is described.

  6. PRODUCTION OF TRIFLUOROACETIC ACID

    DOEpatents

    Haworth, W.N.; Stacey, M.

    1949-07-19

    A method is given for the production of improved yields of trifluoroacetic acid. The compound is prepared by oxidizing m-aminobenzotrifluoride with an alkali metal or alkaline earth metal permanganate at a temperature in the range of 80 deg C to 100 deg C while dissolved ln a mixture of water with glacial acetic acid and/or trifluoroacetic acid. Preferably a mixture of water and trifluoroacetic acid ls used as the solvent.

  7. Quantity of acid in acid fog

    SciTech Connect

    Deal, W.J.

    1983-07-01

    The chemical composition of fog particles has become of considerable interest, because of both the possibility of interpreting atmospheric- chemistry processes in fog particles in terms of the principles of aqueous chemistry and the potential health effects of species present in fog particles. The acidity of fog particles has received wide attention. This communication noted the actual magnitude of the excess acidity in acidic fog particles and suggested a possible line of inquiry into the health effects of such fog so that it can be determined whether a typical fog is detrimental or beneficial relative to dry air. (DP)

  8. Acid Rain Study Guide.

    ERIC Educational Resources Information Center

    Hunger, Carolyn; And Others

    Acid rain is a complex, worldwide environmental problem. This study guide is intended to aid teachers of grades 4-12 to help their students understand what acid rain is, why it is a problem, and what possible solutions exist. The document contains specific sections on: (1) the various terms used in conjunction with acid rain (such as acid…

  9. The Acid Rain Reader.

    ERIC Educational Resources Information Center

    Stubbs, Harriett S.; And Others

    A topic which is often not sufficiently dealt with in elementary school textbooks is acid rain. This student text is designed to supplement classroom materials on the topic. Discussed are: (1) "Rain"; (2) "Water Cycle"; (3) "Fossil Fuels"; (4) "Air Pollution"; (5) "Superstacks"; (6) "Acid/Neutral/Bases"; (7) "pH Scale"; (8) "Acid Rain"; (9)…

  10. What Is Acid Rain?

    ERIC Educational Resources Information Center

    Likens, Gene E.

    2004-01-01

    Acid rain is the collective term for any type of acidified precipitation: rain, snow, sleet, and hail, as well as the presence of acidifying gases, particles, cloud water, and fog in the atmosphere. The increased acidity, primarily from sulfuric and nitric acids, is generated as a by-product of the combustion of fossil fuels such as coal and oil.…

  11. [alpha]-Oxocarboxylic Acids

    ERIC Educational Resources Information Center

    Kerber, Robert C.; Fernando, Marian S.

    2010-01-01

    Several [alpha]-oxocarboxylic acids play key roles in metabolism in plants and animals. However, there are inconsistencies between the structures as commonly portrayed and the reported acid ionization constants, which result because the acids are predominantly hydrated in aqueous solution; that is, the predominant form is RC(OH)[subscript 2]COOH…

  12. Nucleic acid detection compositions

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James L.

    2008-08-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  13. Cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    2000-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  14. Nucleic acid detection assays

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James E.

    2005-04-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  15. Cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor L.; Brow, Mary Ann D.; Dahlberg, James E.

    2007-12-11

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  16. Cleavage of nucleic acids

    SciTech Connect

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow; Mary Ann D.; Dahlberg, James E.

    2010-11-09

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  17. Editorial: Acid precipitation

    SciTech Connect

    1995-09-01

    This editorial focuses on acid rain and the history of public and governmental response to acid rain. Comments on a book by Gwineth Howell `Acid Rain and Acid Waters` are included. The editor feels that Howells has provide a service to the environmental scientific community, with a textbook useful to a range of people, as well as a call for decision makers to learn from the acid rain issue and use it as a model for more sweeping global environmental issues. A balance is needed among several parameters such as level of evidence, probability that the evidence will lead to a specific direction and the cost to the global community. 1 tab.

  18. [Safety of folic acid].

    PubMed

    Ströhle, Alexander; Wolters, Maike; Hahn, Andreas

    2015-08-01

    Improving dietary folate intake is a central public health goal. However, critical voices have become louder warning of too high intake of folic acid. Safety concerns of a high folic acid exposure are usually limited to synthetic folic acid contained in drugs and food supplements. Against this background, the present article focuses on two matters: (a) How do the absorption and metabolism of synthetic folic acid differ from that of other folates? (b) How has the longterm safety of folic acid to be judged, especially regarding the risk of colorectal cancer, autism, asthma, impaired immune defence, masking vitamin B12 deficiency and interactions with the methotrexate metabolism?

  19. Amino acid analysis

    NASA Technical Reports Server (NTRS)

    Winitz, M.; Graff, J. (Inventor)

    1974-01-01

    The process and apparatus for qualitative and quantitative analysis of the amino acid content of a biological sample are presented. The sample is deposited on a cation exchange resin and then is washed with suitable solvents. The amino acids and various cations and organic material with a basic function remain on the resin. The resin is eluted with an acid eluant, and the eluate containing the amino acids is transferred to a reaction vessel where the eluant is removed. Final analysis of the purified acylated amino acid esters is accomplished by gas-liquid chromatographic techniques.

  20. Acidic Ionic Liquids.

    PubMed

    Amarasekara, Ananda S

    2016-05-25

    Ionic liquid with acidic properties is an important branch in the wide ionic liquid field and the aim of this article is to cover all aspects of these acidic ionic liquids, especially focusing on the developments in the last four years. The structural diversity and synthesis of acidic ionic liquids are discussed in the introduction sections of this review. In addition, an unambiguous classification system for various types of acidic ionic liquids is presented in the introduction. The physical properties including acidity, thermo-physical properties, ionic conductivity, spectroscopy, and computational studies on acidic ionic liquids are covered in the next sections. The final section provides a comprehensive review on applications of acidic ionic liquids in a wide array of fields including catalysis, CO2 fixation, ionogel, electrolyte, fuel-cell, membrane, biomass processing, biodiesel synthesis, desulfurization of gasoline/diesel, metal processing, and metal electrodeposition.

  1. Nucleic acid detection kits

    DOEpatents

    Hall, Jeff G.; Lyamichev, Victor I.; Mast, Andrea L.; Brow, Mary Ann; Kwiatkowski, Robert W.; Vavra, Stephanie H.

    2005-03-29

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of nucleic acid from various viruses in a sample.

  2. Acidic Ionic Liquids.

    PubMed

    Amarasekara, Ananda S

    2016-05-25

    Ionic liquid with acidic properties is an important branch in the wide ionic liquid field and the aim of this article is to cover all aspects of these acidic ionic liquids, especially focusing on the developments in the last four years. The structural diversity and synthesis of acidic ionic liquids are discussed in the introduction sections of this review. In addition, an unambiguous classification system for various types of acidic ionic liquids is presented in the introduction. The physical properties including acidity, thermo-physical properties, ionic conductivity, spectroscopy, and computational studies on acidic ionic liquids are covered in the next sections. The final section provides a comprehensive review on applications of acidic ionic liquids in a wide array of fields including catalysis, CO2 fixation, ionogel, electrolyte, fuel-cell, membrane, biomass processing, biodiesel synthesis, desulfurization of gasoline/diesel, metal processing, and metal electrodeposition. PMID:27175515

  3. Boric acid and boronic acids inhibition of pigeonpea urease.

    PubMed

    Reddy, K Ravi Charan; Kayastha, Arvind M

    2006-08-01

    Urease from the seeds of pigeonpea was competitively inhibited by boric acid, butylboronic acid, phenylboronic acid, and 4-bromophenylboronic acid; 4-bromophenylboronic acid being the strongest inhibitor, followed by boric acid > butylboronic acid > phenylboronic acid, respectively. Urease inhibition by boric acid is maximal at acidic pH (5.0) and minimal at alkaline pH (10.0), i.e., the trigonal planar B(OH)3 form is a more effective inhibitor than the tetrahedral B(OH)4 -anionic form. Similarly, the anionic form of phenylboronic acid was least inhibiting in nature.

  4. Biotransformation of cinnamic acid, p-coumaric acid, caffeic acid, and ferulic acid by plant cell cultures of Eucalyptus perriniana.

    PubMed

    Katsuragi, Hisashi; Shimoda, Kei; Kubota, Naoji; Nakajima, Nobuyoshi; Hamada, Hatsuyuki; Hamada, Hiroki

    2010-01-01

    Biotransformations of phenylpropanoids such as cinnamic acid, p-coumaric acid, caffeic acid, and ferulic acid were investigated with plant-cultured cells of Eucalyptus perriniana. The plant-cultured cells of E. perriniana converted cinnamic acid into cinnamic acid β-D-glucopyranosyl ester, p-coumaric acid, and 4-O-β-D-glucopyranosylcoumaric acid. p-Coumaric acid was converted into 4-O-β-D-glucopyranosylcoumaric acid, p-coumaric acid β-D-glucopyranosyl ester, 4-O-β-D-glucopyranosylcoumaric acid β-D-glucopyranosyl ester, a new compound, caffeic acid, and 3-O-β-D-glucopyranosylcaffeic acid. On the other hand, incubation of caffeic acid with cultured E. perriniana cells gave 3-O-β-D-glucopyranosylcaffeic acid, 3-O-(6-O-β-D-glucopyranosyl)-β-D-glucopyranosylcaffeic acid, a new compound, 3-O-β-D-glucopyranosylcaffeic acid β-D-glucopyranosyl ester, 4-O-β-D-glucopyranosylcaffeic acid, 4-O-β-D-glucopyranosylcaffeic acid β-D-glucopyranosyl ester, ferulic acid, and 4-O-β-D-glucopyranosylferulic acid. 4-O-β-D-Glucopyranosylferulic acid, ferulic acid β-D-glucopyranosyl ester, and 4-O-β-D-glucopyranosylferulic acid β-D-glucopyranosyl ester were isolated from E. perriniana cells treated with ferulic acid.

  5. Process for the preparation of lactic acid and glyceric acid

    DOEpatents

    Jackson, James E [Haslett, MI; Miller, Dennis J [Okemos, MI; Marincean, Simona [Dewitt, MI

    2008-12-02

    Hexose and pentose monosaccharides are degraded to lactic acid and glyceric acid in an aqueous solution in the presence of an excess of a strongly anionic exchange resin, such as AMBERLITE IRN78 and AMBERLITE IRA400. The glyceric acid and lactic acid can be separated from the aqueous solution. Lactic acid and glyceric acid are staple articles of commerce.

  6. Well acidizing compositions and methods

    SciTech Connect

    Swanson, B. L.

    1980-12-23

    Gelled acidic compositions suitable for matrix acidizing or fracture acidizing of subterranean formations are provided comprising water, a water-dispersible polymeric viscosifier such as a polymer of acrylamide, an acid, and a polyphenolic material such as lignite.

  7. Bile acids but not acidic acids induce Barrett's esophagus.

    PubMed

    Sun, Dongfeng; Wang, Xiao; Gai, Zhibo; Song, Xiaoming; Jia, Xinyong; Tian, Hui

    2015-01-01

    Barrett's esophagus (BE) is associated with the development of esophageal adenocarcinoma (EAC). Bile acids (BAs) refluxing into the esophagus contribute to esophageal injury, which results in BE and subsequent EAC. We developed two animal models to test the role of BAs in the pathogenesis of BE. We surgically generated BA reflux, with or without gastric acid, in rats. In a second experiment, we fed animals separately with BAs and gastric acid. Pathologic changes were examined and the expression of Muc2 and Cdx2 in BE tissue was tested by immunostaining. Inflammatory factors in the plasma, as well as differentiation genes in BE were examined through highly sensitive ELISA and semi-quantitative RT-PCR techniques. We found that BAs are sufficient for the induction of esophagitis and Barrett's-like metaplasia in the esophagus. Overexpression of inflammatory cells, IL-6, and TNF-α was observed both in animals fed with BAs and surgically generated BA reflux. Furthermore, elevated levels of Cdx2, Muc2, Bmp4, Kit19, and Tff2 (differentiation genes in BE) were found in BA-treated rats. In conclusion, BAs, but not gastric acid, are a major causative factor for BE. We confirmed that BAs contribute to the development of BE by inducing the inflammatory response in the esophagus. Inhibiting BAs may be a promising therapy for BE.

  8. Microorganisms for producing organic acids

    DOEpatents

    Pfleger, Brian Frederick; Begemann, Matthew Brett

    2014-09-30

    Organic acid-producing microorganisms and methods of using same. The organic acid-producing microorganisms comprise modifications that reduce or ablate AcsA activity or AcsA homolog activity. The modifications increase tolerance of the microorganisms to such organic acids as 3-hydroxypropionic acid, acrylic acid, propionic acid, lactic acid, and others. Further modifications to the microorganisms increase production of such organic acids as 3-hydroxypropionic acid, lactate, and others. Methods of producing such organic acids as 3-hydroxypropionic acid, lactate, and others with the modified microorganisms are provided. Methods of using acsA or homologs thereof as counter-selectable markers are also provided.

  9. Acid-Base Homeostasis.

    PubMed

    Hamm, L Lee; Nakhoul, Nazih; Hering-Smith, Kathleen S

    2015-12-01

    Acid-base homeostasis and pH regulation are critical for both normal physiology and cell metabolism and function. The importance of this regulation is evidenced by a variety of physiologic derangements that occur when plasma pH is either high or low. The kidneys have the predominant role in regulating the systemic bicarbonate concentration and hence, the metabolic component of acid-base balance. This function of the kidneys has two components: reabsorption of virtually all of the filtered HCO3(-) and production of new bicarbonate to replace that consumed by normal or pathologic acids. This production or generation of new HCO3(-) is done by net acid excretion. Under normal conditions, approximately one-third to one-half of net acid excretion by the kidneys is in the form of titratable acid. The other one-half to two-thirds is the excretion of ammonium. The capacity to excrete ammonium under conditions of acid loads is quantitatively much greater than the capacity to increase titratable acid. Multiple, often redundant pathways and processes exist to regulate these renal functions. Derangements in acid-base homeostasis, however, are common in clinical medicine and can often be related to the systems involved in acid-base transport in the kidneys.

  10. Effects of chenodeoxycholic acid and deoxycholic acid on cholesterol absorption and metabolism in humans.

    PubMed

    Wang, Yanwen; Jones, Peter J H; Woollett, Laura A; Buckley, Donna D; Yao, Lihang; Granholm, Norman A; Tolley, Elizabeth A; Heubi, James E

    2006-07-01

    Quantitative and qualitative differences in intralumenal bile acids may affect cholesterol absorption and metabolism. To test this hypothesis, 2 cross-over outpatient studies were conducted in adults with apo-A IV 1/1 or apo-E 3/3 genotypes. Study 1 included 11 subjects 24 to 37 years of age, taking 15 mg/kg/day chenodeoxycholic acid (CDCA) or no bile acid for 20 days while being fed a controlled diet. Study 2 included 9 adults 25 to 38 years of age, taking 15 mg/kg/day deoxycholic acid (DCA) or no bile acid, following the same experimental design and procedures as study 1. CDCA had no effect on plasma lipid concentrations, whereas DCA decreased (P < 0.05) plasma high-density lipoprotein (HDL)-cholesterol and tended to decrease (P = 0.15) low-density lipoprotein (LDL)-cholesterol. CDCA treatment enriched (P < 0.0001) bile with CDCA and increased cholesterol concentration in micelles, whereas meal-stimulated bile acid concentrations were decreased. DCA treatment enriched (P < 0.0001) bile with DCA and tended to increase intralumenal cholesterol solubilized in micelles (P = 0.06). No changes were found in cholesterol absorption, free cholesterol fractional synthetic rate (FSR), or 3-hydroxy-3 methylglutaryl (HMG) CoA reductase and LDL receptor messenger ribonucleic acid (mRNA) levels after CDCA treatment. DCA supplementation tended to decrease cholesterol absorption and reciprocally increase FSR and HMG CoA reductase and LDL receptor mRNA levels. Results of these 2 studies suggest that the solubilization of cholesterol in the intestinal micelles is not a rate-limiting step for its absorption.

  11. Citric Acid Alternative to Nitric Acid Passivation

    NASA Technical Reports Server (NTRS)

    Lewis, Pattie L. (Compiler)

    2013-01-01

    The Ground Systems Development and Operations GSDO) Program at NASA John F. Kennedy Space Center (KSC) has the primary objective of modernizing and transforming the launch and range complex at KSC to benefit current and future NASA programs along with other emerging users. Described as the launch support and infrastructure modernization program in the NASA Authorization Act of 2010, the GSDO Program will develop and implement shared infrastructure and process improvements to provide more flexible, affordable, and responsive capabilities to a multi-user community. In support of the GSDO Program, the purpose of this project is to demonstratevalidate citric acid as a passivation agent for stainless steel. Successful completion of this project will result in citric acid being qualified for use as an environmentally preferable alternative to nitric acid for passivation of stainless steel alloys in NASA and DoD applications.

  12. Enzymatic gallic acid esterification.

    PubMed

    Weetal, H H

    1985-02-01

    Gallic acid esters of n-propyl and amyl alcohols have been produced by enzymatic synthesis in organic solvents using immobilized tannase. Studies indicate that maximum esterification of gallic acid occurs with amyl alcohol. The enzyme shows broad alcohol specificity. However, the enzyme exhibits absolute specificity for the acid portion of the ester. Studies were carried out on K(m), V(max), pH, and temperature optima.

  13. Amino acids and proteins.

    PubMed

    van Goudoever, Johannes B; Vlaardingerbroek, Hester; van den Akker, Chris H; de Groof, Femke; van der Schoor, Sophie R D

    2014-01-01

    Amino acids and protein are key factors for growth. The neonatal period requires the highest intake in life to meet the demands. Those demands include amino acids for growth, but proteins and amino acids also function as signalling molecules and function as neurotransmitters. Often the nutritional requirements are not met, resulting in a postnatal growth restriction. However, current knowledge on adequate levels of both amino acid as well as protein intake can avoid under nutrition in the direct postnatal phase, avoid the need for subsequent catch-up growth and improve later outcome.

  14. USGS Tracks Acid Rain

    USGS Publications Warehouse

    Gordon, John D.; Nilles, Mark A.; Schroder, LeRoy J.

    1995-01-01

    The U.S. Geological Survey (USGS) has been actively studying acid rain for the past 15 years. When scientists learned that acid rain could harm fish, fear of damage to our natural environment from acid rain concerned the American public. Research by USGS scientists and other groups began to show that the processes resulting in acid rain are very complex. Scientists were puzzled by the fact that in some cases it was difficult to demonstrate that the pollution from automobiles and factories was causing streams or lakes to become more acidic. Further experiments showed how the natural ability of many soils to neutralize acids would reduce the effects of acid rain in some locations--at least as long as the neutralizing ability lasted (Young, 1991). The USGS has played a key role in establishing and maintaining the only nationwide network of acid rain monitoring stations. This program is called the National Atmospheric Deposition Program/National Trends Network (NADP/NTN). Each week, at approximately 220 NADP/NTN sites across the country, rain and snow samples are collected for analysis. NADP/NTN site in Montana. The USGS supports about 72 of these sites. The information gained from monitoring the chemistry of our nation's rain and snow is important for testing the results of pollution control laws on acid rain.

  15. Recovery of organic acids

    DOEpatents

    Verser, Dan W.; Eggeman, Timothy J.

    2011-11-01

    A method is disclosed for the recovery of an organic acid from a dilute salt solution in which the cation of the salt forms an insoluble carbonate salt. A tertiary amine and CO.sub.2 are introduced to the solution to form the insoluble carbonate salt and a complex between the acid and an amine. A water immiscible solvent, such as an alcohol, is added to extract the acid/amine complex from the dilute salt solution to a reaction phase. The reaction phase is continuously dried and a product between the acid and the solvent, such as an ester, is formed.

  16. Recovery of organic acids

    DOEpatents

    Verser, Dan W.; Eggeman, Timothy J.

    2009-10-13

    A method is disclosed for the recovery of an organic acid from a dilute salt solution in which the cation of the salt forms an insoluble carbonate salt. A tertiary amine and CO.sub.2 are introduced to the solution to form the insoluble carbonate salt and a complex between the acid and an amine. A water immiscible solvent, such as an alcohol, is added to extract the acid/amine complex from the dilute salt solution to a reaction phase. The reaction phase is continuously dried and a product between the acid and the solvent, such as an ester, is formed.

  17. Induction of cellular deoxyribonucleic acid synthesis in butyrate-treated cells by simian virus 40 deoxyribonucleic acid

    SciTech Connect

    Kawasaki, S.; Diamond, L.; Baserga, R.

    1981-11-01

    Sodium butyrate (3mM) inhibited the entry into the S phase of quiescent 3T3 cells stimulated by serum, but had no effect on the accumulation of cellular ribonucleic acid. Simian virus 40 infection or manual microinjection of cloned fragments from the simian virus 40 A gene caused quiescent 3T3 cells to enter the S phase even in the presence of butyrate. NGI cells, a line of 3T3 cells transformed by simian virus 40, grew vigorously in 3 mM butyrate. Homokaryons were formed between G/sub 1/ and S-phase 3T3 cells. Butyrate inhibited the induction of deoxyribonucleic acid synthesis that usually occurs in G/sub 1/ nuclei when G/sub 1/ cells are fused with S-phase cells. However, when G/sub 1/ 3T3 cells were fused with exponentially growing NGI cells, the 3T3 nuclei were induced to enter deoxyribonucleic acid synthesis. In tsAF8 cells, a ribonucleic acid polymerase II mutant that stops in the G/sub 1/ phase of the cell cycle, no temporal sequence was demonstrated between the butyrate block and the temperature-sensitive block. These results confirm previous reports that certain virally coded proteins can induce cell deoxyribonucleic acid synthesis in the absence of cellular functions that are required by serum-stimulated cells. The author's interpretation of these data is that butyrate inhibited cell growth by inhibiting the expression of genes required for the G/sub o/ ..-->.. G/sub 1/ ..-->.. S transition and that the product of the simian virus 40 A gene overrode this inhibition by providing all of the necessary functions for the entry into the S phase.

  18. Mutant fatty acid desaturase

    DOEpatents

    Shanklin, John; Cahoon, Edgar B.

    2004-02-03

    The present invention relates to a method for producing mutants of a fatty acid desaturase having a substantially increased activity towards fatty acid substrates with chains containing fewer than 18 carbons relative to an unmutagenized precursor desaturase having an 18 carbon atom chain length substrate specificity. The method involves inducing one or more mutations in the nucleic acid sequence encoding the precursor desaturase, transforming the mutated sequence into an unsaturated fatty acid auxotroph cell such as MH13 E. coli, culturing the cells in the absence of supplemental unsaturated fatty acids, thereby selecting for recipient cells which have received and which express a mutant fatty acid desaturase with an elevated specificity for fatty acid substrates having chain lengths of less than 18 carbon atoms. A variety of mutants having 16 or fewer carbon atom chain length substrate specificities are produced by this method. Mutant desaturases produced by this method can be introduced via expression vectors into prokaryotic and eukaryotic cells and can also be used in the production of transgenic plants which may be used to produce specific fatty acid products.

  19. Amino Acid Crossword Puzzle

    ERIC Educational Resources Information Center

    Sims, Paul A.

    2011-01-01

    Learning the 20 standard amino acids is an essential component of an introductory course in biochemistry. Later in the course, the students study metabolism and learn about various catabolic and anabolic pathways involving amino acids. Learning new material or concepts often is easier if one can connect the new material to what one already knows;…

  20. Toxicology of Perfluoroalkyl acids

    EPA Science Inventory

    The Perfluoroalkyl acids(PFAAs) area a family of organic chemicals consisting of a perflurinated carbon backbone (4-12in length) and a acidic functional moiety (Carboxylate or sulfonate). These compounds have excellent surface-tension reducing properties and have numerous industr...

  1. Uric acid - blood

    MedlinePlus

    ... High levels of uric acid can sometimes cause gout or kidney disease. You may have this test if you have had or are about to have certain types of chemotherapy. Rapid weight loss, which may occur with such treatments, can increase the amount of uric acid in ...

  2. Bile acid transporters

    PubMed Central

    Dawson, Paul A.; Lan, Tian; Rao, Anuradha

    2009-01-01

    In liver and intestine, transporters play a critical role in maintaining the enterohepatic circulation and bile acid homeostasis. Over the past two decades, there has been significant progress toward identifying the individual membrane transporters and unraveling their complex regulation. In the liver, bile acids are efficiently transported across the sinusoidal membrane by the Na+ taurocholate cotransporting polypeptide with assistance by members of the organic anion transporting polypeptide family. The bile acids are then secreted in an ATP-dependent fashion across the canalicular membrane by the bile salt export pump. Following their movement with bile into the lumen of the small intestine, bile acids are almost quantitatively reclaimed in the ileum by the apical sodium-dependent bile acid transporter. The bile acids are shuttled across the enterocyte to the basolateral membrane and effluxed into the portal circulation by the recently indentified heteromeric organic solute transporter, OSTα-OSTβ. In addition to the hepatocyte and enterocyte, subgroups of these bile acid transporters are expressed by the biliary, renal, and colonic epithelium where they contribute to maintaining bile acid homeostasis and play important cytoprotective roles. This article will review our current understanding of the physiological role and regulation of these important carriers. PMID:19498215

  3. Analysis of Organic Acids.

    ERIC Educational Resources Information Center

    Griswold, John R.; Rauner, Richard A.

    1990-01-01

    Presented are the procedures and a discussion of the results for an experiment in which students select unknown carboxylic acids, determine their melting points, and investigate their solubility behavior in water and ethanol. A table of selected carboxylic acids is included. (CW)

  4. Omega-3 Fatty Acids

    MedlinePlus

    Omega-3 fatty acids are used together with lifestyle changes (diet, weight-loss, exercise) to reduce the amount of triglycerides (a fat-like ... people with very high triglycerides. Omega-3 fatty acids are in a class of medications called antilipemic ...

  5. Toxicology of Perfluoroalkyl Acids*

    EPA Science Inventory

    The perfluoroalkyl acids (PFAAs) are a family of organic chemicals consisting of a perfluorinated carbon backbone (4-12 in length) and an acidic functional moiety (carboxylate or sulfonate). These compounds are chemically stable, have excellent surface-tension reducing properties...

  6. Salicylic Acid Topical

    MedlinePlus

    ... skin blemishes in people who have acne. Topical salicylic acid is also used to treat skin conditions that involve scaling or overgrowth of skin ... water for 15 minutes.Do not apply topical salicylic acid to skin that is broken, red, swollen, irritated, or infected. ...

  7. Uric acid and hypertension.

    PubMed

    Feig, Daniel I

    2011-09-01

    A link between serum uric acid and the development of hypertension was first hypothesized in the 1870s. Although numerous epidemiologic studies in the 1980s and 1990s suggested an association, relatively little attention was paid to it until recently. Animal models have suggested a two-step pathogenesis by which uric acid initially activates the renin angiotensin system and suppresses nitric oxide, leading to uric acid-dependent increase in systemic vascular resistance, followed by a uric acid-mediated vasculopathy, involving renal afferent arterioles, resulting in a late sodium-sensitive hypertension. Initial clinical trials in young patients have supported these mechanisms in young patients but do not yet support pharmacologic reduction of serum uric acid as first-line therapy for hypertension.

  8. Biosynthesis of pulcherriminic acid

    PubMed Central

    MacDonald, J. C.

    1965-01-01

    1. Candida pulcherrima was grown on a complex medium to which various compounds had been added to determine their effect on the biosynthesis of pulcherriminic acid. Most of the pulcherriminic acid synthesized by C. pulcherrima PRL2019 was derived from the l-[1-14C]leucine added to the medium. 2. The cyclic dipeptide of l-leucine (cyclo-l-leucyl-l-leucyl) was shown, by trapping experiments involving cycloleucyl-leucyl isomers, to be synthesized by strain PRL2019. Cyclo-l-leucyl-l-leucyl was derived from l-leucine and was converted into pulcherriminic acid. Cyclo-l-leucyl-l-leucyl was a precursor of pulcherriminic acid in strain PRL2007 also. 3. The results supported the hypothesis that pulcherriminic acid is derived from l-leucine and that cyclo-l-leucyl-l-leucyl is an intermediate in the biosynthesis. PMID:5837792

  9. Total syntheses of cis-cyclopropane fatty acids: dihydromalvalic acid, dihydrosterculic acid, lactobacillic acid, and 9,10-methylenehexadecanoic acid.

    PubMed

    Shah, Sayali; White, Jonathan M; Williams, Spencer J

    2014-12-14

    cis-Cyclopropane fatty acids (cis-CFAs) are widespread constituents of the seed oils of subtropical plants, membrane components of bacteria and protozoa, and the fats and phospholipids of animals. We describe a systematic approach to the synthesis of enantiomeric pairs of four cis-CFAs: cis-9,10-methylenehexadecanoic acid, lactobacillic acid, dihydromalvalic acid, and dihydrosterculic acid. The approach commences with Rh2(OAc)4-catalyzed cyclopropenation of 1-octyne and 1-decyne, and hinges on the preparative scale chromatographic resolution of racemic 2-alkylcycloprop-2-ene-1-carboxylic acids using a homochiral Evan's auxiliary. Saturation of the individual diastereomeric N-cycloprop-2-ene-1-carbonylacyloxazolidines, followed by elaboration to alkylcyclopropylmethylsulfones, allowed Julia-Kocienski olefination with various ω-aldehyde-esters. Finally, saponification and diimide reduction afforded the individual cis-CFA enantiomers. PMID:25321346

  10. Incorporation of Ribonucleic Acid Bases into the Metabolic Pool and RNA of E. coli

    PubMed Central

    Buchwald, M.; Britten, R. J.

    1963-01-01

    Labeled cytosine, adenine, and guanine are rapidly incorporated by E. coli. A fraction of the radioactivity passes directly into RNA with very little delay. The remainder enters a pool before being incorporated into RNA. The fractions entering the pool and the time constants for equilibration of the specific activity of the pool are widely different for the four RNA bases. PMID:14016541

  11. Mesenchymal stem cells as novel micro-ribonucleic acid delivery vehicles in kidney disease.

    PubMed

    Yao, Kevin; Ricardo, Sharon D

    2016-05-01

    MicroRNAs (miRNAs) are short single strands of RNA responsible for post-transcriptional regulation of gene expression and have been implicated in the pathogenesis of chronic kidney disease (CKD). Emerging evidence reports that miRNAs can reduce kidney fibrosis through regulation of targets associated with collagen and extracellular matrix accumulation. However, the development of miRNA therapies has been hampered by the lack of targeted and sustainable methods of systemic miRNA delivery. Mesenchymal stem cells (MSCs) provide a promising miRNA delivery platform to overcome toxicity, the potential for insertional mutations and the low efficiency of previous methods. MSCs are endogenously immunoprivileged and home to sites of inflammation. They also release trophic growth factors to modulate the immune system, alter the polarization of macrophages and provide renal protection and repair. The potential to engineer MSCs to express or overexpress miRNAs, released by exosomes, may enhance their natural functions. Clinical studies are already being conducted individually for the use of miRNAs in cancer and MSCs in diseases associated with CKD. Hence, the combination of miRNAs and MSCs may provide an unparalleled cell-based therapy for treating CKD.

  12. Physical properties of single- and double-stranded coliphage ribonucleic acid

    PubMed Central

    Bishop, D. H. L.

    1966-01-01

    1. The physical characteristics of single- and double-stranded coliphage RNA with regard to their sedimentation behaviour in gradients of sucrose in high or low ionic conditions were examined. The effect of heat on their sedimentation characteristics was also determined. 2. Single-stranded coliphage RNA was found to exist in three different forms having sedimentation coefficients 28s, 20s and 12s. The latter two were interchangeable, depending on ionic strength. All three were almost equally infectious to spheroplasts. 3. Double-stranded coliphage RNA was found to be non-infectious to spheroplasts and had sedimentation coefficients 15s and 12s. Thermal denaturation gave rise to infectious single-stranded 12s RNA. 4. Four possible hypotheses on the mechanism of replication of coliphage RNA are discussed. PMID:4165511

  13. The effect of reaction with formaldehyde on the sedimentation rates of ribonucleic acids

    PubMed Central

    Fenwick, M. L.

    1968-01-01

    It has been reported that the RNA of several bacteriophages and that of the larger ribosomal sub-units of mammalian cells sediment faster in the presence of 0·1m-sodium chloride than is expected from their estimated molecular weights. The effect of blocking the hydrogen-bonding amino groups of these and other types of RNA was studied. The RNA of phage R17 no longer sedimented anomalously fast after treatment with formaldehyde. In contrast, the larger ribosomal RNA of HeLa cells appeared more aberrant than before, sedimenting faster than tobacco-mosaic-virus RNA (mol.wt. 2×106) in the presence of formaldehyde. The rapidly labelled nuclear 45s RNA of HeLa cells still sedimented faster than the larger ribosomal RNA after reaction with formaldehyde, showing no evidence of disaggregation. It is suggested that both the large ribosomal RNA and the 45s RNA of HeLa cells may have a non-linear structure. PMID:16742611

  14. Determination of base ratios of six ribonucleic acid bacteriophages specific to Escherichia coli

    PubMed Central

    Bishop, D. H. L.; Bradley, D. E.

    1965-01-01

    1. A method is described for the isolation of single-stranded-RNA coliphages. Two of the six RNA coliphages investigated were new strains. 2. The base ratios of six RNA coliphages were determined by labelling the host bacterium with [32P]-phosphate, purification of the radioactive coliphages and separation of 2′,3′-ribonucleotides liberated by alkaline hydrolysis of the coliphage RNA. 3. All six of the coliphages were morphologically similar, contained single-stranded RNA, and had sedimentation coefficient 80±5s. 4. The six RNA coliphages fell into two distinct groups, both serologically and in terms of their RNA base ratios. PMID:14333571

  15. Structural proteins of ribonucleic acid tumor viruses. Purification of envelope, core, and internal components.

    PubMed

    Strand, M; August, J T

    1976-01-25

    Murine type C virus structural proteins, the envelope glycopeptides, 30,000 dalton major core protein, and 15,000 dalton internal protein have each been purified to near homogeneity and in high yield from the smae batch of virus by use of phosphocellulose column chromatography and gel filtration procedures. Evidence that these proteins are specified by the viral genome was obtained by competition radioimmunoassay analysis, comparing these polypeptides from Rauscher virus cultivated in a variety of mammalian cell lines; all of the reactive antigenic determinants of these proteins appeared to be virus-specific.

  16. Multimeric small interfering ribonucleic acid for highly efficient sequence-specific gene silencing

    NASA Astrophysics Data System (ADS)

    Mok, Hyejung; Lee, Soo Hyeon; Park, Ji Won; Park, Tae Gwan

    2010-03-01

    Small interfering RNA (siRNA) with 19-21 base pairs has been recently recognized as a new therapeutic agent for effectively silencing a specific gene on a post-transcription level. For siRNA therapeutics, safe and efficient delivery issues are significant hurdles to clinical applications. Here we present a new class of biologically active siRNA structure based on chemically self-crosslinked and multimerized siRNA through cleavable disulphide linkages. The multimerized siRNA can produce more stable and compact polyelectrolyte complexes with less cytotoxic cationic carriers than naked siRNA because of substantially increased charge densities and the presence of flexible chemical linkers in the backbone. The cleavable and multimerized siRNA shows greatly enhanced gene-silencing efficiencies in vitro and in vivo through a target-messenger-RNA-specific RNA interference processing without significantly eliciting immune induction. This study demonstrates that the multimerized siRNA structure complexed with selected cationic condensing agents can serve as potential gene-silencing therapeutics for treating various diseases.

  17. Decreased ribonucleic acid synthesis in isolated rat liver nuclei during starvation

    PubMed Central

    Rickwood, D.; Klemperer, H. G.

    1970-01-01

    1. Isolated nuclei from starved rats showed a lowered incorporation of [14C]UMP into RNA. 2. The Mg2+-dependent incorporation was decreased by 30% after 1 day of starvation, but incorporation in the presence of Mn2+ and ammonium sulphate decreased only after longer periods of starvation. 3. RNA synthesis by nuclei in the presence of excess of added RNA polymerase was unchanged after 1 day of starvation and was inhibited by 20% after 4 days. 4. The capacity of nuclei to bind actinomycin D was unchanged after 1 day and was decreased by 20% after 4 days of starvation. PMID:5493859

  18. Purification and subunit analysis of wheat-germ ribonucleic acid polymerase II

    PubMed Central

    Jendrisak, Jerome J.; Becker, Wayne M.

    1974-01-01

    A procedure is described for the purification of the α-amanitin-sensitive DNA-dependent RNA polymerase [EC 2.7.7.6] from wheat germ. Solubilization of the enzyme activity was achieved by sonication of a crude extract in a high-salt buffer. Purification involved precipitation with protamine sulphate and (NH4)2SO4, chromatography on DEAE-cellulose and phosphocellulose, and sucrose gradient centrifugation. Under denaturing conditions the enzyme dissociated into five polypeptides with molecular weights and molar ratios of 220000 (0.9), 170000 (0.1), 140000 (1.0), 45000 (0.2), and 40000 (0.4). Approx. 1mg of purified RNA polymerase was obtained as a routine from 100g of starting material. ImagesPLATE 1PLATE 2 PMID:4853970

  19. Separation and Partial Characterization of Two Ribonucleic Acid Polymerases from Pea Seedlings 1

    PubMed Central

    Glicklich, Daniel; Jendrisak, Jerome J.; Becker, Wayne M.

    1974-01-01

    Two DNA-dependent RNA polymerases (ribonucleoside triphosphate:RNA nucleotidyl transferase, EC 2.7.7.6) have been isolated from pea (Pisum sativum) seedlings. The enzymes were solubilized by sonication in high salt buffer and were separated by chromatography on diethylaminoethyl cellulose using a linear salt gradient. Polymerase I eluted at 0.10 m (NH4)2SO4, accounted for about 10% of the recovered activity and was completely insensitive to α-amanitin. Polymerase II eluted at 0.14 m (NH4)2SO4, accounted for the remaining 90% of recovered activity and was strongly inhibited by α-amanitin. Both enzymes preferred denatured to native DNA as template, both showed an absolute requirement of divalent cation, and both were sensitive to the ionic strength of the assay medium. The developing pea seedling seems a promising system for studies of possible changes in relative activities and roles of multiple RNA polymerases during eukaryotic development. PMID:16658887

  20. The effects of oestradiol-17beta on the ribonucleic acid polymerases of immature rabbit uterus.

    PubMed Central

    Borthwick, N M; Smellie, R M

    1975-01-01

    Measurements of the endogenous RNA polymerase activities of nuclei isolated from immature rabbit uteri have shown that prior treatment of the animals with oestradiol-17beta has a profound effect on the apparent activities of both RNA polymerases A and B. Within 1 h of hormone treatment, the activity of RNA polymerase A is increased and continues to rise until about 4h when it reaches a plateau and remains steady until at least 8h. The activity of RNA polymerase B increases sharply after oestradiol treatment reaching an early maximum at 30-45 min. Thereafter this activity declines until by 1-2h it approaches control values but a second increase in activity then occurs with a maximum at 3-4h. Treatment of the rabbits with alpha-amanitin before the administration of oestradiol inhibits the hormone-induced stimulation of RNA polymerase A activity in isolated nuclei but when the administration of alpha-amanitin is delayed until after the early rise of RNA polymerase B activity, the oestradiol-induced stimulation of RNA polymerase A is retained. Similar results have been obtained in experiments with cycloheximide suggesting that the stimulation of RNA polymerase A activity by oestradiol is dependent on the hormone-induced stimulation of RNA polymerase B and the subsequent synthesis of protein using the RNA product of the early increase in RNA polymerase B activity. Measurement of the activities of RNA polymerases A and B after isolation of the enzymes from immature rabbit uterine nuclei before and after oestradiol treatment failed to show any differences. Therefore it would appear that the changes in the observed activities of RNA polymerases A and B in isolated nuclei are consequences of changes in the structure and function of chromatin rather than the results of modifications in the RNA polymerases themselves. PMID:1156388

  1. Ontogeny and pituitary regulation of testicular growth hormone-releasing hormone-like messenger ribonucleic acid.

    PubMed

    Berry, S A; Pescovitz, O H

    1990-09-01

    The testis is rich in central nervous system-type neuropeptides, including a GH-releasing hormone (GHRH)-like substance. We examined the ontogeny and pituitary regulation of testicular GHRH-like mRNA (t-GHRH mRNA) and compared this to expression of insulin-like growth factor-I (IGF-I) and IGF-II mRNA in developing testis. t-GHRH mRNA was measured by dot blot hybridization and quantitated using a hypothalamic GHRH cRNA standard. t-GHRH mRNA was not detectable in Northern blots in fetal testis on day 19 of gestation, but was present in low but detectable amounts in testicular dot blots on day 2 of life (0.44 pg/micrograms total RNA). Levels of the RNA increased beginning on day 21 (1.72 +/- 0.23 pg/micrograms total RNA) and reached adult levels by day 30 (4.96 +/- 0.84 pg/micrograms total RNA). The GHRH species on Northern analysis was about 1750 nucleotides at all ages examined; there was a larger species of about 3350 nucleotides seen on days 65 and 90. There was no correlation between the ontogeny of t-GHRH mRNA and either IGF-I or IGF-II mRNAs, which were maximally expressed in the testes of day 2 animals and decreased with age. To examine the influence of the pituitary gland on t-GHRH mRNA, levels of the mRNA were measured in the tests of hypophysectomized animals and age-matched controls. In animals hypophysectomized on day 21 and killed on day 42 and in animals hypophysectomized on day 42 and killed on day 63, there was marked diminution of t-GHRH mRNA (19 +/- 5% and 9 +/- 2% of age-matched controls, respectively). In contrast, in animals hypophysectomized on day 65 and killed on either day 80 or 90, there was a much smaller difference in levels of t-GHRH mRNA compared to values in control animals (73 +/- 20%). This was unlike the effect of hypophysectomy on testicular IGF-I mRNA, where uniform diminution was seen in all three groups. Because GH is important in the regulation of hypothalamic GHRH mRNA, we examined the effects of administration of recombinant human GH on the reinduction of t-GHRH mRNA after hypophysectomy and compared this to the reinduction of IGF-I mRNA. Neither t-GHRH mRNA nor testicular IGF-I mRNA increased in hypophysectomized animals treated with GH. Our results indicate that t-GHRH mRNA is developmentally regulated, and that the hypothalamic-pituitary axis is important in its expression.(ABSTRACT TRUNCATED AT 400 WORDS)

  2. Hormonal regulation of type II glucocorticoid receptor messenger ribonucleic acid in rat brain.

    PubMed

    Peiffer, A; Lapointe, B; Barden, N

    1991-10-01

    Differences in the regulation of type II glucocorticoid receptor (GR) mRNA levels in female rat brain regions involved in the control of the hypothalamic-pituitary-adrenal axis were studied by Northern blot analysis after chronic administration of corticosterone or dexamethasone to adrenalectomized (ADX), ovariectomized (OVX), and ADX/OVX animals. The effect of chronic estradiol or progesterone treatment of intact animals was also studied. Our results show that type II GR mRNA levels of ADX animals were significantly increased above control values in amygdala (140%) and hippocampus (196%), but not in hypothalamus. These increased transcript levels were down-regulated by corticosterone or dexamethasone, with the exception of those in the amygdala, where corticosterone had no effect. Ovariectomy significantly increased hypothalamic GR mRNA content (174%) over control values, and this increase was sensitive to dexamethasone. The combined effect of adrenalectomy/ovariectomy on GR mRNA levels was greater than that of adrenalectomy only in amygdala. Corticosterone increased amygdala transcript levels in OVX and ADX/OVX animals. Estradiol administration to intact animals raised the GR mRNA content of amygdala, while progesterone treatment had no effect on any of the brain regions studied. We conclude that there exists heterogeneity with respect to type II GR mRNA regulation by corticosterone and dexamethasone in brain regions of ADX female rats, and that certain limbic structures show greater sensitivity to these hormonal manipulations, suggesting a more prominent role in the regulation of the hypothalamic-pituitary-adrenal axis. Our results also suggest that circulating estrogens can influence the sensitivity of brain structures (i.e. hypothalamus and amygdala) to glucocorticoids by altering GR mRNA levels. These regions may represent integration sites at which gonadal steroids are able to alter stress hormone secretion.

  3. Evolution of early life inferred from protein and ribonucleic acid sequences

    NASA Technical Reports Server (NTRS)

    Dayhoff, M. O.; Schwartz, R. M.

    1978-01-01

    The chemical structures of ferredoxin, 5S ribosomal RNA, and c-type cytochrome sequences have been employed to construct a phylogenetic tree which connects all major photosynthesizing organisms: the three types of bacteria, blue-green algae, and chloroplasts. Anaerobic and aerobic bacteria, eukaryotic cytoplasmic components and mitochondria are also included in the phylogenetic tree. Anaerobic nonphotosynthesizing bacteria similar to Clostridium were the earliest organisms, arising more than 3.2 billion years ago. Bacterial photosynthesis evolved nearly 3.0 billion years ago, while oxygen-evolving photosynthesis, originating in the blue-green algal line, came into being about 2.0 billion years ago. The phylogenetic tree supports the symbiotic theory of the origin of eukaryotes.

  4. Calcium and potassium ion binding by tobacco mosaic virus ribonucleic acid.

    PubMed

    Gastfriend, H H; Lauffer, M A

    1983-11-15

    Calcium and potassium ion titration experiments were performed on solutions of tobacco mosaic virus RNA using ion-specific electrodes. The data obtained were analyzed using Scatchard and Klotz plots for the number of binding sites per nucleotide (n), and the apparent stability constant for complex formation, beta Me. The experimental design also allowed for the determination of the number of protons released per metal ion bound, chi. The calcium ion titration in water yielded values of 0.45 for n, 6.03 for log beta Ca and 0.24 for chi. When this titration was repeated in 0.01 M-KCl, the values were found to be 0.11 for n, 5.08 for log beta Ca and zero for chi. An aqueous potassium titration was also performed, with values for n, log beta K and chi of 0.25, 2.96 and less than 0.10, respectively.

  5. Prostanoid-induced expression of matrix metalloproteinase-1 messenger ribonucleic acid in rat osteosarcoma cells

    NASA Technical Reports Server (NTRS)

    Clohisy, J. C.; Connolly, T. J.; Bergman, K. D.; Quinn, C. O.; Partridge, N. C.

    1994-01-01

    Individual prostanoids have distinct potencies in activating intracellular signaling pathways and regulating gene expression in osteoblastic cells. The E-series prostaglandins (PGs) are known to stimulate matrix metalloproteinase-1 (MMP-1) synthesis and secretion in certain rodent and human osteoblastic cells, yet the intracellular events involved remain unclear. To further characterize this response and its signal transduction pathway(s), we examined prostanoid-induced expression of the MMP-1 gene in the rat osteoblastic osteosarcoma cell line UMR 106-01. Northern blot analysis demonstrated that prostaglandin E2 (PGE2) and PGE1 were very potent stimulators (40-fold) of MMP-1 transcript abundance, PGF2 alpha and prostacyclin were weak stimulators (4-fold), and thromboxane-B2 had no effect. The marked increase in MMP-1 transcript abundance after PGE2 treatment was first detected at 2 h, became maximal at 4 h, and persisted beyond 24 h. This response was dose dependent and elicited maximal and half-maximal effects with concentrations of 10(-6) and 0.6 x 10(-7) M, respectively. Cycloheximide, a protein synthesis inhibitor, completely blocked this effect of PGE2, suggesting that the expression of other genes is required. Nuclear run-on experiments demonstrated that PGE2 rapidly activates MMP-1 gene transcription, with a maximal increase at 2-4 h. The second messenger analog, 8-bromo-cAMP, mimicked the effects of PGE2 by stimulating a dose-dependent increase in MMP-1 messenger RNA (mRNA) levels, with a maximal effect quantitatively similar to that observed with PGE2. Thus, in UMR 106-01 cells, different prostanoids have distinct potencies in stimulating MMP-1 mRNA abundance. Our data suggest that PGE2 stimulation of MMP-1 synthesis is due to activation of MMP-1 gene transcription and a subsequent marked increase in MMP-1 mRNA abundance. This effect is dependent on de novo protein synthesis and is mimicked by protein kinase-A activation.

  6. The Coding Properties of Lysine-accepting Transfer Ribonucleic Acids from Black-eyed Peas 1

    PubMed Central

    Hague, Donald R.; Kofoid, Eric C.

    1971-01-01

    Lysine-accepting transfer RNA from ungerminated and germinated embryo axes of black-eyed peas (Vigna sinensis L. Savi) was fractionated on benzoylated diethylaminoethyl cellulose and reverse phase Freon columns. Cochromatography indicated the presence of two similar lysyl transfer RNA fractions in each tissue. Ribosome binding studies revealed that the larger of the two fractions in each case is specific for the AAG codon, while the smaller one recognizes AAA and AAG. Possible implications of this difference in quantities of isoacceptors in translation of genetic information are discussed. PMID:16657787

  7. Discovery of huanglongbing (HLB) pre-symptomatic Ribonucleic acid (RNA) biomarkers

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Huanglongbing (HLB) is the most devastating citrus disease and is associated with vector-borne Liberibacter. Currently there is no cure for huanglongbing. Visual disease symptoms appear in only a few leaves months after initial Liberibacter exposure compromising disease management by tree removal. S...

  8. Estrogen-induced decrease of glucocorticoid receptor messenger ribonucleic acid concentration in rat anterior pituitary gland.

    PubMed

    Peiffer, A; Barden, N

    1987-06-01

    Using Northern blots and hybridization techniques, we have identified an approximately 6.5 kilobase glucocorticoid receptor mRNA species in rat anterior pituitary gland. Ovariectomy resulted in an approximately 2-fold increase in glucocorticoid receptor mRNA concentrations. This effect was maximal 8 days after surgery and glucocorticoid receptor mRNA levels remained elevated for at least up to 4 weeks. Administration of 17-beta-estradiol completely reversed the ovariectomy-induced increase in glucocorticoid receptor mRNA content of pituitary gland. Treatment of rats with corticosterone did not influence the ovariectomy-induced increase in glucocorticoid receptor mRNA content, indicating that this increase is not mediated via effects on circulating glucocorticoid levels or availability. In situ hybridization experiments confirmed the ovariectomy-induced increase in glucocorticoid receptor mRNA content and indicated that this action is widely distributed throughout the anterior pituitary gland.

  9. Taxonomy of the Clostridia: ribosomal ribonucleic acid homologies among the species.

    PubMed

    Johnson, J L; Francis, B S

    1975-06-01

    rRNA homologies have been determined on reference strains representing 56 species of Clostridium. Competition experiments using tritium-labelled 23S rRNA were employed. The majority of the species had DNA with 27 to 28% guanine plus cytosine (%GC). These fell into rRNA homology groups I and II, which were well defined, and a third group which consisted of species which did not belong in groups I and II. Species whose DNA was 41 to 45% GC comprised a fourth group. Thirty species were placed into rRNA homology group I on the basis of having 50% or greater homology with Clostridium butyricum, C. perfringens, C. carnis, C. sporogenes, C. novyi or C. pasteurianum. Ten subgroups were delineated in homology group I. Species in each subgroup either had high homology with a particular reference species or a similar pattern of homologies to all of the reference organisms. The eleven species in rRNA homology group II had 69% or greater homology to C. lituseburense. Species in groups I and II had intergroup homologies of 20 to 40%. The six species in group II had very low homologies with groups I and II. Negligible homology also resulted when five of the species were tested against the sixth, C. ramosum. The five species having DNA with 41 to 45% GC were C. innocuum, C. sphenoides, C. indolis, C. barkeri and C. orotic um. Little rRNA homology was apparent between C. innocuum and the other high % GC species or with several Bacillus species having similar %GC DNA. Correlations between homology results and phenotypic characteristics are discussed.

  10. The nucleotide sequences of some large ribonuclease T1 products from bacteriophage R17 ribonucleic acid

    PubMed Central

    Jeppesen, Peter G. N.

    1971-01-01

    A method of `fingerprinting' high-molecular-weight 32P-labelled RNA species, using a two-dimensional thin-layer-chromatographic separation of ribonuclease T1 digestion products, has been applied to RNA from the Escherichia coli bacteriophage R17. The `fingerprinting' technique, besides giving a unique pattern that can be used as a characterization of the RNA, has made it possible to isolate a number of the larger oligonucleotides and to determine their nucleotide sequences. ImagesPLATE 1 PMID:5158505

  11. Mesenchymal stem cells as novel micro-ribonucleic acid delivery vehicles in kidney disease.

    PubMed

    Yao, Kevin; Ricardo, Sharon D

    2016-05-01

    MicroRNAs (miRNAs) are short single strands of RNA responsible for post-transcriptional regulation of gene expression and have been implicated in the pathogenesis of chronic kidney disease (CKD). Emerging evidence reports that miRNAs can reduce kidney fibrosis through regulation of targets associated with collagen and extracellular matrix accumulation. However, the development of miRNA therapies has been hampered by the lack of targeted and sustainable methods of systemic miRNA delivery. Mesenchymal stem cells (MSCs) provide a promising miRNA delivery platform to overcome toxicity, the potential for insertional mutations and the low efficiency of previous methods. MSCs are endogenously immunoprivileged and home to sites of inflammation. They also release trophic growth factors to modulate the immune system, alter the polarization of macrophages and provide renal protection and repair. The potential to engineer MSCs to express or overexpress miRNAs, released by exosomes, may enhance their natural functions. Clinical studies are already being conducted individually for the use of miRNAs in cancer and MSCs in diseases associated with CKD. Hence, the combination of miRNAs and MSCs may provide an unparalleled cell-based therapy for treating CKD. PMID:26437381

  12. The Coding Properties of Lysine-accepting Transfer Ribonucleic Acids from Black-eyed Peas.

    PubMed

    Hague, D R; Kofoid, E C

    1971-09-01

    Lysine-accepting transfer RNA from ungerminated and germinated embryo axes of black-eyed peas (Vigna sinensis L. Savi) was fractionated on benzoylated diethylaminoethyl cellulose and reverse phase Freon columns. Cochromatography indicated the presence of two similar lysyl transfer RNA fractions in each tissue. Ribosome binding studies revealed that the larger of the two fractions in each case is specific for the AAG codon, while the smaller one recognizes AAA and AAG. Possible implications of this difference in quantities of isoacceptors in translation of genetic information are discussed.

  13. Low-molecular-weight (4.5S) ribonucleic acid in higher-plant chloroplast ribosomes.

    PubMed Central

    Whitfeld, P R; Leaver, C J; Bottomley, W; Atchison, B

    1978-01-01

    A species of RNA that migrates on 10% (w/v) polyacrylamide gels between 5S and 4S RNA was detected in spinach chloroplasts. This RNA (referred to as 4.5 S RNA) was present in amounts equimolar to the 5S RNA and its molecular weight was estimated to be approx. 33 000. Fractionation of the chloroplast components showed that the 4.5S RNA was associated with the 50 S ribosomal subunit and that it could be removed by washing the ribosomes with a buffer containing 0.01 M-EDTA and 0.5 M-KCl. It did not appear to be a cleavage product of the labile 23 S RNA of spinach chloroplast ribosomes. When 125I-labelled 4.5 S RNA was hybridized to fragments of spinach chloroplast DNA produced by SmaI restriction endonuclease, a single fragment (mol.wt. 1.15 times 10(6)) became labelled. The same DNA fragment also hybridized to chloroplast 5 S RNA and part of the 23 S RNA. It was concluded that the coding sequence for 4.5 S RNA was part of, or immediately adjacent to, the rRNA-gene region in chloroplast DNA . A comparable RNA species was observed in chloroplasts of tobacco and pea leaves. Images Fig. 8. PMID:743229

  14. The Occurrence and Distribution of Poly(A) Ribonucleic Acid in Soybean

    PubMed Central

    Key, Joe L.; Silflow, Carolyn

    1975-01-01

    The occurrence and distribution of poly(A) sequences in the RNA of soybean (Glycine max var. Wayne) have been studied. Only one of the two species of AMP-rich RNA contains poly(A). D-RNA does not contain detectable poly(A) sequences. The TB-RNA is the poly(A) RNA in this system. At least a part (up to 50% or more) of the mRNA in polyribosomes contains a poly(A) sequence. The poly(A) RNA is heterodisperse in size but has a mean size of approximately 18S (2,000 nucleotides) in urea and formamide gels. The poly(A) fragment resulting from ribonuclease A and T1 digestion migrates as a broad band overlapping the 4 to 5.8S regions of the gels with a mean size of somewhat greater than 5S. No evidence was found for the occurrence of a discrete oligo(A) fragment in the poly(A) RNA; however, oligonucleotides which migrate faster than the poly(A) fraction were observed in preparations which were not bound to oligo(dT) cellulose prior to electrophoresis. This oligonucleotide region was enriched in AMP (up to about 65%) as would be expected after ribonuclease A and T1 digestion. PMID:16659304

  15. Heterogeneity of the 5' terminus of hen ovalbumin messenger ribonucleic acid.

    PubMed Central

    Malek, L T; Eschenfeldt, W H; Munns, T W; Rhoads, R E

    1981-01-01

    The 5'-terminal sequence of hen ovalbumin mRNA was investigated using a novel labeling method. Ovalbumin mRNA was purified by hybridization to complementary DNA coupled to cellulose. The mRNA thus purified was shown to be 97.9% pure by hybridization with plasmid DNA containing sequences to the messengers coding for conalbumin and ovomucoid, the next two most abundant messengers of oviduct. After digestion with RNase T1 and alkaline phosphatase, 5'-terminal capped oligonucleotides were selected by binding to anti-m7G-Sepharose. These were then labeled using RNA ligase and [5'-32P]pCp, separated by two-dimensional gel electrophoresis, and sequenced by partial digestion with base-specific ribonucleases. A nested set of three capped oligonucleotides was identified. Their structures and relative abundances were m7GpppAUACAG, 3% m7GpppACAUACAG, 61+; and m7GpppGUACAUACAG, 36%. Images PMID:6785728

  16. Gluconic acid production.

    PubMed

    Anastassiadis, Savas; Morgunov, Igor G

    2007-01-01

    Gluconic acid, the oxidation product of glucose, is a mild neither caustic nor corrosive, non toxic and readily biodegradable organic acid of great interest for many applications. As a multifunctional carbonic acid belonging to the bulk chemicals and due to its physiological and chemical characteristics, gluconic acid itself, its salts (e.g. alkali metal salts, in especially sodium gluconate) and the gluconolactone form have found extensively versatile uses in the chemical, pharmaceutical, food, construction and other industries. Present review article presents the comprehensive information of patent bibliography for the production of gluconic acid and compares the advantages and disadvantages of known processes. Numerous manufacturing processes are described in the international bibliography and patent literature of the last 100 years for the production of gluconic acid from glucose, including chemical and electrochemical catalysis, enzymatic biocatalysis by free or immobilized enzymes in specialized enzyme bioreactors as well as discontinuous and continuous fermentation processes using free growing or immobilized cells of various microorganisms, including bacteria, yeast-like fungi and fungi. Alternatively, new superior fermentation processes have been developed and extensively described for the continuous and discontinuous production of gluconic acid by isolated strains of yeast-like mold Aureobasidium pullulans, offering numerous advantages over the traditional discontinuous fungi processes.

  17. Trans Fatty Acids

    NASA Astrophysics Data System (ADS)

    Doyle, Ellin

    1997-09-01

    Fats and their various fatty acid components seem to be a perennial concern of nutritionists and persons concerned with healthful diets. Advice on the consumption of saturated, polyunsaturated, monounsaturated, and total fat bombards us from magazines and newspapers. One of the newer players in this field is the group of trans fatty acids found predominantly in partially hydrogenated fats such as margarines and cooking fats. The controversy concerning dietary trans fatty acids was recently addressed in an American Heart Association (AHA) science advisory (1) and in a position paper from the American Society of Clinical Nutrition/American Institute of Nutrition (ASCN/AIN) (2). Both reports emphasize that the best preventive strategy for reducing risk for cardiovascular disease and some types of cancer is a reduction in total and saturated fats in the diet, but a reduction in the intake of trans fatty acids was also recommended. Although the actual health effects of trans fatty acids remain uncertain, experimental evidence indicates that consumption of trans fatty acids adversely affects serum lipid levels. Since elevated levels of serum cholesterol and triacylglycerols are associated with increased risk of cardiovascular disease, it follows that intake of trans fatty acids should be minimized.

  18. Sulfuric Acid on Europa

    NASA Technical Reports Server (NTRS)

    1999-01-01

    Frozen sulfuric acid on Jupiter's moon Europa is depicted in this image produced from data gathered by NASA's Galileo spacecraft. The brightest areas, where the yellow is most intense, represent regions of high frozen sulfuric acid concentration. Sulfuric acid is found in battery acid and in Earth's acid rain.

    This image is based on data gathered by Galileo's near infrared mapping spectrometer.

    Europa's leading hemisphere is toward the bottom right, and there are enhanced concentrations of sulfuric acid in the trailing side of Europa (the upper left side of the image). This is the face of Europa that is struck by sulfur ions coming from Jupiter's innermost moon, Io. The long, narrow features that crisscross Europa also show sulfuric acid that may be from sulfurous material extruded in cracks.

    Galileo, launched in 1989, has been orbiting Jupiter and its moons since December 1995. JPL manages the Galileo mission for NASA's Office of Space Science, Washington DC. JPL is a division of the California Institute of Technology, Pasadena, CA.

  19. Strongly Acidic Auxin Indole-3-Methanesulfonic Acid

    PubMed Central

    Cohen, Jerry D.; Baldi, Bruce G.; Bialek, Krystyna

    1985-01-01

    A radiochemical synthesis is described for [14C]indole-3-methanesulfonic acid (IMS), a strongly acidic auxin analog. Techniques were developed for fractionation and purification of IMS using normal and reverse phase chromatography. In addition, the utility of both Fourier transform infrared spectrometry and fast atom bombardment mass spectrometry for analysis of IMS has been demonstrated. IMS was shown to be an active auxin, stimulating soybean hypocotyl elongation, bean first internode curvature, and ethylene production. IMS uptake by thin sections of soybean hypocotyl was essentially independent of solution pH and, when applied at a 100 micromolar concentration, IMS exhibited a basipetal polarity in its transport in both corn coleoptile and soybean hypocotyl sections. [14C]IMS should, therefore, be a useful compound to study fundamental processes related to the movement of auxins in plant tissues and organelles. PMID:16664007

  20. Understanding acid rain

    SciTech Connect

    Budiansky, S.

    1981-06-01

    The complexities of the phenomenon of acid rain are described. Many factors, including meteorology, geology, chemistry, and biology, all play parts. Varying weather, varying soils, the presence of other pollutants and species differences all act to blur the connections between industrial emissions, acid rain, and environmental damage. Some experts believe that the greatest pH shock to lakes occurs during snow melt and runoff in the spring; others believe that much of the plant damage ascribed to acid rain is actually due to the effects of ozone. Much work needs to be done in the area of sampling. Historical data are lacking and sampling methods are not sufficiently accurate. (JMT)

  1. Understanding Acid Base Disorders.

    PubMed

    Gomez, Hernando; Kellum, John A

    2015-10-01

    The concentration of hydrogen ions is regulated in biologic solutions. There are currently 3 recognized approaches to assess changes in acid base status. First is the traditional Henderson-Hasselbalch approach, also called the physiologic approach, which uses the relationship between HCO3(-) and Pco2; the second is the standard base excess approach based on the Van Slyke equation. The third approach is the quantitative or Stewart approach, which uses the strong ion difference and the total weak acids. This article explores the origins of the current concepts framing the existing methods to analyze acid base balance.

  2. Acid rain and soil.

    PubMed

    vanLoon, G W

    1984-08-01

    A summary of important chemical properties of soil is given and the way in which acid rain may affect these properties is discussed. Acid rain may suppress microbiological decomposition and nitrification processes, thus influencing the nutrient status of soils. It has also been found that soil organic matter is less soluble in more acid solutions. Changed nutrient availability patterns are predicted in a low pH environment and enhanced leaching of essential elements from the soil exchange complex has been observed. Increased solubility of potentially toxic elements such as aluminium may also occur from soils which have been exposed to acidified rainfall.

  3. Disorders of Amino Acid Metabolism

    MedlinePlus

    ... Aspiration Syndrome Additional Content Medical News Disorders of Amino Acid Metabolism By Lee M. Sanders, MD, MPH NOTE: ... Metabolic Disorders Disorders of Carbohydrate Metabolism Disorders of Amino Acid Metabolism Disorders of Lipid Metabolism Amino acids are ...

  4. Pantothenic acid and biotin

    MedlinePlus

    ... well as other nutrients, are provided in the Dietary Reference Intakes (DRIs) developed by the Food and Nutrition Board ... level that is thought to ensure enough nutrition. Dietary Reference Intakes for pantothenic acid: Age 0 to 6 months: ...

  5. Amino Acid Metabolism Disorders

    MedlinePlus

    Metabolism is the process your body uses to make energy from the food you eat. Food is ... One group of these disorders is amino acid metabolism disorders. They include phenylketonuria (PKU) and maple syrup ...

  6. [Hydrofluoric acid burns].

    PubMed

    Holla, Robin; Gorter, Ramon R; Tenhagen, Mark; Vloemans, A F P M Jos; Breederveld, Roelf S

    2016-01-01

    Hydrofluoric acid is increasingly used as a rust remover and detergent. Dermal contact with hydrofluoric acid results in a chemical burn characterized by severe pain and deep tissue necrosis. It may cause electrolyte imbalances with lethal consequences. It is important to identify high-risk patients. 'High risk' is defined as a total affected body area > 3% or exposure to hydrofluoric acid in a concentration > 50%. We present the cases of three male patients (26, 31, and 39 years old) with hydrofluoric acid burns of varying severity and describe the subsequent treatments. The application of calcium gluconate 2.5% gel to the skin is the cornerstone of the treatment, reducing pain as well as improving wound healing. Nails should be thoroughly inspected and possibly removed if the nail is involved, to ensure proper healing. In high-risk patients, plasma calcium levels should be evaluated and cardiac monitoring is indicated.

  7. Folic acid - test

    MedlinePlus

    ... folic acid before and during pregnancy helps prevent neural tube defects, such as spina bifida. Women who ... take more if they have a history of neural tube defects in earlier pregnancies. Ask your provider ...

  8. Nitric acid poisoning

    MedlinePlus

    Symptoms from swallowing nitric acid may include: Abdominal pain - severe Burns to skin or mouth Drooling Fever Mouth pain - severe Rapid drop in blood pressure (shock) Throat swelling, which leads to breathing difficulty ...

  9. [Hydrofluoric acid burns].

    PubMed

    Holla, Robin; Gorter, Ramon R; Tenhagen, Mark; Vloemans, A F P M Jos; Breederveld, Roelf S

    2016-01-01

    Hydrofluoric acid is increasingly used as a rust remover and detergent. Dermal contact with hydrofluoric acid results in a chemical burn characterized by severe pain and deep tissue necrosis. It may cause electrolyte imbalances with lethal consequences. It is important to identify high-risk patients. 'High risk' is defined as a total affected body area > 3% or exposure to hydrofluoric acid in a concentration > 50%. We present the cases of three male patients (26, 31, and 39 years old) with hydrofluoric acid burns of varying severity and describe the subsequent treatments. The application of calcium gluconate 2.5% gel to the skin is the cornerstone of the treatment, reducing pain as well as improving wound healing. Nails should be thoroughly inspected and possibly removed if the nail is involved, to ensure proper healing. In high-risk patients, plasma calcium levels should be evaluated and cardiac monitoring is indicated. PMID:27189091

  10. Difficult Decisions: Acid Rain.

    ERIC Educational Resources Information Center

    Miller, John A.; Slesnick, Irwin L.

    1989-01-01

    Discusses some of the contributing factors and chemical reactions involved in the production of acid rain, its effects, and political issues pertaining to who should pay for the clean up. Supplies questions for consideration and discussion. (RT)

  11. Hyaluronic acid fillers.

    PubMed

    Monheit, Gary D; Coleman, Kyle M

    2006-01-01

    Although hyaluronic acids are a relatively new treatment for facial lines and wrinkles, they have provided numerous advances in the area of cosmetic surgery. This article discusses the inherent properties of hyaluronic acid fillers that make them ideal for treatment of facial lines. It encompasses a review of the current literature on U.S. Food and Drug Administration-approved hyaluronic acid fillers and the role that each of these fillers currently has in facial cosmetics. This article also discusses the potential pitfalls and adverse effects that can be associated with using hyaluronic acids for filling facial lines. Finally, it serves as an overview of current techniques for clinical assessment of patients as well as administration and treatment of facial lines and wrinkles.

  12. Boric acid poisoning

    MedlinePlus

    Borax poisoning ... The main symptoms of boric acid poisoning are blue-green vomit, diarrhea, and a bright red rash on the skin. Other symptoms may include: Blisters Collapse Coma Convulsions Drowsiness ...

  13. Stomach acid test

    MedlinePlus

    Gastric acid secretion test ... The test is done after you have not eaten for a while so fluid is all that remains in ... injected into your body. This is done to test the ability of the cells in the stomach ...

  14. Aminolevulinic Acid Topical

    MedlinePlus

    ... under the skin that result from exposure to sunlight and can develop into skin cancer) of the ... acid will make your skin very sensitive to sunlight (likely to get sunburn). Avoid exposure of treated ...

  15. Amino Acids and Chirality

    NASA Technical Reports Server (NTRS)

    Cook, Jamie E.

    2012-01-01

    Amino acids are among the most heavily studied organic compound class in carbonaceous chondrites. The abundance, distributions, enantiomeric compositions, and stable isotopic ratios of amino acids have been determined in carbonaceous chondrites fi'om a range of classes and petrographic types, with interesting correlations observed between these properties and the class and typc of the chondritcs. In particular, isomeric distributions appear to correlate with parent bodies (chondrite class). In addition, certain chiral amino acids are found in enantiomeric excess in some chondrites. The delivery of these enantiomeric excesses to the early Earth may have contributed to the origin of the homochirality that is central to life on Earth today. This talk will explore the amino acids in carbonaceous chondritcs and their relevance to the origin of life.

  16. (Acid rain workshop)

    SciTech Connect

    Turner, R.S.

    1990-12-05

    The traveler presented a paper entitled Susceptibility of Asian Ecosystems to Soil-Mediated Acid Rain Damage'' at the Second Workshop on Acid Rain in Asia. The workshop was organized by the Asian Institute of Technology (Bangkok, Thailand), Argonne National Laboratory (Argonne, Illinois), and Resource Management Associates (Madison, Wisconsin) and was sponsored by the US Department of Energy, the United Nations Environment Program, the United Nations Economic and Social Commission for Asia and the Pacific, and the World Bank. Papers presented on the first day discussed how the experience gained with acid rain in North America and Europe might be applied to the Asian situation. Papers describing energy use projections, sulfur emissions, and effects of acid rain in several Asian countries were presented on the second day. The remaining time was allotted to discussion, planning, and writing plans for a future research program.

  17. Folic acid in diet

    MedlinePlus

    ... a regular supply of the vitamin in the foods you eat. ... vitamins have been added to the food. Many foods are now fortified with folic acid. Some of these are enriched breads, cereals, flours, ...

  18. Valproic Acid and Pregnancy

    MedlinePlus

    ... in the treatment of epilepsy, and to treat bipolar disorder and migraines. I have been taking valproic acid ... that women with seizure disorders and women with bipolar disorder might have menstrual problems and difficulty getting pregnant. ...

  19. Citric acid urine test

    MedlinePlus

    ... The test is used to diagnose renal tubular acidosis and evaluate kidney stone disease. Normal Results The ... level of citric acid may mean renal tubular acidosis and a tendency to form calcium kidney stones. ...

  20. Folic Acid Quiz

    MedlinePlus

    ... more easily than natural food folate. Close × Answer: D CORRECT: Folic acid reduces the risk for spina ... g., orange juice and green vegetables). Close × Answer: D CORRECT: Spina bifida and anencephaly are neural tube ...

  1. Hydrofluoric acid poisoning

    MedlinePlus

    ... your skin or eyes, you may have: Blisters Burns Pain Vision loss Hydrofluoric acid poisoning can have ... urine tests Camera down the throat to see burns in the esophagus and the stomach (endoscopy) Fluids ...

  2. Portable nucleic acid thermocyclers.

    PubMed

    Almassian, David R; Cockrell, Lisa M; Nelson, William M

    2013-11-21

    A nucleic acid thermal cycler is considered to be portable if it is under ten pounds, easily carried by one individual, and battery powered. Nucleic acid amplification includes both polymerase chain reaction (e.g. PCR, RT-PCR) and isothermal amplification (e.g. RPA, HDA, LAMP, NASBA, RCA, ICAN, SMART, SDA). There are valuable applications for portable nucleic acid thermocyclers in fields that include clinical diagnostics, biothreat detection, and veterinary testing. A system that is portable allows for the distributed detection of targets at the point of care and a reduction of the time from sample to answer. The designer of a portable nucleic acid thermocycler must carefully consider both thermal control and the detection of amplification. In addition to thermal control and detection, the designer may consider the integration of a sample preparation subsystem with the nucleic acid thermocycler. There are a variety of technologies that can achieve accurate thermal control and the detection of nucleic acid amplification. Important evaluation criteria for each technology include maturity, power requirements, cost, sensitivity, speed, and manufacturability. Ultimately the needs of a particular market will lead to user requirements that drive the decision between available technologies.

  3. Neutron Nucleic Acid Crystallography.

    PubMed

    Chatake, Toshiyuki

    2016-01-01

    The hydration shells surrounding nucleic acids and hydrogen-bonding networks involving water molecules and nucleic acids are essential interactions for the structural stability and function of nucleic acids. Water molecules in the hydration shells influence various conformations of DNA and RNA by specific hydrogen-bonding networks, which often contribute to the chemical reactivity and molecular recognition of nucleic acids. However, X-ray crystallography could not provide a complete description of structural information with respect to hydrogen bonds. Indeed, X-ray crystallography is a powerful tool for determining the locations of water molecules, i.e., the location of the oxygen atom of H2O; however, it is very difficult to determine the orientation of the water molecules, i.e., the orientation of the two hydrogen atoms of H2O, because X-ray scattering from the hydrogen atom is very small.Neutron crystallography is a specialized tool for determining the positions of hydrogen atoms. Neutrons are not diffracted by electrons, but are diffracted by atomic nuclei; accordingly, neutron scattering lengths of hydrogen and its isotopes are comparable to those of non-hydrogen atoms. Therefore, neutron crystallography can determine both of the locations and orientations of water molecules. This chapter describes the current status of neutron nucleic acid crystallographic research as well as the basic principles of neutron diffraction experiments performed on nucleic acid crystals: materials, crystallization, diffraction experiments, and structure determination. PMID:26227050

  4. Neutron Nucleic Acid Crystallography.

    PubMed

    Chatake, Toshiyuki

    2016-01-01

    The hydration shells surrounding nucleic acids and hydrogen-bonding networks involving water molecules and nucleic acids are essential interactions for the structural stability and function of nucleic acids. Water molecules in the hydration shells influence various conformations of DNA and RNA by specific hydrogen-bonding networks, which often contribute to the chemical reactivity and molecular recognition of nucleic acids. However, X-ray crystallography could not provide a complete description of structural information with respect to hydrogen bonds. Indeed, X-ray crystallography is a powerful tool for determining the locations of water molecules, i.e., the location of the oxygen atom of H2O; however, it is very difficult to determine the orientation of the water molecules, i.e., the orientation of the two hydrogen atoms of H2O, because X-ray scattering from the hydrogen atom is very small.Neutron crystallography is a specialized tool for determining the positions of hydrogen atoms. Neutrons are not diffracted by electrons, but are diffracted by atomic nuclei; accordingly, neutron scattering lengths of hydrogen and its isotopes are comparable to those of non-hydrogen atoms. Therefore, neutron crystallography can determine both of the locations and orientations of water molecules. This chapter describes the current status of neutron nucleic acid crystallographic research as well as the basic principles of neutron diffraction experiments performed on nucleic acid crystals: materials, crystallization, diffraction experiments, and structure determination.

  5. Utilization of acid tars

    SciTech Connect

    Frolov, A.F.; Denisova, T.L.; Aminov, A.N.

    1987-01-01

    Freshly produced acid tar (FPAT), obtained as refinery waste in treating petroleum oils with sulfuric acid and oleum, contains 80% or more sulfuric acid. Of such tars, pond acid tars, which contain up to 80% neutral petroleum products and sulfonated resins, are more stable, and have found applications in the production of binders for paving materials. In this article the authors are presenting results obtained in a study of the composition and reactivity of FPAT and its stability in storage in blends with asphalts obtained in deasphalting operations, and the possibility of using the FPAT in road construction has been examined. In this work, wastes were used which were obtained in treating the oils T-750, KhF-12, I-8A, and MS-14. Data on the change in group chemical composition of FPAT are shown, and the acidity, viscosity, needle penetration, and softening point of acid tars obtained from different grades of oils are plotted as functions of the storage time. It is also shown that the fresh and hardened FPATs differ in their solubilities in various solvents.

  6. Method for isolating nucleic acids

    SciTech Connect

    Hurt, Jr., Richard Ashley; Elias, Dwayne A.

    2015-09-29

    The current disclosure provides methods and kits for isolating nucleic acid from an environmental sample. The current methods and compositions further provide methods for isolating nucleic acids by reducing adsorption of nucleic acids by charged ions and particles within an environmental sample. The methods of the current disclosure provide methods for isolating nucleic acids by releasing adsorbed nucleic acids from charged particles during the nucleic acid isolation process. The current disclosure facilitates the isolation of nucleic acids of sufficient quality and quantity to enable one of ordinary skill in the art to utilize or analyze the isolated nucleic acids for a wide variety of applications including, sequencing or species population analysis.

  7. Acidification and Acid Rain

    NASA Astrophysics Data System (ADS)

    Norton, S. A.; Veselã½, J.

    2003-12-01

    Air pollution by acids has been known as a problem for centuries (Ducros, 1845; Smith, 1872; Camuffo, 1992; Brimblecombe, 1992). Only in the mid-1900s did it become clear that it was a problem for more than just industrially developed areas, and that precipitation quality can affect aquatic resources ( Gorham, 1955). The last three decades of the twentieth century saw tremendous progress in the documentation of the chemistry of the atmosphere, precipitation, and the systems impacted by acid atmospheric deposition. Chronic acidification of ecosystems results in chemical changes to soil and to surface waters and groundwater as a result of reduction of base cation supply or an increase in acid (H+) supply, or both. The most fundamental changes during chronic acidification are an increase in exchangeable H+ or Al3+ (aluminum) in soils, an increase in H+ activity (˜concentration) in water in contact with soil, and a decrease in alkalinity in waters draining watersheds. Water draining from the soil is acidified and has a lower pH (=-log [H+]). As systems acidify, their biotic community changes.Acidic surface waters occur in many parts of the world as a consequence of natural processes and also due to atmospheric deposition of strong acid (e.g., Canada, Jeffries et al. (1986); the United Kingdom, Evans and Monteith (2001); Sweden, Swedish Environmental Protection Board (1986); Finland, Forsius et al. (1990); Norway, Henriksen et al. (1988a); and the United States (USA), Brakke et al. (1988)). Concern over acidification in the temperate regions of the northern hemisphere has been driven by the potential for accelerating natural acidification by pollution of the atmosphere with acidic or acidifying compounds. Atmospheric pollution ( Figure 1) has resulted in an increased flux of acid to and through ecosystems. Depending on the ability of an ecosystem to neutralize the increased flux of acidity, acidification may increase only imperceptibly or be accelerated at a rate that

  8. Discovery of essential fatty acids

    PubMed Central

    Spector, Arthur A.; Kim, Hee-Yong

    2015-01-01

    Dietary fat was recognized as a good source of energy and fat-soluble vitamins by the first part of the 20th century, but fatty acids were not considered to be essential nutrients because they could be synthesized from dietary carbohydrate. This well-established view was challenged in 1929 by George and Mildred Burr who reported that dietary fatty acid was required to prevent a deficiency disease that occurred in rats fed a fat-free diet. They concluded that fatty acids were essential nutrients and showed that linoleic acid prevented the disease and is an essential fatty acid. The Burrs surmised that other unsaturated fatty acids were essential and subsequently demonstrated that linolenic acid, the omega-3 fatty acid analog of linoleic acid, is also an essential fatty acid. The discovery of essential fatty acids was a paradigm-changing finding, and it is now considered to be one of the landmark discoveries in lipid research. PMID:25339684

  9. Boric acid catalyzed chemoselective esterification of alpha-hydroxycarboxylic acids.

    PubMed

    Houston, Todd A; Wilkinson, Brendan L; Blanchfield, Joanne T

    2004-03-01

    Boric acid catalyzes the selective esterification of alpha-hydroxycarboxylic acids without causing significant esterification to occur with other carboxylic acids. The procedure is simple, high-yielding, and applicable to the esterification of alpha-hydroxy carboxylates in the presence of other carboxylic acids including beta-hydroxyacids within the same molecule. [reaction: see text

  10. Acid Rain, pH & Acidity: A Common Misinterpretation.

    ERIC Educational Resources Information Center

    Clark, David B.; Thompson, Ronald E.

    1989-01-01

    Illustrates the basis for misleading statements about the relationship between pH and acid content in acid rain. Explains why pH cannot be used as a measure of acidity for rain or any other solution. Suggests that teachers present acidity and pH as two separate and distinct concepts. (RT)

  11. Amino-acid contamination of aqueous hydrochloric acid.

    NASA Technical Reports Server (NTRS)

    Wolman, Y.; Miller, S. L.

    1971-01-01

    Considerable amino-acid contamination in commercially available analytical grade hydrochloric acid (37% HCl) was found. One bottle contained 8,300 nmol of amino-acids per liter. A bottle from another supplier contained 6,700 nmol per liter. The contaminants were mostly protein amino-acids and several unknowns. Data on the volatility of the amino-acids during HCl distillation were also obtained.

  12. Analysis of Bile Acids

    NASA Astrophysics Data System (ADS)

    Sjövall, Jan; Griffiths, William J.; Setchell, Kenneth D. R.; Mano, Nariyasu; Goto, Junichi

    Bile acids constitute a large family of steroids in vertebrates, normally formed from cholesterol and carrying a carboxyl group in a side-chain of variable length. Bile alcohols, also formed from cholesterol, have similar structures as bile acids, except for the absence of a carboxyl group in the steroid skeleton. The conversion of cholesterol to bile acids and/or bile alcohols is of major importance for maintenance of cholesterol homeostasis, both from quantitative and regulatory points of view (Chiang, 2004; Kalaany and Mangelsdorf, 2006; Moore, Kato, Xie, et al., 2006; Scotti, Gilardi, Godio, et al., 2007). Appropriately conjugated bile acids and bile alcohols (also referred to as bile salts) are secreted in bile and serve vital functions in the absorption of lipids and lipid-soluble compounds (Hofmann, 2007). Reliable analytical methods are required for studies of the functions and pathophysiological importance of the variety of bile acids and bile alcohols present in living organisms. When combined with genetic and proteomic studies, analysis of these small molecules (in today's terminology: metabolomics, steroidomics, sterolomics, cholanoidomics, etc.) will lead to a deeper understanding of the integrated metabolic processes in lipid metabolism.

  13. Optical high acidity sensor

    DOEpatents

    Jorgensen, B.S.; Nekimken, H.L.; Carey, W.P.; O`Rourke, P.E.

    1997-07-22

    An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber. 10 figs.

  14. Optical high acidity sensor

    DOEpatents

    Jorgensen, Betty S.; Nekimken, Howard L.; Carey, W. Patrick; O'Rourke, Patrick E.

    1997-01-01

    An apparatus and method for determining acid concentrations in solutions having acid concentrations of from about 0.1 Molar to about 16 Molar is disclosed. The apparatus includes a chamber for interrogation of the sample solution, a fiber optic light source for passing light transversely through the chamber, a fiber optic collector for receiving the collimated light after transmission through the chamber, a coating of an acid resistant polymeric composition upon at least one fiber end or lens, the polymeric composition in contact with the sample solution within the chamber and having a detectable response to acid concentrations within the range of from about 0.1 Molar to about 16 Molar, a measurer for the response of the polymeric composition in contact with the sample solution, and, a comparer of the measured response to predetermined standards whereby the acid molarity of the sample solution within the chamber can be determined. Preferably, a first lens is attached to the end of the fiber optic light source, the first lens adapted to collimate light from the fiber optic light source, and a second lens is attached to the end of the fiber optic collector for focusing the collimated light after transmission through the chamber.

  15. Acid sludge utilization

    SciTech Connect

    Suarez, M.

    1980-09-01

    The Peak Oil Company of Tampa, Florida, in cooperation with the United States Department of Energy, has completed an initial study for the incorporation of acid-sludge derived from the rerefining of used lubricating oil into a useful and salable building material. Both bricks and paving materials have been produced using a formulation developed by Peak. Equipment has been designed and constructed for the specific purpose of preparing emulsions containing the acid-sludge, which is a vital ingredient in the final formulation. Testing of products obtained from these initial efforts shows that the acid in the sludge has been effectively neutralized and that heavy metals are not leached from the bricks or paving material in normal testing. While some properties of the building materials that incorporate the acid-sludge by-product are below standards for clay and shale brick, uses are defined for the product as is, and there is some promise of eventual production of building materials that meet all specifications for competitive materials. Initial cost estimations are encouraging, indicating that a profit can be derived by converting a hazardous and noxious by-product of rerefining to a construction material. Acid-sludge has presented a complex and costly disposal problem to the industry resulting in a serious depletion in the capacity for rerefining used lubricating oil.

  16. Domoic acid epileptic disease.

    PubMed

    Ramsdell, John S; Gulland, Frances M

    2014-03-01

    Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid exposure. The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. The sea lion study provided a breadth of insight into clinical presentations, unusual behaviors, brain pathology, and epidemiology. A rat model that replicates key observations of the chronic epileptic syndrome in sea lions has been applied to identify the progression of the epileptic disease state, its relationship to behavioral manifestations, and to define the neural systems involved in these behavioral disorders. Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of knowledge for this disease state in affected humans and sea lions. We discuss causative mechanisms and neural underpinnings of disease maturation revealed by the rat model to present the concept for olfactory origin of an epileptic disease; triggered in dendodendritic synapases of the olfactory bulb and maturing in the olfactory cortex. We conclude with updated information on populations at risk, medical diagnosis, treatment, and prognosis. PMID:24663110

  17. Domoic Acid Epileptic Disease

    PubMed Central

    Ramsdell, John S.; Gulland, Frances M.

    2014-01-01

    Domoic acid epileptic disease is characterized by spontaneous recurrent seizures weeks to months after domoic acid exposure. The potential for this disease was first recognized in a human case study of temporal lobe epilepsy after the 1987 amnesic shellfish-poisoning event in Quebec, and was characterized as a chronic epileptic syndrome in California sea lions through investigation of a series of domoic acid poisoning cases between 1998 and 2006. The sea lion study provided a breadth of insight into clinical presentations, unusual behaviors, brain pathology, and epidemiology. A rat model that replicates key observations of the chronic epileptic syndrome in sea lions has been applied to identify the progression of the epileptic disease state, its relationship to behavioral manifestations, and to define the neural systems involved in these behavioral disorders. Here, we present the concept of domoic acid epileptic disease as a delayed manifestation of domoic acid poisoning and review the state of knowledge for this disease state in affected humans and sea lions. We discuss causative mechanisms and neural underpinnings of disease maturation revealed by the rat model to present the concept for olfactory origin of an epileptic disease; triggered in dendodendritic synapases of the olfactory bulb and maturing in the olfactory cortex. We conclude with updated information on populations at risk, medical diagnosis, treatment, and prognosis. PMID:24663110

  18. A Demonstration of Acid Rain

    ERIC Educational Resources Information Center

    Fong, Man Wai

    2004-01-01

    A demonstration showing acid rain formation is described. Oxides of sulfur and nitrogen that result from the burning of fossil fuels are the major pollutants of acid rain. In this demonstration, SO[subscript 2] gas is produced by the burning of matches. An acid-base indicator will show that the dissolved gas turns an aqueous solution acidic.

  19. DOCOSAHEXAENOIC ACID AND ARACHIDONIC ACID PREVENT ESSENTIAL FATTY ACID DEFICIENCY AND HEPATIC STEATOSIS

    PubMed Central

    Le, Hau D.; Meisel, Jonathan A.; de Meijer, Vincent E.; Fallon, Erica M.; Gura, Kathleen M.; Nose, Vania; Bistrian, Bruce R.; Puder, Mark

    2012-01-01

    Objectives Essential fatty acids are important for growth, development, and physiologic function. Alpha-linolenic acid and linoleic acid are the precursors of docosahexaenoic and arachidonic acid, respectively, and have traditionally been considered the essential fatty acids. However, we hypothesized that docosahexaenoic acid and arachidonic acid can function as the essential fatty acids. Methods Using a murine model of essential fatty acid deficiency and consequent hepatic steatosis, we provided mice with varying amounts of docosahexaenoic and arachidonic acids to determine whether exclusive supplementation of docosahexaenoic and arachidonic acids could prevent essential fatty acid deficiency and inhibit or attenuate hepatic steatosis. Results Mice supplemented with docosahexaenoic and arachidonic acids at 2.1% or 4.2% of their calories for 19 days had normal liver histology and no biochemical evidence of essential fatty acid deficiency, which persisted when observed after 9 weeks. Conclusion Supplementation of sufficient amounts of docosahexaenoic and arachidonic acids alone without alpha-linolenic and linoleic acids meets essential fatty acid requirements and prevents hepatic steatosis in a murine model. PMID:22038210

  20. Biodegradation of cyanuric acid.

    PubMed

    Saldick, J

    1974-12-01

    Cyanuric acid biodegrades readily under a wide variety of natural conditions, and particularly well in systems of either low or zero dissolved-oxygen level, such as anaerobic activated sludge and sewage, soils, muds, and muddy streams and river waters, as well as ordinary aerated activated sludge systems with typically low (1 to 3 ppm) dissolved-oxygen levels. Degradation also proceeds in 3.5% sodium chloride solution. Consequently, there are degradation pathways widely available for breaking down cyanuric acid discharged in domestic effluents. The overall degradation reaction is merely a hydrolysis; CO(2) and ammonia are the initial hydrolytic breakdown products. Since no net oxidation occurs during this breakdown, biodegradation of cyanuric acid exerts no primary biological oxygen demand. However, eventual nitrification of the ammonia released will exert its usual biological oxygen demand.

  1. Exposures to acidic aerosols.

    PubMed

    Spengler, J D; Keeler, G J; Koutrakis, P; Ryan, P B; Raizenne, M; Franklin, C A

    1989-02-01

    Ambient monitoring of acid aerosols in four U.S. cities and in a rural region of southern Ontario clearly show distinct periods of strong acidity. Measurements made in Kingston, TN, and Steubenville, OH, resulted in 24-hr H+ ion concentrations exceeding 100 nmole/m3 more than 10 times during summer months. Periods of elevated acidic aerosols occur less frequently in winter months. The H+ determined during episodic conditions in southern Ontario indicates that respiratory tract deposition can exceed the effects level reported in clinical studies. Observed 12-hr H+ concentrations exceeded 550 nmole/m3 (approximately 27 micrograms/m3 H2SO4). The maximum estimated 1-hr concentration exceeded 1500 nmole/m3 for H+ ions. At these concentrations, an active child might receive more than 2000 nmole of H+ ion in 12 hr and in excess of 900 nmole during the hour when H2SO4 exceeded 50 micrograms/m3.

  2. Biodegradation of Cyanuric Acid

    PubMed Central

    Saldick, Jerome

    1974-01-01

    Cyanuric acid biodegrades readily under a wide variety of natural conditions, and particularly well in systems of either low or zero dissolved-oxygen level, such as anaerobic activated sludge and sewage, soils, muds, and muddy streams and river waters, as well as ordinary aerated activated sludge systems with typically low (1 to 3 ppm) dissolved-oxygen levels. Degradation also proceeds in 3.5% sodium chloride solution. Consequently, there are degradation pathways widely available for breaking down cyanuric acid discharged in domestic effluents. The overall degradation reaction is merely a hydrolysis; CO2 and ammonia are the initial hydrolytic breakdown products. Since no net oxidation occurs during this breakdown, biodegradation of cyanuric acid exerts no primary biological oxygen demand. However, eventual nitrification of the ammonia released will exert its usual biological oxygen demand. PMID:4451360

  3. Calorimetry of Nucleic Acids.

    PubMed

    Rozners, Eriks; Pilch, Daniel S; Egli, Martin

    2015-12-01

    This unit describes the application of calorimetry to characterize the thermodynamics of nucleic acids, specifically, the two major calorimetric methodologies that are currently employed: differential scanning (DSC) and isothermal titration calorimetry (ITC). DSC is used to study thermally induced order-disorder transitions in nucleic acids. A DSC instrument measures, as a function of temperature (T), the excess heat capacity (C(p)(ex)) of a nucleic acid solution relative to the same amount of buffer solution. From a single curve of C(p)(ex) versus T, one can derive the following information: the transition enthalpy (ΔH), entropy (ΔS), free energy (ΔG), and heat capacity (ΔCp); the state of the transition (two-state versus multistate); and the average size of the molecule that melts as a single thermodynamic entity (e.g., the duplex). ITC is used to study the hybridization of nucleic acid molecules at constant temperature. In an ITC experiment, small aliquots of a titrant nucleic acid solution (strand 1) are added to an analyte nucleic acid solution (strand 2), and the released heat is monitored. ITC yields the stoichiometry of the association reaction (n), the enthalpy of association (ΔH), the equilibrium association constant (K), and thus the free energy of association (ΔG). Once ΔH and ΔG are known, ΔS can also be derived. Repetition of the ITC experiment at a number of different temperatures yields the ΔCp for the association reaction from the temperature dependence of ΔH.

  4. Acid rain in Asia

    NASA Astrophysics Data System (ADS)

    Bhatti, Neeloo; Streets, David G.; Foell, Wesley K.

    1992-07-01

    Acid rain has been an issue of great concern in North America and Europe during the past several decades. However, due to the passage of a number of recent regulations, most notably the Clean Air Act in the United States in 1990, there is an emerging perception that the problem in these Western nations is nearing solution. The situation in the developing world, particularly in Asia, is much bleaker. Given the policies of many Asian nations to achieve levels of development comparable with the industrialized world—which necessitate a significant expansion of energy consumption (most derived from indigenous coal reserves)—the potential for the formation of, and damage from, acid deposition in these developing countries is very high. This article delineates and assesses the emissions patterns, meteorology, physical geology, and biological and cultural resources present in various Asian nations. Based on this analysis and the risk factors to acidification, it is concluded that a number of areas in Asia are currently vulnerable to acid rain. These regions include Japan, North and South Korea, southern China, and the mountainous portions of Southeast Asia and southwestern India. Furthermore, with accelerated development (and its attendant increase in energy use and production of emissions of acid deposition precursors) in many nations of Asia, it is likely that other regions will also be affected by acidification in the near future. Based on the results of this overview, it is clear that acid deposition has significant potential to impact the Asian region. However, empirical evidence is urgently needed to confirm this and to provide early warning of increases in the magnitude and spread of acid deposition and its effects throughout this part of the world.

  5. Acid Precipitation; (USA)

    SciTech Connect

    Rushing, J.W.; Hicks, S.C.

    1991-01-01

    This publication, Acid Precipitation (APC) announces on a monthly basis the current worldwide information on acid precipitation and closely related subjects, including wet and dry deposition, long-range transport, environmental effects, modeling, and socioeconomic factors. Information on the following subjects is included within the scope of this publication, but all subjects may not appear in each issue: Pollution sources and pollution control technology; atmospheric transport and chemistry; terrestrial transport and chemistry; aquatic transport and chemistry; biological effects; corrosive effects; and socioeconomics, policy, and legislation.

  6. Whither acid rain?

    PubMed

    Brimblecombe, P

    2001-04-01

    Acid rain, the environmental cause célèbre of the 1980s seems to have vanished from popular conscience. By contrast, scientific research, despite funding difficulties, has continued to produce hundreds of research papers each year. Studies of acid rain taught much about precipitation chemistry, the behaviour of snow packs, long-range transport of pollutants and new issues in the biology of fish and forested ecosystems. There is now evidence of a shift away from research in precipitation and sulfur chemistry, but an impressive theoretical base remains as a legacy.

  7. NITRIC ACID PICKLING PROCESS

    DOEpatents

    Boller, E.R.; Eubank, L.D.

    1958-08-19

    An improved process is described for the treatment of metallic uranium surfaces preparatory to being given hot dip coatings. The process consists in first pickling the uraniunn surInce with aqueous 50% to 70% nitric acid, at 60 to 70 deg C, for about 5 minutes, rinsing the acid solution from the uranium article, promptly drying and then passing it through a molten alkali-metal halide flux consisting of 42% LiCl, 53% KCla and 5% NaCl into a molten metal bath consisting of 85 parts by weight of zinc and 15 parts by weight of aluminum

  8. Fatty acids of Thiobacillus thiooxidans.

    PubMed

    Levin, R A

    1971-12-01

    Fatty acid spectra were made on Thiobacillus thiooxidans cultures both in the presence and absence of organic compounds. Small additions of glucose or acetate had no significant effect either on growth or fatty acid content. The addition of biotin had no stimulatory effect but did result in slight quantitative changes in the fatty acid spectrum. The predominant fatty acid was a C(19) cyclopropane acid.

  9. Fatty Acids of Thiobacillus thiooxidans

    PubMed Central

    Levin, Richard A.

    1971-01-01

    Fatty acid spectra were made on Thiobacillus thiooxidans cultures both in the presence and absence of organic compounds. Small additions of glucose or acetate had no significant effect either on growth or fatty acid content. The addition of biotin had no stimulatory effect but did result in slight quantitative changes in the fatty acid spectrum. The predominant fatty acid was a C19 cyclopropane acid. PMID:4945206

  10. The Acid-Base Titration of a Very Weak Acid: Boric Acid

    ERIC Educational Resources Information Center

    Celeste, M.; Azevedo, C.; Cavaleiro, Ana M. V.

    2012-01-01

    A laboratory experiment based on the titration of boric acid with strong base in the presence of d-mannitol is described. Boric acid is a very weak acid and direct titration with NaOH is not possible. An auxiliary reagent that contributes to the release of protons in a known stoichiometry facilitates the acid-base titration. Students obtain the…

  11. Lactic acid bacterial cell factories for gamma-aminobutyric acid.

    PubMed

    Li, Haixing; Cao, Yusheng

    2010-11-01

    Gamma-aminobutyric acid is a non-protein amino acid that is widely present in organisms. Several important physiological functions of gamma-aminobutyric acid have been characterized, such as neurotransmission, induction of hypotension, diuretic effects, and tranquilizer effects. Many microorganisms can produce gamma-aminobutyric acid including bacteria, fungi and yeasts. Among them, gamma-aminobutyric acid-producing lactic acid bacteria have been a focus of research in recent years, because lactic acid bacteria possess special physiological activities and are generally regarded as safe. They have been extensively used in food industry. The production of lactic acid bacterial gamma-aminobutyric acid is safe and eco-friendly, and this provides the possibility of production of new naturally fermented health-oriented products enriched in gamma-aminobutyric acid. The gamma-aminobutyric acid-producing species of lactic acid bacteria and their isolation sources, the methods for screening of the strains and increasing their production, the enzymatic properties of glutamate decarboxylases and the relative fundamental research are reviewed in this article. And the potential applications of gamma-aminobutyric acid-producing lactic acid bacteria were also referred to.

  12. Comparison of Buffer Effect of Different Acids During Sandstone Acidizing

    NASA Astrophysics Data System (ADS)

    Umer Shafiq, Mian; Khaled Ben Mahmud, Hisham; Hamid, Mohamed Ali

    2015-04-01

    The most important concern of sandstone matrix acidizing is to increase the formation permeability by removing the silica particles. To accomplish this, the mud acid (HF: HCl) has been utilized successfully for many years to stimulate the sandstone formations, but still it has many complexities. This paper presents the results of laboratory investigations of different acid combinations (HF: HCl, HF: H3PO4 and HF: HCOOH). Hydrofluoric acid and fluoboric acid are used to dissolve clays and feldspar. Phosphoric and formic acids are added as a buffer to maintain the pH of the solution; also it allows the maximum penetration of acid into the core sample. Different tests have been performed on the core samples before and after the acidizing to do the comparative study on the buffer effect of these acids. The analysis consists of permeability, porosity, color change and pH value tests. There is more increase in permeability and porosity while less change in pH when phosphoric and formic acids were used compared to mud acid. From these results it has been found that the buffer effect of phosphoric acid and formic acid is better than hydrochloric acid.

  13. [Studies on interaction of acid-treated nanotube titanic acid and amino acids].

    PubMed

    Zhang, Huqin; Chen, Xuemei; Jin, Zhensheng; Liao, Guangxi; Wu, Xiaoming; Du, Jianqiang; Cao, Xiang

    2010-06-01

    Nanotube titanic acid (NTA) has distinct optical and electrical character, and has photocatalysis character. In accordance with these qualities, NTA was treated with acid so as to enhance its surface activity. Surface structures and surface groups of acid-treated NTA were characterized and analyzed by Transmission Electron Microscope (TEM) and Fourier Transform Infrared Spectrometry (FT-IR). The interaction between acid-treated NTA and amino acids was investigated. Analysis results showed that the lengths of acid-treated NTA became obviously shorter. The diameters of nanotube bundles did not change obviously with acid-treating. Meanwhile, the surface of acid-treated NTA was cross-linked with carboxyl or esterfunction. In addition, acid-treated NTA can catch amino acid residues easily, and then form close combination.

  14. Docosahexaenoic acid and lactation

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Docosahexaenoic acid (DHA) is an important component of membrane phospholipids in the retina, and brain, and accumulates rapidly in these tissues during early infancy. DHA is present in human milk, but the amount varies considerably and is largely dependent on maternal diet. This article reviews dat...

  15. Orphenadrinium picrate picric acid

    PubMed Central

    Fun, Hoong-Kun; Hemamalini, Madhukar; Siddaraju, B. P.; Yathirajan, H. S.; Narayana, B.

    2010-01-01

    The asymmetric unit of the title compound N,N-dimethyl-2-[(2-methyl­phen­yl)phenyl­meth­oxy]ethanaminium picrate picric acid, C18H24NO+·C6H2N3O7 −·C6H3N3O7, contains one orphenadrinium cation, one picrate anion and one picric acid mol­ecule. In the orphenadrine cation, the two aromatic rings form a dihedral angle of 70.30 (7)°. There is an intra­molecular O—H⋯O hydrogen bond in the picric acid mol­ecule, which generates an S(6) ring motif. In the crystal structure, the orphenadrine cations, picrate anions and picric acid mol­ecules are connected by strong inter­molecular N—H⋯O hydrogen bonds, π⋯π inter­actions between the benzene rings of cations and anions [centroid–centroid distance = 3.5603 (9) Å] and weak C—H⋯O hydrogen bonds, forming a three-dimensional network. PMID:21580426

  16. Acid Rain Investigations.

    ERIC Educational Resources Information Center

    Hugo, John C.

    1992-01-01

    Presents an activity in which students investigate the formation of solid ammonium chloride aerosol particles to help students better understand the concept of acid rain. Provides activity objectives, procedures, sample data, clean-up instructions, and questions and answers to help interpret the data. (MDH)

  17. The Acid Rain Debate.

    ERIC Educational Resources Information Center

    Oates-Bockenstedt, Catherine

    1997-01-01

    Details an activity designed to motivate students by incorporating science-related issues into a classroom debate. Includes "The Acid Rain Bill" and "Position Guides" for student roles as committee members, consumers, governors, industry owners, tourism professionals, senators, and debate directors. (DKM)

  18. Acid rain bibliography

    SciTech Connect

    Sayers, C.S.

    1983-09-01

    This bibliography identifies 900 citations on various aspects of Acid Rain, covering published bibliographies, books, reports, conference and symposium proceedings, audio visual materials, pamphlets and newsletters. It includes five sections: citations index (complete record of author, title, source, order number); KWIC index; title index; author index; and source index. 900 references.

  19. Acid Rain Classroom Projects.

    ERIC Educational Resources Information Center

    Demchik, Michael J.

    2000-01-01

    Describes a curriculum plan in which students learn about acid rain through instructional media, research and class presentations, lab activities, simulations, design, and design implementation. Describes the simulation activity in detail and includes materials, procedures, instructions, examples, results, and discussion sections. (SAH)

  20. The Acid Rain Debate.

    ERIC Educational Resources Information Center

    Bybee, Rodger; And Others

    1984-01-01

    Describes an activity which provides opportunities for role-playing as industrialists, ecologists, and government officials. The activity involves forming an international commission on acid rain, taking testimony, and, based on the testimony, making recommendations to governments on specific ways to solve the problem. Includes suggestions for…

  1. The Acid Rain Game.

    ERIC Educational Resources Information Center

    Rakow, Steven J.; Glenn, Allen

    1982-01-01

    Provides rationale for and description of an acid rain game (designed for two players), a problem-solving model for elementary students. Although complete instructions are provided, including a copy of the game board, the game is also available for Apple II microcomputers. Information for the computer program is available from the author.…

  2. Targeting tumor acidity

    NASA Astrophysics Data System (ADS)

    Reshetnyak, Yana K.; Engelman, Donald M.; Andreev, Oleg A.

    2012-02-01

    One of the main features of solid tumors is extracellular acidity, which correlates with tumor aggressiveness and metastatic potential. We introduced novel approach in targeting of acidic tumors, and translocation of cell-impermeable cargo molecules across cellular membrane. Our approach is based on main principle of insertion and folding of a polypeptide in lipid bilayer of membrane. We have identified family of pH Low Insertion Peptides (pHLIPs), which are capable spontaneous insertion and folding in membrane at mild acidic conditions. The affinity of peptides of pHLIP family to membrane at low pH is several times higher than at neutral pH. The process of peptides folding occurs within milliseconds. The energy released in a result of folding (about 2 kcal/mol) could be used to move polar cargo across a membrane, which is a novel concept in drug delivery. pHLIP peptides could be considered as a pH-sensitive single peptide molecular transporters and conjugated with imaging probes for fluorescence, MR, PET and SPECT imaging, they represent a novel in vivo marker of acidity. The work is supported by NIH grants CA133890 and GM073857 to OAA, DME, YRK.

  3. Spermatotoxicity of dichloroacetic acid

    EPA Science Inventory

    The testicular toxicity of dichloroacetic acid (DCA), a disinfection byproduct of drinking water, was evaluated in adult male rats given both single and multiple (up to 14 d) oral doses. Delayed spermiation and altered resorption of residual bodies were observed in rats given sin...

  4. Plant fatty acid hydroxylase

    DOEpatents

    Somerville, Chris; van de Loo, Frank

    2000-01-01

    The present invention relates to the identification of nucleic acid sequences and constructs, and methods related thereto, and the use of these sequences and constructs to produce genetically modified plants for the purpose of altering the composition of plant oils, waxes and related compounds.

  5. Alkyl phosphonic acids and sulfonic acids in the Murchison meteorite

    NASA Technical Reports Server (NTRS)

    Cooper, George W.; Onwo, Wilfred M.; Cronin, John R.

    1992-01-01

    Homologous series of alkyl phosphonic acids and alkyl sulfonic acids, along with inorganic orthophosphate and sulfate, are identified in water extracts of the Murchison meteorite after conversion to their t-butyl dimethylsilyl derivatives. The methyl, ethyl, propyl, and butyl compounds are observed in both series. Five of the eight possible alkyl phosphonic acids and seven of the eight possible alkyl sulfonic acids through C4 are identified. Abundances decrease with increasing carbon number as observed of other homologous series indigenous to Murchison. Concentrations range downward from approximately 380 nmol/gram in the alkyl sulfonic acid series, and from 9 nmol/gram in the alkyl phosphonic acid series.

  6. A nucleic acid dependent chemical photocatalysis in live human cells.

    PubMed

    Arian, Dumitru; Cló, Emiliano; Gothelf, Kurt V; Mokhir, Andriy

    2010-01-01

    Only two nucleic acid directed chemical reactions that are compatible with live cells have been reported to date. Neither of these processes generate toxic species from nontoxic starting materials. Reactions of the latter type could be applied as gene-specific drugs, for example, in the treatment of cancer. We report here the first example of a chemical reaction that generates a cytotoxic drug from a nontoxic prodrug in the presence of a specific endogeneous ribonucleic acid in live mammalian cells. In this case, the prodrug is triplet oxygen and the drug is singlet oxygen. The key component of this reaction is an inert molecule (InP-2'-OMe-RNA/Q-2'-OMe-RNA; P: photosensitizer; Q: quencher), which becomes an active photosensitizer (InP-2'-OMe-RNA) in the presence of single-stranded nucleic acid targets. Upon irradiation with red light, the photosensitizer produces over 6000 equivalents of toxic singlet oxygen per nucleic acid target. This reaction is highly sequence specific. To detect the generation of singlet oxygen in live cells, we prepared a membrane-permeable and water-soluble fluorescent scavenger, a derivative of 2,5-diphenylisobenzofurane. The scavenger decomposes upon reaction with singlet oxygen and this is manifested in a decrease in the fluorescence intensity. This effect can be conveniently monitored by flow cytometry.

  7. A Direct, Biomass-Based Synthesis of Benzoic Acid: Formic Acid-Mediated Deoxygenation of the Glucose-Derived Materials Quinic Acid and Shikimic Acid

    SciTech Connect

    Arceo, Elena; Ellman, Jonathan; Bergman, Robert

    2010-05-03

    An alternative biomass-based route to benzoic acid from the renewable starting materials quinic acid and shikimic acid is described. Benzoic acid is obtained selectively using a highly efficient, one-step formic acid-mediated deoxygenation method.

  8. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by...

  9. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by...

  10. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid as... sulfuric acid or hydrochloric acid as impurities, when offered for transportation or transported by...

  11. Synthesis of acid addition salt of delta-aminolevulinic acid from 5-bromo levulinic acid esters

    DOEpatents

    Moens, Luc

    2003-06-24

    A process of preparing an acid addition salt of delta-aminolevulinc acid comprising: a) dissolving a lower alkyl 5-bromolevulinate and hexamethylenetetramine in a solvent selected from the group consisting of water, ethyl acetate, chloroform, acetone, ethanol, tetrahydrofuran and acetonitrile, to form a quaternary ammonium salt of the lower alkyl 5-bromolevulinate; and b) hydrolyzing the quaternary ammonium salt with an inorganic acid to form an acid addition salt of delta-aminolevulinic acid.

  12. Photostabilization of ascorbic acid with citric acid, tartaric acid and boric acid in cream formulations.

    PubMed

    Ahmad, I; Ali Sheraz, M; Ahmed, S; Shad, Z; Vaid, F H M

    2012-06-01

    This study involves the evaluation of the effect of certain stabilizers, that is, citric acid (CT), tartaric acid (TA) and boric acid (BA) on the degradation of ascorbic acid (AH(2) ) in oil-in-water cream formulations exposed to the UV light and stored in the dark. The apparent first-order rate constants (0.34-0.95 × 10(-3) min(-1) in light, 0.38-1.24 × 10(-2) day(-1) in dark) for the degradation reactions in the presence of the stabilizers have been determined. These rate constants have been used to derive the second-order rate constants (0.26-1.45 × 10(-2) M(-1) min(-1) in light, 3.75-8.50 × 10(-3) M(-1) day(-1) in dark) for the interaction of AH(2) and the individual stabilizers. These stabilizers are effective in causing the inhibition of the rate of degradation of AH(2) both in the light and in the dark. The inhibitory effect of the stabilizers is in the order of CT > TA > BA. The rate of degradation of AH(2) in the presence of these stabilizers in the light is about 120 times higher than that in the dark. This could be explained on the basis of the deactivation of AH(2) -excited triplet state by CT and TA and by the inhibition of AH(2) degradation through complex formation with BA. AH(2) leads to the formation of dehydroascorbic acid (A) by chemical and photooxidation in cream formulations.

  13. Fatty acid-producing hosts

    DOEpatents

    Pfleger, Brian F; Lennen, Rebecca M

    2013-12-31

    Described are hosts for overproducing a fatty acid product such as a fatty acid. The hosts include an exogenous nucleic acid encoding a thioesterase and, optionally, an exogenous nucleic acid encoding an acetyl-CoA carboxylase, wherein an acyl-CoA synthetase in the hosts are functionally delected. The hosts prefereably include the nucleic acid encoding the thioesterase at an intermediate copy number. The hosts are preferably recominantly stable and growth-competent at 37.degree. C. Methods of producing a fatty acid product comprising culturing such hosts at 37.degree. C. are also described.

  14. Acid diffusion through polyaniline membranes

    SciTech Connect

    Su, T.M.; Huang, S.C.; Conklin, J.A.

    1995-12-01

    Polyaniline membranes in the undoped (base) and doped (acid) forms are studied for their utility as pervaporation membranes. The separation of water from mixtures of propionic acid, acetic acid and formic acid have been demonstrated from various feed compositions. Doped polyaniline displays an enhanced selectivity of water over these organic acids as compared with undoped polyaniline. For as-cast polyaniline membranes a diffusion coefficient (D) on the order of 10{sup -9} cm{sup 2}/sec has been determined for the flux of protons through the membranes using hydrochloric acid.

  15. The Prebiotic Synthesis of Ethylenediamine Monoacetic Acid, The Repeating Unit of Peptide Nucleic Acids

    NASA Technical Reports Server (NTRS)

    Nelson, Kevin E.; Miller, Stanley L.

    1992-01-01

    The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or

  16. Treatment of Bile Acid Amidation Defects with Glycocholic Acid

    PubMed Central

    Heubi, James E.; Setchell, Kenneth D.R.; Jha, Pinky; Buckley, Donna; Zhang, Wujuan; Rosenthal, Philip; Potter, Carol; Horslen, Simon; Suskind, David

    2014-01-01

    Bile acid amidation defects were predicted to present with fat/fat soluble vitamin malabsorption with minimal cholestasis. We identified and treated 5 patients (1 male/4 females) from 4 families with defective bile acid amidation due to a genetically confirmed deficiency in bile acid CoA:amino acid N-acyl transferase (BAAT) with the conjugated bile acid, glycocholic acid (GCA). Fast atom bombardment-mass spectrometry analysis of urine and bile at baseline revealed predominantly unconjugated cholic acid and absence of the usual glycine and taurine conjugated primary bile acids. Treatment with 15 mg/kg GCA resulted in total duodenal bile acid concentrations of 23.3 ± 19.1 mmol/L (mean ± SD) and 63.5 ± 4.0% of the bile acids were secreted in bile in the conjugated form of which GCA represented 59.6 ± 9.3% of the total biliary bile acids. Unconjugated cholic acid continued to be present in high concentrations in bile because of partial intestinal deconjugation of orally administered GCA. Serum total bile acid concentrations did not significantly differ between pretreatment and post-treatment samples and serum contained predominantly unconjugated cholic acid. These findings confirmed efficient intestinal absorption, hepatic extraction and biliary secretion of the administered GCA. Oral tolerance tests for vitamin D2 (1000 IU vitamin D2/kg) and tocopherol (100 IU/kg tocopherol acetate) demonstrated improvement in fat-soluble vitamin absorption after GCA treatment. Growth improved in 3/3 growth-delayed prepubertal patients. Conclusions: Oral glycocholic acid therapy is safe and effective in improving growth and fat-soluble vitamin absorption in children and adolescents with inborn errors of bile acid metabolism due to amidation defects. PMID:25163551

  17. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  18. NAPAP (National Acid Precipitation Assessment Program) results on acid rain

    SciTech Connect

    Not Available

    1990-06-01

    The National Acid Precipitation Assessment Program (NAPAP) was mandated by Congress in 1980 to study the effects of acid rain. The results of 10 years of research on the effect of acid deposition and ozone on forests, particularly high elevation spruce and fir, southern pines, eastern hardwoods and western conifers, will be published this year.

  19. Acid Earth--The Global Threat of Acid Pollution.

    ERIC Educational Resources Information Center

    McCormick, John

    Acid pollution is a major international problem, but the debate it has elicited has often clouded the distinction between myth and facts. This publication attempts to concerning the acid pollution situation. This publication attempts to identify available facts. It is the first global review of the problem of acid pollution and the first to…

  20. Usnic acid controls the acidity tolerance of lichens.

    PubMed

    Hauck, Markus; Jürgens, Sascha-René

    2008-11-01

    The hypotheses were tested that, firstly, lichens producing the dibenzofuran usnic acid colonize substrates characterized by specific pH ranges, secondly, this preferred pH is in a range where soluble usnic acid and its corresponding anion occur in similar concentrations, and thirdly, usnic acid makes lichens vulnerable to acidity. Lichens with usnic acid prefer an ambient pH range between 3.5 and 5.5 with an optimum between 4.0 and 4.5. This optimum is close to the pK(a1) value of usnic acid of 4.4. Below this optimum pH, dissolved SO(2) reduces the chlorophyll fluorescence yield more in lichens with than without their natural content of usnic acid. This suggests that usnic acid influences the acidity tolerance of lichens. The putative mechanism of the limited acidity tolerance of usnic acid-containing lichens is the acidification of the cytosol by molecules of protonated usnic acid shuttling protons through the plasma membrane at an apoplastic pH

  1. College Chemistry Students' Mental Models of Acids and Acid Strength

    ERIC Educational Resources Information Center

    McClary, LaKeisha; Talanquer, Vicente

    2011-01-01

    The central goal of this study was to characterize the mental models of acids and acid strength expressed by advanced college chemistry students when engaged in prediction, explanation, and justification tasks that asked them to rank chemical compounds based on their relative acid strength. For that purpose we completed a qualitative research…

  2. Acid hydrolysis of cellulose

    SciTech Connect

    Salazar, H.

    1980-12-01

    One of the alternatives to increase world production of etha nol is by the hydrolysis of cellulose content of agricultural residues. Studies have been made on the types of hydrolysis: enzimatic and acid. Data obtained from the sulphuric acid hydrolysis of cellulose showed that this process proceed in two steps, with a yield of approximately 95% glucose. Because of increases in cost of alternatives resources, the high demand of the product and the more economic production of ethanol from cellulose materials, it is certain that this technology will be implemented in the future. At the same time further studies on the disposal and reuse of the by-products of this production must be undertaken.

  3. [Progress in glucaric acid].

    PubMed

    Qiu, Yuying; Fang, Fang; Du, Guocheng; Chen, Jian

    2015-04-01

    Glucaric acid (GA) is derived from glucose and commonly used in chemical industry. It is also considered as one of the "Top value-added chemicals from biomass" as carbohydrate monomers to produce various synthetic polymers and bioenergy. The demand for GA in food manufacture is increasing. GA has also attracted public attentions due to its therapeutic uses such as regulating hormones, increasing the immune function and reducing the risks of cancers. Currently GA is produced by chemical oxidation. Research on production of GA via microbial synthesis is still at preliminary stage. We reviewed the advances of glucaric acid applications, preparation and quantification methods. The prospects on production of GA by microbial fermentation were also discussed. PMID:26380405

  4. Eucomic acid methanol monosolvate

    PubMed Central

    Li, Guo-Qiang; Li, Yao-Lan; Wang, Guo-Cai; Liang, Zhi-Hong; Jiang, Ren-Wang

    2011-01-01

    In the crystal structure of the title compound [systematic name: 2-hy­droxy-2-(4-hy­droxy­benz­yl)butane­dioic acid methanol monosolvate], C11H12O6·CH3OH, the dihedral angles between the planes of the carboxyl groups and the benzene ring are 51.23 (9) and 87.97 (9)°. Inter­molecular O—H⋯O hydrogen-bonding inter­actions involving the hy­droxy and carb­oxy­lic acid groups and the methanol solvent mol­ecule give a three-dimensional structure. PMID:22091200

  5. Industrial ecotoxicology "acid rain".

    PubMed

    Astolfi, E; Gotelli, C; Higa, J

    1986-01-01

    The acid rain phenomenon was studied in the province of Cordoba, Argentina. This study, based on a previously outlined framework, determined the anthropogenic origin of the low pH due to the presence of industrial hydrochloric acid wastage. This industrial ecotoxicological phenomenon seriously affected the forest wealth, causing a great defoliation of trees and shrubs, with a lower effect on crops. A survey on its effects on human beings has not been carried out, but considering the corrosion caused to different metals and its denouncing biocide effect on plants and animals, we should expect to find some kind of harm to the health of the workers involved or others engaged in farming, and even to those who are far away from the polluting agent. PMID:3758667

  6. Industrial ecotoxicology "acid rain".

    PubMed

    Astolfi, E; Gotelli, C; Higa, J

    1986-01-01

    The acid rain phenomenon was studied in the province of Cordoba, Argentina. This study, based on a previously outlined framework, determined the anthropogenic origin of the low pH due to the presence of industrial hydrochloric acid wastage. This industrial ecotoxicological phenomenon seriously affected the forest wealth, causing a great defoliation of trees and shrubs, with a lower effect on crops. A survey on its effects on human beings has not been carried out, but considering the corrosion caused to different metals and its denouncing biocide effect on plants and animals, we should expect to find some kind of harm to the health of the workers involved or others engaged in farming, and even to those who are far away from the polluting agent.

  7. (Radioiodinated free fatty acids)

    SciTech Connect

    Knapp, Jr., F. F.

    1987-12-11

    The traveler participated in the Second International Workshop on Radioiodinated Free Fatty Acids in Amsterdam, The Netherlands where he presented an invited paper describing the pioneering work at the Oak Ridge National Laboratory (ORNL) involving the design, development and testing of new radioiodinated methyl-branched fatty acids for evaluation of heart disease. He also chaired a technical session on the testing of new agents in various in vitro and in vivo systems. He also visited the Institute for Clinical and Experimental Nuclear Medicine in Bonn, West Germany, to review, discuss, plan and coordinate collaborative investigations with that institution. In addition, he visited the Cyclotron Research Center in Liege, Belgium, to discuss continuing collaborative studies with the Osmium-191/Iridium-191m radionuclide generator system, and to complete manuscripts and plan future studies.

  8. Immunomodulatory spherical nucleic acids.

    PubMed

    Radovic-Moreno, Aleksandar F; Chernyak, Natalia; Mader, Christopher C; Nallagatla, Subbarao; Kang, Richard S; Hao, Liangliang; Walker, David A; Halo, Tiffany L; Merkel, Timothy J; Rische, Clayton H; Anantatmula, Sagar; Burkhart, Merideth; Mirkin, Chad A; Gryaznov, Sergei M

    2015-03-31

    Immunomodulatory nucleic acids have extraordinary promise for treating disease, yet clinical progress has been limited by a lack of tools to safely increase activity in patients. Immunomodulatory nucleic acids act by agonizing or antagonizing endosomal toll-like receptors (TLR3, TLR7/8, and TLR9), proteins involved in innate immune signaling. Immunomodulatory spherical nucleic acids (SNAs) that stimulate (immunostimulatory, IS-SNA) or regulate (immunoregulatory, IR-SNA) immunity by engaging TLRs have been designed, synthesized, and characterized. Compared with free oligonucleotides, IS-SNAs exhibit up to 80-fold increases in potency, 700-fold higher antibody titers, 400-fold higher cellular responses to a model antigen, and improved treatment of mice with lymphomas. IR-SNAs exhibit up to eightfold increases in potency and 30% greater reduction in fibrosis score in mice with nonalcoholic steatohepatitis (NASH). Given the clinical potential of SNAs due to their potency, defined chemical nature, and good tolerability, SNAs are attractive new modalities for developing immunotherapies.

  9. Acid rain in Asia

    SciTech Connect

    Bhatti, N.; Streets, D.G. ); Foell, W.K. )

    1991-01-01

    Acid rain has been an issue of widespread concern in North America and Europe for more than fifteen years. However, there is an emerging feeling that the problem in Europe and North America is nearing solution, largely as a result of existing and newly enacted legislation, decreased energy use due to conservation and efficiency improvements, and/or trends in energy policy away from fossil fuels. The situation in Asia appears much bleaker. Fossil fuels are already used in large quantities, such that local air pollution is becoming a serious problem and high deposition levels are being measured. Emission regulations in most countries (with the notable exception of Japan) are not very stringent. Energy plans in many countries (particularly PRC, India, Thailand, and South Korea) call for very large increases in coal combustion in the future. Finally, there is not presently a strong scientific or public constituency for action to mitigate the potential effects of acid deposition. These factors imply potentially serious problems in the future for long-range transport and deposition of sulfur and nitrogen species and consequent damage to ecosystems and materials. The political ramifications of transboundary environmental pollution in this region are also potentially serious. The purpose of this paper is to provide background information on the acid deposition situation in Asia, with the intention of laying the foundation for the development of a possible research program for this region. 36 refs., 8 figs., 8 tabs.

  10. Immunomodulatory spherical nucleic acids

    PubMed Central

    Radovic-Moreno, Aleksandar F.; Chernyak, Natalia; Mader, Christopher C.; Nallagatla, Subbarao; Kang, Richard S.; Hao, Liangliang; Walker, David A.; Halo, Tiffany L.; Merkel, Timothy J.; Rische, Clayton H.; Anantatmula, Sagar; Burkhart, Merideth; Mirkin, Chad A.; Gryaznov, Sergei M.

    2015-01-01

    Immunomodulatory nucleic acids have extraordinary promise for treating disease, yet clinical progress has been limited by a lack of tools to safely increase activity in patients. Immunomodulatory nucleic acids act by agonizing or antagonizing endosomal toll-like receptors (TLR3, TLR7/8, and TLR9), proteins involved in innate immune signaling. Immunomodulatory spherical nucleic acids (SNAs) that stimulate (immunostimulatory, IS-SNA) or regulate (immunoregulatory, IR-SNA) immunity by engaging TLRs have been designed, synthesized, and characterized. Compared with free oligonucleotides, IS-SNAs exhibit up to 80-fold increases in potency, 700-fold higher antibody titers, 400-fold higher cellular responses to a model antigen, and improved treatment of mice with lymphomas. IR-SNAs exhibit up to eightfold increases in potency and 30% greater reduction in fibrosis score in mice with nonalcoholic steatohepatitis (NASH). Given the clinical potential of SNAs due to their potency, defined chemical nature, and good tolerability, SNAs are attractive new modalities for developing immunotherapies. PMID:25775582

  11. Perfluorooctanoic acid and environmental risks

    EPA Science Inventory

    Perfluorooctanoic acid (PFOA) is a member of the perfluoroalkyl acids (PFAA) family of chemicals, which consist of a carbon backbone typically four to fourteen carbons in length and a charged functional moiety.

  12. Folic Acid Questions and Answers

    MedlinePlus

    ... swallow large pills. How can I take a vitamin with folic acid? A : These days, multivitamins with folic acid come in chewable chocolate or fruit flavors, liquids, and large oval or smaller round ...

  13. Omega-3 fatty acids (image)

    MedlinePlus

    Omega-3 fatty acids are a form of polyunsaturated fat that the body derives from food. Omega-3s (and omega-6s) are known as essential fatty acids (EFAs) because they are important for good health. ...

  14. Acid rain: Reign of controversy

    SciTech Connect

    Kahan, A.M.

    1986-01-01

    Acid Rain is a primer on the science and politics of acid rain. Several introductory chapters describe in simple terms the relevant principles of water chemistry, soil chemistry, and plant physiology and discuss the demonstrated or postulated effects of acid rain on fresh waters and forests as well as on statuary and other exposed objects. There follow discussions on the economic and social implications of acid rain (for example, possible health effects) and on the sources, transport, and distribution of air pollutants.

  15. Sedimentation of sulfuric acid in acid tars from current production

    SciTech Connect

    Denisova, T.L.; Frolov, A.F.; Aminov, A.N.; Novosel'tsev, S.P.

    1987-09-01

    Acid tars obtained in treating T-750, KhF-12, and I-8A oils were investigated for purposes of recovering sulfuric acid and asphalt binders from the compositions and of determining the effects of storage time on the recovery. The consumption and sedimentation levels of sulfuric acid during storage for different periods and at different temperatures were assessed. The characteristics of an asphalt binder obtained by neutralizing acid tar with a paste consisting of asphalts from deasphalting operations and slaked lime, followed by oxidation of the mixture with atmospheric air, were determined. The sulfuric acid recovered in the settling process could be burned in order to purify it of organic contaminants.

  16. Sequential injection redox or acid-base titration for determination of ascorbic acid or acetic acid.

    PubMed

    Lenghor, Narong; Jakmunee, Jaroon; Vilen, Michael; Sara, Rolf; Christian, Gary D; Grudpan, Kate

    2002-12-01

    Two sequential injection titration systems with spectrophotometric detection have been developed. The first system for determination of ascorbic acid was based on redox reaction between ascorbic acid and permanganate in an acidic medium and lead to a decrease in color intensity of permanganate, monitored at 525 nm. A linear dependence of peak area obtained with ascorbic acid concentration up to 1200 mg l(-1) was achieved. The relative standard deviation for 11 replicate determinations of 400 mg l(-1) ascorbic acid was 2.9%. The second system, for acetic acid determination, was based on acid-base titration of acetic acid with sodium hydroxide using phenolphthalein as an indicator. The decrease in color intensity of the indicator was proportional to the acid content. A linear calibration graph in the range of 2-8% w v(-1) of acetic acid with a relative standard deviation of 4.8% (5.0% w v(-1) acetic acid, n=11) was obtained. Sample throughputs of 60 h(-1) were achieved for both systems. The systems were successfully applied for the assays of ascorbic acid in vitamin C tablets and acetic acid content in vinegars, respectively.

  17. Nervonic acid and demyelinating disease.

    PubMed

    Sargent, J R; Coupland, K; Wilson, R

    1994-04-01

    Demyelination in adrenoleukodystrophy (ALD) is associated with an accumulation of very long chain saturated fatty acids such as 26:0 stemming from a genetic defect in the peroxisomal beta oxidation system responsible for the chain shortening of these fatty acids. Long chain monoenoic acids such as erucic acid, 22:1(n-9), can normalise elevated serum levels of 26:0 in ALD by depressing their biosynthesis from shorter chain saturated fatty acids. Sphingolipids from post mortem ALD brain have decreased levels of nervonic acid, 24:1(n-9), and increased levels of stearic acid, 18:0. Increased levels of 26:0 are accompanied by decreased nervonic acid biosynthesis in skin fibroblasts from ALD patients. Sphingolipids from post mortem MS brain have the same decreased 24:1(n-9) and increased 18:0 seen in post mortem ALD brain. The 24:1(n-9) content of sphingomyelin is depressed in erythrocytes from multiple sclerosis (MS) patients. Defects in the microsomal biosynthesis of very long chain fatty acids including 24:1(n-9) in 'jumpy' and 'quaking' mice are accompanied by impaired myelination. An impairment in the provision of nervonic acid in demyelinating diseases is indicated, suggesting that dietary therapy with oils rich in very long chain monenoic acid fatty acids may be beneficial in such conditions.

  18. Pantothenic acid biosynthesis in zymomonas

    SciTech Connect

    Tao, Luan; Tomb, Jean-Francois; Viitanen, Paul V.

    2014-07-01

    Zymomonas is unable to synthesize pantothenic acid and requires this essential vitamin in growth medium. Zymomonas strains transformed with an operon for expression of 2-dehydropantoate reductase and aspartate 1-decarboxylase were able to grow in medium lacking pantothenic acid. These strains may be used for ethanol production without pantothenic acid supplementation in seed culture and fermentation media.

  19. An Umbrella for Acid Rain.

    ERIC Educational Resources Information Center

    Randal, Judith

    1979-01-01

    The Environmental Protection Agency has awarded several grants to study effects of and possible solutions to the problem of "acid rain"; pollution from atmospheric nitric and sulfuric acids. The research program is administered through North Carolina State University at Raleigh and will focus on biological effects of acid rain. (JMF)

  20. Carboxylic acid sorption regeneration process

    DOEpatents

    King, C.J.; Poole, L.J.

    1995-05-02

    Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine. 10 figs.

  1. Carboxylic acid sorption regeneration process

    DOEpatents

    King, C. Judson; Poole, Loree J.

    1995-01-01

    Carboxylic acids are sorbed from aqueous feedstocks into an organic liquid phase or onto a solid adsorbent. The acids are freed from the sorbent phase by treating it with aqueous alkylamine thus forming an alkylammonium carboxylate which is dewatered and decomposed to the desired carboxylic acid and the alkylamine.

  2. Heterogeneous uptake of amines by citric acid and humic acid.

    PubMed

    Liu, Yongchun; Ma, Qingxin; He, Hong

    2012-10-16

    Heterogeneous uptake of methylamine (MA), dimethylamine (DMA), and trimethylamine (TMA) onto citric acid and humic acid was investigated using a Knudsen cell reactor coupled to a quadrupole mass spectrometer at 298 K. Acid-base reactions between amines and carboxylic acids were confirmed. The observed uptake coefficients of MA, DMA, and TMA on citric acid at 298 K were measured to be 7.31 ± 1.13 × 10(-3), 6.65 ± 0.49 × 10(-3), and 5.82 ± 0.68 × 10(-3), respectively, and showed independence of sample mass. The observed uptake coefficients of MA, DMA, and TMA on humic acid at 298 K increased linearly with sample mass, and the true uptake coefficients of MA, DMA, and TMA were measured to be 1.26 ± 0.07 × 10(-5), 7.33 ± 0.40 × 10(-6), and 4.75 ± 0.15 × 10(-6), respectively. Citric acid, having stronger acidity, showed a higher reactivity than humic acid for a given amine; while the steric effect of amines was found to govern the reactivity between amines and citric acid or humic acid.

  3. Design Considerations for RNA Spherical Nucleic Acids (SNAs).

    PubMed

    Barnaby, Stacey N; Perelman, Grant A; Kohlstedt, Kevin L; Chinen, Alyssa B; Schatz, George C; Mirkin, Chad A

    2016-09-21

    Ribonucleic acids (RNAs) are key components in many cellular processes such as cell division, differentiation, growth, aging, and death. RNA spherical nucleic acids (RNA-SNAs), which consist of dense shells of double-stranded RNA on nanoparticle surfaces, are powerful and promising therapeutic modalities because they confer advantages over linear RNA such as high cellular uptake and enhanced stability. Due to their three-dimensional shell of oligonucleotides, SNAs, in comparison to linear nucleic acids, interact with the biological environment in unique ways. Herein, the modularity of the RNA-SNA is used to systematically study structure-function relationships in order to understand how the oligonucleotide shell affects interactions with a specific type of biological environment, namely, one that contains serum nucleases. We use a combination of experiment and theory to determine the key architectural properties (i.e., sequence, density, spacer moiety, and backfill molecule) that affect how RNA-SNAs interact with serum nucleases. These data establish a set of design parameters for SNA architectures that are optimized in terms of stability. PMID:27523252

  4. Design Considerations for RNA Spherical Nucleic Acids (SNAs)

    PubMed Central

    2016-01-01

    Ribonucleic acids (RNAs) are key components in many cellular processes such as cell division, differentiation, growth, aging, and death. RNA spherical nucleic acids (RNA-SNAs), which consist of dense shells of double-stranded RNA on nanoparticle surfaces, are powerful and promising therapeutic modalities because they confer advantages over linear RNA such as high cellular uptake and enhanced stability. Due to their three-dimensional shell of oligonucleotides, SNAs, in comparison to linear nucleic acids, interact with the biological environment in unique ways. Herein, the modularity of the RNA-SNA is used to systematically study structure–function relationships in order to understand how the oligonucleotide shell affects interactions with a specific type of biological environment, namely, one that contains serum nucleases. We use a combination of experiment and theory to determine the key architectural properties (i.e., sequence, density, spacer moiety, and backfill molecule) that affect how RNA-SNAs interact with serum nucleases. These data establish a set of design parameters for SNA architectures that are optimized in terms of stability. PMID:27523252

  5. Design Considerations for RNA Spherical Nucleic Acids (SNAs).

    PubMed

    Barnaby, Stacey N; Perelman, Grant A; Kohlstedt, Kevin L; Chinen, Alyssa B; Schatz, George C; Mirkin, Chad A

    2016-09-21

    Ribonucleic acids (RNAs) are key components in many cellular processes such as cell division, differentiation, growth, aging, and death. RNA spherical nucleic acids (RNA-SNAs), which consist of dense shells of double-stranded RNA on nanoparticle surfaces, are powerful and promising therapeutic modalities because they confer advantages over linear RNA such as high cellular uptake and enhanced stability. Due to their three-dimensional shell of oligonucleotides, SNAs, in comparison to linear nucleic acids, interact with the biological environment in unique ways. Herein, the modularity of the RNA-SNA is used to systematically study structure-function relationships in order to understand how the oligonucleotide shell affects interactions with a specific type of biological environment, namely, one that contains serum nucleases. We use a combination of experiment and theory to determine the key architectural properties (i.e., sequence, density, spacer moiety, and backfill molecule) that affect how RNA-SNAs interact with serum nucleases. These data establish a set of design parameters for SNA architectures that are optimized in terms of stability.

  6. Composition for nucleic acid sequencing

    SciTech Connect

    Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

    2008-08-26

    The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

  7. Evolution of rosmarinic acid biosynthesis.

    PubMed

    Petersen, Maike; Abdullah, Yana; Benner, Johannes; Eberle, David; Gehlen, Katja; Hücherig, Stephanie; Janiak, Verena; Kim, Kyung Hee; Sander, Marion; Weitzel, Corinna; Wolters, Stefan

    2009-01-01

    Rosmarinic acid and chlorogenic acid are caffeic acid esters widely found in the plant kingdom and presumably accumulated as defense compounds. In a survey, more than 240 plant species have been screened for the presence of rosmarinic and chlorogenic acids. Several rosmarinic acid-containing species have been detected. The rosmarinic acid accumulation in species of the Marantaceae has not been known before. Rosmarinic acid is found in hornworts, in the fern family Blechnaceae and in species of several orders of mono- and dicotyledonous angiosperms. The biosyntheses of caffeoylshikimate, chlorogenic acid and rosmarinic acid use 4-coumaroyl-CoA from the general phenylpropanoid pathway as hydroxycinnamoyl donor. The hydroxycinnamoyl acceptor substrate comes from the shikimate pathway: shikimic acid, quinic acid and hydroxyphenyllactic acid derived from l-tyrosine. Similar steps are involved in the biosyntheses of rosmarinic, chlorogenic and caffeoylshikimic acids: the transfer of the 4-coumaroyl moiety to an acceptor molecule by a hydroxycinnamoyltransferase from the BAHD acyltransferase family and the meta-hydroxylation of the 4-coumaroyl moiety in the ester by a cytochrome P450 monooxygenase from the CYP98A family. The hydroxycinnamoyltransferases as well as the meta-hydroxylases show high sequence similarities and thus seem to be closely related. The hydroxycinnamoyltransferase and CYP98A14 from Coleus blumei (Lamiaceae) are nevertheless specific for substrates involved in RA biosynthesis showing an evolutionary diversification in phenolic ester metabolism. Our current view is that only a few enzymes had to be "invented" for rosmarinic acid biosynthesis probably on the basis of genes needed for the formation of chlorogenic and caffeoylshikimic acid while further biosynthetic steps might have been recruited from phenylpropanoid metabolism, tocopherol/plastoquinone biosynthesis and photorespiration. PMID:19560175

  8. Evolution of rosmarinic acid biosynthesis.

    PubMed

    Petersen, Maike; Abdullah, Yana; Benner, Johannes; Eberle, David; Gehlen, Katja; Hücherig, Stephanie; Janiak, Verena; Kim, Kyung Hee; Sander, Marion; Weitzel, Corinna; Wolters, Stefan

    2009-01-01

    Rosmarinic acid and chlorogenic acid are caffeic acid esters widely found in the plant kingdom and presumably accumulated as defense compounds. In a survey, more than 240 plant species have been screened for the presence of rosmarinic and chlorogenic acids. Several rosmarinic acid-containing species have been detected. The rosmarinic acid accumulation in species of the Marantaceae has not been known before. Rosmarinic acid is found in hornworts, in the fern family Blechnaceae and in species of several orders of mono- and dicotyledonous angiosperms. The biosyntheses of caffeoylshikimate, chlorogenic acid and rosmarinic acid use 4-coumaroyl-CoA from the general phenylpropanoid pathway as hydroxycinnamoyl donor. The hydroxycinnamoyl acceptor substrate comes from the shikimate pathway: shikimic acid, quinic acid and hydroxyphenyllactic acid derived from l-tyrosine. Similar steps are involved in the biosyntheses of rosmarinic, chlorogenic and caffeoylshikimic acids: the transfer of the 4-coumaroyl moiety to an acceptor molecule by a hydroxycinnamoyltransferase from the BAHD acyltransferase family and the meta-hydroxylation of the 4-coumaroyl moiety in the ester by a cytochrome P450 monooxygenase from the CYP98A family. The hydroxycinnamoyltransferases as well as the meta-hydroxylases show high sequence similarities and thus seem to be closely related. The hydroxycinnamoyltransferase and CYP98A14 from Coleus blumei (Lamiaceae) are nevertheless specific for substrates involved in RA biosynthesis showing an evolutionary diversification in phenolic ester metabolism. Our current view is that only a few enzymes had to be "invented" for rosmarinic acid biosynthesis probably on the basis of genes needed for the formation of chlorogenic and caffeoylshikimic acid while further biosynthetic steps might have been recruited from phenylpropanoid metabolism, tocopherol/plastoquinone biosynthesis and photorespiration.

  9. Microbial transformations of isocupressic acid.

    PubMed

    Lin, S J; Rosazza, J P

    1998-07-01

    Microbial transformations of the labdane-diterpene isocupressic acid (1) with different microorganisms yielded several oxygenated metabolites that were isolated and characterized by MS and NMR spectroscopic analyses. Nocardia aurantia (ATCC 12674) catalyzed the cleavage of the 13,14-double bond to yield a new nor-labdane metabolite, 2. Cunninghamella elegans (-) (NRRL 1393) gave 7beta-hydroxyisocupressic acid (3) and labda-7,13(E)-diene-6beta,15, 17-triol-19-oic acid (4), and Mucor mucedo (ATCC 20094) gave 2alpha-hydroxyisocupressic acid (5) and labda-8(17),14-diene-2alpha, 13-diol-19-oic acid (6).

  10. Invasive cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    2002-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  11. Invasive cleavage of nucleic acids

    DOEpatents

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann D.; Dahlberg, James E.

    1999-01-01

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  12. The politics of acid rain

    SciTech Connect

    Wilcher, M.E. )

    1989-01-01

    This work examines and compares the acid rain policies through the different political systems of Canada, Great Britain and the United States. Because the flow of acid rain can transcend national boundaries, acid rain has become a crucial international problem. According to the author, because of differences in governmental institutions and structure, the extent of governmental intervention in the industrial economy, the degree of reliance on coal for power generation, and the extent of acid rain damage, national responses to the acid rain problem have varied.

  13. [A catalogue of fatty acids].

    PubMed

    Canalejo, E; Martín Peña, G; Gómez Molero, L; Ruiz Galiana, J

    1996-01-01

    Fatty acids structure and function is an area of renewed interest because of its effects on plasma lipids, biosynthesis of prostaglandins, leucotrienes and thromboxanes, and the obligatory demands of some fatty acids, especially for the newborn. Fatty acids are identified in three different ways: by the classical nomenclature, by its trivial name, and by the new methods also known as the omega system. These three different methods have created some confusion. The aim of this article is to revise fatty acids chemical structure and to compile a list of nutritional important fatty acids with the three different terminologies.

  14. Tested Demonstrations: Color Oscillations in the Formic Acid-Nitric Acid-Sulfuric Acid System.

    ERIC Educational Resources Information Center

    Raw, C. J. G.; And Others

    1983-01-01

    Presented are procedures for demonstrating the production of color oscillations when nitric acid is added to a formic acid/concentrated sulfuric acid mixture. Because of safety considerations, "Super-8" home movie of the color changes was found to be satisfactory for demonstration purposes. (JN)

  15. Twinning of dodecanedicarboxylic acid

    NASA Technical Reports Server (NTRS)

    Sen, R.; Wilcox, W. R.

    1986-01-01

    Twinning of 1,10-dodecanedicarboxyl acid (DDA) was observed in 0.1 mm thick films with a polarizing microscope. Twins originated from polycrystalline regions which tended to nucleate on twin faces, and terminated by intersection gone another. Twinning increased dramatically with addition of organic compounds with a similar molecular size and shape. Increasing the freezing rate, increasing the temperature gradient, and addition of silica particles increased twinning. It is proposed that twins nucleate with polycrystals and sometimes anneal out before they become observable. The impurities may enhance twinning either by lowering the twin energy or by adsorbing on growing faces.

  16. Mycophenolic Acid in Silage

    PubMed Central

    Schneweis, Isabell; Meyer, Karsten; Hörmansdorfer, Stefan; Bauer, Johann

    2000-01-01

    We examined 233 silage samples and found that molds were present in 206 samples with counts between 1 × 103 and 8.9 × 107 (mean, 4.7 × 106) CFU/g. Mycophenolic acid, a metabolite of Penicillium roqueforti, was detected by liquid chromatography-mass spectrometry in 74 (32%) of these samples at levels ranging from 20 to 35,000 (mean, 1,400) μg/kg. This compound has well-known immunosuppressive properties, so feeding with contaminated silage may promote the development of infectious diseases in livestock. PMID:10919834

  17. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  18. Beyond acid rain

    SciTech Connect

    Gaffney, J.S.; Streit, G.E.; Spall, W.D.; Hall, J.H.

    1987-06-01

    This paper discussed the effects of the interactions of soluble oxidants and organic toxins with sulfur dioxide and nitrogen dioxide. It suggested that these chemical reactions in the atmosphere produced a more potent acid rain which was harmful not only because it had a low pH but because it contained oxidants and organic toxins which were harmful to surface vegetation and the organisms found in surface waters. It was stressed that air pollution is a global problem and that is is necessary to develop a better fundamental understanding of how air pollution is causing damage to the streams and forests of the world. 50 references.

  19. Interstellar isothiocyanic acid

    NASA Technical Reports Server (NTRS)

    Frerking, M. A.; Linke, R. A.; Thaddeus, P.

    1979-01-01

    Isothiocyanic acid (HNCS) has been identified in Sgr B2 from millimeter-wave spectral line observations. We have definitely detected three rotational lines, and have probably detected two others. The rotational temperature of HNCS in Sgr B2 is 14 plus or minus 5 K, its column density is 2.5 plus or minus 1.0 x 10 to the 13th per sq cm, and its abundance relative to HNCO is consistent with the cosmic S/O ratio, 1/42.

  20. 20-hydroxyeicosatetraenoic acid and epoxyeicosatrienoic acids and blood pressure.

    PubMed

    McGiff, J C; Quilley, J

    2001-03-01

    The properties of 20-hydroxyeicosatetraenoic acid and epoxyeicosatrienoic acids, vasoactivity and modulation of ion transport and mediation/modulation of the effects of vasoactive hormones, such as angiotensin II and endothelin, underscore their importance to renal vascular mechanisms and electrolyte excretion. 20-Hydroxyeicosatetraenoic acid is an integral component of renal autoregulation and tubuloglomerular feedback as well as cerebral autoregulation, eliciting vasoconstriction by the inhibition of potassium channels. Nitric oxide inhibits 20-hydroxyeicosatetraenoic acid formation, the removal of which contributes to the vasodilator effect of nitric oxide. In contrast, epoxyeicosatrienoic acids are generally vasodilatory by activating potassium channels and have been proposed as endothelium-derived hyperpolarizing factors. 20-Hydroxyeicosatetraenoic acid modulates ion transport in key nephron segments by influencing the activities of sodium--potassium-ATPase and the sodium--potassium--chloride co-transporter; however, the primacy of the various arachidonate oxygenases that generate products affecting these activities changes with age. The range and diversity of activity of 20-hydroxyeicosatetraenoic acid is influenced by its metabolism by cyclooxygenase to products affecting vasomotion and salt/water excretion. 20-Hydroxyeicosatetraenoic acid is the principal renal eicosanoid that interacts with several hormonal systems that are central to blood pressure regulation. This article reviews the most recent studies that address 20-hydroxyeicosatetraenoic acid and epoxyeicosatrienoic acids in vascular and renal tubular function and hypertension.

  1. Vibrational structure of the polyunsaturated fatty acids eicosapentaenoic acid and arachidonic acid studied by infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Kiefer, Johannes; Noack, Kristina; Bartelmess, Juergen; Walter, Christian; Dörnenburg, Heike; Leipertz, Alfred

    2010-02-01

    The spectroscopic discrimination of the two structurally similar polyunsaturated C 20 fatty acids (PUFAs) 5,8,11,14,17-eicosapentaenoic acid and 5,8,11,14-eicosatetraenoic acid (arachidonic acid) is shown. For this purpose their vibrational structures are studied by means of attenuated total reflection (ATR) Fourier-transform infrared (FT-IR) spectroscopy. The fingerprint regions of the recorded spectra are found to be almost identical, while the C-H stretching mode regions around 3000 cm -1 show such significant differences as results of electronic and molecular structure alterations based on the different degree of saturation that both fatty acids can be clearly distinguished from each other.

  2. Nucleic acid detection methods

    DOEpatents

    Smith, C.L.; Yaar, R.; Szafranski, P.; Cantor, C.R.

    1998-05-19

    The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3{prime}-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated. 18 figs.

  3. Nucleic Acid Detection Methods

    DOEpatents

    Smith, Cassandra L.; Yaar, Ron; Szafranski, Przemyslaw; Cantor, Charles R.

    1998-05-19

    The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3'-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated.

  4. Cryoprotection from lipoteichoic acid

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Middaugh, Amy; Wickham, Jason R.; Friedline, Anthony; Thomas, Kieth J.; Johnson, Karen; Zachariah, Malcolm; Garimella, Ravindranth

    2012-10-01

    Numerous chemical additives lower the freezing point of water, but life at sub-zero temperatures is sustained by a limited number of biological cryoprotectants. Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, and with a few exceptions, antifreeze proteins are missing. Survival has been attributed to external factors, such as the high salt concentration of brine veins and adhesion to particulates or ice crystal defects. We have discovered an endogenous cryoprotectant in the cell wall of bacteria, lipoteichoic acid biopolymers. Adding 1% LTA to bacteria cultures immediately prior to freezing provides 50% survival rate, similar to the results obtained with 1% glycerol. In the absence of an additive, bacterial survival is negligible as measured with the resazurin cell viability assay. The mode of action for LTA cryoprotection is unknown. With a molecular weight of 3-5 kDa, it is unlikely to enter the cell cytoplasm. Our observations suggest that teichoic acids could provide a shell of liquid water around biofilms and planktonic bacteria, removing the need for brine veins to prevent bacterial freezing.

  5. Bicyclic glutamic acid derivatives.

    PubMed

    Meyer, Udo; Bisel, Philippe; Weckert, Edgar; Frahm, August Wilhelm

    2006-05-15

    For the second-generation asymmetric synthesis of the trans-tris(homoglutamic) acids via Strecker reaction of chiral ketimines, the cyanide addition as the key stereodifferentiating step produces mixtures of diastereomeric alpha-amino nitrile esters the composition of which is independent of the reaction temperature and the type of the solvent, respectively. The subsequent hydrolysis is exclusively achieved with concentrated H(2)SO(4) yielding diastereomeric mixtures of three secondary alpha-amino alpha-carbamoyl-gamma-esters and two diastereomeric cis-fused angular alpha-carbamoyl gamma-lactams as bicyclic glutamic acid derivatives, gained from in situ stereomer differentiating cyclisation of the secondary cis-alpha-amino alpha-carbamoyl-gamma-esters. Separation was achieved by CC. The pure secondary trans-alpha-amino alpha-carbamoyl-gamma-esters cyclise on heating and treatment with concentrated H(2)SO(4), respectively, to diastereomeric cis-fused angular secondary alpha-amino imides. Their hydrogenolysis led to the enantiomeric cis-fused angular primary alpha-amino imides. The configuration of all compounds was completely established by NMR methods, CD-spectra, and by X-ray analyses of the (alphaR,1R,5R)-1-carbamoyl-2-(1-phenylethyl)-2-azabicyclo[3.3.0]octan-3-one and of the trans-alphaS,1S,2R-2-ethoxycarbonylmethyl-1-(1-phenylethylamino)cyclopentanecarboxamide. PMID:16596563

  6. Titration of phosphonic acid derivatives in mixtures.

    PubMed

    Wittmann, Z

    1980-01-01

    An analytical procedure is described for the determination of the weak acids phosphonomethyliminodiacetic acid and phosphonomethyliminoacetic acid in their mixtures, and the dissociation constants of phosphonomethyliminoacetic acid are reported.

  7. Growth of nitric acid hydrates on thin sulfuric acid films

    NASA Technical Reports Server (NTRS)

    Iraci, Laura T.; Middlebrook, Ann M.; Wilson, Margaret A.; Tolbert, Margaret A.

    1994-01-01

    Type I polar stratospheric clouds (PSCs) are thought to nucleate and grow on stratospheric sulfate aerosols (SSAs). To model this system, thin sulfuric acid films were exposed to water and nitric acid vapors (1-3 x 10(exp -4) Torr H2O and 1-2.5 x 10(exp -6) Torr HNO3) and subjected to cooling and heating cycles. Fourier Transform Infrared (FTIR) spectroscopy was used to probe the phase of the sulfuric acid and to identify the HNO3/H2O films that condensed. Nitric acid trihydrate (NAT) was observed to grow on crystalline sulfuric acid tetrahydrate (SAT) films. NAT also condensed in/on supercooled H2SO4 films without causing crystallization of the sulfuric acid. This growth is consistent with NAT nucleation from ternary solutions as the first step in PSC formation.

  8. Determination of benzoic acid, chlorobenzoic acids and chlorendic acid in water

    SciTech Connect

    Dietz, E.A.; Cortellucci, N.J.; Singley, K.F. )

    1993-01-01

    To characterize and conduct treatment studies of a landfill leachate an analysis procedure was required to determine concentrations of benzoic acid, the three isomers of chlorobenzoic acid and chlorendic acid. The title compounds were isolated from acidified (pH 1) water by extraction with methyl t-butyl ether. Analytes were concentrated by back-extracting the ether with 0.1 N sodium hydroxide which was separated and acidified. This solution was analyzed by C[sub 18] reversed-phase HPLC with water/acetonitrile/acetic acid eluent and UV detection at 222 nm. The method has detection limits of 200 [mu]g/L for chlorendic acid and 100 [mu]g/L for benzoic acid and each isomer of chlorobenzoic acid. Validation studies with water which was fortified with the analytes at concentrations ranging from one to ten times detection limits resulted in average recoveries of >95%.

  9. Acid rain: Rhetoric and reality

    SciTech Connect

    Park, C.C.

    1987-01-01

    Acid rain is now one of the most serious environmental problems in developed countries. Emissions and fallout were previously extremely localized, but since the introduction of tall stacks policies in both Britain and the US - pardoxically to disperse particulate pollutants and hence reduce local damage - emissions are now lifted into the upper air currents and carried long distances downwind. The acid rain debate now embraces many western countries - including Canada, the US, England, Scotland, Wales, Sweden, Norway, Denmark, West Germany, the Netherlands, Austria, Switzerland - and a growing number of eastern countries - including the Soviet Union, Poland, East Germany, and Czechoslovakia. The problem of acid rain arises, strictly speaking, not so much from the rainfall itself as from its effects on the environment. Runoff affects surface water and groundwater, as well as soils and vegetation. Consequently changes in rainfall acidity can trigger off a range of impacts on the chemistry and ecology of lakes and rivers, soil chemistry and processes, the health and productivity of plants, and building materials, and metallic structures. The most suitable solutions to the problems of acid rain require prevention rather than cure, and there is broad agreement in both the political scientific communities on the need to reduce emissions of sulfur and nitrogen oxides to the atmosphere. Book divisions discuss: the problem of acid rain, the science of acid rain, the technology of acid rain, and the politics of acid rain, in an effort to evaluate this growing global problem of acid rain.

  10. Therapeutic targeting of bile acids

    PubMed Central

    Gores, Gregory J.

    2015-01-01

    The first objectives of this article are to review the structure, chemistry, and physiology of bile acids and the types of bile acid malabsorption observed in clinical practice. The second major theme addresses the classical or known properties of bile acids, such as the role of bile acid sequestration in the treatment of hyperlipidemia; the use of ursodeoxycholic acid in therapeutics, from traditional oriental medicine to being, until recently, the drug of choice in cholestatic liver diseases; and the potential for normalizing diverse bowel dysfunctions in irritable bowel syndrome, either by sequestering intraluminal bile acids for diarrhea or by delivering more bile acids to the colon to relieve constipation. The final objective addresses novel concepts and therapeutic opportunities such as the interaction of bile acids and the microbiome to control colonic infections, as in Clostridium difficile-associated colitis, and bile acid targeting of the farnesoid X receptor and G protein-coupled bile acid receptor 1 with consequent effects on energy expenditure, fat metabolism, and glycemic control. PMID:26138466

  11. Bile Acid Metabolism and Signaling

    PubMed Central

    Chiang, John Y. L.

    2015-01-01

    Bile acids are important physiological agents for intestinal nutrient absorption and biliary secretion of lipids, toxic metabolites, and xenobiotics. Bile acids also are signaling molecules and metabolic regulators that activate nuclear receptors and G protein-coupled receptor (GPCR) signaling to regulate hepatic lipid, glucose, and energy homeostasis and maintain metabolic homeostasis. Conversion of cholesterol to bile acids is critical for maintaining cholesterol homeostasis and preventing accumulation of cholesterol, triglycerides, and toxic metabolites, and injury in the liver and other organs. Enterohepatic circulation of bile acids from the liver to intestine and back to the liver plays a central role in nutrient absorption and distribution, and metabolic regulation and homeostasis. This physiological process is regulated by a complex membrane transport system in the liver and intestine regulated by nuclear receptors. Toxic bile acids may cause inflammation, apoptosis, and cell death. On the other hand, bile acid-activated nuclear and GPCR signaling protects against inflammation in liver, intestine, and macrophages. Disorders in bile acid metabolism cause cholestatic liver diseases, dyslipidemia, fatty liver diseases, cardiovascular diseases, and diabetes. Bile acids, bile acid derivatives, and bile acid sequestrants are therapeutic agents for treating chronic liver diseases, obesity, and diabetes in humans. PMID:23897684

  12. Bile acid interactions with cholangiocytes.

    PubMed

    Xia, Xuefeng; Francis, Heather; Glaser, Shannon; Alpini, Gianfranco; LeSage, Gene

    2006-06-14

    Cholangiocytes are exposed to high concentrations of bile acids at their apical membrane. A selective transporter for bile acids, the Apical Sodium Bile Acid Cotransporter (ASBT) (also referred to as Ibat; gene name Slc10a2) is localized on the cholangiocyte apical membrane. On the basolateral membrane, four transport systems have been identified (t-ASBT, multidrug resistance (MDR)3, an unidentified anion exchanger system and organic solute transporter (Ost) heteromeric transporter, Ostalpha-Ostbeta. Together, these transporters unidirectionally move bile acids from ductal bile to the circulation. Bile acids absorbed by cholangiocytes recycle via the peribiliary plexus back to hepatocytes for re-secretion into bile. This recycling of bile acids between hepatocytes and cholangiocytes is referred to as the cholehepatic shunt pathway. Recent studies suggest that the cholehepatic shunt pathway may contribute in overall hepatobiliary transport of bile acids and to the adaptation to chronic cholestasis due to extrahepatic obstruction. ASBT is acutely regulated by an adenosine 3', 5'-monophosphate (cAMP)-dependent translocation to the apical membrane and by phosphorylation-dependent ubiquitination and proteasome degradation. ASBT is chronically regulated by changes in gene expression in response to biliary bile acid concentration and inflammatory cytokines. Another potential function of cholangiocyte ASBT is to allow cholangiocytes to sample biliary bile acids in order to activate intracellular signaling pathways. Bile acids trigger changes in intracellular calcium, protein kinase C (PKC), phosphoinositide 3-kinase (PI3K), mitogen-activated protein (MAP) kinase and extracellular signal-regulated protein kinase (ERK) intracellular signals. Bile acids significantly alter cholangiocyte secretion, proliferation and survival. Different bile acids have differential effects on cholangiocyte intracellular signals, and in some instances trigger opposing effects on cholangiocyte

  13. Citric acid production patent review.

    PubMed

    Anastassiadis, Savas; Morgunov, Igor G; Kamzolova, Svetlana V; Finogenova, Tatiana V

    2008-01-01

    Current Review article summarizes the developments in citric acid production technologies in East and West last 100 years. Citric acid is commercially produced by large scale fermentation mostly using selected fungal or yeast strains in aerobe bioreactors and still remains one of the runners in industrial production of biotechnological bulk metabolites obtained by microbial fermentation since about 100 years, reflecting the historical development of modern biotechnology and fermentation process technology in East and West. Citric acid fermentation was first found as a fungal product in cultures of Penicillium glaucum on sugar medium by Wehmer in 1893. Citric acid is an important multifunctional organic acid with a broad range of versatile uses in household and industrial applications that has been produced industrially since the beginning of 20(th) century. There is a great worldwide demand for citric acid consumption due to its low toxicity, mainly being used as acidulant in pharmaceutical and food industries. Global citric acid production has reached 1.4 million tones, increasing annually at 3.5-4.0% in demand and consumption. Citric acid production by fungal submerged fermentation is still dominating, however new perspectives like solid-state processes or continuous yeast processes can be attractive for producers to stand in today's strong competition in industry. Further perspectives aiming in the improvement of citric acid production are the improvement of citric acid producing strains by classical and modern mutagenesis and selection as well as downstream processes. Many inexpensive by-products and residues of the agro-industry (e.g. molasses, glycerin etc.) can be economically utilized as substrates in the production of citric acid, especially in solid-state fermentation, enormously reducing production costs and minimizing environmental problems. Alternatively, continuous processes utilizing yeasts which reach 200-250 g/l citric acid can stand in today

  14. Bile acid interactions with cholangiocytes

    PubMed Central

    Xia, Xuefeng; Francis, Heather; Glaser, Shannon; Alpini, Gianfranco; LeSage, Gene

    2006-01-01

    Cholangiocytes are exposed to high concentrations of bile acids at their apical membrane. A selective transporter for bile acids, the Apical Sodium Bile Acid Cotransporter (ASBT) (also referred to as Ibat; gene name Slc10a2) is localized on the cholangiocyte apical membrane. On the basolateral membrane, four transport systems have been identified (t-ASBT, multidrug resistance (MDR)3, an unidentified anion exchanger system and organic solute transporter (Ost) heteromeric transporter, Ostα-Ostβ. Together, these transporters unidirectionally move bile acids from ductal bile to the circulation. Bile acids absorbed by cholangiocytes recycle via the peribiliary plexus back to hepatocytes for re-secretion into bile. This recycling of bile acids between hepatocytes and cholangiocytes is referred to as the cholehepatic shunt pathway. Recent studies suggest that the cholehepatic shunt pathway may contribute in overall hepatobiliary transport of bile acids and to the adaptation to chronic cholestasis due to extrahepatic obstruction. ASBT is acutely regulated by an adenosine 3', 5’-monophosphate (cAMP)-dependent translocation to the apical membrane and by phosphorylation-dependent ubiquitination and proteasome degradation. ASBT is chronically regulated by changes in gene expression in response to biliary bile acid concentration and inflammatory cytokines. Another potential function of cholangiocyte ASBT is to allow cholangiocytes to sample biliary bile acids in order to activate intracellular signaling pathways. Bile acids trigger changes in intracellular calcium, protein kinase C (PKC), phosphoinositide 3-kinase (PI3K), mitogen-activated protein (MAP) kinase and extracellular signal-regulated protein kinase (ERK) intracellular signals. Bile acids significantly alter cholangiocyte secretion, proliferation and survival. Different bile acids have differential effects on cholangiocyte intracellular signals, and in some instances trigger opposing effects on cholangiocyte

  15. Interactions of amino acids, carboxylic acids, and mineral acids with different quinoline derivatives

    NASA Astrophysics Data System (ADS)

    Kalita, Dipjyoti; Deka, Himangshu; Samanta, Shyam Sundar; Guchait, Subrata; Baruah, Jubaraj B.

    2011-03-01

    A series of quinoline containing receptors having amide and ester bonds are synthesized and characterised. The relative binding abilities of these receptors with various amino acids, carboxylic acids and mineral acids are determined by monitoring the changes in fluorescence intensity. Among the receptors bis(2-(quinolin-8-yloxy)ethyl) isophthalate shows fluorescence enhancement on addition of amino acids whereas the other receptors shows fluorescence quenching on addition of amino acids. The receptor N-(quinolin-8-yl)-2-(quinolin-8-yloxy) propanamide has higher binding affinity for amino acids. However, the receptor N-(quinolin-8-yl)-2-(quinolin-8-yloxy)acetamide having similar structure do not bind to amino acids. This is attributed to the concave structure of the former which is favoured due to the presence of methyl substituent. The receptor bis(2-(quinolin-8-yloxy)ethyl) isophthalate do not bind to hydroxy carboxylic acids, but is a good receptor for dicarboxylic acids. The crystal structure of bromide and perchlorate salts of receptor 2-bromo-N-(quinolin-8-yl)-propanamide are determined. In both the cases the amide groups are not in the plane of quinoline ring. The structure of N-(quinolin-8-yl)-2-(quinolin-8-yloxy)acetamide, N-(2-methoxyphenethyl)-2-(quinolin-8-yloxy)acetamide and their salts with maleic acid as well as fumaric acid are determined. It is observed that the solid state structures are governed by the double bond geometry of these two acid. Maleic acid forms salt in both the cases, whereas fumaric acid forms either salt or co-crystals.

  16. Acidity of Strong Acids in Water and Dimethyl Sulfoxide.

    PubMed

    Trummal, Aleksander; Lipping, Lauri; Kaljurand, Ivari; Koppel, Ilmar A; Leito, Ivo

    2016-05-26

    Careful analysis and comparison of the available acidity data of HCl, HBr, HI, HClO4, and CF3SO3H in water, dimethyl sulfoxide (DMSO), and gas-phase has been carried out. The data include experimental and computational pKa and gas-phase acidity data from the literature, as well as high-level computations using different approaches (including the W1 theory) carried out in this work. As a result of the analysis, for every acid in every medium, a recommended acidity value is presented. In some cases, the currently accepted pKa values were revised by more than 10 orders of magnitude. PMID:27115918

  17. Esterification by the Plasma Acidic Water: Novel Application of Plasma Acid

    NASA Astrophysics Data System (ADS)

    Gu, Ling

    2014-03-01

    This work explores the possibility of plasma acid as acid catalyst in organic reactions. Plasma acidic water was prepared by dielectric barrier discharge and used to catalyze esterification of n-heptanioc acid with ethanol. It is found that the plasma acidic water has a stable and better performance than sulfuric acid, meaning that it is an excellent acid catalyst. The plasma acidic water would be a promising alternative for classic mineral acid as a more environment friendly acid.

  18. 49 CFR 173.158 - Nitric acid.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 49 Transportation 2 2012-10-01 2012-10-01 false Nitric acid. 173.158 Section 173.158... Nitric acid. (a) Nitric acid exceeding 40 percent concentration may not be packaged with any other material. (b) Nitric acid in any concentration which does not contain sulfuric acid or hydrochloric acid...

  19. Acid rain degradation of nylon

    SciTech Connect

    Kyllo, K.E.

    1984-01-01

    Acid rain, precipitation with a pH less than 5.6, is known to damage lakes, vegetation and buildings. Degradation of outdoor textiles by acid rain is strongly suspected but not well documented. This study reports the effects of sunlight, aqueous acid, heat and humidity (acid rain conditions) on spun delustered nylon 6,6 fabric. Untreated nylon and nylon treated with sulfuric acid of pH 2.0, 3.0, and 4.4 were exposed to light in an Atlas Xenon-arc fadeometer at 63/sup 0/C and 65% R.H. for up to 640 AATCC Fading Units. The untreated and acid treated nylon fabrics were also exposed to similar temperature and humidity condition without light. Nylon degradation was determined by changes in breaking strength, elongation, molecular weight, color, amino end group concentration (NH/sub 2/) and /sup 13/C NMR spectra. Physical damage was assessed using SEM.

  20. A Simpler Nucleic Acid

    NASA Technical Reports Server (NTRS)

    Orgel, Leslie

    2000-01-01

    It has been supposed that for a nucleic acid analog to pair with RNA it must, like RNA, have a backbone with at least a sixatom repeat; a shorter backbone presumably would not stretch far enough to bind RNA properly. The Eschenmoser group has shown, however, that this first impression is incorrect.As they report in their new paper, Eschenmoser and co-workers ( I ) have now synthesized a substantial number of these polymers, which are called (L)-a-threofuranosyl oligonucleotides or TNAs. They are composed of bases linked to a threose sugar-phosphate backbone, with phosphodiester bonds connecting the nucleotides. The investigators discovered that pairs of complementary TNAs do indeed form stable Watson-Crick double helices and, perhaps more importantly, that TNAs form stable double helices with complementary RNAs and DNAs.

  1. [Hydrofluoric acid poisoning: case report].

    PubMed

    Cortina, Tatiana Judith; Ferrero, Hilario Andrés

    2013-01-01

    Hydrofluoric acid is a highly dangerous substance with industrial and domestically appliances. Clinical manifestations of poisoning depend on exposure mechanism, acid concentration and exposed tissue penetrability. Gastrointestinal tract symptoms do not correlate with injury severity. Patients with history of hydrofluoric acid ingestion should undergo an endoscopy of the upper gastrointestinal tract. Intoxication requires immediate intervention because systemic toxicity can take place. We present a 5 year old girl who accidentally swallowed 5 ml of 20% hydrofluoric acid. We performed gastrointestinal tract endoscopy post ingestion, which revealed erythematous esophagus and stomach with erosive lesions. Two months later, same study was performed and revealed esophagus and stomach normal mucous membrane.

  2. Preparation and characterization Al3+-bentonite Turen Malang for esterification fatty acid (palmitic acid, oleic acid and linoleic acid)

    NASA Astrophysics Data System (ADS)

    Abdulloh, Abdulloh; Aminah, Nanik Siti; Triyono, Mudasir, Trisunaryanti, Wega

    2016-03-01

    Catalyst preparation and characterization of Al3+-bentonite for esterification of palmitic acid, oleic acid and linoleic acid has been done. Al3+-bentonite catalyst was prepared from natural bentonite of Turen Malang through cation exchange reaction using AlCl3 solution. The catalysts obtained were characterized by XRD, XRF, pyridine-FTIR and surface area analyser using the BET method. Catalyst activity test of Al3+-bentonite for esterification reaction was done at 65°C using molar ratio of metanol-fatty acid of 30:1 and 0.25 g of Al3+-bentonite catalyst for the period of ½, 1, 2, 3, 4 and 5 hours. Based on the characterization results, the Al3+-bentonite Turen Malang catalyst has a d-spacing of 15.63 Ǻ, acid sites of Brönsted and Lewis respectively of 230.79 µmol/g and 99.39 µmol/g, surface area of 507.3 m2/g and the average of radius pore of 20.09 Å. GC-MS analysis results of the oil phase after esterification reaction showed the formation of biodiesel (FAME: Fatty acid methyl ester), namely methyl palmitate, methyl oleate and methyl linoleate. The number of conversions resulted in esterification reaction using Al3+-bentonite Turen Malang catalyst was 74.61%, 37.75%, and 20, 93% for the esterification of palmitic acid, oleic acid and linoleic acid respectively.

  3. Acidic gas capture by diamines

    SciTech Connect

    Rochelle, Gary; Hilliard, Marcus

    2011-05-10

    Compositions and methods related to the removal of acidic gas. In particular, the present disclosure relates to a composition and method for the removal of acidic gas from a gas mixture using a solvent comprising a diamine (e.g., piperazine) and carbon dioxide. One example of a method may involve a method for removing acidic gas comprising contacting a gas mixture having an acidic gas with a solvent, wherein the solvent comprises piperazine in an amount of from about 4 to about 20 moles/kg of water, and carbon dioxide in an amount of from about 0.3 to about 0.9 moles per mole of piperazine.

  4. Molecular structural studies of lichen substances II: atranorin, gyrophoric acid, fumarprotocetraric acid, rhizocarpic acid, calycin, pulvinic dilactone and usnic acid

    NASA Astrophysics Data System (ADS)

    Edwards, Howell G. M.; Newton, Emma M.; Wynn-Williams, David D.

    2003-06-01

    The FT-Raman and infrared vibrational spectra of some important lichen compounds from two metabolic pathways are characterised. Key biomolecular marker bands have been suggested for the spectroscopic identification of atranorin, gyrophoric acid, fumarprotocetraric acid rhizocarpic acid, calycin, pulvinic dilactone and usnic acid. A spectroscopic protocol has been defined for the detection of these molecules in organisms subjected to environmental stresses such as UV-radiation exposure, desiccation and low temperatures. Use of the protocol will be made for the assessment of survival strategies used by stress-tolerant lichens in Antarctic cold deserts.

  5. Cryoprotection from bacterial teichoic acid

    NASA Astrophysics Data System (ADS)

    Rice, Charles V.; Harrison, William; Kirkpatrick, Karl; Brown, Eric D.

    2009-08-01

    Recent studies from our lab demonstrated that teichoic acid is surrounded by liquid water at -40 °C. The size and shape of the liquid water pockets has been visualized with fluorescence microscopy images of aqueous Rhodamine- B solutions. The long, thin channels surround ice crystals with a size of 5-20 microns. Subsequent studies show that B. subtilis Gram-positive bacteria are sequestered into large pockets without added teichoic acid. Here, the ice crystals are orders of manitude larger. When bacteria are mixed with teichoic acid solutions, the distribution of bacteria changes dramatically. The smaller ice crystals allow the bacteria to align in the thin channels of liquid water seen with teichoic acid only. The role of teichoic acid in the freeze tolerance was examined with live/dead fluorescence assays of bacteria mixed with teichoic acid. These quantitative assays were used to determine if teichoic acid acts in a synergetic fashion to enhance the survivability of E. coli, a gram-negative species which lacks teichoic acid. Additionally, we have obtained B. subtilis mutants lacking wall-associated teichoic acids to evaluate cryoprotection compared to the wild-type strain.

  6. In-silico design of computational nucleic acids for molecular information processing.

    PubMed

    Ramlan, Effirul Ikhwan; Zauner, Klaus-Peter

    2013-01-01

    Within recent years nucleic acids have become a focus of interest for prototype implementations of molecular computing concepts. During the same period the importance of ribonucleic acids as components of the regulatory networks within living cells has increasingly been revealed. Molecular computers are attractive due to their ability to function within a biological system; an application area extraneous to the present information technology paradigm. The existence of natural information processing architectures (predominately exemplified by protein) demonstrates that computing based on physical substrates that are radically different from silicon is feasible. Two key principles underlie molecular level information processing in organisms: conformational dynamics of macromolecules and self-assembly of macromolecules. Nucleic acids support both principles, and moreover computational design of these molecules is practicable. This study demonstrates the simplicity with which one can construct a set of nucleic acid computing units using a new computational protocol. With the new protocol, diverse classes of nucleic acids imitating the complete set of boolean logical operators were constructed. These nucleic acid classes display favourable thermodynamic properties and are significantly similar to the approximation of successful candidates implemented in the laboratory. This new protocol would enable the construction of a network of interconnecting nucleic acids (as a circuit) for molecular information processing. PMID:23647621

  7. In-silico design of computational nucleic acids for molecular information processing.

    PubMed

    Ramlan, Effirul Ikhwan; Zauner, Klaus-Peter

    2013-05-07

    Within recent years nucleic acids have become a focus of interest for prototype implementations of molecular computing concepts. During the same period the importance of ribonucleic acids as components of the regulatory networks within living cells has increasingly been revealed. Molecular computers are attractive due to their ability to function within a biological system; an application area extraneous to the present information technology paradigm. The existence of natural information processing architectures (predominately exemplified by protein) demonstrates that computing based on physical substrates that are radically different from silicon is feasible. Two key principles underlie molecular level information processing in organisms: conformational dynamics of macromolecules and self-assembly of macromolecules. Nucleic acids support both principles, and moreover computational design of these molecules is practicable. This study demonstrates the simplicity with which one can construct a set of nucleic acid computing units using a new computational protocol. With the new protocol, diverse classes of nucleic acids imitating the complete set of boolean logical operators were constructed. These nucleic acid classes display favourable thermodynamic properties and are significantly similar to the approximation of successful candidates implemented in the laboratory. This new protocol would enable the construction of a network of interconnecting nucleic acids (as a circuit) for molecular information processing.

  8. In-silico design of computational nucleic acids for molecular information processing

    PubMed Central

    2013-01-01

    Within recent years nucleic acids have become a focus of interest for prototype implementations of molecular computing concepts. During the same period the importance of ribonucleic acids as components of the regulatory networks within living cells has increasingly been revealed. Molecular computers are attractive due to their ability to function within a biological system; an application area extraneous to the present information technology paradigm. The existence of natural information processing architectures (predominately exemplified by protein) demonstrates that computing based on physical substrates that are radically different from silicon is feasible. Two key principles underlie molecular level information processing in organisms: conformational dynamics of macromolecules and self-assembly of macromolecules. Nucleic acids support both principles, and moreover computational design of these molecules is practicable. This study demonstrates the simplicity with which one can construct a set of nucleic acid computing units using a new computational protocol. With the new protocol, diverse classes of nucleic acids imitating the complete set of boolean logical operators were constructed. These nucleic acid classes display favourable thermodynamic properties and are significantly similar to the approximation of successful candidates implemented in the laboratory. This new protocol would enable the construction of a network of interconnecting nucleic acids (as a circuit) for molecular information processing. PMID:23647621

  9. Sulfuric acid as autocatalyst in the formation of sulfuric acid.

    PubMed

    Torrent-Sucarrat, Miquel; Francisco, Joseph S; Anglada, Josep M

    2012-12-26

    Sulfuric acid can act as a catalyst of its own formation. We have carried out a computational investigation on the gas-phase formation of H(2)SO(4) by hydrolysis of SO(3) involving one and two water molecules, and also in the presence of sulfuric acid and its complexes with one and two water molecules. The hydrolysis of SO(3) requires the concurrence of two water molecules, one of them acting as a catalyzer, and our results predict an important catalytic effect, ranging between 3 and 11 kcal·mol(-1) when the catalytic water molecule is substituted by a sulfuric acid molecule or one of its hydrates. In these cases, the reaction products are either bare sulfuric acid dimer or sulfuric acid dimer complexed with a water molecule. There are broad implications from these new findings. The results of the present investigation show that the catalytic effect of sulfuric acid in the SO(3) hydrolysis can be important in the Earth's stratosphere, in the heterogeneous formation of sulfuric acid and in the formation of aerosols, in H(2)SO(4) formation by aircraft engines, and also in understanding the formation of sulfuric acid in the atmosphere of Venus.

  10. Hydrazides of carboxylic acids as inhibitors of steel acidic corrosion

    SciTech Connect

    Aitov, R.G.; Shein, A.B.; Lesnov, A.E.

    1994-09-01

    Hydrazides of carboxylic acids (HCA) inhibit the corrosion of ferrous materials in acids and netral solutions such as stratum and waste waters of oil deposits. In this work, the authors try to explain the above-mentioned difference and to consider HCA as inhibitors of steel hydrogenation.

  11. Fatty Acid Desaturases, Polyunsaturated Fatty Acid Regulation, and Biotechnological Advances

    PubMed Central

    Lee, Je Min; Lee, Hyungjae; Kang, SeokBeom; Park, Woo Jung

    2016-01-01

    Polyunsaturated fatty acids (PUFAs) are considered to be critical nutrients to regulate human health and development, and numerous fatty acid desaturases play key roles in synthesizing PUFAs. Given the lack of delta-12 and -15 desaturases and the low levels of conversion to PUFAs, humans must consume some omega-3 and omega-6 fatty acids in their diet. Many studies on fatty acid desaturases as well as PUFAs have shown that fatty acid desaturase genes are closely related to different human physiological conditions. Since the first front-end desaturases from cyanobacteria were cloned, numerous desaturase genes have been identified and animals and plants have been genetically engineered to produce PUFAs such as eicosapentaenoic acid and docosahexaenoic acid. Recently, a biotechnological approach has been used to develop clinical treatments for human physiological conditions, including cancers and neurogenetic disorders. Thus, understanding the functions and regulation of PUFAs associated with human health and development by using biotechnology may facilitate the engineering of more advanced PUFA production and provide new insights into the complexity of fatty acid metabolism. PMID:26742061

  12. A comparison of chromic acid and sulfuric acid anodizing

    NASA Technical Reports Server (NTRS)

    Danford, M. D.

    1992-01-01

    Because of federal and state mandates restricting the use of hexavalent chromium, it was deemed worthwhile to compare the corrosion protection afforded 2219-T87 aluminum alloy by both Type I chromic acid and Type II sulfuric acid anodizing per MIL-A-8625. Corrosion measurements were made on large, flat 2219-T87 aluminum alloy sheet material with an area of 1 cm(exp 2) exposed to a corrosive medium of 3.5-percent sodium chloride at pH 5.5. Both ac electrochemical impedance spectroscopy and the dc polarization resistance techniques were employed. The results clearly indicate that the corrosion protection obtained by Type II sulfuric acid anodizing is superior, and no problems should result by substituting Type II sulfuric acid anodizing for Type I chromic acid anodizing.

  13. Acid rain on Acid soil: a new perspective.

    PubMed

    Krug, E C; Frink, C R

    1983-08-01

    Acid rain is widely believed to be responsible for acidifying soil and water in areas of North America and northern Europe. However, factors commonly considered to make landscapes susceptible to acidification by acid rain are the same factors long known to strongly acidify soils through the natural processes of soil formation. Recovery from extreme and widespread careless land use has also occurred in regions undergoing acidification. There is evidence that acidification by acid rain is superimposed on long-term acidification induced by changes in land use and consequent vegetative succession. Thus, the interactions of acid rain, acid soil, and vegetation need to be carefully examined on a watershed basis in assessing benefits expected from proposed reductions in emissions of oxides of sulfur and nitrogen.

  14. Carbonic Acid Retreatment of Biomass

    SciTech Connect

    Baylor university

    2003-06-01

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. (1) Solidify the theoretical understanding of the binary CO{sub 2}/H{sub 2}O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. (2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. (3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. (4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. (5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for

  15. Carbonic Acid Pretreatment of Biomass

    SciTech Connect

    G. Peter van Walsum; Kemantha Jayawardhana; Damon Yourchisin; Robert McWilliams; Vanessa Castleberry

    2003-05-31

    This project sought to address six objectives, outlined below. The objectives were met through the completion of ten tasks. 1) Solidify the theoretical understanding of the binary CO2/H2O system at reaction temperatures and pressures. The thermodynamics of pH prediction have been improved to include a more rigorous treatment of non-ideal gas phases. However it was found that experimental attempts to confirm theoretical pH predictions were still off by a factor of about 1.8 pH units. Arrhenius experiments were carried out and the activation energy for carbonic acid appears to be substantially similar to sulfuric acid. Titration experiments have not yet confirmed or quantified the buffering or acid suppression effects of carbonic acid on biomass. 2) Modify the carbonic acid pretreatment severity function to include the effect of endogenous acid formation and carbonate buffering, if necessary. It was found that the existing severity functions serve adequately to account for endogenous acid production and carbonate effects. 3) Quantify the production of soluble carbohydrates at different reaction conditions and severity. Results show that carbonic acid has little effect on increasing soluble carbohydrate concentrations for pretreated aspen wood, compared to pretreatment with water alone. This appears to be connected to the release of endogenous acids by the substrate. A less acidic substrate such as corn stover would derive benefit from the use of carbonic acid. 4) Quantify the production of microbial inhibitors at selected reaction conditions and severity. It was found that the release of inhibitors was correlated to reaction severity and that carbonic acid did not appear to increase or decrease inhibition compared to pretreatment with water alone. 5) Assess the reactivity to enzymatic hydrolysis of material pretreated at selected reaction conditions and severity. Enzymatic hydrolysis rates increased with severity, but no advantage was detected for the use of carbonic

  16. Anacardic Acid, Salicylic Acid, and Oleic Acid Differentially Alter Cellular Bioenergetic Function in Breast Cancer Cells.

    PubMed

    Radde, Brandie N; Alizadeh-Rad, Negin; Price, Stephanie M; Schultz, David J; Klinge, Carolyn M

    2016-11-01

    Anacardic acid is a dietary and medicinal phytochemical that inhibits breast cancer cell proliferation and uncouples oxidative phosphorylation (OXPHOS) in isolated rat liver mitochondria. Since mitochondrial-targeted anticancer therapy (mitocans) may be useful in breast cancer, we examined the effect of anacardic acid on cellular bioenergetics and OXPHOS pathway proteins in breast cancer cells modeling progression to endocrine-independence: MCF-7 estrogen receptor α (ERα)+ endocrine-sensitive; LCC9 and LY2 ERα+, endocrine-resistant, and MDA-MB-231 triple negative breast cancer (TNBC) cells. At concentrations similar to cell proliferation IC50 s, anacardic acid reduced ATP-linked oxygen consumption rate (OCR), mitochondrial reserve capacity, and coupling efficiency while increasing proton leak, reflecting mitochondrial toxicity which was greater in MCF-7 compared to endocrine-resistant and TNBC cells. These results suggest tolerance in endocrine-resistant and TNBC cells to mitochondrial stress induced by anacardic acid. Since anacardic acid is an alkylated 2-hydroxybenzoic acid, the effects of salicylic acid (SA, 2-hydroxybenzoic acid moiety) and oleic acid (OA, monounsaturated alkyl moiety) were tested. SA inhibited whereas OA stimulated cell viability. In contrast to stimulation of basal OCR by anacardic acid (uncoupling effect), neither SA nor OA altered basal OCR- except OA inhibited basal and ATP-linked OCR, and increased ECAR, in MDA-MB-231 cells. Changes in OXPHOS proteins correlated with changes in OCR. Overall, neither the 2-hydroxybenzoic acid moiety nor the monounsaturated alky moiety of anacardic acid is solely responsible for the observed mitochondria-targeted anticancer activity in breast cancer cells and hence both moieties are required in the same molecule for the observed effects. J. Cell. Biochem. 117: 2521-2532, 2016. © 2016 Wiley Periodicals, Inc. PMID:26990649

  17. Production of Succinic Acid from Citric Acid and Related Acids by Lactobacillus Strains

    PubMed Central

    Kaneuchi, Choji; Seki, Masako; Komagata, Kazuo

    1988-01-01

    A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, α-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli. PMID:16347795

  18. Acid rain: a background report

    SciTech Connect

    Glustrom, L.; Stolzenberg, J.

    1982-07-08

    This Staff Brief was prepared for the Wisconsin Legislative Council's Special Committee on Acid Rain to provide an introduction to the issue of acid rain. It is divided into four parts. Part I provides an overview on the controversies surrounding the measurement, formation and effects of acid rain. As described in Part I, the term acid rain is used to describe the deposition of acidic components through both wet deposition (e.g., rain or snow) and dry deposition (e.g., direct contact between atmospheric constituents and the land, water or vegetation of the earth). Part II presents background information on state agency activities relating to acid rain in Wisconsin, describes what is known about the occurrence of, susceptibility to and effects of acid rain in Wisconsin, and provides information related to man-made sources of sulfur and nitrogen oxides in Wisconsin. Part III describes major policies and regulations relating to acid rain which have been or are being developed jointly by the United States and Canadian governments, by the United States government and by the State of Wisconsin. Part IV briefly discusses possible areas for Committee action.

  19. Acid Rain: An Educational Opportunity?

    ERIC Educational Resources Information Center

    Marion, James I.

    1984-01-01

    Deals with how educators can handle the subject of acid rain; illustrates suggestions with experiences of grade nine students visiting Frost Valley Environmental Education Center (Oliverea, New York) to learn scientific concepts through observation of outdoor phenomena, including a stream; and discusses acid rain, pH levels, and pollution control…

  20. Acid rain & electric utilities II

    SciTech Connect

    1997-12-31

    This document presents reports which were presented at the Acid Rain and Electric Utilities Conference. Topics include environmental issues and electric utilities; acid rain program overview; global climate change and carbon dioxide; emissions data management; compliance; emissions control; allowance and trading; nitrogen oxides; and assessment. Individual reports have been processed separately for the United States Department of Energy databases.

  1. Acid Rain: The Scientific Challenge.

    ERIC Educational Resources Information Center

    Godfrey, Paul J.

    1991-01-01

    Documents the workings and findings of the Massachusetts Acid Rain Monitoring Project, which has pooled the volunteer efforts of more than 1,000 amateur and professional scientists since 1983. Reports on the origins of air pollution, the prediction of acid rain, and its effects on both water life and land resources. (JJK)

  2. Acid Precipitation: Causes and Consequences.

    ERIC Educational Resources Information Center

    Babich, Harvey; And Others

    1980-01-01

    This article is the first of three articles in a series on the acid rain problem in recent years. Discussed are the causes of acid precipitation and its consequences for the abiotic and biotic components of the terrestrial and aquatic ecosystems, and for man-made materials. (Author/SA)

  3. Acid Rain: What's the Forecast?

    ERIC Educational Resources Information Center

    Bybee, Rodger

    1984-01-01

    Discusses various types of acid rain, considered to be a century-old problem. Topics include: wet and dry deposition, effects on a variety of environments, ecosystems subject to detrimental effects, and possible solutions to the problem. A list of recommended resources on acid rain is provided. (BC)

  4. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  5. Getting Back to Basics (& Acidics)

    ERIC Educational Resources Information Center

    Rhodes, Sam

    2006-01-01

    This article describes a few novel acid-base experiments intended to introduce students to the basic concepts of acid-base chemistry and provide practical examples that apply directly to the study of biology and the human body. Important concepts such as the reaction between carbon dioxide and water, buffers and protein denaturation, are covered.…

  6. Acid Tests and Basic Fun.

    ERIC Educational Resources Information Center

    McBride, John W.

    1995-01-01

    Explores acids and bases using different indicators, such as turmeric, purple grape juice, and lichens. Because some of these indicators are not as sensitive as cabbage juice or litmus paper, determining to which acids and bases each indicator is sensitive presents an enjoyable, problem-solving challenge for students. Presents directions for…

  7. Acid rain and environmental policy

    SciTech Connect

    Jacobson, J.S.

    1981-10-01

    Various seemingly paradoxical scientific questions are posed which relate to the problem of acid rain and its effect on the environment and environmental policy. The first paradox discussed concerns the supposed increase in fossil fuel usage over the last several decades, with the resultant increases in emissions of pollutants from the combustion of fuels which cause acid rain. Despite these increases, experts do not agree on whether acidity of rain has increased in eastern North America. The second paradox concerns the effect of acid rain on vegetation. If the rain is supposedly harmful, why have some reports shown increases and others, decreases in the growth of crops and trees with the application of simulated acid rain. The third paradox concerns the effect of acid rains on fish life in lakes. If acid rain falls throughout eastern North America, why have some lakes become acid and lost fish populations while others have not. Since unequivocal answers to these scientific questions are not available, a systematic approach is needed for developing policy which can be useful for solving the problem. It appears that traditional cost-benefit analysis can not be the sole basis for decision-making, but that it will be helpful. Research needs must be identified, and the upper and lower limits for alternative strategies must be determined. 14 references, 1 table.

  8. Impacts of acid rain legislation

    SciTech Connect

    Addison, E.L.

    1983-01-01

    The author warns against hasty acid rain legislation that would involve billions of dollars and affect thousands of jobs. He recommends further study into the causes of high acidity in lakes and streams. He states that there are too many uncertainties of whether the problem would be solved by reducing sulfur dioxide emissions from coal-fired power plants. (DMC)

  9. Acid rain: effects on fish and wildlife

    SciTech Connect

    Mayer, K.S.; Multer, E.P.; Schreiber, R.K.

    1984-01-01

    The following questions concerning acid rain are discussed: what is acid rain; what causes acid rain; where do sulfur and nitrogen oxides originate; what areas in the U.S. are susceptible to acid rain; are there early warning signals of acidification to aquatic resources; how does acid rain affect fishery resources; does acid rain affect wildlife; and how can effects of acid rain be reduced.

  10. Lead-acid battery

    SciTech Connect

    Rowlette, J.J.

    1983-09-20

    A light weight lead-acid battery is disclosed having a positive terminal and a negative terminal and including one or more cells or grid stacks having a plurality of vertically stacked conductive monoplates with positive active material and negative active material deposited on alternating plates in the cell or grid stack. Electrolyte layers positioned between each monoplate are included to provide a battery cell having four sides which is capable of being electrically charged and discharged. Two vertical positive bus bars are provided on opposite sides of the battery cell for connecting the monoplates with positive active material together in parallel current conducting relation. In addition, two negative bus bars on opposite sides of the battery cell each being adjacent the positive bus bars are provided for connecting the monoplates with negative active material together in parallel current conducting relation. The positive and negative bus bars not only provide a low resistance method for connecting the plurality of conductive monoplates of their respective battery terminals but also provides support and structural strength to the battery cell structure. In addition, horizontal orientation of monoplates is provided in a vertical stacking arrangement to reduce electrolyte stratification and short circuiting due to flaking of positive and negative active materials from the monoplates.

  11. Lead-acid battery

    NASA Technical Reports Server (NTRS)

    Rowlette, John J. (Inventor)

    1983-01-01

    A light weight lead-acid battery (30) having a positive terminal (36) and a negative terminal (34) and including one or more cells or grid stacks having a plurality of vertically stacked conductive monoplates (10, 20) with positive active material and negative active material deposited on alternating plates in the cell or grid stack. Electrolyte layers (26, 28) positioned between each monoplate are included to provide a battery cell having four sides which is capable of being electrically charged and discharged. Two vertical positive bus bars (42, 43) are provided on opposite sides of the battery cell for connecting the monoplates (10) with positive active material together in parallel current conducting relation. In addition, two negative bus bars (38, 39) on opposite sides of the battery cell each being adjacent the positive bus bars are provided for connecting the monoplates (20) with negative active material together in parallel current conducting relation. The positive (42, 43) and negative (38, 39) bus bars not only provide a low resistance method for connecting the plurality of conductive monoplates of their respective battery terminals (36, 34) but also provides support and structural strength to the battery cell structure. In addition, horizontal orientation of monoplates (10, 20) is provided in a vertical stacking arrangement to reduce electrolyte stratification and short circuiting due to flaking of positive and negative active materials from the monoplates.

  12. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  13. Atmospheric dust and acid rain

    SciTech Connect

    Hedin, L.O.; Likens, G.E.

    1996-12-01

    Why is acid rain still an environmental problem in Europe and North America despite antipollution reforms? The answer really is blowing in the wind: atmospheric dust. These airborne particles can help neutralize the acids falling on forests, but dust levels are unusually low these days. In the air dust particles can neutralize acid rain. What can we do about acid rain and atmospheric dust? Suggestions range from the improbable to the feasible. One reasonable suggestion is to reduce emissions of acidic pollutants to levels that can be buffered by natural quantities of basic compounds in the atmosphere; such a goal would mean continued reductions in sulfur dioxide and nitrogen oxides, perhaps even greater than those prescribed in the 1990 Amendments to the Clean Air Act in the U.S. 5 figs.

  14. Amino acid management in cancer

    PubMed Central

    Tsun, Zhi-Yang; Possemato, Richard

    2016-01-01

    Amino acids have a dual role in cellular metabolism, as they are both the building blocks for protein synthesis and intermediate metabolites which fuel other biosynthetic reactions. Recent work has demonstrated that deregulation of both arms of amino acid management are common alterations seen in cancer. Among the most highly consumed nutrients by cancer cells are the amino acids glutamine and serine, and the biosynthetic pathways that metabolize them are required in various cancer subtypes and the object of current efforts to target cancer metabolism. Also altered in cancer are components of the machinery which sense amino acid sufficiency, nucleated by the mechanistic target of rapamycin (mTOR), a key regulator of cell growth via modulation of key processes including protein synthesis and autophagy. The precise ways in which altered amino acid management supports cellular transformation remain mostly elusive, and a fuller mechanistic understanding of these processes will be important for efforts to exploit such alterations for cancer therapy. PMID:26277542

  15. Fumaric acid production by fermentation

    PubMed Central

    Roa Engel, Carol A.; Zijlmans, Tiemen W.; van Gulik, Walter M.; van der Wielen, Luuk A. M.

    2008-01-01

    The potential of fumaric acid as a raw material in the polymer industry and the increment of cost of petroleum-based fumaric acid raises interest in fermentation processes for production of this compound from renewable resources. Although the chemical process yields 112% w/w fumaric acid from maleic anhydride and the fermentation process yields only 85% w/w from glucose, the latter raw material is three times cheaper. Besides, the fermentation fixes CO2. Production of fumaric acid by Rhizopus species and the involved metabolic pathways are reviewed. Submerged fermentation systems coupled with product recovery techniques seem to have achieved economically attractive yields and productivities. Future prospects for improvement of fumaric acid production include metabolic engineering approaches to achieve low pH fermentations. PMID:18214471

  16. Formation of acrylic acid from lactic acid in supercritical water

    SciTech Connect

    Mok, W.S.L.; Antal, M.J. Jr. ); Jones, M. Jr. )

    1989-09-15

    Supercritical (SC) water is an unusual medium in which fast and specific heterolytic reactions can be conducted at temperatures as high as 400{degree}C. In supercritical water, lactic acid decomposes into gaseous and liquid products via three primary reaction pathways. Products of the acid-catalyzed heterolytic decarbonylation pathway are carbon monoxide, water, and acetaldehyde. Products of the homolytic, decarboxylation pathway are carbon dioxide, hydrogen, and acetaldehyde. Products of the heterolytic, dehydration pathway are acrylic acid and water. The intramolecular nucleophilic displacement of the {alpha}-hydroxyl by the carbonyl group of lactic acid, producing {alpha}-propiolactone as an unstable intermediate which subsequently rearranges to become the unsaturated acid, is a likely mechanism for acrylic acid formation, although an intramolecular E2 elimination initiated by attack of the carbonyl oxygen on a methyl hydrogen cannot be ruled out. Support for the former mechanism comes in part from the observed 100% relative yield of acrylic acid from {beta}-propiolactone in SC water.

  17. Synthesis of l-(+)-Tartaric Acid from l-Ascorbic Acid via 5-Keto-d-Gluconic Acid in Grapes

    PubMed Central

    Saito, Kazumi; Kasai, Zenzaburo

    1984-01-01

    5-Keto-l-idionic acid (≡5-keto-d-gluconic acid, d-xylo-5-hexulosonic acid) was found as a metabolic product of l-ascorbic acid in slices of immature grapes, Vitis labrusca L. cv `Delaware'. Specifically labeled compounds, recognized as metabolic products of l-ascorbic acid in grapes, were fed to young grape tissues to investigate the metabolic pathway from l-ascorbic acid to l-(+)-tartaric acid. Label from dehydro-l-[1-14C]ascorbic acid, 2-keto-l-[1-14C]idonic acid (l-xylo-2-hexulosonic acid), l-[1-14C]idonic acid, or 5-keto-l-[1-14C] idonic acid was incorporated into l-(+)-tartaric acid in high yields as it was in the l-[1-14C]ascorbic acid experiment. In a double label experiment involving a mixture of l-[1-14C]idonic acid and l-[2-3H]idonic acid, the 3H/14C ratios of 5-keto-l-idonic acid and l-(+)-tartaric acid synthesized in young grape leaves were almost the same as the value of the l-idonic acid fed. Label from 5-keto-l-[6-14C]idonic acid was incorporated into sugars and insoluble residue in the same way as l-[6-14C]ascorbic acid was metabolized in grapes. These results provide strong evidence that in grapes l-(+)-tartaric acid is synthesized from the C4 fragment that corresponds to the C1 to C4 group of the 5-keto-l-idonic acid derived from l-ascorbic acid via 2-keto-l-idonic acid and l-idonic acid. PMID:16663792

  18. Molten fatty acid based microemulsions.

    PubMed

    Noirjean, Cecile; Testard, Fabienne; Dejugnat, Christophe; Jestin, Jacques; Carriere, David

    2016-06-21

    We show that ternary mixtures of water (polar phase), myristic acid (MA, apolar phase) and cetyltrimethylammonium bromide (CTAB, cationic surfactant) studied above the melting point of myristic acid allow the preparation of microemulsions without adding a salt or a co-surfactant. The combination of SANS, SAXS/WAXS, DSC, and phase diagram determination allows a complete characterization of the structures and interactions between components in the molten fatty acid based microemulsions. For the different structures characterized (microemulsion, lamellar or hexagonal phases), a similar thermal behaviour is observed for all ternary MA/CTAB/water monophasic samples and for binary MA/CTAB mixtures without water: crystalline myristic acid melts at 52 °C, and a thermal transition at 70 °C is assigned to the breaking of hydrogen bounds inside the mixed myristic acid/CTAB complex (being the surfactant film in the ternary system). Water determines the film curvature, hence the structures observed at high temperature, but does not influence the thermal behaviour of the ternary system. Myristic acid is partitioned in two "species" that behave independently: pure myristic acid and myristic acid associated with CTAB to form an equimolar complex that plays the role of the surfactant film. We therefore show that myristic acid plays the role of a solvent (oil) and a co-surfactant allowing the fine tuning of the structure of oil and water mixtures. This solvosurfactant behaviour of long chain fatty acid opens the way for new formulations with a complex structure without the addition of any extra compound. PMID:27241163

  19. Pentadecanoic and Heptadecanoic Acids: Multifaceted Odd-Chain Fatty Acids.

    PubMed

    Pfeuffer, Maria; Jaudszus, Anke

    2016-07-01

    The odd-chain fatty acids (OCFAs) pentadecanoic acid (15:0) and heptadecanoic acid (17:0), which account for only a small proportion of total saturated fatty acids in milk fat and ruminant meat, are accepted biomarkers of dairy fat intake. However, they can also be synthesized endogenously, for example, from gut-derived propionic acid (3:0). A number of studies have shown an inverse association between OCFA concentrations in human plasma phospholipids or RBCs and risk of type 2 diabetes and cardiovascular disease. We propose a possible involvement in metabolic regulation from the assumption that there is a link between 15:0 and 17:0 and the metabolism of other short-chain, medium-chain, and longer-chain OCFAs. The OCFAs 15:0 and 17:0 can be elongated to very-long-chain FAs (VLCFAs) such as tricosanoic acid (23:0) and pentacosanoic acid (25:0) in glycosphingolipids, particularly found in brain tissue, or can be derived from these VLCFAs. Their chains can be shortened, yielding propionyl-coenzyme A (CoA). Propionyl-CoA, by succinyl-CoA, can replenish the citric acid cycle (CAC) with anaplerotic intermediates and, thus, improve mitochondrial energy metabolism. Mitochondrial function is compromised in a number of disorders and may be impaired with increasing age. Optimizing anaplerotic intermediate availability for the CAC may help to cope with demands in times of increased metabolic stress and with aging. OCFAs may serve as substrates for synthesis of both odd-numbered VLCFAs and propionyl-CoA or store away excess propionic acid. PMID:27422507

  20. Pentadecanoic and Heptadecanoic Acids: Multifaceted Odd-Chain Fatty Acids.

    PubMed

    Pfeuffer, Maria; Jaudszus, Anke

    2016-07-01

    The odd-chain fatty acids (OCFAs) pentadecanoic acid (15:0) and heptadecanoic acid (17:0), which account for only a small proportion of total saturated fatty acids in milk fat and ruminant meat, are accepted biomarkers of dairy fat intake. However, they can also be synthesized endogenously, for example, from gut-derived propionic acid (3:0). A number of studies have shown an inverse association between OCFA concentrations in human plasma phospholipids or RBCs and risk of type 2 diabetes and cardiovascular disease. We propose a possible involvement in metabolic regulation from the assumption that there is a link between 15:0 and 17:0 and the metabolism of other short-chain, medium-chain, and longer-chain OCFAs. The OCFAs 15:0 and 17:0 can be elongated to very-long-chain FAs (VLCFAs) such as tricosanoic acid (23:0) and pentacosanoic acid (25:0) in glycosphingolipids, particularly found in brain tissue, or can be derived from these VLCFAs. Their chains can be shortened, yielding propionyl-coenzyme A (CoA). Propionyl-CoA, by succinyl-CoA, can replenish the citric acid cycle (CAC) with anaplerotic intermediates and, thus, improve mitochondrial energy metabolism. Mitochondrial function is compromised in a number of disorders and may be impaired with increasing age. Optimizing anaplerotic intermediate availability for the CAC may help to cope with demands in times of increased metabolic stress and with aging. OCFAs may serve as substrates for synthesis of both odd-numbered VLCFAs and propionyl-CoA or store away excess propionic acid.

  1. Enzymophoresis of nucleic acids by tandem capillary enzyme reactor-capillary zone electrophoresis.

    PubMed

    Nashabeh, W; el Rassi, Z

    1992-04-10

    Enzymophoresis with coupled heterogeneous capillary enzyme reactor-capillary zone electrophoresis was developed and evaluated in the area of nucleic acids. Ribonuclease T1, hexokinase and adenosine deaminase were successfully immobilized on the inner walls of short fused-silica capillaries through glutaraldehyde attachment. These open-tubular capillary enzyme reactors were quite stable for a prolonged period of use under operation conditions normally used in capillary zone electrophoresis. The capillary enzyme reactors coupled in series with capillary zone electrophoresis served as peak locator on the electropherogram, improved the system selectivity, and facilitated the quantitative determination of the analytes with good accuracy. Also, they allowed the on-line digestion and mapping of minute amounts of transfer ribonucleic acids, and the simultaneous synthesis and separation of nanogram quantities of oligonucleotides.

  2. Acid soil and acid rain, 2nd edition

    SciTech Connect

    Kennedy, I.R.

    1992-01-01

    This book examines the basic chemical processes involved in acidification in order to better assess their long-term effects on the status of soils, the health of plants and other living species that depend on them. It also discusses acidity, pH and protons their significance in bioenergetics and the consequent role of autotrophic organisms in acidifying ecosystems. This edition incorporates and integrates recent findings that render more explanations of the causes of the environmental impacts of acidity, especially in forests and lakes. Also explores current research into acid rain and soil in order to devise appropriate measures for their amelioration.

  3. Functional nucleic acid probes and uses thereof

    DOEpatents

    Nilsen-Hamilton, Marit

    2006-10-03

    The present invention provides functional nucleic acid probes, and methods of using functional nucleic acid probes, for binding a target to carry out a desired function. The probes have at least one functional nucleic acid, at least one regulating nucleic acid, and at least one attenuator. The functional nucleic acid is maintained in an inactive state by the attenuator and activated by the regulating nucleic acid only in the presence of a regulating nucleic acid target. In its activated state the functional nucleic acid can bind to its target to carry out a desired function, such as generating a signal, cleaving a nucleic acid, or catalyzing a reaction.

  4. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  5. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  6. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and... Substances Affirmed as GRAS § 184.1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid...

  7. 21 CFR 184.1021 - Benzoic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Benzoic acid. 184.1021 Section 184.1021 Food and....1021 Benzoic acid. (a) Benzoic acid is the chemical benzenecarboxylic acid (C7H6O2), occurring in nature in free and combined forms. Among the foods in which benzoic acid occurs naturally are...

  8. 21 CFR 189.155 - Monochloroacetic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Monochloroacetic acid. 189.155 Section 189.155... Human Food § 189.155 Monochloroacetic acid. (a) Monochloroacetic acid is the chemical chloroacetic acid... in alcoholic and nonalcoholic beverages. Monochloroacetic acid is permitted in food package...

  9. Diabetes and Alpha Lipoic Acid

    PubMed Central

    Golbidi, Saeid; Badran, Mohammad; Laher, Ismail

    2011-01-01

    Diabetes mellitus is a multi-faceted metabolic disorder where there is increased oxidative stress that contributes to the pathogenesis of this debilitating disease. This has prompted several investigations into the use of antioxidants as a complementary therapeutic approach. Alpha lipoic acid, a naturally occurring dithiol compound which plays an essential role in mitochondrial bioenergetic reactions, has gained considerable attention as an antioxidant for use in managing diabetic complications. Lipoic acid quenches reactive oxygen species, chelates metal ions, and reduces the oxidized forms of other antioxidants such as vitamin C, vitamin E, and glutathione. It also boosts antioxidant defense system through Nrf-2-mediated antioxidant gene expression and by modulation of peroxisome proliferator activated receptors-regulated genes. ALA inhibits nuclear factor kappa B and activates AMPK in skeletal muscles, which in turn have a plethora of metabolic consequences. These diverse actions suggest that lipoic acid acts by multiple mechanisms, many of which have only been uncovered recently. In this review we briefly summarize the known biochemical properties of lipoic acid and then discussed the oxidative mechanisms implicated in diabetic complications and the mechanisms by which lipoic acid may ameliorate these reactions. The findings of some of the clinical trials in which lipoic acid administration has been tested in diabetic patients during the last 10 years are summarized. It appears that the clearest benefit of lipoic acid supplementation is in patients with diabetic neuropathy. PMID:22125537

  10. Cycloadditions for Studying Nucleic Acids.

    PubMed

    Kath-Schorr, Stephanie

    2016-02-01

    Cycloaddition reactions for site-specific or global modification of nucleic acids have enabled the preparation of a plethora of previously inaccessible DNA and RNA constructs for structural and functional studies on naturally occurring nucleic acids, the assembly of nucleic acid nanostructures, therapeutic applications, and recently, the development of novel aptamers. In this chapter, recent progress in nucleic acid functionalization via a range of different cycloaddition (click) chemistries is presented. At first, cycloaddition/click chemistries already used for modifying nucleic acids are summarized, ranging from the well-established copper(I)-catalyzed alkyne-azide cycloaddition reaction to copper free methods, such as the strain-promoted azide-alkyne cycloaddition, tetrazole-based photoclick chemistry and the inverse electron demand Diels-Alder cycloaddition reaction between strained alkenes and tetrazine derivatives. The subsequent sections contain selected applications of nucleic acid functionalization via click chemistry; in particular, site-specific enzymatic labeling in vitro, either via DNA and RNA recognizing enzymes or by introducing unnatural base pairs modified for click reactions. Further sections report recent progress in metabolic labeling and fluorescent detection of DNA and RNA synthesis in vivo, click nucleic acid ligation, click chemistry in nanostructure assembly and click-SELEX as a novel method for the selection of aptamers. PMID:27572987

  11. Phytic acid in green leaves.

    PubMed

    Hadi Alkarawi, H; Zotz, G

    2014-07-01

    Phytic acid or phytate, the free-acid form of myo-inositolhexakiphosphate, is abundant in many seeds and fruits, where it represents the major storage form of phosphorus. Although also known from other plant tissues, available reports on the occurrence of phytic acid, e.g. in leaves, have never been compiled, nor have they been critically reviewed. We found 45 published studies with information on phytic acid content in leaves. Phytic acid was almost always detected when studies specifically tried to detect it, and accounted for up to 98% of total P. However, we argue that such extreme values, which rival findings from storage organs, are dubious and probably result from measurement errors. Excluding these high values from further quantitative analysis, foliar phytic acid-P averaged 2.3 mg·g(-1) , and represented, on average, 7.6% of total P. Remarkably, the ratio of phytic acid-P to total P did not increase with total P, we even detected a negative correlation of the two variables within one species, Manihot esculenta. This enigmatic finding warrants further attention.

  12. Cycloadditions for Studying Nucleic Acids.

    PubMed

    Kath-Schorr, Stephanie

    2016-02-01

    Cycloaddition reactions for site-specific or global modification of nucleic acids have enabled the preparation of a plethora of previously inaccessible DNA and RNA constructs for structural and functional studies on naturally occurring nucleic acids, the assembly of nucleic acid nanostructures, therapeutic applications, and recently, the development of novel aptamers. In this chapter, recent progress in nucleic acid functionalization via a range of different cycloaddition (click) chemistries is presented. At first, cycloaddition/click chemistries already used for modifying nucleic acids are summarized, ranging from the well-established copper(I)-catalyzed alkyne-azide cycloaddition reaction to copper free methods, such as the strain-promoted azide-alkyne cycloaddition, tetrazole-based photoclick chemistry and the inverse electron demand Diels-Alder cycloaddition reaction between strained alkenes and tetrazine derivatives. The subsequent sections contain selected applications of nucleic acid functionalization via click chemistry; in particular, site-specific enzymatic labeling in vitro, either via DNA and RNA recognizing enzymes or by introducing unnatural base pairs modified for click reactions. Further sections report recent progress in metabolic labeling and fluorescent detection of DNA and RNA synthesis in vivo, click nucleic acid ligation, click chemistry in nanostructure assembly and click-SELEX as a novel method for the selection of aptamers.

  13. Terahertz spectrum of gallic acid

    NASA Astrophysics Data System (ADS)

    Wu, Meng; Zhao, Guozhong; Wang, Haiyan; Liang, Chengshen

    2009-11-01

    Gallic acid is natural polyphenol compound found in many green plants. More and more experiments have demonstrated that the gallic acid has comprehensive applications. In the field of medicine, the gallic acid plays an important role in antianaphylaxis, antineoplastic, antimycotic, anti-inflammatory, antivirotic, antiasthmatic and inhibiting the degradation of insulin. It also has a lot of applications in chemical industry, food industry and light industry. So it is important to study the terahertz time-domain spectroscopy of gallic acid. Terahertz time-domain spectroscopy (THz-TDS) is a new coherent spectral technology based on the femtosecond laser. In this work, the spectral characteristics of gallic acid in the range of 0.4 THz to 2.6 THz have been measured by THz-TDS. We obtained its absorption and refraction spectra at room temperature. The vibration absorption spectrum of the single molecule between 0.4 THz and 2.6 THz is simulated based on the Density Functional Theory (DFT). It is found that the gallic acid has the spectral response to THz wave in this frequency range. The results show the abnormal dispersion at 1.51 THz and 2.05 THz. These results can be used in the qualitative analysis of gallic acid and the medicine and food inspection.

  14. Determination of polyfluoroalkyl phosphoric acid diesters, perfluoroalkyl phosphonic acids, perfluoroalkyl phosphinic acids, perfluoroalkyl carboxylic acids, and perfluoroalkane sulfonic acids in lake trout from the Great Lakes region.

    PubMed

    Guo, Rui; Reiner, Eric J; Bhavsar, Satyendra P; Helm, Paul A; Mabury, Scott A; Braekevelt, Eric; Tittlemier, Sheryl A

    2012-11-01

    A comprehensive method to extract perfluoroalkyl carboxylic acids, perfluoroalkane sulfonic acids, perfluoroalkyl phosphonic acids, perfluoroalkyl phosphinic acids, and polyfluoroalkyl phosphoric acid diesters simultaneously from fish samples has been developed. The recoveries of target compounds ranged from 78 % to 121 %. The new method was used to analyze lake trout (Salvelinus namaycush) from the Great Lakes region. The results showed that the total perfluoroalkane sulfonate concentrations ranged from 0.1 to 145 ng/g (wet weight) with perfluorooctane sulfonate (PFOS) as the dominant contaminant. Concentrations in fish between lakes were in the order of Lakes Ontario ≈ Erie > Huron > Superior ≈ Nipigon. The total perfluoroalkyl carboxylic acid concentrations ranged from 0.2 to 18.2 ng/g wet weight. The aggregate mean perfluorooctanoic acid (PFOA) concentration in fish across all lakes was 0.045 ± 0.023 ng/g. Mean concentrations of PFOA were not significantly different (p > 0.1) among the five lakes. Perfluoroalkyl phosphinic acids were detected in lake trout from Lake Ontario, Lake Erie, and Lake Huron with concentration ranging from non-detect (ND) to 0.032 ng/g. Polyfluoroalkyl phosphoric acid diesters were detected only in lake trout from Lake Huron, at levels similar to perfluorooctanoic acid.

  15. Tropospheric cycle of nitrous acid

    NASA Astrophysics Data System (ADS)

    Harrison, Roy M.; Peak, John D.; Collins, Gareth M.

    1996-06-01

    Measurements of the land surface exchange of nitrous acid over grass and sugar beet surfaces reveal both upward and downward fluxes with flux reversal occurring at an ambient concentration of nitrogen dioxide of about 10 ppb. This confirms earlier preliminary findings and strengthens the hypothesis that substantial production of nitrous acid can occur on land surfaces from reaction of nitrogen dioxide and water vapor. Detailed measurements of nitrous acid have been made in central urban, suburban, and rural environments. These measurements, in conjunction with a simple box model, indicate that the atmospheric concentrations of nitrous acid are explicable in terms of a small number of basic processes in which the most important are the surface production of nitrous acid from nitrogen dioxide, atmospheric production from the NO-OH reaction and loss of nitrous acid by photolysis and dry deposition. In the suburban atmosphere, concentrations of nitrous acid are strongly correlated with nitrogen dioxide. In the rural atmosphere a different behavior is seen, with much higher nitrous acid to nitrogen dioxide ratios occurring in more polluted air with nitrogen dioxide concentrations in excess of 10 ppb. At lower nitrogen dioxide concentrations, net deposition of nitrous acid at the ground leads to very low concentrations in advected air. The model study indicates that during daytime in the suburban atmosphere, production of HONO from the NO-OH reaction can compete with photolysis giving a HONO concentration of a few tenths of a part per billion. At the highest observed daytime concentrations of HONO, production of OH radical from its photolysis can proceed at a rate more than 10 times faster than from photolysis of ozone.

  16. Gamma linolenic acid: an antiinflammatory omega-6 fatty acid.

    PubMed

    Kapoor, Rakesh; Huang, Yung-Sheng

    2006-12-01

    Inflammation plays an important role in health and disease. Most of the chronic diseases of modern society, including cancer, diabetes, heart disease, arthritis, Alzheimer's disease, etc. have inflammatory component. At the same time, the link between diet and disease is also being recognized. Amongst dietary constituents, fat has gained most recognition in affecting health. Saturated and trans fatty acids have been implicated in obesity, heart disease, diabetes and cancer while polyunsaturated fatty acids (PUFAs) generally have a positive effect on health. The PUFAs of omega-3 and omega-6 series play a significant role in health and disease by generating potent modulatory molecules for inflammatory responses, including eicosanoids (prostaglandins, and leukotrienes), and cytokines (interleukins) and affecting the gene expression of various bioactive molecules. Gamma linolenic acid (GLA, all cis 6, 9, 12-Octadecatrienoic acid, C18:3, n-6), is produced in the body from linoleic acid (all cis 6,9-octadecadienoic acid), an essential fatty acid of omega-6 series by the enzyme delta-6-desaturase. Preformed GLA is present in trace amounts in green leafy vegetables and in nuts. The most significant source of GLA for infants is breast milk. GLA is further metabolized to dihomogamma linlenic acid (DGLA) which undergoes oxidative metabolism by cyclooxygenases and lipoxygenases to produce anti-inflammatory eicosanoids (prostaglandins of series 1 and leukotrienes of series 3). GLA and its metabolites also affect expression of various genes where by regulating the levels of gene products including matrix proteins. These gene products play a significant role in immune functions and also in cell death (apoptosis). The present review will emphasize the role of GLA in modulating inflammatory response, and hence its potential applications as an anti-inflammatory nutrient or adjuvant.

  17. Solid acids for green chemistry.

    PubMed

    Clark, James H

    2002-09-01

    Solid acids and especially those based on micelle-templated silicas and other mesoporous high surface area support materials are beginning to play a significant role in the greening of fine and specialty chemicals manufacturing processes. A wide range of important organic reactions can be efficiently catalyzed by these materials, which can be designed to provide different types of acidity as well as high degrees of reaction selectivity. The solid acids generally have high turnover numbers and can be easily separated from the organic components. The combination of this chemistry with innovative reaction engineering offers exciting opportunities for innovative green chemical manufacturing in the future. PMID:12234209

  18. Arsanilic acid toxicity in rabbits.

    PubMed

    Confer, A W; Ward, B C; Hines, F A

    1980-04-01

    Rations from several rabbitries experiencing increased mortality, weight loss and diminished reproduction were analyzed for arsanilic acid. Levels of less than 56 ppm of arsanilic acid were found. A 30 day trial was conducted where arsanilic acid was given in doses of 1.6-16.2 mg/day in water to weanling and adult rabbits. The higher doses induced diarrhea, terminal convulsions and death. Weight loss or reduced weight gains occurred in six of seven treated groups. No significant gross or microscopic lesions were observed. Chemical analysis demonstrated the presence of increased total hepatic arsenic levels in treated compared to control rabbits.

  19. Chemiluminescent measurement of atmospheric acid

    NASA Technical Reports Server (NTRS)

    Stedman, D. H.; Kok, G. L.

    1974-01-01

    The design and construction of a gas phase acid sensitive analyzer are reported. These studies showed that the chemical system was a practical analytical method. A complete instrument was developed and prepared for field testing. A Titan 3-C rocket was scheduled for launching on February 11, 1974. Through preparations made by NASA Langley the instrument was set up to monitor the acid concentration in the rocket exhaust. Due to adverse wind conditions no acid was detected. This entire trip is described in detail.

  20. Be an acid rain detective

    SciTech Connect

    Atwill, L.

    1982-07-01

    Acid rain is discussed in a question and answer format. The article is aimed at educating sport fishermen on the subject, and also to encourage them to write their congressmen, senators, and the President about the acid rain problem. The article also announces the availability of an acid rain test kit available through the magazine, ''Sports Afield.'' The kit consists of pH-test paper that turns different shades of pink and blue according to the pH of the water tested. The color of the test paper is then compared to a color chart furnished in the kit and an approximate pH can be determined.

  1. Decarboxylative functionalization of cinnamic acids.

    PubMed

    Borah, Arun Jyoti; Yan, Guobing

    2015-08-14

    Decarboxylative functionalization of α,β-unsaturated carboxylic acids is an emerging area that has been developed significantly in recent years. This critical review focuses on the different decarboxylative functionalization reactions of cinnamic acids leading to the formation of various C-C and C-heteroatom bonds. Apart from metal carboxylates, decarboxylation in cinnamic acids has been achieved efficiently under metal-free conditions, particularly via the use of hypervalent iodine reagents. We believe this review will encourage organic chemists to develop vinylic decarboxylation in a more appealing way with an understanding of new mechanistic insight.

  2. PRODUCTION OF TRIFLUOROACETIC ACID COMPOUNDS

    DOEpatents

    Haworth, W.N.; Stacey, M.

    1949-08-30

    A process is described for the preparation of trifluoroacetic acid. Acetone vapor diluted wlth nitrogen and fluorine also diluted with nltrogen are fed separately at a temperature of about 210 deg C into a reaction vessel containing a catalyst mass selected from-the group consisting of silver and gold. The temperature in the reaction vessel is maintained in the range of 200 deg to 250 deg C. The reaction product, trifluoroacetyl fluoride, is absorbed in aqueous alkali solution. Trifluoroacetic acid is recovered from the solution by acidification wlth an acid such as sulfuric followed by steam distillation.

  3. Acid rain: chemistry and transport.

    PubMed

    Irwin, J G; Williams, M L

    1988-01-01

    This review describes the more important features of the emission, chemistry, transport and deposition of pollutants involved in acid deposition. Global emissions, both natural and man-made, of sulphur and nitrogen oxides are discussed and examples of spatial distributions and trends over the last century presented. The more significant chemical and physical processes involved in the transformation of the primary emissions into their acidic end products are described, including a summary of the approximate timescales of the processes involved. Measurements and modelled calculations of spatial and temporal patterns in the deposition of acidic pollutants by both wet and dry pathways are presented.

  4. Free acidity measurement - a review.

    PubMed

    Srinivasan, T G; Vasudeva Rao, P R

    2014-01-01

    Free acidity is an important parameter especially in the presence of hydrolysable ions. Several methods have been developed for the determination of free acidity, attributing due importance to the accuracy and the precision of the measurement with the aim of the easiness of the methodology as well as post-measurement recovery in mind. This review covers important methods for the determination of free acidity with emphasis on actinide containing solutions, reported in the literature over the past several decades classifying them into different categories.

  5. Amino Acids from a Comet

    NASA Technical Reports Server (NTRS)

    Cook, Jamie Elisla

    2009-01-01

    NASA's Stardust spacecraft returned samples from comet 81P/Wild 2 to Earth in January 2006. Examinations of the organic compounds in cometary samples can reveal information about the prebiotic organic inventory present on the early Earth and within the early Solar System, which may have contributed to the origin of life. Preliminary studies of Stardust material revealed the presence of a suite of organic compounds including several amines and amino acids, but the origin of these compounds (cometary- vs. terrestrial contamination) could not be identified. We have recently measured the carbon isotopic ratios of these amino acids to determine their origin, leading to the first detection of a coetary amino acid.

  6. Can crops tolerate acid rain

    SciTech Connect

    Kaplan, J.K.

    1989-11-01

    This brief article describes work by scientists at the ARS Air Quality-Plant Growth and Development Laboratory in Raleigh, North Carolina, that indicates little damage to crops as a result of acid rain. In studies with simulated acid rain and 216 exposed varieties of 18 crops, there were no significant injuries nor was there reduced growth in most species. Results of chronic and acute exposures were correlated in sensitive tomato and soybean plants and in tolerant winter wheat and lettuce plants. These results suggest that 1-hour exposures could be used in the future to screen varieties for sensitivity to acid rain.

  7. 40 CFR 721.10679 - Carboxylic acid, substituted alkylstannylene ester, reaction products with inorganic acid tetra...

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... alkylstannylene ester, reaction products with inorganic acid tetra alkyl ester (generic). 721.10679 Section 721... Carboxylic acid, substituted alkylstannylene ester, reaction products with inorganic acid tetra alkyl ester... identified generically as carboxylic acid, substituted alkylstannylene ester, reaction products...

  8. Treatment of Amino Acid Metabolism Disorders

    MedlinePlus

    ... Treatment of amino acid metabolism disorders Treatment of amino acid metabolism disorders E-mail to a friend Please ... this page It's been added to your dashboard . Amino acid metabolism disorders are rare health conditions that affect ...

  9. Acid preservation systems for food products

    SciTech Connect

    Tiberio, J. E.; Cirigiano, M. C.

    1984-10-16

    Fumaric acid is used in combination with critical amounts of acetic acid to preserve acid containing food products from microbiological spoilage in the absence of or at reduced levels of chemical preservative.

  10. Genetics Home Reference: sialic acid storage disease

    MedlinePlus

    ... Home Health Conditions sialic acid storage disease sialic acid storage disease Enable Javascript to view the expand/ ... Download PDF Open All Close All Description Sialic acid storage disease is an inherited disorder that primarily ...

  11. Treatment of Fatty Acid Oxidation Disorders

    MedlinePlus

    ... of fatty acid oxidation disorders Treatment of fatty acid oxidation disorders E-mail to a friend Please ... page It's been added to your dashboard . Fatty acid oxidation disorders are rare health conditions that affect ...

  12. Molar extinction coefficients of some fatty acids

    NASA Astrophysics Data System (ADS)

    Sandhu, G. K.; Singh, Kulwant; Lark, B. S.; Gerward, L.

    2002-10-01

    The attenuation of gamma rays in some fatty acids, viz. formic acid (CH 2O 2), acetic acid (C 2H 4O 2), propionic acid (C 3H 6O 2), butyric acid (C 4H 8O 2), n-hexanoic acid (C 6H 12O 2), n-caprylic acid (C 8H 16O 2), lauric acid (C 12H 24O 2), myristic acid (C 14H 28O 2), palmitic acid (C 16H 32O 2), oleic acid (C 18H 34O 2) and stearic acid (C 18H 36O 2), has been measured at the photon energies 81, 356, 511, 662, 1173 and 1332 keV. Experimental values for the molar extinction coefficient, the effective atomic number and the electron density have been derived and compared with theoretical calculations. There is good agreement between experiment and theory.

  13. Biotechnological production of citric acid

    PubMed Central

    Max, Belén; Salgado, José Manuel; Rodríguez, Noelia; Cortés, Sandra; Converti, Attilio; Domínguez, José Manuel

    2010-01-01

    This work provides a review about the biotechnological production of citric acid starting from the physicochemical properties and industrial applications, mainly in the food and pharmaceutical sectors. Several factors affecting citric acid fermentation are discussed, including carbon source, nitrogen and phosphate limitations, pH of culture medium, aeration, trace elements and morphology of the fungus. Special attention is paid to the fundamentals of biochemistry and accumulation of citric acid. Technologies employed at industrial scale such as surface or submerged cultures, mainly employing Aspergillus niger, and processes carried out with Yarrowia lipolytica, as well as the technology for recovering the product are also described. Finally, this review summarizes the use of orange peels and other by-products as feedstocks for the bioproduction of citric acid. PMID:24031566

  14. Simulated acid rain on crops

    SciTech Connect

    Plocher, M.D.; Perrigan, S.C.; Hevel, R.J.; Cooper, R.M.; Moss, D.N.

    1985-10-01

    In 1981, simulated H/sub 2/SO/sub 4/ acid rain was applied to alfalfa and tall fescue and a 2:1 ratio of H/sub 2/SO/sub 4/:HNO/sub 3/ acid rain was applied to alfalfa, tall fescue, barley, wheat, potato, tomato, radish, and corn crops growing in the open field at Corvallis, Oregon. Careful attention was given to effects of the acid rain on the appearance of the foliage, and the effects on yield were measured. Because the effect of pH 4.0 rain on corn yield was the only significant effect noted in the 1981 studies, in 1982, more-extensive studies of the effect of simulated H/sub 2/SO/sub 4//HNO/sub 3/ rain on corn were conducted. No significant effects of acid rain were found on foliage appearance, or on yield of grain or stover in the 1982 studies.

  15. Low acid producing solid propellants

    NASA Technical Reports Server (NTRS)

    Bennett, Robert R.

    1995-01-01

    The potential environmental effects of the exhaust products of conventional rocket propellants have been assessed by various groups. Areas of concern have included stratospheric ozone, acid rain, toxicity, air quality and global warming. Some of the studies which have been performed on this subject have concluded that while the impacts of rocket use are extremely small, there are propellant development options which have the potential to reduce those impacts even further. This paper discusses the various solid propellant options which have been proposed as being more environmentally benign than current systems by reducing HCI emissions. These options include acid neutralized, acid scavenged, and nonchlorine propellants. An assessment of the acid reducing potential and the viability of each of these options is made, based on current information. Such an assessment is needed in order to judge whether the potential improvements justify the expenditures of developing the new propellant systems.

  16. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  17. Biopreservation by lactic acid bacteria.

    PubMed

    Stiles, M E

    1996-10-01

    Biopreservation refers to extended storage life and enhanced safety of foods using the natural microflora and (or) their antibacterial products. Lactic acid bacteria have a major potential for use in biopreservation because they are safe to consume and during storage they naturally dominate the microflora of many foods. In milk, brined vegetables, many cereal products and meats with added carbohydrate, the growth of lactic acid bacteria produces a new food product. In raw meats and fish that are chill stored under vacuum or in an environment with elevated carbon dioxide concentration, the lactic acid bacteria become the dominant population and preserve the meat with a "hidden' fermentation. The same applies to processed meats provided that the lactic acid bacteria survive the heat treatment or they are inoculated onto the product after heat treatment. This paper reviews the current status and potential for controlled biopreservation of foods. PMID:8879414

  18. Phosphonic acid based exchange resins

    DOEpatents

    Horwitz, E.P.; Alexandratos, S.D.; Gatrone, R.C.; Chiarizia, R.

    1995-09-12

    An ion exchange resin is described for extracting metal ions from a liquid waste stream. An ion exchange resin is prepared by copolymerizing a vinylidene diphosphonic acid with styrene, acrylonitrile and divinylbenzene. 10 figs.

  19. Lead/acid battery myths

    NASA Astrophysics Data System (ADS)

    Moseley, P. T.

    The lead/acid battery deserves a more positive image than has been traditional heretofore—particularly with respect to a number of aspects that relate to its utility as a power source for electric vehicles. Recent results from a large internationally coordinated research programme indicate that: (i) with proper attention to construction, valve-regulated lead/acid batteries can be deep-discharged many times without capacity loss; (ii) lead/acid batteries can be recharged extremely rapidly so that long journeys of electric vehicles become a realistic possibility; (iii) ranges of over 150 km between charges are achievable, and (iv) the introduction of significant numbers of lead/acid-powered electric vehicles does offer a beneficial environmental impact.

  20. Making cents of acid recovery

    SciTech Connect

    Ondrey, G.; Shanley, A.

    1993-04-01

    Acid recovery may be expensive, but rising transportation and landfill costs may soon make it the only alternative. Traditionally, acids used in processes from titanium dioxide production to gasoline alkylation and metal pickling were neutralized and discharged into waterways or injected into deep wells. Today, however, discharge permits are being phased out in many countries, and deep well injection is coming under closer scrutiny. An even cheaper option was selling spent acid to fertilizer producers, who used it to dissolve phosphate ores. Health concerns, a depressed fertilizer market and tightening disposal regulations for gypsum byproduct have dried up this option. The paper discusses the processes and costs involved in spent acid regeneration, gypsum-free gas treatments, and problems with explosive contaminants.

  1. Glucaric acids from Leonurus japonicus.

    PubMed

    Jiang, Jianshuang; Li, Yixiu; Feng, Ziming; Yang, Yanan; Zhang, Peicheng

    2015-12-01

    Three new glucaric acids, namely 2-feruloyl-4-syringoyl or 5-feruloyl-3-syringoyl glucaric acid (1), 2-syringoyl-4-feruloyl or 5-syringoyl-3-feruloyl glucaric acid (2), and 3-feruloyl-4-syringoyl or 4-feruloyl-3-syringoyl glucaric acid (3), were isolated from Leonurus japonicus Houtt. Their structures were elucidated by detailed spectroscopic means including UV, IR, HR-ESI-MS, 1D and 2D NMR data spectra. The bioactive assays of compounds 1-3 against hepatoprotection activity were determined. The result suggested that compound 2 exhibited a moderate hepatoprotection activity and the cell survival rate was 74% (10(-5)mol/L), using bicyclol (survival rate: 66%, 10(-5)mol/L) as a positive control. Furthermore, compounds 1-3 were evaluated cytotoxic activities in vitro using HCT-8, Bel-7402, BGC-823, A-549, and A2780 model and the results exhibited no obvious cytotoxicity activity.

  2. Biopreservation by lactic acid bacteria.

    PubMed

    Stiles, M E

    1996-10-01

    Biopreservation refers to extended storage life and enhanced safety of foods using the natural microflora and (or) their antibacterial products. Lactic acid bacteria have a major potential for use in biopreservation because they are safe to consume and during storage they naturally dominate the microflora of many foods. In milk, brined vegetables, many cereal products and meats with added carbohydrate, the growth of lactic acid bacteria produces a new food product. In raw meats and fish that are chill stored under vacuum or in an environment with elevated carbon dioxide concentration, the lactic acid bacteria become the dominant population and preserve the meat with a "hidden' fermentation. The same applies to processed meats provided that the lactic acid bacteria survive the heat treatment or they are inoculated onto the product after heat treatment. This paper reviews the current status and potential for controlled biopreservation of foods.

  3. Microbial production of lactic acid.

    PubMed

    Eiteman, Mark A; Ramalingam, Subramanian

    2015-05-01

    Lactic acid is an important commodity chemical having a wide range of applications. Microbial production effectively competes with chemical synthesis methods because biochemical synthesis permits the generation of either one of the two enantiomers with high optical purity at high yield and titer, a result which is particularly beneficial for the production of poly(lactic acid) polymers having specific properties. The commercial viability of microbial lactic acid production relies on utilization of inexpensive carbon substrates derived from agricultural or waste resources. Therefore, optimal lactic acid formation requires an understanding and engineering of both the competing pathways involved in carbohydrate metabolism, as well as pathways leading to potential by-products which both affect product yield. Recent research leverages those biochemical pathways, while researchers also continue to seek strains with improved tolerance and ability to perform under desirable industrial conditions, for example, of pH and temperature.

  4. Phosphonic acid based exchange resins

    DOEpatents

    Horwitz, E. Philip; Alexandratos, Spiro D.; Gatrone, Ralph C.; Chiarizia, Ronato

    1995-01-01

    An ion exchange resin for extracting metal ions from a liquid waste stream. An ion exchange resin is prepared by copolymerizing a vinylidene diphosphonic acid with styrene, acrylonitrile and divinylbenzene.

  5. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  6. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  7. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  8. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and....1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It is commercially prepared...

  9. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  10. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  11. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and... Substances Affirmed as GRAS § 184.1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid...

  12. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  13. 21 CFR 184.1091 - Succinic acid.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Succinic acid. 184.1091 Section 184.1091 Food and... Substances Affirmed as GRAS § 184.1091 Succinic acid. (a) Succinic acid (C4H6O4, CAS Reg. No. 110-15-6), also referred to as amber acid and ethylenesuccinic acid, is the chemical 1,4-butanedioic acid. It...

  14. 21 CFR 184.1009 - Adipic acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Adipic acid. 184.1009 Section 184.1009 Food and....1009 Adipic acid. (a) Adipic acid (C6H10O4, CAS Reg. No. 00124-04-9) is also known as 1,4-butanedicarboxylic acid or hexane-dioic acid. It is prepared by nitric acid oxidation of cyclohexanol...

  15. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  16. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2011 CFR

    2011-04-01

    ... 21 Food and Drugs 3 2011-04-01 2011-04-01 false Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  17. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2013 CFR

    2013-04-01

    ... 21 Food and Drugs 3 2013-04-01 2013-04-01 false Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  18. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2012 CFR

    2012-04-01

    ... 21 Food and Drugs 3 2012-04-01 2012-04-01 false Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  19. 40 CFR 721.10512 - Fatty acid maleic acid amides (generic).

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 40 Protection of Environment 32 2013-07-01 2013-07-01 false Fatty acid maleic acid amides (generic... Specific Chemical Substances § 721.10512 Fatty acid maleic acid amides (generic). (a) Chemical substance... fatty acid maleic acid amides (PMNs P-07-563 and P-07-564) are subject to reporting under this...

  20. 40 CFR 721.10512 - Fatty acid maleic acid amides (generic).

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 40 Protection of Environment 31 2014-07-01 2014-07-01 false Fatty acid maleic acid amides (generic... Specific Chemical Substances § 721.10512 Fatty acid maleic acid amides (generic). (a) Chemical substance... fatty acid maleic acid amides (PMNs P-07-563 and P-07-564) are subject to reporting under this...

  1. 21 CFR 172.350 - Fumaric acid and salts of fumaric acid.

    Code of Federal Regulations, 2014 CFR

    2014-04-01

    ... 21 Food and Drugs 3 2014-04-01 2014-04-01 false Fumaric acid and salts of fumaric acid. 172.350... Nutritional Additives § 172.350 Fumaric acid and salts of fumaric acid. Fumaric acid and its calcium, ferrous... prescribed conditions: (a) The additives meet the following specifications: (1) Fumaric acid contains...

  2. 21 CFR 172.862 - Oleic acid derived from tall oil fatty acids.

    Code of Federal Regulations, 2010 CFR

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Oleic acid derived from tall oil fatty acids. 172... FOOD FOR HUMAN CONSUMPTION Multipurpose Additives § 172.862 Oleic acid derived from tall oil fatty acids. The food additive oleic acid derived from tall oil fatty acids may be safely used in food and...

  3. Bile acids as metabolic regulators

    PubMed Central

    Li, Tiangang; Chiang, John Y. L.

    2015-01-01

    Summary Small molecule ligands that target to TGR5 and FXR have shown promise in treating various metabolic and inflammation-related human diseases. New insights into the mechanisms underlying the bariatric surgery and bile acid sequestrant treatment suggest that targeting the enterohepatic circulation to modulate gut-liver bile acid signaling, incretin production and microbiota represents a new strategy to treat obesity and type-2 diabetes. PMID:25584736

  4. Aqueous Photochemistry of Glyoxylic Acid.

    PubMed

    Eugene, Alexis J; Xia, Sha-Sha; Guzman, Marcelo I

    2016-06-01

    Aerosols affect climate change, the energy balance of the atmosphere, and public health due to their variable chemical composition, size, and shape. While the formation of secondary organic aerosols (SOA) from gas phase precursors is relatively well understood, studying aqueous chemical reactions contributing to the total SOA budget is the current focus of major attention. Field measurements have revealed that mono-, di-, and oxo-carboxylic acids are abundant species present in SOA and atmospheric waters. This work explores the fate of one of these 2-oxocarboxylic acids, glyoxylic acid, which can photogenerate reactive species under solar irradiation. Additionally, the dark thermal aging of photoproducts is studied by UV-visible and fluorescence spectroscopies to reveal that the optical properties are altered by the glyoxal produced. The optical properties display periodicity in the time domain of the UV-visible spectrum of chromophores with absorption enhancement (thermochromism) or loss (photobleaching) during nighttime and daytime cycles, respectively. During irradiation, excited state glyoxylic acid can undergo α-cleavage or participate in hydrogen abstractions. The use of (13)C nuclear magnetic resonance spectroscopy (NMR) analysis shows that glyoxal is an important intermediate produced during direct photolysis. Glyoxal quickly reaches a quasi-steady state as confirmed by UHPLC-MS analysis of its corresponding (E) and (Z) 2,4-dinitrophenylhydrazones. The homolytic cleavage of glyoxylic acid is proposed as a fundamental step for the production of glyoxal. Both carbon oxides, CO2(g) and CO(g) evolving to the gas-phase, are quantified by FTIR spectroscopy. Finally, formic acid, oxalic acid, and tartaric acid photoproducts are identified by ion chromatography (IC) with conductivity and electrospray (ESI) mass spectrometry (MS) detection and (1)H NMR spectroscopy. A reaction mechanism is proposed based on all experimental observations. PMID:27192089

  5. [Bile acids in coronary arteriosclerosis].

    PubMed

    Malaia, L T; Shelest, A N; Volkov, V I; Cherevatov, B G

    1984-10-01

    Seventy-six patients with chronic coronary heart disease of the atherosclerotic genesis were examined using clinical laboratory and instrumental research methods. The blood serum levels of total cholesterol, triglycerides, lipoproteins and bile acids were measured throughout the course of treatment. When hyperlipoproteinemias were divided according to phenotypes, type II hyperlipoproteinemia proved to be most commonly occurring (65.8%). The patients exhibited lower blood serum levels of bile acids as compared to control.

  6. Alternative to Nitric Acid Passivation

    NASA Technical Reports Server (NTRS)

    Kessel, Kurt R.

    2016-01-01

    Corrosion is an extensive problem that affects the National Aeronautics and Space Administration (NASA) and European Space Agency (ESA). The deleterious effects of corrosion result in steep costs, asset downtime affecting mission readiness, and safety risks to personnel. It is vital to reduce corrosion costs and risks in a sustainable manner. The primary objective of this effort is to qualify citric acid as an environmentally-preferable alternative to nitric acid for passivation of stainless steel alloys.

  7. Photodissociation dynamics of hydroxybenzoic acids

    SciTech Connect

    Yang Yilin; Dyakov, Yuri; Lee, Y. T.; Ni, Chi-Kung; Sun Yilun; Hu Weiping

    2011-01-21

    Aromatic amino acids have large UV absorption cross-sections and low fluorescence quantum yields. Ultrafast internal conversion, which transforms electronic excitation energy to vibrational energy, was assumed to account for the photostability of amino acids. Recent theoretical and experimental investigations suggested that low fluorescence quantum yields of phenol (chromophore of tyrosine) are due to the dissociation from a repulsive excited state. Radicals generated from dissociation may undergo undesired reactions. It contradicts the observed photostability of amino acids. In this work, we explored the photodissociation dynamics of the tyrosine chromophores, 2-, 3- and 4-hydroxybenzoic acid in a molecular beam at 193 nm using multimass ion imaging techniques. We demonstrated that dissociation from the excited state is effectively quenched for the conformers of hydroxybenzoic acids with intramolecular hydrogen bonding. Ab initio calculations show that the excited state and the ground state potential energy surfaces change significantly for the conformers with intramolecular hydrogen bonding. It shows the importance of intramolecular hydrogen bond in the excited state dynamics and provides an alternative molecular mechanism for the photostability of aromatic amino acids upon irradiation of ultraviolet photons.

  8. Lactic acid utilization by the cutaneous Micrococcaceae.

    PubMed

    Smith, R F

    1971-04-01

    Human cutaneous staphylococci and micrococci utilized lactic acid as an energy source on a minimal medium. Propionic acid was not utilized, but l(+)-lactic acid and pyruvic acid could replace ld-lactic acid as a substrate. Selected strains of cocci were inhibited more by the l(+) and d(-) forms of lactic acid than the balanced ld form, particularly at pH 5.6. With proper dilution of substrate, lactic acid was utilized by selected strains in the presence of 10 mug of oleic and palmitic acids per ml.

  9. [On the phenolic acids of vegetables. IV. Hydroxycinnamic acids and hydroxybenzoic acids of vegetables and potatoes (author's transl)].

    PubMed

    Schmidtlein, H; Herrmann, K

    1975-12-16

    Lettuce, endive and chicory exclusively, cornsalad and sweet fennel almost exclusively contain caffeic acid derivatives beside traces of ferulic acid. Parsley exclusively and spinach almost exclusively show p-coumaric acid derivatives. Compared to root, fruit and seed vegetables the contents of phenolic acids in green leaves are considerably high. Rhubarb is the only vegetable, which contains gallic acid (chief phenolic acid) beside hydroxycinnamic, protocatechuic and vanillic acid derivatives. Furthermore hydroxybenzoic acid derivatives (salicylic, gentisic and vanillic acid) occur in cornsalad, sweet fennel, parsley and spinach in small concentrations; cornsalad shows p-hydroxybenzoic acid (ca. 20 mg/kg). Onions (Allium cepa) contain almost only protocatechuic acid beside small amounts of p-hydroxybenzoic and vanillic acid. In the outer dry coloured skins protocatechuic acid reaches concentrations up to 2% of plant material; the internal pulpy tissues show lower concentrations (ca. 20 mg/kg). On the contrary to the bulbs the green leaves of onions like chive and leek contain almost exclusively compounds of ferulic and p-coumaric acid. Garlic even shows a different phenolic acid pattern of skins and internal tissues. The caffeic acid derivatives of potatoes are mainly localized to a 1--2 mm thick outer layer. The different localization of phenolic acids in the different parts of vegetable plants is discussed.

  10. Eubacterium rangiferina, a novel usnic acid-resistant bacterium from the reindeer rumen

    NASA Astrophysics Data System (ADS)

    Sundset, Monica A.; Kohn, Alexandra; Mathiesen, Svein D.; Præsteng, Kirsti E.

    2008-08-01

    Reindeer are able to eat and utilize lichens as an important source of energy and nutrients. In the current study, the activities of antibiotic secondary metabolites including usnic, antranoric, fumarprotocetraric, and lobaric acid commonly found in lichens were tested against a collection of 26 anaerobic rumen bacterial isolates from reindeer ( Rangifer tarandus tarandus) using the agar diffusion method. The isolates were identified based on their 16S ribosomal ribonucleic acid (rRNA) gene sequences. Usnic acid had a potent antimicrobial effect against 25 of the isolates, belonging to Clostridiales, Enterococci, and Streptococci. Isolates of Clostridia and Streptococci were also susceptible to atranoric and lobaric acid. However, one isolate (R3_91_1) was found to be resistant to usnic, antranoric, fumarprotocetraric, and lobaric acid. R3_91_1 was also seen invading and adhering to lichen particles when grown in a liquid anaerobic culture as demonstrated by transmission electron microscopy. This was a Gram-negative, nonmotile rod (0.2-0.7 × 2.0-3.5 μm) with a deoxyribonucleic acid G + C content of 47.0 mol% and main cellular fatty acids including 15:0 anteiso-dimethyl acetal (DMA), 16:0 iso-fatty acid methyl ester (FAME), 13:0 iso-3OH FAME, and 17:0 anteiso-FAME, not matching any of the presently known profiles in the MIDI database. Combined, the phenotypic and genotypic traits including the 16S rRNA gene sequence show that R3_91_1 is a novel species inside the order Clostridiales within the family Lachnospiraceae, for which we propose the name Eubacterium rangiferina. This is the first record of a rumen bacterium able to tolerate and grow in the presence of usnic acid, indicating that the rumen microorganisms in these animals have adapted mechanisms to deal with lichen secondary metabolites, well known for their antimicrobial and toxic effects.

  11. Hepatic messenger ribonucleic acid activity profiles in experimental azotemia in the rat. Relationship to food intake and thyroid function.

    PubMed Central

    Kinlaw, W B; Schwartz, H L; Mariash, C N; Bingham, C; Carr, F E; Oppenheimer, J H

    1984-01-01

    We have studied the hepatic messenger RNA (mRNA) activity profile in chronically azotemic rats and sought to determine whether the observed changes could be mediated either by reduced food intake or diminished thyroid function at the tissue level. mRNA activity profiles were produced by two-dimensional gel electrophoretic separation of radioactively labeled products of an in vitro reticulocyte lysate system which had been programmed by hepatic RNA. Of the approximately 240 translational products identified in this system, seven sequences were consistently altered in azotemia. In pair-fed animals six of these also decreased, but the alterations in three were depressed to a significantly lesser extent in the pair-fed group. Moreover, analysis of covariance suggested that food intake could account for the differences in only one sequence. The possibility that the mRNA activity profile in azotemia could represent the effects of diminished thyroid function was minimized by the finding that the reductions in plasma thyroxine (T4) and triiodothyronine (T3) levels observed were due largely to reduced plasma protein binding, with maintenance of the mean free T4 and free T3 concentrations within the normal range. The changes in only one mRNA sequence could be related to free T3 levels alone. Our findings, therefore, indicate that although diminished food intake and reduced thyroid function may contribute to some of the observed changes in the mRNA activity profiles, the bulk of alterations in azotemia appear to be mediated by other mechanisms. The striking overlap between the sequences affected by azotemia and pair-feeding raises the speculation that altered gene expression in azotemia may reflect an impaired hepatic response at the pretranslational level to metabolic signals associated with food intake. Images PMID:6511910

  12. Initiation and elongation of polyribonucleotide chains on rat ventral-prostate chromatin transcribed by homologous ribonucleic acid polymerase B.

    PubMed Central

    Thomas, P; Davies, P; Griffiths, K

    1977-01-01

    The characteristics of initiation of RNA synthesis and the elongation of RNA chains on rat ventral-prostate chromatin by RNA polymerase B were investigated by two methods. 1. Initiation was carried out under low-salt conditions with three ribonucleoside triphosphates, and elongation was begun in the absence of reinitiation by the addition of the fourth ribonucleoside triphosphate and increasing the salt concentration. 2. Stable initiation complexes were formed by preincubation of enzyme with template at 37 degrees C, elongation was started by the addition of all four ribonucleoside triphosphates and reinitiation or spurious RNA synthesis was prevented by rifamycin AF/013. The latter method gave more reliable results. The dependence of those parameters on the androgenic status of the animal was studied. During the first 24h after castration, elongation was mainly affected, whereas after 72h a smaller number of initiation sites for RNA polymerase B on chromatin was evident. Considerable diurnal variations in the various parameters were observed. Changes in the relative concentrations of the chromatin-associated proteins were also observed after castration. In the rat ventral-prostate gland androgenic steroids may not only influence one stage of the transcriptional process, but may affect many factors involved in the control of gene expression. PMID:562164

  13. Effect of α-amanitin on ribonucleic acid polymerase II of rat brain nuclei and on retention of avoidance conditioning

    PubMed Central

    Montanaro, N.; Novello, F.; Stirpe, F.

    1971-01-01

    1. α-Amanitin inhibits in vitro the activity of RNA polymerase II of rat brain nuclei. 2. The toxin does not pass the blood–brain barrier, but when injected intracerebrally is highly toxic for rats, and causes inhibition of RNA polymerase II of isolated brain nuclei. 3. Intracerebral injection of α-amanitin 6h before training to a passive avoidance task is followed by impaired performance of rats on retesting after 7 days, without affecting performance on retesting immediately after training. PMID:5144225

  14. Effect of ribonucleic acid (RNA) isolation methods on putative reference genes messenger RNA abundance in human spermatozoa.

    PubMed

    Barragán, M; Martínez, A; Llonch, S; Pujol, A; Vernaeve, V; Vassena, R

    2015-07-01

    Although the male gamete participates in a significant proportion of infertility cases, there are currently no proven molecular markers of sperm quality. The search for significant gene expression markers is partially hindered by the lack of a recognized set of reference genes (RGs) to normalize reverse transcription quantitative PCR (RT-qPCR) data across studies. The aim of this study is to define a set of RGs in assisted reproduction patients undergoing different sample collection and RNA isolation methods. Twenty-two normozoospermic men were included in the study. From each man, semen was either cryopreserved by slow freezing or analyzed fresh, and, for each, RNA was extracted with either phenol-free or phenol-based methods. In two cases, both methods were used to isolate RNA. Twenty putative RGs were analyzed and their mRNA abundance across samples was estimated by RT-qPCR. To determine the genes whose steady-state mRNA abundance remains unchanged, three different algorithms (geNorm, BestKeeper and NormFinder) were applied to the qPCR data. We found that RGs such as GAPDH or ACTB, useful in other biological contexts, cannot be used as reference for human spermatozoa. It is possible to compare gene expression from fresh and cryopreserved sperm samples using the same isolation method, while the mRNA abundance of expressed genes becomes different depending on the RNA isolation technique employed. In our conditions, the most appropriate RGs for RT-qPCR analysis were RPLP1, RPL13A, and RPLP2. Published discrepancies in gene expression studies in human spermatozoa may be due in part to inappropriate RGs selection, suggesting a possible different interpretation of PCR data in several reports, which were normalized using unstable RGs.

  15. Endothelin in human brain and pituitary gland: Presence of immunoreactive endothelin, endothelin messenger ribonucleic acid, and endothelin receptors

    SciTech Connect

    Takahashi, K.; Ghatei, M.A.; Jones, P.M.; Murphy, J.K.; Lam, H.C.; O'Halloran, D.J.; Bloom, S.R. )

    1991-03-01

    The presence of immunoreactive (IR) endothelin, endothelin mRNA, and endothelin receptors in human brain and pituitary gland has been studied by RIA, Northern blot hybridization, and receptor assay. IR endothelin was detected in all five brain regions examined (cerebral cortex, cerebellum, brain stem, basal ganglia, and hypothalamus) (6-10 fmol/g wet wt) and spinal cord (22 +/- 6 fmol/g wet wt, n = 7, mean +/- SEM). Higher concentrations of IR endothelin were found in the pituitary gland (147 +/- 30 fmol/g wet wt). Fast protein liquid chromatographic analysis of the IR endothelin in pituitary gland showed a large IR peak in the position of endothelin-3 and a smaller peak in the position of endothelin-1, whereas IR endothelin in the hypothalamus and brain stem was mainly endothelin-1. Endothelin messenger RNA was detected by Northern blot hybridization in the pituitary but not in hypothalamus. The receptor assay showed that 125I-endothelin-1 binding sites were present in large numbers in all five brain regions but were much less abundant in the pituitary gland. Binding capacity and dissociation constant were 5052 +/- 740 fmol/mg protein and 0.045 +/- 0.007 nM in brain stem and 963 +/- 181 fmol/mg protein and 0.034 +/- 0.009 nM in hypothalamus. In the pituitary gland, there were two classes of binding sites for endothelin with dissociation constants of 0.059 +/- 0.002 nM (binding capacity = 418 +/- 63 fmol/mg protein) and 0.652 +/- 0.103 nM (binding capacity = 1717 +/- 200 fmol/mg protein). Endothelin-1, -2 and -3 were almost equipotent in displacing the binding (IC50 approximately 0.04 nM). These findings are in accord with the possibility that endothelin acts as a neurotransmitter, neuromodulator or neurohormone in man.

  16. Alterations in polyribosome and messenger ribonucleic acid metabolism and messenger ribonucleoprotein utilization in osmotically stressed plant seedlings

    SciTech Connect

    Mason, H.S.

    1986-01-01

    Polyribosome aggregation state in growing tissues of barley and wheat leaf of stems of pea and squash was studied in relation to seedling growth and water status of the growing tissue in plants at various levels of osmotic stress. It was found to be highly correlated with water potential and osmotic potential of the growing tissue and with leaf of stem elongation rate. Stress rapidly reduced polyribosome content and water status in growing tissues of barley leaves; changes were slow and slight in the non-growing leaf blade. Membrane-bound and free polyribosomes were equally sensitive to stress-induced disaggregation. Incorporation of /sup 32/PO/sub 4//sup 3 -/ into ribosomal RNA was rapidly inhibited by stress, but stability of poly(A)/sup +/RNA relative to ribosomal RNA was similar in stressed and unstressed tissues, with a half-life of about 12 hours. Stress also caused progressive loss of poly(A)/sup +/RNA from these tissues. Quantitation of poly(A) and in vitro messenger template activity in polysome gradient fractions showed a shift of activity from the polysomal region to the region of 20-60 S in stressed plants. Messenger RNA in the 20-60 S region coded for the same peptides as mRNA found in the polysomal fraction. Nonpolysomal and polysome-derived messenger ribonucleoprotein complexes (mRNP) were isolated, and characteristic proteins were found associated with either fraction. Polysomal mRNP from stressed or unstressed plants were translated with similar efficiency in a wheat germ cell-free system. It was concluded that no translational inhibitory activity was associated with nonpolysomal mRNP from barley prepared as described.

  17. Photoperiodic regulation of histamine H3 receptor and VGF messenger ribonucleic acid in the arcuate nucleus of the Siberian hamster.

    PubMed

    Barrett, Perry; Ross, Alexander W; Balik, Ales; Littlewood, Pauline A; Mercer, Julian G; Moar, Kim M; Sallmen, Tina; Kaslin, Jan; Panula, Pertti; Schuhler, Sandrine; Ebling, Francis J; Ubeaud, Caroline; Morgan, Peter J

    2005-04-01

    To survive winter the Siberian hamster has evolved profound physiological and behavioral adaptations, including a moult to winter pelage, regression of the reproductive axis, onset of daily torpor and increased capacity for thermogenesis. However, one of the most striking adaptations is the catabolism of intraabdominal and sc fat reserves contributing to the loss of up to 40% of body weight. These physiological and behavioral adaptations are photoperiodically driven, yet neither the site(s) in the brain nor the molecular mechanism(s) involved in the regulation of these profound adaptations is known. Here we report a dynamic regulation of gene expression in a dorsal region of the medial posterior area of the arcuate nucleus (dmpARC) of the Siberian and Syrian hamster brain in response to altered photoperiod. We show mRNA for the histamine H3 receptor is down-regulated and VGF is up-regulated in the dmpARC in hamsters switched from long- to short-day photoperiod. These data provide further evidence to support the view that the dmpARC is a major site to relay photoperiodic changes and as a site for the long-term regulation of seasonal physiology and behavior.

  18. 'Distinct cellular localization' of the messenger ribonucleic acid for prostaglandin E receptor subtypes in the mouse uterus during pseudopregnancy.

    PubMed

    Katsuyama, M; Sugimoto, Y; Morimoto, K; Hasumoto, K; Fukumoto, M; Negishi, M; Ichikawa, A

    1997-01-01

    As an initial step to clarify the mechanisms of various uterine actions of PGE2, expression patterns of the messenger RNAs (mRNAs) for four subtypes of PGE receptors, EP1, EP2, EP3, and EP4, were investigated in the mouse uterus during pseudopregnancy. Relative expression levels were investigated by Northern blot analysis of mRNA levels in uteri obtained on days 0, 1, 3, 5, 7, and 9 of pseudopregnancy (day 0 = 48 h after PMSG injection), and cellular localization was determined by in situ hybridization in uteri obtained on days 0 and 5. EP2 mRNA was specifically expressed on day 5, and its expression was confined to the luminal epithelium. On the other hand, the level of the EP3 mRNA expression progressively increased until day 5. Cell populations expressing the EP3 mRNA were confined to the longitudinal smooth muscle on day 0, but they changed to the circular smooth muscle on day 5. The expression level of EP4 mRNA was low on days 0 and 1, but it became high on days 3 and 5. On day 0, EP4 mRNA was localized to the luminal epithelium. On day 5, diffuse, but significant, EP4 expression was observed over the endometrial stroma and epithelium. No EP1 mRNA signals were observed. Transient expression of EP2 on day 5 of pseudopregnancy in the luminal epithelium suggests its involvement in blastocyst implantation signaling. EP4 in the endometrial stroma is suggested to be involved in decidual transformation of the stromal cells, whereas EP3 in the myometrium is believed to be involved in regulation of myometrial activity.

  19. The action of α-amanitin in vivo on the synthesis and maturation of mouse liver ribonucleic acids

    PubMed Central

    Hadjiolov, Asen A.; Dabeva, Mariana D.; Mackedonski, Vladimir V.

    1974-01-01

    α-Amanitin acts in vitro and in vivo as a selective inhibitor of nucleoplasmic RNA polymerases. Treatment of mice with low doses of α-amanitin causes the following changes in the synthesis, maturation and nucleocytoplasmic transfer of liver RNA species. 1. The synthesis of the nuclear precursor of mRNA is strongly inhibited and all electrophoretic components are randomly affected. The labelling of cytoplasmic mRNA is blocked. These effects may be correlated with the rapid and lasting inhibition of nucleoplasmic RNA polymerase. 2. The synthesis and maturation of the nuclear precursor of rRNA is inhibited within 30min. (a) The initial effect is a strong (about 80%) inhibition of the early steps of 45S precursor rRNA maturation. (b) The synthesis of 45S precursor rRNA is also inhibited and the effect increases from about 30% at 30min to more than 70% at 150min. (c) The labelling of nuclear and cytoplasmic 28S and 18S rRNA is almost completely blocked. The labelling of nuclear 5S rRNA is inhibited by about 50%, but that of cytoplasmic 5S rRNA is blocked. (d) The action of α-amanitin on the synthesis of precursor rRNA cannot be correlated with the slight gradual decrease of nucleolar RNA polymerase activity (only 10–20% inhibition at 150min). (e) The inhibition of precursor rRNA maturation and synthesis precedes the ultrastructural lesions of the nucleolus detected by standard electron microscopy. 3. The synthesis of nuclear 4.6S precursor of tRNA is not affected by α-amanitin. However, the labelling of nuclear and cytoplasmic tRNA is decreased by about 50%, which indicates an inhibition of precursor tRNA maturation. The results of this study suggest that the synthesis and maturation of the precursor of rRNA and the maturation of the precursor of tRNA are under the control of nucleoplasmic gene products. The regulator molecules may be either RNA or proteins with exceedingly fast turnover. ImagesPLATE 1(a)PLATE 1(b) PMID:4473981

  20. Regulation of insulin-like growth factor-binding protein messenger ribonucleic acid levels in sheep thyroid cells.

    PubMed

    Bachrach, L K; Eggo, M C; Burrow, G N; Liu, F; Tram, T; Powell, D R

    1991-04-01

    The insulin-like growth factors (IGFs) exist primarily bound to cell surface receptors or complexed to specific binding proteins (IGFBPs). The IGFBPs modulate the bioavailability of the IGFs and may enhance or inhibit IGF actions. Several distinct forms of IGFBPs have been described on the basis of size, immunological determinants, and distribution in biological fluids; the IGFBPs may differ as well in their biological function. Sheep thyroid cells produce IGFBPs under hormonal regulation. Cells grown in basal medium or with six-hormone (6H) medium supplements (transferrin, glycyl-histidyl-lysine, hydrocortisone, somatostatin, insulin, and TSH) release nonglycosylated BPs that migrate at 24, 27, 29, and 32 kDa on Western ligand blot. Cells cultured with the thyroid mitogens epidermal growth factor and phorbol ester release additional glycosylated IGFBPs of 40-44 kDa. Immunoprecipitation experiments indicate that 29- and 32-kDa IGFBPs are antigenically related to IGFBP-2, and the 40- to 44-kDa proteins are related to IGFBP-3. Using specific cDNA probes IGFBP-1, -2, and -3, we examined the regulation of IGFBP mRNA levels in sheep thyroid cultures. The rat IGFBP-2 cDNA probe hybridized to an approximately 1.6-kilobase mRNA species in cells under all culture conditions. However, IGFBP-3 mRNA was detectable only in epidermal growth factor- or phorbol ester-treated cells and appeared within 4 h, preceding the release of IGFBP-3 protein into the medium. The 6H additives, which stimulate differentiated function in thyroid cells, inhibited the mRNA levels of both IGFBP-2 and IGFBP-3. IGFBP-1 mRNA was not detectable. The distinct regulation of these IGFBPs suggest that they may play different biological roles in modulating thyroid physiology. PMID:1706262